Survival analysis

International Nuclear Information System (INIS)

Badwe, R.A.

1999-01-01

The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model

Análisis de supervivencia en presencia de riesgos competitivos: estimadores de la probabilidad de suceso Survival analysis with competing risks: estimating failure probability

Directory of Open Access Journals (Sweden)

Javier Llorca

2004-10-01

Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

Survival Analysis of Patients with End Stage Renal Disease

Science.gov (United States)

Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.

2015-06-01

This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.

["That flesh, pink and perishable": analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain) in the presence of competing risks].

Science.gov (United States)

Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel

2009-01-01

To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

Bias and precision of methods for estimating the difference in restricted mean survival time from an individual patient data meta-analysis

Directory of Open Access Journals (Sweden)

Béranger Lueza

2016-03-01

Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect

Survival analysis II: Cox regression

NARCIS (Netherlands)

Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.

2011-01-01

In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the

ASURV: Astronomical SURVival Statistics

Science.gov (United States)

Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.

2014-06-01

ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.

Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

International Nuclear Information System (INIS)

Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.

1996-01-01

It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs

Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

Energy Technology Data Exchange (ETDEWEB)

Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)

1996-12-01

It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.

Survival analysis in hematologic malignancies: recommendations for clinicians

Science.gov (United States)

Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril

2014-01-01

The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982

CASAS: Cancer Survival Analysis Suite, a web based application.

Science.gov (United States)

Rupji, Manali; Zhang, Xinyan; Kowalski, Jeanne

2017-01-01

We present CASAS, a shiny R based tool for interactive survival analysis and visualization of results. The tool provides a web-based one stop shop to perform the following types of survival analysis:  quantile, landmark and competing risks, in addition to standard survival analysis.  The interface makes it easy to perform such survival analyses and obtain results using the interactive Kaplan-Meier and cumulative incidence plots.  Univariate analysis can be performed on one or several user specified variable(s) simultaneously, the results of which are displayed in a single table that includes log rank p-values and hazard ratios along with their significance. For several quantile survival analyses from multiple cancer types, a single summary grid is constructed. The CASAS package has been implemented in R and is available via http://shinygispa.winship.emory.edu/CASAS/. The developmental repository is available at https://github.com/manalirupji/CASAS/.

Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.

Science.gov (United States)

Pion, J; Lenoir, M; Vandorpe, B; Segers, V

2015-11-01

This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.

Survival of Root-filled Teeth in the Swedish Adult Population

DEFF Research Database (Denmark)

Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik

2016-01-01

INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...

Serum level of soluble urokinase-type plasminogen activator receptor is a strong and independent predictor of survival in human immunodeficiency virus infection

DEFF Research Database (Denmark)

Sidenius, N; Sier, C.F.M.; Ullum, H

2000-01-01

levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...

«Esa corporeidad mortal y rosa»: análisis del tiempo libre de enfermedad del cáncer de mama en Gipuzkoa en presencia de riesgos competitivos "That deadly and pink corporeity": Analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain in the presence of competing risks

Directory of Open Access Journals (Sweden)

Pablo Martínez-Camblor

2009-12-01

sobrestimación tanto de la probabilidad de recidiva como de la mortalidad debida a la enfermedad.Objective: To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. Methods: All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival were also studied. Results: Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Conclusions: Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

Survival analysis of heart failure patients: A case study.

Science.gov (United States)

Ahmad, Tanvir; Munir, Assia; Bhatti, Sajjad Haider; Aftab, Muhammad; Raza, Muhammad Ali

2017-01-01

This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015). All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.

High serum uric acid concentration predicts poor survival in patients with breast cancer.

Science.gov (United States)

Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min

2017-10-01

Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of colorectal and gastric cancer: Survival and prognostic factors

International Nuclear Information System (INIS)

Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R

2009-01-01

Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)

Restaging and Survival Analysis of 4036 Ovarian Cancer Patients According to the 2013 FIGO Classification for Ovarian, Fallopian Tube, and Primary Peritoneal Cancer

DEFF Research Database (Denmark)

Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul

2016-01-01

OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...

Survival analysis of heart failure patients: A case study.

Directory of Open Access Journals (Sweden)

Tanvir Ahmad

Full Text Available This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015. All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.

Is there racial/ethnic variance in cervical cancer- specific survival of ...

African Journals Online (AJOL)

incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...

Neyman, Markov processes and survival analysis.

Science.gov (United States)

Yang, Grace

2013-07-01

J. Neyman used stochastic processes extensively in his applied work. One example is the Fix and Neyman (F-N) competing risks model (1951) that uses finite homogeneous Markov processes to analyse clinical trials with breast cancer patients. We revisit the F-N model, and compare it with the Kaplan-Meier (K-M) formulation for right censored data. The comparison offers a way to generalize the K-M formulation to include risks of recovery and relapses in the calculation of a patient's survival probability. The generalization is to extend the F-N model to a nonhomogeneous Markov process. Closed-form solutions of the survival probability are available in special cases of the nonhomogeneous processes, like the popular multiple decrement model (including the K-M model) and Chiang's staging model, but these models do not consider recovery and relapses while the F-N model does. An analysis of sero-epidemiology current status data with recurrent events is illustrated. Fix and Neyman used Neyman's RBAN (regular best asymptotic normal) estimates for the risks, and provided a numerical example showing the importance of considering both the survival probability and the length of time of a patient living a normal life in the evaluation of clinical trials. The said extension would result in a complicated model and it is unlikely to find analytical closed-form solutions for survival analysis. With ever increasing computing power, numerical methods offer a viable way of investigating the problem.

Metagenes Associated with Survival in Non-Small Cell Lung Cancer

Science.gov (United States)

Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres

2011-01-01

NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

DEFF Research Database (Denmark)

Kyndi, M.; Sorensen, F.B.; Alsner, J.

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

Prognostic and survival analysis of 837 Chinese colorectal cancer patients.

Science.gov (United States)

Yuan, Ying; Li, Mo-Dan; Hu, Han-Guang; Dong, Cai-Xia; Chen, Jia-Qi; Li, Xiao-Fen; Li, Jing-Jing; Shen, Hong

2013-05-07

To develop a prognostic model to predict survival of patients with colorectal cancer (CRC). Survival data of 837 CRC patients undergoing surgery between 1996 and 2006 were collected and analyzed by univariate analysis and Cox proportional hazard regression model to reveal the prognostic factors for CRC. All data were recorded using a standard data form and analyzed using SPSS version 18.0 (SPSS, Chicago, IL, United States). Survival curves were calculated by the Kaplan-Meier method. The log rank test was used to assess differences in survival. Univariate hazard ratios and significant and independent predictors of disease-specific survival and were identified by Cox proportional hazard analysis. The stepwise procedure was set to a threshold of 0.05. Statistical significance was defined as P analysis suggested age, preoperative obstruction, serum carcinoembryonic antigen level at diagnosis, status of resection, tumor size, histological grade, pathological type, lymphovascular invasion, invasion of adjacent organs, and tumor node metastasis (TNM) staging were positive prognostic factors (P analysis showed a significant statistical difference in 3-year survival among these groups: LNR1, 73%; LNR2, 55%; and LNR3, 42% (P analysis results showed that histological grade, depth of bowel wall invasion, and number of metastatic lymph nodes were the most important prognostic factors for CRC if we did not consider the interaction of the TNM staging system (P < 0.05). When the TNM staging was taken into account, histological grade lost its statistical significance, while the specific TNM staging system showed a statistically significant difference (P < 0.0001). The overall survival of CRC patients has improved between 1996 and 2006. LNR is a powerful factor for estimating the survival of stage III CRC patients.

Assessing the effect of quantitative and qualitative predictors on gastric cancer individuals survival using hierarchical artificial neural network models.

Science.gov (United States)

Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat

2013-01-01

There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer

Survival of Patients With Cervical Cancer in Rural India

OpenAIRE

Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy

2015-01-01

Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...

Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis

Directory of Open Access Journals (Sweden)

Amal Saki Malehi

2016-01-01

Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.

SAMSN1 is highly expressed and associated with a poor survival in glioblastoma multiforme.

Directory of Open Access Journals (Sweden)

Yong Yan

Full Text Available OBJECTIVES: To study the expression pattern and prognostic significance of SAMSN1 in glioma. METHODS: Affymetrix and Arrystar gene microarray data in the setting of glioma was analyzed to preliminarily study the expression pattern of SAMSN1 in glioma tissues, and Hieratical clustering of gene microarray data was performed to filter out genes that have prognostic value in malignant glioma. Survival analysis by Kaplan-Meier estimates stratified by SAMSN1 expression was then made based on the data of more than 500 GBM cases provided by The Cancer Genome Atlas (TCGA project. At last, we detected the expression of SAMSN1 in large numbers of glioma and normal brain tissue samples using Tissue Microarray (TMA. Survival analysis by Kaplan-Meier estimates in each grade of glioma was stratified by SAMSN1 expression. Multivariate survival analysis was made by Cox proportional hazards regression models in corresponding groups of glioma. RESULTS: With the expression data of SAMSN1 and 68 other genes, high-grade glioma could be classified into two groups with clearly different prognoses. Gene and large sample tissue microarrays showed high expression of SAMSN1 in glioma particularly in GBM. Survival analysis based on the TCGA GBM data matrix and TMA multi-grade glioma dataset found that SAMSN1 expression was closely related to the prognosis of GBM, either PFS or OS (P<0.05. Multivariate survival analysis with Cox proportional hazards regression models confirmed that high expression of SAMSN1 was a strong risk factor for PFS and OS of GBM patients. CONCLUSION: SAMSN1 is over-expressed in glioma as compared with that found in normal brains, especially in GBM. High expression of SAMSN1 is a significant risk factor for the progression free and overall survival of GBM.

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

DEFF Research Database (Denmark)

Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

Excellent survival after liver transplantation for isolated polycystic liver disease: an European Liver Transplant Registry study

DEFF Research Database (Denmark)

van Keimpema, Loes; Nevens, Frederik; Adam, René

2011-01-01

Patients with end-stage isolated polycystic liver disease (PCLD) suffer from incapacitating symptoms because of very large liver volumes. Liver transplantation (LT) is the only curative option. This study assesses the feasibility of LT in PCLD. We used the European Liver Transplant Registry (ELTR......) database to extract demographics and outcomes of 58 PCLD patients. We used Kaplan-Meier survival analysis for survival rates. Severe abdominal pain (75%) was the most prominent symptom, while portal hypertension (35%) was the most common complication in PCLD. The explantation of the polycystic liver...

Hypofractionated radiation therapy for invasive thyroid carcinoma in dogs: a retrospective analysis of survival

International Nuclear Information System (INIS)

Brearley, M.J.; Hayes, A.M.; Murphy, S.

1999-01-01

Thirteen dogs with invasive thyroid carcinoma (WHO classification T2b or T3b) seen between January 1991 and October 1997 were treated by external beam Irradiation. Four once-weekly fractions of 9 gray of 4 MeV X-rays were administered. Four of the dogs died of progression of the primary disease and four from metastatic spread. Of the remaining dogs, three died of unrelated problems, although two were still alive at the time of the censor. Kaplan-Meier analysis of the survival time from first dose to death from either primary or metastatic disease gave a median survival time of 96 weeks (mean 85 weeks, range six to 247 weeks). Radiographic evidence of pulmonary metastatic disease at presentation had no prognostic value whereas crude growth rate was a highly significant factor. The present series Indicates that radiation therapy should be considered an important modality for the control of invasive thyroid carcinoma in the dog

Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers

Directory of Open Access Journals (Sweden)

Wickramarachchi RE

2010-09-01

Full Text Available Abstract Objectives This study compares clinico-pathological features in young (50 years with colorectal cancer, survival in the young and the influence of pre-operative clinical and histological factors on survival. Materials and methods A twelve year prospective database of colorectal cancer was analysed. Fifty-three young patients were compared with forty seven consecutive older patients over fifty years old. An analysis of survival was undertaken in young patients using Kaplan Meier graphs, non parametric methods, Cox's Proportional Hazard Ratios and Weibull Hazard models. Results Young patients comprised 13.4 percent of 397 with colorectal cancer. Duration of symptoms and presentation in the young was similar to older patients (median, range; young patients; 6 months, 2 weeks to 2 years, older patients; 4 months, 4 weeks to 3 years, p > 0.05. In both groups, the majority presented without bowel obstruction (young - 81%, older - 94%. Cancer proximal to the splenic flexure was present more in young than in older patients. Synchronous cancers were found exclusively in the young. Mucinous tumours were seen in 16% of young and 4% of older patients (p Conclusion If patients, who are less than 40 years old with colorectal cancer, survive twenty months after operation, the prognosis improves and their survival becomes predictable.

Physical activity increases survival after heart valve surgery

DEFF Research Database (Denmark)

Lund, K.; Sibilitz, Kirstine Lærum; Kikkenborg Berg, Selina

2016-01-01

physical activity levels 6-12 months after heart valve surgery and (1) survival, (2) hospital readmission 18-24 months after surgery and (3) participation in exercise-based cardiac rehabilitation. METHODS: Prospective cohort study with registry data from The CopenHeart survey, The Danish National Patient......OBJECTIVES: Increased physical activity predicts survival and reduces risk of readmission in patients with coronary heart disease. However, few data show how physical activity is associated with survival and readmission after heart valve surgery. Objective were to assess the association between...... Register and The Danish Civil Registration System of 742 eligible patients. Physical activity was quantified with the International Physical Activity Questionnaire and analysed using Kaplan-Meier analysis and Cox regression and logistic regression methods. RESULTS: Patients with a moderate to high physical...

