WorldWideScience

Sample records for kb cis-regulatory deletion

  1. Characterization of Cer-1 cis-regulatory region during early Xenopus development.

    Science.gov (United States)

    Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

    2011-05-01

    Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

  2. Statistical significance of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Smith Andrew D

    2007-01-01

    Full Text Available Abstract Background It is becoming increasingly important for researchers to be able to scan through large genomic regions for transcription factor binding sites or clusters of binding sites forming cis-regulatory modules. Correspondingly, there has been a push to develop algorithms for the rapid detection and assessment of cis-regulatory modules. While various algorithms for this purpose have been introduced, most are not well suited for rapid, genome scale scanning. Results We introduce methods designed for the detection and statistical evaluation of cis-regulatory modules, modeled as either clusters of individual binding sites or as combinations of sites with constrained organization. In order to determine the statistical significance of module sites, we first need a method to determine the statistical significance of single transcription factor binding site matches. We introduce a straightforward method of estimating the statistical significance of single site matches using a database of known promoters to produce data structures that can be used to estimate p-values for binding site matches. We next introduce a technique to calculate the statistical significance of the arrangement of binding sites within a module using a max-gap model. If the module scanned for has defined organizational parameters, the probability of the module is corrected to account for organizational constraints. The statistical significance of single site matches and the architecture of sites within the module can be combined to provide an overall estimation of statistical significance of cis-regulatory module sites. Conclusion The methods introduced in this paper allow for the detection and statistical evaluation of single transcription factor binding sites and cis-regulatory modules. The features described are implemented in the Search Tool for Occurrences of Regulatory Motifs (STORM and MODSTORM software.

  3. The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

    Science.gov (United States)

    Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

    2014-04-01

    α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

  4. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle

    DEFF Research Database (Denmark)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole

    The spectacular increase in productivity of dairy cattle has been accompanied by a decline in fertility. It is assumed that this reduction is due to the negative energy balance of high producing cows. We herein describe the dissection of a fertility QTL in Nordic Red cattle to a 660-Kb deletion...

  5. Identification of choriogenin cis-regulatory elements and production of estrogen-inducible, liver-specific transgenic Medaka.

    Science.gov (United States)

    Ueno, Tetsuro; Yasumasu, Shigeki; Hayashi, Shinji; Iuchi, Ichiro

    2004-07-01

    Choriogenins (chg-H, chg-L) are precursor proteins of egg envelope of medaka and synthesized in the spawning female liver in response to estrogen. We linked a gene construct chg-L1.5 kb/GFP (a 1.5 kb 5'-upstream region of the chg-L gene fused with a green fluorescence protein (GFP) gene) to another construct emgb/RFP (a cis-regulatory region of embryonic globin gene fused with an RFP gene), injected the double fusion gene construct into 1- or 2-cell-stage embryos, and selected embryos expressing the RFP in erythroid cells. From the embryos, we established two lines of chg-L1.5 kb/GFP-emgb/RFP-transgenic medaka. The 3-month-old spawning females and estradiol-17beta (E2)-exposed males displayed the liver-specific GFP expression. The E2-dependent GFP expression was detected in the differentiating liver of the stage 37-38 embryos. In addition, RT-PCR and whole-mount in situ hybridization showed that the E2-dependent chg expression was found in the liver of the stage 34 embryos of wild medaka, suggesting that such E2-dependency is achieved shortly after differentiation of the liver. Analysis using serial deletion mutants fused with GFP showed that the region -426 to -284 of the chg-L gene or the region -364 to -265 of the chg-H gene had the ability to promote the E2-dependent liver-specific GFP expression of its downstream gene. Further analyses suggested that an estrogen response element (ERE) at -309, an ERE half-site at -330 and a binding site for C/EBP at -363 of the chg-L gene played important roles in its downstream chg-L gene expression. In addition, this transgenic medaka may be useful as one of the test animals for detecting environmental estrogenic steroids.

  6. Deletion of 2.7 kb near HOXD3 in an Arabian horse with occipitoatlantoaxial malformation.

    Science.gov (United States)

    Bordbari, M H; Penedo, M C T; Aleman, M; Valberg, S J; Mickelson, J; Finno, C J

    2017-06-01

    In the horse, the term occipitoatlantoaxial malformation (OAAM) is used to describe a developmental defect in which the first cervical vertebra (atlas) resembles the base of the skull (occiput) and the second cervical vertebra (axis) resembles the atlas. Affected individuals demonstrate an abnormal posture and varying degrees of ataxia. The homeobox (HOX) gene cluster is involved in the development of both the axial and appendicular skeleton. Hoxd3-null mice demonstrate a strikingly similar phenotype to Arabian foals with OAAM. Whole-genome sequencing was performed in an OAAM-affected horse (OAAM1) and seven unaffected Arabian horses. Visual inspection of the raw reads within the region of HOXD3 identified a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3. A genotyping assay revealed that both parents of OAAM1 were heterozygous for the deletion. Additional genotyping identified two of 162 heterozygote Arabians, and the deletion was not present in 371 horses of other breeds. Comparative genomics studies have revealed that this region is highly conserved across species and that the entire genomic region between Hoxd4 and Hoxd3 is transcribed in mice. Two additional Arabian foals diagnosed with OAAM (OAAM 2 and 3) were genotyped and did not have the 2.7-kb deletion. Closer examination of the phenotype in these cases revealed notable variation. OAAM3 also had facial malformations and a patent ductus arteriosus, and the actual malformation at the craniocervical junction differed. Genetic heterogeneity may exist across the HOXD locus in Arabian foals with OAAM. © 2017 Stichting International Foundation for Animal Genetics.

  7. Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

    Science.gov (United States)

    Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

    2013-06-01

    Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

  8. Male infertility is significantly associated with multiple deletions in an 8.7-kb segment of sperm mtDNA in Pakistan.

    Science.gov (United States)

    Mughal, Irfan Afzal; Irfan, Asma; Jahan, Sarwat; Hameed, Abdul

    2017-06-12

    This study aimed to find a link between sperm mitochondrial DNA mutations and male infertility in Pakistan. DNA from semen samples was extracted and amplified by PCR using 7.8-kb deletion-specific primers. The PCR products were separated on agarose gel, visualized under UV-illumination, and then photographed. The results were genotyped and the data were analyzed using SPSS. Deletion analysis of the 8.7-kb fragment by long PCR revealed multiple deletions. The frequency of deletion was much higher in infertile groups as compared to the control group. Further, on comparison between different subtypes of infertile groups, the deletions were highest in the oligoasthenoteratozoospermia (OAT) group. The statistical analysis of case and control groups showed a significant association of the 8.7-kb deletion with human male infertile groups (P = 0.031), and particularly a very significant association with the OAT subgroup (P = 0.019). A significant association has been found between human male infertility and mtDNA deletions in an 8.7-kb segment of sperm mtDNA in a Pakistani population.

  9. Identification of a novel 15.5 kb SHOX deletion associated with ...

    Indian Academy of Sciences (India)

    ANGELOS ALEXANDROU

    deletion, encompassing exons 3–6, was initially detected by array-CGH, followed by MLPA analysis. Sequencing of ... The proband, a female, second child of four children was born to ... at the age of 43 years, she had an occipitofrontal circumfer- ence (ofc) of ..... obox gene cause growth failure in idiopathic short stature and.

  10. The 29.5 kb APOBEC3B Deletion Polymorphism Is Not Associated with Clinical Outcome of Breast Cancer.

    Science.gov (United States)

    Liu, Jingjing; Sieuwerts, Anieta M; Look, Maxime P; van der Vlugt-Daane, Michelle; Meijer-van Gelder, Marion E; Foekens, John A; Hollestelle, Antoinette; Martens, John W M

    2016-01-01

    Increased APOBEC3B mRNA levels are associated with a hypermutator phenotype and poor prognosis in ER-positive breast cancer patients. In addition, a 29.5 kb deletion polymorphism of APOBEC3B, resulting in an APOBEC3A-B hybrid transcript, has been associated with an increased breast cancer risk and the hypermutator phenotype. Here we evaluated whether the APOBEC3B deletion polymorphism also associates with clinical outcome of breast cancer. Copy number analysis was performed by quantitative PCR (qPCR) in primary tumors of 1,756 Dutch breast cancer patients. The APOBEC3B deletion was found in 187 patients of whom 16 carried a two-copy deletion and 171 carried a one-copy deletion. The prognostic value of the APOBEC3B deletion for the natural course of the disease was evaluated among 1,076 lymph-node negative (LNN) patients who did not receive adjuvant systemic treatment. No association was found between APOBEC3B copy number values and the length of metastasis-free survival (MFS; hazard ratio (HR) = 1.00, 95% confidence interval (CI) = 0.90-1.11, P = 0.96). Subgroup analysis by ER status also did not reveal an association between APOBEC3B copy number values and the length of MFS. The predictive value of the APOBEC3B deletion was assessed among 329 ER-positive breast cancer patients who received tamoxifen as the first-line therapy for recurrent disease and 226 breast cancer patients who received first-line chemotherapy for recurrent disease. No association between APOBEC3B copy number values and the overall response rate (ORR) to either tamoxifen (odds ratio (OR) = 0.88, 95% CI = 0.69-1.13, P = 0.31) or chemotherapy (OR = 0.97, 95% CI = 0.71-1.33, P = 0.87) was found. Thus, in contrast to APOBEC3B mRNA levels, the APOBEC3B deletion polymorphism has neither a prognostic nor a predictive value for breast cancer patients. Although a correlation exists between APOBEC3B copy number and mRNA expression, it is relatively weak. This suggests that other mechanisms exist that may

  11. One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1

    Science.gov (United States)

    Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.

    2014-01-01

    Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158

  12. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    Science.gov (United States)

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  13. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  14. Whole transcriptomic and proteomic analyses of an isogenic M. tuberculosis clinical strain with a naturally occurring 15 Kb genomic deletion.

    Directory of Open Access Journals (Sweden)

    Carla Duncan

    Full Text Available Tuberculosis remains one of the most difficult to control infectious diseases in the world. Many different factors contribute to the complexity of this disease. These include the ability of the host to control the infection which may directly relate to nutritional status, presence of co-morbidities and genetic predisposition. Pathogen factors, in particular the ability of different Mycobacterium tuberculosis strains to respond to the harsh environment of the host granuloma, which includes low oxygen and nutrient availability and the presence of damaging radical oxygen and nitrogen species, also play an important role in the success of different strains to cause disease. In this study we evaluated the impact of a naturally occurring 12 gene 15 Kb genomic deletion on the physiology and virulence of M. tuberculosis. The strains denominated ON-A WT (wild type and ON-A NM (natural mutant were isolated from a previously reported TB outbreak in an inner city under-housed population in Toronto, Canada. Here we subjected these isogenic strains to transcriptomic (via RNA-seq and proteomic analyses and identified several gene clusters with differential expression in the natural mutant, including the DosR regulon and the molybdenum cofactor biosynthesis genes, both of which were found in lower abundance in the natural mutant. We also demonstrated lesser virulence of the natural mutant in the guinea pig animal model. Overall, our findings suggest that the ON-A natural mutant is less fit to cause disease, but nevertheless has the potential to cause extended transmission in at-risk populations.

  15. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  16. Using hexamers to predict cis-regulatory motifs in Drosophila

    Directory of Open Access Journals (Sweden)

    Kibler Dennis

    2005-10-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites.

  17. Genetic mapping uncovers cis-regulatory landscape of RNA editing.

    Science.gov (United States)

    Ramaswami, Gokul; Deng, Patricia; Zhang, Rui; Anna Carbone, Mary; Mackay, Trudy F C; Li, Jin Billy

    2015-09-16

    Adenosine-to-inosine (A-to-I) RNA editing, catalysed by ADAR enzymes conserved in metazoans, plays an important role in neurological functions. Although the fine-tuning mechanism provided by A-to-I RNA editing is important, the underlying rules governing ADAR substrate recognition are not well understood. We apply a quantitative trait loci (QTL) mapping approach to identify genetic variants associated with variability in RNA editing. With very accurate measurement of RNA editing levels at 789 sites in 131 Drosophila melanogaster strains, here we identify 545 editing QTLs (edQTLs) associated with differences in RNA editing. We demonstrate that many edQTLs can act through changes in the local secondary structure for edited dsRNAs. Furthermore, we find that edQTLs located outside of the edited dsRNA duplex are enriched in secondary structure, suggesting that distal dsRNA structure beyond the editing site duplex affects RNA editing efficiency. Our work will facilitate the understanding of the cis-regulatory code of RNA editing.

  18. Changes in Cis-regulatory Elements during Morphological Evolution

    Directory of Open Access Journals (Sweden)

    Yu-Lee Paul

    2012-10-01

    Full Text Available How have animals evolved new body designs (morphological evolution? This requires explanations both for simple morphological changes, such as differences in pigmentation and hair patterns between different Drosophila populations and species, and also for more complex changes, such as differences in the forelimbs of mice and bats, and the necks of amphibians and reptiles. The genetic changes and pathways involved in these evolutionary steps require identification. Many, though not all, of these events occur by changes in cis-regulatory (enhancer elements within developmental genes. Enhancers are modular, each affecting expression in only one or a few tissues. Therefore it is possible to add, remove or alter an enhancer without producing changes in multiple tissues, and thereby avoid widespread (pleiotropic deleterious effects. Ideally, for a given step in morphological evolution it is necessary to identify (i the change in phenotype, (ii the changes in gene expression, (iii the DNA region, enhancer or otherwise, affected, (iv the mutation involved, (v the nature of the transcription or other factors that bind to this site. In practice these data are incomplete for most of the published studies upon morphological evolution. Here, the investigations are categorized according to how far these analyses have proceeded.

  19. Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree.

    Science.gov (United States)

    Bai, Ying; Chen, Yibing; Kong, Xiangdong

    2018-02-02

    It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.

  20. Novel 31.2 kb α0 Deletion in a Palestinian Family with α-Thalassemia

    DEFF Research Database (Denmark)

    Brieghel, Christian; Birgens, Henrik; Frederiksen, Henrik

    2015-01-01

    A previously unknown α(0) deletion, designated - -(DANE), was found in three generations of a Danish family of Palestinian origin. Six patients were heterozygous and three patients had deletional Hb H (β4) disease with a compound heterozygosity for the common -α(3.7) (rightward) deletion. Multipl...

  1. A 590 kb deletion caused by non-allelic homologous recombination between two LINE-1 elements in a patient with mesomelia-synostosis syndrome.

    Science.gov (United States)

    Kohmoto, Tomohiro; Naruto, Takuya; Watanabe, Miki; Fujita, Yuji; Ujiro, Sae; Okamoto, Nana; Horikawa, Hideaki; Masuda, Kiyoshi; Imoto, Issei

    2017-04-01

    Mesomelia-synostoses syndrome (MSS) is a rare, autosomal-dominant, syndromal osteochondrodysplasia characterized by mesomelic limb shortening, acral synostoses, and multiple congenital malformations due to a non-recurrent deletion at 8q13 that always encompasses two coding-genes, SULF1 and SLCO5A1. To date, five unrelated patients have been reported worldwide, and MMS was previously proposed to not be a genomic disorder associated with deletions recurring from non-allelic homologous recombination (NAHR) in at least two analyzed cases. We conducted targeted gene panel sequencing and subsequent array-based copy number analysis in an 11-year-old undiagnosed Japanese female patient with multiple congenital anomalies that included mesomelic limb shortening and detected a novel 590 Kb deletion at 8q13 encompassing the same gene set as reported previously, resulting in the diagnosis of MSS. Breakpoint sequences of the deleted region in our case demonstrated the first LINE-1s (L1s)-mediated unequal NAHR event utilizing two distant L1 elements as homology substrates in this disease, which may represent a novel causative mechanism of the 8q13 deletion, expanding the range of mechanisms involved in the chromosomal rearrangements responsible for MSS. © 2017 Wiley Periodicals, Inc.

  2. A 725 kb deletion at 22q13.1 chromosomal region including SOX10 gene in a boy with a neurologic variant of Waardenburg syndrome type 2.

    Science.gov (United States)

    Siomou, Elisavet; Manolakos, Emmanouil; Petersen, Michael; Thomaidis, Loretta; Gyftodimou, Yolanda; Orru, Sandro; Papoulidis, Ioannis

    2012-11-01

    Waardenburg syndrome (WS) is a rare (1/40,000) autosomal dominant disorder resulting from melanocyte defects, with varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair, skin, and inner ear. WS is classified into four clinical subtypes (WS1-S4). Six genes have been identified to be associated with the different subtypes of WS, among which SOX10, which is localized within the region 22q13.1. Lately it has been suggested that whole SOX10 gene deletions can be encountered when testing for WS. In this study we report a case of a 13-year-old boy with a unique de novo 725 kb deletion within the 22q13.1 chromosomal region, including the SOX10 gene and presenting clinical features of a neurologic variant of WS2. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  3. In Vivo Deletion of the Cebpa +37 kb Enhancer Markedly Reduces Cebpa mRNA in Myeloid Progenitors but Not in Non-Hematopoietic Tissues to Impair Granulopoiesis

    Science.gov (United States)

    Guo, Hong; Cooper, Stacy; Friedman, Alan D.

    2016-01-01

    The murine Cebpa gene contains a +37 kb, evolutionarily conserved 440 bp enhancer that directs high-level expression to myeloid progenitors in transgenic mice. The enhancer is bound and activated by Runx1, Scl, GATA2, C/EBPα, c-Myb, Pu.1, and additional Ets factors in myeloid cells. CRISPR/Cas9-mediated replacement of the wild-type enhancer with a variant mutant in its seven Ets sites leads to 20-fold reduction of Cebpa mRNA in the 32Dcl3 myeloid cell line. To determine the effect of deleting the enhancer in vivo, we now characterize C57BL/6 mice in which loxP sites flank a 688 bp DNA segment containing the enhancer. CMV-Cre mediated germline deletion resulted in diminution of the expected number of viable Enh(f/f);CMV-Cre offspring, with 28-fold reduction in marrow Cebpa mRNA but normal levels in liver, lung, adipose, intestine, muscle, and kidney. Cre-transduction of lineage-negative marrow cells in vitro reduced Cebpa mRNA 12-fold, with impairment of granulocytic maturation, morphologic blast accumulation, and IL-3 dependent myeloid colony replating for >12 generations. Exposure of Enh(f/f);Mx1-Cre mice to pIpC led to 14-fold reduction of Cebpa mRNA in GMP or CMP, 30-fold reduction in LSK, and deletion and confirmed marrow-intrinsic impairment of granulopoiesis and B cell generation with LSK and monocyte lineage expansion. These findings demonstrate a critical role for the +37 kb Cebpa enhancer for hematopoietic-specific Cebpa expression, with enhancer deletion leading to impaired myelopoiesis and potentially preleukemic progenitor expansion. PMID:26937964

  4. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  5. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.

    Science.gov (United States)

    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D

    2012-09-01

    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

  6. Neuropsychological phenotype of a patient with a de novo 970 kb interstitial deletion in the distal 16p11.2 region

    Directory of Open Access Journals (Sweden)

    Egger JI

    2014-03-01

    Full Text Available Jos I M Egger,1–3 Willem M A Verhoeven,1,4 Wim Verbeeck,5 Nicole de Leeuw61Vincent van Gogh Institute for Psychiatry, Centre of Excellence for Neuropsychiatry, Venray, the Netherlands; 2Donders Institute for Brain, Cognition and Behaviour, Radboud University Nijmegen, Nijmegen, the Netherlands; 3Behavioural Science Institute, Radboud University Nijmegen, Nijmegen, the Netherlands; 4Erasmus University Medical Centre, Department of Psychiatry, Rotterdam, the Netherlands; 5Vincent van Gogh Institute for Psychiatry, Centre for Autism and ADHD, Venray, the Netherlands; 6Department of Human Genetics, Radboud University Medical Centre, Nijmegen, the NetherlandsAbstract: The 16p11.2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay, symptoms from the autism spectrum, epilepsy, congenital anomalies, and obesity. These phenotypes are often related to a proximal 16p11.2 deletion of approximately 600 kb (BP4–BP5 that includes the SH2B1 gene that is reported to be causative for morbid obesity. This more centromeric deletion is most strongly related to autism spectrum susceptibility and is functionally different from the more distal 16p12.2p11.2 region, which includes the so-called atypical 16p11.2 BP2–BP3 deletion (approximately 220 kb presenting with developmental delay, behavioral problems and mild facial dysmorphisms. Here, an adult male with a long history of maladaptive behaviors is described who was referred for diagnostic assessment of his amotivational features. Extensive neuropsychological examination demonstrated rigid thinking, anxious beliefs, and ideas of reference in the presence of normal intelligence. Microarray analysis demonstrated a de novo 970 kb 16p11.2 BP1–BP4 microdeletion that can be regarded as explanatory for his behavioral profile. It is concluded that microdeletion syndromes are not exclusively related to intellectual disabilities and

  7. Barcoded DNA-tag reporters for multiplex cis-regulatory analysis.

    Directory of Open Access Journals (Sweden)

    Jongmin Nam

    Full Text Available Cis-regulatory DNA sequences causally mediate patterns of gene expression, but efficient experimental analysis of these control systems has remained challenging. Here we develop a new version of "barcoded" DNA-tag reporters, "Nanotags" that permit simultaneous quantitative analysis of up to 130 distinct cis-regulatory modules (CRMs. The activities of these reporters are measured in single experiments by the NanoString RNA counting method and other quantitative procedures. We demonstrate the efficiency of the Nanotag method by simultaneously measuring hourly temporal activities of 126 CRMs from 46 genes in the developing sea urchin embryo, otherwise a virtually impossible task. Nanotags are also used in gene perturbation experiments to reveal cis-regulatory responses of many CRMs at once. Nanotag methodology can be applied to many research areas, ranging from gene regulatory networks to functional and evolutionary genomics.

  8. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    Science.gov (United States)

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  9. Conserved cis-regulatory regions in a large genomic landscape control SHH and BMP-regulated Gremlin1 expression in mouse limb buds

    Directory of Open Access Journals (Sweden)

    Zuniga Aimée

    2012-08-01

    Full Text Available Abstract Background Mouse limb bud is a prime model to study the regulatory interactions that control vertebrate organogenesis. Major aspects of limb bud development are controlled by feedback loops that define a self-regulatory signalling system. The SHH/GREM1/AER-FGF feedback loop forms the core of this signalling system that operates between the posterior mesenchymal organiser and the ectodermal signalling centre. The BMP antagonist Gremlin1 (GREM1 is a critical node in this system, whose dynamic expression is controlled by BMP, SHH, and FGF signalling and key to normal progression of limb bud development. Previous analysis identified a distant cis-regulatory landscape within the neighbouring Formin1 (Fmn1 locus that is required for Grem1 expression, reminiscent of the genomic landscapes controlling HoxD and Shh expression in limb buds. Results Three highly conserved regions (HMCO1-3 were identified within the previously defined critical genomic region and tested for their ability to regulate Grem1 expression in mouse limb buds. Using a combination of BAC and conventional transgenic approaches, a 9 kb region located ~70 kb downstream of the Grem1 transcription unit was identified. This region, termed Grem1 Regulatory Sequence 1 (GRS1, is able to recapitulate major aspects of Grem1 expression, as it drives expression of a LacZ reporter into the posterior and, to a lesser extent, in the distal-anterior mesenchyme. Crossing the GRS1 transgene into embryos with alterations in the SHH and BMP pathways established that GRS1 depends on SHH and is modulated by BMP signalling, i.e. integrates inputs from these pathways. Chromatin immunoprecipitation revealed interaction of endogenous GLI3 proteins with the core cis-regulatory elements in the GRS1 region. As GLI3 is a mediator of SHH signal transduction, these results indicated that SHH directly controls Grem1 expression through the GRS1 region. Finally, all cis-regulatory regions within the Grem1

  10. Retrospective analysis in oculocutaneous albinism patients for the 2.7 kb deletion in the OCA2 gene revealed a co-segregation of the controversial variant, p.R305W.

    Science.gov (United States)

    Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing

    2017-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.

  11. Characterization of an Equine α-S2-Casein Variant Due to a 1.3 kb Deletion Spanning Two Coding Exons

    Science.gov (United States)

    Brinkmann, Julia; Koudelka, Tomas; Keppler, Julia K.; Tholey, Andreas; Schwarz, Karin; Thaller, Georg; Tetens, Jens

    2015-01-01

    The production and consumption of mare’s milk in Europe has gained importance, mainly based on positive health effects and a lower allergenic potential as compared to cows’ milk. The allergenicity of milk is to a certain extent affected by different genetic variants. In classical dairy species, much research has been conducted into the genetic variability of milk proteins, but the knowledge in horses is scarce. Here, we characterize two major forms of equine αS2-casein arising from genomic 1.3 kb in-frame deletion involving two coding exons, one of which represents an equid specific duplication. Findings at the DNA-level have been verified by cDNA sequencing from horse milk of mares with different genotypes. At the protein-level, we were able to show by SDS-page and in-gel digestion with subsequent LC-MS analysis that both proteins are actually expressed. The comparison with published sequences of other equids revealed that the deletion has probably occurred before the ancestor of present-day asses and zebras diverged from the horse lineage. PMID:26444874

  12. CRX ChIP-seq reveals the cis-regulatory architecture of mouse photoreceptors

    NARCIS (Netherlands)

    J.C. Corbo (Joseph); K.A. Lawrence (Karen); M. Karlstetter (Marcus); C.A. Myers (Connie); M. Abdelaziz (Musa); W. Dirkes (William); K. Weigelt (Karin); M. Seifert (Martin); V. Benes (Vladimir); L.G. Fritsche (Lars); B.H.F. Weber (Bernhard); T. Langmann (Thomas)

    2010-01-01

    textabstractApproximately 98% of mammalian DNA is noncoding, yet we understand relatively little about the function of this enigmatic portion of the genome. The cis-regulatory elements that control gene expression reside in noncoding regions and can be identified by mapping the binding sites of

  13. Cis-regulatory elements in the primate brain: from functional specialization to neurodegeneration

    NARCIS (Netherlands)

    Vermunt, Marit W.

    2017-01-01

    Over the last decade, the noncoding part of the genome has been shown to harbour thousands of cis-regulatory elements, such as enhancers, that activate well-defined gene expression programs. Here, we charted active enhancers in a multiplicity of human brain regions to understand the role of

  14. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  15. Genome-wide prediction of cis-regulatory regions using supervised deep learning methods.

    Science.gov (United States)

    Li, Yifeng; Shi, Wenqiang; Wasserman, Wyeth W

    2018-05-31

    In the human genome, 98% of DNA sequences are non-protein-coding regions that were previously disregarded as junk DNA. In fact, non-coding regions host a variety of cis-regulatory regions which precisely control the expression of genes. Thus, Identifying active cis-regulatory regions in the human genome is critical for understanding gene regulation and assessing the impact of genetic variation on phenotype. The developments of high-throughput sequencing and machine learning technologies make it possible to predict cis-regulatory regions genome wide. Based on rich data resources such as the Encyclopedia of DNA Elements (ENCODE) and the Functional Annotation of the Mammalian Genome (FANTOM) projects, we introduce DECRES based on supervised deep learning approaches for the identification of enhancer and promoter regions in the human genome. Due to their ability to discover patterns in large and complex data, the introduction of deep learning methods enables a significant advance in our knowledge of the genomic locations of cis-regulatory regions. Using models for well-characterized cell lines, we identify key experimental features that contribute to the predictive performance. Applying DECRES, we delineate locations of 300,000 candidate enhancers genome wide (6.8% of the genome, of which 40,000 are supported by bidirectional transcription data), and 26,000 candidate promoters (0.6% of the genome). The predicted annotations of cis-regulatory regions will provide broad utility for genome interpretation from functional genomics to clinical applications. The DECRES model demonstrates potentials of deep learning technologies when combined with high-throughput sequencing data, and inspires the development of other advanced neural network models for further improvement of genome annotations.

  16. An in vivo cis-regulatory screen at the type 2 diabetes associated TCF7L2 locus identifies multiple tissue-specific enhancers.

    Directory of Open Access Journals (Sweden)

    Daniel Savic

    Full Text Available Genome-wide association studies (GWAS have repeatedly shown an association between non-coding variants in the TCF7L2 locus and risk for type 2 diabetes (T2D, implicating a role for cis-regulatory variation within this locus in disease etiology. Supporting this hypothesis, we previously localized complex regulatory activity to the TCF7L2 T2D-associated interval using an in vivo bacterial artificial chromosome (BAC enhancer-trapping reporter strategy. To follow-up on this broad initial survey of the TCF7L2 regulatory landscape, we performed a fine-mapping enhancer scan using in vivo mouse transgenic reporter assays. We functionally interrogated approximately 50% of the sequences within the T2D-associated interval, utilizing sequence conservation within this 92-kb interval to determine the regulatory potential of all evolutionary conserved sequences that exhibited conservation to the non-eutherian mammal opossum. Included in this study was a detailed functional interrogation of sequences spanning both protective and risk alleles of single nucleotide polymorphism (SNP rs7903146, which has exhibited allele-specific enhancer function in pancreatic beta cells. Using these assays, we identified nine segments regulating various aspects of the TCF7L2 expression profile and that constitute nearly 70% of the sequences tested. These results highlight the regulatory complexity of this interval and support the notion that a TCF7L2 cis-regulatory disruption leads to T2D predisposition.

  17. Prediction of tissue-specific cis-regulatory modules using Bayesian networks and regression trees

    Directory of Open Access Journals (Sweden)

    Chen Xiaoyu

    2007-12-01

    Full Text Available Abstract Background In vertebrates, a large part of gene transcriptional regulation is operated by cis-regulatory modules. These modules are believed to be regulating much of the tissue-specificity of gene expression. Results We develop a Bayesian network approach for identifying cis-regulatory modules likely to regulate tissue-specific expression. The network integrates predicted transcription factor binding site information, transcription factor expression data, and target gene expression data. At its core is a regression tree modeling the effect of combinations of transcription factors bound to a module. A new unsupervised EM-like algorithm is developed to learn the parameters of the network, including the regression tree structure. Conclusion Our approach is shown to accurately identify known human liver and erythroid-specific modules. When applied to the prediction of tissue-specific modules in 10 different tissues, the network predicts a number of important transcription factor combinations whose concerted binding is associated to specific expression.

  18. Computational and molecular dissection of an X-box cis-Regulatory module

    OpenAIRE

    Warrington, Timothy Burton

    2015-01-01

    Ciliopathies are a class of human diseases marked by dysfunction of the cellular organelle, cilia. While many of the molecular components that make up cilia have been identified and studied, comparatively little is understood about the transcriptional regulation of genes encoding these components. The conserved transcription factor Regulatory Factor X (RFX)/DAF-19, which acts through binding to the cis-regulatory motif known as X-box, has been shown to regulate ciliary genes in many animals f...

  19. Creating and validating cis-regulatory maps of tissue-specific gene expression regulation

    Science.gov (United States)

    O'Connor, Timothy R.; Bailey, Timothy L.

    2014-01-01

    Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088

  20. Pathogenic adaptation of intracellular bacteria by rewiring a cis-regulatory input function.

    Science.gov (United States)

    Osborne, Suzanne E; Walthers, Don; Tomljenovic, Ana M; Mulder, David T; Silphaduang, Uma; Duong, Nancy; Lowden, Michael J; Wickham, Mark E; Waller, Ross F; Kenney, Linda J; Coombes, Brian K

    2009-03-10

    The acquisition of DNA by horizontal gene transfer enables bacteria to adapt to previously unexploited ecological niches. Although horizontal gene transfer and mutation of protein-coding sequences are well-recognized forms of pathogen evolution, the evolutionary significance of cis-regulatory mutations in creating phenotypic diversity through altered transcriptional outputs is not known. We show the significance of regulatory mutation for pathogen evolution by mapping and then rewiring a cis-regulatory module controlling a gene required for murine typhoid. Acquisition of a binding site for the Salmonella pathogenicity island-2 regulator, SsrB, enabled the srfN gene, ancestral to the Salmonella genus, to play a role in pathoadaptation of S. typhimurium to a host animal. We identified the evolved cis-regulatory module and quantified the fitness gain that this regulatory output accrues for the bacterium using competitive infections of host animals. Our findings highlight a mechanism of pathogen evolution involving regulatory mutation that is selected because of the fitness advantage the new regulatory output provides the incipient clones.

  1. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    International Nuclear Information System (INIS)

    Mao, Grace; Brody, James P.

    2007-01-01

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s -1 . We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase

  2. Dwarfism and Altered Craniofacial Development in Rabbits Is Caused by a 12.1 kb Deletion at the HMGA2 Locus.

    Science.gov (United States)

    Carneiro, Miguel; Hu, Dou; Archer, John; Feng, Chungang; Afonso, Sandra; Chen, Congying; Blanco-Aguiar, José A; Garreau, Hervé; Boucher, Samuel; Ferreira, Paula G; Ferrand, Nuno; Rubin, Carl-Johan; Andersson, Leif

    2017-02-01

    The dwarf phenotype characterizes the smallest of rabbit breeds and is governed largely by the effects of a single dwarfing allele with an incompletely dominant effect on growth. Dwarf rabbits typically weigh under 1 kg and have altered craniofacial morphology. The dwarf allele is recessive lethal and dwarf homozygotes die within a few days of birth. The dwarf phenotype is expressed in heterozygous individuals and rabbits from dwarf breeds homozygous for the wild-type allele are normal, although smaller when compared to other breeds. Here, we show that the dwarf allele constitutes a ∼12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene. HMGA2 has been frequently associated with variation in body size across species. Homozygotes for null alleles are viable in mice but not in rabbits and probably not in humans. RNA-sequencing analysis of rabbit embryos showed that very few genes (4-29 genes) were differentially expressed among the three HMGA2/dwarf genotypes, suggesting that dwarfism and inviability in rabbits are caused by modest changes in gene expression. Our results show that HMGA2 is critical for normal expression of IGF2BP2, which encodes an RNA-binding protein. Finally, we report a catalog of regions of elevated genetic differentiation between dwarf and normal-size rabbits, including LCORL-NCAPG, STC2, HOXD cluster, and IGF2BP2 Levels and patterns of genetic diversity at the LCORL-NCAPG locus further suggest that small size in dwarf breeds was enhanced by crosses with wild rabbits. Overall, our results imply that small size in dwarf rabbits results from a large effect, loss-of-function (LOF) mutation in HMGA2 combined with polygenic selection. Copyright © 2017 by the Genetics Society of America.

  3. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  4. Comparative genomics of metabolic capacities of regulons controlled by cis-regulatory RNA motifs in bacteria.

    Science.gov (United States)

    Sun, Eric I; Leyn, Semen A; Kazanov, Marat D; Saier, Milton H; Novichkov, Pavel S; Rodionov, Dmitry A

    2013-09-02

    In silico comparative genomics approaches have been efficiently used for functional prediction and reconstruction of metabolic and regulatory networks. Riboswitches are metabolite-sensing structures often found in bacterial mRNA leaders controlling gene expression on transcriptional or translational levels.An increasing number of riboswitches and other cis-regulatory RNAs have been recently classified into numerous RNA families in the Rfam database. High conservation of these RNA motifs provides a unique advantage for their genomic identification and comparative analysis. A comparative genomics approach implemented in the RegPredict tool was used for reconstruction and functional annotation of regulons controlled by RNAs from 43 Rfam families in diverse taxonomic groups of Bacteria. The inferred regulons include ~5200 cis-regulatory RNAs and more than 12000 target genes in 255 microbial genomes. All predicted RNA-regulated genes were classified into specific and overall functional categories. Analysis of taxonomic distribution of these categories allowed us to establish major functional preferences for each analyzed cis-regulatory RNA motif family. Overall, most RNA motif regulons showed predictable functional content in accordance with their experimentally established effector ligands. Our results suggest that some RNA motifs (including thiamin pyrophosphate and cobalamin riboswitches that control the cofactor metabolism) are widespread and likely originated from the last common ancestor of all bacteria. However, many more analyzed RNA motifs are restricted to a narrow taxonomic group of bacteria and likely represent more recent evolutionary innovations. The reconstructed regulatory networks for major known RNA motifs substantially expand the existing knowledge of transcriptional regulation in bacteria. The inferred regulons can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. The obtained genome

  5. On the Concept of Cis-regulatory Information: From Sequence Motifs to Logic Functions

    Science.gov (United States)

    Tarpine, Ryan; Istrail, Sorin

    The regulatory genome is about the “system level organization of the core genomic regulatory apparatus, and how this is the locus of causality underlying the twin phenomena of animal development and animal evolution” (E.H. Davidson. The Regulatory Genome: Gene Regulatory Networks in Development and Evolution, Academic Press, 2006). Information processing in the regulatory genome is done through regulatory states, defined as sets of transcription factors (sequence-specific DNA binding proteins which determine gene expression) that are expressed and active at the same time. The core information processing machinery consists of modular DNA sequence elements, called cis-modules, that interact with transcription factors. The cis-modules “read” the information contained in the regulatory state of the cell through transcription factor binding, “process” it, and directly or indirectly communicate with the basal transcription apparatus to determine gene expression. This endowment of each gene with the information-receiving capacity through their cis-regulatory modules is essential for the response to every possible regulatory state to which it might be exposed during all phases of the life cycle and in all cell types. We present here a set of challenges addressed by our CYRENE research project aimed at studying the cis-regulatory code of the regulatory genome. The CYRENE Project is devoted to (1) the construction of a database, the cis-Lexicon, containing comprehensive information across species about experimentally validated cis-regulatory modules; and (2) the software development of a next-generation genome browser, the cis-Browser, specialized for the regulatory genome. The presentation is anchored on three main computational challenges: the Gene Naming Problem, the Consensus Sequence Bottleneck Problem, and the Logic Function Inference Problem.

  6. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  7. Plasticity of the cis-regulatory input function of a gene.

    Directory of Open Access Journals (Sweden)

    Avraham E Mayo

    2006-04-01

    Full Text Available The transcription rate of a gene is often controlled by several regulators that bind specific sites in the gene's cis-regulatory region. The combined effect of these regulators is described by a cis-regulatory input function. What determines the form of an input function, and how variable is it with respect to mutations? To address this, we employ the well-characterized lac operon of Escherichia coli, which has an elaborate input function, intermediate between Boolean AND-gate and OR-gate logic. We mapped in detail the input function of 12 variants of the lac promoter, each with different point mutations in the regulator binding sites, by means of accurate expression measurements from living cells. We find that even a few mutations can significantly change the input function, resulting in functions that resemble Pure AND gates, OR gates, or single-input switches. Other types of gates were not found. The variant input functions can be described in a unified manner by a mathematical model. The model also lets us predict which functions cannot be reached by point mutations. The input function that we studied thus appears to be plastic, in the sense that many of the mutations do not ruin the regulation completely but rather result in new ways to integrate the inputs.

  8. Evolution of New cis-Regulatory Motifs Required for Cell-Specific Gene Expression in Caenorhabditis.

    Directory of Open Access Journals (Sweden)

    Michalis Barkoulas

    2016-09-01

    Full Text Available Patterning of C. elegans vulval cell fates relies on inductive signaling. In this induction event, a single cell, the gonadal anchor cell, secretes LIN-3/EGF and induces three out of six competent precursor cells to acquire a vulval fate. We previously showed that this developmental system is robust to a four-fold variation in lin-3/EGF genetic dose. Here using single-molecule FISH, we find that the mean level of expression of lin-3 in the anchor cell is remarkably conserved. No change in lin-3 expression level could be detected among C. elegans wild isolates and only a low level of change-less than 30%-in the Caenorhabditis genus and in Oscheius tipulae. In C. elegans, lin-3 expression in the anchor cell is known to require three transcription factor binding sites, specifically two E-boxes and a nuclear-hormone-receptor (NHR binding site. Mutation of any of these three elements in C. elegans results in a dramatic decrease in lin-3 expression. Yet only a single E-box is found in the Drosophilae supergroup of Caenorhabditis species, including C. angaria, while the NHR-binding site likely only evolved at the base of the Elegans group. We find that a transgene from C. angaria bearing a single E-box is sufficient for normal expression in C. elegans. Even a short 58 bp cis-regulatory fragment from C. angaria with this single E-box is able to replace the three transcription factor binding sites at the endogenous C. elegans lin-3 locus, resulting in the wild-type expression level. Thus, regulatory evolution occurring in cis within a 58 bp lin-3 fragment, results in a strict requirement for the NHR binding site and a second E-box in C. elegans. This single-cell, single-molecule, quantitative and functional evo-devo study demonstrates that conserved expression levels can hide extensive change in cis-regulatory site requirements and highlights the evolution of new cis-regulatory elements required for cell-specific gene expression.

  9. A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Haitao Guo

    2017-01-01

    Full Text Available The discovery of cis-regulatory modules (CRMs is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them.

  10. A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model

    Science.gov (United States)

    2017-01-01

    The discovery of cis-regulatory modules (CRMs) is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them. PMID:28497059

  11. Alignment and prediction of cis-regulatory modules based on a probabilistic model of evolution.

    Directory of Open Access Journals (Sweden)

    Xin He

    2009-03-01

    Full Text Available Cross-species comparison has emerged as a powerful paradigm for predicting cis-regulatory modules (CRMs and understanding their evolution. The comparison requires reliable sequence alignment, which remains a challenging task for less conserved noncoding sequences. Furthermore, the existing models of DNA sequence evolution generally do not explicitly treat the special properties of CRM sequences. To address these limitations, we propose a model of CRM evolution that captures different modes of evolution of functional transcription factor binding sites (TFBSs and the background sequences. A particularly novel aspect of our work is a probabilistic model of gains and losses of TFBSs, a process being recognized as an important part of regulatory sequence evolution. We present a computational framework that uses this model to solve the problems of CRM alignment and prediction. Our alignment method is similar to existing methods of statistical alignment but uses the conserved binding sites to improve alignment. Our CRM prediction method deals with the inherent uncertainties of binding site annotations and sequence alignment in a probabilistic framework. In simulated as well as real data, we demonstrate that our program is able to improve both alignment and prediction of CRM sequences over several state-of-the-art methods. Finally, we used alignments produced by our program to study binding site conservation in genome-wide binding data of key transcription factors in the Drosophila blastoderm, with two intriguing results: (i the factor-bound sequences are under strong evolutionary constraints even if their neighboring genes are not expressed in the blastoderm and (ii binding sites in distal bound sequences (relative to transcription start sites tend to be more conserved than those in proximal regions. Our approach is implemented as software, EMMA (Evolutionary Model-based cis-regulatory Module Analysis, ready to be applied in a broad biological context.

  12. In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

    Science.gov (United States)

    Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

    2018-01-01

    DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

  13. Identification of putative cis-regulatory elements in Cryptosporidium parvum by de novo pattern finding

    Directory of Open Access Journals (Sweden)

    Kissinger Jessica C

    2007-01-01

    Full Text Available Abstract Background Cryptosporidium parvum is a unicellular eukaryote in the phylum Apicomplexa. It is an obligate intracellular parasite that causes diarrhea and is a significant AIDS-related pathogen. Cryptosporidium parvum is not amenable to long-term laboratory cultivation or classical molecular genetic analysis. The parasite exhibits a complex life cycle, a broad host range, and fundamental mechanisms of gene regulation remain unknown. We have used data from the recently sequenced genome of this organism to uncover clues about gene regulation in C. parvum. We have applied two pattern finding algorithms MEME and AlignACE to identify conserved, over-represented motifs in the 5' upstream regions of genes in C. parvum. To support our findings, we have established comparative real-time -PCR expression profiles for the groups of genes examined computationally. Results We find that groups of genes that share a function or belong to a common pathway share upstream motifs. Different motifs are conserved upstream of different groups of genes. Comparative real-time PCR studies show co-expression of genes within each group (in sub-sets during the life cycle of the parasite, suggesting co-regulation of these genes may be driven by the use of conserved upstream motifs. Conclusion This is one of the first attempts to characterize cis-regulatory elements in the absence of any previously characterized elements and with very limited expression data (seven genes only. Using de novo pattern finding algorithms, we have identified specific DNA motifs that are conserved upstream of genes belonging to the same metabolic pathway or gene family. We have demonstrated the co-expression of these genes (often in subsets using comparative real-time-PCR experiments thus establishing evidence for these conserved motifs as putative cis-regulatory elements. Given the lack of prior information concerning expression patterns and organization of promoters in C. parvum we

  14. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Directory of Open Access Journals (Sweden)

    Diana S José-Edwards

    2015-12-01

    Full Text Available A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs, and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs.

  15. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Science.gov (United States)

    José-Edwards, Diana S; Oda-Ishii, Izumi; Kugler, Jamie E; Passamaneck, Yale J; Katikala, Lavanya; Nibu, Yutaka; Di Gregorio, Anna

    2015-12-01

    A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs), and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC) microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs.

  16. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle: Additional Evidence for the Common Occurrence of Balancing Selection in Livestock

    Science.gov (United States)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole; Iso-Touru, Terhi; Guldbrandtsen, Bernt; Karim, Latifa; Nielsen, Ulrik Sander; Panitz, Frank; Aamand, Gert Pedersen; Schulman, Nina; Georges, Michel; Vilkki, Johanna; Lund, Mogens Sandø; Druet, Tom

    2014-01-01

    In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the negative energy balance of high-producing cows at the peak of lactation. We herein describe the fine-mapping of a major fertility QTL in Nordic Red cattle, and identify a 660-kb deletion encompassing four genes as the causative variant. We show that the deletion is a recessive embryonically lethal mutation. This probably results from the loss of RNASEH2B, which is known to cause embryonic death in mice. Despite its dramatic effect on fertility, 13%, 23% and 32% of the animals carry the deletion in Danish, Swedish and Finnish Red Cattle, respectively. To explain this, we searched for favorable effects on other traits and found that the deletion has strong positive effects on milk yield. This study demonstrates that embryonic lethal mutations account for a non-negligible fraction of the decline in fertility of domestic cattle, and that associated positive effects on milk yield may account for part of the negative genetic correlation. Our study adds to the evidence that structural variants contribute to animal phenotypic variation, and that balancing selection might be more common in livestock species than previously appreciated. PMID:24391517

  17. A 660-Kb deletion with antagonistic effects on fertility and milk production segregates at high frequency in Nordic Red cattle: additional evidence for the common occurrence of balancing selection in livestock.

    Directory of Open Access Journals (Sweden)

    Naveen Kumar Kadri

    2014-01-01

    Full Text Available In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the negative energy balance of high-producing cows at the peak of lactation. We herein describe the fine-mapping of a major fertility QTL in Nordic Red cattle, and identify a 660-kb deletion encompassing four genes as the causative variant. We show that the deletion is a recessive embryonically lethal mutation. This probably results from the loss of RNASEH2B, which is known to cause embryonic death in mice. Despite its dramatic effect on fertility, 13%, 23% and 32% of the animals carry the deletion in Danish, Swedish and Finnish Red Cattle, respectively. To explain this, we searched for favorable effects on other traits and found that the deletion has strong positive effects on milk yield. This study demonstrates that embryonic lethal mutations account for a non-negligible fraction of the decline in fertility of domestic cattle, and that associated positive effects on milk yield may account for part of the negative genetic correlation. Our study adds to the evidence that structural variants contribute to animal phenotypic variation, and that balancing selection might be more common in livestock species than previously appreciated.

  18. Nomadic enhancers: tissue-specific cis-regulatory elements of yellow have divergent genomic positions among Drosophila species.

    Directory of Open Access Journals (Sweden)

    Gizem Kalay

    2010-11-01

    Full Text Available cis-regulatory DNA sequences known as enhancers control gene expression in space and time. They are central to metazoan development and are often responsible for changes in gene regulation that contribute to phenotypic evolution. Here, we examine the sequence, function, and genomic location of enhancers controlling tissue- and cell-type specific expression of the yellow gene in six Drosophila species. yellow is required for the production of dark pigment, and its expression has evolved largely in concert with divergent pigment patterns. Using Drosophila melanogaster as a transgenic host, we examined the expression of reporter genes in which either 5' intergenic or intronic sequences of yellow from each species controlled the expression of Green Fluorescent Protein. Surprisingly, we found that sequences controlling expression in the wing veins, as well as sequences controlling expression in epidermal cells of the abdomen, thorax, and wing, were located in different genomic regions in different species. By contrast, sequences controlling expression in bristle-associated cells were located in the intron of all species. Differences in the precise pattern of spatial expression within the developing epidermis of D. melanogaster transformants usually correlated with adult pigmentation in the species from which the cis-regulatory sequences were derived, which is consistent with cis-regulatory evolution affecting yellow expression playing a central role in Drosophila pigmentation divergence. Sequence comparisons among species favored a model in which sequential nucleotide substitutions were responsible for the observed changes in cis-regulatory architecture. Taken together, these data demonstrate frequent changes in yellow cis-regulatory architecture among Drosophila species. Similar analyses of other genes, combining in vivo functional tests of enhancer activity with in silico comparative genomics, are needed to determine whether the pattern of

  19. Neuropsychological phenotype of a patient with a de novo 970 kb interstitial deletion in the distal 16p11.2 region

    NARCIS (Netherlands)

    Egger, J.I.; Verhoeven, W.M.A.; Verbeeck, W.J.C.; Leeuw, N. de

    2014-01-01

    The 16p11.2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay, symptoms from the autism spectrum, epilepsy, congenital anomalies, and obesity. These phenotypes are often related to a proximal 16p11.2 deletion of

  20. Identifying cis-regulatory modules by combining comparative and compositional analysis of DNA.

    Science.gov (United States)

    Pierstorff, Nora; Bergman, Casey M; Wiehe, Thomas

    2006-12-01

    Predicting cis-regulatory modules (CRMs) in higher eukaryotes is a challenging computational task. Commonly used methods to predict CRMs based on the signal of transcription factor binding sites (TFBS) are limited by prior information about transcription factor specificity. More general methods that bypass the reliance on TFBS models are needed for comprehensive CRM prediction. We have developed a method to predict CRMs called CisPlusFinder that identifies high density regions of perfect local ungapped sequences (PLUSs) based on multiple species conservation. By assuming that PLUSs contain core TFBS motifs that are locally overrepresented, the method attempts to capture the expected features of CRM structure and evolution. Applied to a benchmark dataset of CRMs involved in early Drosophila development, CisPlusFinder predicts more annotated CRMs than all other methods tested. Using the REDfly database, we find that some 'false positive' predictions in the benchmark dataset correspond to recently annotated CRMs. Our work demonstrates that CRM prediction methods that combine comparative genomic data with statistical properties of DNA may achieve reasonable performance when applied genome-wide in the absence of an a priori set of known TFBS motifs. The program CisPlusFinder can be downloaded at http://jakob.genetik.uni-koeln.de/bioinformatik/people/nora/nora.html. All software is licensed under the Lesser GNU Public License (LGPL).

  1. Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

    Science.gov (United States)

    Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

    2011-01-01

    We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

  2. Validation of skeletal muscle cis-regulatory module predictions reveals nucleotide composition bias in functional enhancers.

    Directory of Open Access Journals (Sweden)

    Andrew T Kwon

    2011-12-01

    Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.

  3. Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

    Science.gov (United States)

    Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

    2007-08-01

    Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

  4. PReMod: a database of genome-wide mammalian cis-regulatory module predictions.

    Science.gov (United States)

    Ferretti, Vincent; Poitras, Christian; Bergeron, Dominique; Coulombe, Benoit; Robert, François; Blanchette, Mathieu

    2007-01-01

    We describe PReMod, a new database of genome-wide cis-regulatory module (CRM) predictions for both the human and the mouse genomes. The prediction algorithm, described previously in Blanchette et al. (2006) Genome Res., 16, 656-668, exploits the fact that many known CRMs are made of clusters of phylogenetically conserved and repeated transcription factors (TF) binding sites. Contrary to other existing databases, PReMod is not restricted to modules located proximal to genes, but in fact mostly contains distal predicted CRMs (pCRMs). Through its web interface, PReMod allows users to (i) identify pCRMs around a gene of interest; (ii) identify pCRMs that have binding sites for a given TF (or a set of TFs) or (iii) download the entire dataset for local analyses. Queries can also be refined by filtering for specific chromosomal regions, for specific regions relative to genes or for the presence of CpG islands. The output includes information about the binding sites predicted within the selected pCRMs, and a graphical display of their distribution within the pCRMs. It also provides a visual depiction of the chromosomal context of the selected pCRMs in terms of neighboring pCRMs and genes, all of which are linked to the UCSC Genome Browser and the NCBI. PReMod: http://genomequebec.mcgill.ca/PReMod.

  5. BET Bromodomain Inhibition Releases the Mediator Complex from Select cis-Regulatory Elements.

    Science.gov (United States)

    Bhagwat, Anand S; Roe, Jae-Seok; Mok, Beverly Y L; Hohmann, Anja F; Shi, Junwei; Vakoc, Christopher R

    2016-04-19

    The bromodomain and extraterminal (BET) protein BRD4 can physically interact with the Mediator complex, but the relevance of this association to the therapeutic effects of BET inhibitors in cancer is unclear. Here, we show that BET inhibition causes a rapid release of Mediator from a subset of cis-regulatory elements in the genome of acute myeloid leukemia (AML) cells. These sites of Mediator eviction were highly correlated with transcriptional suppression of neighboring genes, which are enriched for targets of the transcription factor MYB and for functions related to leukemogenesis. A shRNA screen of Mediator in AML cells identified the MED12, MED13, MED23, and MED24 subunits as performing a similar regulatory function to BRD4 in this context, including a shared role in sustaining a block in myeloid maturation. These findings suggest that the interaction between BRD4 and Mediator has functional importance for gene-specific transcriptional activation and for AML maintenance. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Lmx1b-targeted cis-regulatory modules involved in limb dorsalization.

    Science.gov (United States)

    Haro, Endika; Watson, Billy A; Feenstra, Jennifer M; Tegeler, Luke; Pira, Charmaine U; Mohan, Subburaman; Oberg, Kerby C

    2017-06-01

    Lmx1b is a homeodomain transcription factor responsible for limb dorsalization. Despite striking double-ventral (loss-of-function) and double-dorsal (gain-of-function) limb phenotypes, no direct gene targets in the limb have been confirmed. To determine direct targets, we performed a chromatin immunoprecipitation against Lmx1b in mouse limbs at embryonic day 12.5 followed by next-generation sequencing (ChIP-seq). Nearly 84% ( n =617) of the Lmx1b-bound genomic intervals (LBIs) identified overlap with chromatin regulatory marks indicative of potential cis -regulatory modules (PCRMs). In addition, 73 LBIs mapped to CRMs that are known to be active during limb development. We compared Lmx1b-bound PCRMs with genes regulated by Lmx1b and found 292 PCRMs within 1 Mb of 254 Lmx1b-regulated genes. Gene ontological analysis suggests that Lmx1b targets extracellular matrix production, bone/joint formation, axonal guidance, vascular development, cell proliferation and cell movement. We validated the functional activity of a PCRM associated with joint-related Gdf5 that provides a mechanism for Lmx1b-mediated joint modification and a PCRM associated with Lmx1b that suggests a role in autoregulation. This is the first report to describe genome-wide Lmx1b binding during limb development, directly linking Lmx1b to targets that accomplish limb dorsalization. © 2017. Published by The Company of Biologists Ltd.