Survival Analysis of Factors Influencing Cyclic Fatigue of Nickel-Titanium Endodontic Instruments

Directory of Open Access Journals (Sweden)

Eva Fišerová

2015-01-01

Full Text Available Objective. The aim of this study was to validate a survival analysis assessing the effect of type of rotary system, canal curvature, and instrument size on cyclic resistance. Materials and Methods. Cyclic fatigue testing was carried out in stainless steel artificial canals with radii of curvature of 3 or 5 mm and the angle of curvature of 60 degrees. All the instruments were new and 25 mm in working length, and ISO colour coding indicated the instrument size (yellow for size 20; red for size 25. Wizard Navigator instruments, Mtwo instruments, ProTaper instruments, and Revo-S instruments were passively rotated at 250 rotations per minute, and the time fracture was being recorded. Subsequently, fractographic analysis of broken tips was performed by scanning electron microscope. The data were then analysed by the Kaplan-Meier estimator of the survival function, the Cox proportional hazards model, the Wald test for regression covariates, and the Wald test for significance of regression model. Conclusion. The lifespan registered for the tested instruments was Mtwo > Wizard Navigator > Revo-S > ProTaper; 5 mm radius > 3 mm radius; and yellow > red in ISO colour coding system.

Setting the stage for medieval plague: Pre-black death trends in survival and mortality.

Science.gov (United States)

DeWitte, Sharon N

2015-11-01

The 14(th) -century Black Death was one of the most devastating epidemics in human history, killing tens of millions of people in a short period of time. It is not clear why mortality rates during the epidemic were so high. One possibility is that the affected human populations were particularly stressed in the 14(th) century, perhaps as a result of repeated famines in areas such as England. This project examines survival and mortality in two pre-Black Death time periods, 11-12(th) centuries vs 13(th) century CE, to determine if demographic conditions were deteriorating before the epidemic occurred. This study is done using a sample of individuals from several London cemeteries that have been dated, in whole or in part, either to the 11-12(th) centuries (n = 339) or 13(th) century (n = 258). Temporal trends in survivorship and mortality are assessed via Kaplan-Meier survival analysis and by modeling time period as a covariate affecting the Gompertz hazard of adult mortality. The age-at-death distributions from the two pre-Black Death time periods are significantly different, with fewer older adults in 13(th) century. The results of Kaplan-Meier survival analysis indicate reductions in survival before the Black Death, with significantly lower survival in the 13(th) century (Mantel Cox p < 0.001). Last, hazard analysis reveals increases in mortality rates before the Black Death. Together, these results suggest that health in general was declining in the 13(th) century, and this might have led to high mortality during the Black Death. This highlights the importance of considering human context to understand disease in past and living human populations. © 2015 Wiley Periodicals, Inc.

Outcome predictors in the management of intramedullary classic ependymoma: An integrative survival analysis.

Science.gov (United States)

Wang, Yinqing; Cai, Ranze; Wang, Rui; Wang, Chunhua; Chen, Chunmei

2018-06-01

This is a retrospective study.The aim of this study was to illustrate the survival outcomes of patients with classic ependymoma (CE) and identify potential prognostic factors.CE is the most common category of spinal ependymomas, but few published studies have discussed predictors of the survival outcome.A Boolean search of the PubMed, Embase, and OVID databases was conducted by 2 investigators independently. The objects were intramedullary grade II ependymoma according to 2007 WHO classification. Univariate Kaplan-Meier analysis and Log-Rank tests were performed to identify variables associated with progression-free survival (PFS) or overall survival (OS). Multivariate Cox regression was performed to assess hazard ratios (HRs) with 95% confidence intervals (95% CIs). Statistical analysis was performed by SPSS version 23.0 (IBM Corp.) with statistical significance defined as P analysis showed that patients who had undergone total resection (TR) had better PFS and OS than those with subtotal resection (STR) and biopsy (P = .002, P = .004, respectively). Within either univariate or multivariate analysis (P = .000, P = .07, respectively), histological type was an independent prognostic factor for PFS of CE [papillary type: HR 0.002, 95% CI (0.000-0.073), P = .001, tanycytic type: HR 0.010, 95% CI (0.000-0.218), P = .003].It was the first integrative analysis of CE to elucidate the correlation between kinds of factors and prognostic outcomes. Definite histological type and safely TR were foundation of CE's management. 4.

Measuring survival time: a probability-based approach useful in healthcare decision-making.

Science.gov (United States)

2011-01-01

In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.

Predicting long-term graft survival in adult kidney transplant recipients

Directory of Open Access Journals (Sweden)

Brett W Pinsky

2012-01-01

Full Text Available The ability to accurately predict a population′s long-term survival has important implications for quantifying the benefits of transplantation. To identify a model that can accurately predict a kidney transplant population′s long-term graft survival, we retrospectively studied the United Network of Organ Sharing data from 13,111 kidney-only transplants completed in 1988- 1989. Nineteen-year death-censored graft survival (DCGS projections were calculated and com-pared with the population′s actual graft survival. The projection curves were created using a two-part estimation model that (1 fits a Kaplan-Meier survival curve immediately after transplant (Part A and (2 uses truncated observational data to model a survival function for long-term projection (Part B. Projection curves were examined using varying amounts of time to fit both parts of the model. The accuracy of the projection curve was determined by examining whether predicted sur-vival fell within the 95% confidence interval for the 19-year Kaplan-Meier survival, and the sample size needed to detect the difference in projected versus observed survival in a clinical trial. The 19-year DCGS was 40.7% (39.8-41.6%. Excellent predictability (41.3% can be achieved when Part A is fit for three years and Part B is projected using two additional years of data. Using less than five total years of data tended to overestimate the population′s long-term survival, accurate prediction of long-term DCGS is possible, but requires attention to the quantity data used in the projection method.

The influence of sarcopenia on survival and surgical complications in ovarian cancer patients undergoing primary debulking surgery.

Science.gov (United States)

Rutten, I J G; Ubachs, J; Kruitwagen, R F P M; van Dijk, D P J; Beets-Tan, R G H; Massuger, L F A G; Olde Damink, S W M; Van Gorp, T

2017-04-01

Sarcopenia, severe skeletal muscle loss, has been identified as a prognostic factor in various malignancies. This study aims to investigate whether sarcopenia is associated with overall survival (OS) and surgical complications in patients with advanced ovarian cancer undergoing primary debulking surgery (PDS). Ovarian cancer patients (n = 216) treated with PDS were enrolled retrospectively. Total skeletal muscle surface area was measured on axial computed tomography at the level of the third lumbar vertebra. Optimum stratification was used to find the optimal skeletal muscle index cut-off to define sarcopenia (≤38.73 cm 2 /m 2 ). Cox-regression and Kaplan-Meier analysis were used to analyse the relationship between sarcopenia and OS. The effect of sarcopenia on the development of major surgical complications was studied with logistic regression. Kaplan-Meier analysis showed a significant survival disadvantage for patients with sarcopenia compared to patients without sarcopenia (p = 0.010). Sarcopenia univariably predicted OS (HR 1.536 (95% CI 1.105-2.134), p = 0.011) but was not significant in multivariable Cox-regression analysis (HR 1.362 (95% CI 0.968-1.916), p = 0.076). Significant predictors for OS in multivariable Cox-regression analysis were complete PDS, treatment in a specialised centre and the development of major complications. Sarcopenia was not predictive of major complications. Sarcopenia was not predictive of OS or major complications in ovarian cancer patients undergoing primary debulking surgery. However a strong trend towards a survival disadvantage for patients with sarcopenia was seen. Future prospective studies should focus on interventions to prevent or reverse sarcopenia and possibly increase ovarian cancer survival. Complete cytoreduction remains the strongest predictor of ovarian cancer survival. Copyright © 2017 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights

Decreased graft survival in liver transplant recipients of donors with positive blood cultures: a review of the United Network for Organ Sharing dataset.

Science.gov (United States)

Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto

2017-06-01

Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.

Tumour heterogeneity in non-small cell lung carcinoma assessed by CT texture analysis: a potential marker of survival

International Nuclear Information System (INIS)

Ganeshan, Balaji; Miles, Ken; Panayiotou, Elleny; Burnand, Kate; Dizdarevic, Sabina

2012-01-01

To establish the potential for tumour heterogeneity in non-small cell lung cancer (NSCLC) as assessed by CT texture analysis (CTTA) to provide an independent marker of survival for patients with NSCLC. Tumour heterogeneity was assessed by CTTA of unenhanced images of primary pulmonary lesions from 54 patients undergoing 18 F-fluorodeoxyglucose (FDG) PET-CT for staging of NSCLC. CTTA comprised image filtration to extract fine, medium and coarse features with quantification of the distribution of pixel values (uniformity) within the filtered images. Receiver operating characteristics identified thresholds for PET and CTTA parameters that were related to patient survival using Kaplan-Meier analysis. The median (range) survival was 29.5 (1-38) months. 24, 10, 14 and 6 patients had tumour stages I, II, III and IV respectively. PET stage and tumour heterogeneity assessed by CTTA were significant independent predictors of survival (PET stage: Odds ratio 3.85, 95% confidence limits 0.9-8.09, P = 0.002; CTTA: Odds ratio 56.4, 95% confidence limits 4.79-666, p = 0.001). SUV was not a significantly associated with survival. Assessment of tumour heterogeneity by CTTA of non-contrast enhanced images has the potential for to provide a novel, independent predictor of survival for patients with NSCLC. (orig.)

Perioperative Blood Transfusion as a Significant Predictor of Biochemical Recurrence and Survival after Radical Prostatectomy in Patients with Prostate Cancer.

Directory of Open Access Journals (Sweden)

Jung Kwon Kim

Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.

Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province

Directory of Open Access Journals (Sweden)

Reza Zamani

2015-05-01

Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.

Tetranectin positive expression in tumour tissue leads to longer survival in Danish women with ovarian cancer. Results from the 'Malova' ovarian cancer study

DEFF Research Database (Denmark)

Heeran, Mel C; Rask, Lene; Høgdall, Claus K

2015-01-01

of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...

Adjuvant Medications That Improve Survival after Locoregional Therapy.

Science.gov (United States)

Boas, F Edward; Ziv, Etay; Yarmohammadi, Hooman; Brown, Karen T; Erinjeri, Joseph P; Sofocleous, Constantinos T; Harding, James J; Solomon, Stephen B

2017-07-01

To determine if outpatient medications taken at the time of liver tumor embolization or ablation affect survival. A retrospective review was done of 2,032 liver tumor embolization, radioembolization, and ablation procedures performed in 1,092 patients from June 2009 to April 2016. Pathology, hepatocellular carcinoma (HCC) stage (American Joint Committee on Cancer), neuroendocrine tumor (NET) grade, initial locoregional therapy, overall survival after initial locoregional therapy, Child-Pugh score, Eastern Cooperative Oncology Group performance status, Charlson Comorbidity Index, and outpatient medications taken at the time of locoregional therapy were analyzed for each patient. Kaplan-Meier survival curves were calculated for patients taking 29 medications or medication classes (including prescription and nonprescription medications) for reasons unrelated to their primary cancer diagnosis. Kaplan-Meier curves were compared using the log-rank test. For patients with HCC initially treated with embolization (n = 304 patients), the following medications were associated with improved survival when taken at the time of embolization: beta-blockers (P = .0007), aspirin (P = .0008) and other nonsteroidal antiinflammatory drugs (P = .009), proton pump inhibitors (P = .004), and antivirals for hepatitis B or C (P = .01). For colorectal liver metastases initially treated with ablation (n = 172 patients), beta-blockers were associated with improved survival when taken at the time of ablation (P = .02). Aspirin and beta-blockers are associated with significantly improved survival when taken at the time of embolization for HCC. Aspirin was not associated with survival differences after locoregional therapy for NET or colorectal liver metastases, suggesting an HCC-specific effect. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

Association of phase angle on bioelectrical impedance analysis and dialysis frequency with survival of chronic hemodialysis patients

Science.gov (United States)

Muzasti, R. A.; Lubis, H. R.

2018-03-01

Phase angle, a parameter by Bioelectrical Impedance Analysis, can detect body composition changes, so it can be used as a prognostic indicator in some chronic conditions. This study was for determining the relationship between PhA and hemodiálisis frequency with the survival of chronic hemodiálisis patients. This longitudinal retrospective study involved 173 chronic hemodiálisis patients at Rasyida Renal Hospital. The Kaplan-Meier method is used to determine the survival. Cox proportional hazard analysis is used to determine which variables significantly increase mortality. During the study period, 89 patients underwent hemodiálysis 3x a week (4 hours/session), and 84 patients underwent HD 2x a week (5 hours/session). Demographic and clinical characteristics in both groups were similar. There was no difference in PhA value in groups of 3x a week and group 2x a week (4.02 ± 1.13 vs 4.25 ± 1.12). Patients with twice a week hemodiálisis had a shorter survival than the 3x week group (35.14 ± 2.76 vs 38.62 ± 3.03) although it was not statistically significant (p = 0.126).

Comparison of graft survival following penetrating keratoplasty and Descemet's stripping endothelial keratoplasty in eyes with a glaucoma drainage device.

Science.gov (United States)

Iverson, Shawn M; Spierer, Oriel; Papachristou, George C; Feuer, William J; Shi, Wei; Greenfield, David S; O'Brien, Terrence P

2018-02-01

To compare corneal graft survival rates after penetrating keratoplasty (PK) and Descemet's stripping endothelial keratoplasty (DSEK) in patients with a glaucoma drainage device (GDD) or medically managed glaucoma. A retrospective chart review was conducted on consecutive patients who underwent primary PK or primary DSEK. Inclusion criteria consisted of eyes with a diagnosis of glaucoma prior to corneal transplantation and a minimum of 6 months of follow-up. Graft failure was defined as an edematous cornea with failure to maintain deturgescence lasting beyond a period of 1 month of intense steroid therapy or vascularization and scarring resulting in irreversible loss of central graft clarity. Corneal graft survival was calculated using Kaplan-Meier survival analysis. Patients were divided into four groups: GDD-PK, GDD-DSEK, medical-PK and medical-DSEK. Fifty-six eyes of 56 patients were identified as meeting inclusion criteria. Among eyes with a GDD, there was no difference in the proportion of failures between PK grafts (48%) and DSEK grafts (50%) (p = 0.90). Failure occurred earlier in DSEK recipients compared to PK recipients, 5.82 ± 6.77 months versus 14.40 ± 7.70 months, respectively (p = 0.04). A Kaplan-Meier analysis did not identify a difference between the four groups with respect to graft failure (p = 0.52). There is no significant difference in graft survival rates between medically and surgically treated glaucoma patients for either PK or DSEK grafts. In patients with GDD, graft failure occurs earlier in DSEK compared to PK.

The prognostic value of metabolic tumor volume in FDG PET/CT evaluation of post-operative survival in patients with esophageal squamous cell cancer

International Nuclear Information System (INIS)

Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li

2011-01-01

Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)

Estimation of Unemployment Duration in Botoşani County Using Survival Analysis

Directory of Open Access Journals (Sweden)

Darabă Gabriel

2017-01-01

Full Text Available In this paper we aim at estimating the unemployment duration in Botosani County in order tostudy the impact of individual characteristics (gender, age, place of residence, unemploymentbenefit, etc. on the length of unemployment spells. We use Cox regression model to measure theeffects of gender, age, residential environment, etc. on the hazard rate of leaving unemploymentandKaplan-Meier estimator to compare survival probabilities among different categories ofunemployed persons. The study is carried out on a sample of 200 unemployment spellsregisteredwith the Employment Agency of Botoşani County from January 2012 to December 2015. Theresults reveal that place of residence, unemployment benefit and unemployed category have asignificant impact on unemployment spells.

Analysis of survival for patients with chronic kidney disease primarily related to renal cancer surgery.

Science.gov (United States)

Wu, Jitao; Suk-Ouichai, Chalairat; Dong, Wen; Antonio, Elvis Caraballo; Derweesh, Ithaar H; Lane, Brian R; Demirjian, Sevag; Li, Jianbo; Campbell, Steven C

2018-01-01

To evaluate predictors of long-term survival for patients with chronic kidney disease primarily due to surgery (CKD-S). Patients with CKD-S have generally good survival that approximates patients who do not have CKD even after renal cancer surgery (RCS), yet there may be heterogeneity within this cohort. From 1997 to 2008, 4 246 patients underwent RCS at our centre. The median (interquartile range [IQR]) follow-up was 9.4 (7.3-11.0) years. New baseline glomerular filtration rate (GFR) was defined as highest GFR between nadir and 6 weeks after RCS. We retrospectively evaluated three cohorts: no-CKD (new baseline GFR of ≥60 mL/min/1.73 m 2 ); CKD-S (new baseline GFR of cancer-related survival (NRCRS) for the CKD-S cohort. Kaplan-Meier analysis assessed the longitudinal impact of new baseline GFR (45-60 mL/min/1.73 m 2 vs <45 mL/min/1.73 m 2 ) and Cox regression evaluated relative impact of preoperative GFR, new baseline GFR, and relevant demographics/comorbidities. Of the 4 246 patients who underwent RCS, 931 had CKD-S and 1 113 had CKD-M/S, whilst 2 202 had no-CKD even after RCS. Partial/radical nephrectomy (PN/RN) was performed in 54%/46% of the patients, respectively. For CKD-S, 641 patients had a new baseline GFR of 45-60 mL/min/1.73 m 2 and 290 had a new baseline GFR of <45 mL/min/1.73 m 2 . Kaplan-Meier analysis showed significantly reduced NRCRS for patients with CKD-S with a GFR of <45 mL/min/1.73 m 2 compared to those with no-CKD or CKD-S with a GFR of 45-60 mL/min/1.73 m 2 (both P ≤ 0.004), and competing risk analysis confirmed this (P < 0.001). Age, gender, heart disease, and new baseline GFR were all associated independently with NRCRS for patients with CKD-S (all P ≤ 0.02). Our data suggest that CKD-S is heterogeneous, and patients with a reduced new baseline GFR have compromised survival, particularly if <45 mL/min/1.73 m 2 . Our findings may have implications regarding choice of PN/RN in patients at risk of developing

Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

Science.gov (United States)

2017-08-01

28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival

Clinical Significance of Preoperative Albumin and Globulin Ratio in Patients with Gastric Cancer Undergoing Treatment

Directory of Open Access Journals (Sweden)

Min-jie Mao

2017-01-01

Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.

Prognostic and survival analysis of presbyopia: The healthy twin study

Science.gov (United States)

Lira, Adiyani; Sung, Joohon

2015-12-01

Presbyopia, a vision condition in which the eye loses its flexibility to focus on near objects, is part of ageing process which mostly perceptible in the early or mid 40s. It is well known that age is its major risk factor, while sex, alcohol, poor nutrition, ocular and systemic diseases are known as common risk factors. However, many other variables might influence the prognosis. Therefore in this paper we developed a prognostic model to estimate survival from presbyopia. 1645 participants which part of the Healthy Twin Study, a prospective cohort study that has recruited Korean adult twins and their family members based on a nation-wide registry at public health agencies since 2005, were collected and analyzed by univariate analysis as well as Cox proportional hazard model to reveal the prognostic factors for presbyopia while survival curves were calculated by Kaplan-Meier method. Besides age, sex, diabetes, and myopia; the proposed model shows that education level (especially engineering program) also contribute to the occurrence of presbyopia as well. Generally, at 47 years old, the chance of getting presbyopia becomes higher with the survival probability is less than 50%. Furthermore, our study shows that by stratifying the survival curve, MZ has shorter survival with average onset time about 45.8 compare to DZ and siblings with 47.5 years old. By providing factors that have more effects and mainly associate with presbyopia, we expect that we could help to design an intervention to control or delay its onset time.

Marital status independently predicts testis cancer survival--an analysis of the SEER database.

Science.gov (United States)

Abern, Michael R; Dude, Annie M; Coogan, Christopher L

2012-01-01

Previous reports have shown that married men with malignancies have improved 10-year survival over unmarried men. We sought to investigate the effect of marital status on 10-year survival in a U.S. population-based cohort of men with testis cancer. We examined 30,789 cases of testis cancer reported to the Surveillance, Epidemiology, and End Results (SEER 17) database between 1973 and 2005. All staging were converted to the 1997 AJCC TNM system. Patients less than 18 years of age at time of diagnosis were excluded. A subgroup analysis of patients with stages I or II non-seminomatous germ cell tumors (NSGCT) was performed. Univariate analysis using t-tests and χ(2) tests compared characteristics of patients separated by marital status. Multivariate analysis was performed using a Cox proportional hazard model to generate Kaplan-Meier survival curves, with all-cause and cancer-specific mortality as the primary endpoints. 20,245 cases met the inclusion criteria. Married men were more likely to be older (38.9 vs. 31.4 years), Caucasian (94.4% vs. 92.1%), stage I (73.1% vs. 61.4%), and have seminoma as the tumor histology (57.3% vs. 43.4%). On multivariate analysis, married status (HR 0.58, P married status (HR 0.60, P married and unmarried men (44.8% vs. 43.4%, P = 0.33). Marital status is an independent predictor of improved overall and cancer-specific survival in men with testis cancer. In men with stages I or II NSGCT, RPLND is an additional predictor of improved overall survival. Marital status does not appear to influence whether men undergo RPLND. Copyright © 2012 Elsevier Inc. All rights reserved.

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

International Nuclear Information System (INIS)

Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

2008-01-01

Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

Clinical performance of ART restorations in primary teeth: a survival analysis.

Science.gov (United States)

Faccin, Elise Sasso; Ferreira, Simone Helena; Kramer, Paulo Floriani; Ardenghi, Thiago Machado; Feldens, Carlos Alberto

2009-01-01

To assess the survival of Atraumatic Restorative Treatment (ART) restorations in primary teeth performed in a dental clinical setting. One hundred and five single-surface ART restorations placed in 56 preschool children (mean age 31 months) were included. Final-year dental students performed the restorations using standard ART procedures with hand instruments. A resin-modified glass ionomer cement (Vitremer 3M/ESPE) was used as a restorative material. Performances of the restorations were assessed directly by the ART evaluation criteria. Follow-up period ranged from 6 to 48 months. Survival estimates for restoration longevity were evaluated using the Kaplan-Meier method. Log-rank test (P ART restorations were 89%, 85% and 72% in 6 to 11, 12 to 24 and 25 to 48 months of evaluation respectively. Differences in success rates among demographic and clinical characteristics were not statistically significant. High survivals rates of the ART restorations found in this study seem to indicate the reliability of this approach as an appropriate treatment option for primary teeth in a clinical setting.

The BCR-ABLT315I mutation compromises survival in chronic phase chronic myelogenous leukemia patients resistant to tyrosine kinase inhibitors, in a matched pair analysis

DEFF Research Database (Denmark)

Nicolini, Franck E; Ibrahim, Amr R; Soverini, Simona

2013-01-01

The BCR-ABL T315I mutation confers resistance to currently licensed tyrosine kinase inhibitors in chronic myelogenous leukemia. However, the impact of this mutation on survival in early stages of disease, in chronic phase, has never been detailed. Using matched pair analysis, a cohort of 64...... patients with chronic phase chronic myelogenous leukemia harboring a T315I mutation and resistant to imatinib mesylate was compared to a similar cohort of 53 chronic phase patients resistant to imatinib, but with no detectable T315I mutation, in the pre-ponatinib era. These patients were matched according...... to age at diagnosis, interval between disease diagnosis and start of imatinib treatment, and duration of imatinib therapy. Kaplan-Meier survival analyses demonstrated the significant negative impact of the presence of the T315I mutation on overall survival (since imatinib-resistance: 48.4 months for T315...

Colorectal cancers detected through screening are associated with lower stages and improved survival

DEFF Research Database (Denmark)

Lindebjerg, Jan; Osler, Merete; Bisgaard, Claus Hedebo

2014-01-01

in the feasibility study cohort were reviewed with respect to the effect of screening participation on stages and survival. MATERIAL AND METHODS: All cases of CRC in a feasibility study cohort diagnosed from the beginning of the study until two years after the study ended were identified. Differences...... in the distribution of colon cancer stages and rectal cancer groups between the various screening categories were analysed through χ(2)-tests. Survival analysis with respect to screening groups was done by Kaplan-Meier and Cox-Mantel hazard ratios, and survival was corrected for lead time. RESULTS: Colon cancers...... detected through screening were diagnosed at significantly lower stages than among screening non-responders. There were relatively fewer locally advanced rectal cancers among patients diagnosed through positive FOBT than among non-responders. Survival among screening cancer patients was superior...

Survival benefits of remote ischemic conditioning in sepsis.

Science.gov (United States)

Joseph, Bellal; Khalil, Mazhar; Hashmi, Ammar; Hecker, Louise; Kulvatunyou, Narong; Tang, Andrew; Friese, Randall S; Rhee, Peter

2017-06-01

Sepsis remains the leading cause of death in the surgical intensive care unit. Prior studies have demonstrated a survival benefit of remote ischemic conditioning (RIC) in many disease states. The aim of this study was to determine the effects of RIC on survival in sepsis in an animal model and to assess alterations in inflammatory biochemical profiles. We hypothesized that RIC alters inflammatory biochemical profiles resulting in decreased mortality in a septic mouse model. Eight to 12 week C57BL/6 mice received intra-peritoneal injection of 12.5-mg/kg lipopolysaccharide (LPS). Septic animals in the experimental group underwent RIC at 0, 2, and 6 h after LPS by surgical exploration and alternate clamping of the femoral artery. Six 4-min cycles of ischemia-reperfusion were performed. Primary outcome was survival at 5-d after LPS injection. Secondary outcome was to assess the following serum cytokine levels: interferon-γ (IFN-γ), interleukin (IL)-10, IL-1β, and tumor necrosis factoralpha (TNFα) at the baseline before LPS injection, 0 hour after LPS injection, and at 2, 4, 24 hours after induction of sepsis (RIC was performed at 2 h after LPS injection). Kaplan-Meier survival analysis and log-rank test were used. ANOVA test was used to compare cytokine measurements. We performed experiments on 44 mice: 14 sham and 30 RIC mice (10 at each time point). Overall survival was higher in the experimental group compared to the sham group (57% versus 21%; P = 0.02), with the highest survival rate observed in the 2-hour post-RIC group (70%). On Kaplan-Meier analysis, 2-h post-RIC group had increased survival at 5 days after LPS (P = 0.04) with hazard ratio of 0.3 (95% confidence interval = 0.09-0.98). In the RIC group, serum concentrations of IFN-γ, IL-10, IL-1β, and TNFα peaked at 2 h after LPS and then decreased significantly over 24 hours (P sepsis and has the potential for implementation in the clinical practice. Early implementation of RIC may play an

Geographical variations in the use of cancer treatments are associated with survival of lung cancer patients

DEFF Research Database (Denmark)

Møller, Henrik; Coupland, Victoria H; Tataru, Daniela

2018-01-01

INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... to statistical adjustments for age, sex, socio-economic status, performance status and co-morbidity. CONCLUSION: The extent of use of different treatment modalities varies between geographical areas in England. These variations are not attributable to measurable patient and tumour characteristics, and more...

Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center

Directory of Open Access Journals (Sweden)

Claudio Calazan do Carmo

2011-08-01

Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (p<0.001. There was seen a dose-response relationship between mortality and clinical staging, ranging from 27.8 to 749.6 per 1,000 cases-year in women stage I and IV, respectively. CONCLUSIONS: The study showed that early detection through prevention programs is crucial to increase cervical cancer survival.

Geographical variations in the use of cancer treatments are associated with survival of lung cancer patients

DEFF Research Database (Denmark)

Møller, Henrik; Coupland, Victoria H; Tataru, Daniela

2018-01-01

INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... diagnosis. RESULTS: Survival improved over the period studied. The use of active treatment varied between geographical areas, with inter-quintile ranges of 9%-17% for surgical resection, 4%-13% for radical radiotherapy, and 22%-35% for chemotherapy. At 2 years, there were 188 potentially avoidable deaths...

Third-line Targeted Therapy in Metastatic Renal Cell Carcinoma: Results from the International Metastatic Renal Cell Carcinoma Database Consortium

DEFF Research Database (Denmark)

Wells, J Connor; Stukalin, Igor; Norton, Craig

2017-01-01

and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...

PROGNOSTIC FACTORS FOR SURVIVAL IN PATIENTS WITH METASTATIC COLORECTAL CANCER TREATED WITH FIRST - LINE CHEMOTHERAPY

Directory of Open Access Journals (Sweden)

Deyan Davidov

2017-05-01

Full Text Available Objective: The aim of this study was to investigate the prognostic significance for survival of certain clinical and pathological factors in patients with advanced or metastatic colorectal carcinoma (CRC treated with first- line chemotherapy. Methods: From 2002 to 2011 seventy- four consecutive patients with advanced or metastatic CRC, treated in UMHAT- Dr. G. Stranski, Department of Medical Oncology entered the study. Some patient’s characteristics, hematological and pathological parameters, were evaluated for their role as predictors of overall survival. The therapeutic regimens included FOLFOX or FOlFIRI. Survival analysis was evaluated by Kaplan- Meier test. The influence of pretreatment characteristics as prognostic factor for survival was analyzed using multivariate stepwise Cox regression analyses. Results: In multivariate analysis a significant correlation was exhibited between survival, poor performance status and multiple sites of metastasis. Variables significantly associated with overall survival in univariate analysis were performance status>1, thrombocytosis, anemia and number of metastatic sites >1. Conclusion: These results indicated that poor performance status, anemia, thrombocytosis as well as multiple site of metastasis could be useful prognostic factors in patients with metastatic CRC.

Brachytherapy Improves Biochemical Failure–Free Survival in Low- and Intermediate-Risk Prostate Cancer Compared With Conventionally Fractionated External Beam Radiation Therapy: A Propensity Score Matched Analysis

International Nuclear Information System (INIS)

Smith, Graham D.; Pickles, Tom; Crook, Juanita; Martin, Andre-Guy; Vigneault, Eric; Cury, Fabio L.; Morris, Jim; Catton, Charles; Lukka, Himu; Warner, Andrew; Yang, Ying; Rodrigues, George

2015-01-01

Purpose: To compare, in a retrospective study, biochemical failure-free survival (bFFS) and overall survival (OS) in low-risk and intermediate-risk prostate cancer patients who received brachytherapy (BT) (either low-dose-rate brachytherapy [LDR-BT] or high-dose-rate brachytherapy with external beam radiation therapy [HDR-BT+EBRT]) versus external beam radiation therapy (EBRT) alone. Methods and Materials: Patient data were obtained from the ProCaRS database, which contains 7974 prostate cancer patients treated with primary radiation therapy at four Canadian cancer institutions from 1994 to 2010. Propensity score matching was used to obtain the following 3 matched cohorts with balanced baseline prognostic factors: (1) low-risk LDR-BT versus EBRT; (2) intermediate-risk LDR-BT versus EBRT; and (3) intermediate-risk HDR-BT+EBRT versus EBRT. Kaplan-Meier survival analysis was performed to compare differences in bFFS (primary endpoint) and OS in the 3 matched groups. Results: Propensity score matching created acceptable balance in the baseline prognostic factors in all matches. Final matches included 2 1:1 matches in the intermediate-risk cohorts, LDR-BT versus EBRT (total n=254) and HDR-BT+EBRT versus EBRT (total n=388), and one 4:1 match in the low-risk cohort (LDR-BT:EBRT, total n=400). Median follow-up ranged from 2.7 to 7.3 years for the 3 matched cohorts. Kaplan-Meier survival analysis showed that all BT treatment options were associated with statistically significant improvements in bFFS when compared with EBRT in all cohorts (intermediate-risk EBRT vs LDR-BT hazard ratio [HR] 4.58, P=.001; intermediate-risk EBRT vs HDR-BT+EBRT HR 2.08, P=.007; low-risk EBRT vs LDR-BT HR 2.90, P=.004). No significant difference in OS was found in all comparisons (intermediate-risk EBRT vs LDR-BT HR 1.27, P=.687; intermediate-risk EBRT vs HDR-BT+EBRT HR 1.55, P=.470; low-risk LDR-BT vs EBRT HR 1.41, P=.500). Conclusions: Propensity score matched analysis showed that BT options led

Trastuzumab and survival of patients with metastatic breast cancer.

Science.gov (United States)

Kast, Karin; Schoffer, Olaf; Link, Theresa; Forberger, Almuth; Petzold, Andrea; Niedostatek, Antje; Werner, Carmen; Klug, Stefanie J; Werner, Andreas; Gatzweiler, Axel; Richter, Barbara; Baretton, Gustavo; Wimberger, Pauline

2017-08-01

Prognosis of Her2-positive breast cancer has changed since the introduction of trastuzumab for treatment in metastatic and early breast cancer. It was described to be even better compared to prognosis of Her2-negative metastatic breast cancer. The purpose of this study was to evaluate the effect of trastuzumab in our cohort. Besides the effect of adjuvant pretreatment with trastuzumab on survival of patients with metastatic Her2-positive breast cancer was analyzed. All patients with primary breast cancer of the Regional Breast Cancer Center Dresden diagnosed during the years 2001-2013 were analyzed for treatment with or without trastuzumab in the adjuvant and in the metastatic treatment setting using Kaplan-Meier survival estimation and Cox regression. Age and tumor stage at time of first diagnosis of breast cancer as well as hormone receptor status, grading, time, and site of metastasis at first diagnosis of distant metastatic disease were analyzed. Of 4.481 female patients with primary breast cancer, 643 presented with metastatic disease. Her2-positive status was documented in 465 patients, including 116 patients with primary or secondary metastases. Median survival of patients with Her2-positive primary metastatic disease was 3.0 years (95% CI 2.3-4.0). After adjustment for other factors, survival was better in patients with Her2-positive breast cancer with trastuzumab therapy compared to Her2-negative metastatic disease (HR 2.10; 95% CI 1.58-2.79). Analysis of influence of adjuvant therapy with and without trastuzumab by Kaplan-Meier showed a trend for better survival in not pretreated patients. Median survival was highest in hormone receptor-positive Her2-positive (triple-positive) primary metastatic breast cancer patients with 3.3 years (95% CI 2.3-4.6). Prognosis of patients with Her2-positive metastatic breast cancer after trastuzumab treatment is more favorable than for Her2-negative breast cancer. The role of adjuvant chemotherapy with or without

Chest computed tomography scores are predictive of survival in patients with cystic fibrosis awaiting lung transplantation

DEFF Research Database (Denmark)

Loeve, Martine; Hop, Wim C. J.; de Bruijne, Marleen

2012-01-01

Rationale: Up to a third of cystic fibrosis (CF) patients awaiting lung transplantation (LTX) die while waiting. Inclusion of computed tomography (CT) scores may improve survival prediction models such as the lung allocation score (LAS). Objectives: This study investigated the association between...... CT and survival in CF patients screened for LTX. Methods: Clinical data and chest CTs of 411 CF patients screened for LTX between 1990 and 2005 were collected from 17 centers. CTs were scored with the Severe Advanced Lung Disease (SALD) 4-category scoring system, including the components "infection....../inflammation" (INF), air trapping/hypoperfusion (AT), normal/hyperperfusion (NOR) and bulla/cysts (BUL). The volume of each component was computed using semi-automated software. Survival analysis included Kaplan-Meier curves, and Cox-regression models. Measurements and main results: 366 (186 males) out of 411...

Cementless One-Stage Revision in Chronic Periprosthetic Hip Joint Infection. Ninety-One Percent Infection Free Survival in 56 Patients at Minimum 2-Year Follow-Up

DEFF Research Database (Denmark)

Lange, Jeppe; Troelsen, Anders; Solgaard, Søren

2018-01-01

was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...

[Analysis of clinicopathologic and survival characteristics in patients with right-or left-sided colon cancer].

Science.gov (United States)

Hu, Junjie; Zhou, Zhixiang; Liang, Jianwei; Zhou, Haitao; Wang, Zheng; Zhang, Xingmao; Zeng, Weigen

2015-07-28

This study aimed to clarify the clinical and histological parameters, and survival difference between right- and left-sided colon cancer. We retrospectively analyzed the medical records (2006.1-2009.12) of 1 088 consecutive colon cancer patients who received surgery at our hospital. Right- and left-sided colon cancers were compared regarding the clinical and histological parameters. The survival analysis was performed by the Kaplan-Meier method, and the log-rank test was used to determine the statistical significance of differences. Right-sided colon cancer was associated with older age, a more advanced state, and poorly differentiated and undifferentiated adenocarcinoma (25.2% vs 13.2%), mucinous adenocarcinoma (33.5% vs 17.3%) and vascular invasion (9.9% vs 3.9%) were more commonly seen in right-sided colon cancer compared with right-sided colon cancer, and all these differences were statistically significant. Median overall survival was right, 67 months; and left, 68 months. The five-years overall survival of right- and left-sided colon cancer was I/II stage, 91.4% vs 88.6% (P = 0.819); III stage, 66.1% vs 75.4% (P = 0.010); and IV stage, 27.8% vs 38.5% (P = 0.020) respectively. Right- and left-sided colon cancers are significantly different regarding clinical and histological parameters. Right-sided colon cancers in stage III and IV have a worse prognosis.

Kaplan turbine tip vortex cavitation - analysis and prevention

Science.gov (United States)

Motycak, L.; Skotak, A.; Kupcik, R.

2012-11-01

The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

Directory of Open Access Journals (Sweden)

Jie Zhao

2015-01-01

Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.

Graft survival rate of renal transplantation during a period of 10 years in Iran

Directory of Open Access Journals (Sweden)

Fatemeh Shahbazi

2015-01-01

Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.

Biostatistics series module 9: Survival analysis

Directory of Open Access Journals (Sweden)

Avijit Hazra

2017-01-01

Full Text Available Survival analysis is concerned with “time to event“ data. Conventionally, it dealt with cancer death as the event in question, but it can handle any event occurring over a time frame, and this need not be always adverse in nature. When the outcome of a study is the time to an event, it is often not possible to wait until the event in question has happened to all the subjects, for example, until all are dead. In addition, subjects may leave the study prematurely. Such situations lead to what is called censored observations as complete information is not available for these subjects. The data set is thus an assemblage of times to the event in question and times after which no more information on the individual is available. Survival analysis methods are the only techniques capable of handling censored observations without treating them as missing data. They also make no assumption regarding normal distribution of time to event data. Descriptive methods for exploring survival times in a sample include life table and Kaplan–Meier techniques as well as various kinds of distribution fitting as advanced modeling techniques. The Kaplan–Meier cumulative survival probability over time plot has become the signature plot for biomedical survival analysis. Several techniques are available for comparing the survival experience in two or more groups – the log-rank test is popularly used. This test can also be used to produce an odds ratio as an estimate of risk of the event in the test group; this is called hazard ratio (HR. Limitations of the traditional log-rank test have led to various modifications and enhancements. Finally, survival analysis offers different regression models for estimating the impact of multiple predictors on survival. Cox's proportional hazard model is the most general of the regression methods that allows the hazard function to be modeled on a set of explanatory variables without making restrictive assumptions concerning the

Markov chains and semi-Markov models in time-to-event analysis.

Science.gov (United States)

Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J

2013-10-25

A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.

Prognostic nutritional index is associated with survival after total gastrectomy for patients with gastric cancer.

Science.gov (United States)

Ishizuka, Mitsuru; Oyama, Yusuke; Abe, Akihito; Tago, Kazuma; Tanaka, Genki; Kubota, Keiichi

2014-08-01

To investigate the influence of clinical characteristics including nutritional markers on postoperative survival in patients undergoing total gastrectomy (TG) for gastric cancer (GC). One hundred fifty-four patients were enrolled. Uni- and multivariate analyses using the Cox proportional hazard model were performed to explore the most valuable clinical characteristic that was associated with postoperative survival. Multivariate analysis using twelve clinical characteristics selected from univariate analyses revealed that age (≤ 72/>72), carcinoembryonic antigen (≤ 20/>20) (ng/ml), white blood cell count (≤ 9.5/>9.5) (× 10(3)/mm(3)), prognostic nutritional index (PNI) (≤ 45/>45) and lymph node metastasis (negative/positive) were associated with postoperative survival. Kaplan-Meier analysis and log-rank test showed that patients with higher PNI (>45) had a higher postoperative survival rate than those with lower PNI (≤ 45) (p<0.001). PNI is associated with postoperative survival of patients undergoing TG for GC and is able to divide such patients into two independent groups before surgery. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Survival benefit of early androgen receptor inhibitor therapy in locally advanced prostate cancer

DEFF Research Database (Denmark)

Thomsen, Frederik B; Brasso, Klaus; Christensen, Ib J

2015-01-01

BACKGROUND: The optimal timing of endocrine therapy in non-metastatic prostate cancer (PCa) is still an issue of debate. METHODS: A randomised, double-blind, parallel-group trial comparing bicalutamide 150mg once daily with placebo in addition to standard care in patients with hormone-naïve, non......-metastatic PCa. Kaplan-Meier analysis was used to estimate overall survival (OS) and multivariate Cox proportional hazard model was performed to analyse time-to-event (death). FINDINGS: A total of 1218 patients were included into the Scandinavian Prostate Cancer Group (SPCG)-6 study of which 607 were randomised...... disease (hazard ratios (HR)=0.77 (95% confidence interval (CI): 0.63-0.94, p=0.01), regardless of baseline prostate-specific antigen (PSA), with a survival benefit which was apparent throughout the study period. In contrast, survival favoured randomisation to the placebo arm in patients with localised...