  7. Identifying Cis-Regulatory Changes Involved in the Evolution of Aerobic Fermentation in Yeasts

    Science.gov (United States)

    Lin, Zhenguo; Wang, Tzi-Yuan; Tsai, Bing-Shi; Wu, Fang-Ting; Yu, Fu-Jung; Tseng, Yu-Jung; Sung, Huang-Mo; Li, Wen-Hsiung

    2013-01-01

    Gene regulation change has long been recognized as an important mechanism for phenotypic evolution. We used the evolution of yeast aerobic fermentation as a model to explore how gene regulation has evolved and how this process has contributed to phenotypic evolution and adaptation. Most eukaryotes fully oxidize glucose to CO2 and H2O in mitochondria to maximize energy yield, whereas some yeasts, such as Saccharomyces cerevisiae and its relatives, predominantly ferment glucose into ethanol even in the presence of oxygen, a phenomenon known as aerobic fermentation. We examined the genome-wide gene expression levels among 12 different yeasts and found that a group of genes involved in the mitochondrial respiration process showed the largest reduction in gene expression level during the evolution of aerobic fermentation. Our analysis revealed that the downregulation of these genes was significantly associated with massive loss of binding motifs of Cbf1p in the fermentative yeasts. Our experimental assays confirmed the binding of Cbf1p to the predicted motif and the activator role of Cbf1p. In summary, our study laid a foundation to unravel the long-time mystery about the genetic basis of evolution of aerobic fermentation, providing new insights into understanding the role of cis-regulatory changes in phenotypic evolution. PMID:23650209

  8. Bioinformatic analysis of cis-regulatory interactions between progesterone and estrogen receptors in breast cancer

    Directory of Open Access Journals (Sweden)

    Matloob Khushi

    2014-11-01

    Full Text Available Chromatin factors interact with each other in a cell and sequence-specific manner in order to regulate transcription and a wealth of publically available datasets exists describing the genomic locations of these interactions. Our recently published BiSA (Binding Sites Analyser database contains transcription factor binding locations and epigenetic modifications collected from published studies and provides tools to analyse stored and imported data. Using BiSA we investigated the overlapping cis-regulatory role of estrogen receptor alpha (ERα and progesterone receptor (PR in the T-47D breast cancer cell line. We found that ERα binding sites overlap with a subset of PR binding sites. To investigate further, we re-analysed raw data to remove any biases introduced by the use of distinct tools in the original publications. We identified 22,152 PR and 18,560 ERα binding sites (<5% false discovery rate with 4,358 overlapping regions among the two datasets. BiSA statistical analysis revealed a non-significant overall overlap correlation between the two factors, suggesting that ERα and PR are not partner factors and do not require each other for binding to occur. However, Monte Carlo simulation by Binary Interval Search (BITS, Relevant Distance, Absolute Distance, Jaccard and Projection tests by Genometricorr revealed a statistically significant spatial correlation of binding regions on chromosome between the two factors. Motif analysis revealed that the shared binding regions were enriched with binding motifs for ERα, PR and a number of other transcription and pioneer factors. Some of these factors are known to co-locate with ERα and PR binding. Therefore spatially close proximity of ERα binding sites with PR binding sites suggests that ERα and PR, in general function independently at the molecular level, but that their activities converge on a specific subset of transcriptional targets.

  9. An integrative and applicable phylogenetic footprinting framework for cis-regulatory motifs identification in prokaryotic genomes.

    Science.gov (United States)

    Liu, Bingqiang; Zhang, Hanyuan; Zhou, Chuan; Li, Guojun; Fennell, Anne; Wang, Guanghui; Kang, Yu; Liu, Qi; Ma, Qin

    2016-08-09

    Phylogenetic footprinting is an important computational technique for identifying cis-regulatory motifs in orthologous regulatory regions from multiple genomes, as motifs tend to evolve slower than their surrounding non-functional sequences. Its application, however, has several difficulties for optimizing the selection of orthologous data and reducing the false positives in motif prediction. Here we present an integrative phylogenetic footprinting framework for accurate motif predictions in prokaryotic genomes (MP(3)). The framework includes a new orthologous data preparation procedure, an additional promoter scoring and pruning method and an integration of six existing motif finding algorithms as basic motif search engines. Specifically, we collected orthologous genes from available prokaryotic genomes and built the orthologous regulatory regions based on sequence similarity of promoter regions. This procedure made full use of the large-scale genomic data and taxonomy information and filtered out the promoters with limited contribution to produce a high quality orthologous promoter set. The promoter scoring and pruning is implemented through motif voting by a set of complementary predicting tools that mine as many motif candidates as possible and simultaneously eliminate the effect of random noise. We have applied the framework to Escherichia coli k12 genome and evaluated the prediction performance through comparison with seven existing programs. This evaluation was systematically carried out at the nucleotide and binding site level, and the results showed that MP(3) consistently outperformed other popular motif finding tools. We have integrated MP(3) into our motif identification and analysis server DMINDA, allowing users to efficiently identify and analyze motifs in 2,072 completely sequenced prokaryotic genomes. The performance evaluation indicated that MP(3) is effective for predicting regulatory motifs in prokaryotic genomes. Its application may enhance

  10. Functional evolution of cis-regulatory modules at a homeotic gene in Drosophila.

    Directory of Open Access Journals (Sweden)

    Margaret C W Ho

    2009-11-01

    Full Text Available It is a long-held belief in evolutionary biology that the rate of molecular evolution for a given DNA sequence is inversely related to the level of functional constraint. This belief holds true for the protein-coding homeotic (Hox genes originally discovered in Drosophila melanogaster. Expression of the Hox genes in Drosophila embryos is essential for body patterning and is controlled by an extensive array of cis-regulatory modules (CRMs. How the regulatory modules functionally evolve in different species is not clear. A comparison of the CRMs for the Abdominal-B gene from different Drosophila species reveals relatively low levels of overall sequence conservation. However, embryonic enhancer CRMs from other Drosophila species direct transgenic reporter gene expression in the same spatial and temporal patterns during development as their D. melanogaster orthologs. Bioinformatic analysis reveals the presence of short conserved sequences within defined CRMs, representing gap and pair-rule transcription factor binding sites. One predicted binding site for the gap transcription factor KRUPPEL in the IAB5 CRM was found to be altered in Superabdominal (Sab mutations. In Sab mutant flies, the third abdominal segment is transformed into a copy of the fifth abdominal segment. A model for KRUPPEL-mediated repression at this binding site is presented. These findings challenge our current understanding of the relationship between sequence evolution at the molecular level and functional activity of a CRM. While the overall sequence conservation at Drosophila CRMs is not distinctive from neighboring genomic regions, functionally critical transcription factor binding sites within embryonic enhancer CRMs are highly conserved. These results have implications for understanding mechanisms of gene expression during embryonic development, enhancer function, and the molecular evolution of eukaryotic regulatory modules.

  11. A HLA class I cis-regulatory element whose activity can be modulated by hormones.

    Science.gov (United States)

    Sim, B C; Hui, K M

    1994-12-01

    To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

  12. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Directory of Open Access Journals (Sweden)

    Arindam Deb

    Full Text Available Combinations of cis-regulatory elements (CREs present at the promoters facilitate the binding of several transcription factors (TFs, thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic

  13. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. © 2015. Published by The Company of Biologists Ltd.

  14. Implications of duplicated cis-regulatory elements in the evolution of metazoans: the DDI model or how simplicity begets novelty.

    Science.gov (United States)

    Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi

    2009-07-01

    The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.

  15. Identification of a cis-regulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis.

    Science.gov (United States)

    Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K

    1995-05-20

    In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.

  16. Direct activation of a notochord cis-regulatory module by Brachyury and FoxA in the ascidian Ciona intestinalis.

    Science.gov (United States)

    Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna

    2009-11-01

    The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.

  17. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera

    Directory of Open Access Journals (Sweden)

    James J. Lewis

    2016-09-01

    Full Text Available Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  18. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    Science.gov (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  19. Identification of cis-regulatory sequences that activate transcription in the suspensor of plant embryos.

    Science.gov (United States)

    Kawashima, Tomokazu; Wang, Xingjun; Henry, Kelli F; Bi, Yuping; Weterings, Koen; Goldberg, Robert B

    2009-03-03

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the scarlet runner bean (Phaseolus coccineus) G564 gene to understand how genes are activated specifically within the suspensor during early embryo development. Previously, we showed that the G564 upstream region has a block of tandem repeats, which contain a conserved 10-bp motif (GAAAAG(C)/(T)GAA), and that deletion of these repeats results in a loss of suspensor transcription. Here, we use gain-of-function (GOF) experiments with transgenic globular-stage tobacco embryos to show that only 1 of the 5 tandem repeats is required to drive suspensor-specific transcription. Fine-scale deletion and scanning mutagenesis experiments with 1 tandem repeat uncovered a 54-bp region that contains all of the sequences required to activate transcription in the suspensor, including the 10-bp motif (GAAAAGCGAA) and a similar 10-bp-like motif (GAAAAACGAA). Site-directed mutagenesis and GOF experiments indicated that both the 10-bp and 10-bp-like motifs are necessary, but not sufficient to activate transcription in the suspensor, and that a sequence (TTGGT) between the 10-bp and the 10-bp-like motifs is also necessary for suspensor transcription. Together, these data identify sequences that are required to activate transcription in the suspensor of a plant embryo after fertilization.

  20. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  1. cisMEP: an integrated repository of genomic epigenetic profiles and cis-regulatory modules in Drosophila.

    Science.gov (United States)

    Yang, Tzu-Hsien; Wang, Chung-Ching; Hung, Po-Cheng; Wu, Wei-Sheng

    2014-01-01

    Cis-regulatory modules (CRMs), or the DNA sequences required for regulating gene expression, play the central role in biological researches on transcriptional regulation in metazoan species. Nowadays, the systematic understanding of CRMs still mainly resorts to computational methods due to the time-consuming and small-scale nature of experimental methods. But the accuracy and reliability of different CRM prediction tools are still unclear. Without comparative cross-analysis of the results and combinatorial consideration with extra experimental information, there is no easy way to assess the confidence of the predicted CRMs. This limits the genome-wide understanding of CRMs. It is known that transcription factor binding and epigenetic profiles tend to determine functions of CRMs in gene transcriptional regulation. Thus integration of the genome-wide epigenetic profiles with systematically predicted CRMs can greatly help researchers evaluate and decipher the prediction confidence and possible transcriptional regulatory functions of these potential CRMs. However, these data are still fragmentary in the literatures. Here we performed the computational genome-wide screening for potential CRMs using different prediction tools and constructed the pioneer database, cisMEP (cis-regulatory module epigenetic profile database), to integrate these computationally identified CRMs with genomic epigenetic profile data. cisMEP collects the literature-curated TFBS location data and nine genres of epigenetic data for assessing the confidence of these potential CRMs and deciphering the possible CRM functionality. cisMEP aims to provide a user-friendly interface for researchers to assess the confidence of different potential CRMs and to understand the functions of CRMs through experimentally-identified epigenetic profiles. The deposited potential CRMs and experimental epigenetic profiles for confidence assessment provide experimentally testable hypotheses for the molecular mechanisms

  2. A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

    Science.gov (United States)

    Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

    1997-09-05

    To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient

  3. Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

    Science.gov (United States)

    Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

    2015-01-08

    Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

  4. KB WOT Fisheries 2017

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and advance the expertise needed to carry out the statutory obligations in fisheries monitoring and advice of The Netherlands. The contents of the KB WOT Fisheries programme for 2017 reflects the scientific and management needs of the WOT

  5. Unveiling combinatorial regulation through the combination of ChIP information and in silico cis-regulatory module detection

    Science.gov (United States)

    Sun, Hong; Guns, Tias; Fierro, Ana Carolina; Thorrez, Lieven; Nijssen, Siegfried; Marchal, Kathleen

    2012-01-01

    Computationally retrieving biologically relevant cis-regulatory modules (CRMs) is not straightforward. Because of the large number of candidates and the imperfection of the screening methods, many spurious CRMs are detected that are as high scoring as the biologically true ones. Using ChIP-information allows not only to reduce the regions in which the binding sites of the assayed transcription factor (TF) should be located, but also allows restricting the valid CRMs to those that contain the assayed TF (here referred to as applying CRM detection in a query-based mode). In this study, we show that exploiting ChIP-information in a query-based way makes in silico CRM detection a much more feasible endeavor. To be able to handle the large datasets, the query-based setting and other specificities proper to CRM detection on ChIP-Seq based data, we developed a novel powerful CRM detection method ‘CPModule’. By applying it on a well-studied ChIP-Seq data set involved in self-renewal of mouse embryonic stem cells, we demonstrate how our tool can recover combinatorial regulation of five known TFs that are key in the self-renewal of mouse embryonic stem cells. Additionally, we make a number of new predictions on combinatorial regulation of these five key TFs with other TFs documented in TRANSFAC. PMID:22422841

  6. Does positive selection drive transcription factor binding site turnover? A test with Drosophila cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Bin Z He

    2011-04-01

    Full Text Available Transcription factor binding site(s (TFBS gain and loss (i.e., turnover is a well-documented feature of cis-regulatory module (CRM evolution, yet little attention has been paid to the evolutionary force(s driving this turnover process. The predominant view, motivated by its widespread occurrence, emphasizes the importance of compensatory mutation and genetic drift. Positive selection, in contrast, although it has been invoked in specific instances of adaptive gene expression evolution, has not been considered as a general alternative to neutral compensatory evolution. In this study we evaluate the two hypotheses by analyzing patterns of single nucleotide polymorphism in the TFBS of well-characterized CRM in two closely related Drosophila species, Drosophila melanogaster and Drosophila simulans. An important feature of the analysis is classification of TFBS mutations according to the direction of their predicted effect on binding affinity, which allows gains and losses to be evaluated independently along the two phylogenetic lineages. The observed patterns of polymorphism and divergence are not compatible with neutral evolution for either class of mutations. Instead, multiple lines of evidence are consistent with contributions of positive selection to TFBS gain and loss as well as purifying selection in its maintenance. In discussion, we propose a model to reconcile the finding of selection driving TFBS turnover with constrained CRM function over long evolutionary time.

  7. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  8. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements

    Science.gov (United States)

    Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.

    2016-01-01

    The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646

  9. A novel method for predicting activity of cis-regulatory modules, based on a diverse training set.

    Science.gov (United States)

    Yang, Wei; Sinha, Saurabh

    2017-01-01

    With the rapid emergence of technologies for locating cis-regulatory modules (CRMs) genome-wide, the next pressing challenge is to assign precise functions to each CRM, i.e. to determine the spatiotemporal domains or cell-types where it drives expression. A popular approach to this task is to model the typical k-mer composition of a set of CRMs known to drive a common expression pattern, and assign that pattern to other CRMs exhibiting a similar k-mer composition. This approach does not rely on prior knowledge of transcription factors relevant to the CRM or their binding motifs, and is thus more widely applicable than motif-based methods for predicting CRM activity, but is also prone to false positive predictions. We present a novel strategy to improve the above-mentioned approach: to predict if a CRM drives a specific gene expression pattern, assess not only how similar the CRM is to other CRMs with similar activity but also to CRMs with distinct activities. We use a state-of-the-art statistical method to quantify a CRM's sequence similarity to many different training sets of CRMs, and employ a classification algorithm to integrate these similarity scores into a single prediction of the CRM's activity. This strategy is shown to significantly improve CRM activity prediction over current approaches. Our implementation of the new method, called IMMBoost, is freely available as source code, at https://github.com/weiyangedward/IMMBoost CONTACT: sinhas@illinois.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Nutritional control of gene expression in Drosophila larvae via TOR, Myc and a novel cis-regulatory element

    Directory of Open Access Journals (Sweden)

    Grewal Savraj S

    2010-01-01

    Full Text Available Abstract Background Nutrient availability is a key determinant of eukaryotic cell growth. In unicellular organisms many signaling and transcriptional networks link nutrient availability to the expression of metabolic genes required for growth. However, less is known about the corresponding mechanisms that operate in metazoans. We used gene expression profiling to explore this issue in developing Drosophila larvae. Results We found that starvation for dietary amino acids (AA's leads to dynamic changes in transcript levels of many metabolic genes. The conserved insulin/PI3K and TOR signaling pathways mediate nutrition-dependent growth in Drosophila and other animals. We found that many AA starvation-responsive transcripts were also altered in TOR mutants. In contrast, although PI3K overexpression induced robust changes in the expression of many metabolic genes, these changes showed limited overlap with the AA starvation expression profile. We did however identify a strong overlap between genes regulated by the transcription factor, Myc, and AA starvation-responsive genes, particularly those involved in ribosome biogenesis, protein synthesis and mitochondrial function. The consensus Myc DNA binding site is enriched in promoters of these AA starvation genes, and we found that Myc overexpression could bypass dietary AA to induce expression of these genes. We also identified another sequence motif (Motif 1 enriched in the promoters of AA starvation-responsive genes. We showed that Motif 1 was both necessary and sufficient to mediate transcriptional responses to dietary AA in larvae. Conclusions Our data suggest that many of the transcriptional effects of amino acids are mediated via signaling through the TOR pathway in Drosophila larvae. We also find that these transcriptional effects are mediated through at least two mechanisms: via the transcription factor Myc, and via the Motif 1 cis-regulatory element. These studies begin to elucidate a nutrient

  11. LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms.

    Science.gov (United States)

    Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie

    2014-02-17

    As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of

  12. Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs

    Directory of Open Access Journals (Sweden)

    Girgis Hani Z

    2012-02-01

    Full Text Available Abstract Background Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF binding sites (TFBSs. Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. Results We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was

  13. A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

    Science.gov (United States)

    Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

    2012-09-01

    Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised

  14. Computational exploration of cis-regulatory modules in rhythmic expression data using the "Exploration of Distinctive CREs and CRMs" (EDCC) and "CRM Network Generator" (CNG) programs.

    Science.gov (United States)

    Bekiaris, Pavlos Stephanos; Tekath, Tobias; Staiger, Dorothee; Danisman, Selahattin

    2018-01-01

    Understanding the effect of cis-regulatory elements (CRE) and clusters of CREs, which are called cis-regulatory modules (CRM), in eukaryotic gene expression is a challenge of computational biology. We developed two programs that allow simple, fast and reliable analysis of candidate CREs and CRMs that may affect specific gene expression and that determine positional features between individual CREs within a CRM. The first program, "Exploration of Distinctive CREs and CRMs" (EDCC), correlates candidate CREs and CRMs with specific gene expression patterns. For pairs of CREs, EDCC also determines positional preferences of the single CREs in relation to each other and to the transcriptional start site. The second program, "CRM Network Generator" (CNG), prioritizes these positional preferences using a neural network and thus allows unbiased rating of the positional preferences that were determined by EDCC. We tested these programs with data from a microarray study of circadian gene expression in Arabidopsis thaliana. Analyzing more than 1.5 million pairwise CRE combinations, we found 22 candidate combinations, of which several contained known clock promoter elements together with elements that had not been identified as relevant to circadian gene expression before. CNG analysis further identified positional preferences of these CRE pairs, hinting at positional information that may be relevant for circadian gene expression. Future wet lab experiments will have to determine which of these combinations confer daytime specific circadian gene expression.

  15. RNA-ID, a highly sensitive and robust method to identify cis-regulatory sequences using superfolder GFP and a fluorescence-based assay.

    Science.gov (United States)

    Dean, Kimberly M; Grayhack, Elizabeth J

    2012-12-01

    We have developed a robust and sensitive method, called RNA-ID, to screen for cis-regulatory sequences in RNA using fluorescence-activated cell sorting (FACS) of yeast cells bearing a reporter in which expression of both superfolder green fluorescent protein (GFP) and yeast codon-optimized mCherry red fluorescent protein (RFP) is driven by the bidirectional GAL1,10 promoter. This method recapitulates previously reported progressive inhibition of translation mediated by increasing numbers of CGA codon pairs, and restoration of expression by introduction of a tRNA with an anticodon that base pairs exactly with the CGA codon. This method also reproduces effects of paromomycin and context on stop codon read-through. Five key features of this method contribute to its effectiveness as a selection for regulatory sequences: The system exhibits greater than a 250-fold dynamic range, a quantitative and dose-dependent response to known inhibitory sequences, exquisite resolution that allows nearly complete physical separation of distinct populations, and a reproducible signal between different cells transformed with the identical reporter, all of which are coupled with simple methods involving ligation-independent cloning, to create large libraries. Moreover, we provide evidence that there are sequences within a 9-nt library that cause reduced GFP fluorescence, suggesting that there are novel cis-regulatory sequences to be found even in this short sequence space. This method is widely applicable to the study of both RNA-mediated and codon-mediated effects on expression.

  16. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  17. Cis-regulatory signatures of orthologous stress-associated bZIP transcription factors from rice, sorghum and Arabidopsis based on phylogenetic footprints

    Directory of Open Access Journals (Sweden)

    Xu Fuyu

    2012-09-01

    Full Text Available Abstract Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa formed ten clusters of orthologous groups (COG with genes from the monocot sorghum (Sorghum bicolor and dicot Arabidopsis (Arabidopsis thaliana. The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in

  18. Microevolution of cis-regulatory elements: an example from the pair-rule segmentation gene fushi tarazu in the Drosophila melanogaster subgroup.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available The importance of non-coding DNAs that control transcription is ever noticeable, but the characterization and analysis of the evolution of such DNAs presents challenges not found in the analysis of coding sequences. In this study of the cis-regulatory elements of the pair rule segmentation gene fushi tarazu (ftz I report the DNA sequences of ftz's zebra element (promoter and a region containing the proximal enhancer from a total of 45 fly lines belonging to several populations of the species Drosophila melanogaster, D. simulans, D. sechellia, D. mauritiana, D. yakuba, D. teissieri, D. orena and D. erecta. Both elements evolve at slower rate than ftz synonymous sites, thus reflecting their functional importance. The promoter evolves more slowly than the average for ftz's coding sequence while, on average, the enhancer evolves more rapidly, suggesting more functional constraint and effective purifying selection on the former. Comparative analysis of the number and nature of base substitutions failed to detect significant evidence for positive/adaptive selection in transcription-factor-binding sites. These seem to evolve at similar rates to regions not known to bind transcription factors. Although this result reflects the evolutionary flexibility of the transcription factor binding sites, it also suggests a complex and still not completely understood nature of even the characterized cis-regulatory sequences. The latter seem to contain more functional parts than those currently identified, some of which probably transcription factor binding. This study illustrates ways in which functional assignments of sequences within cis-acting sequences can be used in the search for adaptive evolution, but also highlights difficulties in how such functional assignment and analysis can be carried out.

  19. Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

    Science.gov (United States)

    Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

    2005-09-01

    We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

  20. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

    Directory of Open Access Journals (Sweden)

    Lamprini G Kalampoki

    Full Text Available Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN. The Paracentrotus lividus Coup-TF gene (PlCoup-TF is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232, was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3 within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1 or ectopic expression (RE2, RE3. It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

  1. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Directory of Open Access Journals (Sweden)

    Yoav Hadas

    Full Text Available Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1 and Neurofascin (Nfasc are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  2. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  3. The lncRNA Malat1 Is Dispensable for Mouse Development but Its Transcription Plays a cis-Regulatory Role in the Adult

    Directory of Open Access Journals (Sweden)

    Bin Zhang

    2012-07-01

    Full Text Available Genome-wide studies have identified thousands of long noncoding RNAs (lncRNAs lacking protein-coding capacity. However, most lncRNAs are expressed at a very low level, and in most cases there is no genetic evidence to support their in vivo function. Malat1 (metastasis associated lung adenocarcinoma transcript 1 is among the most abundant and highly conserved lncRNAs, and it exhibits an uncommon 3′-end processing mechanism. In addition, its specific nuclear localization, developmental regulation, and dysregulation in cancer are suggestive of it having a critical biological function. We have characterized a Malat1 loss-of-function genetic model that indicates that Malat1 is not essential for mouse pre- and postnatal development. Furthermore, depletion of Malat1 does not affect global gene expression, splicing factor level and phosphorylation status, or alternative pre-mRNA splicing. However, among a small number of genes that were dysregulated in adult Malat1 knockout mice, many were Malat1 neighboring genes, thus indicating a potential cis-regulatory role of Malat1 gene transcription.

  4. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element.

    Science.gov (United States)

    Weterings, K; Schrauwen, J; Wullems, G; Twell, D

    1995-07-01

    Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.

  5. A 1.37-Mb 12p11.22-p11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation.

    Science.gov (United States)

    Chen, Chih-Ping; Lin, Shuan-Pei; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Lee, Chen-Chi; Wang, Wayseen

    2014-03-01

    To present an array comparative genomic hybridization (aCGH) characterization of a 12p11.22-p11.21 microdeletion and 22q11.2 microduplication in an adolescent girl with autism, mental retardation, facial dysmorphism, microcephaly, behavior problems, and an apparently balanced reciprocal translocation of t(8;12)(q24.3;p11.2). A 13-year-old girl was referred to the hospital because of autism, mental retardation, and difficulty in the self-care of her menstruation. Cytogenetic analysis revealed an apparently balanced reciprocal translocation and a karyotype of 46,XX,t(8;12) (q24.3;p11.2)dn. The girl manifested microcephaly, hypertelorism, flat facial profile, prominent forehead, thick scalp hair, upslanting palpebral fissures, broad nasal bridge, bulbous nose, right simian crease, bilateral clinodactyly of the fifth fingers, bilateral pes cavus, learning difficulties, mental retardation, emotional instability, cognitive impairment, behavior problems, jumping-like gaits, and autistic spectrum disorder. aCGH was performed to evaluate genomic imbalance in this patient. aCGH analysis revealed a 1.37-Mb 12p11.22-p11.21 microdeletion or arr [hg 19] 12p11.22-p11.21 (30,645,008-32,014,774)×1 and a 367-kb 22q11.21 microduplication or arr [hg 19] 22q11.21 (18,657,470-19,024,306)×3. The 1.37-Mb 12p11.22-p11.21 microdeletion encompassed 26 genes including IPO8, CAPRIN2, and DDX11, and the 367-kb 22q11.21 microduplication encompassed 20 genes including USP18, DGCR6, PRODH, and DGCR2. An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22-p11.21 microdeletion and 22q11.2 microduplication. Copyright © 2014. Published by Elsevier B.V.

  6. Dynamic in vivo binding of transcription factors to cis-regulatory modules of cer and gsc in the stepwise formation of the Spemann–Mangold organizer

    Science.gov (United States)

    Sudou, Norihiro; Yamamoto, Shinji; Ogino, Hajime; Taira, Masanori

    2012-01-01

    How multiple developmental cues are integrated on cis-regulatory modules (CRMs) for cell fate decisions remains uncertain. The Spemann–Mangold organizer in Xenopus embryos expresses the transcription factors Lim1/Lhx1, Otx2, Mix1, Siamois (Sia) and VegT. Reporter analyses using sperm nuclear transplantation and DNA injection showed that cerberus (cer) and goosecoid (gsc) are activated by the aforementioned transcription factors through CRMs conserved between X. laevis and X. tropicalis. ChIP-qPCR analysis for the five transcription factors revealed that cer and gsc CRMs are initially bound by both Sia and VegT at the late blastula stage, and subsequently bound by all five factors at the gastrula stage. At the neurula stage, only binding of Lim1 and Otx2 to the gsc CRM, among others, persists, which corresponds to their co-expression in the prechordal plate. Based on these data, together with detailed expression pattern analysis, we propose a new model of stepwise formation of the organizer, in which (1) maternal VegT and Wnt-induced Sia first bind to CRMs at the blastula stage; then (2) Nodal-inducible Lim1, Otx2, Mix1 and zygotic VegT are bound to CRMs in the dorsal endodermal and mesodermal regions where all these genes are co-expressed; and (3) these two regions are combined at the gastrula stage to form the organizer. Thus, the in vivo dynamics of multiple transcription factors highlight their roles in the initiation and maintenance of gene expression, and also reveal the stepwise integration of maternal, Nodal and Wnt signaling on CRMs of organizer genes to generate the organizer. PMID:22492356

  7. Dynamic in vivo binding of transcription factors to cis-regulatory modules of cer and gsc in the stepwise formation of the Spemann-Mangold organizer.

    Science.gov (United States)

    Sudou, Norihiro; Yamamoto, Shinji; Ogino, Hajime; Taira, Masanori

    2012-05-01

    How multiple developmental cues are integrated on cis-regulatory modules (CRMs) for cell fate decisions remains uncertain. The Spemann-Mangold organizer in Xenopus embryos expresses the transcription factors Lim1/Lhx1, Otx2, Mix1, Siamois (Sia) and VegT. Reporter analyses using sperm nuclear transplantation and DNA injection showed that cerberus (cer) and goosecoid (gsc) are activated by the aforementioned transcription factors through CRMs conserved between X. laevis and X. tropicalis. ChIP-qPCR analysis for the five transcription factors revealed that cer and gsc CRMs are initially bound by both Sia and VegT at the late blastula stage, and subsequently bound by all five factors at the gastrula stage. At the neurula stage, only binding of Lim1 and Otx2 to the gsc CRM, among others, persists, which corresponds to their co-expression in the prechordal plate. Based on these data, together with detailed expression pattern analysis, we propose a new model of stepwise formation of the organizer, in which (1) maternal VegT and Wnt-induced Sia first bind to CRMs at the blastula stage; then (2) Nodal-inducible Lim1, Otx2, Mix1 and zygotic VegT are bound to CRMs in the dorsal endodermal and mesodermal regions where all these genes are co-expressed; and (3) these two regions are combined at the gastrula stage to form the organizer. Thus, the in vivo dynamics of multiple transcription factors highlight their roles in the initiation and maintenance of gene expression, and also reveal the stepwise integration of maternal, Nodal and Wnt signaling on CRMs of organizer genes to generate the organizer.

  8. Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT genomic binding patterns discerns cell-specific cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Kang Keunsoo

    2013-01-01

    Full Text Available Abstract Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM, which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors.

  9. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  10. Characterization of five partial deletions of the factor VIII gene

    International Nuclear Information System (INIS)

    Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.

    1987-01-01

    Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes

  11. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects...... demonstrated a marked difference between wild-type and the mutant probe, which uniquely bound one or several transcription factors extracted from Caco-2 cells. This finding supports a model in which ectopic anterior SHH expression in the developing limb results from abnormal binding of one or more...

  12. [Effect of the 10 kb sequence of piscine Streptococcus agalactiae on bacterial virulence].

    Science.gov (United States)

    Liu, Guangjin; Zhu, Jielian; Shi, Ziwei; Ding, Ming; Wang, Ruyi; Yao, Huochun; Lu, Chengping; Xu, Pao

    2016-01-04

    From the previous comparative genomic analysis, we found a specific unknown 10 kb sequence (including 11 Open reading Frames) in Chinese piscine strain GD201008-001 genome. To study the role of 10 kb in the pathogenicity of piscine S. agalactiae, the 10 kb sequence was deleted from the GD201008-001 genome. The isogenic mutant Δ10 kb was constructed by using the temperature-sensitive Streptococcus-E. coli shuttle vector pSET4s. We compared the growth characteristics, adherence to HEp-2 cell and bacterial virulence in a zebrafish infection model between wild strain and mutant. Meanwhile the expressions of the known virulence genes from GD201008-001 and Δ10 kb were also quantified by real-time PCR. The Δ10 kb showed no significant differences in bacterial morphology and adherence to HEp-2 cells compared with the wild-type strain, but the speed of growth was slightly slower than the wild strain. Furthermore the 50% lethal dose of Δ10 kb was decreased up to 10-fold (P kb sequence of piscine Streptococcus agalactiae exerts a significant effect on bacterial virulence and probably regulates the virulence genes expression of GD20 1008-001.

  13. A 1.37-Mb 12p11.22–p11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2014-03-01

    Conclusion: An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22–p11.21 microdeletion and 22q11.2 microduplication.

  14. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  15. Refinement of genotype-phenotype correlation in 18 patients carrying a 1q24q25 deletion

    DEFF Research Database (Denmark)

    Chatron, Nicolas; Haddad, Véronique; Andrieux, Joris

    2015-01-01

    of different sizes (490 kb to 20.95 Mb) localized within chromosome bands 1q23.3-q31.2 (chr1:160797550-192912120, hg19). The 490 kb deletion is the smallest deletion reported to date associated with this phenotype. We delineated three regions that may contribute to the phenotype: a proximal one (chr1...

  16. The rates and patterns of deletions in the human factor IX gene

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))

    1994-02-01

    Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.

  17. ARMed SPHINCS computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.; Cheng, C.-M.; Chung, K.-M.; Persiano, G.; Yang, B.-Y.

    2016-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on an embedded microprocessor with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41KB signature on an ARM Cortex

  18. ARMed SPHINCS : computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.

    2015-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on a "very small device" with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41\\,KB signature on an ARM Cortex M3

  19. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  20. The Half-Life of the HSV-1 1.5 kb LAT Intron is similar to the half-Life of the 2.0 kb LAT Intron

    Science.gov (United States)

    Brinkman, Kerry K.; Mishra, Prakhar; Fraser, Nigel W.

    2013-01-01

    Herpes Simplex Virus type 1 (HSV-1) establishes a latent infection in the sensory neurons of the peripheral nervous system of humans. Although about 80 genes are expressed during the lytic cycle of the virus infection, essentially only one gene is expressed during the latent cycle. This gene is known as the latency associated transcript (LAT) and it appears to play a role in the latency cycle through an anti-apoptotic function in the 5’ end of the gene and miRNA encoded along the length of the transcript which down regulate some of the viral immediate early (IE) gene products. The LAT gene is about 8.3 kb long and consists of two exons separated by an unusual intron. The intron between the exons consists of two nested introns. This arrangement of introns has been called a twintron. Furthermore, the larger (2 kb) intron has been shown to be very stable. In this study we measure the stability of the shorter 1.5 kb nested intron and find its half-life is similar to the longer intron. This was achieved by deleting the 0.5 kb overlapping intron from a plasmid construct designed to express the LAT transcript from a tet-inducible promoter, and measuring the half-life of the 1.5 kb intron in tissue culture cells. This finding supports the hypothesis that it is the common branch-point region of these nested introns that is responsible for their stability. PMID:23335177

  1. Identification of a novel 15.5 kb SHOX deletion associated with ...

    Indian Academy of Sciences (India)

    ANGELOS ALEXANDROU

    She had right-sided torticollis and postu- ral tremor mainly involving the .... Repeatmasker and USCS human genome browser tracks were used to identify ..... a Cypriot patient with severe intellectual disability and a jugular fossa malformation: ...

  2. Identification of a novel 15.5 kb SHOX deletion associated

    Indian Academy of Sciences (India)

    ... Cyprus Institute of Neurology and Genetics and Archbishop Makarios III Medical Centre, Nicosia 1066, Cyprus; Neurology Clinic D,The Cyprus Institute of Neurology and Genetics, Nicosia 1683, Cyprus; Molecular Genetics, Function and Therapy Department, The Cyprus Institute of Neurology and Genetics, Nicosia 1683, ...

  3. Identification of a novel 15.5 kb SHOX deletion associated with ...

    Indian Academy of Sciences (India)

    a Cypriot patient with severe intellectual disability and a jugular fossa malformation: review of the literature. Am. J. Med. Genet. A 167, 664–669. Tempel S. 2012 Using and understanding RepeatMasker. Methods. Mol. Biol. 859, 29–51. Received 21 January 2016, in revised form 8 March 2016; accepted 11 March 2016.

  4. Disruption of a -35kb enhancer impairs CTCF binding and MLH1 expression in colorectal cells.

    Science.gov (United States)

    Liu, Qing; Thoms, Julie A; Nunez, Andrea C; Huang, Yizhou; Knezevic, Kathy; Packham, Deborah; Poulos, Rebecca C; Williams, Rachel; Beck, Dominik; Hawkins, Nicholas J; Ward, Robyn L; Wong, Jason W H; Hesson, Luke B; Sloane, Mathew A; Pimanda, John

    2018-06-13

    MLH1 is a major tumour suppressor gene involved in the pathogenesis of Lynch syndrome and various sporadic cancers. Despite their potential pathogenic importance, genomic regions capable of regulating MLH1 expression over long distances have yet to be identified. Here we use chromosome conformation capture (3C) to screen a 650-kb region flanking the MLH1 locus to identify interactions between the MLH1 promoter and distal regions in MLH1 expressing and non-expressing cells. Putative enhancers were functionally validated using luciferase reporter assays, chromatin immunoprecipitation and CRISPR-Cas9 mediated deletion of endogenous regions. To evaluate whether germline variants in the enhancer might contribute to impaired MLH1 expression in patients with suspected Lynch syndrome, we also screened germline DNA from a cohort of 74 patients with no known coding mutations or epimutations at the MLH1 promoter. A 1.8kb DNA fragment, 35kb upstream of the MLH1 transcription start site enhances MLH1 gene expression in colorectal cells. The enhancer was bound by CTCF and CRISPR-Cas9 mediated deletion of a core binding region impairs endogenous MLH1 expression. 5.4% of suspected Lynch syndrome patients have a rare single nucleotide variant (G>A; rs143969848; 2.5% in gnomAD European, non-Finnish) within a highly conserved CTCF binding motif, which disrupts enhancer activity in SW620 colorectal carcinoma cells. A CTCF bound region within the MLH1 -35 enhancer regulates MLH1 expression in colorectal cells and is worthy of scrutiny in future genetic screening strategies for suspected Lynch syndrome associated with loss of MLH1 expression. Copyright ©2018, American Association for Cancer Research.

  5. Clinical and molecuar characterization of Brazilian patients with growth hormone gene deletions

    Directory of Open Access Journals (Sweden)

    I.J.P. Arnhold

    1998-04-01

    Full Text Available Genomic DNA from 23 patients with isolated growth hormone (GH deficiency (12 males and 11 females: heights -4.9 ± 1.4 SDS was screened for GH gene deletions by restriction endonuclease analysis of polymerase chain reaction amplification products. Three unrelated patients had typical features of severe GH deficiency and deletions (6.7 kb in two and 7.6 kb in one of the GH gene. The two patients with 6.7-kb deletions developed growth-attenuating anti-GH antibodies whereas the patient with the 7.6-kb deletion continued to grow with GH replacement therapy. Our finding that 3/23 (~13% Brazilian subjects had GH gene deletions agrees with previous studies of severe isolated GH deficiency subjects in other populations. Two of three subjects (67% with deletions developed blocking antibodies despite administration of exogenous GH at low doses. Interestingly, only 1/10 of cases with affected relatives or parental consanguinity had GH-1 gene deletions

  6. A de novo 1.58 Mb deletion, including MAP2K6 and mapping 1.28 Mb upstream to SOX9, identified in a patient with Pierre Robin sequence and osteopenia with multiple fractures.

    Science.gov (United States)

    Smyk, Marta; Roeder, Elizabeth; Cheung, Sau Wai; Szafranski, Przemyslaw; Stankiewicz, Paweł

    2015-08-01

    Defects of long-range regulatory elements of dosage-sensitive genes represent an under-recognized mechanism underlying genetic diseases. Haploinsufficiency of SOX9, the gene essential for development of testes and differentiation of chondrocytes, results in campomelic dysplasia, a skeletal malformation syndrome often associated with sex reversal. Chromosomal rearrangements with breakpoints mapping up to 1.6 Mb up- and downstream to SOX9, and disrupting its distant cis-regulatory elements, have been described in patients with milder forms of campomelic dysplasia, Pierre Robin sequence, and sex reversal. We present an ∼1.58 Mb deletion mapping ∼1.28 Mb upstream to SOX9 that encompasses its putative long-range cis-regulatory element(s) and MAP2K6 in a patient with Pierre Robin sequence and osteopenia with multiple fractures. Low bone mass panel testing using massively parallel sequencing of 23 nuclear genes, including COL1A1 and COL1A2 was negative. Based on the previous mouse model of Map2k6, suggesting that Sox9 is likely a downstream target of the p38 MAPK pathway, and our previous chromosome conformation capture-on-chip (4C) data showing potential interactions between SOX9 promoter and MAP2K6, we hypothesize that deletion of MAP2K6 might have affected SOX9 expression and contributed to our patient's phenotype. © 2015 Wiley Periodicals, Inc.

  7. Size does matter: Cre-mediated somatic deletion efficiency depends on the distance between the target lox-sites

    NARCIS (Netherlands)

    Coppoolse, E.R.; Vroomen, de M.J.; Gennip, van F.; Hersmus, B.J.M.; Haaren, van M.J.

    2005-01-01

    Cre/lox recombination in vivo has become an important tool to induce chromosomal rearrangements like deletions. Using a combination of Ds transposition and Cre/lox recombination in two independent experiments on chromosomes 6 and 7 of tomato, two sets of somatic deletions up to a size of 200 kb were

  8. Thermal performance measurements on ATLAS-SCT KB forward modules

    CERN Document Server

    Donegà, M; D'Onofrio, M; Ferrère, D; Hirt, C; Ikegami, Y; Kohriki, T; Kondo, T; Lindsay, S; Mangin-Brinet, M; Niinikoski, T O; Pernegger, H; Perrin, E; Taylor, G; Terada, S; Unno, Y; Wallny, R; Weber, M

    2003-01-01

    The thermal design of the KB module is presented. A Finite Elements Analysis (FEA) has been used to finalize the module design. The thermal performance of an outer irradiated KB module has been measured at different cooling conditions. The thermal runaway of the module has been measured. The FEA model has been compared with the measurements and has been used to predict the thermal performance in a realistic SCT scenario.

  9. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    Science.gov (United States)

    Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni; Mitchell, Leslie A.; Luo, Zhouqing; Fan, Yanqun; Zhou, Baojin; Wen, Bo; Tan, Fengji; Wang, Yujia; Zi, Jin; Xie, Zexiong; Li, Bingzhi; Yang, Kun; Richardson, Sarah M.; Jiang, Hui; French, Christopher E.; Nieduszynski, Conrad A.; Koszul, Romain; Marston, Adele L.; Yuan, Yingjin; Wang, Jian; Bader, Joel S.; Dai, Junbiao; Boeke, Jef D.; Xu, Xun; Cai, Yizhi; Yang, Huanming

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synII is mainly caused by the deletion of 13 tRNAs. By both complementation assays and SCRaMbLE, we targeted and debuged the origin of a growth defect at 37°C in glycerol medium, which is related to misregulation of the HOG response. Despite the subtle differences, the synII strain shows highly consistent biological processes comparable to the native strain. PMID:28280153

  10. Genomic rearrangements by LINE-1 insertion-mediated deletion in the human and chimpanzee lineages.

    Science.gov (United States)

    Han, Kyudong; Sen, Shurjo K; Wang, Jianxin; Callinan, Pauline A; Lee, Jungnam; Cordaux, Richard; Liang, Ping; Batzer, Mark A

    2005-01-01

    Long INterspersed Elements (LINE-1s or L1s) are abundant non-LTR retrotransposons in mammalian genomes that are capable of insertional mutagenesis. They have been associated with target site deletions upon insertion in cell culture studies of retrotransposition. Here, we report 50 deletion events in the human and chimpanzee genomes directly linked to the insertion of L1 elements, resulting in the loss of approximately 18 kb of sequence from the human genome and approximately 15 kb from the chimpanzee genome. Our data suggest that during the primate radiation, L1 insertions may have deleted up to 7.5 Mb of target genomic sequences. While the results of our in vivo analysis differ from those of previous cell culture assays of L1 insertion-mediated deletions in terms of the size and rate of sequence deletion, evolutionary factors can reconcile the differences. We report a pattern of genomic deletion sizes similar to those created during the retrotransposition of Alu elements. Our study provides support for the existence of different mechanisms for small and large L1-mediated deletions, and we present a model for the correlation of L1 element size and the corresponding deletion size. In addition, we show that internal rearrangements can modify L1 structure during retrotransposition events associated with large deletions.

  11. Modulation of NF-KB in rescued irradiated cells

    International Nuclear Information System (INIS)

    Lam, R.K.K.; Fung, Y.K.; Han, W.; Li, L.; Chiu, S.K.; Cheng, S.H.; Yu, K.N.

    2015-01-01

    Studies by different groups on the rescue effect, where unirradiated bystander cells mitigated the damages in the irradiated cells, since its discovery by the authors' group in 2011 were first reviewed. The properties of the rescue effect were then examined using a novel experimental set-up to physically separate the rescue signals from the bystander signals. The authors' results showed that the rescue effect was mediated through activation of the nuclear factor-KB (NF-KB) response pathway in the irradiated cells, and that the NF-KB activation inhibitor BAy -1 1-7082 did not affect the activation of this response pathway in the irradiated cells induced by direct irradiation. (authors)

  12. DNA amplification of a further exon of Duchenne muscular dystrophy locus increase possibilities for deletion screening

    Energy Technology Data Exchange (ETDEWEB)

    Speer, A.; Rosenthal, A.; Billwitz, H.; Hanke, R.; Forrest, S.M; Love, D.; Davies, K.E.; Coutelle, C. (John Radcliffe Hospital, Oxford (England))

    1989-06-26

    The data of Chamberlain et al allow the detection of 76% of deletions in the region Cf56A/Cf23a identified by hybridization in their patients. The authors have generated two oligonucleotides allowing the amplification of a further exon which is included in the 3.4 kb hybridization of fragment of Cf56a. This exon is deleted in about 10% of their patients.

  13. The KB WOT Fisheries Programme carried out in 2015

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is established to maintain and develop the expertise needed to carry out the statutory obligations of the Netherlands in fisheries monitoring and advice. It is also a flexible program which responds to changes over time in WOT requirements, fisheries management and

  14. Mapping autonomously replicating sequence elements in a 73-kb ...

    Indian Academy of Sciences (India)

    Autonomously replicating sequence (ARS) elements are the genetic determinants of replication origin function in yeasts. They can be easily identified as the plasmids containing them transform yeast cells at a high frequency. As the first step towards identifying all potential replication origins in a 73-kb region of the long arm ...

  15. The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.

    Science.gov (United States)

    Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O

    1992-05-01

    Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.

  16. Partial deletion 11q

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Tommerup, N; Sørensen, F B

    1995-01-01

    We describe the cytogenetic findings and the dysmorphic features in a stillborn girl with a large de novo terminal deletion of the long arm of chromosome 11. The karyotype was 46,XX,del(11)(q21qter). By reviewing previous reports of deletion 11q, we found that cleft lip and palate are most...

  17. The human thyroglobulin gene is over 300 kb long and contains introns of up to 64 kb

    NARCIS (Netherlands)

    Baas, F.; van Ommen, G. J.; Bikker, H.; Arnberg, A. C.; de Vijlder, J. J.

    1986-01-01

    Thyroglobulin (Tg), the precursor of thyroid hormones, is a 660.000 Da dimeric glycoprotein synthesized exclusively in the thyroid gland. We have cloned the human thyroglobulin gene from cosmid and phage libraries and constructed a complete restriction map. The gene encodes an 8.7 kb mRNA, covers at

  18. Deletion mutations of bacteriophage

    International Nuclear Information System (INIS)

    Ryo, Yeikou

    1975-01-01

    Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)

  19. Schizophrenia and chromosomal deletions

    Energy Technology Data Exchange (ETDEWEB)

    Lindsay, E.A.; Baldini, A. [Baylor College of Medicine, Houston, TX (United States); Morris, M. A. [Univ. of Geneva School of Medicine, NY (United States)] [and others

    1995-06-01

    Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized. These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.

  20. Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.

    Science.gov (United States)

    Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C

    2010-12-20

    Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.

  1. Quantum deletion: Beyond the no-deletion principle

    International Nuclear Information System (INIS)

    Adhikari, Satyabrata

    2005-01-01

    Suppose we are given two identical copies of an unknown quantum state and we wish to delete one copy from among the given two copies. The quantum no-deletion principle restricts us from perfectly deleting a copy but it does not prohibit us from deleting a copy approximately. Here we construct two types of a 'universal quantum deletion machine' which approximately deletes a copy such that the fidelity of deletion does not depend on the input state. The two types of universal quantum deletion machines are (1) a conventional deletion machine described by one unitary operator and (2) a modified deletion machine described by two unitary operators. Here it is shown that the modified deletion machine deletes a qubit with fidelity 3/4, which is the maximum limit for deleting an unknown quantum state. In addition to this we also show that the modified deletion machine retains the qubit in the first mode with average fidelity 0.77 (approx.) which is slightly greater than the fidelity of measurement for two given identical states, showing how precisely one can determine its state [S. Massar and S. Popescu, Phys. Rev. Lett. 74, 1259 (1995)]. We also show that the deletion machine itself is input state independent, i.e., the information is not hidden in the deleting machine, and hence we can delete the information completely from the deletion machine

  2. Crystal structure and thermal behavior of KB3O6

    International Nuclear Information System (INIS)

    Bubnova, R.S.; Fundamenskij, V.S.; Filatov, S.K.; Polyakova, I.G.

    2004-01-01

    The structure of potassium triborate prepared in metastable state by crystallization from melt at ∼ 800 deg C was studied by the method of X-ray diffraction analysis. It was ascertained that KB 3 O 6 belongs to monoclinic crystal system, space group P2 1 /c, a = 9.319(1), b = 6.648(1), c = 21.094(2) A, β = 94.38(1) deg, Z = 12. The compound is referred to a new structural type. Anion of the structure is a single boron-oxygen frame formed by three independent rigid triborate rings of [B 3 O 5 ] - , each of them consisting of two BO 3 triangles and BO 4 tetrahedron. Phase transformations during KB 3 O 6 heating up to 800 deg C, as well as thermal expansion in the range of 20-650 deg C, were studied [ru

  3. Targeted deletion of the 9p21 noncoding coronary artery disease risk interval in mice

    Energy Technology Data Exchange (ETDEWEB)

    Visel, Axel; Zhu, Yiwen; May, Dalit; Afzal, Veena; Gong, Elaine; Attanasio, Catia; Blow, Matthew J.; Cohen, Jonathan C.; Rubin, Edward M.; Pennacchio, Len A.

    2010-01-01

    Sequence polymorphisms in a 58kb interval on chromosome 9p21 confer a markedly increased risk for coronary artery disease (CAD), the leading cause of death worldwide 1,2. The variants have a substantial impact on the epidemiology of CAD and other life?threatening vascular conditions since nearly a quarter of Caucasians are homozygous for risk alleles. However, the risk interval is devoid of protein?coding genes and the mechanism linking the region to CAD risk has remained enigmatic. Here we show that deletion of the orthologous 70kb noncoding interval on mouse chromosome 4 affects cardiac expression of neighboring genes, as well as proliferation properties of vascular cells. Chr4delta70kb/delta70kb mice are viable, but show increased mortality both during development and as adults. Cardiac expression of two genes near the noncoding interval, Cdkn2a and Cdkn2b, is severely reduced in chr4delta70kb/delta70kb mice, indicating that distant-acting gene regulatory functions are located in the noncoding CAD risk interval. Allelespecific expression of Cdkn2b transcripts in heterozygous mice revealed that the deletion affects expression through a cis-acting mechanism. Primary cultures of chr4delta70kb/delta70kb aortic smooth muscle cells exhibited excessive proliferation and diminished senescence, a cellular phenotype consistent with accelerated CAD pathogenesis. Taken together, our results provide direct evidence that the CAD risk interval plays a pivotal role in regulation of cardiac Cdkn2a/b expression and suggest that this region affects CAD progression by altering the dynamics of vascular cell proliferation.

  4. Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region.

    Science.gov (United States)

    Gatta, Valentina; Palka, Chiara; Chiavaroli, Valentina; Franchi, Sara; Cannataro, Giovanni; Savastano, Massimo; Cotroneo, Antonio Raffaele; Chiarelli, Francesco; Mohn, Angelika; Stuppia, Liborio

    2014-07-23

    SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients.Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region.

  5. Detection of genomic deletions in rice using oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Bordeos Alicia

    2009-03-01

    Full Text Available Abstract Background The induction of genomic deletions by physical- or chemical- agents is an easy and inexpensive means to generate a genome-saturating collection of mutations. Different mutagens can be selected to ensure a mutant collection with a range of deletion sizes. This would allow identification of mutations in single genes or, alternatively, a deleted group of genes that might collectively govern a trait (e.g., quantitative trait loci, QTL. However, deletion mutants have not been widely used in functional genomics, because the mutated genes are not tagged and therefore, difficult to identify. Here, we present a microarray-based approach to identify deleted genomic regions in rice mutants selected from a large collection generated by gamma ray or fast neutron treatment. Our study focuses not only on the utility of this method for forward genetics, but also its potential as a reverse genetics tool through accumulation of hybridization data for a collection of deletion mutants harboring multiple genetic lesions. Results We demonstrate that hybridization of labeled genomic DNA directly onto the Affymetrix Rice GeneChip® allows rapid localization of deleted regions in rice mutants. Deletions ranged in size from one gene model to ~500 kb and were predicted on all 12 rice chromosomes. The utility of the technique as a tool in forward genetics was demonstrated in combination with an allelic series of mutants to rapidly narrow the genomic region, and eventually identify a candidate gene responsible for a lesion mimic phenotype. Finally, the positions of mutations in 14 mutants were aligned onto the rice pseudomolecules in a user-friendly genome browser to allow for rapid identification of untagged mutations http://irfgc.irri.org/cgi-bin/gbrowse/IR64_deletion_mutants/. Conclusion We demonstrate the utility of oligonucleotide arrays to discover deleted genes in rice. The density and distribution of deletions suggests the feasibility of a

  6. Rare deletions at 16p13.11 predispose to a diverse spectrum of sporadic epilepsy syndromes.

    Science.gov (United States)

    Heinzen, Erin L; Radtke, Rodney A; Urban, Thomas J; Cavalleri, Gianpiero L; Depondt, Chantal; Need, Anna C; Walley, Nicole M; Nicoletti, Paola; Ge, Dongliang; Catarino, Claudia B; Duncan, John S; Kasperaviciūte, Dalia; Tate, Sarah K; Caboclo, Luis O; Sander, Josemir W; Clayton, Lisa; Linney, Kristen N; Shianna, Kevin V; Gumbs, Curtis E; Smith, Jason; Cronin, Kenneth D; Maia, Jessica M; Doherty, Colin P; Pandolfo, Massimo; Leppert, David; Middleton, Lefkos T; Gibson, Rachel A; Johnson, Michael R; Matthews, Paul M; Hosford, David; Kälviäinen, Reetta; Eriksson, Kai; Kantanen, Anne-Mari; Dorn, Thomas; Hansen, Jörg; Krämer, Günter; Steinhoff, Bernhard J; Wieser, Heinz-Gregor; Zumsteg, Dominik; Ortega, Marcos; Wood, Nicholas W; Huxley-Jones, Julie; Mikati, Mohamad; Gallentine, William B; Husain, Aatif M; Buckley, Patrick G; Stallings, Ray L; Podgoreanu, Mihai V; Delanty, Norman; Sisodiya, Sanjay M; Goldstein, David B

    2010-05-14

    Deletions at 16p13.11 are associated with schizophrenia, mental retardation, and most recently idiopathic generalized epilepsy. To evaluate the role of 16p13.11 deletions, as well as other structural variation, in epilepsy disorders, we used genome-wide screens to identify copy number variation in 3812 patients with a diverse spectrum of epilepsy syndromes and in 1299 neurologically-normal controls. Large deletions (> 100 kb) at 16p13.11 were observed in 23 patients, whereas no control had a deletion greater than 16 kb. Patients, even those with identically sized 16p13.11 deletions, presented with highly variable epilepsy phenotypes. For a subset of patients with a 16p13.11 deletion, we show a consistent reduction of expression for included genes, suggesting that haploinsufficiency might contribute to pathogenicity. We also investigated another possible mechanism of pathogenicity by using hybridization-based capture and next-generation sequencing of the homologous chromosome for ten 16p13.11-deletion patients to look for unmasked recessive mutations. Follow-up genotyping of suggestive polymorphisms failed to identify any convincing recessive-acting mutations in the homologous interval corresponding to the deletion. The observation that two of the 16p13.11 deletions were larger than 2 Mb in size led us to screen for other large deletions. We found 12 additional genomic regions harboring deletions > 2 Mb in epilepsy patients, and none in controls. Additional evaluation is needed to characterize the role of these exceedingly large, non-locus-specific deletions in epilepsy. Collectively, these data implicate 16p13.11 and possibly other large deletions as risk factors for a wide range of epilepsy disorders, and they appear to point toward haploinsufficiency as a contributor to the pathogenicity of deletions. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Effect of gamma rays at the dihydrofolate reductase locus: deletions and inversions

    International Nuclear Information System (INIS)

    Urlaub, G.; Mitchell, P.J.; Kas, E.; Chasin, L.A.; Funanage, V.L.; Myoda, T.T.; Hamlin, J.

    1986-01-01

    A series 11 gamma-ray-induced mutants at the dihydrofolate reductase (dhfr) locus in Chinese hamster ovary cells has been examined for the types of DNA sequence change brought about by this form of ionizing radiation. All 11 mutants were found to have suffered major structural changes affecting the dhfr gene. In eight of the mutants, all or part of the dhfr gene has been deleted. The extent of these deletions was examined in seven of these mutants and, for comparison, in two deletion mutants that were induced by UV irradiation. For this purpose, probes from an overlapping set of cosmids that span 210 kb of DNA in this region were used. Three of seven gamma-ray-induced mutants and one UV-induced mutant were shown to have deleted the entire 210-kb region. In the remaining mutants, endpoints ranging from within the dhfr gene to 100 kb downstream were observed. No upstream endpoints were detected, so that an upper limit on the size of these large deletions could not be assigned. Three of the 11 gamma-ray-induced mutants contained an interruption in the dhfr gene without any detectable loss of sequence. Restriction analysis of these interrupted mutants showed that at least 8-14 kb of foreign DNA sequence became joined to the gene at the point of disruption. Cytogenetic analysis of these mutants showed that in two cases an inversion of the banding pattern on chromosome Z-2 had taken place. The inverted dhfr mutants contain very low amounts of dhfr RNA sequences, and the 5' end of an inversion mutant gene exhibits the same pattern of DNA methylation and DNase I-hypersensitivity as the wild-type gene. Our results suggest that ionizing radiation causes primarily, if not exclusively, large deletions and inversions in mammalian cells

  8. Distinct phenotype of PHF6 deletions in females.

    Science.gov (United States)

    Di Donato, N; Isidor, B; Lopez Cazaux, S; Le Caignec, C; Klink, B; Kraus, C; Schrock, E; Hackmann, K

    2014-02-01

    We report on two female patients carrying small overlapping Xq26.2 deletions of 100 kb and 270 kb involving the PHF6 gene. Mutations in PHF6 have been reported in individuals with Borjeson-Forssman-Lehmann syndrome, a condition present almost exclusively in males. Two very recent papers revealed de novo PHF6 defects in seven female patients with intellectual disability and a phenotype resembling Coffin-Siris syndrome (sparse hair, bitemporal narrowing, arched eyebrows, synophrys, high nasal root, bulbous nasal tip, marked clinodactyly with the hypoplastic terminal phalanges of the fifth fingers and cutaneous syndactyly of the toes, Blaschkoid linear skin hyperpigmentation, dental anomalies and occasional major malformations). The clinical presentation of these patients overlaps completely with our first patient, who carries a germline deletion involving PHF6. The second patient has a mosaic deletion and presented with a very mild phenotype of PHF6 loss in females. Our report confirms that PHF6 loss in females results in a recognizable phenotype overlapping with Coffin-Siris syndrome and distinct from Borjeson-Forssman-Lehmann syndrome. We expand the clinical spectrum and provide the first summary of the recommended medical evaluation. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  9. Two novel types of contiguous gene deletion of the AVPR2 and ARHGAP4 genes in unrelated Japanese kindreds with nephrogenic diabetes insipidus.

    Science.gov (United States)

    Demura, Masashi; Takeda, Yoshiyu; Yoneda, Takashi; Furukawa, Kenji; Usukura, Mikiya; Itoh, Yuji; Mabuchi, Hiroshi

    2002-01-01

    Study of two families containing individuals with nephrogenic diabetes insipidus (NDI) indicated different types of 21.3 kb and 26.3 kb deletions involving the AVPR2 and ARHGAP4 (RhoGAP C1) genes. In the case of the 21.3 kb deletion, the deletion consensus motif (5'-TGAAGG-3') and polypurine runs, known as the arrest site of polymerase alpha, were detected in the vicinity of the deletion junction. Inverted repeats (7/8 matches), believed to potentiate DNA loop formation, flank the deletion breakpoint. We propose this deletion to be the result of slipped mispairing during DNA replication. In the case of the 26.3 kb deletion, the 12,945 bp inverted region with the 10,003 bp internal deletion was accompanied with the 2,509 bp deletion in the 5'-side and the 13,785 bp deletion in the 3'-side. We defined three deletion junctions in this rearrangement (DJ1, DJ2, and DJ3) from the 5'-side. The surrounding sequence of DJ1 (5'-CCC-3') closely resembled that of DJ3 (5'-AGGG-3') (DJ1; 5'-cCCCgaggg-3', DJ3; 5'-ccccAGGG-3'), and DJ1 was located in the 5'-side of DJ3 without any overlapping in sequence. The immunoglobulin class switch (ICS) motif (5'-TGGGG-3') was found around the complementary sequence of DJ3. There was a 10-base palindrome (5'-aGACAtgtct-3') in the alignment of the DJ2 (5'-GACA-3') region. From these findings, we propose a novel mutation process with the rearrangement probably resulting from stem-loop induced non-homologous recombination in an ICS-like fashion. Both patients, despite lacking ARHGAP4, had no morphological, clinical, or laboratory abnormalities except for those usually found in patients with NDI. Copyright 2001 Wiley-Liss, Inc.

  10. The simplest possible design for a KB microfocus mirror system?

    Energy Technology Data Exchange (ETDEWEB)

    Collins, S. P., E-mail: steve.collins@diamond.ac.uk; Scott, S. M.; Hawkins, D. M.; Fabrizi, F.; Moser, B.; Nisbet, G.; Sutter, J. P. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Harwin, R. C. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Department of Physics, Cavendish Laboratory, JJ Thomson Avenue, Cambridge, CB3 0HE (United Kingdom); Harwin, W. S. [School of Systems Engineering, University of Reading, Whiteknights, Reading, Berkshire, RG6 6AH (United Kingdom)

    2016-07-27

    We report a design for a Kirkpatrick-Baez (KB) microfocussing mirror system. The main components are described, with emphasis on a ‘tripod’ manipulator, where we outline the required coordinate transformation calculations. The merit of this device lies in its simplicity of design, minimal degrees of freedom, and speed and ease of setup on a beamline. Test results and an example of the mirrors in use on Diamond Beamline I16, showing a high-resolution polar domain map of KTiOPO{sub 4} with a spot size of 1.25 µm × 1.5 µm, are presented.

  11. Composition and size of Apollo asteroid 1984 KB

    Science.gov (United States)

    Bell, Jeffrey F.; Hawke, B. Ray; Brown, Robert Hamilton

    1988-01-01

    The Class S object-typifying spectral signatures of olivine, pyroxene, and NiFe metal are noted in the present reflection spectra and thermal-emission radiometric data for the earth orbit-crossing Apollo object, 1984KB; a surface material akin to the rare lodranite meteorites. While the Class S object identification is strengthened by standard asteroid thermal model's indication of an about 0.7-km radius, and albedo of about 0.16, which is inconsistent with the IR spectrum, is obtained by an analysis of the same thermal data with a bare-rock thermal model. The object must have a significant regolith despite its small size.

  12. KB WOT Fisheries 2013 - Maintaining Excellence and Innvovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Beek, van F.A.

    2013-01-01

    Het KB programma voor Visserijonderzoek onderhoudt en ontwikkelt de expertise, die nodig is om de WOT voor de visserij uit te voeren. De inhoud van het KB WOT-programma voor 2013 weerspiegelt de recente discussies tussen IMARES, CVO en EZ over de toekomstige richting van het onderzoek. De KB

  13. MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus.

    Science.gov (United States)

    Saito, Mari; Yamagata, Takanori; Matsumoto, Ayumi; Shiba, Yusuke; Nagashima, Masako; Taniguchi, Shuhei; Jimbo, Eriko; Momoi, Mariko Y

    2014-01-01

    Deletion of the monoamine oxidase (MAO)-A and MAO-B was detected in two male siblings and in their mother. The approximately 800-kb deletion, extending from about 43.0MB to 43.8MB, was detected by array comparative genomic hybridization analysis. The MAOA and MAOB genes were included in the deletion, but the adjacent Norrie disease gene, NDP, was not deleted. The boys had short stature, hypotonia, severe developmental delays, episodes of sudden loss of muscle tone, exiting behavior, lip-smacking and autistic features. The serotonin levels in their cerebrospinal fluid were extremely elevated. Another set of siblings with this deletion was reported previously. We propose recognition of MAOA/B deletion syndrome as a distinct disorder. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  14. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements.

    Science.gov (United States)

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-12-01

    The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  15. Computational methods to dissect cis-regulatory transcriptional ...

    Indian Academy of Sciences (India)

    The formation of diverse cell types from an invariant set of genes is governed by biochemical and molecular processes that regulate gene activity. A complete understanding of the regulatory mechanisms of gene expression is the major function of genomics. Computational genomics is a rapidly emerging area for ...

  16. Patterns of cis regulatory variation in diverse human populations.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    Full Text Available The genetic basis of gene expression variation has long been studied with the aim to understand the landscape of regulatory variants, but also more recently to assist in the interpretation and elucidation of disease signals. To date, many studies have looked in specific tissues and population-based samples, but there has been limited assessment of the degree of inter-population variability in regulatory variation. We analyzed genome-wide gene expression in lymphoblastoid cell lines from a total of 726 individuals from 8 global populations from the HapMap3 project and correlated gene expression levels with HapMap3 SNPs located in cis to the genes. We describe the influence of ancestry on gene expression levels within and between these diverse human populations and uncover a non-negligible impact on global patterns of gene expression. We further dissect the specific functional pathways differentiated between populations. We also identify 5,691 expression quantitative trait loci (eQTLs after controlling for both non-genetic factors and population admixture and observe that half of the cis-eQTLs are replicated in one or more of the populations. We highlight patterns of eQTL-sharing between populations, which are partially determined by population genetic relatedness, and discover significant sharing of eQTL effects between Asians, European-admixed, and African subpopulations. Specifically, we observe that both the effect size and the direction of effect for eQTLs are highly conserved across populations. We observe an increasing proximity of eQTLs toward the transcription start site as sharing of eQTLs among populations increases, highlighting that variants close to TSS have stronger effects and therefore are more likely to be detected across a wider panel of populations. Together these results offer a unique picture and resource of the degree of differentiation among human populations in functional regulatory variation and provide an estimate for the transferability of complex trait variants across populations.

  17. Cis-regulatory timers for developmental gene expression.

    Directory of Open Access Journals (Sweden)

    Lionel Christiaen

    2013-10-01

    Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.

  18. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  19. Compound heterozygous deletions in pseudoautosomal region 1 in an infant with mild manifestations of langer mesomelic dysplasia.

    Science.gov (United States)

    Tsuchiya, Takayoshi; Shibata, Minoru; Numabe, Hironao; Jinno, Tomoko; Nakabayashi, Kazuhiko; Nishimura, Gen; Nagai, Toshiro; Ogata, Tsutomu; Fukami, Maki

    2014-02-01

    Haploinsufficiency of SHOX on the short arm pseudoautosomal region (PAR1) leads to Leri-Weill dyschondrosteosis (LWD), and nullizygosity of SHOX results in Langer mesomelic dysplasia (LMD). Molecular defects of LWD/LMD include various microdeletions in PAR1 that involve exons and/or the putative upstream or downstream enhancer regions of SHOX, as well as several intragenic mutations. Here, we report on a Japanese male infant with mild manifestations of LMD and hitherto unreported microdeletions in PAR1. Clinical analysis revealed mesomelic short stature with various radiological findings indicative of LMD. Molecular analyses identified compound heterozygous deletions, that is, a maternally inherited ∼46 kb deletion involving the upstream region and exons 1-5 of SHOX, and a paternally inherited ∼500 kb deletion started from a position ∼300 kb downstream from SHOX. In silico analysis revealed that the downstream deletion did not affect the known putative enhancer regions of SHOX, although it encompassed several non-coding elements which were well conserved among various species with SHOX orthologs. These results provide the possibility of the presence of a novel enhancer for SHOX in the genomic region ∼300 to ∼800 kb downstream of the start codon. © 2013 Wiley Periodicals, Inc.

  20. Isolation of a Spodoptera exigua baculovirus recombinant with retained biological activity despite a 10.6 kb deletion

    NARCIS (Netherlands)

    Dai, X.; Hajos, J.P.; Joosten, N.N.; Oers, van M.M.; IJkel, W.F.J.; Zuidema, D.; Yi, P.

    2000-01-01

    When Spodoptera exigua multicapsid nucleopolyhedrovirus (SeMNPV) is grown in insect cell culture, defective viruses are generated. These viruses lack about 25 kbp of sequence information and are no longer infectious for insects. This makes the engineering of SeMNPV for improved insecticidal activity

  1. A 660-Kb deletion with antagonistic effects on fertility and milk production segregates at high frequency in Nordic Red cattle

    DEFF Research Database (Denmark)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole

    2014-01-01

    In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the nega......In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due...

  2. Sakharov at KB-11. The path of a genius

    International Nuclear Information System (INIS)

    Ilkaev, Radii I

    2012-01-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined. (conferences and symposia)

  3. Sakharov at KB-11. The path of a genius

    Science.gov (United States)

    Ilkaev, Radii I.

    2012-02-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined.

  4. HINT-KB: The human interactome knowledge base

    KAUST Repository

    Theofilatos, Konstantinos A.

    2012-01-01

    Proteins and their interactions are considered to play a significant role in many cellular processes. The identification of Protein-Protein interactions (PPIs) in human is an open research area. Many Databases, which contain information about experimentally and computationally detected human PPIs as well as their corresponding annotation data, have been developed. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://150.140.142.24:84/Default.aspx) which is a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, estimates a set of features of interest and computes a confidence score for every candidate protein interaction using a modern computational hybrid methodology. © 2012 IFIP International Federation for Information Processing.

  5. Mirror profile optimization for nano-focusing KB mirror

    International Nuclear Information System (INIS)

    Zhang Lin; Baker, Robert; Barrett, Ray; Cloetens, Peter; Dabin, Yves

    2010-01-01

    A KB focusing mirror width profile has been optimized to achieve nano-focusing for the nano-imaging end-station ID22NI at the ESRF. The complete mirror and flexure bender assembly has been modeled in 3D with finite element analysis using ANSYS. Bender stiffness, anticlastic effects and geometrical non-linear effects have been considered. Various points have been studied: anisotropy and crystal orientation, stress in the mirror and bender, actuator resolution and the mirror-bender adhesive bonding... Extremely high performance of the mirror is expected with residual slope error smaller than 0.6 μrad, peak-to-valley, compared to the bent slope of 3000 μrad.

  6. PGen: large-scale genomic variations analysis workflow and browser in SoyKB.

    Science.gov (United States)

    Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti

    2016-10-06

    With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most

  7. A BanI RFLP at a deletion hotspot in the human dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Read, A P; Mountford, R [St. Mary' s Hospital, Manchester (England)

    1990-01-25

    Cf56a is a 0.9 kb EcoRI fragment of dystrophin cDNA in pUC13. Cf56a is identical to Kunkel's cDNA probe 8. Constant bands of 14.4, 11.0, 8.1, 6.2 and 1.3 kb correspond to exons I, N, L, N and K respectively. The polymorphic band is exon J (exon 48, 1.2+3.9 kb HindIII bands). This exon is deleted in 25% of all Duchenne/Becker dystrophy boys. Therefore this RFLP is useful for determining carrier status of at-risk females by showing heterozygosity or apparent non-maternity.

  8. A BanI RFLP at a deletion hotspot in the human dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Read, A.P.; Mountford, R. (St. Mary' s Hospital, Manchester (England))

    1990-01-25

    Cf56a is a 0.9 kb EcoRI fragment of dystrophin cDNA in pUC13. Cf56a is identical to Kunkel's cDNA probe 8. Constant bands of 14.4, 11.0, 8.1, 6.2 and 1.3 kb correspond to exons I, N, L, N and K respectively. The polymorphic band is exon J (exon 48, 1.2+3.9 kb HindIII bands). This exon is deleted in 25% of all Duchenne/Becker dystrophy boys. Therefore this RFLP is useful for determining carrier status of at-risk females by showing heterozygosity or apparent non-maternity.

  9. Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

    Science.gov (United States)

    Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

    α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

  10. Mapping the end points of large deletions affecting the hprt locus in human peripheral blood cells and cell lines

    International Nuclear Information System (INIS)

    Nelson, S.L.; Grosovsky, A.J.; Jones, I.M.; Burkhart-Schultz, K.; Fuscoe, J.C.

    1995-01-01

    We have examined the extent of of HPRT - total gene deletions in three mutant collections: spontaneous and X-ray-induced deletions in TK6 human B lymphoblasts, and HPRT - deletions arising in vivo in T cells. A set of 13 Xq26 STS markers surrounding hprt and spanning approximately 3.3 Mb was used. Each marker used was observed to be missing in at least one of the hprt deletion mutants analyzed. The largest deletion observed encompassed at least 3 Mb. Nine deletions extended outside of the mapped region in the centromeric direction (>1.7 Mb). In contrast, only two telomeric deletions extended to marker 342R (1.26 Mb), and both exhibited slowed or limited cell growth. These data suggest the existence of a gene, within the vicinity of 342R, which establishes the telomeric limit of recoverable deletions. Most (25/41) X-ray-induced total gene deletion mutants exhibited marker loss, but only 1/8 of the spontaneous deletions encompassed any Xq26 markers (P = 0.0187). Furthermore, nearly half (3/8) of the spontaneous 3' total deletion breakpoints were within 14 kb of the hprt coding sequence. In contrast, 40/41 X-ray-induced HPRT - total deletions extended beyond this point (P = 0.011). Although the overall representation of total gene deletions in the in vivo spectrum is low, 4/5 encompass Xq26 markers flanking hprt. This pattern differs significantly from spontaneous HPRT - large deletions occurring in vitro (P = 0.032) but resembles the spectrum of X-ray-induced deletions. 24 refs., 6 figs., 1 tab

  11. SAFOD Brittle Microstructure and Mechanics Knowledge Base (BM2KB)

    Science.gov (United States)

    Babaie, Hassan A.; Broda Cindi, M.; Hadizadeh, Jafar; Kumar, Anuj

    2013-07-01

    Scientific drilling near Parkfield, California has established the San Andreas Fault Observatory at Depth (SAFOD), which provides the solid earth community with short range geophysical and fault zone material data. The BM2KB ontology was developed in order to formalize the knowledge about brittle microstructures in the fault rocks sampled from the SAFOD cores. A knowledge base, instantiated from this domain ontology, stores and presents the observed microstructural and analytical data with respect to implications for brittle deformation and mechanics of faulting. These data can be searched on the knowledge base‧s Web interface by selecting a set of terms (classes, properties) from different drop-down lists that are dynamically populated from the ontology. In addition to this general search, a query can also be conducted to view data contributed by a specific investigator. A search by sample is done using the EarthScope SAFOD Core Viewer that allows a user to locate samples on high resolution images of core sections belonging to different runs and holes. The class hierarchy of the BM2KB ontology was initially designed using the Unified Modeling Language (UML), which was used as a visual guide to develop the ontology in OWL applying the Protégé ontology editor. Various Semantic Web technologies such as the RDF, RDFS, and OWL ontology languages, SPARQL query language, and Pellet reasoning engine, were used to develop the ontology. An interactive Web application interface was developed through Jena, a java based framework, with AJAX technology, jsp pages, and java servlets, and deployed via an Apache tomcat server. The interface allows the registered user to submit data related to their research on a sample of the SAFOD core. The submitted data, after initial review by the knowledge base administrator, are added to the extensible knowledge base and become available in subsequent queries to all types of users. The interface facilitates inference capabilities in the

  12. The clinical significance of HER-2 and NF-KB expression in gastric cancer.

    Science.gov (United States)

    Li, Xiaogai; Tu, Jiancheng; Zhang, Di; Xu, Zhigao; Yang, Guifang; Gong, Lingling; Yu, Mingxia

    2013-09-01

    To investigate the expression of human epidermal growth factor 2 (HER-2) and Nuclear factor-Kb (NF-KB) in gastric cancer, and the relation of these two parameters with stage, grade and metastasis of gastric cancer. The serum level of HER-2 in 75 gastric cancer patients and control participants were determined by enzyme-linked immunosorbent assay (ELISA) kits. Expression of HER-2 and NF-KB protein were detected by immunohistochemical staining (SP method) of paraffin-embedded tissues in 75 tumors (observed group) and 22 normal gastric specimens. The clinical pathological data was statistically analyzed. Serum HER-2 level were significantly increased in study group compared with those in the control group (pKB in the observed group was 24.00% (18/75) and 62.67% (47/75) respectively. The expression of HER-2 and NF-KB were not correlated with age and gender, but with stage, grade and metastasis (pKB was correlated with tumor size (pKB had a positive rate of 94.44% (17/18), but a positive rate of 52.63% (30/57) when HER-2 was negative. Expression of NF-KB in gastric cancer tissue was correlated with HER-2 expression (X2 = 8.514, pKB in gastric cancer tissue is correlated with HER-2 expression, and they may play a very important role in the progress of gastric cancer.

  13. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    Science.gov (United States)

    Doherty, Ben; Lawlor, Denise; Gillet, Jean-Pierre; Gottesman, Michael; O'Leary, John J; Stordal, Britta

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer. A Taqman low-density array was used to characterize the expression of 380 genes previously associated with chemoresistance. Identified pathways were further analyzed using cytotoxicity assays, metabolomics and western blots. KB-8-5-11 cells were sensitive to CuSO4 and the glutathione inhibitor buthionine sulphoximine. Expression of ATPase, Cu(2+) transporting alpha (ATP7A) and ATP7B were decreased at the protein and gene levels respectively in KB-8-5-11. KB-8-5-11 had decreased gene expression of glutathione S-transferase pi 1 (GSTP1), GSTA4 and GSTK1. Cisplatin treatment significantly lowered total cellular glutathione in parental KB-3-1 cells. Glutathione also tended to be lower in KB-8-5-11 cells compared to KB-3-1 cells. KB-8-5-11 cells have alterations in their copper transporters and glutathione metabolism, contributing to their cisplatin-sensitive phenotype.

  14. WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma

    NARCIS (Netherlands)

    Stec, I.; Wright, T. J.; van Ommen, G. J.; de Boer, P. A.; van Haeringen, A.; Moorman, A. F.; Altherr, M. R.; den Dunnen, J. T.

    1998-01-01

    Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4 (4p16.3). The smallest region of overlap between WHS patients, the WHS critical region, has been confined to 165 kb, of which the complete sequence is known. We

  15. Identification of a 3.0-kb Major Recombination Hotspot in Patients with Sotos Syndrome Who Carry a Common 1.9-Mb Microdeletion

    Science.gov (United States)

    Visser, Remco; Shimokawa, Osamu; Harada, Naoki; Kinoshita, Akira; Ohta, Tohru; Niikawa, Norio; Matsumoto, Naomichi

    2005-01-01

    Sotos syndrome (SoS) is a congenital dysmorphic disorder characterized by overgrowth in childhood, distinctive craniofacial features, and mental retardation. Haploinsufficiency of the NSD1 gene owing to either intragenic mutations or microdeletions is known to be the major cause of SoS. The common ∼2.2-Mb microdeletion encompasses the whole NSD1 gene and neighboring genes and is flanked by low-copy repeats (LCRs). Here, we report the identification of a 3.0-kb major recombination hotspot within these LCRs, in which we mapped deletion breakpoints in 78.7% (37/47) of patients with SoS who carry the common microdeletion. The deletion size was subsequently refined to 1.9 Mb. Sequencing of breakpoint fragments from all 37 patients revealed junctions between a segment of the proximal LCR (PLCR-B) and the corresponding region of the distal LCR (DLCR-2B). PLCR-B and DLCR-2B are the only directly oriented regions, whereas the remaining regions of the PLCR and DLCR are in inverted orientation. The PLCR, with a size of 394.0 kb, and the DLCR, with a size of of 429.8 kb, showed high overall homology (∼98.5%), with an increased sequence similarity (∼99.4%) within the 3.0-kb breakpoint cluster. Several recombination-associated motifs were identified in the hotspot and/or its vicinity. Interestingly, a 10-fold average increase of a translin motif, as compared with the normal distribution within the LCRs, was recognized. Furthermore, a heterozygous inversion of the interval between the LCRs was detected in all fathers of the children carrying a deletion in the paternally derived chromosome. The functional significance of these findings remains to be elucidated. Segmental duplications of the primate genome play a major role in chromosomal evolution. Evolutionary study showed that the duplication of the SoS LCRs occurred 23.3–47.6 million years ago, before the divergence of Old World monkeys. PMID:15580547

  16. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    LENUS (Irish Health Repository)

    Doherty, Ben

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer.

  17. KB WOT Fisheries 2018: maintaining excellence and innovation in fisheries research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and develop expertise needed to carry out the Dutch statutory obligations in fisheries monitoring and advice. The KB WOT Fisheries programme developed for 2018 reflects the scientific and management needs of the WOT fisheries programme. The

  18. KB WOT Fisheries 2014 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2013-01-01

    The KB WOT Fisheries programme is fundamental to the maintenance and development of expertise needed to carry out the statutory obligations of the Dutch WOT Fisheries monitoring and advice. The structure of the KB WOT Fisheries programme 2014 is a result of discussions on the research direction and

  19. KB WOT Fisheries 2015 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2015-01-01

    The KB WOT Fisheries programme is essential to the maintenance and development of the expertise which are needed for the Dutch statutory obligations in fisheries monitoring and advice. The contents of the KB WOT Fisheries programme for 2015 reflects the needs of the research developments the WOT

  20. Microarray-based ultra-high resolution discovery of genomic deletion mutations

    Science.gov (United States)

    2014-01-01

    Background Oligonucleotide microarray-based comparative genomic hybridization (CGH) offers an attractive possible route for the rapid and cost-effective genome-wide discovery of deletion mutations. CGH typically involves comparison of the hybridization intensities of genomic DNA samples with microarray chip representations of entire genomes, and has widespread potential application in experimental research and medical diagnostics. However, the power to detect small deletions is low. Results Here we use a graduated series of Arabidopsis thaliana genomic deletion mutations (of sizes ranging from 4 bp to ~5 kb) to optimize CGH-based genomic deletion detection. We show that the power to detect smaller deletions (4, 28 and 104 bp) depends upon oligonucleotide density (essentially the number of genome-representative oligonucleotides on the microarray chip), and determine the oligonucleotide spacings necessary to guarantee detection of deletions of specified size. Conclusions Our findings will enhance a wide range of research and clinical applications, and in particular will aid in the discovery of genomic deletions in the absence of a priori knowledge of their existence. PMID:24655320

  1. Exploration of methods to localize DNA sequences missing from c-locus deletions

    International Nuclear Information System (INIS)

    Albritton, L.M.; Russell, L.B.; Montgomery, C.S.

    1987-01-01

    The authors have earlier characterized a large number of radiation-induced mutations at the c locus (on Chromosome 7) through genetic analysis, including extensive complementation tests. Based on this work, they have postulated that many of these mutations are deletions of various lengths, overlapping at c (the marker used in the mutation-rate experiments that generated the mutants). It was possible to apportion these deletions among 13 complementation groups and to fit them to a linear map of 8 functional units. Collectively, the deletions extend from a point between tp and c to one between sh-1 and Hbb, i.e., a genetic distance of from 6 to 10 cM, corresponding to at least 10 4 Kb of DNA. This year, the authors completed a pilot study designed to explore methods for finding DNA sequences that map to the region covered by the various c-deletions. The general plan was to probe DNA with clones derived from Chromosome-7-enriched libraries or with sequences known (or suspected) to reside in Chromosome 7. Three methods were explored for deriving the c-region-deficient DNA: (a) from mouse-hamster somatic-cell hydrids retaining a deleted mouse Chromosome 7, but no homologue; (b) from F 1 hybrids of M. musculus domesticus (carrying a c-locus deletion) by M. spretus; and (c) from F 1 hybrids of M. domesticus stocks carrying complementing deletions

  2. Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

    Science.gov (United States)

    Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

    2014-01-01

    The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

  3. Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

    Science.gov (United States)

    Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

    2014-08-01

    The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Hungarian Marfan family with large FBN1 deletion calls attention to copy number variation detection in the current NGS era

    Science.gov (United States)

    Ágg, Bence; Meienberg, Janine; Kopps, Anna M.; Fattorini, Nathalie; Stengl, Roland; Daradics, Noémi; Pólos, Miklós; Bors, András; Radovits, Tamás; Merkely, Béla; De Backer, Julie; Szabolcs, Zoltán; Mátyás, Gábor

    2018-01-01

    Copy number variations (CNVs) comprise about 10% of reported disease-causing mutations in Mendelian disorders. Nevertheless, pathogenic CNVs may have been under-detected due to the lack or insufficient use of appropriate detection methods. In this report, on the example of the diagnostic odyssey of a patient with Marfan syndrome (MFS) harboring a hitherto unreported 32-kb FBN1 deletion, we highlight the need for and the feasibility of testing for CNVs (>1 kb) in Mendelian disorders in the current next-generation sequencing (NGS) era. PMID:29850152

  5. Deletions of a differentially methylated CpG island at SNRPN define a putative imprinting control region

    Energy Technology Data Exchange (ETDEWEB)

    Sutcliffe, J.S.,; Nakao, M.; Beaudet, A.L. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are associated with paternal and maternal deficiencies, respectively, of gene expression within human chromosome 15q11-q13, and are caused by deletion, uniparental disomy, or other mutations. Four transcripts designated PAR-5, PAR-7, PAR-1 and PAR-4 were isolated and localized to a region within 300 kb telomeric to the gene encoding small nuclear ribonucleoprotein-associated polypeptide N (SNRPN). Analysis of the transcripts in cultured fibroblasts and lymphoblasts from deletion patients demonstrated that SNRPN, PAR-5 and PAR-1 are expressed exclusively from the paternal chromosome, defining an imprinted domain that spans at least 200 kb. All three imprinted transcripts were absent in cells from three PWS patients (one pair of sibs and one sporadic case) with small deletions that involve a differentially methylated CpG island containing a previously undescribed 5{prime} untranslated exon ({alpha}) of SNRPN. Methylation of the CpG island is specific for the maternal chromosome consistent with paternal expression of the imprinted domain. One deletion, which is benign when maternally transmitted, extends upstream <30 kb from the CpG island, and is associated with altered methylation centromeric to SNRPN, and loss of transcription telomeric to SNRPN, implying the presence of an imprinting control region around the CpG island containing exon {alpha}.

  6. Deletion 1q43 encompassing only CHRM3 in a patient with autistic disorder.

    Science.gov (United States)

    Petersen, Andrea Klunder; Ahmad, Ausaf; Shafiq, Mustafa; Brown-Kipphut, Brigette; Fong, Chin-To; Anwar Iqbal, M

    2013-02-01

    Deletions on the distal portion of the long arm of chromosome 1 result in complex and highly variable clinical phenotypes which include intellectual disability, autism, seizures, microcephaly/craniofacial dysmorphology, corpus callosal agenesis/hypogenesis, cardiac and genital anomalies, hand and foot abnormalities and short stature. Genotype-phenotype correlation reported a minimum region of 2 Mb at 1q43-q44. We report on a 3 ½ year old male patient diagnosed with autistic disorder who has social withdrawal, eating problems, repetitive stereotypic behaviors including self-injurious head banging and hair pulling, and no seizures, anxiety, or mood swings. Array comparative genomic hybridization (aCGH) showed an interstitial deletion of 473 kb at 1q43 region (239,412,391-239,885,394; NCBI build37/hg19) harboring only CHRM3 (Acetylcholine Receptor, Muscarinic, 3; OMIM: 118494). Recently, another case with a de novo interstitial deletion of 911 kb at 1q43 encompassing three genes including CHRM3 was reported. The M3 muscarinic receptor influences a multitude of central and peripheral nervous system processes via its interaction with acetylcholine and may be an important modulator of behavior, learning and memory. We propose CHRM3 as a candidate gene responsible for our patient's specific phenotype as well as the overlapping phenotypic features of other patients with 1q43 or 1q43-q44 deletions. Copyright © 2013. Published by Elsevier Masson SAS.

  7. Radiative transfer in disc galaxies - V. The accuracy of the KB approximation

    Science.gov (United States)

    Lee, Dukhang; Baes, Maarten; Seon, Kwang-Il; Camps, Peter; Verstocken, Sam; Han, Wonyong

    2016-12-01

    We investigate the accuracy of an approximate radiative transfer technique that was first proposed by Kylafis & Bahcall (hereafter the KB approximation) and has been popular in modelling dusty late-type galaxies. We compare realistic galaxy models calculated with the KB approximation with those of a three-dimensional Monte Carlo radiative transfer code SKIRT. The SKIRT code fully takes into account of the contribution of multiple scattering whereas the KB approximation calculates only single scattered intensity and multiple scattering components are approximated. We find that the KB approximation gives fairly accurate results if optically thin, face-on galaxies are considered. However, for highly inclined (I ≳ 85°) and/or optically thick (central face-on optical depth ≳1) galaxy models, the approximation can give rise to substantial errors, sometimes, up to ≳40 per cent. Moreover, it is also found that the KB approximation is not always physical, sometimes producing infinite intensities at lines of sight with high optical depth in edge-on galaxy models. There is no `simple recipe' to correct the errors of the KB approximation that is universally applicable to any galaxy models. Therefore, it is recommended that the full radiative transfer calculation be used, even though it is slower than the KB approximation.

  8. Establishment and characterization of arsenic trioxide resistant KB/ATO cells.

    Science.gov (United States)

    Zhang, Yun-Kai; Dai, Chunling; Yuan, Chun-Gang; Wu, Hsiang-Chun; Xiao, Zhijie; Lei, Zi-Ning; Yang, Dong-Hua; Le, X Chris; Fu, Liwu; Chen, Zhe-Sheng

    2017-09-01

    Arsenic trioxide (ATO) is used as a chemotherapeutic agent for the treatment of acute promyelocytic leukemia. However, increasing drug resistance is reducing its efficacy. Therefore, a better understanding of ATO resistance mechanism is required. In this study, we established an ATO-resistant human epidermoid carcinoma cell line, KB/ATO, from its parental KB-3-1 cells. In addition to ATO, KB/ATO cells also exhibited cross-resistance to other anticancer drugs such as cisplatin, antimony potassium tartrate, and 6-mercaptopurine. The arsenic accumulation in KB/ATO cells was significantly lower than that in KB-3-1 cells. Further analysis indicated that neither application of P-glycoprotein inhibitor, breast cancer resistant protein (BCRP) inhibitor, or multidrug resistance protein 1 (MRP1) inhibitor could eliminate ATO resistance. We found that the expression level of ABCB6 was increased in KB/ATO cells. In conclusion, ABCB6 could be an important factor for ATO resistance in KB/ATO cells. The ABCB6 level may serve as a predictive biomarker for the effectiveness of ATO therapy.

  9. An extensive deletion causing overproduction of yeast iso-2-cytochrome c

    International Nuclear Information System (INIS)

    McKnight, G.L.; Cardillo, T.S.; Sherman, F.

    1981-01-01

    CYC7-H3 is a cis-dominant regulatory mutation that causes a 20-fold overproduction of yeast iso-2-cytochrome c. The CYC7-H3 mutation is an approximately 5 kb deletion with one breakpoint located in the 5' noncoding region of the CYC7 gene, approximately 200 base from the ATG initiation codon. The deletion apparently fuses a new regulatory region to the structural portion of the CYC7 locus. The CYC7-H3 deletion encompasses the RAD23 locus, which controls UV sensitivity and the ANP1 locus, which controls osmotic sensitivity. The gene cluster CYC7-RAD23-ANP1 displays striking similarity to the gene cluster CYC1-OSM1-RAD7, which controls, respectively, iso-1-cytochrome c, osmotic sensitivity and UV sensitivity. We suggest that these gene clusters are related by an ancient transpositional event

  10. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  11. KB425796-A, a novel antifungal antibiotic produced by Paenibacillus sp. 530603.

    Science.gov (United States)

    Kai, Hirohito; Yamashita, Midori; Takase, Shigehiro; Hashimoto, Michizane; Muramatsu, Hideyuki; Nakamura, Ikuko; Yoshikawa, Koji; Ezaki, Masami; Nitta, Kumiko; Watanabe, Masato; Inamura, Noriaki; Fujie, Akihiko

    2013-08-01

    The novel antifungal macrocyclic lipopeptidolactone, KB425796-A (1), was isolated from the fermentation broth of bacterial strain 530603, which was identified as a new Paenibacillus species based on morphological and physiological characteristics, and 16S rRNA sequences. KB425796-A (1) was isolated as white powder by solvent extraction, HP-20 and ODS-B column chromatography, and lyophilization, and was determined to have the molecular formula C79H115N19O18. KB425796-A (1) showed antifungal activities against Aspergillus fumigatus and the micafungin-resistant infectious fungi Trichosporon asahii, Rhizopus oryzae, Pseudallescheria boydii and Cryptococcus neoformans.

  12. Large Genomic Deletions in CACNA1A Cause Episodic Ataxia Type 2

    Directory of Open Access Journals (Sweden)

    Jijun eWan

    2011-09-01

    Full Text Available Episodic ataxia (EA syndromes are heritable diseases characterized by dramatic episodes of imbalance and incoordination. Episodic ataxia type 2 (EA2, the most common and the best characterized subtype, is caused by mostly nonsense, splice site, small indel and sometimes missense mutations in CACNA1A. Direct sequencing of CACNA1A fails to identify mutations in some patients with EA2-like features, possibly due to incomplete interrogation of CACNA1A or defects in other EA genes not yet defined. Previous reports described genomic deletions between 4-40kb in EA2. In 47 subjects with EA (26 with EA2-like features who tested negative for mutations in the known EA genes, we used Multiplex Ligation-dependent Probe Amplification (MLPA to analyze CACNA1A for exonic copy number variations. Breakpoints were further defined by long-range PCR. We identified distinct multi-exonic deletions in three probands with classic EA2-like features: episodes of prolonged vertigo and ataxia triggered by stress and fatigue, interictal nystagmus, with onset during infancy or early childhood. The breakpoints in all three probands are located in Alu sequences, indicating errors in homologous recombination of Alu sequences as the underlying mechanism. The smallest deletion spanned exons 39 and 40, while the largest deletion spanned 200kb, missing all but the first three exons. One deletion involving exons 39 through 47 arose spontaneously. The search for mutations in CACNA1A appears most fruitful in EA patients with interictal nystagmus and onset early in life. The finding of large heterozygous deletions suggests haploinsufficiency as a possible pathomechanism of EA2.

  13. P450XXI (steroid 21-hydroxylase) gene deletions are not found in family studies of congenital adrenal hyperplasia

    International Nuclear Information System (INIS)

    Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.

    1987-01-01

    Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase)], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions

  14. Identification and characterization of large DNA deletions affecting oil quality traits in soybean seeds through transcriptome sequencing analysis.

    Science.gov (United States)

    Goettel, Wolfgang; Ramirez, Martha; Upchurch, Robert G; An, Yong-Qiang Charles

    2016-08-01

    Identification and characterization of a 254-kb genomic deletion on a duplicated chromosome segment that resulted in a low level of palmitic acid in soybean seeds using transcriptome sequencing. A large number of soybean genotypes varying in seed oil composition and content have been identified. Understanding the molecular mechanisms underlying these variations is important for breeders to effectively utilize them as a genetic resource. Through design and application of a bioinformatics approach, we identified nine co-regulated gene clusters by comparing seed transcriptomes of nine soybean genotypes varying in oil composition and content. We demonstrated that four gene clusters in the genotypes M23, Jack and N0304-303-3 coincided with large-scale genome rearrangements. The co-regulated gene clusters in M23 and Jack mapped to a previously described 164-kb deletion and a copy number amplification of the Rhg1 locus, respectively. The coordinately down-regulated gene clusters in N0304-303-3 were caused by a 254-kb deletion containing 19 genes including a fatty acyl-ACP thioesterase B gene (FATB1a). This deletion was associated with reduced palmitic acid content in seeds and was the molecular cause of a previously reported nonfunctional FATB1a allele, fap nc . The M23 and N0304-304-3 deletions were located in duplicated genome segments retained from the Glycine-specific whole genome duplication that occurred 13 million years ago. The homoeologous genes in these duplicated regions shared a strong similarity in both their encoded protein sequences and transcript accumulation levels, suggesting that they may have conserved and important functions in seeds. The functional conservation of homoeologous genes may result in genetic redundancy and gene dosage effects for their associated seed traits, explaining why the large deletion did not cause lethal effects or completely eliminate palmitic acid in N0304-303-3.

  15. On Deletion of Sutra Translation

    Institute of Scientific and Technical Information of China (English)

    CHEN Shu-juan

    2017-01-01

    Dao An's the metaphor of translation "wine diluted with water' ' expressed a view about translation that had been abridged.Later Kumarajiva provided metaphor "rice chewed—tasteless and downright disgusting".Both of them felt regretted at the weakening of taste,sometimes even the complete loss of flavor caused by deletion in translation of Buddhist sutras.In early sutra translation,deletion is unavoidable which made many sutra translators felt confused and drove them to study it further and some even managed to give their understanding to this issue.This thesis will discuss the definition,and what causes deletion and the measures adopted by the sutra translators.

  16. Analysis of employee benefits in Factoring KB, a.s.v

    OpenAIRE

    Vachoušek, Stanislav

    2011-01-01

    The main objective of this work is to analyze employee benefits - benefits of Factoring KB, a.s. The theoretical part of the generally specifies the basic concepts related to employee benefits needed to cope with the analytical part. The content of this section is primarily a system of employee benefits, classification of employee benefits, tax savings and marginally trends in providing benefits. The analytical part is devoted exclusively to Factoring KB, there is an analysis of employee bene...

  17. Paradoxical effects of KB-R7943 on arrhythmogenicity in a chronic myocardial infarction rabbit model.

    Science.gov (United States)

    Chang, Po-Cheng; Wo, Hung-Ta; Lee, Hui-Ling; Wen, Ming-Shien; Chou, Chung-Chuan

    2015-07-01

    Na(+)/Ca(2+) exchanger blockade has been reported to be anti-arrhythmic in different models. The effects of KB-R7943, a Na(+)/Ca(2+) exchanger blocker, on arrhythmogenesis in hearts with chronic myocardial infarction (MI) remain unclear. Dual voltage and intracellular Ca(2+) (Cai) optical mapping was performed in nine rabbit hearts with chronic MI and four control hearts. Electrophysiology studies including inducibility of ventricular tachyarrhythmias, ventricular fibrillation dominant frequency, action potential, Cai alternans, Cai decay, and conduction velocity were performed. The same protocol was repeated in the presence of KB-R7943 (0.5, 1, and 5μM) after the baseline studies. KB-R7943 was effective in suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias in hearts with chronic MI. Surprisingly, KB-R7943 increased the inducibility of ventricular tachyarrhythmias in a dose-dependent manner (11%, 11%, 22%, and 56% at baseline and with 0.5, 1, and 5μM KB-R7943, respectively, p=0.02). Optical mapping analysis revealed that the underlying mechanisms of the induced ventricular tachyarrhythmias were probably spatially discordant alternans with wave breaks and rotors. Further analysis showed that KB-R7943 significantly enhanced both action potential (p=0.033) and Cai (p=0.001) alternans, prolonged Cai decay (tau value) in a dose-dependent manner (p=0.004), and caused heterogeneous conduction delay especially at peri-infarct zones during rapid burst pacing. In contrast, KB-R7943 had insignificant effects in control hearts. In this chronic MI rabbit model, KB-R7943 has contrasting effects on arrhythmogenesis, suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias, but enhancing the inducibility of tachyarrhythmias. The mechanism is probably the enhanced spatially discordant alternans because of prolonged Cai decay and heterogeneous conduction delay. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier

  18. Capsaicin induces cell cycle arrest and apoptosis in human KB cancer cells.

    Science.gov (United States)

    Lin, Chia-Han; Lu, Wei-Cheng; Wang, Che-Wei; Chan, Ya-Chi; Chen, Mu-Kuan

    2013-02-25

    Capsaicin, a pungent phytochemical in a variety of red peppers of the genus Capsicum, has shown an anti-proliferative effect on various human cancer cell lines. In contrast, capsaicin has also been considered to promote the growth of cancer cells. Thus, the effects of capsaicin on various cell types need to be explored. The anti-proliferative effects of capsaicin on human KB cancer cells are still unknown. Therefore, we examined the viability, cell cycle progression, and factors associated with apoptosis in KB cells treated with capsaicin. The cell proliferation/viability and cytotoxicity of KB cells exposed to capsaicin were determined by a sulforhodamine B colorimetric assay and trypan blue exclusion. Apoptosis was detected by Hoechst staining and confirmed by western blot analysis of poly-(ADP-ribose) polymerase cleavage. Cell cycle distribution and changes of the mitochondrial membrane potential were analyzed by flow cytometry. Furthermore, the expression of caspase 3, 8 and 9 was evaluated by immunoblotting. We found that treatment of KB cells with capsaicin significantly reduced cell proliferation/viability and induced cell death in a dose-dependent manner compared with that in the untreated control. Cell cycle analysis indicated that exposure of KB cells to capsaicin resulted in cell cycle arrest at G2/M phase. Capsaicin-induced growth inhibition of KB cells appeared to be associated with induction of apoptosis. Moreover, capsaicin induced disruption of the mitochondrial membrane potential as well as activation of caspase 9, 3 and poly-(ADP-ribose) polymerase in KB cells. Our data demonstrate that capsaicin modulates cell cycle progression and induces apoptosis in human KB cancer cells through mitochondrial membrane permeabilization and caspase activation. These observations suggest an anti-cancer activity of capsaicin.

  19. Physical mapping of chromosome 8p22 markers and their homozygous deletion in a metastatic prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bova, G.S.; Pin, S.S.; Isaacs, W.B. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)]|[Brady Urological Institute, Baltimore, MD (United States)] [and others

    1996-07-01

    Numerous studies have implicated the short arm of chromosome 8 as the site of one or more tumor suppressor genes inactivated in carcinogenesis of the prostate, colon, lung, and liver. Previously, we identified a homozygous deletion on chromosome 8p22 in a metastatic prostate cancer. To map this homozygous deletion physically, long-range restriction mapping was performed using yeast artificial chromosomes (YACs) spanning approximately 2 Mb of chromosome band 8p22. Subcloned genomic DNA and cDNA probes isolated by hybrid capture from these YACs were mapped in relation to one another, reinforcing map integrity. Mapped single-copy probes from the region were then applied to DNA isolated from a metastatic prostate cancer containing a chromosome 8p22 homozygous deletion and indicated that its deletion spans 730-970 kb. Candidate genes PRLTS (PDGF-receptor {beta}-like tumor suppressor) and CTSB (cathepsin B) are located outside the region of homozygous deletion. Genethon marker D8S549 is located approximately at the center of this region of homozygous deletion. Two new microsatellite polymorphisms, D8S1991 and D8S1992, also located within the region of homozygous deletion on chromosome 8p22, are described. Physical mapping places cosmid CI8-2644 telomeric to MSR (macrophage scavenger receptor), the reverse of a previously published map, altering the interpretation of published deletion studies. This work should prove helpful in the identification of candidate tumor suppressor genes in this region. 47 refs., 5 figs., 1 tab.

  20. The UniProtKB/Swiss-Prot knowledgebase and its Plant Proteome Annotation Program.

    Science.gov (United States)

    Schneider, Michel; Lane, Lydie; Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Bougueleret, Lydie; Bairoch, Amos

    2009-04-13

    The UniProt knowledgebase, UniProtKB, is the main product of the UniProt consortium. It consists of two sections, UniProtKB/Swiss-Prot, the manually curated section, and UniProtKB/TrEMBL, the computer translation of the EMBL/GenBank/DDBJ nucleotide sequence database. Taken together, these two sections cover all the proteins characterized or inferred from all publicly available nucleotide sequences. The Plant Proteome Annotation Program (PPAP) of UniProtKB/Swiss-Prot focuses on the manual annotation of plant-specific proteins and protein families. Our major effort is currently directed towards the two model plants Arabidopsis thaliana and Oryza sativa. In UniProtKB/Swiss-Prot, redundancy is minimized by merging all data from different sources in a single entry. The proposed protein sequence is frequently modified after comparison with ESTs, full length transcripts or homologous proteins from other species. The information present in manually curated entries allows the reconstruction of all described isoforms. The annotation also includes proteomics data such as PTM and protein identification MS experimental results. UniProtKB and the other products of the UniProt consortium are accessible online at www.uniprot.org.

  1. FragKB: structural and literature annotation resource of conserved peptide fragments and residues.

    Directory of Open Access Journals (Sweden)

    Ashish V Tendulkar

    Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.

  2. [Effects of metformin on human oral cancer KB cell proliferation and apoptosis in vitro].

    Science.gov (United States)

    Wang, Fang; Xu, Jincheng; Xia, Fei; Liu, Zhe; Zhao, Surong; Liu, Hao; Jiang, Zhiwen

    2014-02-01

    To investigate the effects of metformin on the proliferation and apoptosis of human oral cancer cell line KB in vitro. Human oral cancer cell line KB was exposed to different doses of metformin (0, 1.25, 2.5, 5, 10, and 20 mmol/L), and the changes in cell viability were detected using MTT assay. Colony formation of the cells was observed following an 8-day metformin exposure. The changes in mitochondrial membrane potential were measured by JC-1 assay, and PI staining was used to observe the cell apoptosis. Western blotting was employed to detect the changes in the protein expressions of GRP78 and activated caspase-3. Metformin exposure caused time- and dose-dependent suppression of KB cell proliferation, and exposure to 5 mmol/L metformin for 24, 48 and 72 h resulted in cell survival rates of 68.0%, 36.9%, and 14.5%, respectively. Metformin significantly inhibited KB cell colony formation. Exposure of the cells to increased concentrations of metformin gradually increased the apoptotic rate and decreased mitochondrial membrane potential. Metformin caused an initial up-regulation followed by a down-regulation of GRP78 expression in KB cells and increased the expression of activated caspase-3. Metformin can inhibit the proliferation and induce apoptosis of KB cells, the mechanism of which may involve the activation of the mitochondrial apoptotic pathway and endoplasmic reticulum stress.

  3. Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements

    OpenAIRE

    Whibley, Annabel; Urquhart, Jill; Dore, Jonathan; Willatt, Lionel; Parkin, Georgina; Gaunt, Lorraine; Black, Graeme; Donnai, Dian; Raymond, F Lucy

    2010-01-01

    Monoamine oxidases (MAO-A and MAO-B) have a key role in the degradation of amine neurotransmitters, such as dopamine, norepinephrine and serotonin. We identified an inherited 240 kb deletion on Xp11.3–p11.4, which encompasses both monoamine oxidase genes but, unlike other published reports, does not affect the adjacent Norrie disease gene (NDP). The brothers who inherited the deletion, and thus have no monoamine oxidase function, presented with severe developmental delay, intermittent hypoton...