Nomogram based overall survival prediction in stereotactic body radiotherapy for oligo-metastatic lung disease

DEFF Research Database (Denmark)

Tanadini-Lang, S; Rieber, J; Filippi, A R

2017-01-01

BACKGROUND: Radical local treatment of pulmonary metastases is practiced with increasing frequency due to acknowledgment and better understanding of oligo-metastatic disease. This study aimed to develop a nomogram predicting overall survival (OS) after stereotactic body radiotherapy (SBRT......) for pulmonary metastases. PATIENTS AND METHODS: A multi-institutional database of 670 patients treated with SBRT for pulmonary metastases was used as training cohort. Cox regression analysis with bidirectional variable elimination was performed to identify factors to be included into the nomogram model...... to predict 2-year OS. The calibration rate of the nomogram was assessed by plotting the actual Kaplan-Meier 2-year OS against the nomogram predicted survival. The nomogram was externally validated using two separate monocentric databases of 145 and 92 patients treated with SBRT for pulmonary metastases...

A population-based study of survival and discharge status for survivors after head injury

DEFF Research Database (Denmark)

Engberg, Aase Worså; Teasdale, T W

2004-01-01

and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score

Ten-Year Experience of Renal Transplantation at the Northwest National Medical Center, Sonora Mexico: A Survival Study.

Science.gov (United States)

Ma, M A; Laguna-Teniente, I R

2016-03-01

To improve survival after kidney transplantation, it is important to identify the variables that affect it. The aim of this work was to determine the survival of renal grafts from living and cadaveric donors and the survival of patients with graft failure in a tertiary medical unit in northwest Mexico. We performed a retrospective cohort study of patients who received transplants since 2004 at the center. Database and medical records of patients were reviewed. The data were captured in a database previously designed in the SPSS v21.1 program for statistical processing. A descriptive analysis with frequencies and percentages and numeric variables measure of central tendency and dispersion was conducted. The survival analysis was made with the Kaplan-Meier method to estimate the graft survive. A total of 412 transplantations were performed during the 2004-2013 period. We analyzed 331 records, and the 10-year survival rates of donor allografts from living and cadaveric donors were 86.64% and 72.78%, respectively. Copyright © 2016 Elsevier Inc. All rights reserved.

Reporting and methodological quality of survival analysis in articles published in Chinese oncology journals.

Science.gov (United States)

Zhu, Xiaoyan; Zhou, Xiaobin; Zhang, Yuan; Sun, Xiao; Liu, Haihua; Zhang, Yingying

2017-12-01

Survival analysis methods have gained widespread use in the filed of oncology. For achievement of reliable results, the methodological process and report quality is crucial. This review provides the first examination of methodological characteristics and reporting quality of survival analysis in articles published in leading Chinese oncology journals.To examine methodological and reporting quality of survival analysis, to identify some common deficiencies, to desirable precautions in the analysis, and relate advice for authors, readers, and editors.A total of 242 survival analysis articles were included to be evaluated from 1492 articles published in 4 leading Chinese oncology journals in 2013. Articles were evaluated according to 16 established items for proper use and reporting of survival analysis.The application rates of Kaplan-Meier, life table, log-rank test, Breslow test, and Cox proportional hazards model (Cox model) were 91.74%, 3.72%, 78.51%, 0.41%, and 46.28%, respectively, no article used the parametric method for survival analysis. Multivariate Cox model was conducted in 112 articles (46.28%). Follow-up rates were mentioned in 155 articles (64.05%), of which 4 articles were under 80% and the lowest was 75.25%, 55 articles were100%. The report rates of all types of survival endpoint were lower than 10%. Eleven of 100 articles which reported a loss to follow-up had stated how to treat it in the analysis. One hundred thirty articles (53.72%) did not perform multivariate analysis. One hundred thirty-nine articles (57.44%) did not define the survival time. Violations and omissions of methodological guidelines included no mention of pertinent checks for proportional hazard assumption; no report of testing for interactions and collinearity between independent variables; no report of calculation method of sample size. Thirty-six articles (32.74%) reported the methods of independent variable selection. The above defects could make potentially inaccurate

The Impact of Demographic and Socioeconomic Factors on Major Salivary Gland Cancer Survival.

Science.gov (United States)

Olarte, Lucia S; Megwalu, Uchechukwu C

2014-06-01

This study aimed to investigate the impact of demographic and socioeconomic factors on survival in patients with major salivary gland malignancies. Population-based study using the Surveillance, Epidemiology, and End Results (SEER) cancer database. The study cohort consisted of 10,735 men and women ages 20 and older who were diagnosed with major salivary gland carcinoma from 1973 to 2009. Kaplan-Meier analysis revealed that the overall and disease-specific survival was higher for women than for men (P impact on overall survival. Male sex (HR = 1.38; 95% CI, 1.27-1.49), increasing age, and single status (HR = 1.29; 95% CI, 1.19-1.39) had poor prognostic impact on disease-specific survival. For patients with salivary gland malignancies, there is a survival benefit for younger patients, female patients, and married patients. This highlights the significance of demographic factors on survival outcomes for patients with salivary gland malignancies and highlights areas for further research on health disparities. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2014.

Improved long-term survival after intra-operative single high-dose ATG-Fresenius induction in renal transplantation: a single centre experience.

Science.gov (United States)

Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus

2009-01-01

In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778

A retrospective analysis of survival and prognostic factors after stereotactic radiosurgery for aggressive meningiomas

International Nuclear Information System (INIS)

Ferraro, Daniel J; Zoberi, Imran; Simpson, Joseph R; Jaboin, Jerry J; Funk, Ryan K; Blackett, John William; Ju, Michelle R; DeWees, Todd A; Chicoine, Michael R; Dowling, Joshua L; Rich, Keith M; Drzymala, Robert E

2014-01-01

While most meningiomas are benign, aggressive meningiomas are associated with high levels of recurrence and mortality. A single institution’s Gamma Knife radiosurgical experience with atypical and malignant meningiomas is presented, stratified by the most recent WHO classification. Thirty-one patients with atypical and 4 patients with malignant meningiomas treated with Gamma Knife radiosurgery between July 2000 and July 2011 were retrospectively reviewed. All patients underwent prior surgical resection. Overall survival was the primary endpoint and rate of disease recurrence in the brain was a secondary endpoint. Patients who had previous radiotherapy or prior surgical resection were included. Kaplan-Meier and Cox proportional hazards models were used to estimate survival and identify factors predictive of recurrence and survival. Post-Gamma Knife recurrence was identified in 11 patients (31.4%) with a median overall survival of 36 months and progression-free survival of 25.8 months. Nine patients (25.7%) had died. Three-year overall survival (OS) and progression-free survival (PFS) rates were 78.0% and 65.0%, respectively. WHO grade II 3-year OS and PFS were 83.4% and 70.1%, while WHO grade III 3-year OS and PFS were 33.3% and 0%. Recurrence rate was significantly higher in patients with a prior history of benign meningioma, nuclear atypia, high mitotic rate, spontaneous necrosis, and WHO grade III diagnosis on univariate analysis; only WHO grade III diagnosis was significant on multivariate analysis. Overall survival was adversely affected in patients with WHO grade III diagnosis, prior history of benign meningioma, prior fractionated radiotherapy, larger tumor volume, and higher isocenter number on univariate analysis; WHO grade III diagnosis and larger treated tumor volume were significant on multivariate analysis. Atypical and anaplastic meningiomas remain difficult tumors to treat. WHO grade III diagnosis and treated tumor volume were significantly

Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

OpenAIRE

Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu

2015-01-01

Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...

Aplicación y técnicas del análisis de supervivencia en las investigaciones clínicas Application and techniques of survival analysis in clinical research

Directory of Open Access Journals (Sweden)

Anissa Gramatges Ortiz

2002-08-01

Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated

Conditional survival of patients with diffuse large B-cell lymphoma

DEFF Research Database (Denmark)

Møller, Michael Boe; Pedersen, Niels Tinggaard; Christensen, Bjarne E

2006-01-01

BACKGROUND: Prognosis of lymphoma patients is usually estimated at the time of diagnosis and the estimates are guided by the International Prognostic Index (IPI). However, conditional survival estimates are more informative clinically, as they consider those patients only who have already survive...... survival probability provides more accurate prognostic information than the conventional survival rate estimated from the time of diagnosis.......BACKGROUND: Prognosis of lymphoma patients is usually estimated at the time of diagnosis and the estimates are guided by the International Prognostic Index (IPI). However, conditional survival estimates are more informative clinically, as they consider those patients only who have already survived...... a period of time after treatment. Conditional survival data have not been reported for lymphoma patients. METHODS: Conditional survival was estimated for 1209 patients with diffuse large B-cell lymphoma (DLBCL) from the population-based LYFO registry of the Danish Lymphoma Group. The Kaplan-Meier method...

Survival and clinical outcome of dogs with ischaemic stroke

DEFF Research Database (Denmark)

Gredal, Hanne Birgit; Toft, Nils; Westrup, Ulrik

2013-01-01

The objectives of the present study were to investigate survival time, possible predictors of survival and clinical outcome in dogs with ischaemic stroke. A retrospective study of dogs with a previous diagnosis of ischaemic stroke diagnosed by magnetic resonance imaging (MRI) was performed....... The association between survival and the hypothesised risk factors was examined using univariable exact logistic regression. Survival was examined using Kaplan-Meier and Cox regression. Twenty-two dogs were identified. Five dogs (23%) died within the first 30days of the stroke event. Median survival in 30-day...... survivors was 505days. Four dogs (18%) were still alive by the end of the study. Right-sided lesions posed a significantly increased risk of mortality with a median survival time in dogs with right-sided lesions of 24days vs. 602days in dogs with left sided lesions (P=0.006). Clinical outcome was considered...

Carbonic anhydrase IX and response to postmastectomy radiotherapy in high-risk breast cancer: a subgroup analysis of the DBCG82 b and c trials

DEFF Research Database (Denmark)

Kyndi, M.; Sorensen, F.B.; Alsner, J.

2008-01-01

-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...

A review and comparison of methods for recreating individual patient data from published Kaplan-Meier survival curves for economic evaluations: a simulation study.

Science.gov (United States)

Wan, Xiaomin; Peng, Liubao; Li, Yuanjian

2015-01-01

In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.

Is Human Papillomavirus Associated with Prostate Cancer Survival?

Directory of Open Access Journals (Sweden)

Mariarosa Pascale

2013-01-01

Full Text Available The role of human papillomavirus (HPV in prostate carcinogenesis is highly controversial: some studies suggest a positive association between HPV infection and an increased risk of prostate cancer (PCa, whereas others do not reveal any correlation. In this study, we investigated the prognostic impact of HPV infection on survival in 150 primary PCa patients. One hundred twelve (74.67% patients had positive expression of HPV E7 protein, which was evaluated in tumour tissue by immunohistochemistry. DNA analysis on a subset of cases confirmed HPV infection and revealed the presence of genotype 16. In Kaplan-Meier analysis, HPV-positive cancer patients showed worse overall survival (OS (median 4.59 years compared to HPV-negative (median 8.24 years, P=0.0381. In multivariate analysis age (P<0.001, Gleason score (P<0.001, nuclear grading (P=0.002, and HPV status (P=0.034 were independent prognostic factors for OS. In our cohort, we observed high prevalence of HPV nuclear E7 oncoprotein and an association between HPV infection and PCa survival. In the debate about the oncogenic activity of HPV in PCa, our results further confirm the need for additional studies to clarify the possible role of HPV in prostate carcinogenesis.

Factors predicting survival in amyotrophic lateral sclerosis patients on non-invasive ventilation.

Science.gov (United States)

Gonzalez Calzada, Nuria; Prats Soro, Enric; Mateu Gomez, Lluis; Giro Bulta, Esther; Cordoba Izquierdo, Ana; Povedano Panades, Monica; Dorca Sargatal, Jordi; Farrero Muñoz, Eva

2016-01-01

Non invasive ventilation (NIV) improves quality of life and extends survival in amyotrophic lateral sclerosis (ALS) patients. However, few data exist about the factors related to survival. We intended to assess the predictive factors that influence survival in patients after NIV initiation. Patients who started NIV from 2000 to 2014 and were tolerant (compliance ≥ 4 hours) were included; demographic, disease related and respiratory variables at NIV initiation were analysed. Statistical analysis was performed using the Kaplan-Meier test and Cox proportional hazard models. 213 patients were included with median survival from NIV initiation of 13.5 months. In univariate analysis, the identified risk factors for mortality were severity of bulbar involvement (HR 2), Forced Vital Capacity (FVC) % (HR 0.99) and ALSFRS-R (HR 0.97). Multivariate analysis showed that bulbar involvement (HR 1.92) and ALSFRS-R (HR 0.97) were independent predictive factors of survival in patients on NIV. In our study, the two prognostic factors in ALS patients following NIV were the severity of bulbar involvement and ALSFRS-R at the time on NIV initiation. A better assessment of bulbar involvement, including evaluation of the upper airway, and a careful titration on NIV are necessary to optimize treatment efficacy.