  4. A Population of Deletion Mutants and an Integrated Mapping and Exome-seq Pipeline for Gene Discovery in Maize

    Science.gov (United States)

    Jia, Shangang; Li, Aixia; Morton, Kyla; Avoles-Kianian, Penny; Kianian, Shahryar F.; Zhang, Chi; Holding, David

    2016-01-01

    To better understand maize endosperm filling and maturation, we used γ-irradiation of the B73 maize reference line to generate mutants with opaque endosperm and reduced kernel fill phenotypes, and created a population of 1788 lines including 39 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes. For molecular characterization of the mutants, we developed a novel functional genomics platform that combined bulked segregant RNA and exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. To exemplify the utility of the mutants and provide proof-of-concept for the bioinformatics platform, we present detailed characterization of line 937, an opaque mutant harboring a 6203 bp in-frame deletion covering six exons within the Opaque-1 gene. In addition, we describe mutant line 146 which contains a 4.8 kb intragene deletion within the Sugary-1 gene and line 916 in which an 8.6 kb deletion knocks out a Cyclin A2 gene. The publically available algorithm developed in this work improves the identification of causative deletions and its corresponding gaps within mapping peaks. This study demonstrates the utility of γ-irradiation for forward genetics in large nondense genomes such as maize since deletions often affect single genes. Furthermore, we show how this classical mutagenesis method becomes applicable for functional genomics when combined with state-of-the-art genomics tools. PMID:27261000

  5. Inhibition of the cardiac ATP-dependent potassium current by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Vornanen, Matti

    2014-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, in cardiomyocytes KB-R7943 also effectively blocks several K(+) currents including the delayed rectifier, IKr, and background inward rectifier, IK1. In the present study we analyze the effects of KB-R7943 on the ATP-dependent potassium current (IKATP) recorded by whole-cell patch-clamp in ventricular cardiomyocytes from a mammal (mouse) and a fish (crucian carp). IKATP was induced by external application of a mitochondrial uncoupler CCCP (3×10(-7) M) and internal perfusion of the cell with ATP-free pipette solution. A weakly inwardly rectifying current with a large outward component, recorded in the presence of CCCP, was blocked with 10(-5) M glibenclamide by 56.1±4.6% and 56.9±3.6% in crucian carp and mouse ventricular myocytes, respectively. In fish cardiomyocytes IKATP was blocked by KB-R7943 with an IC50 value of 3.14×10(-7) M, while in mammalian cells IC50 was 2.8×10(-6) M (PKB-R7943 inhibited CCCP-induced IKATP by 99.9±0.13% and 97.5±1.2% in crucian carp and mouse ventricular myocytes, respectively. In crucian carp the IKATP is about an order of magnitude more sensitive to KB-R7943 than the background IK1, but in mammals IKATP and IK1 are almost equally sensitive to KB-R7943. Therefore, the ability of KB-R7943 to block IKATP should be taken into account together with INCX inhibition when investigating possible cardioprotective effects of this compound. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    Science.gov (United States)

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  7. Deletions, Inversions, Duplications: Engineering of Structural Variants using CRISPR/Cas in Mice

    Directory of Open Access Journals (Sweden)

    Katerina Kraft

    2015-02-01

    Full Text Available Structural variations (SVs contribute to the variability of our genome and are often associated with disease. Their study in model systems was hampered until now by labor-intensive genetic targeting procedures and multiple mouse crossing steps. Here we present the use of CRISPR/Cas for the fast (10 weeks and efficient generation of SVs in mice. We specifically produced deletions, inversions, and also duplications at six different genomic loci ranging from 1.1 kb to 1.6 Mb with efficiencies up to 42%. After PCR-based selection, clones were successfully used to create mice via aggregation. To test the practicability of the method, we reproduced a human 500 kb disease-associated deletion and were able to recapitulate the human phenotype in mice. Furthermore, we evaluated the regulatory potential of a large genomic interval by deleting a 1.5 Mb fragment. The method presented permits rapid in vivo modeling of genomic rearrangements.

  8. A novel large deletion of the ICR1 region including H19 and putative enhancer elements.

    Science.gov (United States)

    Fryssira, Helen; Amenta, Stella; Kanber, Deniz; Sofocleous, Christalena; Lykopoulou, Evangelia; Kanaka-Gantenbein, Christina; Cerrato, Flavia; Lüdecke, Hermann-Josef; Bens, Susanne; Riccio, Andrea; Buiting, Karin

    2015-05-06

    Beckwith-Wiedemann syndrome (BWS) is a rare pediatric overgrowth disorder with a variable clinical phenotype caused by deregulation affecting imprinted genes in the chromosomal region 11p15. Alterations of the imprinting control region 1 (ICR1) at the IGF2/H19 locus resulting in biallelic expression of IGF2 and biallelic silencing of H19 account for approximately 10% of patients with BWS. The majority of these patients have epimutations of the ICR1 without detectable DNA sequence changes. Only a few patients were found to have deletions. Most of these deletions are small affecting different parts of the ICR1 differentially methylated region (ICR1-DMR) removing target sequences for CTCF. Only a very few deletions reported so far include the H19 gene in addition to the CTCF binding sites. None of these deletions include IGF2. A male patient was born with hypotonia, facial dysmorphisms and hypoglycemia suggestive of Beckwith-Wiedemann syndrome. Using methylation-specific (MS)-MLPA (Multiplex ligation-dependent probe amplification) we have identified a maternally inherited large deletion of the ICR1 region in a patient and his mother. The deletion results in a variable clinical expression with a classical BWS in the mother and a more severe presentation of BWS in her son. By genome-wide SNP array analysis the deletion was found to span ~100 kb genomic DNA including the ICR1DMR, H19, two adjacent non-imprinted genes and two of three predicted enhancer elements downstream to H19. Methylation analysis by deep bisulfite next generation sequencing revealed hypermethylation of the maternal allele at the IGF2 locus in both, mother and child, although IGF2 is not affected by the deletion. We here report on a novel large familial deletion of the ICR1 region in a BWS family. Due to the deletion of the ICR1-DMR CTCF binding cannot take place and the residual enhancer elements have access to the IGF2 promoters. The aberrant methylation (hypermethylation) of the maternal IGF2

  9. Strategies for state-dependent quantum deleting

    International Nuclear Information System (INIS)

    Song Wei; Yang Ming; Cao Zhuoliang

    2004-01-01

    A quantum state-dependent quantum deleting machine is constructed. We obtain a upper bound of the global fidelity on N-to-M quantum deleting from a set of K non-orthogonal states. Quantum networks are constructed for the above state-dependent quantum deleting machine when K=2. Our deleting protocol only involves a unitary interaction among the initial copies, with no ancilla. We also present some analogies between quantum cloning and deleting

  10. Large deletions play a minor but essential role in congenital coagulation factor VII and X deficiencies.

    Science.gov (United States)

    Rath, M; Najm, J; Sirb, H; Kentouche, K; Dufke, A; Pauli, S; Hackmann, K; Liehr, T; Hübner, C A; Felbor, U

    2015-01-01

    Congenital factor VII (FVII) and factor X (FX) deficiencies belong to the group of rare bleeding disorders which may occur in separate or combined forms since both the F7 and F10 genes are located in close proximity on the distal long arm of chromosome 13 (13q34). We here present data of 192 consecutive index cases with FVII and/or FX deficiency. 10 novel and 53 recurrent sequence alterations were identified in the F7 gene and 5 novel as well as 11 recurrent in the F10 gene including one homozygous 4.35 kb deletion within F7 (c.64+430_131-6delinsTCGTAA) and three large heterozygous deletions involving both the F7 and F10 genes. One of the latter proved to be cytogenetically visible as a chromosome 13q34 deletion and associated with agenesis of the corpus callosum and psychomotor retardation. Large deletions play a minor but essential role in the mutational spectrum of the F7 and F10 genes. Copy number analyses (e. g. MLPA) should be considered if sequencing cannot clarify the underlying reason of an observed coagulopathy. Of note, in cases of combined FVII/FX deficiency, a deletion of the two contiguous genes might be part of a larger chromosomal rearrangement.

  11. Genomic Deletion at 10q23 in Prostate Cancer: More Than PTEN Loss?

    Directory of Open Access Journals (Sweden)

    Raghavendra Tejo Karthik Poluri

    2018-06-01

    Full Text Available The PTEN gene encodes for the phosphatase and tensin homolog; it is a tumor suppressor gene that is among the most frequently inactivated genes throughout the human cancer spectrum. The most recent sequencing approaches have allowed the identification of PTEN genomic alterations, including deletion, mutation, or rearrangement in about 50% of prostate cancer (PCa cases. It appears that mechanisms leading to PTEN inactivation are cancer-specific, comprising gene mutations, small insertions/deletions, copy number alterations (CNAs, promoter hypermethylation, and RNA interference. The examination of publicly available results from deep-sequencing studies of various cancers showed that PCa appears to be the only cancer in which PTEN is lost mostly through CNA. Instead of inactivating mutations, which are seen in other cancers, deletion of the 10q23 locus is the most common form of PTEN inactivation in PCa. By investigating the minimal deleted region at 10q23, several other genes appear to be lost simultaneously with PTEN. Expression data indicate that, like PTEN, these genes are also downregulated upon loss of 10q23. These analyses raise the possibility that 10q23 is lost upon selective pressure not only to inactivate PTEN but also to impair the expression of surrounding genes. As such, several genes from this deleted region, which represents about 500 kb, may also act as tumor suppressors in PCa, requiring further studies on their respective functions in that context.

  12. SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

    Science.gov (United States)

    Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

    2007-11-01

    Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

  13. Novel deletion alleles carrying CYP21A1P/A2 chimeric genes in Brazilian patients with 21-hydroxylase deficiency

    Directory of Open Access Journals (Sweden)

    Guerra-Júnior Gil

    2010-06-01

    Full Text Available Abstract Background Congenital adrenal hyperplasia due to 21-hydroxylase deficiency is caused by deletions, large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes for putative serine/threonine Kinase RP, complement C4, steroid 21-hydroxylase CYP21 tenascin TNX, normally, in a duplicated cluster known as RCCX module. The CYP21 extra copy is a pseudogene (CYP21A1P. In Brazil, 30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles. Such alleles are considered to result from unequal crossovers within the bimodular C4/CYP21 locus. Depending on the localization of recombination breakpoint, different alleles can be generated conferring the locus high degree of allelic variability. The purpose of the study was to investigate the variability of deleted alleles in patients with 21-hydroxylase deficiency. Methods We used different techniques to investigate the variability of 30-kb deletion alleles in patients with 21-hydroxylase deficiency. Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR and MLPA analyses followed by sequencing to refine the location of recombination breakpoints. Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. Results An allele carrying a CYP21A1P/A2 chimeric gene was found unusually associated to a C4B/C4A Taq I 6.4-kb fragment, generally associated to C4B and CYP21A1P deletions. A novel haplotype bearing both p.P34L and p.H62L, novel and rare mutations, respectively, was identified in exon 1, however p.P30L, the most frequent pseudogene-derived mutation in this exon, was absent. Four unrelated patients showed this haplotype. Absence of p.P34L in CYP21A1P of normal controls indicated that it is not derived from pseudogene. In addition, the combination of different

  14. ATLAS DQ2 Deletion Service

    International Nuclear Information System (INIS)

    Oleynik, Danila; Petrosyan, Artem; Garonne, Vincent; Campana, Simone

    2012-01-01

    The ATLAS Distributed Data Management project DQ2 is responsible for the replication, access and bookkeeping of ATLAS data across more than 100 distributed grid sites. It also enforces data management policies decided on by the collaboration and defined in the ATLAS computing model. The DQ2 Deletion Service is one of the most important DDM services. This distributed service interacts with 3rd party grid middleware and the DQ2 catalogues to serve data deletion requests on the grid. Furthermore, it also takes care of retry strategies, check-pointing transactions, load management and fault tolerance. In this paper special attention is paid to the technical details which are used to achieve the high performance of service, accomplished without overloading either site storage, catalogues or other DQ2 components. Special attention is also paid to the deletion monitoring service that allows operators a detailed view of the working system.

  15. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    OpenAIRE

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ?150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; r...

  16. Inhibition of the cardiac inward rectifier potassium currents by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Alekseeva, Eugenia I; Vornanen, Matti

    2013-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, KB-R7943 is shown to be a potent blocker of several ion currents including inward and delayed rectifier K(+) currents of cardiomyocytes. To further characterize KB-R7943 as a blocker of the cardiac inward rectifiers we compared KB-R7943 sensitivity of the background inward rectifier (IK1) and the carbacholine-induced inward rectifier (IKACh) currents in mammalian (Rattus norvegicus; rat) and fish (Carassius carassius; crucian carp) cardiac myocytes. The basal IK1 of ventricular myocytes was blocked with apparent IC50-values of 4.6×10(-6) M and 3.5×10(-6) M for rat and fish, respectively. IKACh was almost an order of magnitude more sensitive to KB-R7943 than IK1 with IC50-values of 6.2×10(-7) M for rat and 2.5×10(-7) M for fish. The fish cardiac NCX current was half-maximally blocked at the concentration of 1.9-3×10(-6) M in both forward and reversed mode of operation. Thus, the sensitivity of three cardiac currents to KB-R7943 block increases in the order IK1~INCXrectifier potassium currents, in particular IKACh, should be taken into account when interpreting the data with this inhibitor from in vivo and in vitro experiments in both mammalian and fish models. © 2013.

  17. The redesigned Forensic Research/Reference on Genetics-knowledge base, FROG-kb.

    Science.gov (United States)

    Kidd, Kenneth K; Soundararajan, Usha; Rajeevan, Haseena; Pakstis, Andrew J; Moore, Katherine N; Ropero-Miller, Jeri D

    2018-03-01

    The Forensic Resource/Reference on Genetics-knowledge base (FROG-kb) web site was introduced in 2011 and in the five years since the previous publication ongoing research into how the database can better serve forensics has resulted in extensive redesign of the database interface and functionality. Originally designed as a prototype to support forensic use of single nucleotide polymorphisms (SNPs), FROG-kb provides a freely accessible web interface that facilitates forensic practice and can be useful for teaching and research. Based on knowledge gained through its use, the web interface has been redesigned for easier navigation through the multiple components. The site also has functional enhancements, extensive new documentation, and new reference panels of SNPs with new curated data. FROG-kb focuses on single nucleotide polymorphisms (SNPs) and provides reference population data for several published panels of individual identification SNPs (IISNPs) and several published panels of ancestry inference SNPs (AISNPs). For each of the various marker panels with reference population data, FROG-kb calculates random match probabilities (RMP) and relative likelihoods of ancestry for a user-entered genotype profile (either completely or partially specified). Example genotype profiles are available and the User's Manual presents interpretation guidelines for the calculations. The extensive documentation along with ongoing updates makes FROG-kb a comprehensive tool in facilitating use of SNPs in forensic practice and education. An overview of the new FROG-kb with examples and material explaining the results of its use are presented here. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Prenatal diagnosis of two fetuses with deletions of 8p23.1, critical region for congenital diaphragmatic hernia and heart defects.

    Science.gov (United States)

    Keitges, Elisabeth A; Pasion, Romela; Burnside, Rachel D; Mason, Carla; Gonzalez-Ruiz, Antonio; Dunn, Teresa; Masiello, Meredith; Gebbia, Joseph A; Fernandez, Carlos O; Risheg, Hiba

    2013-07-01

    Microdeletions of 8p23.1 are mediated by low copy repeats and can cause congenital diaphragmatic hernia (CDH) and cardiac defects. Within this region, point mutations of the GATA4 gene have been shown to cause cardiac defects. However, the cause of CDH in these deletions has been difficult to determine due to the paucity of mutations that result in CDH, the lack of smaller deletions to refine the region and the reduced penetrance of CDH in these large deletions. Mice deficient for one copy of the Gata4 gene have been described with CDH and heart defects suggesting mutations in Gata4 can cause the phenotype in mice. We report on the SNP microarray analysis on two fetuses with deletions of 8p23.1. The first had CDH and a ventricular septal defect (VSD) on ultrasonography and a family history of a maternal VSD. Microarray analysis detected a 127-kb deletion which included the GATA4 and NEIL2 genes which was inherited from the mother. The second fetus had an incomplete atrioventricular canal defect on ultrasonography. Microarray analysis showed a 315-kb deletion that included seven genes, GATA4, NEIL2, FDFT1, CTSB, DEFB136, DEFB135, and DEFB134. These results suggest that haploinsufficiency of the two genes in common within 8p23.1; GATA4 and NEIL2 can cause CDH and cardiac defects in humans. Copyright © 2013 Wiley Periodicals, Inc.

  19. Small regions of overlapping deletions on 6q26 in human astrocytic tumours identified using chromosome 6 tile path array CGH

    Science.gov (United States)

    Ichimura, Koichi; Mungall, Andrew J; Fiegler, Heike; Pearson, Danita M.; Dunham, Ian; Carter, Nigel P; Collins, V. Peter

    2009-01-01

    Deletions of chromosome 6 are a common abnormality in diverse human malignancies including astrocytic tumours, suggesting the presence of tumour suppressor genes (TSG). In order to help identify candidate TSGs, we have constructed a chromosome 6 tile path microarray. The array contains 1780 clones (778 PACs and 1002 BACs) that cover 98.3% of the published chromosome 6 sequences. A total of 104 adult astrocytic tumours (10 diffuse astrocytomas, 30 anaplastic astrocytomas (AA), 64 glioblastomas (GB)) were analysed using this array. Single copy number change was successfully detected and the result was in general concordant with a microsatellite analysis. The pattern of copy number change was complex with multiple interstitial deletions/gains. However, a predominance of telomeric 6q deletions was seen. Two small common and overlapping regions of deletion at 6q26 were identified. One was 1002 kb in size and contained PACRG and QKI, while the second was 199 kb and harbours a single gene, ARID1B. The data show that the chromosome 6 tile path array is useful in mapping copy number changes with high resolution and accuracy. We confirmed the high frequency of chromosome 6 deletions in AA and GB, and identified two novel commonly deleted regions that may harbour TSGs. PMID:16205629

  20. Deletion of UBE3A in brothers with Angelman syndrome at the breakpoint with an inversion at 15q11.2.

    Science.gov (United States)

    Kuroda, Yukiko; Ohashi, Ikuko; Saito, Toshiyuki; Nagai, Jun-Ichi; Ida, Kazumi; Naruto, Takuya; Wada, Takahito; Kurosawa, Kenji

    2014-11-01

    Angelman syndrome (AS) is characterized by severe intellectual disability with ataxia, epilepsy, and behavioral uniqueness. The underlining molecular deficit is the absence of the maternal copy of the imprinted UBE3A gene due to maternal deletions, which is observed in 70-75% of cases, and can be detected using fluorescent in situ hybridization (FISH) of the UBE3A region. Only a few familial AS cases have been reported with a complete deletion of UBE3A. Here, we report on siblings with AS caused by a microdeletion of 15q11.2-q12 encompassing UBE3A at the breakpoint of an inversion at 15q11.2 and 15q26.1. Karyotyping revealed an inversion of 15q, and FISH revealed the deletion of the UBE3A region. Array comparative genomic hybridization (CGH) demonstrated a 467 kb deletion at 15q11.2-q12, encompassing only UBE3A, SNORD115, and PAR1, and a 53 kb deletion at 15q26.1, encompassing a part of SLCO3A1. Their mother had a normal karyotype and array CGH detected no deletion of 15q11.2-q12, so we assumed gonadal mosaicism. This report describes a rare type of familial AS detected using the D15S10 FISH test. © 2014 Wiley Periodicals, Inc.

  1. Molecular dissection of a contiguous gene syndrome: Frequent submicroscopic deletions, evolutionarily conserved sequences, and a hypomethylated island in the Miller-Dieker chromosome region

    International Nuclear Information System (INIS)

    Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.

    1989-01-01

    The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region

  2. A low-delay 8 Kb/s backward-adaptive CELP coder

    Science.gov (United States)

    Neumeyer, L. G.; Leblanc, W. P.; Mahmoud, S. A.

    1990-01-01

    Code excited linear prediction coding is an efficient technique for compressing speech sequences. Communications quality of speech can be obtained at bit rates below 8 Kb/s. However, relatively large coding delays are necessary to buffer the input speech in order to perform the LPC analysis. A low delay 8 Kb/s CELP coder is introduced in which the short term predictor is based on past synthesized speech. A new distortion measure that improves the tracking of the formant filter is discussed. Formal listening tests showed that the performance of the backward adaptive coder is almost as good as the conventional CELP coder.

  3. Pressure derivatives of elastic moduli of fused quartz to 10 kb

    Science.gov (United States)

    Peselnick, L.; Meister, R.; Wilson, W.H.

    1967-01-01

    Measurements of the longitudinal and shear moduli were made on fused quartz to 10 kb at 24??5??C. The anomalous behavior of the bulk modulus K at low pressure, ???K ???P 0, at higher pressures. The pressure derivative of the rigidity modulus ???G ???P remains constant and negative for the pressure range covered. A 15-kb hydrostatic pressure vessel is described for use with ultrasonic pulse instrumentation for precise measurements of elastic moduli and density changes with pressure. The placing of the transducer outside the pressure medium, and the use of C-ring pressure seals result in ease of operation and simplicity of design. ?? 1967.

  4. Small deletions of SATB2 cause some of the clinical features of the 2q33.1 microdeletion syndrome.

    Directory of Open Access Journals (Sweden)

    Jill A Rosenfeld

    Full Text Available Recurrent deletions of 2q32q33 have recently been reported as a new microdeletion syndrome. Clinical features of this syndrome include severe mental retardation, growth retardation, dysmorphic features, thin and sparse hair, feeding difficulties and cleft or high palate. The commonly deleted region contains at least seven genes. Haploinsufficiency of one of these genes, SATB2, a DNA-binding protein that regulates gene expression, has been implicated as causative in the cleft or high palate of individuals with 2q32q33 microdeletion syndrome. In this study we describe three individuals with smaller microdeletions of this region, within 2q33.1. The deletions ranged in size from 173.1 kb to 185.2 kb and spanned part of SATB2. Review of clinical records showed similar clinical features among these individuals, including severe developmental delay and tooth abnormalities. Two of the individuals had behavioral problems. Only one of the subjects presented here had a cleft palate, suggesting reduced penetrance for this feature. Our results suggest that deletion of SATB2 is responsible for several of the clinical features associated with 2q32q33 microdeletion syndrome.

  5. Deletion at the GCNT2 Locus Causes Autosomal Recessive Congenital Cataracts.

    Science.gov (United States)

    Irum, Bushra; Khan, Shahid Y; Ali, Muhammad; Daud, Muhammad; Kabir, Firoz; Rauf, Bushra; Fatima, Fareeha; Iqbal, Hira; Khan, Arif O; Al Obaisi, Saif; Naeem, Muhammad Asif; Nasir, Idrees A; Khan, Shaheen N; Husnain, Tayyab; Riazuddin, Sheikh; Akram, Javed; Eghrari, Allen O; Riazuddin, S Amer

    2016-01-01

    The aim of this study is to identify the molecular basis of autosomal recessive congenital cataracts (arCC) in a large consanguineous pedigree. All participating individuals underwent a detailed ophthalmic examination. Each patient's medical history, particularly of cataracts and other ocular abnormalities, was compiled from available medical records and interviews with family elders. Blood samples were donated by all participating family members and used to extract genomic DNA. Genetic analysis was performed to rule out linkage to known arCC loci and genes. Whole-exome sequencing libraries were prepared and paired-end sequenced. A large deletion was found that segregated with arCC in the family, and chromosome walking was conducted to estimate the proximal and distal boundaries of the deletion mutation. Exclusion and linkage analysis suggested linkage to a region of chromosome 6p24 harboring GCNT2 (glucosaminyl (N-acetyl) transferase 2) with a two-point logarithm of odds score of 5.78. PCR amplifications of the coding exons of GCNT2 failed in individuals with arCC, and whole-exome data analysis revealed a large deletion on chromosome 6p in the region harboring GCNT2. Chromosomal walking using multiple primer pairs delineated the extent of the deletion to approximately 190 kb. Interestingly, a failure to amplify a junctional fragment of the deletion break strongly suggests an insertion in addition to the large deletion. Here, we report a novel insertion/deletion mutation at the GCNT2 locus that is responsible for congenital cataracts in a large consanguineous family.

  6. Multi-exon deletions of the FBN1 gene in Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Schrijver Iris

    2001-10-01

    Full Text Available Abstract Background Mutations in the fibrillin -1 gene (FBN1 cause Marfan syndrome (MFS, an autosomal dominant multi-system connective tissue disorder. The 200 different mutations reported in the 235 kb, 65 exon-containing gene include only one family with a genomic multi-exon deletion. Methods We used long-range RT-PCR for mutation detection and long-range genomic PCR and DNA sequencing for identification of deletion breakpoints, allele-specific transcript analyses to determine stability of the mutant RNA, and pulse-chase studies to quantitate fibrillin synthesis and extracellular matrix deposition in cultured fibroblasts. Southern blots of genomic DNA were probed with three overlapping fragments covering the FBN1 coding exons Results Two novel multi-exon FBN1 deletions were discovered. Identical nucleotide pentamers were found at or near the intronic breakpoints. In a Case with classic MFS, an in-frame deletion of exons 42 and 43 removed the C-terminal 24 amino acids of the 5th LTBP (8-cysteine domain and the adjacent 25th calcium-binding EGF-like (6-cysteine domain. The mutant mRNA was stable, but fibrillin synthesis and matrix deposition were significantly reduced. A Case with severe childhood-onset MFS has a de novo deletion of exons 44–46 that removed three EGF-like domains. Fibrillin protein synthesis was normal, but matrix deposition was strikingly reduced. No genomic rearrangements were detected by Southern analysis of 18 unrelated MFS samples negative for FBN1 mutation screening. Conclusions Two novel deletion cases expand knowledge of mutational mechanisms and genotype/phenotype correlations of fibrillinopathies. Deletions or mutations affecting an LTBP domain may result in unstable mutant protein cleavage products that interfere with microfibril assembly.

  7. PAX3 gene deletion detected by microarray analysis in a girl with hearing loss.

    Science.gov (United States)

    Drozniewska, Malgorzata; Haus, Olga

    2014-01-01

    Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16 year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862 kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype.

  8. Study on the effect of paclitaxel nanostructure lipid carrier cooperated with radiation on the KB Cells

    International Nuclear Information System (INIS)

    Liu Min; Li Zhihui; Xu Yujie

    2011-01-01

    Objective: To investigate the cytotoxicity effect of paclitaxel nanostructure lipid carrier (TAX-NLC) cooperated with radiation treatment on the KB cells. Methods: The cytotoxicity effect of TAX-NLC compared with free paclitaxel (TAX) on the KB cells was measured by MTT assay, and the cell cycle distribution was analyzed by flow cytometry. Results: The cytotoxicity effect of TAX-NLC was stronger than that of the free TAX. And the cooperative effect between the TAX-NLC and ionized radiation were observed, the cooperative effect of TAX-NLC was stronger than that of the free TAX. Flow cytometric analysis indicated that the rearrangement of cell cycle in KB cells were induced by TAX-NLC. The more G2/M phase cells were observed in KB cells treated by TAX-NLC compared with free TAX. The effect of TAX-NLC in the rearrangement of cell cycle was stronger than that of the free TAX. Conclusion: The cytotoxicity effect of TAX-NLC is stronger than that of the free TAX. And the cooperative effect of TAX-NLC is stronger than that of the free TAX. (authors)

  9. Structural and biophysical characterization of the PI4KB:14-3-3 protein complex

    Czech Academy of Sciences Publication Activity Database

    Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 191 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : PI4KB * 14-3-3 proteins Subject RIV: CE - Biochemistry

  10. Report of the KB-WOT fisheries programme carried out in 2007

    NARCIS (Netherlands)

    Dickey-Collas, M.; Beek, van F.A.

    2008-01-01

    This report documents the activities of the KB WOT fisheries programme in 2007. It gives the results, products and documents the experienced gained by staff through the programme. It also shows how the individual projects fit into the research priority areas of WOT fisheries programme for 2007. The

  11. Identification and characterization of survivin-derived H-2Kb-restricted CTL epitopes

    DEFF Research Database (Denmark)

    Hofmann, Uta B; Voigt, Heike; Andersen, Mads H

    2009-01-01

    for potential binding K(b)-restricted octamer peptide epitopes. Two epitopes, which bind strongly to K(b), were selected to test their immunogenicity in vivo. Spleen cells from mice vaccinated by intradermal injection of mature DC pulsed with these peptides displayed reactivity to the respective epitopes...

  12. Introducing the Forensic Research/Reference on Genetics knowledge base, FROG-kb.

    Science.gov (United States)

    Rajeevan, Haseena; Soundararajan, Usha; Pakstis, Andrew J; Kidd, Kenneth K

    2012-09-01

    Online tools and databases based on multi-allelic short tandem repeat polymorphisms (STRPs) are actively used in forensic teaching, research, and investigations. The Fst value of each CODIS marker tends to be low across the populations of the world and most populations typically have all the common STRP alleles present diminishing the ability of these systems to discriminate ethnicity. Recently, considerable research is being conducted on single nucleotide polymorphisms (SNPs) to be considered for human identification and description. However, online tools and databases that can be used for forensic research and investigation are limited. The back end DBMS (Database Management System) for FROG-kb is Oracle version 10. The front end is implemented with specific code using technologies such as Java, Java Servlet, JSP, JQuery, and GoogleCharts. We present an open access web application, FROG-kb (Forensic Research/Reference on Genetics-knowledge base, http://frog.med.yale.edu), that is useful for teaching and research relevant to forensics and can serve as a tool facilitating forensic practice. The underlying data for FROG-kb are provided by the already extensively used and referenced ALlele FREquency Database, ALFRED (http://alfred.med.yale.edu). In addition to displaying data in an organized manner, computational tools that use the underlying allele frequencies with user-provided data are implemented in FROG-kb. These tools are organized by the different published SNP/marker panels available. This web tool currently has implemented general functions possible for two types of SNP panels, individual identification and ancestry inference, and a prediction function specific to a phenotype informative panel for eye color. The current online version of FROG-kb already provides new and useful functionality. We expect FROG-kb to grow and expand in capabilities and welcome input from the forensic community in identifying datasets and functionalities that will be most helpful

  13. Biomarkers’ Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM

    Directory of Open Access Journals (Sweden)

    Gretchen L. W. Heavner

    2018-02-01

    Full Text Available Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1TM, including several reductive dehalogenases (RDases and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR as a targeted approach for quantifying transcript copies in the KB-1TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10−12 to 5.9 × 10−10 microelectron equivalents per cell per hour (μeeq/cell∙h. Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA and the hydrogenase HupL (R2 = 0.83 and 0.88, respectively, but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1TM. Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1TM. The addition of oxygen induced cell stress that caused respiration

  14. Biomarkers' Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM.

    Science.gov (United States)

    Heavner, Gretchen L W; Mansfeldt, Cresten B; Debs, Garrett E; Hellerstedt, Sage T; Rowe, Annette R; Richardson, Ruth E

    2018-02-08

    Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR) rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC) containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1 TM , including several reductive dehalogenases (RDases) and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs) and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR) as a targeted approach for quantifying transcript copies in the KB-1 TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1 TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10 -12 to 5.9 × 10 -10 microelectron equivalents per cell per hour (μeeq/cell∙h). Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA) and the hydrogenase HupL (R² = 0.83 and 0.88, respectively), but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1 TM . Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1 TM . The addition of oxygen induced cell stress that caused respiration rates

  15. UniProtKB amid the turmoil of plant proteomics research

    Directory of Open Access Journals (Sweden)

    Michel eSchneider

    2012-12-01

    Full Text Available The UniProt knowledgebase (UniProtKB provides a single, centralized, authoritative resource for protein sequences and functional information. The majority of its records is based on automatic translation of coding sequences (CDS provided by submitters at the time of initial deposition to the nucleotide sequence databases (INSDC. More and more frequently, only the raw sequence of a complete genome is deposited to the nucleotide sequence databases and the gene model predictions and annotations are kept in separate, specialized model organism databases (MODs. In order to be able to provide the complete proteome of model organisms, UniProtKB had to implement pipelines for import of protein sequences from Ensembl and EnsemblGenomes.A single genome can be the target of several unrelated sequencing projects and the final assembly and gene model predictions may diverge quite significantly. In addition, several cultivars of the same species are often sequenced -1001 Arabidopsis cultivars are currently under way- and the resulting proteomes are far from being identical. Therefore, one challenge for UniProtKB is to store and organize these data in a convenient way and to clearly defined reference proteomes that should be made available to users. Manual annotation is one of the landmarks of the Swiss-Prot section of UniProtKB. Besides adding functional annotation, curators are checking, and often correcting, gene model predictions. For plants, this task is limited to Arabidopsis thaliana and Oryza sativa subsp japonica. Proteomics data providing experimental evidences confirming the existence of proteins or identifying sequence features such as post translational modifications are also imported into UniProtKB records and the knowledgebase is cross-referenced to numerous proteomics resources.

  16. Fabrication of nested elliptical KB mirrors using profile coating for synchrotron radiation X-ray focusing

    International Nuclear Information System (INIS)

    Liu Chian; Ice, G.E.; Liu, W.; Assoufid, L.; Qian, J.; Shi, B.; Khachatryan, R.; Wieczorek, M.; Zschack, P.; Tischler, J.Z.

    2012-01-01

    This paper describes fabrication methods used to demonstrate the advantages of nested or Montel optics for micro/nanofocusing of synchrotron X-ray beams. A standard Kirkpatrick-Baez (KB) mirror system uses two separated elliptical mirrors at glancing angles to the X-ray beam and sequentially arranged at 90° to each other to focus X-rays successively in the vertical and horizontal directions. A nested KB mirror system has the two mirrors positioned perpendicular and side-by-side to each other. Compared to a standard KB mirror system, Montel optics can focus a larger divergence and the mirrors can have a shorter focal length. As a result, nested mirrors can be fabricated with improved demagnification factor and ultimately smaller focal spot, than with a standard KB arrangement. The nested system is also more compact with an increased working distance, and is more stable, with reduced complexity of mirror stages. However, although Montel optics is commercially available for laboratory X-ray sources, due to technical difficulties they have not been used to microfocus synchrotron radiation X-rays, where ultra-precise mirror surfaces are essential. The main challenge in adapting nested optics for synchrotron microfocusing is to fabricate mirrors with a precise elliptical surface profile at the very edge where the two mirrors meet and where X-rays scatter. For example, in our application to achieve a sub-micron focus with high efficiency, a surface figure root-mean-square (rms) error on the order of 1 nm is required in the useable area along the X-ray footprint with a ∼0.1 mm-diameter cross section. In this paper we describe promising ways to fabricate precise nested KB mirrors using our profile coating technique and inexpensive flat Si substrates.

  17. Growth characteristics of Lactobacillus brevis KB290 in the presence of bile.

    Science.gov (United States)

    Kimoto-Nira, Hiromi; Suzuki, Shigenori; Suganuma, Hiroyuki; Moriya, Naoko; Suzuki, Chise

    2015-10-01

    Live Lactobacillus brevis KB290 have several probiotic activities, including immune stimulation and modulation of intestinal microbial balance. We investigated the adaptation of L. brevis KB290 to bile as a mechanism of intestinal survival. Strain KB290 was grown for 5 days at 37 °C in tryptone-yeast extract-glucose (TYG) broth supplemented with 0.5% sodium acetate (TYGA) containing 0.15%, 0.3%, or 0.5% bile. Growth was determined by absorbance at 620 nm or by dry weight. Growth was enhanced as the broth's bile concentration increased. Bile-enhanced growth was not observed in TYG broth or with xylose or fructose as the carbon source, although strain KB290 could assimilate these sugars. Compared with cells grown without bile, cells grown with bile had twice the cell yield (dry weight) and higher hydrophobicity, which may improve epithelial adhesion. Metabolite analysis revealed that bile induced more lactate production by glycolysis, thus enhancing growth efficiency. Scanning electron microscopy revealed that cells cultured without bile for 5 days in TYGA broth had a shortened rod shape and showed lysis and aggregation, unlike cells cultured for 1 day; cells grown with bile for 5 days had an intact rod shape and rarely appeared damaged. Cellular material leakage through autolysis was lower in the presence of bile than in its absence. Thus lysis of strain KB290 cells cultured for extended periods was suppressed in the presence of bile. This study provides new role of bile and sodium acetate for retaining an intact cell shape and enhancing cell yield, which are beneficial for intestinal survival. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Solid renal tumor severity in von Hippel Lindau disease is related to germline deletion length and location.

    Science.gov (United States)

    Maranchie, Jodi K; Afonso, Anoushka; Albert, Paul S; Kalyandrug, Sivaram; Phillips, John L; Zhou, Shubo; Peterson, James; Ghadimi, Bijan M; Hurley, Katheen; Riss, Joseph; Vasselli, James R; Ried, Thomas; Zbar, Berton; Choyke, Peter; Walther, McClellan M; Klausner, Richard D; Linehan, W Marston

    2004-01-01

    von Hippel Lindau disease (VHL) is an autosomal dominant familial cancer syndrome linked to alteration of the VHL tumor suppressor gene. Affected patients are predisposed to develop pheochromocytomas and cystic and solid tumors of the kidney, CNS, pancreas, retina, and epididymis. However, organ involvement varies considerably among families and has been shown to correlate with the underlying germline alteration. Clinically, we observed a paradoxically lower prevalence of renal cell carcinoma (RCC) in patients with complete germline deletion of VHL. To determine if a relationship existed between the type of VHL deletion and disease, we retrospectively evaluated 123 patients from 55 families with large germline VHL deletions, including 42 intragenic partial deletions and 13 complete VHL deletions, by history and radiographic imaging. Each individual and family was scored for cystic or solid involvement of CNS, pancreas, and kidney, and for pheochromocytoma. Germline deletions were mapped using a combination of fluorescent in situ hybridization (FISH) and quantitative Southern and Southern blot analysis. An age-adjusted comparison demonstrated a higher prevalence of RCC in patients with partial germline VHL deletions relative to complete deletions (48.9 vs. 22.6%, p=0.007). This striking phenotypic dichotomy was not seen for cystic renal lesions or for CNS (p=0.22), pancreas (p=0.72), or pheochromocytoma (p=0.34). Deletion mapping revealed that development of RCC had an even greater correlation with retention of HSPC300 (C3orf10), located within the 30-kb region of chromosome 3p, immediately telomeric to VHL (52.3 vs. 18.9%, p <0.001), suggesting the presence of a neighboring gene or genes critical to the development and maintenance of RCC. Careful correlation of genotypic data with objective phenotypic measures will provide further insight into the mechanisms of tumor formation. Copyright 2003 Wiley-Liss, Inc.

  19. Heterozygous deletion at the SOX10 gene locus in two patients from a Chinese family with Waardenburg syndrome type II.

    Science.gov (United States)

    Wenzhi, He; Ruijin, Wen; Jieliang, Li; Xiaoyan, Ma; Haibo, Liu; Xiaoman, Wang; Jiajia, Xian; Shaoying, Li; Shuanglin, Li; Qing, Li

    2015-10-01

    Waardenburg syndrome (WS) is a rare disease characterized by sensorineural deafness and pigment disturbance. To date, almost 100 mutations have been reported, but few reports on cases with SOX10 gene deletion. The inheritance pattern of SOX10 gene deletion is still unclear. Our objective was to identify the genetic causes of Waardenburg syndrome type II in a two-generation Chinese family. Clinical evaluations were conducted in both of the patients. Microarray analysis and multiplex ligation-dependent probe amplification (MLPA) were performed to identify disease-related copy number variants (CNVs). DNA sequencing of the SOX10, MITF and SNAI2 genes was performed to identify the pathogenic mutation responsible for WS2. A 280kb heterozygous deletion at the 22q13.1 chromosome region (including SOX10) was detected in both of the patients. No mutation was found in the patients, unaffected family members and 30 unrelated healthy controls. This report is the first to describe SOX10 heterozygous deletions in Chinese WS2 patients. Our result conform the thesis that heterozygous deletions at SOX10 is an important pathogenicity for WS, and present as autosomal dominant inheritance. Nevertheless, heterozygous deletion of the SOX10 gene would be worth investigating to understand their functions and contributions to neurologic phenotypes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. PAR1 deletions downstream of SHOX are the most frequent defect in a Spanish cohort of Léri-Weill dyschondrosteosis (LWD) probands.

    Science.gov (United States)

    Benito-Sanz, Sara; del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Magano, Luis F; Lapunzina, Pablo; Argente, Jesús; Campos-Barros, Angel; Heath, Karen E

    2006-10-01

    Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and Madelung deformity. Mutations or deletions of the SHOX gene have been previously identified as the main cause of LWD. We recently identified the existence of a second class of pseudoautosomal region 1 (PAR1) deletions which do not include SHOX, implicated in the etiopathogenesis of LWD. The deletions map at least 30-250 kb downstream of SHOX, are variable in size and clearly cosegregate with the LWD phenotype. In order to determine the frequency of this new type of deletions in the Spanish population we analyzed the distribution of PAR1 defects, including the screening of SHOX deletions, mutations, and PAR1 deletions downstream of SHOX, in a total of 26 LWD probands by a combination of MLPA, microsatellite analysis, SNP genotyping, dHPLC, and DNA sequencing. A molecular defect was identified in 16/26 LWD patients (61.5%): 10 PAR1 deletions downstream of SHOX, four SHOX encompassing deletions, and two SHOX mutations. No apparent phenotypic differences were observed between patients with SHOX defects and those with PAR1 deletions downstream of SHOX. In the examined cohort of Spanish LWD probands, PAR1 deletions downstream of SHOX represent the highest proportion of identified mutations (38%) compared to SHOX deletions (15%) and mutations (8%). As a consequence of our findings, the screening of this region should be included in the routine genetic testing of LWD. Also, LWD patients who tested negative for SHOX defects should be re-evaluated for PAR1 deletions downstream of SHOX.

  1. In vitro Cytotoxicity, Pharmacokinetics, Tissue Distribution, and Metabolism of Small-Molecule Protein Kinase D Inhibitors, kb-NB142-70 and kb-NB165-09, in Mice bearing Human Cancer Xenografts

    Science.gov (United States)

    Guo, Jianxia; Clausen, Dana M.; Beumer, Jan H.; Parise, Robert A.; Egorin, Merrill J.; Bravo-Altamirano, Karla; Wipf, Peter; Sharlow, Elizabeth R.; Wang, Qiming Jane; Eiseman, Julie L.

    2012-01-01

    Purpose Protein kinase D (PKD) mediates diverse biological responses including cell growth and survival. Therefore, PKD inhibitors may have therapeutic potential. We evaluated the in vitro cytotoxicity of two PKD inhibitors, kb-NB142-70 and its methoxy analog, kb-NB165-09, and examined their in vivo efficacy and pharmacokinetics. Methods The in vitro cytotoxicities of kb-NB142-70 and kb-NB165-09 were evaluated by MTT assay against PC-3, androgen independent prostate cancer cells, and CFPAC-1 and PANC-1, pancreatic cancer cells. Efficacy studies were conducted in mice bearing either PC-3 or CPFAC-1 xenografts. Tumor-bearing mice were euthanized between 5 and 1440 min after iv dosing, and plasma and tissue concentrations were measured by HPLC-UV. Metabolites were characterized by LC-MS/MS. Results kb-NB142-70 and kb-NB165-09 inhibited cellular growth in the low-mid μM range. The compounds were inactive when administered to tumor-bearing mice. In mice treated with kb-NB142-70, the plasma Cmax was 36.9 nmol/mL and the PC-3 tumor Cmax was 11.8 nmol/g. In mice dosed with kb-NB165-09, the plasma Cmax was 61.9 nmol/mL while the PANC-1 tumor Cmax was 8.0 nmol/g. The plasma half-lives of kb-NB142-70 and kb-NB165-09 were 6 and 14 min, respectively. Both compounds underwent oxidation and glucuronidation. Conclusions kb-NB142-70 and kb-NB165-09 were rapidly metabolized, and concentrations in tumor were lower than those required for in vitro cytotoxicity. Replacement of the phenolic hydroxyl group with a methoxy group increased the plasma half-life of kb-NB165-09 2.3-fold over that of kb-NB142-70. Rapid metabolism in mice suggests that next-generation compounds will require further structural modifications to increase potency and/or metabolic stability. PMID:23108699

  2. Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.

    Science.gov (United States)

    Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A

    2014-10-01

    Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  4. Species-specific deletion of the viral attachment glycoprotein of avian metapneumovirus.

    Science.gov (United States)

    Kong, Byung-Whi; Foster, Linda K; Foster, Douglas N

    2008-03-01

    The avian metapneumovirus (AMPV) genome encodes the fusion (F), small hydrophobic (SH), and attachment glycoprotein (G) as envelope glycoproteins. The F and G proteins mainly function to allow viral entry into host cells during the early steps of the virus life cycle. The highly variable AMPV G protein is a major determinant for distinguishing virus subtypes. Sequence analysis was used to determine if any differences between avian or mammalian cell propagated subtype C AMPV could be detected for the 1.8kb G gene. As a result, the complete 1.8kb G gene was found to be present when AMPV was propagated in our immortal turkey turbinate (TT-1) cell line regardless of passage number. Surprisingly, AMPV propagated for 15 or more passages in mammalian Vero cells revealed an essentially deleted G gene in the viral genome, resulting in no G gene mRNA expression. Although the Vero cell propagated AMPV genome contained a small 122 nucleotide fragment of the G gene, no other mRNA variants were detected from either mammalian or avian propagated AMPV. The G gene truncation might be caused by cellular molecular mechanisms that are species-specific. The lack of viral gene deletions suggests that avian cell propagated AMPV will provide a better alternative host for live recombinant vaccine development based on a reverse genetics system.

  5. The influence of large deletions on the mutation frequency induced by tritiated water and X-radiation in male Drosophila melanogaster post-meiotic germ cells

    International Nuclear Information System (INIS)

    Fossett, N.G.; Byrne, B.J.; Kelley, S.J.; Tucker, A.B.; Arbour-Reily, P.; Lee, W.R.

    1994-01-01

    Tritium beta radiation ( 3 H β-radiation) in the form of tritiated water was used to induce mutations at the alcohol dehydrogenase (Adh) locus in male Drosophila melanogaster post-meiotic germ cells. All 23 Adh null mutations were large deletions (>20 kb), determined by genetic complementation and Southern blot analyses. 27 Adh null mutations have been induced by 100-kVp X-rays and have been genetically and molecularly characterized. In contrast to 3 H β-radiation, 100-kVp X-rays induced a bimodal distribution of Adh null mutations, intragenic mutations, ≤250 bp, and large deletions, >100 kb. A statistically significant difference was observed between the frequency of large deletions (23/23 or 1.0) induced by 3 H β-radiation and the frequency of large deletions (19/27 or 0.7) induced by 100-kVp X-rays. However, a statistical difference was not observed between the size distribution of the large deletions induced by 3 H β-radiation and X-rays. The relative deletion frequency (RDF) induced by 3 H β-radiation and 100-kVp X-rays was (1.0/0.7=1.4). The relative biological effectiveness (RBE) of these two radiation sources was 1.4, determined from the ratio of the regression coefficients of the respective 3 H β-radiation and X-ray sex-linked recessive lethal (SLRL) dose-response data. The large difference in size between the two classes of X-ray-induced Adh null mutations and the increase in mutation frequency and deletion frequency for 3 H β-radiation with respect to X-rays may indicate that the relative deletion frequency (RDF) is the molecular biological basis for the increase in the RBE for radiation sources with a mean LET value ≤10 keV/μm

  6. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  7. Kirkpatrick-Baez (KB) and Lobster Eye (LE) Optics for Astronomical and Laboratory Applications

    International Nuclear Information System (INIS)

    Hudec, R.; Hudec, R.

    2010-01-01

    Most of grazing incidence (reflective) X-ray imaging systems used in astronomy and in other (laboratory) applications are based on the Wolter 1 (or modified) arrangement. But there were proposed also other designs and configurations, which are considered for future applications for both in laboratory and (finitely) in space. The Kirkpatrick-Baez (KB) lenses as well as various types of Lobster-Eye (LE) optics and MCP/Micropore optics serve as an example. Analogously to Wolter lenses, the X-rays are mostly reflected twice in these systems to create focal images. The KB systems have already found wide usage in laboratory and synchrotron, both application are reviewed and discussed in detail in this paper. While this paper focuses on future possible applications of non-Wolter grazing incidence systems in space and astronomy, we also discuss in detail applications in other areas of science, where (in contrary to astronomy) some of these systems have demonstrated their advantages

  8. Alignment of KB mirrors with at-wavelength metrology tool simulated using SRW

    Science.gov (United States)

    Idir, Mourad; Rakitin, Maksim; Gao, Bo; Xue, Junpeng; Huang, Lei; Chubar, Oleg

    2017-08-01

    Synchrotron Radiation Workshop (SRW) is a powerful synchrotron radiation simulation tool and has been widely used at synchrotron facilities all over the world. During the last decade, many types of X-ray wavefront sensors have been developed and used. In this work, we present our recent effort on the development of at-wavelength metrology simulation based on SRW mainly focused on the Hartmann Wavefront Sensor (HWS). Various conditions have been studied to verify that the simulated HWS is performing as expected in terms of accuracy. This at-wavelength metrology simulation tool is then used to align KB mirrors by minimizing the wavefront aberrations. We will present our optimization process to perform an `in situ' alignment using conditions as close as possible to the real experiments (KB mirrors with different levels of figure errors or different misalignment geometry).

  9. Structural basis for hijacking of human ACBD3 and PI4KB proteins by picornaviruses

    Czech Academy of Sciences Publication Activity Database

    Klíma, Martin; Chalupská, Dominika; Rozycki, B.; Humpolíčková, Jana; Smola, Miroslav; Horová, Vladimíra; Hexnerová, Rozálie; Veverka, Václav; Toth, D.; Balla, T.; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 129 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR(CZ) GJ17-07058Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : picornavirus * ACBD3 * PI4KB Subject RIV: CE - Biochemistry

  10. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    OpenAIRE

    Shen, Yue; Wang, Yun; Chen, Tai; Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synI...

  11. Neuropsychological phenotype of a patient with a de novo 970 kb interstitial deletion in the distal 16p11.2 region

    NARCIS (Netherlands)

    J.I.M. Egger (Jos); W.M.A. Verhoeven (Wim); W. Verbeeck (Wim); N. de Leeuw (Nicole)

    2014-01-01

    textabstractThe 16p11.2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay, symptoms from the autism spectrum, epilepsy, congenital anomalies, and obesity. These phenotypes are often related to a proximal 16p11.2

  12. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

    Science.gov (United States)

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

  13. Homozygous deletion of six genes including corneodesmosin on chromosome 6p21.3 is associated with generalized peeling skin disease.

    Science.gov (United States)

    Teye, Kwesi; Hamada, Takahiro; Krol, Rafal P; Numata, Sanae; Ishii, Norito; Matsuda, Mitsuhiro; Ohata, Chika; Furumura, Minao; Hashimoto, Takashi

    2014-07-01

    Peeling skin syndrome (PSS) is a rare autosomal recessive form of ichthyosis showing skin exfoliation. PSS is divided into acral and generalized PSS, and the latter is further classified into non-inflammatory type (PSS type A) and inflammatory type (PSS type B). PSS type B is now called peeling skin disease (PSD). Different loss-of-function mutations in the corneodesmosin (CDSN) gene have been reported to cause PSD. The aim of this study was to determine genetic basis of disease in a 14-year-old Japanese patient with PSD. Immunohistochemical study showed lack of corneodesmosin (CDSN) in the skin, and standard PCR for genomic DNA failed to amplify CDSN product, suggesting CDSN defect. Multiplex ligation-dependent probe amplification and genomic quantitative real-time PCR analyses detected large homozygous deletion of 59,184bp extending from 40.6kb upstream to 13.2kb downstream of CDSN, which included 6 genes (TCF19, CCHCR1, PSORS1C2, PSORS1C1, CDSN and C6orf15). The continuous gene lost did not result in additional clinical features. Inverted repeats with 85% similarity flanking the deletion breakpoint were considered to mediate the deletion by non-homologous end joining or fork stalling and template switching/microhomology-mediated break-induced replication. Parents were clinically unaffected and were heterozygote carriers of the same deletion, which was absent in 284 ethnically matched control alleles. We also developed simple PCR method, which is useful for detection of this deletion. Although 5 other genes were also deleted, homozygous deletion of CDSN was considered to be responsible for this PSD. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  14. Identification of MHC class I H-2 Kb/Db-restricted immunogenic peptides derived from retinal proteins

    DEFF Research Database (Denmark)

    Wang, Mingjun; Bai, Fang; Pries, Mette

    2006-01-01

    PURPOSE: To identify H-2 Kb/Db-binding immunogenic peptides derived from retinal proteins. METHODS: Computer-based prediction was used to identify potentially H-2 Kb/Db-binding peptides derived from the interphotoreceptor retinol-binding protein (IRBP), soluble retinal antigen (S...... on day 21 after immunization with IRBP or IRBP and the immunogenic peptides. RESULTS: All the 21 predicted peptides were found to upregulate expression of H-2 Kb/Db on RMA-S cells. Five peptides, the two IRBP-derived peptides IRBP89-96 and IRBP(101-108), and the three PEDF-derived peptides, PEDF389....... The immunogenic peptides alone did not induce inflammation in the eyes, but they could enhance severity of uveitis induced by IRBP. CONCLUSIONS: Five of 21 H-2 Kb/Db-binding retinal protein-derived peptides were found to be immunogenic, suggesting that these peptides could function as autoantigenic epitopes...

  15. Aloin Inhibits Interleukin (IL)-1β-Stimulated IL-8 Production in KB Cells.

    Science.gov (United States)

    Na, Hee Sam; Song, Yu Ri; Kim, Seyeon; Heo, Jun-Young; Chung, Hae-Young; Chung, Jin

    2016-06-01

    Interleukin (IL)-1β, which is elevated in oral diseases including gingivitis, stimulates epithelial cells to produce IL-8 and perpetuate inflammatory responses. This study investigates stimulatory effects of salivary IL-1β in IL-8 production and determines if aloin inhibits IL-1β-stimulated IL-8 production in epithelial cells. Saliva was collected from volunteers to determine IL-1β and IL-8 levels. Samples from volunteers were divided into two groups: those with low and those with high IL-1β levels. KB cells were stimulated with IL-1β or saliva with or without IL-1 receptor agonist or specific mitogen-activated protein kinase (MAPK) inhibitors. IL-8 production was measured by enzyme-linked immunosorbent assay (ELISA). MAPK protein expression involved in IL-1β-induced IL-8 secretion was detected by Western blot. KB cells were pretreated with aloin, and its effect on IL-1β-induced IL-8 production was examined by ELISA and Western blot analysis. Saliva with high IL-1β strongly stimulated IL-8 production in KB cells, and IL-1 receptor agonist significantly inhibited IL-8 production. Low IL-1β-containing saliva did not increase IL-8 production. IL-1β treatment of KB cells induced activation of MAPK signaling molecules as well as nuclear factor-kappa B. IL-1β-induced IL-8 production was decreased by p38 and extracellular signal-regulated kinase (ERK) inhibitor treatment. Aloin pretreatment inhibited IL-1β-induced IL-8 production in a dose-dependent manner and inhibited activation of the p38 and ERK signaling pathway. Finally, aloin pretreatment also inhibited saliva-induced IL-8 production. Results indicated that IL-1β in saliva stimulates epithelial cells to produce IL-8 and that aloin effectively inhibits salivary IL-1β-induced IL-8 production by mitigating the p38 and ERK pathway. Therefore, aloin may be a good candidate for modulating oral inflammatory diseases.

  16. Cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror

    International Nuclear Information System (INIS)

    Yuan Sheng; Goldberg, Kenneth A.; Yashchuk, Valeriy V.; Celestre, Richard; McKinney, Wayne R.; Morrison, Gregory; Macdougall, James; Mochi, Iacopo; Warwick, Tony

    2011-01-01

    At the Advanced Light Source (ALS), we are developing broadly applicable, high-accuracy, in-situ, at-wavelength wavefront slope measurement techniques for Kirkpatrick-Baez (KB) mirror nano-focusing. In this paper, we report an initial cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror. This cross-check provides a validation of the in-situ shearing interferometry, currently under development at the ALS.

  17. Clinical comparison of overlapping deletions of 19p13.3.

    Science.gov (United States)

    Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A

    2013-05-01

    We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.

  18. Highly restricted deletion of the SNORD116 region is implicated in Prader–Willi Syndrome

    Science.gov (United States)

    Bieth, Eric; Eddiry, Sanaa; Gaston, Véronique; Lorenzini, Françoise; Buffet, Alexandre; Conte Auriol, Françoise; Molinas, Catherine; Cailley, Dorothée; Rooryck, Caroline; Arveiler, Benoit; Cavaillé, Jérome; Salles, Jean Pierre; Tauber, Maïthé

    2015-01-01

    The SNORD116 locus lies in the 15q11-13 region of paternally expressed genes implicated in Prader–Willi Syndrome (PWS), a complex disease accompanied by obesity and severe neurobehavioural disturbances. Cases of PWS patients with a deletion encompassing the SNORD116 gene cluster, but preserving the expression of flanking genes, have been described. We report a 23-year-old woman who presented clinical criteria of PWS, including the behavioural and nutritional features, obesity, developmental delay and endocrine dysfunctions with hyperghrelinemia. We found a paternally transmitted highly restricted deletion of the SNORD116 gene cluster, the shortest described to date (118 kb). This deletion was also present in the father. This finding in a human case strongly supports the current hypothesis that lack of the paternal SNORD116 gene cluster has a determinant role in the pathogenesis of PWS. Moreover, targeted analysis of the SNORD116 gene cluster, complementary to SNRPN methylation analysis, should be carried out in subjects with a phenotype suggestive of PWS. PMID:24916642

  19. Highly restricted deletion of the SNORD116 region is implicated in Prader-Willi Syndrome.

    Science.gov (United States)

    Bieth, Eric; Eddiry, Sanaa; Gaston, Véronique; Lorenzini, Françoise; Buffet, Alexandre; Conte Auriol, Françoise; Molinas, Catherine; Cailley, Dorothée; Rooryck, Caroline; Arveiler, Benoit; Cavaillé, Jérome; Salles, Jean Pierre; Tauber, Maïthé

    2015-02-01

    The SNORD116 locus lies in the 15q11-13 region of paternally expressed genes implicated in Prader-Willi Syndrome (PWS), a complex disease accompanied by obesity and severe neurobehavioural disturbances. Cases of PWS patients with a deletion encompassing the SNORD116 gene cluster, but preserving the expression of flanking genes, have been described. We report a 23-year-old woman who presented clinical criteria of PWS, including the behavioural and nutritional features, obesity, developmental delay and endocrine dysfunctions with hyperghrelinemia. We found a paternally transmitted highly restricted deletion of the SNORD116 gene cluster, the shortest described to date (118 kb). This deletion was also present in the father. This finding in a human case strongly supports the current hypothesis that lack of the paternal SNORD116 gene cluster has a determinant role in the pathogenesis of PWS. Moreover, targeted analysis of the SNORD116 gene cluster, complementary to SNRPN methylation analysis, should be carried out in subjects with a phenotype suggestive of PWS.

  20. Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

    1989-05-01

    Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

  1. Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

    Science.gov (United States)

    Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

    2004-01-01

    Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

  2. OC-2-KB: A software pipeline to build an evidence-based obesity and cancer knowledge base.

    Science.gov (United States)

    Lossio-Ventura, Juan Antonio; Hogan, William; Modave, François; Guo, Yi; He, Zhe; Hicks, Amanda; Bian, Jiang

    2017-11-01

    Obesity has been linked to several types of cancer. Access to adequate health information activates people's participation in managing their own health, which ultimately improves their health outcomes. Nevertheless, the existing online information about the relationship between obesity and cancer is heterogeneous and poorly organized. A formal knowledge representation can help better organize and deliver quality health information. Currently, there are several efforts in the biomedical domain to convert unstructured data to structured data and store them in Semantic Web knowledge bases (KB). In this demo paper, we present, OC-2-KB (Obesity and Cancer to Knowledge Base), a system that is tailored to guide the automatic KB construction for managing obesity and cancer knowledge from free-text scientific literature (i.e., PubMed abstracts) in a systematic way. OC-2-KB has two important modules which perform the acquisition of entities and the extraction then classification of relationships among these entities. We tested the OC-2-KB system on a data set with 23 manually annotated obesity and cancer PubMed abstracts and created a preliminary KB with 765 triples. We conducted a preliminary evaluation on this sample of triples and reported our evaluation results.

  3. Deletion of Xpter encompassing the SHOX gene and PAR1 region in familial patients with Leri-Weill Dyschondrosteosis syndrome.

    Science.gov (United States)

    Mutesa, L; Vanbellinghen, J F; Hellin, A C; Segers, K; Jamar, M; Pierquin, G; Bours, V

    2009-01-01

    Heterozygote deletions or mutations of pseudoautosomal 1 region (PAR1) encompassing the short stature homeobox-containing (SHOX) gene cause Leri-Weill Dyschondrosteosis (LWD), which is a dominantly inherited osteochondroplasia characterized by short stature with mesomelic shortening of the upper and lower limbs and Madelung deformity of the wrists. SHOX is expressed by both sex chromosomes in males and females and plays an important role in bone growth and development. Clinically, the LWD expression is variable and more severe in females than males due to sex differences in oestrogen levels. Here, we report two familial cases of LWD with a large Xp terminal deletion (approximately 943 kb) of distal PAR1 encompassing the SHOX gene. In addition, the proband had mental retardation which appeared to be from recessive inheritance in the family.

  4. Congenital disorder of glycosylation Ic due to a de novo deletion and an hALG-6 mutation.

    Science.gov (United States)

    Eklund, Erik A; Sun, Liangwu; Yang, Samuel P; Pasion, Romela M; Thorland, Erik C; Freeze, Hudson H

    2006-01-20

    We describe a new cause of congenital disorder of glycosylation-Ic (CDG-Ic) in a young girl with a rather mild CDG phenotype. Her cells accumulated lipid-linked oligosaccharides lacking three glucose residues, and sequencing of the ALG6 gene showed what initially appeared to be a homozygous novel point mutation (338G>A). However, haplotype analysis showed that the patient does not carry any paternal DNA markers extending 33kb in the telomeric direction from the ALG6 region, and microsatellite analysis extended the abnormal region to at least 2.5Mb. We used high-resolution karyotyping to confirm a deletion (10-12Mb) [del(1)(p31.2p32.3)] and found no structural abnormalities in the father, suggesting a de novo event. Our findings extend the causes of CDG to larger DNA deletions and identify the first Japanese CDG-Ic mutation.

  5. Allelic variants of CAMTA1 and FLJ10737 within a commonly deleted region at 1p36 in neuroblastoma

    DEFF Research Database (Denmark)

    Henrich, Kai-Oliver; Claas, Andreas; Praml, Christian

    2007-01-01

    Deletion of a distal portion of 1p is seen in a wide range of human malignancies, including neuroblastoma. Here, a 1p36.3 commonly deleted region of 216 kb has been defined encompassing two genes, CAMTA1 and FLJ10737. Low expression of CAMTA1 has been recently shown to be an independent predictor...... of poor outcome in neuroblastoma patients. The present study surveys CAMTA1 and FLJ10737 for genetic alterations by fluorescence-based single strand conformation polymorphism (SSCP) using a panel of DNAs from 88 neuroblastomas, their matching blood samples and 97 unaffected individuals. Nucleotide...... variants encoding amino acid substitutions were found in both genes. One CAMTA1 variant (T1336I) was not detected in 97 unaffected individuals, another (N1177K) resides in a conserved domain of the CAMTA1 protein and was found hemizygous in six neuroblastomas. We found no evidence for somatic mutations...

  6. Probabilistic cloning and deleting of quantum states

    International Nuclear Information System (INIS)

    Feng Yuan; Zhang Shengyu; Ying Mingsheng

    2002-01-01

    We construct a probabilistic cloning and deleting machine which, taking several copies of an input quantum state, can output a linear superposition of multiple cloning and deleting states. Since the machine can perform cloning and deleting in a single unitary evolution, the probabilistic cloning and other cloning machines proposed in the previous literature can be thought of as special cases of our machine. A sufficient and necessary condition for successful cloning and deleting is presented, and it requires that the copies of an arbitrarily presumed number of the input states are linearly independent. This simply generalizes some results for cloning. We also derive an upper bound for the success probability of the cloning and deleting machine

  7. VenomKB, a new knowledge base for facilitating the validation of putative venom therapies.

    Science.gov (United States)

    Romano, Joseph D; Tatonetti, Nicholas P

    2015-11-24

    Animal venoms have been used for therapeutic purposes since the dawn of recorded history. Only a small fraction, however, have been tested for pharmaceutical utility. Modern computational methods enable the systematic exploration of novel therapeutic uses for venom compounds. Unfortunately, there is currently no comprehensive resource describing the clinical effects of venoms to support this computational analysis. We present VenomKB, a new publicly accessible knowledge base and website that aims to act as a repository for emerging and putative venom therapies. Presently, it consists of three database tables: (1) Manually curated records of putative venom therapies supported by scientific literature, (2) automatically parsed MEDLINE articles describing compounds that may be venom derived, and their effects on the human body, and (3) automatically retrieved records from the new Semantic Medline resource that describe the effects of venom compounds on mammalian anatomy. Data from VenomKB may be selectively retrieved in a variety of popular data formats, are open-source, and will be continually updated as venom therapies become better understood.

  8. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    Energy Technology Data Exchange (ETDEWEB)

    Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  9. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene; Saidi, Rabie; Hoehndorf, Robert; Martin, Maria J.; Solovyev, Victor

    2016-01-01

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  10. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene

    2016-07-08

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  11. Apoptosis-Inducing Effect of Three Medicinal Plants on Oral Cancer Cells KB and ORL-48

    Directory of Open Access Journals (Sweden)

    Mohd Zabidi Majid

    2014-01-01

    Full Text Available Brucea javanica, Azadirachta indica, and Typhonium flagelliforme are medicinal plants commonly used to treat conditions associated with tumour formation. This study aimed to determine the antiproliferative activity of these plants extracts on KB and ORL-48 oral cancer cell lines and to suggest their mode of cell death. The concentration producing 50% cell inhibition (IC50 was determined and the activity was examined under an inverted microscope. Immunohistochemistry fluorescent staining method (TUNEL was performed to indicate the mechanism of cell death and the fragmented DNA band pattern produced was obtained for verification. Compared to Azadirachta sp. and Typhonium sp., the antiproliferative activity of Brucea sp. extract was the most potent on both KB and ORL-48 cells with IC50 of 24.37 ± 1.75 and 6.67 ± 1.15 µg/mL, respectively. Signs of cell attrition were observed 24 hr after treatment. Green fluorescent spots indicating cell death by apoptosis were observed in images of both cells following treatment with all the three extracts. DNA fragments harvested from Brucea-treated cells produced bands in a ladder pattern suggesting the apoptotic effect of the extract. It is thus concluded that Brucea sp. extract exhibited cytotoxic activity on ORL-48 cells and their action mechanism is via apoptosis.

  12. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S.J.; Smith, T.J.; England, S.; Collins, F.; Davies, K.E.

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  13. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S J; Smith, T J; England, S; Collins, F; Davies, K E

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  14. Loss of retrovirus production in JB/RH melanoma cells transfected with H-2Kb and TAP-1 genes.

    Science.gov (United States)

    Li, M; Xu, F; Muller, J; Huang, X; Hearing, V J; Gorelik, E

    1999-01-20

    JB/RH1 melanoma cells, as well as other melanomas of C57BL/6 mice (B16 and JB/MS), express a common melanoma-associated antigen (MAA) encoded by an ecotropic melanoma-associated retrovirus (MelARV). JB/RH1 cells do not express the H-2Kb molecules due to down-regulation of the H-2Kb and TAP-1 genes. When JB/RH1 cells were transfected with the H-2Kb and cotransfected with the TAP-1 gene, it resulted in the appearance of H-2Kb molecules and an increase in their immunogenicity, albeit they lost expression of retrovirus-encoded MAA recognized by MM2-9B6 mAb. Loss of MAA was found to result from a complete and stable elimination of ecotropic MelARV production in the H-2Kb/TAP-1-transfected JB/RH1 cells. Northern blot analysis showed no differences in ecotropic retroviral messages in MelARV-producing and -nonproducing melanoma cells, suggesting that loss of MelARV production was not due to down-regulation of MelARV transcription. Southern blot analysis revealed several rearrangements in the proviral DNA of H-2Kb-positive JB/RH1 melanoma cells. Sequence analysis of the ecotropic proviral DNA from these cells showed numerous nucleotide substitutions, some of which resulted in the appearance of a novel intraviral PstI restriction site and the loss of a HindIII restriction site in the pol region. PCR amplification of the proviral DNAs indicates that an ecotropic provirus found in the H-2Kb-positive cells is novel and does not preexist in the parental H-2Kb-negative melanoma cells. Conversely, the ecotropic provirus of the parental JB/RH1 cells was not amplifable from the H-2Kb-positive cells. Our data indicate that stable loss of retroviral production in the H-2Kb/TAP-1-transfected melanoma cells is probably due to the induction of recombination between a productive ecotropic MelARV and a defective nonecotropic provirus leading to the generation of a defective ecotropic provirus and the loss of MelARV production and expression of the retrovirus-encoded MAA. Copyright 1999

  15. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway

    Science.gov (United States)

    KIM, JAE-SUNG; PARK, MI-RA; LEE, SOOK-YOUNG; KIM, DO KYOUNG; MOON, SUNG-MIN; KIM, CHUN SUNG; CHO, SEUNG SIK; YOON, GOO; IM, HEE-JEONG; YOU, JAE-SEEK; OH, JI-SU; KIM, SU-GWAN

    2014-01-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 μM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico-A-induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and −3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico-A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer. PMID:24337492

  16. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Mi-Ra; Lee, Sook-Young; Kim, Do Kyoung; Moon, Sung-Min; Kim, Chun Sung; Cho, Seung Sik; Yoon, Goo; Im, Hee-Jeong; You, Jae-Seek; Oh, Ji-Su; Kim, Su-Gwan

    2014-02-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 µM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico‑A‑induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and -3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico‑A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer.

  17. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking*

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-01-01

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. PMID:26453302

  18. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  19. Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

    Science.gov (United States)

    Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

    1996-03-01

    In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

  20. A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Y.; Li, X.M.; Shapiro, L.J. [UCSF School of Medicine, San Francisco, CA (United States)] [and others

    1994-09-01

    Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand, and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.

  1. Inflammatory peeling skin syndrome caused by homozygous genomic deletion in the PSORS1 region encompassing the CDSN gene.

    Science.gov (United States)

    Ishida-Yamamoto, Akemi; Furio, Laetitia; Igawa, Satomi; Honma, Masaru; Tron, Elodie; Malan, Valerie; Murakami, Masamoto; Hovnanian, Alain

    2014-01-01

    Peeling skin syndrome (PSS) type B is a rare recessive genodermatosis characterized by lifelong widespread, reddish peeling of the skin with pruritus. The disease is caused by small-scale mutations in the Corneodesmosin gene (CDSN) leading to premature termination codons. We report for the first time a Japanese case resulting from complete deletion of CDSN. Corneodesmosin was undetectable in the epidermis, and CDSN was unamplifiable by PCR. QMPSF analysis demonstrated deletion of CDSN exons inherited from each parent. Deletion mapping using microsatellite haplotyping, CGH array and PCR analysis established that the genomic deletion spanned 49-72 kb between HCG22 and TCF19, removing CDSN as well as five other genes within the psoriasis susceptibility region 1 (PSORS1) on 6p21.33. This observation widens the spectrum of molecular defects underlying PSS type B and shows that loss of these five genes from the PSORS1 region does not result in an additional cutaneous phenotype. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Fshb-iCre mice are efficient and specific Cre deleters for the gonadotrope lineage.

    Science.gov (United States)

    Wang, Huizhen; Hastings, Richard; Miller, William L; Kumar, T Rajendra

    2016-01-05

    Genetic analysis of development and function of the gonadotrope cell lineage within mouse anterior pituitary has been greatly facilitated by at least three currently available Cre strains in which Cre was either knocked into the Gnrhr locus or expressed as a transgene from Cga and Lhb promoters. However, in each case there are some limitations including CRE expression in thyrotropes within pituitary or ectopic expression outside of pituitary, for example in some populations of neurons or gonads. Hence, these Cre strains often pose problems with regard to undesirable deletion of alleles in non-gonadotrope cells, fertility and germline transmission of mutant alleles. Here, we describe generation and characterization of a new Fshb-iCre deleter strain using 4.7 kb of ovine Fshb promoter regulatory sequences driving iCre expression exclusively in the gonadotrope lineage within anterior pituitary. Fshb-iCre mice develop normally, display no ectopic CRE expression in gonads and are fertile. When crossed onto a loxP recombination-mediated red to green color switch reporter mouse genetic background, in vivo CRE recombinase activity is detectable in gonadotropes at more than 95% efficiency and the GFP-tagged gonadotropes readily purified by fluorescence activated cell sorting. We demonstrate the applicability of this Fshb-iCre deleter strain in a mouse model in which Dicer is efficiently and selectively deleted in gonadotropes. We further show that loss of DICER-dependent miRNAs in gonadotropes leads to profound suppression of gonadotropins resulting in male and female infertility. Thus, Fshb-iCre mice serve as a new genetic tool to efficiently manipulate gonadotrope-specific gene expression in vivo. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Phylogeography, salinity adaptations and metabolic potential of the Candidate Division KB1 Bacteria based on a partial single cell genome.

    Directory of Open Access Journals (Sweden)

    Lisa M Nigro

    2016-08-01

    Full Text Available Deep-sea hypersaline anoxic basins (DHABs and other hypersaline environments contain abundant and diverse microbial life that has adapted to these extreme conditions. The bacterial Candidate Division KB1 represents one of several uncultured groups that has been consistently observed in hypersaline microbial diversity studies. Here we report the phylogeography of KB1, its phylogenetic relationships to Candidate Division OP1 Bacteria, and its potential metabolic and osmotic stress adaptations based on a partial single cell amplified genome (SAG of KB1 from Orca Basin, the largest hypersaline seafloor brine basin in the Gulf of Mexico. Our results are consistent with the hypothesis – previously developed based on 14C incorporation experiments with mixed-species enrichments from Mediterranean seafloor brines - that KB1 has adapted its proteins to elevated intracellular salinity, but at the same time KB1 apparently imports glycine betaine; this compatible solute is potentially not limited to osmoregulation but could also serve as a carbon and energy source.

  4. STUDI NILAI ANAK, JUMLAH ANAK YANG DIINGINKAN, DAN KEIKUTSERTAAN ORANG TUA DALAM PROGRAM KB

    Directory of Open Access Journals (Sweden)

    Hartoyo Hartoyo

    2011-01-01

    Full Text Available  This research was to analyze the correlation between mother and family characteristics with value of children and the influence factors of demand for children and involvement of parent in family planning programme. This research involved 60 families who be acceptor and non-acceptor KB that were selected randomly. Mother’s age had significant correlation with power and influence dimension, working status of mother had significant correlation with stimulation and fun dimension and morality dimension, mother’s education had significant correlation with morality dimension, the number of living children had significant correlation with adult status and social identity dimension and economic utility and security in old age dimension. Moreover, family size variable had significant positive influence to demand for children. Beside that, age of mother’s first marriage and difference of the number of living children with demand for children had significant positive influence to participating family in family planning programme. 

  5. A 320 mV, 6 kb subthreshold 10T SRAM employing voltage lowering techniques

    International Nuclear Information System (INIS)

    Cai Jiangzheng; Zhang Sumin; Yuan Jia; Shang Xinchao; Chen Liming; Hei Yong

    2015-01-01

    This paper presents a 6 kb SRAM that uses a novel 10T cell to achieve a minimum operating voltage of 320 mV in a 130 nm CMOS process. A number of low power circuit techniques are included to enable the proposed SRAM to operate in the subthreshold region. The reverse short channel effect and the reverse narrow channel effect are utilized to improve the performance of the SRAM. A novel subthreshold pulse generation circuit produces an ideal pulse to make read operation stable. A floating write bit-line effectively reduces the standby leakage consumption. Finally, a short read bit-line makes the read operation fast and energy-saving. Measurements indicate that these techniques are effective, the SRAM can operate at 800 kHz and consume 1.94 μW at its lowest voltage (320 mV). (paper)

  6. A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach.

    Science.gov (United States)

    López-Girona, Elena; Zhang, Yu; Eduardo, Iban; Mora, José Ramón Hernández; Alexiou, Konstantinos G; Arús, Pere; Aranzana, María José

    2017-07-27

    In peach, the flat phenotype is caused by a partially dominant allele in heterozygosis (Ss), fruits from homozygous trees (SS) abort a few weeks after fruit setting. Previous research has identified a SSR marker (UDP98-412) highly associated with the trait, found suitable for marker assisted selection (MAS). Here we report a ∼10 Kb deletion affecting the gene PRUPE.6G281100, 400 Kb upstream of UDP98-412, co-segregating with the trait. This gene is a leucine-rich repeat receptor-like kinase (LRR-RLK) orthologous to the Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) group. PCR markers suitable for MAS confirmed its strong association with the trait in a collection of 246 cultivars. They were used to evaluate the DNA from a round fruit derived from a somatic mutation of the flat variety 'UFO-4', revealing that the mutation affected the flat associated allele (S). Protein BLAST alignment identified significant hits with genes involved in different biological processes. Best protein hit occurred with AtRLP12, which may functionally complement CLAVATA2, a key regulator that controls the stem cell population size. RT-PCR analysis revealed the absence of transcription of the partially deleted allele. The data support PRUPE.6G281100 as a candidate gene for flat shape in peach.

  7. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  8. Seven gene deletions in seven days

    DEFF Research Database (Denmark)

    Ingemann Jensen, Sheila; Lennen, Rebecca; Herrgard, Markus

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering ...

  9. Conditional Deletion of Pten Causes Bronchiolar Hyperplasia

    OpenAIRE

    Davé, Vrushank; Wert, Susan E.; Tanner, Tiffany; Thitoff, Angela R.; Loudy, Dave E.; Whitsett, Jeffrey A.

    2007-01-01

    Tumor suppressor phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a lipid phosphatase that regulates multiple cellular processes including cell polarity, migration, proliferation, and carcinogenesis. In this work, we demonstrate that conditional deletion of Pten (PtenΔ/Δ) in the respiratory epithelial cells of the developing mouse lung caused epithelial cell proliferation and hyperplasia as early as 4 to 6 weeks of age. While bronchiolar cell differentiation was normal, as in...

  10. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  11. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1.

    Science.gov (United States)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-04-04

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1.

  12. The reverse-mode NCX1 activity inhibitor KB-R7943 promotes prostate cancer cell death by activating the JNK pathway and blocking autophagic flux.

    Science.gov (United States)

    Long, Zhou; Chen, BaiJun; Liu, Qian; Zhao, Jiang; Yang, ZhenXing; Dong, XingYou; Xia, LiuBin; Huang, ShengQuan; Hu, XiaoYan; Song, Bo; Li, LongKun

    2016-07-05

    We explored the effects of KB-R7943, an inhibitor of reverse-mode NCX1 activity, in prostate cancer (PCa). NCX1 was overexpressed in PCa tissues and cell lines, and higher NCX1 levels were associated higher PCa grades. At concentrations greater than 10 μM, KB-R7943 dose-dependently decreased PC3 and LNCaP cell viability. KB-R7943 also increased cell cycle G1/S phase arrest and induced apoptosis in PC3 cells. KB-R7943 increased autophagosome accumulation in PCa cells as indicated by increases in LC3-II levels and eGFP-LC3 puncta. Combined treatment with chloroquine (CQ) and KB-R7943 decreased P62 and increased LC3-II protein levels in PC3 cells, indicating that KB-R7943 blocked autophagic flux. KB-R7943 induced autophagosome accumulation mainly by downregulating the PI3K/AKT/m-TOR pathway and upregulating the JNK pathway. In xenograft experiments, KB-R7943 inhibited tumor growth. Combined treatment with KB-R7943 and an autophagy inhibitor inhibited growth and increased apoptosis. These results indicate that KB-R7943 promotes cell death in PCa by activating the JNK signaling pathway and blocking autophagic flux.

  13. NcoI dimorphic site located 8kb 3' to the human apolipoprotein AIV (APOA4) gene

    Energy Technology Data Exchange (ETDEWEB)

    Coleman, R T; Malloy, M J; Kane, J P; Frossard, P M

    1988-02-11

    pA4C3 a 0.5kb fragment from the 3' end of the human apolipoprotein AIV cDNA was isolated from a human intestine cDNA library and cloned into the EcoRI site of the plasmid pUC18. NcoI (CCATGG) (New England Biolabs) detects a single two-allele polymorphism with a band at either 18.6kb or at 12.6kb. The human apolipoprotein AI-CIII-AIV gene complex has been assigned to the long arm of chromosome 11 by Southern blot analysis of human-Chinese hamster cell hybrids. Co-dominant segregation was demonstrated in one family of six individuals.

  14. Fluorescent Inhibitors as Tools To Characterize Enzymes: Case Study of the Lipid Kinase Phosphatidylinositol 4-Kinase IIIβ (PI4KB).

    Science.gov (United States)

    Humpolickova, Jana; Mejdrová, Ivana; Matousova, Marika; Nencka, Radim; Boura, Evzen

    2017-01-12

    The lipid kinase phosphatidylinositol 4-kinase IIIβ (PI4KB) is an essential host factor for many positive-sense single-stranded RNA (+RNA) viruses including human pathogens hepatitis C virus (HCV), Severe acute respiratory syndrome (SARS), coxsackie viruses, and rhinoviruses. Inhibitors of PI4KB are considered to be potential broad-spectrum virostatics, and it is therefore critical to develop a biochemical understanding of the kinase. Here, we present highly potent and selective fluorescent inhibitors that we show to be useful chemical biology tools especially in determination of dissociation constants. Moreover, we show that the coumarin-labeled inhibitor can be used to image PI4KB in cells using fluorescence-lifetime imaging microscopy (FLIM) microscopy.

  15. Na+/Ca2+ exchange inhibitor, KB-R7943, attenuates contrast-induced acute 
kidney injury.

    Science.gov (United States)

    Yang, Dingwei; Yang, Dingping; Jia, Ruhan; Tan, Jin

    2013-01-01

    Intracellular Ca2+ overload is considered to be a key factor in contrast-induced acute kidney injury (CI-AKI). The Na+/Ca2+ exchanger (NCX) system is one of the main pathways of intracellular Ca2+ overload. We investigated the effects of KB-R7943, an inhibitor of the reverse mode of NCX, on CI-AKI in a rat model. Rats were divided into control group, CI-AKI group and pretreatment groups (with KB-R7943 dose of 5 or 10 mg/kg). CI-AKI was induced by diatrizoate administration in rats with cholesterol-supplemented diet for 8 weeks. Renal function and renal hemodynamics were determined 1 day following contrast medium administration. Renal histopathology was observed by light microscope. Renal tubular apoptosis was examined by TUNEL. Renal endothelin-1 (ET-1) was measured by radioimmunoassay. Renal malondialdehyde (MDA) and catalase (CAT) were measured as oxidative markers. Levels of serum creatinine (Scr), renal ET-1, MDA and CAT, and resistance index (RI) of renal blood vessels increased significantly in CI-AKI rats. The 
increases in Scr and RI of renal blood vessels induced by diatrizoate were suppressed significantly and 
dose-dependently by pretreatment with KB-R7943. Histopathological and TUNEL results showed that 
the contrast medium-induced severe renal tubular 
necrosis and apoptosis were significantly and dose-dependently attenuated by KB-R7943. KB-R7943 significantly suppressed the increment of renal ET-1 content and MDA and CAT level induced by contrast medium administration. Activation of the reverse mode of NCX, followed by ET-1 overproduction and increased oxidative stress, seems to play an important role in the pathogenesis of CI-AKI. The inhibitor of the reverse mode of NCX, KB-R7943, has renoprotective effects on CI-AKI.

  16. Chemoresistance to 5-FU inhibited by 635 nm LED irradiation in CD133+ KB cell line.

    Science.gov (United States)

    Kim, Donghwi; Park, Mineon; Jang, Hyunwoong; Hyun, Hoon; Lim, Wonbong

    2018-01-01

    Consistent with cancer stem cell theory, a small fraction of cancer cells, described as cancer stem cells (CSCs), may promote tumor recurrence and anti-cancer drug resistance. Therefore, much effort has been devoted to the development of CSC targeted therapy to vanquish drug resistance. In this study, we have investigated the effect of multiple light-emitting diode (LED) irradiation treatments with conventional anti-cancer drugs on CSC-like oral cancer cells that acquired stemness by ectopic over expression of CD133. To evaluate combined LED irradiation anti-cancer drug effects, we investigated the chemosensitizing effect of 635 nm irradiation on 5-fluorouracil (5FU)-treated KB CD133+ and KB Vec cells, interrogating the underlying molecular mechanisms associated with stemness and apoptosis that are responsible for chemopreventive activity. In addition, combination therapy with LED irradiation and 5-FU treatment was carried out in KB CD133+ and KB Vec cell-inoculated mouse models. LED irradiation of 635 nm inhibited CSC-like properties consistent with a decrease in OCT4 and NANOG protein expression, reducing colony-forming ability. In addition, LED irradiation enhanced 5-FU-induced cytotoxicity and improved 5-FU chemosensitivity in KB CD133+ via enhancement of apoptosis. These findings were validated in vivo, wherein LED irradiation combined with 5-FU treatment inhibited tumor growth in KB CD133+ -inoculated mice. Collectively, our results provide novel evidence for 635 nm irradiation-induced 5-FU chemosensitization of CSC in oral cancer. In addition, this research highlights that 635 nm LED irradiation may serve as an adjunct treatment to conventional chemotherapeutic drugs in patients with oral cancer.

  17. rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts

    Science.gov (United States)

    Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.

    2016-01-01

    Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

  18. Melting relations in the Fe-rich portion of the system FeFeS at 30 kb pressure

    Science.gov (United States)

    Brett, R.; Bell, P.M.

    1969-01-01

    The melting relations of FeFeS mixtures covering the composition range from Fe to Fe67S33 have been determined at 30 kb pressure. The phase relations are similar to those at low pressure. The eutectic has a composition of Fe72.9S27.1 and a temperature of 990??C. Solubility of S in Fe at elevated temperatures at 30 kb is of the same order of magnitude as at low pressure. Sulfur may have significantly lowered the melting point of iron in the upper mantle during the period of coalescence of metal prior to core formation in the primitive earth. ?? 1969.

  19. A putative autonomous 20.5 kb-CACTA transposon insertion in an F3'H allele identifies a new CACTA transposon subfamily in Glycine max

    Directory of Open Access Journals (Sweden)

    Vodkin Lila

    2008-12-01

    Full Text Available Abstract Background The molecular organization of very few genetically defined CACTA transposon systems have been characterized thoroughly as those of Spm/En in maize, Tam1 of Antirrhinum majus Candystripe1 (Cs1 from Sorghum bicolor and CAC1 from Arabidopsis thaliana, for example. To date, only defective deletion derivatives of CACTA elements have been described for soybean, an economically important plant species whose genome sequence will be completed in 2008. Results We identified a 20.5 kb insertion in a soybean flavonoid 3'-hydroxylase (F3'H gene representing the t* allele (stable gray trichome color whose origin traces to a single mutable chimeric plant displaying both tawny and gray trichomes. This 20.5 kb insertion has the molecular structure of a putative autonomous transposon of the CACTA family, designated Tgmt*. It encodes a large gene that was expressed in two sister isolines (T* and tm of the stable gray line (t* from which Tgmt* was isolated. RT-PCR derived cDNAs uncovered the structure of a large precursor mRNA as well as alternatively spliced transcripts reminiscent of the TNPA-mRNA generated by the En-1 element of maize but without sequence similarity to the maize TNPA. The larger mRNA encodes a transposase with a tnp2 and TNP1-transposase family domains. Because the two soybean lines expressing Tgmt* were derived from the same mutable chimeric plant that created the stable gray trichome t* allele line from which the element was isolated, Tgmt* has the potential to be an autonomous element that was rapidly inactivated in the stable gray trichome t* line. Comparison of Tgmt* to previously described Tgm elements demonstrated that two subtypes of CACTA transposon families exist in soybean based on divergence of their characteristic subterminal repeated motifs and their transposases. In addition, we report the sequence and annotation of a BAC clone containing the F3'H gene (T locus which was interrupted by the novel Tgmt* element

  20. 46 CFR 67.171 - Deletion; requirement and procedure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Deletion; requirement and procedure. 67.171 Section 67...; Requirement for Exchange, Replacement, Deletion, Cancellation § 67.171 Deletion; requirement and procedure. (a... provided in § 67.161, and the vessel is subject to deletion from the roll of actively documented vessels...

  1. 19 CFR 142.49 - Deletion of C-4 Code.

    Science.gov (United States)

    2010-04-01

    .... Entry filers may delete C-4 Codes from Line Release by notifying the port director in writing on a Deletion Data Loading Sheet. Such notification shall state the C-4 Code which is to be deleted, the port... TREASURY (CONTINUED) ENTRY PROCESS Line Release § 142.49 Deletion of C-4 Code. (a) By Customs. A port...

  2. Finding cis-regulatory modules in Drosophila using phylogenetic hidden Markov models

    DEFF Research Database (Denmark)

    Wong, Wendy S W; Nielsen, Rasmus

    2007-01-01

    MOTIVATION: Finding the regulatory modules for transcription factors binding is an important step in elucidating the complex molecular mechanisms underlying regulation of gene expression. There are numerous methods available for solving this problem, however, very few of them take advantage of th...

  3. Piecing together cis-regulatory networks: insights from epigenomics studies in plants.

    Science.gov (United States)

    Huang, Shao-Shan C; Ecker, Joseph R

    2018-05-01

    5-Methylcytosine, a chemical modification of DNA, is a covalent modification found in the genomes of both plants and animals. Epigenetic inheritance of phenotypes mediated by DNA methylation is well established in plants. Most of the known mechanisms of establishing, maintaining and modifying DNA methylation have been worked out in the reference plant Arabidopsis thaliana. Major functions of DNA methylation in plants include regulation of gene expression and silencing of transposable elements (TEs) and repetitive sequences, both of which have parallels in mammalian biology, involve interaction with the transcriptional machinery, and may have profound effects on the regulatory networks in the cell. Methylome and transcriptome dynamics have been investigated in development and environmental responses in Arabidopsis and agriculturally and ecologically important plants, revealing the interdependent relationship among genomic context, methylation patterns, and expression of TE and protein coding genes. Analyses of methylome variation among plant natural populations and species have begun to quantify the extent of genetic control of methylome variation vs. true epimutation, and model the evolutionary forces driving methylome evolution in both short and long time scales. The ability of DNA methylation to positively or negatively modulate binding affinity of transcription factors (TFs) provides a natural link from genome sequence and methylation changes to transcription. Technologies that allow systematic determination of methylation sensitivities of TFs, in native genomic and methylation context without confounding factors such as histone modifications, will provide baseline datasets for building cell-type- and individual-specific regulatory networks that underlie the establishment and inheritance of complex traits. This article is categorized under: Laboratory Methods and Technologies > Genetic/Genomic Methods Biological Mechanisms > Regulatory Biology. © 2017 Wiley Periodicals, Inc.

  4. Confocal quantification of cis-regulatory reporter gene expression in living sea urchin.

    Science.gov (United States)

    Damle, Sagar; Hanser, Bridget; Davidson, Eric H; Fraser, Scott E

    2006-11-15

    Quantification of GFP reporter gene expression at single cell level in living sea urchin embryos can now be accomplished by a new method of confocal laser scanning microscopy (CLSM). Eggs injected with a tissue-specific GFP reporter DNA construct were grown to gastrula stage and their fluorescence recorded as a series of contiguous Z-section slices that spanned the entire embryo. To measure the depth-dependent signal decay seen in the successive slices of an image stack, the eggs were coinjected with a freely diffusible internal fluorescent standard, rhodamine dextran. The measured rhodamine fluorescence was used to generate a computational correction for the depth-dependent loss of GFP fluorescence per slice. The intensity of GFP fluorescence was converted to the number of GFP molecules using a conversion constant derived from CLSM imaging of eggs injected with a measured quantity of GFP protein. The outcome is a validated method for accurately counting GFP molecules in given cells in reporter gene transfer experiments, as we demonstrate by use of an expression construct expressed exclusively in skeletogenic cells.

  5. Systematic identification of cis-regulatory sequences active in mouse and human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Marica Grskovic

    2007-08-01

    Full Text Available Understanding the transcriptional regulation of pluripotent cells is of fundamental interest and will greatly inform efforts aimed at directing differentiation of embryonic stem (ES cells or reprogramming somatic cells. We first analyzed the transcriptional profiles of mouse ES cells and primordial germ cells and identified genes upregulated in pluripotent cells both in vitro and in vivo. These genes are enriched for roles in transcription, chromatin remodeling, cell cycle, and DNA repair. We developed a novel computational algorithm, CompMoby, which combines analyses of sequences both aligned and non-aligned between different genomes with a probabilistic segmentation model to systematically predict short DNA motifs that regulate gene expression. CompMoby was used to identify conserved overrepresented motifs in genes upregulated in pluripotent cells. We show that the motifs are preferentially active in undifferentiated mouse ES and embryonic germ cells in a sequence-specific manner, and that they can act as enhancers in the context of an endogenous promoter. Importantly, the activity of the motifs is conserved in human ES cells. We further show that the transcription factor NF-Y specifically binds to one of the motifs, is differentially expressed during ES cell differentiation, and is required for ES cell proliferation. This study provides novel insights into the transcriptional regulatory networks of pluripotent cells. Our results suggest that this systematic approach can be broadly applied to understanding transcriptional networks in mammalian species.

  6. Genetic mapping of the LOBED LEAF 1 (ClLL1) gene to a 127.6-kb region in watermelon (Citrullus lanatus L.).

    Science.gov (United States)

    Wei, Chunhua; Chen, Xiner; Wang, Zhongyuan; Liu, Qiyan; Li, Hao; Zhang, Yong; Ma, Jianxiang; Yang, Jianqiang; Zhang, Xian

    2017-01-01

    The lobed leaf character is a unique morphologic trait in crops, featuring many potential advantages for agricultural productivity. Although the majority of watermelon varieties feature lobed leaves, the genetic factors responsible for lobed leaf formation remain elusive. The F2:3 leaf shape segregating population offers the opportunity to study the underlying mechanism of lobed leaf formation in watermelon. Genetic analysis revealed that a single dominant allele (designated ClLL1) controlled the lobed leaf trait. A large-sized F3:4 population derived from F2:3 individuals was used to map ClLL1. A total of 5,966 reliable SNPs and indels were identified genome-wide via a combination of BSA and RNA-seq. Using the validated SNP and indel markers, the location of ClLL1 was narrowed down to a 127.6-kb region between markers W08314 and W07061, containing 23 putative ORFs. Expression analysis via qRT-PCR revealed differential expression patterns (fold-changes above 2-fold or below 0.5-fold) of three ORFs (ORF3, ORF11, and ORF18) between lobed and non-lobed leaf plants. Based on gene annotation and expression analysis, ORF18 (encoding an uncharacterized protein) and ORF22 (encoding a homeobox-leucine zipper-like protein) were considered as most likely candidate genes. Furthermore, sequence analysis revealed no polymorphisms in cDNA sequences of ORF18; however, two notable deletions were identified in ORF22. This study is the first report to map a leaf shape gene in watermelon and will facilitate cloning and functional characterization of ClLL1 in future studies.

  7. Rapid deletion production in fungi via Agrobacterium mediated transformation of OSCAR deletion contructs.

    Science.gov (United States)

    Precise deletion of gene(s) of interest, while leaving the rest of the genome unchanged, provides the ideal product to determine that particular gene’s function in the living organism. In this protocol we describe the OSCAR method of precise and rapid deletion plasmid construction. OSCAR relies on t...

  8. The fate of deleted DNA produced during programmed genomic deletion events in Tetrahymena thermophila.

    Science.gov (United States)

    Saveliev, S V; Cox, M M

    1994-01-01

    Thousands of DNA deletion events occur during macronuclear development in the ciliate Tetrahymena thermophila. In two deleted genomic regions, designated M and R, the eliminated sequences form circles that can be detected by PCR. However, the circles are not normal products of the reaction pathway. The circular forms occur at very low levels in conjugating cells, but are stable. Sequencing analysis showed that many of the circles (as many as 50% of those examined) reflected a precise deletion in the M and R regions. The remaining circles were either smaller or larger and contained varying lengths of sequences derived from the chromosomal DNA surrounding the eliminated region. The chromosomal junctions left behind after deletion were more precise, although deletions in either the M or R regions can generate any of several alternative junctions (1). Some new chromosomal junctions were detected in the present study. The results suggest that the deleted segment is released as a linear DNA species that is degraded rapidly. The species is only rarely converted to the stable circles we detect. The deletion mechanism is different from those proposed for deletion events in hypotrichous ciliates (2-4), and does not reflect a conservative site-specific recombination process such as that promoted by the bacteriophage lambda integrase (5). Images PMID:7838724

  9. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    FluKB is a knowledge-based system focusing on data and analytical tools for influenza vaccine discovery. The main goal of FluKB is to provide access to curated influenza sequence and epitope data and enhance the analysis of influenza sequence diversity and the analysis of targets of immune...... responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  10. Novel contiguous gene deletion in peruvian girl with Trichothiodystrophy type 4 and glutaric aciduria type 3.

    Science.gov (United States)

    La Serna-Infantes, Jorge; Pastor, Miguel Chávez; Trubnykova, Milana; Velásquez, Félix Chavesta; Sotomayor, Flor Vásquez; Barriga, Hugo Abarca

    2018-02-05

    Trichothiodystrophy type 4 is a rare autosomal recessive and ectodermal disorder, characterized by dry, brittle, sparse and sulfur-deficient hair and other features like intellectual disability, ichthyotic skin and short stature, caused by a homozygous mutation in MPLKIP gene. Glutaric aciduria type 3 is caused by a homozygous mutation in SUGCT gene with no distinctive phenotype. Both genes are localized on chromosome 7 (7p14). We report an 8-year-old female with short stature, microcephaly, development delay, intellectual disability and hair characterized for dark, short, coarse, sparse and brittle associated to classical trichorrhexis microscopy pattern. Chromosome microarray analysis showed a 125 kb homozygous pathogenic deletion, which includes genes MPLKIP and SUGCT, not described before. This is the first case described in Peru of a novel contiguous gene deletion of Trichothiodystrophy type 4 and Glutaric aciduria type 3 performed by chromosome microarray analysis, highlighting the contribution and importance of molecular technologies on diagnosis of rare genetic conditions. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  11. Atherosclerotic lesions and mitochondria DNA deletions in brain microvessels: implication in the pathogenesis of Alzheimer's disease.

    Science.gov (United States)

    Aliev, Gjumrakch; Gasimov, Eldar; Obrenovich, Mark E; Fischbach, Kathryn; Shenk, Justin C; Smith, Mark A; Perry, George

    2008-01-01

    The pathogenesis that is primarily responsible for Alzheimer's disease (AD) and cerebrovascular accidents (CVA) appears to involve chronic hypoperfusion. We studied the ultrastructural features of vascular lesions and mitochondria in brain vascular wall cells from human AD biopsy samples and two transgenic mouse models of AD, yeast artificial chromosome (YAC) and C57B6/SJL Tg (+), which overexpress human amyloid beta precursor protein (AbetaPP). In situ hybridization using probes for normal and 5 kb deleted human and mouse mitochondrial DNA (mtDNA) was performed along with immunocytochemistry using antibodies against the Abeta peptide processed from AbetaPP, 8-hydroxy-2'-guanosine (8OHG), and cytochrome c oxidase (COX). More amyloid deposition, oxidative stress markers as well as mitochondrial DNA deletions and structural abnormalities were present in the vascular walls of the human AD samples and the AbetaPP-YAC and C57B6/SJL Tg (+) transgenic mice compared to age-matched controls. Ultrastructural damage in perivascular cells highly correlated with endothelial lesions in all samples. Therefore, pharmacological interventions, directed at correcting the chronic hypoperfusion state, may change the natural course of the development of dementing neurodegeneration.

  12. Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

    Science.gov (United States)

    Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

    2017-03-01

    This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

  13. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  14. Identification of the first de novo PAR1 deletion downstream of SHOX in an individual diagnosed with Léri-Weill dyschondrosteosis (LWD).

    Science.gov (United States)

    Barroso, Eva; Benito-Sanz, Sara; Belinchón, Alberta; Yuste-Checa, Patricia; Gracia, Ricardo; Aragones, Angel; Campos-Barros, Angel; Heath, Karen E

    2010-01-01

    Léri-Weill dyschondrosteosis (LWD, MIM 127300), is a dominantly inherited skeletal dysplasia with disproportionate short stature, mesomelic limb shortening, and the characteristic Madelung deformity. Two regions of the pseudoautosomal region 1 (PAR1) have been shown to be involved in LWD, SHOX (short-stature homeobox-containing gene) and the downstream enhancer region. We report our genetic findings of a young girl clinically diagnosed with LWD. We analyzed the proband and her family using MLPA and microsatellite analysis. We identified a deletion, 726-866 kb in size, of the downstream SHOX enhancer region in the proband. Neither parent carried the deletion. Microsatellite analysis showed that the deleted allele was of paternal origin. The mutation is more likely to have arisen from a de novo event but paternal gonadal mosaicism cannot be excluded. In conclusion, we report the clinical and molecular details of the first case of a de novo deletion of the downstream PAR1 region in an LWD individual. De novo deletions of SHOX and the downstream enhancer region must be therefore considered in cases of isolated LWD. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  15. A novel deletion in the thyrotropin Beta-subunit gene identified by array comparative genomic hybridization analysis causes central congenital hypothyroidism in a boy originating from Turkey.

    Science.gov (United States)

    Hermanns, Pia; Couch, Robert; Leonard, Norma; Klotz, Cherise; Pohlenz, Joachim

    2014-01-01

    Isolated central congenital hypothyroidism (ICCH) is rare but important. Most ICCH patients are diagnosed later, which results in severe growth failure and intellectual disability. We describe a boy with ICCH due to a large homozygous TSHβ gene deletion. A 51-day-old male Turkish infant, whose parents were first cousins, was admitted for evaluation of prolonged jaundice. His clinical appearance was compatible with hypothyroidism. Venous thyrotropin (TSH) was undetectably low, with a subsequent low free T4 and a low free T3, suggestive of central hypothyroidism. Using different PCR protocols, we could not amplify both coding exons of the boy's TSHβ gene, which suggested a deletion. An array comparative genomic hybridization (aCGH) using specific probes around the TSHβ gene locus showed him to be homozygous for a 6-kb deletion spanning all exons and parts of the 5' untranslated region of the gene. Infants who are clinically suspected of having hypothyroidism should be evaluated thoroughly, even if their TSH-based screening result is normal. In cases with ICCH and undetectably low TSH serum concentrations, a TSHβ gene deletion should be considered; aCGH should be performed when gene deletions are suspected. In such cases, PCR-based sequencing techniques give negative results.

  16. The gene for replication factor C subunit 2 (RFC2) is within the 7q11.23 Williams syndrome deletion

    Energy Technology Data Exchange (ETDEWEB)

    Peoples, R.; Perez-Jurado, L.; Francke, U.; Yu-Ker Wang [Stanford Univ. Medical Center, CA (United States); Kaplan, P. [Children`s Hospital of Philadelphia, PA (United States)

    1996-06-01

    Williams syndrome (WS) is a developmental disorder with multiple system manifestations, including supraval var aortic stenosis (SVAS), peripheral pulmonic stenosis, connective tissue abnormalities, short stature, characteristic personality profile and cognitive deficits, and variable hypercalcemia in infancy. It is caused by heterozygosity for a chromosomal deletion of part of band 7q11.23 including the elastin locus (ELN). Since disruption of the ELN gene causes autosomal dominant SVAS, it is assumed that ELN haploinsufficiency is responsible for the cardiovascular features of WS. The deletion that extends from the ELN locus in both directions is {ge}200 kb in size, although estimates of {ge}2 Mb are suggested by high-resolution chromosome banding and physical mapping studies. We have searched for additional dosage-sensitive genes within the deletion that may be responsible for the noncardiovascular features. We report here that the gene for replication factor C subunit 2 (RFC2) maps within the WS deletion region and was found to be deleted in all of 18 WS patients studied. The protein product of RFC2 is part of a multimeric complex involved in DNA elongation during replication. 14 refs., 3 figs.

  17. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits.

    Science.gov (United States)

    Jia, Bei; Huang, Liping; Chen, Yaoyu; Liu, Siping; Chen, Cuihua; Xiong, Ke; Song, Lanlin; Zhou, Yulai; Yang, Xinping; Zhong, Mei

    2017-12-01

    Contiguous microdeletions of the Norrie disease pseudoglioma (NDP) region on chromosome Xp11.3 have been widely confirmed as contributing to the typical clinical features of Norrie disease (ND). However, the precise relation between genotype and phenotype could vary. The contiguous deletion of NDP and its neighbouring genes, MAOA/B and EFHC2, reportedly leads to syndromic clinical features such as microcephaly, intellectual disability, and epilepsy. Herewe report a novel contiguous microdeletion of the NDP region containing the MAOB and EFHC2 genes,which causes eye defects but no cognitive disability.We detected a deletion of 494.6 kb atXp11.3 in both the proband and carrier mother. This deletionwas then used as the molecular marker in prenatal diagnosis for two subsequent pregnancies. The deletion was absent in one of the foetuses, who remain without any abnormalities at 2 years of age. The proband shows the typical ocular clinical features of ND including bilateral retinal detachment, microphthalmia, atrophic irides, corneal opacification, and cataracts, but no symptoms of microcephaly, intellectual disability, and epilepsy. This familial study demonstrates that a deficiency in one of two MAO genes may not lead to psychomotor delay, and deletion of EFHC2 may not cause epilepsy. Our observations provide new information on the genotype-phenotype relations of MAOA/B and EFHC2 genes involved in the contiguous deletions of ND.

  18. Reduced expression of APC-1B but not APC-1A by the deletion of promoter 1B is responsible for familial adenomatous polyposis.

    Science.gov (United States)

    Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi

    2016-05-24

    Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.

  19. Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

    Science.gov (United States)

    Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

    2009-09-01

    We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

  20. Small mosaic deletion encompassing the snoRNAs and SNURF-SNRPN results in an atypical Prader-Willi syndrome phenotype.

    Science.gov (United States)

    Anderlid, Britt-Marie; Lundin, Johanna; Malmgren, Helena; Lehtihet, Mikael; Nordgren, Ann

    2014-02-01

    Genetic analyses were performed in a male patient with suspected Prader-Willi syndrome who presented with hypogonadism, excessive eating, central obesity, small hands and feet and cognition within the low normal range. However, he had no neonatal hypotonia or feeding problems during infancy. Chromosome analysis showed a normal male karyotype. Further analysis with array-CGH identified a mosaic 847 kb deletion in 15q11-q13, including SNURF-SNRPN, the snoRNA gene clusters SNORD116 (HBII-85), SNORD115, (HBII-52), SNORD109 A and B (HBII-438A and B), SNORD64 (HBII-13), and NPAP1 (C15ORF2). MLPA confirmed the deletion and the results were compatible with a paternal origin. Metaphase-FISH verified the mosaicism with the deletion present in 58% of leukocytes analyzed. Three smaller deletions in this region have previously been reported in patients with Prader-Willi syndrome phenotype. All three deletions included SNORD116, but only two encompassed parts of SNURF-SNRPN, implicating SNORD116 as the major contributor to the Prader-Willi phenotype. Our case adds further information about genotype-phenotype correlation and supports the hypothesis that SNORD116 plays a major role in the pathogenesis of Prader-Willi syndrome. Furthermore, it examplifies diagnostic difficulties in atypical cases and illustrates the need for additional testing methods when Prader-Willi syndrome is suspected. © 2013 Wiley Periodicals, Inc.

  1. Analysis of gene and protein name synonyms in Entrez Gene and UniProtKB resources

    KAUST Repository

    Arkasosy, Basil

    2013-05-11

    Ambiguity in texts is a well-known problem: words can carry several meanings, and hence, can be read and interpreted differently. This is also true in the biological literature; names of biological concepts, such as genes and proteins, might be ambiguous, referring in some cases to more than one gene or one protein, or in others, to both genes and proteins at the same time. Public biological databases give a very useful insight about genes and proteins information, including their names. In this study, we made a thorough analysis of the nomenclatures of genes and proteins in two data sources and for six different species. We developed an automated process that parses, extracts, processes and stores information available in two major biological databases: Entrez Gene and UniProtKB. We analysed gene and protein synonyms, their types, frequencies, and the ambiguities within a species, in between data sources and cross-species. We found that at least 40% of the cross-species ambiguities are caused by names that are already ambiguous within the species. Our study shows that from the six species we analysed (Homo Sapiens, Mus Musculus, Arabidopsis Thaliana, Oryza Sativa, Bacillus Subtilis and Pseudomonas Fluorescens), rice (Oriza Sativa) has the best naming model in Entrez Gene database, with low ambiguities between data sources and cross-species.

  2. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking.

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-12-18

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Internally deleted WNV genomes isolated from exotic birds in New Mexico: function in cells, mosquitoes, and mice.