Comparative pathogenicity of Vibrio spp., Photobacterium damselae ssp. damselae and five isolates of Aeromonas salmonicida ssp. achromogenes in juvenile Atlantic halibut (Hippoglossus hippoglossus).

Science.gov (United States)

Bowden, T J; Bricknell, I R; Preziosi, B M

2018-01-01

Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.

Kaplan turbine tip vortex cavitation – analysis and prevention

International Nuclear Information System (INIS)

Motycak, L; Skotak, A; Kupcik, R

2012-01-01

The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

Patients undergoing radical prostatectomy have a better survival than the background population

DEFF Research Database (Denmark)

Andreas Røder, Martin; Brasso, Klaus; Drimer Berg, Kasper

2013-01-01

underwent radical prostatectomy. Patients were followed prospectively per protocol. No patients were lost to follow-up. Overall and cause-specific survival were described using Kaplan-Meier plots. Standardized relative survival and mortality ratio were calculated based on expected survival in the age......INTRODUCTION: The objective of this study was to investigate standardised relative survival and mortality ratio for patients undergoing radical prostatectomy for localized prostate cancer at our institution. MATERIAL AND METHODS: Between 1995 and 2010, a total of 1,350 consecutive patients......-matched Danish population using the methods and macros described by Dickmann. The country-specific population mortality rates used for calculation of the expected survival were based on data from The Human Mortality Database. RESULTS: The median follow-up was 3.4 years (range: 0-14.3 years). A total of 59 (4...

Effect of an Oral Adsorbent, AST-120, on Dialysis Initiation and Survival in Patients with Chronic Kidney Disease

Directory of Open Access Journals (Sweden)

Shingo Hatakeyama

2012-01-01

Full Text Available The oral adsorbent AST-120 has the potential to delay dialysis initiation and improve survival of patients on dialysis. We evaluated the effect of AST-120 on dialysis initiation and its potential to improve survival in patients with chronic kidney disease. The present retrospective pair-matched study included 560 patients, grouped according to whether or not they received AST-120 before dialysis (AST-120 and non-AST-120 groups. The cumulative dialysis initiation free rate and survival rate were compared by the Kaplan-Meier method. Multivariate analysis was used to determine the impact of AST-120 on dialysis initiation. Our results showed significant differences in the 12- and 24-month dialysis initiation free rate (P<0.001, although no significant difference was observed in the survival rate between the two groups. In conclusion, AST-120 delays dialysis initiation in chronic kidney disease (CKD patients but has no effect on survival. AST-120 is an effective therapy for delaying the progression of CKD.

Review of epidemiological and clinical characteristics and overall survival in patients with colorectal cancer

Directory of Open Access Journals (Sweden)

Michelle Eisenhardt

2013-10-01

Full Text Available Backgound and Objectives: Colorectal cancer (CRC has high incidence, is often treatable and curable if diagnosed early. This study aimed to identify the epidemiological characteristic and assess overall survival in patients with CRC treated at a center specializing in oncology. Methods: Medical records of 127 patients with CRC were retrospectively evaluated. Clinical and epidemiological characteristics, in addition to treatment protocols and adverse reactions presented by patients were reviewed. The association of significance was assessed by chi-square and Fisher exact tests. The survival analyses were performed using the Kaplan-Meier method. The confidence interval was of 95% (p

Somatic mutation load of estrogen receptor-positive breast tumors predicts overall survival: an analysis of genome sequence data.

Science.gov (United States)

Haricharan, Svasti; Bainbridge, Matthew N; Scheet, Paul; Brown, Powel H

2014-07-01

Breast cancer is one of the most commonly diagnosed cancers in women. While there are several effective therapies for breast cancer and important single gene prognostic/predictive markers, more than 40,000 women die from this disease every year. The increasing availability of large-scale genomic datasets provides opportunities for identifying factors that influence breast cancer survival in smaller, well-defined subsets. The purpose of this study was to investigate the genomic landscape of various breast cancer subtypes and its potential associations with clinical outcomes. We used statistical analysis of sequence data generated by the Cancer Genome Atlas initiative including somatic mutation load (SML) analysis, Kaplan-Meier survival curves, gene mutational frequency, and mutational enrichment evaluation to study the genomic landscape of breast cancer. We show that ER(+), but not ER(-), tumors with high SML associate with poor overall survival (HR = 2.02). Further, these high mutation load tumors are enriched for coincident mutations in both DNA damage repair and ER signature genes. While it is known that somatic mutations in specific genes affect breast cancer survival, this study is the first to identify that SML may constitute an important global signature for a subset of ER(+) tumors prone to high mortality. Moreover, although somatic mutations in individual DNA damage genes affect clinical outcome, our results indicate that coincident mutations in DNA damage response and signature ER genes may prove more informative for ER(+) breast cancer survival. Next generation sequencing may prove an essential tool for identifying pathways underlying poor outcomes and for tailoring therapeutic strategies.

Two-year survival analysis of twisted wire fixed retainer versus spiral wire and fiber-reinforced composite retainers: a preliminary explorative single-blind randomized clinical trial.

Science.gov (United States)

Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa

2016-03-01

Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.

Epidermal Growth Factor Receptor Is Related to Poor Survival in Glioblastomas: Single-Institution Experience

Science.gov (United States)

Choi, Youngmin; Lee, Hyung-Sik; Hur, Won-Joo; Sung, Ki-Han; Kim, Ki-Uk; Choi, Sun-Seob; Kim, Su-Jin; Kim, Dae-Cheol

2013-01-01

Purpose There are conflicting results surrounding the prognostic significance of epidermal growth factor receptor (EGFR) status in glioblastoma (GBM) patients. Accordingly, we attempted to assess the influence of EGFR expression on the survival of GBM patients receiving postoperative radiotherapy. Materials and Methods Thirty three GBM patients who had received surgery and postoperative radiotherapy at our institute, between March 1997 and February 2006, were included. The evaluation of EGFR expression with immunohistochemistry was available for 30 patients. Kaplan-Meier survival analysis and Cox regression were used for statistical analysis. Results EGFR was expressed in 23 patients (76.7%), and not expressed in seven (23.3%). Survival in EGFR expressing GBM patients was significantly less than that in non-expressing patients (median survival: 12.5 versus 17.5 months, p=0.013). Patients who received more than 60 Gy showed improved survival over those who received up to 60 Gy (median survival: 17.0 versus 9.0 months, p=0.000). Negative EGFR expression and a higher radiation dose were significantly correlated with improved survival on multivariate analysis. Survival rates showed no differences according to age, sex, and surgical extent. Conclusion The expression of EGFR demonstrated a significantly deleterious effect on the survival of GBM patients. Therefore, approaches targeting EGFR should be considered in potential treatment methods for GBM patients, in addition to current management strategies. PMID:23225805

Different patterns in the prognostic value of age for bladder cancer-specific survival depending on tumor stages.

Science.gov (United States)

Feng, Huan; Zhang, Wei; Li, Jiajun; Lu, Xiaozhe

2015-01-01

To compare the pathological features and long-term survival of bladder cancer (BCa) in young patients with elderly counterparts. Using the U.S. National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) population-based data, we identified 93115 patients with non-metastatic bladder cancer diagnosed between 1988 and 2003. Patients were categorized into young (50 years and under) and elderly groups (over 50 years of age). The overall and five-year bladder cancer specific survival (BCSS) data were obtained using Kaplan-Meier plots. Multivariable Cox regression models were built for the analysis of long-term survival outcomes and risk factors. There were significant differences between the two groups in primary site, pathologic grading, histologic type, AJCC stage (pstage patients. The study findings show different patterns in the prognostic value of age for determining BCSS, depending on the tumor stages. Compared with elderly patients, young patients with bladder cancer surgery appear to have unique characteristics and a higher overall and cancer specific survival rate.

Does surgery or radiation provide the best overall survival in Ewing's sarcoma? A review of the National Cancer Data Base.

Science.gov (United States)

Miller, Benjamin J; Gao, Yubo; Duchman, Kyle R

2017-09-01

There is continuing debate regarding the ideal modality for local control of the primary tumor for patients with Ewing's sarcoma. The primary aim of this study is to investigate the impact of the method of local control on overall survival in patients with Ewing's sarcoma. The National Cancer Data Base was used to identify patients Ewing's sarcoma of bone. A Kaplan-Meier survival analysis was performed at 2, 5, and 10 years. Factors with a level of significance of P 8 cm, and male sex while controlling for tumor site. Surgery alone was consistently the method of local control that resulted in the highest overall survival. Surgery alone resulted in the best overall survival for patients with Ewing's sarcoma of bone. The results of this investigation provide support to the approach of surgical resection with negative margins when possible. © 2017 Wiley Periodicals, Inc.

Factors predicting survival following noninvasive ventilation in amyotrophic lateral sclerosis.

Science.gov (United States)

Peysson, S; Vandenberghe, N; Philit, F; Vial, C; Petitjean, T; Bouhour, F; Bayle, J Y; Broussolle, E

2008-01-01

The involvement of respiratory muscles is a major predicting factor for survival in amyotrophic lateral sclerosis (ALS). Recent studies show that noninvasive ventilation (NIV) can relieve symptoms of alveolar hypoventilation. However, factors predicting survival in ALS patients when treated with NIV need to be clarified. We conducted a retrospective study of 33 consecutive ALS patients receiving NIV. Ten patients had bulbar onset. We determined the median survivals from onset, diagnosis and initiation of NIV and factors predicting survival. Statistical analysis was performed using the Kaplan-Meier test and Cox proportional hazard models. The median initial and maximal total uses of NIV were 10 and 14 h/24h. The overall median survival from ALS onset was 34.2 months and worsened with increasing age and bulbar onset of the disease. The median survival from initiation of NIV was 8.4 months and was significantly poorer in patients with advanced age or with airway mucus accumulation. Survival from initiation of NIV was not influenced by respiratory parameters or bulbar symptoms. Advanced age at diagnosis and airway mucus accumulation represent poorer prognostic factors of ALS patients treated with NIV. NIV is a helpful treatment of sleep-disordered breathing, including patients with bulbar involvement. Copyright 2008 S. Karger AG, Basel.

Survival of Alzheimer's disease patients in Korea.

Science.gov (United States)

Go, Seok Min; Lee, Kang Soo; Seo, Sang Won; Chin, Juhee; Kang, Sue J; Moon, So Young; Na, Duk L; Cheong, Hae-Kwan

2013-01-01

The natural history of Alzheimer's disease (AD) has rarely been studied in the Korean population. Our study on survival analyses in Korean AD patients potentially provides a basis for cross-cultural comparisons. We studied 724 consecutive patients from a memory disorder clinic in a tertiary hospital in Seoul, who were diagnosed as having AD between April 1995 and December 2005. Deaths were identified by the Statistics Korea database. The Kaplan-Meier method was used for survival analysis, and a Cox proportional hazard model was used to assess factors related to patient survival. The overall median survival from the onset of first symptoms and from the time of diagnosis was 12.6 years (95% confidence interval 11.7-13.4) and 9.3 years (95% confidence interval 8.7-9.9), respectively. The age of onset, male gender, history of diabetes mellitus, lower Mini-Mental State Examination score, and higher Clinical Dementia Rating score were negatively associated with survival. There was a reversal of risk of AD between early-onset and later-onset AD, 9.1 years after onset. The results of our study show a different pattern of survival compared to those studies carried out with western AD populations. Mortality risk of early-onset AD varied depending on the duration of follow-up. Copyright © 2013 S. Karger AG, Basel.

Repair or Replacement for Isolated Tricuspid Valve Pathology? Insights from a Surgical Analysis on Long-Term Survival

Science.gov (United States)

Farag, Mina; Arif, Rawa; Sabashnikov, Anton; Zeriouh, Mohamed; Popov, Aron-Frederik; Ruhparwar, Arjang; Schmack, Bastian; Dohmen, Pascal M.; Szabó, Gábor; Karck, Matthias; Weymann, Alexander

2017-01-01

Background Long-term follow-up data concerning isolated tricuspid valve pathology after replacement or reconstruction is limited. Current American Heart Association guidelines equally recommend repair and replacement when surgical intervention is indicated. Our aim was to investigate and compare operative mortality and long-term survival in patients undergoing isolated tricuspid valve repair surgery versus replacement. Material/Methods Between 1995 and 2011, 109 consecutive patients underwent surgical correction of tricuspid valve pathology at our institution for varying structural pathologies. A total of 41 (37.6%) patients underwent tricuspid annuloplasty/repair (TAP) with or without ring implantation, while 68 (62.3%) patients received tricuspid valve replacement (TVR) of whom 36 (53%) were mechanical and 32 (47%) were biological prostheses. Results Early survival at 30 days after surgery was 97.6% in the TAP group and 91.1% in the TVR group. After 6 months, 89.1% in the TAP group and 87.8% in the TVR group were alive. In terms of long-term survival, there was no further mortality observed after one year post surgery in both groups (Log Rank p=0.919, Breslow p=0.834, Tarone-Ware p=0.880) in the Kaplan-Meier Survival analysis. The 1-, 5-, and 8-year survival rates were 85.8% for TAP and 87.8% for TVR group. Conclusions Surgical repair of the tricuspid valve does not show survival benefit when compared to replacement. Hence valve replacement should be considered generously in patients with reasonable suspicion that regurgitation after repair will reoccur. PMID:28236633

Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System

Science.gov (United States)

Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola

2011-01-01

Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…

Ambulation and survival following surgery in elderly patients with metastatic epidural spinal cord compression.