    Science.gov (United States)

    Pesko, Kendra N; Fitzpatrick, Kelly A; Ryan, Elizabeth M; Shi, Pei-Yong; Zhang, Bo; Lennon, Niall J; Newman, Ruchi M; Henn, Matthew R; Ebel, Gregory D

    2012-05-25

    Most RNA viruses exist in their hosts as a heterogeneous population of related variants. Due to error prone replication, mutants are constantly generated which may differ in individual fitness from the population as a whole. Here we characterize three WNV isolates that contain, along with full-length genomes, mutants with large internal deletions to structural and nonstructural protein-coding regions. The isolates were all obtained from lorikeets that died from WNV at the Rio Grande Zoo in Albuquerque, NM between 2005 and 2007. The deletions are approximately 2kb, in frame, and result in the elimination of the complete envelope, and portions of the prM and NS-1 proteins. In Vero cell culture, these internally deleted WNV genomes function as defective interfering particles, reducing the production of full-length virus when introduced at high multiplicities of infection. In mosquitoes, the shortened WNV genomes reduced infection and dissemination rates, and virus titers overall, and were not detected in legs or salivary secretions at 14 or 21 days post-infection. In mice, inoculation with internally deleted genomes did not attenuate pathogenesis relative to full-length or infectious clone derived virus, and shortened genomes were not detected in mice at the time of death. These observations provide evidence that large deletions may occur within flavivirus populations more frequently than has generally been appreciated and suggest that they impact population phenotype minimally. Additionally, our findings suggest that highly similar mutants may frequently occur in particular vertebrate hosts. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Deletion Genotypes Reduce Occlusion Body Potency but Increase Occlusion Body Production in a Colombian Spodoptera frugiperda Nucleopolyhedrovirus Population

    Science.gov (United States)

    Barrera, Gloria; Williams, Trevor; Villamizar, Laura; Caballero, Primitivo; Simón, Oihane

    2013-01-01

    A Colombian field isolate (SfCOL-wt) of Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) is a mixture of different genotypes. To evaluate the insecticidal properties of the different genotypic variants, 83 plaque purified virus were characterized. Ten distinct genotypes were identified (named A through J). SfCOL-A was the most prevalent (71±2%; mean ± SE) showing a PstI restriction profile indistinguishable to that of SfCOL-wt. The remaining nine genotypes presented genomic deletions of 3.8 - 21.8 Kb located mainly between nucleotides 11,436 and 33,883 in the reference genome SfMNPV-B, affecting the region between open reading frames (ORFs) sf20 and sf33. The insecticidal activity of each genotype from SfCOL-wt and several mixtures of genotypes was compared to that of SfCOL-wt. The potency of SfCOL-A occlusion bodies (OBs) was 4.4-fold higher than SfCOL-wt OBs, whereas the speed of kill of SfCOL-A was similar to that of SfCOL-wt. Deletion genotype OBs were similarly or less potent than SfCOL-wt but six deletion genotypes were faster killing than SfCOL-wt. The potency of genotype mixtures co-occluded within OBs were consistently reduced in two-genotype mixtures involving equal proportions of SfCOL-A and one of three deletion genotypes (SfCOL-C, -D or -F). Speed of kill and OB production were improved only when the certain genotype mixtures were co-occluded, although OB production was higher in the SfCOL-wt isolate than in any of the component genotypes, or mixtures thereof. Deleted genotypes reduced OB potency but increased OB production of the SfCOL-wt population, which is structured to maximize the production of OBs in each infected host. PMID:24116220

  5. Deletion genotypes reduce occlusion body potency but increase occlusion body production in a Colombian Spodoptera frugiperda nucleopolyhedrovirus population.

    Directory of Open Access Journals (Sweden)

    Gloria Barrera

    Full Text Available A Colombian field isolate (SfCOL-wt of Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV is a mixture of different genotypes. To evaluate the insecticidal properties of the different genotypic variants, 83 plaque purified virus were characterized. Ten distinct genotypes were identified (named A through J. SfCOL-A was the most prevalent (71±2%; mean ± SE showing a PstI restriction profile indistinguishable to that of SfCOL-wt. The remaining nine genotypes presented genomic deletions of 3.8 - 21.8 Kb located mainly between nucleotides 11,436 and 33,883 in the reference genome SfMNPV-B, affecting the region between open reading frames (ORFs sf20 and sf33. The insecticidal activity of each genotype from SfCOL-wt and several mixtures of genotypes was compared to that of SfCOL-wt. The potency of SfCOL-A occlusion bodies (OBs was 4.4-fold higher than SfCOL-wt OBs, whereas the speed of kill of SfCOL-A was similar to that of SfCOL-wt. Deletion genotype OBs were similarly or less potent than SfCOL-wt but six deletion genotypes were faster killing than SfCOL-wt. The potency of genotype mixtures co-occluded within OBs were consistently reduced in two-genotype mixtures involving equal proportions of SfCOL-A and one of three deletion genotypes (SfCOL-C, -D or -F. Speed of kill and OB production were improved only when the certain genotype mixtures were co-occluded, although OB production was higher in the SfCOL-wt isolate than in any of the component genotypes, or mixtures thereof. Deleted genotypes reduced OB potency but increased OB production of the SfCOL-wt population, which is structured to maximize the production of OBs in each infected host.

  6. Prader-Willi syndrome and atypical submicroscopic 15q11-q13 deletions with or without imprinting defects.

    Science.gov (United States)

    Hassan, Maaz; Butler, Merlin G

    2016-11-01

    We report a 20 year follow up on a Caucasian female, now 26 years of age, with Prader-Willi syndrome (PWS) harboring an atypical 15q11-q13 submicroscopic deletion of 100-200 kb in size first detected in 1996 involving the imprinting center, SNRPN gene and surrounding region. PWS is a rare complex disorder caused by the loss of paternally expressed genes in the 15q11-q13 region. With high resolution chromosomal microarray and methylation - specific MLPA analysis, we updated the genetic findings on our patient and found a 209,819bp deletion including the SNURF-SNRPN gene complex which includes the imprinting center and the SNORD116 region. We compared with four other similarly reported individuals in the literature with atypical submicroscopic deletions within this region but without imprinting center involvement to better characterize the specific genetic lesions causing PWS clinical findings. Clinically, our patient met the diagnostic criteria of PWS including infantile hypotonia, a poor suck with feeding difficulties, global developmental delays and later food foraging, childhood obesity, small hands and skin picking. Small atypical deletions of comparable sizes were seen in the 15q11-q13 region in all five cases and similar behavioral/physical characteristics were found despite an imprinting defect in our patient. These results further support an overlapping critical deletion region involving the non-coding snoRNA SNORD116 in common in the five individuals playing a key role in contributing to the PWS phenotype. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  7. 9q22 Deletion - First Familial Case

    Directory of Open Access Journals (Sweden)

    Yamamoto Toshiyuki

    2011-06-01

    Full Text Available Abstract Background Only 29 cases of constitutional 9q22 deletions have been published and all have been sporadic. Most associate with Gorlin syndrome or nevoid basal cell carcinoma syndrome (NBCCS, MIM #109400 due to haploinsufficiency of the PTCH1 gene (MIM *601309. Methods and Results We report two mentally retarded female siblings and their cognitively normal father, all carrying a similar 5.3 Mb microdeletion at 9q22.2q22.32, detected by array CGH (244 K. The deletion does not involve the PTCH1 gene, but instead 30 other gene,s including the ROR2 gene (MIM *602337 which causing both brachydactyly type 1 (MIM #113000 and Robinow syndrome (MIM #268310, and the immunologically active SYK gene (MIM *600085. The deletion in the father was de novo and FISH analysis of blood lymphocytes did not suggest mosaicism. All three patients share similar mild dysmorphic features with downslanting palpebral fissures, narrow, high bridged nose with small nares, long, deeply grooved philtrum, ears with broad helix and uplifted lobuli, and small toenails. All have significant dysarthria and suffer from continuous middle ear and upper respiratory infections. The father also has a funnel chest and unilateral hypoplastic kidney but the daughters have no malformations. Conclusions This is the first report of a familial constitutional 9q22 deletion and the first deletion studied by array-CGH which does not involve the PTCH1 gene. The phenotype and penetrance are variable and the deletion found in the cognitively normal normal father poses a challenge in genetic counseling.

  8. Deletion 22q13.3 syndrome

    Directory of Open Access Journals (Sweden)

    Phelan Mary C

    2008-05-01

    Full Text Available Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH or array comparative genomic hybridization (CGH is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy. Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements

  9. Some analogies between quantum cloning and quantum deleting

    International Nuclear Information System (INIS)

    Qiu Daowen

    2002-01-01

    We further verify the impossibility of deleting an arbitrary unknown quantum state, and also show it is impossible to delete two nonorthogonal quantum states as a consequence of unitarity of quantum mechanics. A quantum approximate (deterministic) deleting machine and a probabilistic (exact) deleting machine are constructed. The estimation for the global fidelity characterizing the efficiency of the quantum approximate deleting is given. We then demonstrate that unknown nonorthogonal states chosen from a set with their multiple copies can evolve into a linear superposition of multiple deletions and failure branches by a unitary process if and only if the states are linearly independent. It is notable that the proof for necessity is somewhat different from Pati's [Phys. Rev. Lett. 83, 2849 (1999)]. Another deleting machine for the input states that are unnecessarily linearly independent is also presented. The bounds on the success probabilities of these deleting machines are derived. So we expound some preliminary analogies between quantum cloning and deleting

  10. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Shawana Kamran

    2015-01-01

    Full Text Available The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL. The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9(q23;q34. Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH studies, and Chromosomal Microarray Analysis (CMA. The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9(q24;q34 and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL.

  12. A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene.

    Science.gov (United States)

    Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B

    2000-09-01

    Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.

  13. Reactive oxygen species are crucial for hydroxychavicol toxicity toward KB epithelial cells.

    Science.gov (United States)

    Jeng, J H; Wang, Y J; Chang, W H; Wu, H L; Li, C H; Uang, B J; Kang, J J; Lee, J J; Hahn, L J; Lin, B R; Chang, M C

    2004-01-01

    Betel quid (BQ) chewing shows a strong correlation to the incidence of oral submucous fibrosis (OSF), leukoplakia and oral cancer. BQ contains mainly areca nut, lime, Piper betle leaf (PBL) and the inflorescence of P. betle (IPB). Hydroxychavicol (4-allyl-catechol, HC), as a major phenolic compound in PBL and IPB, is shown to induce oxidative stress, glutathione (GSH) depletion and cell cycle deregulation. Using bivariate BrdU/PI flow cytometry, KB cells in DNA synthesis (S phase) are shown to be sensitive to the toxic effect of HC and show cell cycle arrest and apoptosis following exposure to 0.1 and 0.3 mM HC. HC-induced apoptosis and cell cycle arrest are associated with mitochondrial membrane potential (delta Psim) depolarization as revealed by a decrease in rhodamine fluorescence. N-acetyl-L-cysteine (1 mM), superoxide dismutase (100 U/ml) and catalase (1000 U/ml) were effective in prevention of HC-induced GSH depletion (as indicated by chloromethylfluorescein fluorescence), reactive oxygen species (ROS) production (by dichlorofluorescein fluorescence), cell cycle arrest and apoptosis. However, dimethylthiourea (2 mM), neocuproine (1 mM), 1,10-phenanthroline (200 microM) and desferrioxamine (0.5 mM) showed little effect on HC-induced cell changes. HC elevated the cellular and mitochondrial GSH levels at moderate concentrations (0.05-0.1 mM), whereas at a concentration of 0.3 mM, inhibitory effects were noted. These results indicate that HC consumption may be associated with BQ-chewing-related oral mucosal diseases via GSH depletion, ROS production, mitochondrial dysfunction, cell cycle disturbance and the induction of apoptosis. These events are related to the production of superoxide radicals and hydrogen peroxide.

  14. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  15. Protective effect of Na(+)/Ca (2+) exchange blocker KB-R7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rats.

    Science.gov (United States)

    Lv, Yan; Ren, Yongkui; Sun, Lufan; Wang, Shaojun; Wei, Minjie; Jia, Dalin

    2013-06-01

    Reverse-mode activation of the Na(+)/Ca(2+) exchanger (NCX) during reperfusion following ischemia contributes to Ca(2+) overload and cardiomyocyte injury. KB-R7943, a selective reverse-mode NCX inhibitor, reduces lethal reperfusion injury under non-ischemic conditions. However, the effectiveness of this compound under ischemic conditions is unclear. In the present study, we studied the effects of KB-R7943 in an animal model of hyperlipidemia. We further assessed whether the K ATP (+) channels are involved in potential protective mechanisms of KB-R7943. Twelve rats were fed normal chow, while 48 animals were fed a high cholesterol diet. The hearts from the control and hypercholesterolemic rats were subjected to 25 min of global ischemia followed by a 120-min reperfusion. Before this, hearts from hypercholesterolemic rats either received no intervention (cholesterol control group) or were pre-treated with 1 μM KB-R7943 and 0.3 μM of K ATP (+) blocker glibenclamide or glibenclamide alone. The infarction sizes (triphenyltetrazolium assay) were 35 ± 5.0 % in the control group, 46 ± 8.7 % in the cholesterol control group (p KB-R7943 group (p KB-R7943 and glibenclamide group, and 47 ± 8.5 % in the glibenclamide group (p KB-R7943 attenuated the magnitude of cell apoptosis (p KB-R7943 reduces the infarction size and apoptosis in hyperlipidemic animals through the activation of K ATP (+) channels.

  16. Familial deletion 18p syndrome: case report

    Directory of Open Access Journals (Sweden)

    Lemyre Emmanuelle

    2006-07-01

    Full Text Available Abstract Background Deletion 18p is a frequent deletion syndrome characterized by dysmorphic features, growth deficiencies, and mental retardation with a poorer verbal performance. Until now, five families have been described with limited clinical description. We report transmission of deletion 18p from a mother to her two daughters and review the previous cases. Case presentation The proband is 12 years old and has short stature, dysmorphic features and moderate mental retardation. Her sister is 9 years old and also has short stature and similar dysmorphic features. Her cognitive performance is within the borderline to mild mental retardation range. The mother also presents short stature. Psychological evaluation showed moderate mental retardation. Chromosome analysis from the sisters and their mother revealed the same chromosomal deletion: 46, XX, del(18(p11.2. Previous familial cases were consistent regarding the transmission of mental retardation. Our family differs in this regard with variable cognitive impairment and does not display poorer verbal than non-verbal abilities. An exclusive maternal transmission is observed throughout those families. Women with del(18p are fertile and seem to have a normal miscarriage rate. Conclusion Genetic counseling for these patients should take into account a greater range of cognitive outcome than previously reported.

  17. 78 FR 37525 - Procurement List; Deletions

    Science.gov (United States)

    2013-06-21

    .... Contracting Activity: Dept of the Air Force, FA7014 AFDW A7KI, Andrews AFB, MD. Service Type/Location: Laundry... Procurement List. SUMMARY: This action deletes products and services from the Procurement List that were... products and services listed below are no longer suitable for procurement by the Federal Government under...

  18. Sequence analysis of 17 NRXN1 deletions

    DEFF Research Database (Denmark)

    Hoeffding, Louise Kristine Enggaard; Hansen, Thomas; Ingason, Andrés

    2014-01-01

    into the molecular mechanisms governing such genomic rearrangements may increase our understanding of disease pathology and evolutionary processes. Here we analyse 17 carriers of non-recurrent deletions in the NRXN1 gene, which have been associated with neurodevelopmental disorders, e.g. schizophrenia, autism...

  19. Angiotensin Converting Enzyme Insertion/Deletion Gene ...

    African Journals Online (AJOL)

    Angiotensin Converting Enzyme Insertion/Deletion Gene Polymorphism: An Observational Study among Diabetic Hypertensive Subjects in Malaysia. ... Methods: The pharmacological effect of ACE inhibition on mean arterial pressure (MAP) and glomerular filtration rate (GFR) were observed among a total of 62 subjects for ...

  20. Obtaining a Proportional Allocation by Deleting Items

    NARCIS (Netherlands)

    Dorn, B.; de Haan, R.; Schlotter, I.; Röthe, J.

    2017-01-01

    We consider the following control problem on fair allocation of indivisible goods. Given a set I of items and a set of agents, each having strict linear preference over the items, we ask for a minimum subset of the items whose deletion guarantees the existence of a proportional allocation in the

  1. Union-Find with Constant Time Deletions

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Thorup, Mikkel; Gørtz, Inge Li

    2014-01-01

    operations performed, and α_M/N_(n) is a functional inverse of Ackermann’s function. They left open the question whether delete operations can be implemented more efficiently than find operations, for example, in o(log n) worst-case time. We resolve this open problem by presenting a relatively simple...

  2. Mapping genomic deletions down to the base

    DEFF Research Database (Denmark)

    Dunø, Morten; Hove, Hanne; Kirchhoff, Maria

    2004-01-01

    the breakpoint of the third patient was mapped to a region previously predicted to be prone for rearrangements. One patient also harboured an inversion in connection with the deletion that disrupted the HDAC9 gene. All three patients showed clinical characteristics reminiscent of the hand-foot-genital syndrome...

  3. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  4. Delayed chromosomal instability caused by large deletion

    International Nuclear Information System (INIS)

    Ojima, M.; Suzuki, K.; Kodama, S.; Watanabe, M.

    2003-01-01

    Full text: There is accumulating evidence that genomic instability, manifested by the expression of delayed phenotypes, is induced by X-irradiation but not by ultraviolet (UV) light. It is well known that ionizing radiation, such as X-rays, induces DNA double strand breaks, but UV-light mainly causes base damage like pyrimidine dimers and (6-4) photoproducts. Although the mechanism of radiation-induced genomic instability has not been thoroughly explained, it is suggested that DNA double strand breaks contribute the induction of genomic instability. We examined here whether X-ray induced gene deletion at the hprt locus induces delayed instability in chromosome X. SV40-immortalized normal human fibroblasts, GM638, were irradiated with X-rays (3, 6 Gy), and the hprt mutants were isolated in the presence of 6-thioguanine (6-TG). A 2-fold and a 60-fold increase in mutation frequency were found by 3 Gy and 6 Gy irradiation, respectively. The molecular structure of the hprt mutations was determined by multiplex polymerase chain reaction of nine exons. Approximately 60% of 3 Gy mutants lost a part or the entire hprt gene, and the other mutants showed point mutations like spontaneous mutants. All 6 Gy mutants show total gene deletion. The chromosomes of the hprt mutants were analyzed by Whole Human Chromosome X Paint FISH or Xq telomere FISH. None of the point or partial gene deletion mutants showed aberrations of X-chromosome, however total gene deletion mutants induced translocations and dicentrics involving chromosome X. These results suggest that large deletion caused by DNA double strand breaks destabilizes chromosome structure, which may be involved in an induction of radiation-induced genomic instability

  5. Receptor-mediated targeting of 67Ga-Deferoxamine-Folate to folate-receptor-positive human kb tumor xenografts

    International Nuclear Information System (INIS)

    Mathias, Carla J.; Wang, Susan; Low, Philip S.; Waters, David J.; Green, Mark A.

    1999-01-01

    The radiochemical synthesis and stability of 67 Ga-deferoxamine-folate ([ 67 Ga]Ga-DF-Folate) were examined as a function of DF-Folate concentration. Optimal labeling occurred at DF-Folate concentrations ≥2.5 μg/mL. To define the possible biological significance of variations in product formulation, the biodistribution of [ 67 Ga]Ga-DF-Folate was examined as a function of administered deferoxamine-folate dose in an athymic mouse KB tumor model. The folate-receptor-positive KB tumors were found to concentrate the 67 Ga radiolabel in a dose-dependent fashion, consistent with saturable involvement of the folate receptor in mediating tumor accumulation of the radiopharmaceutical

  6. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Science.gov (United States)

    Rogers, Elizabeth E; Stenger, Drake C

    2012-01-01

    A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

  7. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available A ≈ 38kB plasmid (pXF-RIV5 was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51 sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th century.

  8. Genetics Home Reference: 17q12 deletion syndrome

    Science.gov (United States)

    ... with 17q12 deletion syndrome have delayed development (particularly speech and language delays), intellectual disability, or behavioral or psychiatric disorders. Behavioral and psychiatric conditions that have been reported in people with 17q12 deletion syndrome include autism ...

  9. Paracetamol - toxicity and microbial utilization. Pseudomonas moorei KB4 as a case study for exploring degradation pathway.

    Science.gov (United States)

    Żur, Joanna; Wojcieszyńska, Danuta; Hupert-Kocurek, Katarzyna; Marchlewicz, Ariel; Guzik, Urszula

    2018-09-01

    Paracetamol, a widely used analgesic and antipyretic drug, is currently one of the most emerging pollutants worldwide. Besides its wide prevalence in the literature only several bacterial strains able to degrade this compound have been described. In this study, we isolated six new bacterial strains able to remove paracetamol. The isolated strains were identified as the members of Pseudomonas, Bacillus, Acinetobacter and Sphingomonas genera and characterized phenotypically and biochemically using standard methods. From the isolated strains, Pseudomonas moorei KB4 was able to utilize 50 mg L -1 of paracetamol. As the main degradation products, p-aminophenol and hydroquinone were identified. Based on the measurements of specific activity of acyl amidohydrolase, deaminase and hydroquinone 1,2-dioxygenase and the results of liquid chromatography analyses, we proposed a mechanism of paracetamol degradation by KB4 strain under co-metabolic conditions with glucose. Additionally, toxicity bioassays and the influence of various environmental factors, including pH, temperature, heavy metals at no-observed-effective-concentrations, and the presence of aromatic compounds on the efficiency and mechanism of paracetamol degradation by KB4 strain were determined. This comprehensive study about paracetamol biodegradation will be helpful in designing a treatment systems of wastewaters contaminated with paracetamol. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Ornithine aminotransferase (OAT): recombination between an X-linked OAT sequence (7.5 kb) and the Norrie disease locus.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Spence, M A; Cortessis, V; Sparkes, R S; Kivlin, J D; Mohandas, T; Inana, G

    1990-01-01

    A human ornithine aminotransferase (OAT) locus has been mapped to the Xp11.2, as has the Norrie disease locus. We used a cDNA probe to investigate a 3-generation UCLA family with Norrie disease; a 4.2-kb RFLP was detected and a maximum lod score of 0.602 at zero recombination fraction was calculated. We used the same probe to study a second multigeneration family with Norrie disease from Utah. A different RFLP of 7.5 kb in size was identified and a recombinational event between the OAT locus represented by this RFLP and the disease loci was observed. Linkage analysis of these two loci in this family revealed a maximum load score of 1.88 at a recombination fraction of 0.10. Although both families have affected members with the same disease, the lod scores are reported separately because the 4.2- and 7.5-kb RFLPs may represent two different loci for the X-linked OAT.

  11. Probabilistic deletion of copies of linearly independent quantum states

    International Nuclear Information System (INIS)

    Feng Jian; Gao Yunfeng; Wang Jisuo; Zhan Mingsheng

    2002-01-01

    We show that each of two copies of the nonorthogonal states randomly selected from a certain set S can be probabilistically deleted by a general unitary-reduction operation if and only if the states are linearly independent. We derive a tight bound on the best possible deleting efficiencies. These results for 2→1 probabilistic deleting are also generalized into the case of N→M deleting (N,M positive integers and N>M)

  12. 78 FR 29119 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2013-05-17

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and Deletion from the Procurement List. SUMMARY: This action adds products and services to the... Activity: Washington Headquarters Services (WHS), Acquisition Directorate, Washington, DC. Deletion On 4/5...

  13. 5 CFR 1631.17 - Deletion of exempted information.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Deletion of exempted information. 1631.17... Deletion of exempted information. Where requested records contain matters which are exempted under 5 U.S.C... disclosed by the Board with deletions. To each such record, the Board shall attach a written justification...

  14. 75 FR 56995 - Procurement List Proposed Additions and Deletion

    Science.gov (United States)

    2010-09-17

    ... Additions and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Additions to and Deletion From the Procurement List. SUMMARY: The Committee is proposing to add... aggregated by the Defense Logistics Agency Troop Support, Philadelphia, PA. Deletion Regulatory Flexibility...

  15. 5 CFR 2502.18 - Deletion of exempted information.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Deletion of exempted information. 2502.18... Charges for Search and Reproduction § 2502.18 Deletion of exempted information. Where requested records... the remainder of the records, they shall be disclosed by the Office with deletions. To each such...

  16. 78 FR 75912 - Procurement List; Addition and Deletion

    Science.gov (United States)

    2013-12-13

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Addition to and deletion from the Procurement List. SUMMARY: This action adds a service to the Procurement...: General Services Administration, Fort Worth, TX Deletion On 11/1/2013 (78 FR 65618), the Committee for...

  17. 78 FR 27369 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2013-05-10

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and Deletion from the Procurement List. SUMMARY: This action adds products to the Procurement..., Philadelphia, PA. Deletion On 4/5/2013 (78 FR 20622-20623), the Committee for Purchase From People Who Are...

  18. 75 FR 7450 - Procurement List: Proposed Addition and Deletion

    Science.gov (United States)

    2010-02-19

    ... Addition and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed addition to and deletion from Procurement List. SUMMARY: The Committee is proposing to add to the... W6BA ACA, FT CARSON, COLORADO. Deletion Regulatory Flexibility Act Certification I certify that the...

  19. 77 FR 20795 - Procurement List Proposed Addition and Deletion

    Science.gov (United States)

    2012-04-06

    ... Addition and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Addition to and Deletion from the Procurement List. SUMMARY: The Committee is proposing to add a.... Deletion Regulatory Flexibility Act Certification I certify that the following action will not have a...

  20. 36 CFR 1275.58 - Deletion of restricted portions.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Deletion of restricted... HISTORICAL MATERIALS OF THE NIXON ADMINISTRATION Access by the Public § 1275.58 Deletion of restricted... materials after the deletion of the portions which are restricted under this § 1275.50 or § 1275.52. ...

  1. 75 FR 69638 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2010-11-15

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and deletion from the Procurement List. SUMMARY: This action adds products and a service to the...), DENVER, CO. Deletion On 9/17/2010 (75 FR 56995-56996), the Committee for Purchase From People Who Are...

  2. 76 FR 60810 - Procurement List; Proposed Additions and Deletion

    Science.gov (United States)

    2011-09-30

    ... Additions and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Additions to and Deletion from the Procurement List. SUMMARY: The Committee is proposing to add... Activity: Department of Energy, Idaho Operations Office, Idaho Falls, ID. DELETION Regulatory Flexibility...

  3. 44 CFR 5.27 - Deletion of identifying details.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Deletion of identifying... Availability of General Agency Information, Rules, Orders, Policies, and Similar Material § 5.27 Deletion of..., interpretation, or staff manual or instruction. However, the justification for each deletion will be explained...

  4. 29 CFR 1610.20 - Deletion of exempted matters.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Deletion of exempted matters. 1610.20 Section 1610.20 Labor... Production or Disclosure Under 5 U.S.C. 552 § 1610.20 Deletion of exempted matters. Where requested records... the remainder of the records, they shall be disclosed by the Commission with deletions. To each such...

  5. 49 CFR 7.6 - Deletion of identifying detail.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Deletion of identifying detail. 7.6 Section 7.6... To Be Made Public by DOT § 7.6 Deletion of identifying detail. Whenever it is determined to be... the deletion will accompany the record published or made available for inspection. ...

  6. 76 FR 5142 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2011-01-28

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and deletion from the Procurement List. SUMMARY: This action adds services to the Procurement.... Contracting Activity: Department of Transportation, Federal Aviation Administration, Jamaica, NY. Deletion On...

  7. Genetics Home Reference: proximal 18q deletion syndrome

    Science.gov (United States)

    ... characteristic features. Most cases of proximal 18q deletion syndrome are the result of a new (de novo) deletion and are not inherited from a ... J, Fox PT, Stratton RF, Perry B, Hale DE. Recurrent interstitial deletions of proximal 18q: a new syndrome involving expressive speech delay. Am J Med Genet ...

  8. An environment-mediated quantum deleter

    International Nuclear Information System (INIS)

    Srikanth, R.; Banerjee, Subhashish

    2007-01-01

    Environment-induced decoherence presents a great challenge to realizing a quantum computer. We point out the somewhat surprising fact that decoherence can be useful, indeed necessary, for practical quantum computation, in particular, for the effective erasure of quantum memory in order to initialize the state of the quantum computer. The essential point behind the deleter is that the environment, by means of a dissipative interaction, furnishes a contractive map towards a pure state. We present a specific example of an amplitude damping channel provided by a two-level system's interaction with its environment in the weak Born-Markov approximation. This is contrasted with a purely dephasing, non-dissipative channel provided by a two-level system's interaction with its environment by means of a quantum nondemolition interaction. We point out that currently used state preparation techniques, for example using optical pumping, essentially perform as quantum deleters

  9. KB-R7943, a plasma membrane Na(+)/Ca(2+) exchanger inhibitor, blocks opening of the mitochondrial permeability transition pore.

    Science.gov (United States)

    Wiczer, Brian M; Marcu, Raluca; Hawkins, Brian J

    2014-01-31

    The isothiourea derivative, KB-R7943, inhibits the reverse-mode of the plasma membrane sodium/calcium exchanger and protects against ischemia/reperfusion injury. The mechanism through which KB-R7943 confers protection, however, remains controversial. Recently, KB-R7943 has been shown to inhibit mitochondrial calcium uptake and matrix overload, which may contribute to its protective effects. While using KB-R7943 for this purpose, we find here no evidence that KB-R7943 directly blocks mitochondrial calcium uptake. Rather, we find that KB-R7943 inhibits opening of the mitochondrial permeability transition pore in permeabilized cells and isolated liver mitochondria. Furthermore, we find that this observation correlates with protection against calcium ionophore-induced mitochondrial membrane potential depolarization and cell death, without detrimental effects to basal mitochondrial membrane potential or complex I-dependent mitochondrial respiration. Our data reveal another mechanism through which KB-R7943 may protect against calcium-induced injury, as well as a novel means to inhibit the mitochondrial permeability transition pore. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. The protective effect of Na+/Ca2+ exchange blocker kb-r7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rat.

    Science.gov (United States)

    Ren, Yongkui; Deng, Liju; Cai, Yunfei; Lv, Yan; Jia, Dalin

    2014-11-01

    KB-R7943 reduces lethal reperfusion injury under normal conditions, but its effectiveness under certain pathological states is in dispute. In the present study, we sought to determine the effect of KB-R7943 in hyperlipidemic animals and assess if the K ATP (+) are involved in the protective mechanisms. In group 1 (G1), isolated rat hearts underwent 25 min global ischemia (GI) and 120 min reperfusion (R). In group 2 (G2), G1 was repeated but the animals were subjected to a 1.5 % cholesterol-enriched diet during 6 weeks (hypercholesterolemic animals). In group 3 (G3), G2 was repeated but 1 μM KB-R7943 was added to the perfusate for 10 min from the start of reperfusion. In group 4 (G4), G3 was repeated, and glibenclamide (K ATP (+) , blocker, 0.3 μM) was administered. The infarct size was measured by triphenyltetrazolium. The infarct size was 35 ± 5.0 % in G1 and 46 ± 8.7 % in G2 (P KB-R7943 reduced the infarct size (28.6 ± 3.3 % in G3 vs. G2, P KB-R7943 attenuated apoptotic cell (G3 vs. G2, P KB-R7943. Thus, diet-induced hypercholesterolemia enhances myocardial injury; KB-R7943 reduces infarct size and apoptosis in hyperlipidemic animals through the activation of K(+)ATP channels.

  11. Impact of functional germline variants and a deletion polymorphism in APOBEC3A and APOBEC3B on breast cancer risk and survival in a Swedish study population.

    Science.gov (United States)

    Göhler, Stella; Da Silva Filho, Miguel Inacio; Johansson, Robert; Enquist-Olsson, Kerstin; Henriksson, Roger; Hemminki, Kari; Lenner, Per; Försti, Asta

    2016-01-01

    The C → T mutation signature caused by APOBEC family members contributes to the development of breast cancer (BC). Also overexpression of APOBEC3B and a ~29.5-kb deletion polymorphism between APOBEC3A and APOBEC3B have been associated with increased BC risk. We investigated in a population-based study, with 782 Swedish BC cases and 1559 controls, associations between potentially functional germline variants in APOBEC3A or APOBEC3B gene and BC risk and survival. Additionally, we identified deletion polymorphism carriers and explored possible associations with BC. No evidence of association between any germline variant, including the deletion polymorphism, and BC risk or survival was observed. Only APOBEC3A promoter polymorphism rs5757402 was associated with low stage (OR = 0.69, 95 % CI 0.50-0.96, dominant model). The reported association between the deletion polymorphism and BC risk was not confirmed in the Swedish population, nor did any genotyped germline variant show any association with BC risk or survival.

  12. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  13. A recombination outside the BB deletion refines the location of the X-linked retinitis pigmentosa locus RP3

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, R.; Bingham, E.; Forsythe, P.; McHenry, C. [Univ. of Michigan, Ann Arbor, MI (United States)] [and others

    1996-07-01

    Genetic loci for X-linked retinitis pigmentosa (XLRP) have been mapped between Xp11.22 and Xp22.13 (RP2, RP3, RP6, and RP15). The RP3 gene, which is responsible for the predominant form of XLRP in most Caucasian populations, has been localized to Xp21.1 by linkage analysis and the map positions of chromosomal deletions associated with the disease. Previous linkage studies have suggested that RP3 is flanked by the markers DXS1110 (distal) and OTC (proximal). Patient BB was though to have RP because of a lesion at the RP3 locus, in addition to chronic granulomatous disease, Duchenne muscular dystrophy (DMD), mild mental retardation, and the McLeod phenotype. This patient carried a deletion extending {approximately}3 Mb from DMD in Xp21.3 to Xp21.1, with the proximal breakpoint located {approximately}40 kb centromeric to DXS1110. The RP3 gene, therefore, is believed to reside between DXS1110 and the proximal breakpoint of the BB deletion. In order to refine the location of RP3 and to ascertain patients with RP3, we have been analyzing several XLRP families for linkage to Xp markers. Linkage analysis in an American family of 27 individuals demonstrates segregation of XLRP with markers in Xp21.1, consistent with the RP3 subtype. One affected male shows a recombination event proximal to DXS1110. Additional markers within the DXS1110-OTC interval show that the crossover is between two novel polymorphic markers, DXS8349 and M6, both of which are present in BB DNA and lie centromeric to the proximal breakpoint. This recombination places the XLRP mutation in this family outside the BB deletion and redefines the location of RP3. 22 refs., 3 figs., 2 tabs.

  14. Conditional deletion of Pten causes bronchiolar hyperplasia.

    Science.gov (United States)

    Davé, Vrushank; Wert, Susan E; Tanner, Tiffany; Thitoff, Angela R; Loudy, Dave E; Whitsett, Jeffrey A

    2008-03-01

    Tumor suppressor phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a lipid phosphatase that regulates multiple cellular processes including cell polarity, migration, proliferation, and carcinogenesis. In this work, we demonstrate that conditional deletion of Pten (Pten(Delta/Delta)) in the respiratory epithelial cells of the developing mouse lung caused epithelial cell proliferation and hyperplasia as early as 4 to 6 weeks of age. While bronchiolar cell differentiation was normal, as indicated by beta-tubulin and FOXJ1 expression in ciliated cells and by CCSP expression in nonciliated cells, cell proliferation (detected by expression of Ki-67, phospho-histone-H3, and cyclin D1) was increased and associated with activation of the AKT/mTOR survival pathway. Deletion of Pten caused papillary epithelial hyperplasia characterized by a hypercellular epithelium lining papillae with fibrovascular cores that protruded into the airway lumens. Cell polarity, as assessed by subcellular localization of cadherin, beta-catenin, and zonula occludens-1, was unaltered. PTEN is required for regulation of epithelial cell proliferation in the lung and for the maintenance of the normal simple columnar epithelium characteristics of bronchi and bronchioles.

  15. A familial pericentric inversion of chromosome 11 associated with a microdeletion of 163 kb and microduplication of 288 kb at 11p13 and 11q22.3 without aniridia or eye anomalies.

    Science.gov (United States)

    Balay, Lara; Totten, Ellen; Okada, Luna; Zell, Sidney; Ticho, Benjamin; Israel, Jeannette; Kogan, Jillene

    2016-01-01

    Interstitial deletions of 11p13 involving MPPED2, DCDC5, DCDC1, DNAJC24, IMMP1L, and ELP4 are previously reported to have downstream transcriptional effects on the expression of PAX6, due to a downstream regulatory region (DRR). Currently, no clear genotype-phenotype correlations have been established allowing for conclusive information regarding the exact location of the PAX6 DRR, though its location has been approximated in mouse models to be within the Elp4 gene. Of the clinical reports currently published examining patients with intact PAX6 genes but harboring deletions identified in genes downstream of PAX6, 100% indicate phenotypes which include aniridia, whereas approximately half report additional eye deformities, autism, or intellectual disability. In this clinical report, we present a 12-year-old male patient, his brother, and mother with pericentric inversions of chromosome 11 associated with submicroscopic interstitial deletions of 11p13 and duplications of 11q22.3. The inversions were identified by standard cytogenetic analysis; microarray and FISH detected the chromosomal imbalance. The patient's phenotype includes intellectual disability, speech abnormalities, and autistic behaviors, but interestingly neither the patient, his brother, nor mother have aniridia or other eye anomalies. To the best of our knowledge, these findings in three family members represent the only reported cases with 11p13 deletions downstream of PAX6 not demonstrating phenotypic characteristics of aniridia or abnormal eye development. Although none of the deleted genes are obvious candidates for the patient's phenotype, the absence of aniridia in the presence of this deletion in all three family members further delineates the location of the DRR for PAX6. © 2015 Wiley Periodicals, Inc.

  16. [Effect of smokers'sera on Porphyromonas gingivalis internalizing KB cells and the expression of matrix metalloproteinase-1, -9 and tissue inhibitor of metalloproteinase-1].

    Science.gov (United States)

    Wang, Hongyan; Tan, Lisi; Liu, Junchao; Li, Qian; Pan, Yaping; Zhong, Ming

    2014-01-01

    To investigate the effects of serum from smoking individuals or non-smoking individuals with periodontitis on Porphyromonas gingivalis (Pg) internalizing KB cells, and the expression of matrix metalloproteinase(MMP)-1, MMP-9, tissue inhibitor of metalloproteinase-1 (TIMP-1) in the culture supernatant of KB cells. The venous blood of 20 periodontitis patients' (10 smoking and 10 non-smoking) was extracted under the informed consent and centrifuged for serum. The smoking-individual serum (Y group) and non-smoking-individual (N group) serum were added to the model of Pg internalizing KB cells for 12 hours, plated on brain-heart infusion (BHI) and incubated anaerobically at 37 °C for 5 days. The colony forming units (CFU) of cell-invasive bacteria were estimated by colony counting. MMP-1, MMP-9 and TIMP-1 protein levels in culture supernatant were determined by enzyme-linked immunosorbent assay(ELISA) in the two groups following co-culture of Pg with KB cells for 12 hours. The CFU were (11.2 ± 1.1)×10(4), (12.6 ± 1.2)×10(4), (44.7 ± 1.3)×10(4) CFU/ml when adding 200, 400, 800 µl Y-group serum to the model of Pg co-culture with KB cells and when the serum was extracted from N group, the CFU were (33.6 ± 1.4)×10(4),(38.9 ± 1.1)×10(4), (11.2 ± 1.2)×10(4) CFU/ml respectively. When 200, 400, 800 µl Y group-serum was added to co-culture fluid of Pg internalizing KB cells, the concentrations of MMP-1 secreted from KB cells were (107.2 ± 21.5), (165.9 ± 20.2), (434.4 ± 48.0) µg/L respectively, the concentrations of MMP-9 were (3.99 ± 0.29), (4.21 ± 0.61), (5.62 ± 0.47) µg/L respectively, the concentrations of TIMP-1 were (401.3 ± 12.7), (418.3 ± 28.5), (637.3 ± 37.3) µg/L. When the serum (200, 400, 800 µl) extracted from N group, the concentration of MMP-1 and MMP-9 secreted by KB cell were (77.6 ± 10.8), (84.7 ± 10.2) and (98.2 ± 9.7) µg/L and (3.84 ± 0.52), (4.02 ± 0.68), (4.25 ± 0.37) µg/L, respectively. The concentration of TIMP-1 were

  17. Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUD and ADHD.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Steinberg, Bruce; Modestino, Edward J; Fried, Lyle; Baron, David; Siwicki, David; Braverman, Eric R; Badgaiyan, Rajendra D

    2018-03-01

    Background Addictive-like behaviors (e.g., hoarding and shopping) may be the result of the cumulative effects of dopaminergic and other neurotransmitter genetic variants as well as elevated stress levels. We, therefore, propose that dopamine homeostasis may be the preferred goal in combating such challenging and unwanted behaviors, when simple dopaminergic activation through potent agonists may not provide any resolution. Case presentation C.J. is a 38-year-old, single, female, living with her mother. She has a history of substance use disorder as well as attention deficit hyperactivity disorder, inattentive type. She had been stable on buprenorphine/naloxone combination and amphetamine, dextroamphetamine mixed salts for many years when unexpectedly she lost her job for oversleeping and not calling into work. KB200z (a pro-dopamine compound) was added to her regimen for complaints of low drive and motivation. After taking this nutraceutical for 4 weeks, she noticed a marked improvement in her mental status and many behaviors. She noted that her shopping and hoarding addictions had appreciably decreased. Furthermore, her lifelong history of terrifying lucid dreams was eliminated. Finally, she felt more in control; her locus of control shifted from external to more internal. Discussion The hypothesis is that C.J.'s reported, behavioral, and psychological benefits resulted from the pro-dopamine-regulating effect of KB220Z across the brain reward system. Conclusions This effect, we surmise, could be the result of a new dopamine balance, across C.J.'s brain reward system. Dopamine homeostasis is an effect of KB220Z seen in both animal and human placebo-controlled fMRI experiments.

  18. Constitutive Activation of NF-KB in Prostate Carcinoma Cells Through a Positive Feedback Loop: Implication of Inducible IKK-Related Kinase (IKKi)

    National Research Council Canada - National Science Library

    Budunova, Irina V

    2005-01-01

    The overall goal of this project is to understand the role of inducible IKK-related kinase IKKi in constitutive activation of anti-apoptotic transcription factor NF-KB prostate carcinoma (PC) cells...

  19. Chromosomal deletion unmasking a recessive disease: 22q13 deletion syndrome and metachromatic leukodystrophy

    DEFF Research Database (Denmark)

    Bisgaard, A-M; Kirchhoff, M; Nielsen, J E

    2008-01-01

    A deletion on one chromosome and a mutant allele on the other may cause an autosomal recessive disease. We report on two patients with mental retardation, dysmorphic features and low catalytic activity of arylsulfatase A. One patient had a pathogenic mutation in the arylsulfatase A gene (ARSA......) and succumbed to metachromatic leukodystrophy (MLD). The other patient had a pseudoallele, which does not lead to MLD. The presenting clinical features and low arylsulfatase A activity were explained, in each patients, by a deletion of 22q13 and, thereby, of one allele of ARSA....

  20. Mapping of genomic EGFRvIII deletions in glioblastoma: insight into rearrangement mechanisms and biomarker development.

    Science.gov (United States)

    Koga, Tomoyuki; Li, Bin; Figueroa, Javier M; Ren, Bing; Chen, Clark C; Carter, Bob S; Furnari, Frank B

    2018-04-12

    Epidermal growth factor receptor (EGFR) variant III (vIII) is the most common oncogenic rearrangement in glioblastoma (GBM) generated by deletion of exons two to seven of EGFR. The proximal breakpoints occur in variable positions within the 123-kb intron one, presenting significant challenges in terms of PCR-based mapping. Molecular mechanisms underlying these deletions remain unclear. We determined the presence of EGFRvIII and its breakpoints for 29 GBM samples using quantitative polymerase chain reaction (qPCR), arrayed PCR mapping, Sanger sequencing, and whole genome sequencing (WGS). Patient-specific breakpoint PCR was performed on tumors, plasma and cerebrospinal fluid (CSF) samples. The breakpoint sequences and single nucleotide polymorphisms (SNPs) were analyzed to elucidate the underlying biogenic mechanism. PCR mapping and WGS independently unveiled eight EGFRvIII breakpoints in six tumors. Patient-specific primers yielded EGFRvIII PCR amplicons in matched tumors, and in cell-free DNA (cfDNA) from a CSF sample, but not in cfDNA or extracellular-vesicle DNA from plasma. The breakpoint analysis revealed nucleotide insertions in four, an insertion of a region outside of EGFR locus in one, microhomologies in three, as well as a duplication or an inversion accompanied by microhomologies in two, suggestive of distinct DNA repair mechanisms. In the GBM samples that harbored distinct breakpoints, the SNP compositions of EGFRvIII and amplified non-vIII EGFR were identical, suggesting that these rearrangements arose from amplified non-vIII EGFR. Our approach efficiently "fingerprints" each sample's EGFRvIII breakpoints. Breakpoint sequence analyses suggest that independent breakpoints arose from precursor amplified non-vIII EGFR through different DNA repair mechanisms.

  1. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  2. The effect of Lactobacillus brevis KB290 against irritable bowel syndrome: a placebo-controlled double-blind crossover trial

    Directory of Open Access Journals (Sweden)

    Murakami Katsumi

    2012-08-01

    Full Text Available Abstract Background Irritable bowel syndrome (IBS is a functional disorder of the digestive tract that causes chronic abdominal symptoms. We evaluated the effects of Lactobacillus brevis KB290 (KB290, which has been demonstrated to be effective at improving bowel movements and the composition of intestinal microflora, on IBS symptoms. Methods We performed a placebo control double-blind cross matched trial. Thirty-five males and females (aged 6 years and above who had been diagnosed with IBS according to the Rome III criteria were divided into 2 groups, and after a 4-week pre-trial observation period, they were administered test capsules containing KB290 or placebo for 4 weeks (consumption period I. Then, the capsule administration was suspended for 4 weeks in both groups (washout period, before the opposite capsules were administered for a further 4 weeks (consumption period II. Fecal samples were collected on the first day of the pre-consumption observation period, the last day of consumption period I, the last day of the washout period, and the last day of consumption period II. In addition, the subjects’ IBS symptoms and quality of life (QOL and any adverse events that they experienced were evaluated. Results No significant difference in IBS symptoms was noted among the various periods. However, the mean QOL scores were improved during the test capsule consumption. The frequencies of watery and mushy feces were significantly lower in the test capsule consumption period than during the pre-consumption observation period, and the frequency of abdominal pain was significantly reduced in the test capsule consumption period compared with the other periods. The frequency of the genus Bifidobacterium was significantly higher, and that of the genus Clostridium was significantly lower, after the test capsule consumption than after the placebo consumption. The frequencies of the genera Lactobacillus, Bacteroides, and Enterococcus were also

  3. MicroRNA-205 suppresses the oral carcinoma oncogenic activity via down-regulation of Axin-2 in KB human oral cancer cell.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Sun-Young; Lee, Seul Ah; Park, Min-Gyeong; Yu, Sun-Kyoung; Lee, Myoung-Hwa; Park, Mi-Ra; Kim, Su-Gwan; Oh, Ji-Su; Lee, Sook-Young; Kim, Chun Sung; Kim, Heung-Joong; Chun, Hong Sung; Kim, Jin-Soo; Moon, Sung-Min; Kim, Do Kyung

    2014-02-01

    MicroRNA (miRNA) is a small noncoding RNA molecule, 19-25 nucleotides in length, which regulates several pathways including cell development, cell proliferation, carcinogenesis, apoptosis, etc. In this study, the over-expression of microRNA-205 (miR-205) increased the number of apoptotic cells by at least 4 times compared to the control. In addition, over-expressed miRNA in KB oral cancer cells triggered apoptosis via the caspase cascade, including the cleavage of caspase-9, caspase-7, caspase-3, and PARP. Flow cytometry showed that apoptotic cell death was increased significantly by 35.33% in KB oral cancer cells with over-expressed miR-205 compared to the control. The microarray data showed that axis inhibitor protein 2 (Axin2) was down-regulated in KB oral cancer cells transfected with miR-205. In addition, Axin2 was down-regulated by approximately 50% by over-expressed miR-205 at both the mRNA and protein levels. Interestingly, Axin2 was up-regulated in KB oral cancer compared to human normal oral keratinocytes. Furthermore, the cell cytotoxicity and apoptotic population of KB oral cancer cells were increased significantly after Axin2 siRNA transfection. These results suggest that Axin2 is might be as potential oncogene in KB oral cancer cells. The luciferase assay showed that over-expressed miR-205 in KB oral cancer cells suppressed AXIN2 expression through an interaction with its own binding site at AXIN2 3'UTR (64-92). These results suggest that miR-205 is a novel anti-oncogenic miRNA in KB oral cancer cells, and may have potential applications in oral cancer therapy.

  4. Writing and deleting single magnetic skyrmions.

    Science.gov (United States)

    Romming, Niklas; Hanneken, Christian; Menzel, Matthias; Bickel, Jessica E; Wolter, Boris; von Bergmann, Kirsten; Kubetzka, André; Wiesendanger, Roland

    2013-08-09

    Topologically nontrivial spin textures have recently been investigated for spintronic applications. Here, we report on an ultrathin magnetic film in which individual skyrmions can be written and deleted in a controlled fashion with local spin-polarized currents from a scanning tunneling microscope. An external magnetic field is used to tune the energy landscape, and the temperature is adjusted to prevent thermally activated switching between topologically distinct states. Switching rate and direction can then be controlled by the parameters used for current injection. The creation and annihilation of individual magnetic skyrmions demonstrates the potential for topological charge in future information-storage concepts.

  5. Alpinia pricei Rhizome Extracts Induce Cell Cycle Arrest in Human Squamous Carcinoma KB Cells and Suppress Tumor Growth in Nude Mice

    Directory of Open Access Journals (Sweden)

    You-Cheng Hseu

    2011-01-01

    Full Text Available Alpinia pricei has been shown to induce apoptosis in human squamous carcinoma (KB cells. In this study, we report the effectiveness of the ethanol (70% extracts of A. pricei rhizome (AP extracts in terms of tumor regression as determined using both in vitro cell culture and in vivo athymic nude mice models of KB cells. We found that the AP extract (25–200 μg/mL treatment decreased the proliferation of KB cells by arresting progression through the G2/M phase of the cell cycle. This cell cycle blockade was associated with reductions in cyclin A and B1, Cdc2, and Cdc25C, and increased p21/WAF1, Wee1, p53 and phospho-p53 (p-p53 in a dose- and time-dependent manner. Moreover, we found that AP extract treatment decreased metalloproteinase-9 (MMP-9 and urokinase plasminogen activator (u-PA expression, while expression of their endogenous inhibitors, tissue inhibitor of MMP-1 (TIMP-1 and plasminogen activator inhibitor-1 (PAI-1, were increased in KB cells. Furthermore, AP extract treatment effectively delayed tumor incidence in nude mice inoculated with KB cells and reduced the tumor burden. AP extract treatment also induced apoptotic DNA fragmentation, as detected by in situ TUNEL staining. Thus, A. pricei may possess antitumor activity in human squamous carcinoma (KB cells.

  6. Umbelliferone arrest cell cycle at G0/G1 phase and induces apoptosis in human oral carcinoma (KB) cells possibly via oxidative DNA damage.

    Science.gov (United States)

    Vijayalakshmi, Annamalai; Sindhu, Ganapathy

    2017-08-01

    Umbelliferone (UMB) has widespread pharmacological activity, comprising anti-inflammatory, anti-oxidant, anti-genotoxic and anti-immunomodulatory but the anticancer activity remains unknown in human oral carcinoma (HOC) KB cells. MTT assay determinations was revealed that treatment of KB cells with UMB, prevent and reduce the cell proliferation with the IC 50 - 200μM as well as induces loss of cell viability, morphology change and internucleosomal DNA fragmentation in a concentration dependent manner. Acridine orange and ethidium bromide dual staining assay established that UMB induced apoptosis in KB cells in a dose dependent manner. Alkaline comet assay determination revealed UMB has the potential to increase oxidative DNA damage in KB cells through DNA tail formation significantly (pKB cells. Similarly, we observed increased DNA damage stimulated apoptotic morphological changes in UMB treated cells. Taken together, the present study suggests that UMB exhibits anticancer effect on KB cell line with the increased generation of intracellular ROS, triggered oxidative stress mediated depolarization of mitochondria, which contributes cell death via DNA damage as well as cell cycle arrest at G0/G1 phase. The results have also provided us insight in the pharmacological backgrounds for the potential use of UMB, to target divergent pathways of cell survival and cell death. To conclude UMB could develop as a novel candidate for cancer chemoprevention and therapy, which is our future focus and to develop a connectivity map between in vivo and in vitro activity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. Whole genome HBV deletion profiles and the accumulation of preS deletion mutant during antiviral treatment

    Science.gov (United States)

    2012-01-01

    Background Hepatitis B virus (HBV), because of its error-prone viral polymerase, has a high mutation rate leading to widespread substitutions, deletions, and insertions in the HBV genome. Deletions may significantly change viral biological features complicating the progression of liver diseases. However, the clinical conditions correlating to the accumulation of deleted mutants remain unclear. In this study, we explored HBV deletion patterns and their association with disease status and antiviral treatment by performing whole genome sequencing on samples from 51 hepatitis B patients and by monitoring changes in deletion variants during treatment. Clone sequencing was used to analyze preS regions in another cohort of 52 patients. Results Among the core, preS, and basic core promoter (BCP) deletion hotspots, we identified preS to have the highest frequency and the most complex deletion pattern using whole genome sequencing. Further clone sequencing analysis on preS identified 70 deletions which were classified into 4 types, the most common being preS2. Also, in contrast to the core and BCP regions, most preS deletions were in-frame. Most deletions interrupted viral surface epitopes, and are possibly involved in evading immuno-surveillance. Among various clinical factors examined, logistic regression showed that antiviral medication affected the accumulation of deletion mutants (OR = 6.81, 95% CI = 1.296 ~ 35.817, P = 0.023). In chronic carriers of the virus, and individuals with chronic hepatitis, the deletion rate was significantly higher in the antiviral treatment group (Fisher exact test, P = 0.007). Particularly, preS2 deletions were associated with the usage of nucleos(t)ide analog therapy (Fisher exact test, P = 0.023). Dynamic increases in preS1 or preS2 deletions were also observed in quasispecies from samples taken from patients before and after three months of ADV therapy. In vitro experiments demonstrated that preS2 deletions alone

  8. Effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer.

    Science.gov (United States)

    Shen, Shan; Tang, Jingxia

    2017-08-01

    The present study describes the effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer. Oral cancer is twice as common in men than women. More than 90% of oral cancers in men and 85% in women are linked to lifestyle and environmental factors. PPP2R2B methylation may be associated with survival and prognosis in patients with gliomas. In tumor cell proliferation and apoptosis, the mechanism of PPP2R2B remains unclear. In the present study, we found that PPP2R2B expression of H1299 cells is significantly decreased after being treated by GA-13315. KB cells were isolated from patients with oral cancer and treated with GA-13315 (5 µM). Cells without GA-13315 treatment served as the control group. An MTT experiment was performed to detect the post-treatment cell growth between the groups. A flow cytometry was used to detect cell apoptosis. Western blot analysis and quantitative polymerase chain reaction methods were used for detecting the expression of PPP2R2B. Compared with the control group, the cell proliferation of the treatment group slowed after being treated with GA-13315. The difference was statistically significant (Poral cancer were weakened after being treated by GA-13315. GA-13315 can accelerate the apoptosis of oral cancer cells and presents a dose correlation. The biological effect is exerted through the decrease of PPP2R2B.

  9. Effect of surface charge and agglomerate degree of magnetic iron oxide nanoparticles on KB cellular uptake in vitro.

    Science.gov (United States)

    Ge, Yuqing; Zhang, Yu; Xia, Jingguang; Ma, Ming; He, Shiying; Nie, Fang; Gu, Ning

    2009-10-15

    We synthesized three types of magnetic iron oxide nanoparticles (MNPs), which were meso-2,3-dimercaptosuccinic acid (DMSA) coated MNPs (DMSA@MNPs, 17.3+/-4.8 nm, negative charge), chitosan (CS) coated MNPs (CS@MNPs, 16.5+/-6.1 nm, positive charge) and magnetic nanoparticles agglomerates, formed by electronic aggregation between DMSA@MNPs and CS (CS-DMSA@MNPs, 85.7+/-72.9 nm, positive charge) respectively. The interactions of these MNPs with Oral Squamous Carcinoma Cell KB were investigated. The results showed that cellular uptakes of MNPs were on the dependence of incubation time, nanoparticles concentration and nanoparticles properties such as surface charge, size, etc. The cellular uptake was enhanced with the increase of incubation time and nanoparticles concentration. Although all MNPs could enter to cells, we observed apparent differences in the magnitude of nanoparticles uptaken. The cellular uptake of CS-DMSA@MNPs by KB cells was the highest and that of DMSA@MNPs was the lowest among the three types of MNPs. The same conclusions were drawn via the reduction of water proton relaxation times T(2)(*), resulting from the different iron load of labeled cells using a 1.5T clinical MR imager. The finding of this study will have implications in the chemical design of nanomaterials for biomedical applications.

  10. Li-Fraumeni-like syndrome associated with a large BRCA1 intragenic deletion

    International Nuclear Information System (INIS)

    Silva, Amanda Gonçalves; Achatz, Maria Isabel W; Rosenberg, Carla; Krepischi, Ana C V; Ewald, Ingrid Petroni; Sapienza, Marina; Pinheiro, Manuela; Peixoto, Ana; Nóbrega, Amanda França de; Carraro, Dirce M; Teixeira, Manuel R; Ashton-Prolla, Patricia

    2012-01-01

    Li-Fraumeni (LFS) and Li-Fraumeni-like (LFL) syndromes are associated to germline TP53 mutations, and are characterized by the development of central nervous system tumors, sarcomas, adrenocortical carcinomas, and other early-onset tumors. Due to the high frequency of breast cancer in LFS/LFL families, these syndromes clinically overlap with hereditary breast cancer (HBC). Germline point mutations in BRCA1, BRCA2, and TP53 genes are associated with high risk of breast cancer. Large rearrangements involving these genes are also implicated in the HBC phenotype. We have screened DNA copy number changes by MLPA on BRCA1, BRCA2, and TP53 genes in 23 breast cancer patients with a clinical diagnosis consistent with LFS/LFL; most of these families also met the clinical criteria for other HBC syndromes. We found no DNA copy number alterations in the BRCA2 and TP53 genes, but we detected in one patient a 36.4 Kb BRCA1 microdeletion, confirmed and further mapped by array-CGH, encompassing exons 9–19. Breakpoints sequencing analysis suggests that this rearrangement was mediated by flanking Alu sequences. This is the first description of a germline intragenic BRCA1 deletion in a breast cancer patient with a family history consistent with both LFL and HBC syndromes. Our results show that large rearrangements in these known cancer predisposition genes occur, but are not a frequent cause of cancer susceptibility

  11. Deletion of an X-inactivation boundary disrupts adjacent gene silencing.

    Directory of Open Access Journals (Sweden)

    Lindsay M Horvath

    2013-11-01

    Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.

  12. Deletion of ultraconserved elements yields viable mice

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Zhu, Yiwen; Visel, Axel; Holt, Amy; Afzal, Veena; Pennacchio, Len A.; Rubin, Edward M.

    2007-07-15

    Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lacking these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.

  13. Method for introducing unidirectional nested deletions

    Science.gov (United States)

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  14. Rare human diseases: 9p deletion syndrome

    Directory of Open Access Journals (Sweden)

    Galagan V.O.

    2014-09-01

    Full Text Available Objective of the study was to review the anamnesis, pheno - and genotype in patients with rare chromosome disorders such as 9p deletion syndrome. Genetic methods of investigation (clinical and genealogical, cytogenetic, FISH- method, paraclinical and instrumental methods of examination were used. Karyotyping was performed by the G-method of differential staining of chromosomes. Only three cases of pathology were diagnosed in the Medical Genetics Center over the last 10 years. By anamnesis data nobody in the probands’ families had bad habits, was exposed to occupational hazards, took part in the elimination of the Chernobyl accident or lived in contaminated areas. Clinical signs of diseases have not been identified in probands’ parents. All probands had trigonocephaly, bilateral epicanthal folds, ocular hypertelorism, downslanting palpebral fissures, long philtrum, flat face and nasal bridge, low set ears with malformed auricles. Two patients of three ones had exophthalmos, contracture of the second and third fingers, abnormal external genitalia. In all three cases there was monosomy of chromosome 9 of critical segment p 24. Normal karyotypes were seen in all parents, so there were three cases of new mutations of 9p deletion syndrome. Retardation of physical, psycho-spech, mental development in proband with or without congenital anomalies requires medical genetic counseling in a specialized institution. Cases of reproductive loss in anamnesis require cytogenetic investigation of fetal membranes and amniotic fluid.

  15. Heterozygous deletion of FOXA2 segregates with disease in a family with heterotaxy, panhypopituitarism, and biliary atresia.

    Science.gov (United States)

    Tsai, Ellen A; Grochowski, Christopher M; Falsey, Alexandra M; Rajagopalan, Ramakrishnan; Wendel, Danielle; Devoto, Marcella; Krantz, Ian D; Loomes, Kathleen M; Spinner, Nancy B

    2015-06-01

    Biliary atresia (BA) is a pediatric cholangiopathy with unknown etiology occurring in isolated and syndromic forms. Laterality defects affecting the cardiovascular and gastrointestinal systems are the most common features present in syndromic BA. Most cases are sporadic, although reports of familial cases have led to the hypothesis of genetic susceptibility in some patients. We identified a child with BA, malrotation, and interrupted inferior vena cava whose father presented with situs inversus, polysplenia, panhypopituitarism, and mildly dysmorphic facial features. Chromosomal microarray analysis demonstrated a 277 kb heterozygous deletion on chromosome 20, which included a single gene, FOXA2, in the proband and her father. This deletion was confirmed to be de novo in the father. The proband and her father share a common diagnosis of heterotaxy, but they also each presented with a variety of other issues. Further genetic screening revealed that the proband carried an additional protein-altering polymorphism (rs1904589; p.His165Arg) in the NODAL gene that is not present in the father, and this variant has been shown to decrease expression of the gene. As FOXA2 can be a regulator of NODAL expression, we propose that haploinsufficiency for FOXA2 combined with a decreased expression of NODAL is the likely cause for syndromic BA in this proband. © 2015 WILEY PERIODICALS, INC.

  16. Whole genome sequencing reveals a novel deletion variant in the KIT gene in horses with white spotted coat colour phenotypes.

    Science.gov (United States)

    Dürig, N; Jude, R; Holl, H; Brooks, S A; Lafayette, C; Jagannathan, V; Leeb, T

    2017-08-01

    White spotting phenotypes in horses can range in severity from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for such phenotypes in horses. For the present study, we re-investigated a large horse family segregating a variable white spotting phenotype, for which conventional Sanger sequencing of the candidate genes' individual exons had failed to reveal the causative variant. We obtained whole genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~1.9-kb deletion spanning exons 10-13 of the KIT gene (chr3:77,740,239_77,742,136del1898insTATAT). In continuity with previously named equine KIT variants we propose to designate the newly identified deletion variant W22. We had access to 21 horses carrying the W22 allele. Four of them were compound heterozygous W20/W22 and had a completely white phenotype. Our data suggest that W22 represents a true null allele of the KIT gene, whereas the previously identified W20 leads to a partial loss of function. These findings will enable more precise genetic testing for depigmentation phenotypes in horses. © 2017 Stichting International Foundation for Animal Genetics.

  17. Are there ethnic differences in deletions in the dystrophin gene?

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, M.; Verma, I.C. [All India Inst. of Medical Sciences, New Delhi (India)

    1997-01-20

    We studied 160 cases of Duchenne muscular dystrophy (DMD) drawn from all parts of India, using multiplex PCR of 27 exons. Of these, 103 (64.4%) showed intragenic deletions. Most (69.7%) of the deletions involved exons 45-51. The phenotype of cases with deletion of single exons did not differ significantly from those with deletion of multiple exons. The distribution of deletions in studies from different countries was variable, but this was accounted for either by the small number of cases studied, or by fewer exons analyzed. It is concluded that there is likely to be no ethnic difference with respect to deletions in the DMD gene. 38 refs., 2 figs., 3 tabs.

  18. Panchromatic cooperative hyperspectral adaptive wide band deletion repair method

    Science.gov (United States)

    Jiang, Bitao; Shi, Chunyu

    2018-02-01

    In the hyperspectral data, the phenomenon of stripe deletion often occurs, which seriously affects the efficiency and accuracy of data analysis and application. Narrow band deletion can be directly repaired by interpolation, and this method is not ideal for wide band deletion repair. In this paper, an adaptive spectral wide band missing restoration method based on panchromatic information is proposed, and the effectiveness of the algorithm is verified by experiments.

  19. NPL deletion policy for RCRA-regulated TSD facilities finalized

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Under a new policy published by EPA on March 20, 1995, certain sites may be deleted from the National Priorities List (NPL) and deferred to RCRA corrective action. To be deleted from the NPL, a site must (1) be regulated under RCRA as a treatment, storage, or disposal (TSD) facility and (2) meet the four criteria specified by EPA. The new NPL deletion policy, which does not pertain to federal TSD facilities, became effective on April 19, 1995. 1 tab

  20. Clival encephalocele and 5q15 deletion: a case report.

    Science.gov (United States)

    Puvabanditsin, Surasak; Malik, Imran; Garrow, Eugene; Francois, Lissa; Mehta, Rajeev

    2015-03-01

    A preterm neonate presenting with respiratory distress after birth was found to have a clival encephalocele, which is a variant of a basal encephalocele, and hypoplasia of the cerebellum. Genetic studies revealed a small deletion of the long arm of chromosome 5: 5q15 deletion. We report a rare variant of a basal encephalocele with a cerebellar malformation and 5q15 deletion. © The Author(s) 2014.

  1. Male gametophytic sterility. 1 - Gametic sterilities and deletions in petunia

    Energy Technology Data Exchange (ETDEWEB)

    Cornu, A.; Maizonnier, D. (Station d' Amelioration des Plantes de l' I.N.R.A., Dijon (France))

    1982-01-01

    Terminal deletions induced by ionizing radiations in Petunia are not sexually transmitted. Cytogenetic study of plants with a heterozygous deletion and their progenies shows that this lack of transmission is accompanied by a gametic semi-sterility due to the fact that gametes carrying the deleted chromosome are not viable. The interest of such a male sterility with a gametophytic determinism for the study of sporophyte-gametophyte relationships is underlined.

  2. HOXA genes cluster: clinical implications of the smallest deletion

    OpenAIRE

    Pezzani, Lidia; Milani, Donatella; Manzoni, Francesca; Baccarin, Marco; Silipigni, Rosamaria; Guerneri, Silvana; Esposito, Susanna

    2015-01-01

    Background HOXA genes cluster plays a fundamental role in embryologic development. Deletion of the entire cluster is known to cause a clinically recognizable syndrome with mild developmental delay, characteristic facies, small feet with unusually short and big halluces, abnormal thumbs, and urogenital malformations. The clinical manifestations may vary with different ranges of deletions of HOXA cluster and flanking regions. Case presentation We report a girl with the smallest deletion reporte...

  3. A Comparative Study of Quantum and Classical Deletion

    International Nuclear Information System (INIS)

    Shen Yao; Hao Liang; Long Guilu

    2010-01-01

    Here in this letter, we study the difference between quantum and classical deletion. We point out that the linear mapping deletion operation used in the impossibility proof for quantum systems applies also to classical system. The general classical deletion operation is a combined operation of measurement and transformation, i.e., first read the state and then transfer the state to the standard blank state. Though both quantum information and classical information can be deleted in an open system, quantum information cannot be recovered while classical information can be recovered. (general)

  4. Comprehensive analysis of pathogenic deletion variants in Fanconi anemia genes.

    Science.gov (United States)

    Flynn, Elizabeth K; Kamat, Aparna; Lach, Francis P; Donovan, Frank X; Kimble, Danielle C; Narisu, Narisu; Sanborn, Erica; Boulad, Farid; Davies, Stella M; Gillio, Alfred P; Harris, Richard E; MacMillan, Margaret L; Wagner, John E; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A; Chandrasekharappa, Settara C

    2014-11-01

    Fanconi anemia (FA) is a rare recessive disease resulting from mutations in one of at least 16 different genes. Mutation types and phenotypic manifestations of FA are highly heterogeneous and influence the clinical management of the disease. We analyzed 202 FA families for large deletions, using high-resolution comparative genome hybridization arrays, single-nucleotide polymorphism arrays, and DNA sequencing. We found pathogenic deletions in 88 FANCA, seven FANCC, two FANCD2, and one FANCB families. We find 35% of FA families carry large deletions, accounting for 18% of all FA pathogenic variants. Cloning and sequencing across the deletion breakpoints revealed that 52 FANCA deletion ends, and one FANCC deletion end extended beyond the gene boundaries, potentially affecting neighboring genes with phenotypic consequences. Seventy-five percent of the FANCA deletions are Alu-Alu mediated, predominantly by AluY elements, and appear to be caused by nonallelic homologous recombination. Individual Alu hotspots were identified. Defining the haplotypes of four FANCA deletions shared by multiple families revealed that three share a common ancestry. Knowing the exact molecular changes that lead to the disease may be critical for a better understanding of the FA phenotype, and to gain insight into the mechanisms driving these pathogenic deletion variants. © 2014 WILEY PERIODICALS, INC.

  5. 75 FR 1355 - Procurement List Additions and Deletions

    Science.gov (United States)

    2010-01-11

    .../Location: Janitorial Services, Jamestown Service Center, 8430 Country Club Street, Jamestown, ND. NPA..., the following products and services are deleted from the Procurement List: Products Business Cards NSN...

  6. SVA retrotransposon insertion-associated deletion represents a novel mutational mechanism underlying large genomic copy number changes with non-recurrent breakpoints

    Science.gov (United States)

    2014-01-01

    Background Genomic disorders are caused by copy number changes that may exhibit recurrent breakpoints processed by nonallelic homologous recombination. However, region-specific disease-associated copy number changes have also been observed which exhibit non-recurrent breakpoints. The mechanisms underlying these non-recurrent copy number changes have not yet been fully elucidated. Results We analyze large NF1 deletions with non-recurrent breakpoints as a model to investigate the full spectrum of causative mechanisms, and observe that they are mediated by various DNA double strand break repair mechanisms, as well as aberrant replication. Further, two of the 17 NF1 deletions with non-recurrent breakpoints, identified in unrelated patients, occur in association with the concomitant insertion of SINE/variable number of tandem repeats/Alu (SVA) retrotransposons at the deletion breakpoints. The respective breakpoints are refractory to analysis by standard breakpoint-spanning PCRs and are only identified by means of optimized PCR protocols designed to amplify across GC-rich sequences. The SVA elements are integrated within SUZ12P intron 8 in both patients, and were mediated by target-primed reverse transcription of SVA mRNA intermediates derived from retrotranspositionally active source elements. Both SVA insertions occurred during early postzygotic development and are uniquely associated with large deletions of 1 Mb and 867 kb, respectively, at the insertion sites. Conclusions Since active SVA elements are abundant in the human genome and the retrotranspositional activity of many SVA source elements is high, SVA insertion-associated large genomic deletions encompassing many hundreds of kilobases could constitute a novel and as yet under-appreciated mechanism underlying large-scale copy number changes in the human genome. PMID:24958239

  7. Deficiency of Interleukin-1 Receptor Antagonist (DIRA): Report of the First Indian Patient and a Novel Deletion Affecting IL1RN.

    Science.gov (United States)

    Mendonca, Leonardo O; Malle, Louise; Donovan, Frank X; Chandrasekharappa, Settara C; Montealegre Sanchez, Gina A; Garg, Megha; Tedgard, Ulf; Castells, Mariana; Saini, Shiv S; Dutta, Sourabh; Goldbach-Mansky, Raphaela; Suri, Deepti; Jesus, Adriana A

    2017-07-01

    Deficiency of interleukin-1 receptor antagonist (DIRA) is a rare life-threatening autoinflammatory disease caused by autosomal recessive mutations in IL1RN. DIRA presents clinically with early onset generalized pustulosis, multifocal osteomyelitis, and elevation of acute phase reactants. We evaluated and treated an antibiotic-unresponsive patient with presumed DIRA with recombinant IL-1Ra (anakinra). The patient developed anaphylaxis to anakinra and was subsequently desensitized. Genetic analysis of IL1RN was undertaken and treatment with anakinra was initiated. A 5-month-old Indian girl born to healthy non-consanguineous parents presented at the third week of life with irritability, sterile multifocal osteomyelitis including ribs and clavicles, a mild pustular rash, and elevated acute phase reactants. SNP array of the patient's genomic DNA revealed a previously unrecognized homozygous deletion of approximately 22.5 Kb. PCR and Sanger sequencing of the borders of the deleted area allowed identification of the breakpoints of the deletion, thus confirming a homozygous 22,216 bp deletion that spans the first four exons of IL1RN. Due to a clinical suspicion of DIRA, anakinra was initiated which resulted in an anaphylactic reaction that triggered desensitization with subsequent marked and sustained clinical and laboratory improvement. We report a novel DIRA-causing homozygous deletion affecting IL1RN in an Indian patient. The mutation likely is a founder mutation; the design of breakpoint-specific primers will enable genetic screening in Indian patients suspected of DIRA. The patient developed anaphylaxis to anakinra, was desensitized, and is in clinical remission on continued treatment.

  8. Molecular characterization of Rhodococcus equi isolates from horses in Poland: pVapA characteristics and plasmid new variant, 85-kb type V.

    Science.gov (United States)

    Witkowski, Lucjan; Rzewuska, Magdalena; Takai, Shinji; Chrobak-Chmiel, Dorota; Kizerwetter-Świda, Magdalena; Feret, Małgorzata; Gawryś, Marta; Witkowski, Maciej; Kita, Jerzy

    2017-01-26

    Rhodococcus equi is one of the most significant bacterial pathogens affecting foals up to 6 months of age worldwide. Rhodococcosis is present in Poland however information about molecular characterization of R. equi isolates is scarce. This study describes molecular characterization of Rhodococcus equi infection on 13 horse breeding farms in Poland between 2001 and 2012. Samples were collected by tracheobronchial aspiration from pneumonic foals or during necropsy. The R. equi isolates were genotyped by plasmid profiling and pulsed-field gel electrophoresis. Totally, 58 R. equi isolates were investigated. One isolate lost its plasmid. Among the 57 VapA-positive isolates, 48 contained 85-kb type I plasmid (82.8%), 8 contained 87-kb type I plasmid (13.8%). One isolate (1.7%) had a unique restriction cleavage pattern and the 2nd fragment of EcoRI digests of this plasmid DNA was about 2600 bases smaller than that of the 85 kb type I. This new plasmid variant was designated as the "85-kb type V". Among the 58 isolates typeable with VspI-PFGE, ten PFGE clusters were detected. The majority of foals were infected mostly with isolates of low genetic diversity. Most of clinical isolates of R. equi from foals in Poland contain pVapA 85-kb type I and 87-kb type I similarly to the other European countries and the United States. However, the new variant of pVapA 85-kb type V was identified. The chromosomal variability was detected among some of the investigated isolates and the presence of farm-specific isolates might be possible.

  9. Klf5 deletion promotes Pten deletion-initiated luminal-type mouse prostate tumors through multiple oncogenic signaling pathways.

    Science.gov (United States)

    Xing, Changsheng; Ci, Xinpei; Sun, Xiaodong; Fu, Xiaoying; Zhang, Zhiqian; Dong, Eric N; Hao, Zhao-Zhe; Dong, Jin-Tang

    2014-11-01

    Krüppel-like factor 5 (KLF5) regulates multiple biologic processes. Its function in tumorigenesis appears contradictory though, showing both tumor suppressor and tumor promoting activities. In this study, we examined whether and how Klf5 functions in prostatic tumorigenesis using mice with prostate-specific deletion of Klf5 and phosphatase and tensin homolog (Pten), both of which are frequently inactivated in human prostate cancer. Histologic analysis demonstrated that when one Pten allele was deleted, which causes mouse prostatic intraepithelial neoplasia (mPIN), Klf5 deletion accelerated the emergence and progression of mPIN. When both Pten alleles were deleted, which causes prostate cancer, Klf5 deletion promoted tumor growth, increased cell proliferation, and caused more severe morphologic and molecular alterations. Homozygous deletion of Klf5 was more effective than hemizygous deletion. Unexpectedly, while Pten deletion alone expanded basal cell population in a tumor as reported, Klf5 deletion in the Pten-null background clearly reduced basal cell population while expanding luminal cell population. Global gene expression profiling, pathway analysis, and experimental validation indicate that multiple mechanisms could mediate the tumor-promoting effect of Klf5 deletion, including the up-regulation of epidermal growth factor and its downstream signaling molecules AKT and ERK and the inactivation of the p15 cell cycle inhibitor. KLF5 also appears to cooperate with several transcription factors, including CREB1, Sp1, Myc, ER and AR, to regulate gene expression. These findings validate the tumor suppressor function of KLF5. They also yield a mouse model that shares two common genetic alterations with human prostate cancer-mutation/deletion of Pten and deletion of Klf5.

  10. An ARHGEF10 deletion is highly associated with a juvenile-onset inherited polyneuropathy in Leonberger and Saint Bernard dogs.

    Directory of Open Access Journals (Sweden)

    Kari J Ekenstedt

    2014-10-01

    Full Text Available An inherited polyneuropathy (PN observed in Leonberger dogs has clinical similarities to a genetically heterogeneous group of peripheral neuropathies termed Charcot-Marie-Tooth (CMT disease in humans. The Leonberger disorder is a severe, juvenile-onset, chronic, progressive, and mixed PN, characterized by exercise intolerance, gait abnormalities and muscle atrophy of the pelvic limbs, as well as inspiratory stridor and dyspnea. We mapped a PN locus in Leonbergers to a 250 kb region on canine chromosome 16 (Praw = 1.16×10-10, Pgenome, corrected = 0.006 utilizing a high-density SNP array. Within this interval is the ARHGEF10 gene, a member of the rho family of GTPases known to be involved in neuronal growth and axonal migration, and implicated in human hypomyelination. ARHGEF10 sequencing identified a 10 bp deletion in affected dogs that removes four nucleotides from the 3'-end of exon 17 and six nucleotides from the 5'-end of intron 17 (c.1955_1958+6delCACGGTGAGC. This eliminates the 3'-splice junction of exon 17, creates an alternate splice site immediately downstream in which the processed mRNA contains a frame shift, and generates a premature stop codon predicted to truncate approximately 50% of the protein. Homozygosity for the deletion was highly associated with the severe juvenile-onset PN phenotype in both Leonberger and Saint Bernard dogs. The overall clinical picture of PN in these breeds, and the effects of sex and heterozygosity of the ARHGEF10 deletion, are less clear due to the likely presence of other forms of PN with variable ages of onset and severity of clinical signs. This is the first documented severe polyneuropathy associated with a mutation in ARHGEF10 in any species.

  11. A French multicenter study of over 700 patients with 22q11 deletions diagnosed using FISH or aCGH.

    Science.gov (United States)

    Poirsier, Céline; Besseau-Ayasse, Justine; Schluth-Bolard, Caroline; Toutain, Jérôme; Missirian, Chantal; Le Caignec, Cédric; Bazin, Anne; de Blois, Marie Christine; Kuentz, Paul; Catty, Marie; Choiset, Agnès; Plessis, Ghislaine; Basinko, Audrey; Letard, Pascaline; Flori, Elisabeth; Jimenez, Mélanie; Valduga, Mylène; Landais, Emilie; Lallaoui, Hakima; Cartault, François; Lespinasse, James; Martin-Coignard, Dominique; Callier, Patrick; Pebrel-Richard, Céline; Portnoi, Marie-France; Busa, Tiffany; Receveur, Aline; Amblard, Florence; Yardin, Catherine; Harbuz, Radu; Prieur, Fabienne; Le Meur, Nathalie; Pipiras, Eva; Kleinfinger, Pascale; Vialard, François; Doco-Fenzy, Martine

    2016-06-01

    Although 22q11.2 deletion syndrome (22q11.2DS) is the most recurrent human microdeletion syndrome associated with a highly variable phenotype, little is known about the condition's true incidence and the phenotype at diagnosis. We performed a multicenter, retrospective analysis of postnatally diagnosed patients recruited by members of the Association des Cytogénéticiens de Langue Française (the French-Speaking Cytogeneticists Association). Clinical and cytogenetic data on 749 cases diagnosed between 1995 and 2013 were collected by 31 French cytogenetics laboratories. The most frequent reasons for referral of postnatally diagnosed cases were a congenital heart defect (CHD, 48.6%), facial dysmorphism (49.7%) and developmental delay (40.7%). Since 2007 (the year in which array comparative genomic hybridization (aCGH) was introduced for the routine screening of patients with intellectual disability), almost all cases have been diagnosed using FISH (96.1%). Only 15 cases (all with an atypical phenotype) were diagnosed with aCGH; the deletion size ranged from 745 to 2904 kb. The deletion was inherited in 15.0% of cases and was of maternal origin in 85.5% of the latter. This is the largest yet documented cohort of patients with 22q11.2DS (the most commonly diagnosed microdeletion) from the same population. French cytogenetics laboratories diagnosed at least 108 affected patients (including fetuses) per year from among a national population of ∼66 million. As observed for prenatal diagnoses, CHDs were the most frequently detected malformation in postnatal diagnoses. The most common CHD in postnatal diagnoses was an isolated septal defect.

  12. Reciprocal deletion and duplication at 2q23.1 indicates a role for MBD5 in autism spectrum disorder.

    Science.gov (United States)

    Mullegama, Sureni V; Rosenfeld, Jill A; Orellana, Carmen; van Bon, Bregje W M; Halbach, Sara; Repnikova, Elena A; Brick, Lauren; Li, Chumei; Dupuis, Lucie; Rosello, Monica; Aradhya, Swaroop; Stavropoulos, D James; Manickam, Kandamurugu; Mitchell, Elyse; Hodge, Jennelle C; Talkowski, Michael E; Gusella, James F; Keller, Kory; Zonana, Jonathan; Schwartz, Stuart; Pyatt, Robert E; Waggoner, Darrel J; Shaffer, Lisa G; Lin, Angela E; de Vries, Bert B A; Mendoza-Londono, Roberto; Elsea, Sarah H

    2014-01-01

    Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.

  13. SnoRNA Snord116 (Pwcr1/MBII-85 deletion causes growth deficiency and hyperphagia in mice.

    Directory of Open Access Journals (Sweden)

    Feng Ding

    Full Text Available Prader-Willi syndrome (PWS is the leading genetic cause of obesity. After initial severe hypotonia, PWS children become hyperphagic and morbidly obese, if intake is not restricted. Short stature with abnormal growth hormone secretion, hypogonadism, cognitive impairment, anxiety and behavior problems are other features. PWS is caused by lack of expression of imprinted genes in a approximately 4 mb region of chromosome band 15q11.2. Our previous translocation studies predicted a major role for the C/D box small nucleolar RNA cluster SNORD116 (PWCR1/HBII-85 in PWS. To test this hypothesis, we created a approximately 150 kb deletion of the > 40 copies of Snord116 (Pwcr1/MBII-85 in C57BL/6 mice. Snord116del mice with paternally derived deletion lack expression of this snoRNA. They have early-onset postnatal growth deficiency, but normal fertility and lifespan. While pituitary structure and somatotrophs are normal, liver Igf1 mRNA is decreased. In cognitive and behavior tests, Snord116del mice are deficient in motor learning and have increased anxiety. Around three months of age, they develop hyperphagia, but stay lean on regular and high-fat diet. On reduced caloric intake, Snord116del mice maintain their weight better than wild-type littermates, excluding increased energy requirement as a cause of hyperphagia. Normal compensatory feeding after fasting, and ability to maintain body temperature in the cold indicate normal energy homeostasis regulation. Metabolic chamber studies reveal that Snord116del mice maintain energy homeostasis by altered fuel usage. Prolonged mealtime and increased circulating ghrelin indicate a defect in meal termination mechanism. Snord116del mice, the first snoRNA deletion animal model, reveal a novel role for a non-coding RNA in growth and feeding regulation.

  14. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    Directory of Open Access Journals (Sweden)

    Beever Jonathan E

    2010-05-01

    Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

  15. Giant panda BAC library construction and assembly of a 650-kb contig spanning major histocompatibility complex class II region

    Directory of Open Access Journals (Sweden)

    Pan Hui-Juan

    2007-09-01

    Full Text Available Abstract Background Giant panda is rare and endangered species endemic to China. The low rates of reproductive success and infectious disease resistance have severely hampered the development of captive and wild populations of the giant panda. The major histocompatibility complex (MHC plays important roles in immune response and reproductive system such as mate choice and mother-fetus bio-compatibility. It is thus essential to understand genetic details of the giant panda MHC. Construction of a bacterial artificial chromosome (BAC library will provide a new tool for panda genome physical mapping and thus facilitate understanding of panda MHC genes. Results A giant panda BAC library consisting of 205,800 clones has been constructed. The average insert size was calculated to be 97 kb based on the examination of 174 randomly selected clones, indicating that the giant panda library contained 6.8-fold genome equivalents. Screening of the library with 16 giant panda PCR primer pairs revealed 6.4 positive clones per locus, in good agreement with an expected 6.8-fold genomic coverage of the library. Based on this BAC library, we constructed a contig map of the giant panda MHC class II region from BTNL2 to DAXX spanning about 650 kb by a three-step method: (1 PCR-based screening of the BAC library with primers from homologous MHC class II gene loci, end sequences and BAC clone shotgun sequences, (2 DNA sequencing validation of positive clones, and (3 restriction digest fingerprinting verification of inter-clone overlapping. Conclusion The identifications of genes and genomic regions of interest are greatly favored by the availability of this giant panda BAC library. The giant panda BAC library thus provides a useful platform for physical mapping, genome sequencing or complex analysis of targeted genomic regions. The 650 kb sequence-ready BAC contig map of the giant panda MHC class II region from BTNL2 to DAXX, verified by the three-step method, offers a

  16. KB-R7943, an inhibitor of the reverse Na+/Ca2+ exchanger, blocks N-methyl-D-aspartate receptor and inhibits mitochondrial complex I

    Science.gov (United States)

    Brustovetsky, Tatiana; Brittain, Matthew K; Sheets, Patrick L; Cummins, Theodore R; Pinelis, Vsevolod; Brustovetsky, Nickolay

    2011-01-01

    BACKGROUND AND PURPOSE An isothiourea derivative (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea methane sulfonate (KB-R7943), a widely used inhibitor of the reverse Na+/Ca2+ exchanger (NCXrev), was instrumental in establishing the role of NCXrev in glutamate-induced Ca2+ deregulation in neurons. Here, the effects of KB-R7943 on N-methyl-D-aspartate (NMDA) receptors and mitochondrial complex I were tested. EXPERIMENTAL APPROACH Fluorescence microscopy, electrophysiological patch-clamp techniques and cellular respirometry with Seahorse XF24 analyzer were used with cultured hippocampal neurons; membrane potential imaging, respirometry and Ca2+ flux measurements were made in isolated rat brain mitochondria. KEY RESULTS KB-R7943 inhibited NCXrev with IC50= 5.7 ± 2.1 µM, blocked NMDAR-mediated ion currents, and inhibited NMDA-induced increase in cytosolic Ca2+ with IC50= 13.4 ± 3.6 µM but accelerated calcium deregulation and mitochondrial depolarization in glutamate-treated neurons. KB-R7943 depolarized mitochondria in a Ca2+-independent manner. Stimulation of NMDA receptors caused NAD(P)H oxidation that was coupled or uncoupled from ATP synthesis depending on the presence of Ca2+ in the bath solution. KB-R7943, or rotenone, increased NAD(P)H autofluorescence under resting conditions and suppressed NAD(P)H oxidation following glutamate application. KB-R7943 inhibited 2,4-dinitrophenol-stimulated respiration of cultured neurons with IC50= 11.4 ± 2.4 µM. With isolated brain mitochondria, KB-R7943 inhibited respiration, depolarized organelles and suppressed Ca2+ uptake when mitochondria oxidized complex I substrates but was ineffective when mitochondria were supplied with succinate, a complex II substrate. CONCLUSIONS AND IMPLICATIONS KB-R7943, in addition to NCXrev, blocked NMDA receptors in cultured hippocampal neurons and inhibited complex I in the mitochondrial respiratory chain. These findings are critical for the correct interpretation of experimental

  17. TM4SF20 Ancestral Deletion and Susceptibility to a Pediatric Disorder of Early Language Delay and Cerebral White Matter Hyperintensities

    Science.gov (United States)

    Wiszniewski, Wojciech; Hunter, Jill V.; Hanchard, Neil A.; Willer, Jason R.; Shaw, Chad; Tian, Qi; Illner, Anna; Wang, Xueqing; Cheung, Sau W.; Patel, Ankita; Campbell, Ian M.; Gelowani, Violet; Hixson, Patricia; Ester, Audrey R.; Azamian, Mahshid S.; Potocki, Lorraine; Zapata, Gladys; Hernandez, Patricia P.; Ramocki, Melissa B.; Santos-Cortez, Regie L.P.; Wang, Gao; York, Michele K.; Justice, Monica J.; Chu, Zili D.; Bader, Patricia I.; Omo-Griffith, Lisa; Madduri, Nirupama S.; Scharer, Gunter; Crawford, Heather P.; Yanatatsaneejit, Pattamawadee; Eifert, Anna; Kerr, Jeffery; Bacino, Carlos A.; Franklin, Adiaha I.A.; Goin-Kochel, Robin P.; Simpson, Gayle; Immken, Ladonna; Haque, Muhammad E.; Stosic, Marija; Williams, Misti D.; Morgan, Thomas M.; Pruthi, Sumit; Omary, Reed; Boyadjiev, Simeon A.; Win, Kay K.; Thida, Aye; Hurles, Matthew; Hibberd, Martin Lloyd; Khor, Chiea Chuen; Van Vinh Chau, Nguyen; Gallagher, Thomas E.; Mutirangura, Apiwat; Stankiewicz, Pawel; Beaudet, Arthur L.; Maletic-Savatic, Mirjana; Rosenfeld, Jill A.; Shaffer, Lisa G.; Davis, Erica E.; Belmont, John W.; Dunstan, Sarah; Simmons, Cameron P.; Bonnen, Penelope E.; Leal, Suzanne M.; Katsanis, Nicholas; Lupski, James R.; Lalani, Seema R.

    2013-01-01

    White matter hyperintensities (WMHs) of the brain are important markers of aging and small-vessel disease. WMHs are rare in healthy children and, when observed, often occur with comorbid neuroinflammatory or vasculitic processes. Here, we describe a complex 4 kb deletion in 2q36.3 that segregates with early childhood communication disorders and WMH in 15 unrelated families predominantly from Southeast Asia. The premature brain aging phenotype with punctate and multifocal WMHs was observed in ∼70% of young carrier parents who underwent brain MRI. The complex deletion removes the penultimate exon 3 of TM4SF20, a gene encoding a transmembrane protein of unknown function. Minigene analysis showed that the resultant net loss of an exon introduces a premature stop codon, which, in turn, leads to the generation of a stable protein that fails to target to the plasma membrane and accumulates in the cytoplasm. Finally, we report this deletion to be enriched in individuals of Vietnamese Kinh descent, with an allele frequency of about 1%, embedded in an ancestral haplotype. Our data point to a constellation of early language delay and WMH phenotypes, driven by a likely toxic mechanism of TM4SF20 truncation, and highlight the importance of understanding and managing population-specific low-frequency pathogenic alleles. PMID:23810381

  18. A molecular deletion of distal chromosome 4p in two families with a satellited chromosome 4 lacking the Wolf-Hirschhorn syndrome phenotype.

    Science.gov (United States)

    Estabrooks, L L; Lamb, A N; Kirkman, H N; Callanan, N P; Rao, K W

    1992-11-01

    We report two families with a satellited chromosome 4 short arm (4ps). Satellites and stalks normally occur on the short arms of acrocentric chromosomes; however, the literature cites several reports of satellited nonacrocentric chromosomes, which presumably result from a translocation with an acrocentric chromosome. This is the first report of 4ps chromosomes. Our families are remarkable in that both unaffected and affected individuals carry the 4ps chromosome. The phenotypes observed in affected individuals, although dissimilar, were sufficient to encourage a search for a deletion of chromosome 4p. By Southern blot analysis and fluorescence in situ hybridization, a deletion of material mapping approximately 150 kb from chromosome 4pter was discovered. This deletion is notable because it does not result in the Wolf-Hirschhorn syndrome and can result in an apparently normal phenotype. We speculate that homology between subterminal repeat sequences on 4p and sequences on the acrocentric short arms may explain the origin of the rearrangement and that position effect may play a role in the expression of the abnormal phenotype.

  19. Antiproliferative activity of flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the MCF7, KB, and NIH/3T3 cell lines.

    Science.gov (United States)

    Nedel, Fernanda; Begnini, Karine; Carvalho, Pedro Henrique de Azambuja; Lund, Rafael Guerra; Beira, Fátima T A; Del Pino, Francisco Augusto B

    2012-11-01

    This study assessed the antiproliferative effect in vitro of the flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the human breast adenocarcinoma (MCF-7), human mouth epidermal carcinoma (KB), and mouse embryonic fibroblast (NIH 3T3) cell lines, using sulforhodamine B (SRB) assay. A cell density of 2×10(4)/well was seeded in 96-well plates, and samples at different concentrations ranging from 10 to 500 mg/mL were tested. The optical density was determined in an ELISA multiplate reader (Thermo Plate TP-Reader). Results demonstrated that the hexane extract presented antiproliferative activity against both the tumor cell lines KB and MCF-7, presenting a GI(50) (MCF-7=13.09 mg/mL), TGI (KB=37.76 mg/mL), and IL(50) (KB=291.07 mg/mL). Also, the hexane extract presented antiproliferative activity toward NIH 3T3 cells GI(50) (183.65 mg/mL), TGI (280.54 mg/mL), and IL(50) (384.59 mg/mL). The results indicate that the flower hexane extract obtained from M. spicata associated with M. rotundifolia presents an antineoplastic activity against KB and MCF-7, although an antiproliferative effect at a high concentration of the extract was observed toward NIH 3T3.

  20. Alteration in Inflammation-related miR-146a Expression in NF-KB Signaling Pathway in Diabetic Rat Hippocampus.

    Science.gov (United States)

    Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza

    2016-03-01

    The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.

  1. Identification of a new DPY19L2 mutation and a better definition of DPY19L2 deletion breakpoints leading to globozoospermia.

    Science.gov (United States)

    Ghédir, Houda; Ibala-Romdhane, Samira; Okutman, Ozlem; Viot, Géraldine; Saad, Ali; Viville, Stéphane

    2016-01-01

    The purpose of this study was to analyze DPY19L2 sequence variants to investigate the mechanism leading to the entire DPY19L2 deletion in a large cohort of infertile globozoospermic patients. An improved analysis of the DPY19L2 deletion breakpoints (BPs) allowed us to identify two BPs located in a small 1 kb region and to more precisely localize the BPs reported previously. Three genes [spermatogenesis associated 16 (SPATA16), protein interacting with PRKCA (PICK1) and DPY19L2] were previously correlated with globozoospermia, but a homozygous deletion of the entire DPY19L2 was identified as the most frequent alteration causing this phenotype. In addition, several point mutations in this gene were reported. In previous work, we have identified nine BPs for the DPY19L2 deletion clustered in two hotspot regions, while others reported a total of five BPs. We screened for the DPY19L2 deletion and for mutations in the DPY19L2, SPATA16 and PICK1 genes in a cohort of 21 Tunisian globozoospermic patients. In order to characterize the DPY19L2 deletion BPs, we sequenced a 2 kb fragment on low copy repeat (LCR) 1 and LCR2 in Tunisian fertile controls to distinguish between single-nucleotide polymorphisms (SNPs) and LCR-specific markers. Molecular analyses performed on 18 genetically independent individuals showed that 11 (61.1%) were homozygous for the DPY19L2 deletion, 2 (11.1%) were homozygous for the non-synonymous mutation (p.R298C) in exon 8, 1 patient (5.6%) was homozygous for a new splice-site mutation at the junction exon-intron 16 [c.1579_1580+4delAGGTAAinsTCAT] and no DPY19L2, SPATA16 or PICK1 mutations were identified for 4 patients (22.2%). By defining 15 specific LCR markers, we characterized 2 BPs for the DPY19L2 deletion in 11 patients showing the homozygous deletion. Using 20 non-LCR-specific SNPs, we identified 8 distinct haplotypes. A limitation of this study is the small number of patients owing to the rarity of this form of male infertility. Our data showed

  2. Brand deletion: How the decision-making approach affects deletion success

    Directory of Open Access Journals (Sweden)

    Víctor Temprano-García

    2018-04-01

    Full Text Available Literature on brand deletion (BD, a critical and topical decision within a firm's marketing strategy, is extremely scarce. The present research is concerned with the decision-making process and examines the effect on BD success of three different approaches to decision-making – rational, intuitive and political – and of the interaction between the rational and political approaches. The moderating effect of the type of BD – i.e., total brand killing or disposal vs. brand name change – is also analyzed. The model is tested on a sample of 155 cases of BD. Results point to positive effects on BD success of both rationality and intuition, and a negative effect of politics. Findings also indicate that the negative impact of political behavior on BD success is minimized in the absence of evidence and objective information and when the BD is undertaken through a brand name change. JEL classification: L10, M31, Keywords: Brand deletion, Rational decision-making, Intuitive decision-making, Political decision-making, Brand deletion success

  3. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  4. Generalised deletion designs | Gachii | African Journal of Science ...

    African Journals Online (AJOL)

    In this paper asymmetrical single replicate factorial designs are constructed from symmetrical single replicate factorial designs using the deletion technique. The study is along the lines of Voss(1986), Chauhan(1989) and Gachii and Odhiambo(1997). We give results for the general order deletion designs of the form sn-m1(s ...

  5. 24 CFR 990.155 - Addition and deletion of units.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Addition and deletion of units. 990.155 Section 990.155 Housing and Urban Development Regulations Relating to Housing and Urban...; Computation of Eligible Unit Months § 990.155 Addition and deletion of units. (a) Changes in public housing...

  6. 4977-bp mitochondrial DNA deletion in infertile patients with varicocele.

    Science.gov (United States)

    Gashti, N G; Salehi, Z; Madani, A H; Dalivandan, S T

    2014-04-01

    Varicocele is the abnormal inflexion and distension of veins of the pampiniform plexus within spermatic cord and is one of the amendable causes of male infertility. It can increase reactive oxygen species (ROS) production in semen and cause oxidative stress. The purpose of this study was to analyse spermatozoa mtDNA 4977-bp deletion in infertile men with varicocele. To detect 4977-bp deletion in spermatozoa mtDNA, semen samples of 60 infertile patients with clinical varicocele and 90 normal men from northern Iran were prepared. After extraction of spermatozoa total DNA, Gap polymerase chain reaction (Gap PCR) was performed. 4977-bp deletion was observed in 81.66% of patients with varicocele, while approximately 15.55% of controls had this deletion. As spermatozoa from patients with varicocele had a high frequency of occurrence of 4977-bp deletion in mtDNA [OR = 24.18, 95% confidence interval (CI) = 10.15-57.57, P deletion in spermatozoa and cause infertility in north Iranian men. However, to determine the relation between sperm mtDNA 4977-bp deletion and varicocele-induced infertility, larger population-based studies are needed. It is concluded that there is an association between sperm mtDNA 4977-bp deletion and varicocele-induced infertility in the population studied. © 2013 Blackwell Verlag GmbH.

  7. 34 CFR 5.16 - Deletion of identifying details.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Deletion of identifying details. 5.16 Section 5.16 Education Office of the Secretary, Department of Education AVAILABILITY OF INFORMATION TO THE PUBLIC PURSUANT TO PUB. L. 90-23 (Eff. until 7-14-10) What Records Are Available § 5.16 Deletion of identifying...

  8. 42 CFR 401.118 - Deletion of identifying details.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Deletion of identifying details. 401.118 Section 401.118 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... Deletion of identifying details. When CMS publishes or otherwise makes available an opinion or order...

  9. Coexistence of 9p Deletion Syndrome and Autism Spectrum Disorder

    Science.gov (United States)

    Günes, Serkan; Ekinci, Özalp; Ekinci, Nuran; Toros, Fevziye

    2017-01-01

    Deletion or duplication of the short arm of chromosome 9 may lead to a variety of clinical conditions including craniofacial and limb abnormalities, skeletal malformations, mental retardation, and autism spectrum disorder. Here, we present a case report of 5-year-old boy with 9p deletion syndrome and autism spectrum disorder.

  10. Linguistic and Psychomotor Development in Children with Chromosome 14 Deletions

    Science.gov (United States)

    Zampini, Laura; D'Odorico, Laura; Zanchi, Paola; Zollino, Marcella; Neri, Giovanni

    2012-01-01

    The present study focussed on a specific type of rare genetic condition: chromosome 14 deletions. Children with this genetic condition often show developmental delays and brain and neurological problems, although the type and severity of symptoms varies depending on the size and location of the deleted genetic material. The specific aim of the…

  11. 76 FR 78248 - Procurement List; Addition and Deletions

    Science.gov (United States)

    2011-12-16

    .... Service Type/Location: Laundry Service, Stratton Medical Center, 113 Holland Ave, Albany, NY. [[Page 78249...: Addition to and Deletions from the Procurement List. SUMMARY: This action adds a service to the Procurement... disabilities, and deletes products and services from the Procurement List previously furnished by such agencies...

  12. 75 FR 49481 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2010-08-13

    ... added to the Procurement List: Services Service Type/Locations: Laundry Service, Atlanta VA Medical...: Additions to and deletion from the Procurement List. SUMMARY: This action adds services to the Procurement... disabilities and deletes a service from the Procurement List previously furnished by such agency. DATES...

  13. 78 FR 21916 - Procurement List; Addition And Deletions

    Science.gov (United States)

    2013-04-12

    ..., the following service is added to the Procurement List: Service Service Type/Location: Laundry Service...: Addition to and Deletions from the Procurement List. SUMMARY: This action adds a service to the Procurement... disabilities, and deletes products and services from the Procurement List previously furnished by such agencies...

  14. 78 FR 53733 - Procurement List Additions and Deletions

    Science.gov (United States)

    2013-08-30

    .../Location: Industrial Laundry Service, Bureau of Engraving and Printing, 9000 Blue Mound Road, Fort Worth...: Additions to and Deletions from the Procurement List. SUMMARY: This action adds products and services to the... severe disabilities, and deletes services from the Procurement List previously provided by such agencies...

  15. Recurrence and Variability of Germline EPCAM Deletions in Lynch Syndrome

    NARCIS (Netherlands)

    Kuiper, Roland P.; Vissers, Lisenka E. L. M.; Venkatachalam, Ramprasath; Bodmer, Danielle; Hoenselaar, Eveline; Goossens, Monique; Haufe, Aline; Kamping, Eveline; Niessen, Renee C.; Hogervorst, Frans B. L.; Gille, Johan J. P.; Redeker, Bert; Tops, Carli M. J.; van Gijn, Marielle E.; van den Ouweland, Ans M. W.; Rahner, Nils; Steinke, Verena; Kahl, Philip; Holinski-Feder, Elke; Morak, Monika; Kloor, Matthias; Stemmler, Susanne; Betz, Beate; Hutter, Pierre; Bunyan, David J.; Syngal, Sapna; Culver, Julie O.; Graham, Tracy; Chan, Tsun L.; Nagtegaal, Iris D.; van Krieken, J. Han J. M.; Schackert, Hans K.; Hoogerbrugge, Nicoline; van Kessel, Ad Geurts; Ligtenberg, Marjolijn J. L.

    Recently, we identified 3' end deletions in the EPCAM gene as a novel cause of Lynch syndrome. These truncating EPCAM deletions cause allele-specific epigenetic silencing of the neighboring DNA mismatch repair gene MSH2 in tissues expressing EPCAM. Here we screened a cohort of unexplained Lynch-like

  16. Attenuation of monkeypox virus by deletion of genomic regions

    Science.gov (United States)

    Lopera, Juan G.; Falendysz, Elizabeth A.; Rocke, Tonie E.; Osorio, Jorge E.

    2015-01-01

    Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivostudies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence.

  17. Role of DNA deletion length in mutation and cell survival

    International Nuclear Information System (INIS)

    Braby, L.A.; Morgan, T.L.

    1992-01-01

    A model is presented which is based on the assumption that malignant transformation, mutation, chromosome aberration, and reproductive death of cells are all manifestations of radiation induced deletions in the DNA of the cell, and that the size of the deletion in relation to the spacing of essential genes determines the consequences of that deletion. It is assumed that two independent types of potentially lethal lesions can result in DNA deletions, and that the relative numbers of these types of damage is dependent on radiation quality. The repair of the damage reduces the length of a deletion, but does not always eliminate it. The predictions of this model are in good agreement with a wide variety of experimental evidence. (author)

  18. Melting relations and elemental distribution of portion of the system Fe-S-Si-O to 32 KB with planetary application

    Science.gov (United States)

    Huang, W. L.

    1980-01-01

    The melting relations and distribution of K and Cs in portions of the system was determined at high pressures. Ferrosilite is stable as a primary phase at high pressures because of the incongruent melting of ferrosilite to quartz plus liquid and the boundary between the one and two liquid fields on the joint Fe(1-x) O-FeS-SiO2 shifts away from silica with increasing pressures. Potassium K was found to have limited solubility in metal sulfide liquids at pressures up to 45 kb. The speculation that K may dissolve significantly in metal-metal sulfide liquids after undergoing first order isomorphic transition was tested by determining the distribution of Cs between sulfide and silicate liquids as an analogy to K. At 45 kb, 1400 C and 27 kb, 1300 C only limited amounts of Cs were detected in quench sulfide liquids even at pressures beyond the isomorphic transition of Cs.

  19. Ku80-deleted cells are defective at base excision repair

    International Nuclear Information System (INIS)

    Li, Han; Marple, Teresa; Hasty, Paul

    2013-01-01

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H 2 O 2 and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs

  20. Ku80-deleted cells are defective at base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Li, Han [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain); Marple, Teresa [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Hasty, Paul, E-mail: hastye@uthscsa.edu [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain)

    2013-05-15

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H{sub 2}O{sub 2} and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs.

  1. Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

    Science.gov (United States)

    Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

    2018-01-01

    Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

  2. CRISPR reveals a distal super-enhancer required for Sox2 expression in mouse embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Yan Li

    Full Text Available The pluripotency of embryonic stem cells (ESCs is maintained by a small group of master transcription factors including Oct4, Sox2 and Nanog. These core factors form a regulatory circuit controlling the transcription of a number of pluripotency factors including themselves. Although previous studies have identified transcriptional regulators of this core network, the cis-regulatory DNA sequences required for the transcription of these key pluripotency factors remain to be defined. We analyzed epigenomic data within the 1.5 Mb gene-desert regions around the Sox2 gene and identified a 13kb-long super-enhancer (SE located 100kb downstream of Sox2 in mouse ESCs. This SE is occupied by Oct4, Sox2, Nanog, and the mediator complex, and physically interacts with the Sox2 locus via DNA looping. Using a simple and highly efficient double-CRISPR genome editing strategy we deleted the entire 13-kb SE and characterized transcriptional defects in the resulting monoallelic and biallelic deletion clones with RNA-seq. We showed that the SE is responsible for over 90% of Sox2 expression, and Sox2 is the only target gene along the chromosome. Our results support the functional significance of a SE in maintaining the pluripotency transcription program in mouse ESCs.

  3. Tau deletion promotes brain insulin resistance.

    Science.gov (United States)

    Marciniak, Elodie; Leboucher, Antoine; Caron, Emilie; Ahmed, Tariq; Tailleux, Anne; Dumont, Julie; Issad, Tarik; Gerhardt, Ellen; Pagesy, Patrick; Vileno, Margaux; Bournonville, Clément; Hamdane, Malika; Bantubungi, Kadiombo; Lancel, Steve; Demeyer, Dominique; Eddarkaoui, Sabiha; Vallez, Emmanuelle; Vieau, Didier; Humez, Sandrine; Faivre, Emilie; Grenier-Boley, Benjamin; Outeiro, Tiago F; Staels, Bart; Amouyel, Philippe; Balschun, Detlef; Buee, Luc; Blum, David

    2017-08-07

    The molecular pathways underlying tau pathology-induced synaptic/cognitive deficits and neurodegeneration are poorly understood. One prevalent hypothesis is that hyperphosphorylation, misfolding, and fibrillization of tau impair synaptic plasticity and cause degeneration. However, tau pathology may also result in the loss of specific physiological tau functions, which are largely unknown but could contribute to neuronal dysfunction. In the present study, we uncovered a novel function of tau in its ability to regulate brain insulin signaling. We found that tau deletion leads to an impaired hippocampal response to insulin, caused by altered IRS-1 and PTEN (phosphatase and tensin homologue on chromosome 10) activities. Our data also demonstrate that tau knockout mice exhibit an impaired hypothalamic anorexigenic effect of insulin that is associated with energy metabolism alterations. Consistently, we found that tau haplotypes are associated with glycemic traits in humans. The present data have far-reaching clinical implications and raise the hypothesis that pathophysiological tau loss-of-function favors brain insulin resistance, which is instrumental for cognitive and metabolic impairments in Alzheimer's disease patients. © 2017 Marciniak et al.

  4. Usefulness of MLPA in the detection of SHOX deletions.

    Science.gov (United States)

    Funari, Mariana F A; Jorge, Alexander A L; Souza, Silvia C A L; Billerbeck, Ana E C; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

    2010-01-01

    SHOX haploinsufficiency causes a wide spectrum of short stature phenotypes, such as Leri-Weill dyschondrosteosis (LWD) and disproportionate short stature (DSS). SHOX deletions are responsible for approximately two thirds of isolated haploinsufficiency; therefore, it is important to determine the most appropriate methodology for detection of gene deletion. In this study, three methodologies for the detection of SHOX deletions were compared: the fluorescence in situ hybridization (FISH), microsatellite analysis and multiplex ligation-dependent probe amplification (MLPA). Forty-four patients (8 LWD and 36 DSS) were analyzed. The cosmid LLNOYCO3'M'34F5 was used as a probe for the FISH analysis and microsatellite analysis were performed using three intragenic microsatellite markers. MLPA was performed using commercial kits. Twelve patients (8 LWD and 4 DSS) had deletions in SHOX area detected by MLPA and 2 patients generated discordant results with the other methodologies. In the first case, the deletion was not detected by FISH. In the second case, both FISH and microsatellite analyses were unable to identify the intragenic deletion. In conclusion, MLPA was more sensitive, less expensive and less laborious; therefore, it should be used as the initial molecular method for the detection of SHOX gene deletion. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  5. Conversion of Deletions during Recombination in Pneumococcal Transformation

    Science.gov (United States)

    Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

    1989-01-01

    Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

  6. A strong deletion bias in nonallelic gene conversion.

    Directory of Open Access Journals (Sweden)

    Raquel Assis

    Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.