Science.gov (United States)

Itshayek, Eyal; Candanedo, Carlos; Fraifeld, Shifra; Hasharoni, Amir; Kaplan, Leon; Schroeder, Josh E; Cohen, José E

2017-12-28

Metastatic epidural spinal cord compression (MESCC) is a disabling consequence of disease progression. Surgery can restore/preserve physical function, improving access to treatments that increase duration of survival; however, advanced patient age may deter oncologists and surgeons from considering surgical management. Evaluate the duration of ambulation and survival in elderly patients following surgical decompression of MESCC. Retrospective file review of a prospective database, under IRB waiver of informed consent, of consecutive patients treated in an academic tertiary care medical center from 8/2008-3/2015. Patients ≥65 years presenting neurological and/or radiological signs of cord compression due to metastatic disease, who underwent surgical decompression. Duration of ambulation and survival. Patients underwent urgent multidisciplinary evaluation and surgery. Ambulation and survival were compared with age, pre- and postoperative neurological (American Spinal Injury Association [ASIA] Impairment Scale [AIS]) and performance status (Karnofsky Performance Status [KPS], and Tokuhashi Score using Kruskal-Wallis and Wilcoxon signed-rank tests, Pearson correlation coefficient, Cox regression model, log rank analysis, and Kaplan Meir analysis. 40 patients were included (21 male, 54%; mean age 74 years, range 65-87). Surgery was performed a mean 3.8 days after onset of motor symptoms. Mean duration of ambulation and survival were 474 (range 0-1662) and 525 days (range 11-1662), respectively; 53% of patients (21/40) survived and 43% (17/40) retained ambulation for ≥1 year. There was no significant relationship between survival and ambulation for patients aged 65-69, 70-79, or 80-89, although Kaplan Meier analysis suggested stratification. There was a significant relationship between duration of ambulation and pre- and postoperative AIS (p=0.0342, p=0.0358, respectively) and postoperative KPS (p=0.0221). Tokuhashi score was not significantly related to duration of

Ureteric complications in live related donor renal transplantation - impact on graft and patient survival

Directory of Open Access Journals (Sweden)

A Srivastava

2004-01-01

Full Text Available Objective : The study was performed with an aim to determine the incidence of ureteric complications in live related donor renal transplantation, and to study the effect of ureteric complications on long term graft and patient survival. Patients And Methods: Records of 1200 consecutive live related renal transplants done from 1989-2002 were reviewed. Twenty-six ureteric complications were noted to occur and treatment modalities employed were documented. In the non complication group sufficient data for evaluation was available in 867 patients. Survival analysis were performed using Kaplan-Meier techniques. Results: The overall incidence of urological complications is 2.9%. Complications occurred at a mean interval of 31.9 days after renal transplantation. Ureteric complications occurred in 2% patients with stented and 7.7% patients with non stented anastomosis (p=0.001. Mean follow up following renal transplantation was 37.4 months. Survival analysis showed that ureteric complications did not increase the risk of graft fai lu re or patient death. Conclusions: Ureteric complications in live related donor renal transplantation occurred in 2.9 % patients and did not impair graft and patient survival.

Survival, causes of death, and prognostic factors in systemic sclerosis: analysis of 947 Brazilian patients.

Science.gov (United States)

Sampaio-Barros, Percival D; Bortoluzzo, Adriana B; Marangoni, Roberta G; Rocha, Luiza F; Del Rio, Ana Paula T; Samara, Adil M; Yoshinari, Natalino H; Marques-Neto, João Francisco

2012-10-01

To analyze survival, prognostic factors, and causes of death in a large cohort of patients with systemic sclerosis (SSc). From 1991 to 2010, 947 patients with SSc were treated at 2 referral university centers in Brazil. Causes of death were considered SSc-related and non-SSc-related. Multiple logistic regression analysis was used to identify prognostic factors. Survival at 5 and 10 years was estimated using the Kaplan-Meier method. One hundred sixty-eight patients died during the followup. Among the 110 deaths considered related to SSc, there was predominance of lung (48.1%) and heart (24.5%) involvement. Most of the 58 deaths not related to SSc were caused by infection, cardiovascular or cerebrovascular disease, and cancer. Male sex, modified Rodnan skin score (mRSS) > 20, osteoarticular involvement, lung involvement, and renal crisis were the main prognostic factors associated to death. Overall survival rate was 90% for 5 years and 84% for 10 years. Patients presented worse prognosis if they had diffuse SSc (85% vs 92% at 5 yrs, respectively, and 77% vs 87% at 10 yrs, compared to limited SSc), male sex (77% vs 90% at 5 yrs and 64% vs 86% at 10 yrs, compared to female sex), and mRSS > 20 (83% vs 90% at 5 yrs and 66% vs 86% at 10 yrs, compared to mRSS < 20). Survival was worse in male patients with diffuse SSc, and lung and heart involvement represented the main causes of death in this South American series of patients with SSc.

Influence of antiviral therapy on survival of patients with hepatitis B ...

African Journals Online (AJOL)

The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...

The preoperative plasma fibrinogen level is an independent prognostic factor for overall survival of breast cancer patients who underwent surgical treatment.

Science.gov (United States)

Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming

2015-12-01

Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Retrospective Analysis of the Survival Benefit of Induction Chemotherapy in Stage IVa-b Nasopharyngeal Carcinoma.

Science.gov (United States)

Lan, Xiao-Wen; Zou, Xue-Bin; Xiao, Yao; Tang, Jie; OuYang, Pu-Yun; Su, Zhen; Xie, Fang-Yun

2016-01-01

The value of adding induction chemotherapy to chemoradiotherapy in locoregionally advanced nasopharyngeal carcinoma (LA-NPC) remains controversial, yet high-risk patients with LA-NPC have poor outcomes after chemoradiotherapy. We aimed to assess the survival benefits of induction chemotherapy in stage IVa-b NPC. A total of 602 patients with stage IVa-b NPC treated with intensity-modulated radiation therapy (IMRT) and concurrent chemotherapy with or without induction chemotherapy were retrospectively analyzed. Overall survival (OS), locoregional relapse-free survival (LRFS), distant metastasis-free survival (DMFS) and progression-free survival (PFS) were evaluated using the Kaplan-Meier method, log-rank test and Cox regression analysis. In univariate analysis, 5-year OS was 83.2% for induction chemotherapy plus concurrent chemotherapy and 74.8% for concurrent chemotherapy alone, corresponding to an absolute risk reduction of 8.4% (P = 0.022). Compared to concurrent chemotherapy alone, addition of induction chemotherapy improved 5-year DMFS (83.2% vs. 74.4%, P = 0.018) but not 5-year LRFS (83.7% vs. 83.0%, P = 0.848) or PFS (71.9% vs. 66.0%, P = 0.12). Age, T category, N category, chemotherapy strategy and clinical stage were associated with 5-year OS (P = 0.017, P = 0.031, P = 0.007, P = 0.022, P = 0.001, respectively). In multivariate analysis, induction chemotherapy plus concurrent chemotherapy was an independent favorable prognostic factor for OS (HR, 0.62; 95% CI, 0.43-0.90, P = 0.012) and DMFS (HR, 0.57; 95% CI, 0.38-0.83, P = 0.004). In subgroup analysis, induction chemotherapy significantly improved 5-year DMFS in stage IVa (86.8% vs. 77.3%, P = 0.008), but provided no significant benefit in stage IVb. In patients with stage IVa-b NPC treated with IMRT, addition of induction chemotherapy to concurrent chemotherapy significantly improved 5-year OS and 5-year DMFS. This study provides a basis for selection of high risk patients in future clinical therapeutic

A novel systemic immune-inflammation index predicts survival and quality of life of patients after curative resection for esophageal squamous cell carcinoma.

Science.gov (United States)

Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng

2017-10-01

A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.

Extraneural metastases of medulloblastoma: desmoplastic variants may have prolonged survival.

Science.gov (United States)

Young, Robert J; Khakoo, Yasmin; Yhu, Stephen; Wolden, Suzanne; De Braganca, Kevin C; Gilheeney, Stephen W; Dunkel, Ira J

2015-04-01

Extraneural metastases from CNS medulloblastoma are rare and poorly described. The purpose of this study is to describe the clinical and radiological characteristics of a large single institution series of patients with medulloblastoma who developed extraneural metastases. We retrospectively reviewed a departmental database over a 20 year period for all patients with medulloblastoma who developed extraneural metastases. Chart and imaging reviews were performed, and overall survival (OS) estimated by the Kaplan-Meier method. We found 14 patients with medulloblastoma and extraneural metastases. The median age at initial diagnosis was 16.3 years (range, 3.2-44.2), and the most common subtype was desmoplastic (n = 6, 42.9%). After initial gross total resection, most patients received radiation therapy alone (n = 10, 71.4%). Metastases to bone were most common (n = 11, 78.6%) followed by metastases to bone marrow (n = 6, 42.9%), usually to the spine. The median time from initial diagnosis to first extraneural metastasis was 1.5 years (range, 0.2-17.4), and the median OS from extraneural metastasis to death was 3.3 years (range, 0-18). The Kaplan-Meier estimate of 5 year OS from extraneural metastasis diagnosis was 40.0% (95% CI, 20.2-79.2). Extraneural metastases from medulloblastoma may rarely develop after initial diagnosis to involve bone and bone marrow. We found that desmoplastic variant extraneural tumors had longer survival than nondesmoplastic variants, suggesting that histopathological and more recent molecular subtyping have important roles in determining the prognosis of medulloblastoma patients. © 2014 Wiley Periodicals, Inc.

Prognostic factors and survival in primary malignant astrocytomas of the spinal cord: a population-based analysis from 1973 to 2007.

Science.gov (United States)

Adams, Hadie; Avendaño, Javier; Raza, Shaan M; Gokaslan, Ziya L; Jallo, George I; Quiñones-Hinojosa, Alfredo

2012-05-20

Observational cross-sectional study. Using data from the population-based cancer registries of the Surveillance, Epidemiology and End Results (SEER) program, we analyzed demographic features, tumor and treatment characteristics, as well as survival rates in patients with primary malignant astrocytomas of the spinal cord (PMASC). PMASC is a rare neoplasm and is considered to carry the same dismal outcome as their cerebral counterparts. Our current knowledge is incomplete, and understanding the epidemiology, diagnosis, and optimal treatment still poses challenges. The SEER data from 1973 to 2007 were reviewed for pathologically confirmed primary anaplastic astrocytomas (AA) and glioblastomas of the spinal cord (C72.0). We compared the clinical features and outcomes of the cohort in uni- and multivariate fashion. Survival was calculated and compared using Kaplan-Meier curves and log-rank analysis. Our search criteria retrieved 135 patients diagnosed with PMASC. The median survival for PMASC was 13 months with 1-, 2-, and 5-year survival rates of 51.8%, 32.2%, and 18.7%. Patient diagnosed with AA had a median survival time of 17 months versus 10 months in patients diagnosed with glioblastomas. Adult patients observed markedly prolonged survival compared with the pediatric group, with a 16-month versus 9-month median survival, respectively. Multivariate analysis revealed age at diagnosis, pediatric and adult age groups, sex, tumor histology, and extent of resection as significant predictors of survival. Interestingly, outcomes did not significantly change throughout the last decades or by receiving radiotherapy. Outcome for patients diagnosed with PMASC remains poor and presents an ongoing challenge for professionals in the field of neurospinal medicine and surgery. In our analyses of AA, adult patients, males, and patients undergoing radical resections were associated with increased survival. However, incidence of these lesions is low; hence, building strong

THROMBOCYTOSIS AS PROGNOSTIC FACTOR FOR SURVIVAL IN PATIENTS WITH ADVANCED NON SMALL CELL LUNG CANCER TREATED WITH FIRST- LINE CHEMOTHERAPY.

Directory of Open Access Journals (Sweden)

Deyan Davidov

2014-12-01

Full Text Available Objective: The aim of this study was to evaluate elevated platelet count as a prognostic factor for survival in patients with advanced (stage IIIB/ IV non- small cell lung cancer (NSCLC receiving first- line chemotherapy. Methods: From 2005 to 2009 three hundreds forty seven consecutive patients with stage IIIB or IV NSCLC, treated in Department of Medical Oncology, UMHAT "Dr Georgi Stranski" entered the study. The therapeutic regimens included intravenous administration of platinum- based doublets. Survival analysis was evaluated by Kaplan- Meier test. The influence of pretreatment thrombocytosis as prognostic factor for survival was analyzed using multivariate stepwise Cox regression analyses. Results: Elevated platelet counts were found in 78 patients. The overall survival for patients without elevated platelet counts was 9,6 months versus 6,9 months for these with thrombocytosis. In multivariate analysis as independent poor prognostic factors were identified: stage, performance status and elevated platelet counts. Conclusions: These results indicated that platelet counts as well as some clinical pathologic characteristics could be useful prognostic factors in patients with unresectable NSCLC.

[Survival rate for breast cancer in Rabat (Morocco) 2005-2008].