  7. Combination of Aloe vera and xenograft induction on decreasing of NF-kb of tooth extraction socket preservation in Cavia cobaya

    Directory of Open Access Journals (Sweden)

    Utari Kresnoadi

    2014-03-01

    Full Text Available Background: Tooth extraction can naturally cause inflammation triggering osteoclast proliferation and alveolar bone resorption. Preservation of the tooth extraction sockets is needed for patients in order to reduce alveolar bone resorption risks. Aloe vera is known to have anthraquinones components, namely Aloin, Aloe emedin, and barbaloin, considered as anti-inflammation. Therefore, to overcome the inflammation, the role of NF-kb is very significant to decrease nuclear factor kappa b (NF-kb. As a result, inflammation risks will be decreased. Purpose: The study was aimed to determine the induction effect of combination of Aloe vera and XCB into tooth extraction sockets to reduce inflammation by reducing NF-kb expression, osteoclasts and osteoblasts. Methods: Forty-eight Cavia cobaya were divided into eight groups, each group consisted of six animals. The mandibular incisors of those Cavia cobaya were extracted and induced with either PEG, XCB, Aloe vera, or the combination of Aloe vera + XCB. Those animals were sacrificed on day 7 and day 30 after the extraction. Then immunohistochemical and histopathology examinations were conducted to observe NF-kb expression, osteoblasts and osteoclasts. Results: It was known that in group induced with the combination of Aloe vera and xenograft concelous bovine, the growth of osteoblasts was high, while NF-kb expression and osteoclasts reduced. Conclusion: It can be concluded that the induction of the combination of Aloe vera and XCB into the tooth extraction sockets can reduce NF-kb expression and osteoclast, as a result, alveolar bone resorption risks decrease, and osteoblast increase.Latar belakang: Trauma mekanis akibat pencabutan gigi asli menyebabkan keradangan. Keradangan memicu proliferasi osteoklas sehingga menyebabkan resorpsi tulang alveolararis. Pada pembuatan gigi tiruan, resorpsi tulang alveolar yang terjadi, sangat tidak diinginkan, sebab resorpsi tulang alveolar mengurangi keberhasilan

  8. Effects of taxol and ionizing radiation on cytotoxicity and prostaglandin production in KB, RPMI-2650, SW-13 and L929

    International Nuclear Information System (INIS)

    Lee, Keon Il; Yoo, Dong Soo

    1998-01-01

    The author evaluated the effects of taxol, a microtubular inhibitor, as a possible radiation sensitizer and the production of prostaglandins on three human cancer cell lines (KB, RPMI-2650 and SW-13) and one murine cell line (L929). Each cell line was divided into four groups (control, taxol only, radiation only and combination of taxol and radiation). The treatment consisted of a single irradiation of 10 Gy and graded doses (5, 50, 100, 200, 300, 500 nM) of taxol for a 24-h period. The cytotoxicity of taxol alone was measured at 1 day after (1-day group) and 4 days after (4-day group) the treatment. The survival ratio of cell was analyzed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyl tetrazolium bromide) test. Prostaglandins (PGE2 and PGI2) were measured in the culture medium by a radioimmunoassay. The results obtained were as follows ; 1. There was a significantly in creased cytotoxicity of KB cells in 4-day group than those in 1-day group. There was a high correlation between doses of taxol and cell viability in both groups (1-day group R=0.82741, 4-day group R=0.84655). 2. There was a significantly increased cytotoxicity of RPMI-2650 cells treated with high concentration of taxol in 4-day group than those in 1-day group. Also there was a high correlation between doses of taxol and cell viability in 4-day group (R=0.93917). 3. There was a significantly increased cytotoxicity of SW-13 cell treated with high concentration of taxol in 4-day group than those in 1-day group. However no high correlation was observed between doses of taxol and cell viability in both groups (1-day group R=0.46362, 4-day group R=0.65425). 4. There was a significantly increased cytotoxicity of L929 cells treated with low concentration of taxol in 4-day group than those in 1-day group. At the same time, there was a low correlation between doses of taxol and cell viability in both groups (1-day group R=0.34237, 4-day group R=0.23381). 5. In 1-day group of L929 cells, higher

  9. Performance of quantum cloning and deleting machines over coherence

    Science.gov (United States)

    Karmakar, Sumana; Sen, Ajoy; Sarkar, Debasis

    2017-10-01

    Coherence, being at the heart of interference phenomena, is found to be an useful resource in quantum information theory. Here we want to understand quantum coherence under the combination of two fundamentally dual processes, viz., cloning and deleting. We found the role of quantum cloning and deletion machines with the consumption and generation of quantum coherence. We establish cloning as a cohering process and deletion as a decohering process. Fidelity of the process will be shown to have connection with coherence generation and consumption of the processes.

  10. Brand deletion: How the decision-making approach affects deletion success

    OpenAIRE

    Víctor Temprano-García; Ana Isabel Rodríguez-Escudero; Javier Rodríguez-Pinto

    2018-01-01

    Literature on brand deletion (BD), a critical and topical decision within a firm's marketing strategy, is extremely scarce. The present research is concerned with the decision-making process and examines the effect on BD success of three different approaches to decision-making – rational, intuitive and political – and of the interaction between the rational and political approaches. The moderating effect of the type of BD – i.e., total brand killing or disposal vs. brand name change – is also...

  11. The putative imprinted locus D15S9 within the common deletion region for the Prader-Willi and Angelman syndromes encodes two overlapping mRNAs transcribed from opposite strands

    Energy Technology Data Exchange (ETDEWEB)

    Glenn, C.C.; Driscoll, D.J. [Univ. of Florida, Gainesville, FL (United States); Saitoh, S. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others

    1994-09-01

    Prader-Willi syndrome is typically caused by a deletion of paternal 15q11-q13, or maternal uniparental disomy (UPD) of chromosome 15, while Angelman syndrome is caused by a maternal deletion or paternal UPD of the same region. Therefore, these two clinically distinct neurobehavioral syndromes result from differential expression of imprinted genes within 15q11-q13. A 3.1 kb cDNA, DN34, from the D15S9 locus within 15q11-q13 was isolated from a human fetal brain library. We showed previously that DN34 probe detects a DNA methylation imprint and therefore may represent a candidate imprinted gene. Isolation of genomic clones and DNA sequencing demonstrated that the gene segment encoding the partial cDNA DN34 was split by a 2 kb intron, but did not encode a substantial open reading frame (ORF). Preliminary analysis of expression by RT-PCR suggests that this gene is expressed in fetal but not in tested tissue types from the adult, and thus its imprinting status has not been possible to assess at present. Surprisingly, we found an ORF on the antisense strand of the DN34 cDNA. This ORF encodes a putative polypeptide of 505 amino acid residues containing a RING C{sub 3}HC{sub 4} zinc-finger motif and other features of nuclear proteins. Subsequent characterization of this gene, ZNF127, and a mouse homolog, demonstrated expression of 3.2 kb transcript from all tested fetal and adult tissues. Transcripts initiate from within a CpG-island, shown to be differentially methylated on parental alleles in the human. Interestingly, functional imprinting of the mouse homolog was subsequently demonstrated in an F{sub 1} cross by analyzing a VNTR polymorphism in the mRNA. The ZNF127 gene is intronless, has significant overlap with the DN34 gene on the antisense strand, and a 1 kb 3{prime} end within the 2 kb DN34 intron.

  12. Inclusion of Moloney murine leukemia virus elements upstream of the transgene cassette in an E1-deleted adenovirus leads to an unusual genomic integration in epithelial cells

    International Nuclear Information System (INIS)

    Zheng Changyu; O'Connell, Brian C.; Baum, Bruce J.

    2003-01-01

    Classically, the 5' and 3' long terminal repeats (LTRs) are considered necessary but not sufficient for retroviral integration. Recently, we reported that inclusion of these and additional elements from Moloney murine leukemia virus (MoMLV) facilitated transgene integration, without retroviral integrase, when placed in an adenoviral context (AdLTR-luc vector) (Nat. Biotech. 18 (2000), 176; Biochem. Biophys. Res. Commun. 300 (2003), 115). To help understand this nonhomologous DNA recombination event, we constructed another vector, AdELP-luc, with 2.7 kb of MoMLV elements identically placed into an E1-deleted adenovirus type 5 backbone upstream of a luciferase cDNA reporter gene. Unlike AdLTR-luc, no MoMLV elements were placed downstream of the expression cassette. AdELP-luc readily infected epithelial cells in vitro. Southern hybridizations with DNA from cloned cells showed that disruption of the MoMLV sequences occurred. One cell clone, grown in vitro without any special selection medium for 9 months, exhibited stable vector integration and luciferase activity. Importantly, both Southern hybridization and FISH analyses showed that in addition to the MoMLV elements and expression cassette, substantial adenoviral sequence downstream of the luciferase cDNA was genomically integrated. These results suggest that the 2.7 kb of MoMLV sequence included in AdELP-luc have cis-acting functions and mediates an unusual integration event

  13. 22q11.2 deletion syndrome

    Science.gov (United States)

    McDonald-McGinn, Donna M.; Sullivan, Kathleen E.; Marino, Bruno; Philip, Nicole; Swillen, Ann; Vorstman, Jacob A. S.; Zackai, Elaine H.; Emanuel, Beverly S.; Vermeesch, Joris R.; Morrow, Bernice E.; Scambler, Peter J.; Bassett, Anne S.

    2016-01-01

    22q11.2 deletion syndrome (22q11.2DS) is the most common chromosomal microdeletion disorder, estimated to result mainly from de novo non-homologous meiotic recombination events occurring in approximately 1 in every 1,000 fetuses. The first description in the English language of the constellation of findings now known to be due to this chromosomal difference was made in the 1960s in children with DiGeorge syndrome, who presented with the clinical triad of immunodeficiency, hypoparathyroidism and congenital heart disease. The syndrome is now known to have a heterogeneous presentation that includes multiple additional congenital anomalies and later-onset conditions, such as palatal, gastrointestinal and renal abnormalities, autoimmune disease, variable cognitive delays, behavioural phenotypes and psychiatric illness — all far extending the original description of DiGeorge syndrome. Management requires a multidisciplinary approach involving paediatrics, general medicine, surgery, psychiatry, psychology, interventional therapies (physical, occupational, speech, language and behavioural) and genetic counselling. Although common, lack of recognition of the condition and/or lack of familiarity with genetic testing methods, together with the wide variability of clinical presentation, delays diagnosis. Early diagnosis, preferably prenatally or neonatally, could improve outcomes, thus stressing the importance of universal screening. Equally important, 22q11.2DS has become a model for understanding rare and frequent congenital anomalies, medical conditions, psychiatric and developmental disorders, and may provide a platform to better understand these disorders while affording opportunities for translational strategies across the lifespan for both patients with 22q11.2DS and those with these associated features in the general population. PMID:27189754

  14. Heme oxygenase-1 deletion affects stress erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Yu-An Cao

    Full Text Available Homeostatic erythropoiesis leads to the formation of mature red blood cells under non-stress conditions, and the production of new erythrocytes occurs as the need arises. In response to environmental stimuli, such as bone marrow transplantation, myelosuppression, or anemia, erythroid progenitors proliferate rapidly in a process referred to as stress erythropoiesis. We have previously demonstrated that heme oxygenase-1 (HO-1 deficiency leads to disrupted stress hematopoiesis. Here, we describe the specific effects of HO-1 deficiency on stress erythropoiesis.We used a transplant model to induce stress conditions. In irradiated recipients that received hmox(+/- or hmox(+/+ bone marrow cells, we evaluated (i the erythrocyte parameters in the peripheral blood; (ii the staining intensity of CD71-, Ter119-, and CD49d-specific surface markers during erythroblast differentiation; (iii the patterns of histological iron staining; and (iv the number of Mac-1(+-cells expressing TNF-α. In the spleens of mice that received hmox(+/- cells, we show (i decreases in the proerythroblast, basophilic, and polychromatophilic erythroblast populations; (ii increases in the insoluble iron levels and decreases in the soluble iron levels; (iii increased numbers of Mac-1(+-cells expressing TNF-α; and (iv decreased levels of CD49d expression in the basophilic and polychromatophilic erythroblast populations.As reflected by effects on secreted and cell surface proteins, HO-1 deletion likely affects stress erythropoiesis through the retention of erythroblasts in the erythroblastic islands of the spleen. Thus, HO-1 may serve as a therapeutic target for controlling erythropoiesis, and the dysregulation of HO-1 may be a predisposing condition for hematologic diseases.

  15. A potential contributory role for ciliary dysfunction in the 16p11.2 600 kb BP4-BP5 pathology

    NARCIS (Netherlands)

    Migliavacca, Eugenia; Golzio, Christelle; Männik, Katrin; Blumenthal, Ian; Oh, Edwin C.; Harewood, Louise; Kosmicki, Jack A.; Loviglio, Maria Nicla; Giannuzzi, Giuliana; Hippolyte, Loyse; Maillard, Anne M.; Alfaiz, Ali Abdullah; Witwicki, Robert; Didelot, Gérard; Van Der Werf, Ilse; Alfaiz, Ali A.; Zazhytska, Marianna; Chrast, Jacqueline; Macé, Aurélien; Bergmann, Sven; Kutalik, Zoltan; Siffredi, Vanessa; Zufferey, Flore; Martinet, Danielle; Bena, Frédérique; Rauch, Anita; Bouquillon, Sonia; Delobel, Bruno; Boute, Odile; Duban-Bedu, Bénédicte; Le Caignec, Cédric; Isidor, Bertrand; Chiesa, Jean; Keren, Boris; Gilbert-Dussardier, Brigitte; Touraine, Renaud; Campion, Dominique; Thambo, Caroline Rooryck; Mathieu-Dramard, Michèle; Plessis, Ghislaine; Kooy, Frank; Peeters, Hilde; Ounap, Katrin; Vulto-Van Silfhout, Anneke T.; De Vries, Bert B.; Van Binsbergen, Ellen; Nordgren, Ann; Mucciolo, Mafalda; Renieri, Alessandra; Rajcan-Separovic, Evica; Philipps, John A.; Ellis, Richard J.; Van Haelst, Mieke M.; Andrieux, Joris; Gusella, James F.; Daly, Mark J.; Beckmann, Jacques S.; Jacquemont, Sébastien; Talkowski, Michael E.; Katsanis, Nicholas; Reymond, Alexandre

    2015-01-01

    The 16p11.2 600 kb copy-number variants (CNVs) are associated with mirror phenotypes on BMI, head circumference, and brain volume and represent frequent genetic lesions in autism spectrum disorders (ASDs) and schizophrenia. Here we interrogated the transcriptome of individuals carrying reciprocal

  16. UniProtKB/Swiss-Prot, the Manually Annotated Section of the UniProt KnowledgeBase: How to Use the Entry View.

    Science.gov (United States)

    Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Schneider, Michel; Bansal, Parit; Bridge, Alan J; Poux, Sylvain; Bougueleret, Lydie; Xenarios, Ioannis

    2016-01-01

    The Universal Protein Resource (UniProt, http://www.uniprot.org ) consortium is an initiative of the SIB Swiss Institute of Bioinformatics (SIB), the European Bioinformatics Institute (EBI) and the Protein Information Resource (PIR) to provide the scientific community with a central resource for protein sequences and functional information. The UniProt consortium maintains the UniProt KnowledgeBase (UniProtKB), updated every 4 weeks, and several supplementary databases including the UniProt Reference Clusters (UniRef) and the UniProt Archive (UniParc).The Swiss-Prot section of the UniProt KnowledgeBase (UniProtKB/Swiss-Prot) contains publicly available expertly manually annotated protein sequences obtained from a broad spectrum of organisms. Plant protein entries are produced in the frame of the Plant Proteome Annotation Program (PPAP), with an emphasis on characterized proteins of Arabidopsis thaliana and Oryza sativa. High level annotations provided by UniProtKB/Swiss-Prot are widely used to predict annotation of newly available proteins through automatic pipelines.The purpose of this chapter is to present a guided tour of a UniProtKB/Swiss-Prot entry. We will also present some of the tools and databases that are linked to each entry.

  17. Chronic myeloid leukemia may be associated with several bcr-abl transcripts including the acute lymphoid leukemia-type 7 kb transcript

    NARCIS (Netherlands)

    Selleri, L.; von Lindern, M.; Hermans, A.; Meijer, D.; Torelli, G.; Grosveld, G.

    1990-01-01

    In the majority of Philadelphia (Ph)-positive chronic myeloid leukemia (CML) patients, the c-abl gene is fused to the bcr gene, resulting in the transcription of an 8.5 kb chimeric bcr-abl mRNA, which is translated into a p210bcr-abl fusion protein. In about 50% of the Ph-positive acute lymphoid

  18. A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

    Science.gov (United States)

    Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

    2013-12-01

    The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  19. 3,3′,4,4′,5-Pentachlorobiphenyl Inhibits Drug Efflux Through P-Glycoprotein in KB-3 Cells Expressing Mutant Human P-Glycoprotein

    Directory of Open Access Journals (Sweden)

    Hiroshi Fujise

    2004-01-01

    Full Text Available The effects on the drug efflux of 3,3′,4,4′,5-pentachlorobiphenyl (PCB-126, the most toxic of all coplanar polychlorinated biphenyls (Co-PCBs, were examined in KB-3 cells expressing human wild-type and mutant P-glycoprotein in which the 61st amino acid was substituted for serine or phenylalanine (KB3-Phe61. In the cells expressing P-glycoproteins, accumulations of vinblastine and colchicine decreased form 85% to 92% and from 62% to 91%, respectively, and the drug tolerances for these chemicals were increased. In KB3-Phe61, the decreases in drug accumulation were inhibited by adding PCB-126 in a way similar to that with cyclosporine A: by adding 1 μM PCB-126, the accumulations of vinblastine and colchicine increased up to 3.3- and 2.3-fold, respectively. It is suggested that PCB-126 decreased the drug efflux by inhibiting the P-glycoprotein in KB3-Phe61. Since there were various P-glycoproteins and many congeners of Co-PCBs, this inhibition has to be considered a new cause of the toxic effects of Co-PCBs.

  20. One-step FPLC-size-exclusion chromatography procedure for purification of rDMBT1 6 kb with increased biological activity

    DEFF Research Database (Denmark)

    Tuttolomondo, Martina; Hansen, Pernille Lund; Mollenhauer, Jan

    2018-01-01

    from saliva or produced in vitro and purified by a multistep affinity purification procedure using bacteria, followed by FPLC. Here, we compared a simple, one-step FPLC-SEC protocol for purification of recombinant DMBT1 6 kb, with that of the standard bacteria affinity purification-based protocol. Our...

  1. A method for sensible heat flux model parameterization based on radiometric surface temperature and environmental factors without involving the parameter KB-1

    Science.gov (United States)

    Zhuang, Qifeng; Wu, Bingfang; Yan, Nana; Zhu, Weiwei; Xing, Qiang

    2016-05-01

    Sensible heat flux is a key component of land-atmosphere interaction. In most parameterizations it is calculated with surface-air temperature differences and total aerodynamic resistance to heat transfer (Rae) that is related to the KB-1 parameter. Suitable values are hard to obtain since KB-1 is related both to canopy characteristics and environmental conditions. In this paper, a parameterize method for sensible heat flux over vegetated surfaces (maize field and grass land in the Heihe river basin of northwest China) was proposed based on the radiometric surface temperature, surface resistance (Rs) and vapor pressures (saturated and actual) at the surface and the atmosphere above the canopy. A biophysics-based surface resistance model was revised to compute surface resistance with several environmental factors. The total aerodynamic resistance to heat transfer is directly calculated by combining the biophysics-based surface resistance and vapor pressures. One merit of this method is that the calculation of KB-1 can be avoided. The method provides a new way to estimate sensible heat flux over vegetated surfaces and its performance compares well to the LAS measured sensible heat and other empirical or semi-empirical KB-1 based estimations.

  2. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    Directory of Open Access Journals (Sweden)

    Birte Möhlendick

    Full Text Available Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH of single cells. The protocol is based on an established adapter-linker PCR (WGAM and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost- effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  3. Dual AAV Gene Therapy for Duchenne Muscular Dystrophy with a 7-kb Mini-Dystrophin Gene in the Canine Model.

    Science.gov (United States)

    Kodippili, Kasun; Hakim, Chady H; Pan, Xiufang; Yang, Hsiao T; Yue, Yongping; Zhang, Yadong; Shin, Jin-Hong; Yang, N Nora; Duan, Dongsheng

    2018-03-01

    Dual adeno-associated virus (AAV) technology was developed in 2000 to double the packaging capacity of the AAV vector. The proof of principle has been demonstrated in various mouse models. Yet, pivotal evidence is lacking in large animal models of human diseases. Here we report expression of a 7-kb canine ΔH2-R15 mini-dystrophin gene using a pair of dual AAV vectors in the canine model of Duchenne muscular dystrophy (DMD). The ΔH2-R15 minigene is by far the most potent synthetic dystrophin gene engineered for DMD gene therapy. We packaged minigene dual vectors in Y731F tyrosine-modified AAV-9 and delivered to the extensor carpi ulnaris muscle of a 12-month-old affected dog at the dose of 2 × 10 13 viral genome particles/vector/muscle. Widespread mini-dystrophin expression was observed 2 months after gene transfer. The missing dystrophin-associated glycoprotein complex was restored. Treatment also reduced muscle degeneration and fibrosis and improved myofiber size distribution. Importantly, dual AAV therapy greatly protected the muscle from eccentric contraction-induced force loss. Our data provide the first clear evidence that dual AAV therapy can be translated to a diseased large mammal. Further development of dual AAV technology may lead to effective therapies for DMD and many other diseases in human patients.

  4. Immobilization of Cellulase from Bacillus subtilis UniMAP-KB01 on Multi-walled Carbon Nanotubes for Biofuel Production

    Science.gov (United States)

    Naresh, Sandrasekaran; Hoong Shuit, Siew; Kunasundari, Balakrishnan; Hoo Peng, Yong; Qi, Hwa Ng; Teoh, Yi Peng

    2018-03-01

    Bacillus subtilis UniMAP-KB01, a cellulase producer was isolated from Malaysian mangrove soil. Through morphological identification it was observed that the B. subtilis appears to be in rod shaped and identified as a gram positive bacterium. Growth profile of isolated B. subtilis was established by measuring optical density (OD) at 600 nm for every 1 hour intervals. Polymath software was employed to plot the growth profile and the non-linear plot established gave the precision value of linear regression, R2 of 0.9602, root mean square deviation (RMSD) of 0.0176 and variance of 0.0025. The hydrolysis capacity testing revealed the cellulolytic index of 2.83 ± 0.46 after stained with Gram’s Iodine. The harvested crude enzyme after 24 hours incubation in carboxymethylcellulose (CMC) broth at 45°C and 100 RPM, was tested for enzyme activity. Through Filter Paper Assay (FPA), the cellulase activity was calculated to be 0.05 U/mL. The hydrolysis capacity testing and FPA shown an acceptable value for thermophilic bacterial enzyme activity. Thus, this isolated strain reasoned to be potential for producing thermostable cellulase which will be immobilized onto multi-walled carbon nanotubes and the cellulolytic activity will be characterized for biofuel production.

  5. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  6. KB23 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  7. KB21 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  8. Multigene deletions in lung adenocarcinomas from irradiated and control mice

    International Nuclear Information System (INIS)

    Zhang, Y.; Woloschak, G.E.

    1996-01-01

    K-ras codon 12 point mutations mRb and p53 gene deletions were examined in tissues from 120 normal lungs and lung adenocarcinomas that were Formalin-treated and paraffin-embedded 25 years ago. The results showed that 12 of 60 (20%) lung adenocarcinomas had mRb deletions. All lung adenocarcinomas that were initially found bearing deleted mRb had p53 deletions (15 of 15; 100%). A significantly higher mutation frequency for K-ras codon 12 point mutations was also found in the lung adenocarcinomas from mice exposed to 24 once-weekly neutron irradiation (10 of 10; 100%) compared with those exposed to 24 or 60 once-weekly γ-ray doses (5 of 10; 50%). The data suggested that p53 and K-ras gene alterations were two contributory factors responsible for the increased incidence of lung adenocarcinoma in B6CF 1 male mice exposed to protracted neutron radiation

  9. Additions and deletions to the known cerambycidae (Coleoptera) of Bolivia

    Science.gov (United States)

    An additional 137 species and two tribes are added to the known cerambycid fauna of Bolivia while 12 species are deleted. Comments and statistics regarding the growth of knowledge on the Bolivian Cerambycid fauna and species endemicity are included....

  10. 78 FR 75911 - Procurement List; Proposed Additions and Deletions

    Science.gov (United States)

    2013-12-13

    ... persons who are blind or have other severe disabilities and to delete products and a service previously...: General Services Administration, New York, NY NSN: 8955-01-E61-3689--Coffee, Roasted, Ground, 39 oz. bag...

  11. 76 FR 37069 - Procurement List; Proposed Additions and Deletion

    Science.gov (United States)

    2011-06-24

    ... Certification The following products and service are proposed for addition to Procurement List for production by... following product is proposed for deletion from the Procurement List: Product Detergent, Laundry NSN: 7930...

  12. Mapping the pericentric heterochromatin by comparative genomic hybridization analysis and chromosome deletions in Drosophila melanogaster.

    Science.gov (United States)

    He, Bing; Caudy, Amy; Parsons, Lance; Rosebrock, Adam; Pane, Attilio; Raj, Sandeep; Wieschaus, Eric

    2012-12-01

    Heterochromatin represents a significant portion of eukaryotic genomes and has essential structural and regulatory functions. Its molecular organization is largely unknown due to difficulties in sequencing through and assembling repetitive sequences enriched in the heterochromatin. Here we developed a novel strategy using chromosomal rearrangements and embryonic phenotypes to position unmapped Drosophila melanogaster heterochromatic sequence to specific chromosomal regions. By excluding sequences that can be mapped to the assembled euchromatic arms, we identified sequences that are specific to heterochromatin and used them to design heterochromatin specific probes ("H-probes") for microarray. By comparative genomic hybridization (CGH) analyses of embryos deficient for each chromosome or chromosome arm, we were able to map most of our H-probes to specific chromosome arms. We also positioned sequences mapped to the second and X chromosomes to finer intervals by analyzing smaller deletions with breakpoints in heterochromatin. Using this approach, we were able to map >40% (13.9 Mb) of the previously unmapped heterochromatin sequences assembled by the whole-genome sequencing effort on arm U and arm Uextra to specific locations. We also identified and mapped 110 kb of novel heterochromatic sequences. Subsequent analyses revealed that sequences located within different heterochromatic regions have distinct properties, such as sequence composition, degree of repetitiveness, and level of underreplication in polytenized tissues. Surprisingly, although heterochromatin is generally considered to be transcriptionally silent, we detected region-specific temporal patterns of transcription in heterochromatin during oogenesis and early embryonic development. Our study provides a useful approach to elucidate the molecular organization and function of heterochromatin and reveals region-specific variation of heterochromatin.

  13. Mapping the pericentric heterochromatin by comparative genomic hybridization analysis and chromosome deletions in Drosophila melanogaster

    Science.gov (United States)

    He, Bing; Caudy, Amy; Parsons, Lance; Rosebrock, Adam; Pane, Attilio; Raj, Sandeep; Wieschaus, Eric

    2012-01-01

    Heterochromatin represents a significant portion of eukaryotic genomes and has essential structural and regulatory functions. Its molecular organization is largely unknown due to difficulties in sequencing through and assembling repetitive sequences enriched in the heterochromatin. Here we developed a novel strategy using chromosomal rearrangements and embryonic phenotypes to position unmapped Drosophila melanogaster heterochromatic sequence to specific chromosomal regions. By excluding sequences that can be mapped to the assembled euchromatic arms, we identified sequences that are specific to heterochromatin and used them to design heterochromatin specific probes (“H-probes”) for microarray. By comparative genomic hybridization (CGH) analyses of embryos deficient for each chromosome or chromosome arm, we were able to map most of our H-probes to specific chromosome arms. We also positioned sequences mapped to the second and X chromosomes to finer intervals by analyzing smaller deletions with breakpoints in heterochromatin. Using this approach, we were able to map >40% (13.9 Mb) of the previously unmapped heterochromatin sequences assembled by the whole-genome sequencing effort on arm U and arm Uextra to specific locations. We also identified and mapped 110 kb of novel heterochromatic sequences. Subsequent analyses revealed that sequences located within different heterochromatic regions have distinct properties, such as sequence composition, degree of repetitiveness, and level of underreplication in polytenized tissues. Surprisingly, although heterochromatin is generally considered to be transcriptionally silent, we detected region-specific temporal patterns of transcription in heterochromatin during oogenesis and early embryonic development. Our study provides a useful approach to elucidate the molecular organization and function of heterochromatin and reveals region-specific variation of heterochromatin. PMID:22745230

  14. The significance of chromosome deletions in atomic-bomb survivors

    International Nuclear Information System (INIS)

    Tanaka, Kimio; Shigeta, Chiharu; Oguma, Nobuo; Kamada, Nanao; Deng, Z.; Niimi, Masanobu; Aisaka, Tadaichi.

    1986-01-01

    In 39 A-bomb survivors 40 years after exposure at ≤ 1,000 m from ground zero, the frequency and features of chromosome deletions in peripheral lymphocytes were examined using a differential staining technique. Simultaneously, in vitro irradiation experiment with Cf-252 was made to infer chromosome aberrations occuring immediately after exposure. Californium-252 with 100 rad induced dicentric and ring chromosomes in 40 % of the cells and acentric fragments in 44 %. Among the A-bomb survivors, chromosome aberrations were observed in 651 (21 %) of the total 3,136 cells. There were 146 cells with deletions (22 % of abnormal cells; 5 % of the total cells), and 10 cells with acentric fragment (0.3 % of the total cells). The figure for deletions was far higher than that reported in the literature. A large number of deletions were seen in chromosomes no.4, no.21, and no.22, and a few deletions in chromosomes no.7 and no.20. Significance of chromosome deletions is discussed. (Namekawa, K.)

  15. Fast detection of deletion breakpoints using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Gulshara Abildinova

    2016-01-01

    Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.

  16. Properties of non-coding DNA and identification of putative cis-regulatory elements in Theileria parva

    Directory of Open Access Journals (Sweden)

    Guo Xiang

    2008-12-01

    Full Text Available Abstract Background Parasites in the genus Theileria cause lymphoproliferative diseases in cattle, resulting in enormous socio-economic losses. The availability of the genome sequences and annotation for T. parva and T. annulata has facilitated the study of parasite biology and their relationship with host cell transformation and tropism. However, the mechanism of transcriptional regulation in this genus, which may be key to understanding fundamental aspects of its parasitology, remains poorly understood. In this study, we analyze the evolution of non-coding sequences in the Theileria genome and identify conserved sequence elements that may be involved in gene regulation of these parasitic species. Results Intergenic regions and introns in Theileria are short, and their length distributions are considerably right-skewed. Intergenic regions flanked by genes in 5'-5' orientation tend to be longer and slightly more AT-rich than those flanked by two stop codons; intergenic regions flanked by genes in 3'-5' orientation have intermediate values of length and AT composition. Intron position is negatively correlated with intron length, and positively correlated with GC content. Using stringent criteria, we identified a set of high-quality orthologous non-coding sequences between T. parva and T. annulata, and determined the distribution of selective constraints across regions, which are shown to be higher close to translation start sites. A positive correlation between constraint and length in both intergenic regions and introns suggests a tight control over length expansion of non-coding regions. Genome-wide searches for functional elements revealed several conserved motifs in intergenic regions of Theileria genomes. Two such motifs are preferentially located within the first 60 base pairs upstream of transcription start sites in T. parva, are preferentially associated with specific protein functional categories, and have significant similarity to know regulatory motifs in other species. These results suggest that these two motifs are likely to represent transcription factor binding sites in Theileria. Conclusion Theileria genomes are highly compact, with selection seemingly favoring short introns and intergenic regions. Three over-represented sequence motifs were independently identified in intergenic regions of both Theileria species, and the evidence suggests that at least two of them play a role in transcriptional control in T. parva. These are prime candidates for experimental validation of transcription factor binding sites in this single-celled eukaryotic parasite. Sequences similar to two of these Theileria motifs are conserved in Plasmodium hinting at the possibility of common regulatory machinery across the phylum Apicomplexa.

  17. Discovery of cell-type specific DNA motif grammar in cis-regulatory elements using random Forest.

    Science.gov (United States)

    Wang, Xin; Lin, Peijie; Ho, Joshua W K

    2018-01-19

    It has been observed that many transcription factors (TFs) can bind to different genomic loci depending on the cell type in which a TF is expressed in, even though the individual TF usually binds to the same core motif in different cell types. How a TF can bind to the genome in such a highly cell-type specific manner, is a critical research question. One hypothesis is that a TF requires co-binding of different TFs in different cell types. If this is the case, it may be possible to observe different combinations of TF motifs - a motif grammar - located at the TF binding sites in different cell types. In this study, we develop a bioinformatics method to systematically identify DNA motifs in TF binding sites across multiple cell types based on published ChIP-seq data, and address two questions: (1) can we build a machine learning classifier to predict cell-type specificity based on motif combinations alone, and (2) can we extract meaningful cell-type specific motif grammars from this classifier model. We present a Random Forest (RF) based approach to build a multi-class classifier to predict the cell-type specificity of a TF binding site given its motif content. We applied this RF classifier to two published ChIP-seq datasets of TF (TCF7L2 and MAX) across multiple cell types. Using cross-validation, we show that motif combinations alone are indeed predictive of cell types. Furthermore, we present a rule mining approach to extract the most discriminatory rules in the RF classifier, thus allowing us to discover the underlying cell-type specific motif grammar. Our bioinformatics analysis supports the hypothesis that combinatorial TF motif patterns are cell-type specific.

  18. Mouse transgenesis identifies conserved functional enhancers and cis-regulatory motif in the vertebrate LIM homeobox gene Lhx2 locus.

    Directory of Open Access Journals (Sweden)

    Alison P Lee

    Full Text Available The vertebrate Lhx2 is a member of the LIM homeobox family of transcription factors. It is essential for the normal development of the forebrain, eye, olfactory system and liver as well for the differentiation of lymphoid cells. However, despite the highly restricted spatio-temporal expression pattern of Lhx2, nothing is known about its transcriptional regulation. In mammals and chicken, Crb2, Dennd1a and Lhx2 constitute a conserved linkage block, while the intervening Dennd1a is lost in the fugu Lhx2 locus. To identify functional enhancers of Lhx2, we predicted conserved noncoding elements (CNEs in the human, mouse and fugu Crb2-Lhx2 loci and assayed their function in transgenic mouse at E11.5. Four of the eight CNE constructs tested functioned as tissue-specific enhancers in specific regions of the central nervous system and the dorsal root ganglia (DRG, recapitulating partial and overlapping expression patterns of Lhx2 and Crb2 genes. There was considerable overlap in the expression domains of the CNEs, which suggests that the CNEs are either redundant enhancers or regulating different genes in the locus. Using a large set of CNEs (810 CNEs associated with transcription factor-encoding genes that express predominantly in the central nervous system, we predicted four over-represented 8-mer motifs that are likely to be associated with expression in the central nervous system. Mutation of one of them in a CNE that drove reporter expression in the neural tube and DRG abolished expression in both domains indicating that this motif is essential for expression in these domains. The failure of the four functional enhancers to recapitulate the complete expression pattern of Lhx2 at E11.5 indicates that there must be other Lhx2 enhancers that are either located outside the region investigated or divergent in mammals and fishes. Other approaches such as sequence comparison between multiple mammals are required to identify and characterize such enhancers.

  19. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures

    NARCIS (Netherlands)

    Kusters, E.; Della Pina, S.; Castel, R.; Souer, E.; Koes, R.

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than

  20. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    NARCIS (Netherlands)

    Kusters, E.; Della Pina, S.; Castel, R.; Souer, E.J.; Koes, R.E.

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than

  1. Cis-regulatory PLETHORA promoter elements directing root and nodule expression are conserved between Arabidopsis thaliana and Medicago truncatula

    NARCIS (Netherlands)

    Franssen, H.G.J.M.; Kulikova, O.; Willemsen, V.A.; Heidstra, R.

    2017-01-01

    Nodules are unique organs formed on roots of legumes by soil-borne bacteria, collectively known as rhizobium. Recently, we have shown that orthologs of the AINTEGUMENTA-like (AIL) AP2 transcription factors PLETHORA (PLT) 1 to 4, that redundantly regulate Arabidopsis thaliana root development are

  2. Identification of sparsely distributed clusters of cis-regulatory elements in sets of co-expressed genes

    OpenAIRE

    Kreiman, Gabriel

    2004-01-01

    Sequence information and high‐throughput methods to measure gene expression levels open the door to explore transcriptional regulation using computational tools. Combinatorial regulation and sparseness of regulatory elements throughout the genome allow organisms to control the spatial and temporal patterns of gene expression. Here we study the organization of cis‐regulatory elements in sets of co‐regulated genes. We build an algorithm to search for combinations of transcription factor binding...

  3. A Survey of 6,300 Genomic Fragments for cis-Regulatory Activity in the Imaginal Discs of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Aurélie Jory

    2012-10-01

    Full Text Available Over 6,000 fragments from the genome of Drosophila melanogaster were analyzed for their ability to drive expression of GAL4 reporter genes in the third-instar larval imaginal discs. About 1,200 reporter genes drove expression in the eye, antenna, leg, wing, haltere, or genital imaginal discs. The patterns ranged from large regions to individual cells. About 75% of the active fragments drove expression in multiple discs; 20% were expressed in ventral, but not dorsal, discs (legs, genital, and antenna, whereas ∼23% were expressed in dorsal but not ventral discs (wing, haltere, and eye. Several patterns, for example, within the leg chordotonal organ, appeared a surprisingly large number of times. Unbiased searches for DNA sequence motifs suggest candidate transcription factors that may regulate enhancers with shared activities. Together, these expression patterns provide a valuable resource to the community and offer a broad overview of how transcriptional regulatory information is distributed in the Drosophila genome.

  4. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Directory of Open Access Journals (Sweden)

    Rahul Karnik

    Full Text Available The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  5. Reciprocal Effects on Neurocognitive and Metabolic Phenotypes in Mouse Models of 16p11.2 Deletion and Duplication Syndromes.

    Directory of Open Access Journals (Sweden)

    Thomas Arbogast

    2016-02-01

    Full Text Available The 16p11.2 600 kb BP4-BP5 deletion and duplication syndromes have been associated with developmental delay; autism spectrum disorders; and reciprocal effects on the body mass index, head circumference and brain volumes. Here, we explored these relationships using novel engineered mouse models carrying a deletion (Del/+ or a duplication (Dup/+ of the Sult1a1-Spn region homologous to the human 16p11.2 BP4-BP5 locus. On a C57BL/6N inbred genetic background, Del/+ mice exhibited reduced weight and impaired adipogenesis, hyperactivity, repetitive behaviors, and recognition memory deficits. In contrast, Dup/+ mice showed largely opposite phenotypes. On a F1 C57BL/6N × C3B hybrid genetic background, we also observed alterations in social interaction in the Del/+ and the Dup/+ animals, with other robust phenotypes affecting recognition memory and weight. To explore the dosage effect of the 16p11.2 genes on metabolism, Del/+ and Dup/+ models were challenged with high fat and high sugar diet, which revealed opposite energy imbalance. Transcriptomic analysis revealed that the majority of the genes located in the Sult1a1-Spn region were sensitive to dosage with a major effect on several pathways associated with neurocognitive and metabolic phenotypes. Whereas the behavioral consequence of the 16p11 region genetic dosage was similar in mice and humans with activity and memory alterations, the metabolic defects were opposite: adult Del/+ mice are lean in comparison to the human obese phenotype and the Dup/+ mice are overweight in comparison to the human underweight phenotype. Together, these data indicate that the dosage imbalance at the 16p11.2 locus perturbs the expression of modifiers outside the CNV that can modulate the penetrance, expressivity and direction of effects in both humans and mice.

  6. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  7. 41 CFR 51-2.3 - Notice of proposed addition or deletion.

    Science.gov (United States)

    2010-07-01

    ... addition or deletion. 51-2.3 Section 51-2.3 Public Contracts and Property Management Other Provisions... or deletion. At least 30 days prior to the Committee's consideration of the addition or deletion of a... Register announcing the proposed addition or deletion and providing interested persons an opportunity to...

  8. 10 CFR 9.19 - Segregation of exempt information and deletion of identifying details.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Segregation of exempt information and deletion of... Information Act Regulations § 9.19 Segregation of exempt information and deletion of identifying details. (a... deletions are made from parts of the record by computer, the amount of information deleted will be indicated...

  9. A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

    DEFF Research Database (Denmark)

    Becher, Naja; Gjørup, Vibike; Christensen, Rikke

    2012-01-01

    A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

  10. Cordyceps militaris Fraction induces apoptosis and G2/M Arrest via c-Jun N-Terminal kinase signaling pathway in oral squamous carcinoma KB Cells.

    Science.gov (United States)

    Xie, Wangshi; Zhang, Zhang; Song, Liyan; Huang, Chunhua; Guo, Zhongyi; Hu, Xianjing; Bi, Sixue; Yu, Rongmin

    2018-01-01

    Cordyceps militaris fraction (CMF) has been shown to possess in vitro antitumor activity against human chronic myeloid leukemia K562 cells in our previous research. The in vitro inhibitory activities of CMF on the growth of KB cells were evaluated by viability assay. The apoptotic and cell cycle influences of CMF were detected by 4',6-diamidino-2-phenylindole staining and flow cytometry assay. The expression of different apoptosis-associated proteins and cell cycle regulatory proteins was examined by Western blot assay. The nuclear localization of c-Jun was observed by fluorescence staining. The objective of this study was to investigate the antiproliferative effect of CMF as well as the mechanism underlying the apoptosis and cell cycle arrest it induces in KB cells. CMF suppressed KB cells' proliferation in a dose- and time-dependent manner. Flow cytometric analysis indicated that CMF induced G2/M cell cycle arrest and apoptosis. Western blot analysis revealed that CMF induced caspase-3, caspase-9, and PARP cleavages, and increased the Bax/Bcl-2 ratio. CMF also led to increased expression of p21, decreased expression of cyclin B1, mitotic phosphatase cdc25c, and mitotic kinase cdc2, as well as unchanged expression of p53. In addition, CMF stimulated c-Jun N-terminal kinases (JNK) protein phosphorylations, resulting in upregulated expression of c-Jun and nuclear localization of c-Jun. Pretreatment with JNK inhibitor SP600125 suppressed CMF-induced apoptosis and G2/M arrest. CMF is capable of modulating c-Jun caspase and Bcl-2 family proteins through JNK-dependent apoptosis, which results in G2/M phase arrest in KB cells. CMF could be developed as a promising candidate for the new antitumor agents. CMF exhibited strong anticancer activity against oral squamous carcinoma KB cellsCMF inhibited KB cells' proliferation via induction of apoptosis and G2/M cell cycle arrestCMF activated JNK signaling pathway and promoted the nuclear localization of c-JunCMF regulated the

  11. Epileptic encephalopathy in a girl with an interstitial deletion of Xp22 comprising promoter and exon 1 of the CDKL5 gene.

    Science.gov (United States)

    Bahi-Buisson, Nadia; Girard, Benoit; Gautier, Agnes; Nectoux, Juliette; Fichou, Yann; Saillour, Yoann; Poirier, Karine; Chelly, Jamel; Bienvenu, Thierry

    2010-01-05

    We report a 2-year-old girl with early onset seizures variant of Rett syndrome with a deletion at Xp22 detected by multiplex ligation-dependent probe amplification (MLPA) technique. This patient presented with tonic seizures at 7 days of life. Subsequently, she developed infantile spasms at three months and finally refractory myoclonic epilepsy. She demonstrated severe encephalopathy with hypotonia, deceleration of head growth, with eye gaze but limited eye pursuit, no language, limited hand use, and intermittent hand stereotypies. This combination of clinical features, suggestive of early onset variant of Rett syndrome led us to screen the CDKL5 gene. In a first step, screening of the whole coding sequence of the CDKL5 gene revealed no point mutations. In a second step, we searched gross rearrangements by MLPA and identified a microdeletion affecting both the promoter and exon 1 in CDKL5. Subsequent analysis on a Nimblegen HD2 microarray confirmed a deletion of approximately 300 kb at Xp22, including the BEND2, SCML2, and CDKL5 genes. In conclusion, our report suggests that searching for large rearrangements in CDKL5 should be considered in girls with early onset seizures and Rett-like features. (c) 2009 Wiley-Liss, Inc.

  12. Identification of the -α(2.4) Deletion in One Family and in One Hb H Disease Patient in Guangxi, People's Republic of China.

    Science.gov (United States)

    Pang, Wanrong; Sun, Lei; Long, Ju; Weng, Xunjin; Ye, Xuehe; Wang, Junjie; Liao, Yan; Tang, Weijun; Fan, Zuqian; Wu, Suping; Song, Chuanlu; Wei, Xiaoying; Zhang, Chenghong

    2016-06-01

    The 2.4 kb (or -α(2.4)) deletion in the α-globin gene cluster (NG_000006.1) is an α(+)-thalassemia (α(+)-thal) allele. The molecular basis of -α(2.4) is a deletion from 36860 to 39251 of the α-globin gene cluster. It was reported by three research groups in 2005, 2012 and 2014, respectively. In routine thalassemia screening studies by this research group, we found an individual with the -α(2.4)/αα genotype and an Hb H (β4) disease patient whose genotype was - -(SEA)/-α(2.4). Samples from the parents of the carrier of the -α(2.4)/αα genotype were collected to perform pedigree analysis, and the proband's mother's genotype was diagnosed to be - -(SEA)/-α(2.4). The research revealed that the -α(2.4) allele exists in the population of southern Guangxi, People's Republic of China.

  13. Amino-acid composition after loop deletion drives domain swapping.

    Science.gov (United States)

    Nandwani, Neha; Surana, Parag; Udgaonkar, Jayant B; Das, Ranabir; Gosavi, Shachi

    2017-10-01

    Rational engineering of a protein to enable domain swapping requires an understanding of the sequence, structural and energetic factors that favor the domain-swapped oligomer over the monomer. While it is known that the deletion of loops between β-strands can promote domain swapping, the spliced sequence at the position of the loop deletion is thought to have a minimal role to play in such domain swapping. Here, two loop-deletion mutants of the non-domain-swapping protein monellin, frame-shifted by a single residue, were designed. Although the spliced sequence in the two mutants differed by only one residue at the site of the deletion, only one of them (YEIKG) promoted domain swapping. The mutant containing the spliced sequence YENKG was entirely monomeric. This new understanding that the domain swapping propensity after loop deletion may depend critically on the chemical composition of the shortened loop will facilitate the rational design of domain swapping. © 2017 The Protein Society.

  14. The Yeast Deletion Collection: A Decade of Functional Genomics

    Science.gov (United States)

    Giaever, Guri; Nislow, Corey

    2014-01-01

    The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991

  15. Molecular studies of deletions at the human steroid sulfatase locus

    International Nuclear Information System (INIS)

    Shapiro, L.J.; Yen, P.; Pomerantz, D.; Martin, E.; Rolewic, L.; Mohandas, T.

    1989-01-01

    The human steroid sulfatase gene (STS) is located on the distal X chromosome short arm close to the pseudoautosomal region but in a segment of DNA that is unique to the X chromosome. In contrast to most X chromosome-encoded genes, STS expression is not extinguished during the process of X chromosome inactivation. Deficiency of STS activity produced the syndrome of X chromosome-linked ichthyosis, which is one of the most common inborn errors of metabolism in man. Approximately 90% of STS - individuals have large deletions at the STS locus. The authors and others have found that the end points of such deletions are heterogeneous in their location. One recently ascertained subject was observed to have a 40-kilobase deletion that is entirely intragenic, permitting the cloning and sequencing of the deletion junction. Studies of this patient and of other X chromosome sequences in other subjects permit some insight into the mechanism(s) responsible for generating frequent deletions on the short arm of the X chromosome

  16. Sorting genomes by reciprocal translocations, insertions, and deletions.

    Science.gov (United States)

    Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

    2010-01-01

    The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

  17. Identification of herpes simplex virus type 1 proteins encoded within the first 1.5 kb of the latency-associated transcript.

    Science.gov (United States)

    Henderson, Gail; Jaber, Tareq; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2009-09-01

    Expression of the first 1.5 kb of the latency-associated transcript (LAT) that is encoded by herpes simplex virus type 1 (HSV-1) is sufficient for wild-type (wt) levels of reactivation from latency in small animal models. Peptide-specific immunoglobulin G (IgG) was generated against open reading frames (ORFs) that are located within the first 1.5 kb of LAT coding sequences. Cells stably transfected with LAT or trigeminal ganglionic neurons of mice infected with a LAT expressing virus appeared to express the L2 or L8 ORF. Only L2 ORF expression was readily detected in trigeminal ganglionic neurons of latently infected mice.

  18. Identification of two small RNAs within the first 1.5-kb of the herpes simplex virus type 1-encoded latency-associated transcript.

    Science.gov (United States)

    Peng, Weiping; Vitvitskaia, Olga; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2008-01-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected neurons. In the rabbit or mouse ocular models of infection, expression of the first 1.5 kb of LAT coding sequences is sufficient for and necessary for wild-type levels of spontaneous reactivation from latency. The antiapoptosis functions of LAT, which maps to the same 1.5 kb of LAT, are important for the latency-reactivation cycle because replacement of LAT with other antiapoptosis genes (the baculovirus IAP gene or the bovine herpesvirus type 1 latency-related gene) restores wild-type levels of reactivation to a LAT null mutant. A recent study identified a micro-RNA within LAT that can inhibit apoptosis (Gupta et al, Nature 442: 82-85). In this study, the authors analyzed the first 1.5 kb of LAT for additional small RNAs that may have regulatory functions. Two LAT-specific small RNAs were detected in productively infected human neuroblastoma cells within the first 1.5 kb of LAT, in a region that is important for inhibiting apoptosis. Although these small RNAs possess extensive secondary structure and a stem-loop structure, bands migrating near 23 bases were not detected suggesting these small RNAs are not true micro-RNAs. Both of the small LAT-specific RNAs have the potential to base pair with the ICP4 mRNA. These two small LAT RNAs may play a role in the latency-reactivation cycle by reducing apoptosis and/or by reducing ICP4 RNA expression.

  19. Induction of necrosis and apoptosis to KB cancer cells by sanguinarine is associated with reactive oxygen species production and mitochondrial membrane depolarization

    International Nuclear Information System (INIS)

    Chang, M.-C.; Chan, C.-P.; Wang, Y.-J.; Lee, P.-H.; Chen, L.-I; Tsai, Y.-L.; Lin, B.-R.; Wang, Y.-L.; Jeng, J.-H.

    2007-01-01

    Sanguinarine is a benzopheanthridine alkaloid present in the root of Sanguinaria canadensis L. and Chellidonium majus L. In this study, sanguinarine (2 and 3 μM) exhibited cytotoxicity to KB cancer cells by decreasing MTT reduction to 83% and 52% of control after 24-h of exposure. Sanguinarine also inhibited the colony forming capacity (> 52-58%) and growth of KB cancer cells at concentrations higher than 0.5-1 μM. Short-term exposure to sanguinarine (> 0.5 μM) effectively suppressed the adhesion of KB cells to collagen and fibronectin (FN). Sanguinarine (2 and 3 μM) induced evident apoptosis as indicated by an increase in sub-G0/G1 populations, which was detected after 6-h of exposure. Only a slight increase in cells arresting in S-phase and G2/M was noted. Induction of KB cell apoptosis and necrosis by sanguinarine (2 and 3 μM) was further confirmed by Annexin V-PI dual staining flow cytometry and the presence of DNA fragmentation. The cytotoxicity by sanguinarine was accompanied by an increase in production of reactive oxygen species (ROS) and depolarization of mitochondrial membrane potential as indicated by single cell flow cytometric analysis of DCF and rhodamine fluorescence. NAC (1 and 3 mM) and catalase (2000 U/ml) prevented the sanguinarine-induced ROS production and cytotoxicity, whereas dimethylthiourea (DMT) showed no marked preventive effect. These results suggest that sanguinarine has anticarcinogenic properties with induction of ROS production and mitochondrial membrane depolarization, which mediate cancer cell death

  20. CLCNKB mutations causing mild Bartter syndrome profoundly alter the pH and Ca2+ dependence of ClC-Kb channels.

    Science.gov (United States)

    Andrini, Olga; Keck, Mathilde; L'Hoste, Sébastien; Briones, Rodolfo; Mansour-Hendili, Lamisse; Grand, Teddy; Sepúlveda, Francisco V; Blanchard, Anne; Lourdel, Stéphane; Vargas-Poussou, Rosa; Teulon, Jacques

    2014-09-01

    ClC-Kb, a member of the ClC family of Cl(-) channels/transporters, plays a major role in the absorption of NaCl in the distal nephron. CLCNKB mutations cause Bartter syndrome type 3, a hereditary renal salt-wasting tubulopathy. Here, we investigate the functional consequences of a Val to Met substitution at position 170 (V170M, α helix F), which was detected in eight patients displaying a mild phenotype. Conductance and surface expression were reduced by ~40-50 %. The regulation of channel activity by external H(+) and Ca(2+) is a characteristic property of ClC-Kb. Inhibition by external H(+) was dramatically altered, with pKH shifting from 7.6 to 6.0. Stimulation by external Ca(2+) on the other hand was no longer detectable at pH 7.4, but was still present at acidic pH values. Functionally, these regulatory modifications partly counterbalance the reduced surface expression by rendering V170M hyperactive. Pathogenic Met170 seems to interact with another methionine on α helix H (Met227) since diverse mutations at this site partly removed pH sensitivity alterations of V170M ClC-Kb. Exploring other disease-associated mutations, we found that a Pro to Leu substitution at position 124 (α helix D, Simon et al., Nat Genet 1997, 17:171-178) had functional consequences similar to those of V170M. In conclusion, we report here for the first time that ClC-Kb disease-causing mutations located around the selectivity filter can result in both reduced surface expression and hyperactivity in heterologous expression systems. This interplay must be considered when analyzing the mild phenotype of patients with type 3 Bartter syndrome.