Science.gov (United States)

Mechita, Nada Bennani; Tazi, Mohammed Adnane; Er-Raki, Abdelouahed; Mrabet, Mustapha; Saadi, Asma; Benjaafar, Noureddine; Razine, Rachid

2016-01-01

Breast cancer is a public health problem in Morocco. This study aims to estimate the survival rate for patients with breast cancer living in Rabat. We conducted a prognostic study of female patients with breast cancer diagnosed during 2005-2008, living in Rabat and whose data were recorded in the Rabat Cancer Registry. The date of inclusion in this study corresponded with the date on which cancer was histologically confirmed. Survival rate was estimated using the Kaplan-Meier method and the comparison between the different classes of a variable was made using the log rank test. The study of factors associated with survival was performed using the Cox model. During the study period 628 cases of breast cancer were collected. Mortality rate was 19.9%. Overall 1-year survival rate was 97.1%, 89.2% at 3 years and 80.6% at 5 years. In multivariate analysis, breast cancer survival was statistically lower in patients over 70 years of age (p <0.001) with large tumor size (p < 0.001), advanced-stage adenopathies (p = 0.007), metastases (p < 0.001) and not using hormone therapy (p = 0.002). Large tumor size and metastases are poor prognostic factors in breast cancer, hence the need to strengthen screening programs.

Survival pathological prognosis factors in breast cancer

International Nuclear Information System (INIS)

Gonzalez-Longoria Boada, Lourdes B.

2012-01-01

A descriptive and longitudinal study of 273 women with breast cancer belonging to Granma province was carried out from 2003 to 2004, in order to analyze the survival of this female population, reason why the method of Kaplan Meier was used for the calculation of the mentioned variable and the Log Rank test was used for the comparison of curves. Patients with higher survival at 5 years were those who had tumors of 2 cm or less (87.5%), histological grade I (90.3%), nuclear grade I (88.3%), as well as the absence of vascular, lymphatic or lymph node invasion (with 80.6; 74.9 and 6.1% respectively). Also, tumor size, histological and nuclear grade, nodal status, as well as lymphatic and vascular invasion constituted prognosis factors, which favored the individualization of therapeutic behaviors

Oncological Outcomes After Robotic Proctectomy for Rectal Cancer: Analysis of a Prospective Database.

Science.gov (United States)

Sammour, Tarik; Malakorn, Songphol; Bednarski, Brian K; Kaur, Harmeet; Shin, Ui Sup; Messick, Craig; You, Yi-Qian Nancy; Chang, George J

2018-03-01

The aim of this study is to evaluate the oncological outcomes of robotic total mesorectal excision (TME) at an NCI designated cancer center. The effectiveness of laparoscopic TME could not be established, but the robotic-assisted approach may hold some promise, with improved visualization and ergonomics for pelvic dissection. Oncological outcome data is presently lacking. Patients who underwent total mesorectal excision or tumor-specific mesorectal excision for rectal cancer between April 2009 and April 2016 via a robotic approach were identified from a prospective single-institution database. The circumferential resection margin (CRM), distal resection margin, and TME completeness rates were determined. Kaplan-Meier analysis of disease-free survival and overall survival was performed for all patients treated with curative intent. A total of 276 patients underwent robotic proctectomy during the study period. Robotic surgery was performed initially by 1 surgeon with 3 additional surgeons progressively transitioning from open to robotic during the study period with annual increase in the total number of cases performed robotically. Seven patients had involved circumferential resection margins (2.5%), and there were no positive distal or proximal resection margins. One hundred eighty-six patients had TME quality assessed, and only 1 patient (0.5%) had an incomplete TME. Eighty-three patients were followed up for a minimum of 3 years, with a local recurrence rate of 2.4%, and a distant recurrence rate of 16.9%. Five-year disease-free survival on Kaplan-Meier analysis was 82%, and 5-year overall survival was 87%. Robotic proctectomy for rectal cancer can be performed with good short and medium term oncological outcomes in selected patients.

Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer

DEFF Research Database (Denmark)

Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim

2017-01-01

OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...

Benign meningiomas: primary treatment selection affects survival

International Nuclear Information System (INIS)

Condra, Kellie S.; Buatti, John M.; Mendenhall, William M.; Friedman, William A.; Marcus, Robert B.; Rhoton, Albert L.

1997-01-01

Purpose: To examine the effect of primary treatment selection on outcomes for benign intracranial meningiomas at the University of Florida. Methods and Materials: For 262 patients, the impact of age, Karnofsky performance status, pathologic features, tumor size, tumor location, and treatment modality on local control and cause-specific survival was analyzed (minimum potential follow-up, 2 years; median follow-up, 8.2 years). Extent of surgery was classified by Simpson grade. Treatment groups: surgery alone (n = 229), surgery and postoperative radiotherapy (RT) (n = 21), RT alone (n = 7), radiosurgery alone (n = 5). Survival analysis: Kaplan-Meier method with univariate and multivariate analysis. Results: At 15 years, local control was 76% after total excision (TE) and 87% after subtotal excision plus RT (SE+RT), both significantly better (p = 0.0001) than after SE alone (30%). Cause-specific survival at 15 years was reduced after treatment with SE alone (51%), compared with TE (88%) or SE+RT (86%) (p = 0.0003). Recurrence after primary treatment portended decreased survival, independent of initial treatment group or salvage treatment selection (p = 0.001). Atypical pathologic features predicted reduced 15-year local control (54 vs. 71%) and cause-specific survival rates (57 vs. 86%). Multivariate analysis for cause-specific survival revealed treatment group (SE vs. others; p = 0.0001), pathologic features (atypical vs. typical; p = 0.0056), and Karnofsky performance status (≥80 vs. <80; p = 0.0153) as significant variables. Conclusion: Benign meningiomas are well managed by TE or SE+RT. SE alone is inadequate therapy and adversely affects cause-specific survival. Atypical pathologic features predict a poorer outcome, suggesting possible benefit from more aggressive treatment. Because local recurrence portends lower survival rates, primary treatment choice is important

Communicating projected survival with treatments for chronic kidney disease: patient comprehension and perspectives on visual aids.

Science.gov (United States)

Dowen, Frances; Sidhu, Karishma; Broadbent, Elizabeth; Pilmore, Helen

2017-09-21

Mortality in end stage renal disease (ESRD) is higher than many malignancies. There is no data about the optimal way to present information about projected survival to patients with ESRD. In other areas, graphs have been shown to be more easily understood than narrative. We examined patient comprehension and perspectives on graphs in communicating projected survival in chronic kidney disease (CKD). One hundred seventy-seven patients with CKD were shown 4 different graphs presenting post transplantation survival data. Patients were asked to interpret a Kaplan Meier curve, pie chart, histogram and pictograph and answer a multi-choice question to determine understanding. We measured interpretation, usefulness and preference for the graphs. Most patients correctly interpreted the graphs. There was asignificant difference in the percentage of correct answers when comparing different graph types (p = 0.0439). The pictograph was correctly interpreted by 81% of participants, the histogram by 79%, pie chart by 77% and Kaplan Meier by 69%. Correct interpretation of the histogram was associated with educational level (p = 0.008) and inversely associated with age > 65 (p = 0.008). Of those who interpreted all four graphs correctly, there was an association with employment (p = 0.001) and New Zealand European ethnicity (p = 0.002). 87% of patients found the graphs useful. The pie chart was the most preferred graph (p 0.002). The readability of the graphs may have been improved with an alternative colour choice, especially in the setting of visual impairment. Visual aids, can be beneficial adjuncts to discussing survival in CKD.

Factors affecting survival outcomes of patients with non-metastatic Ewing's sarcoma family tumors in the spine: a retrospective analysis of 63 patients in a single center.

Science.gov (United States)

Wan, Wei; Lou, Yan; Hu, Zhiqi; Wang, Ting; Li, Jinsong; Tang, Yu; Wu, Zhipeng; Xu, Leqin; Yang, Xinghai; Song, Dianwen; Xiao, Jianru

2017-01-01

Little information has been published in the literature regarding survival outcomes of patients with Ewing's sarcoma family tumors (ESFTs) of the spine. The purpose of this study is to explore factors that may affect the prognosis of patients with non-metastatic spinal ESFTs. A retrospective analysis of survival outcomes was performed in patients with non-metastatic spinal ESFTs. Univariate and multivariate analyses were employed to identify prognostic factors for recurrence and survival. Recurrence-free survival (RFS) and overall survival (OS) were defined as the date of surgery to the date of local relapse and death. Kaplan-Meier methods were applied to estimate RFS and OS. Log-rank test was used to analyze single factors for RFS and OS. Factors with p values ≤0.1 were subjected to multivariate analysis. A total of 63 patients with non-metastatic spinal ESFTs were included in this study. The mean follow-up period was 35.1 months (range 1-155). Postoperative recurrence was detected in 25 patients, and distant metastasis and death occurred in 22 and 36 patients respectively. The result of multivariate analysis suggested that age older than 25 years and neoadjuvant chemotherapy were favorable independent prognostic factors for RFS and OS. In addition, total en-bloc resection, postoperative chemotherapy, radiotherapy and non-distant metastasis were favorable independent prognostic factors for OS. Age older than 25 years and neoadjuvant chemotherapy are favorable prognostic factors for both RFS and OS. In addition, total en-bloc resection, postoperative chemotherapy, radiotherapy and non-distant metastasis are closely associated with favorable survival.

IMP3 expression in human ovarian cancer is associated with improved survival

DEFF Research Database (Denmark)

Noske, Aurelia; Faggad, Areeg; Wirtz, Ralph

2009-01-01

The insulin-like growth factor-II mRNA-binding protein IMP3 plays an important role in embryogenesis and recent reports suggest an involvement in tumorigenesis. Although IMP3 expression has been well studied in mouse and human fetal and adult gonads, its role in ovarian cancer is unknown. We...... investigated the expression of IMP3 at protein and mRNA levels in a cohort of primary ovarian carcinomas and in 11 ovarian cancer cell lines. Western blot analysis revealed an expression of IMP3 in all ovarian cancer cell lines and immunohistochemistry demonstrated a positive cytoplasmic staining in 32 of 68...... carcinomas (47%). In contrast, epithelium of borderline tumors, as well as, benign ovarian lesions and normal ovaries exhibited only weak or no IMP3 expression. In univariate Kaplan-Meier analysis, IMP3 protein expression was significantly associated with better overall survival (P=0.048). To confirm...

Sobrevivência após acidentes de trânsito: impacto das variáveis clínicas e pré-hospitalares Sobrevida después de accidentes de tránsito: impacto de las variables clínicas y pre hospitalarias Survival after motor vehicle crash: impact of clinical and prehospital variables

Directory of Open Access Journals (Sweden)

Marisa Aparecida Amaro Malvestio

2008-08-01

Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized

Trends in adult leukemia incidence and survival in Denmark, 1943-2003

DEFF Research Database (Denmark)

Thygesen, Lau Caspar; Nielsen, Ove Juul; Johansen, Christoffer

2009-01-01

The etiology of leukemia is largely unknown. Ecological data indicating trends in incidence and survival can provide information about changes in risk factors, can reflect underlying changes in diagnostic classification, and can measure therapeutic advances. From the records of the Danish Cancer...... Registry with registration starting from 1943, we calculated age-specific, period-specific, and age-standardized (world standard) incidence rates of chronic lymphoid leukemia (CLL), acute lymphoid leukemia (ALL), chronic myeloid leukemia (CML), and acute myeloid leukemia (AML) for persons above the age...... of 18. Kaplan-Meier survival curves and median survival times were calculated. Between 1943 and 2003, there were 26,036 cases of leukemia reported. The age-specific incidence rates of CLL, CML, and AML were higher for older men and women, while the incidence rates of ALL by age were more homogeneous...

Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation: long-term results from the Bio-CAPTURE registry.

Science.gov (United States)

van den Reek, J M P A; Tummers, M; Zweegers, J; Seyger, M M B; van Lümig, P P M; Driessen, R J B; van de Kerkhof, P C M; Kievit, W; de Jong, E M G J

2015-03-01

Drug survival is an indicator for treatment success; insight in predictors associated with drug survival is important. To analyse the long-term drug survival for adalimumab in patients with psoriasis treated in daily practice and (II) to identify predictors of prolonged drug survival for adalimumab split for different reasons of discontinuation. Data were extracted from a prospective psoriasis cohort and analysed using Kaplan-Meier survival curves split for reasons of discontinuation. Baseline predictors associated with longer drug survival were identified using multivariate Cox-regression analysis. One hundred and sixteen patients were included with a total of 208 patient-years. Overall drug survival was 76% after 1 year and 52% after 4.5 years. In patients who stopped due to ineffectiveness, longer drug survival was associated with the absence of specific comorbidities (P = 0.03). In patients who stopped due to side-effects, longer drug survival was associated with male gender (P = 0.02). Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation. Strong, specific predictors can lead to patient-tailored treatment. © 2014 European Academy of Dermatology and Venereology.

Utilization pattern and survival outcomes of adjuvant therapies in high-grade nonretroperitoneal abdominal soft tissue sarcoma: A population-based study.

Science.gov (United States)

Green, William Ross; Chokshi, Ravi; Jabbour, Salma K; DeLaney, Thomas F; Mahmoud, Omar

2018-02-01

Nonretroperitoneal abdominal soft tissue sarcoma (NRA-STS) is a rare disease with limited data supporting its management. Our study aimed to reveal the utilization patterns of adjuvant therapy and its potential survival benefits using the National Cancer Data Base. The analysis included patients with resected high-grade NRA-STS. Chi-square analysis was used to evaluate distribution of patient and tumor-related factors within treatment groups. The Kaplan-Meier and Cox proportional hazards model were utilized to evaluate overall survival according to treatment approach. Multivariate analysis was used to determine the impact of these factors on patients' outcome. Matched propensity score analysis was implemented to control for imbalance of confounding variables. At median follow-up of 49 months, 5-year overall survival improved from 46% without adjuvant radiation therapy to 52% (P = 0.009) with radiotherapy delivery with a 30% reduction in hazard of death (95% confidence interval = 0.58-0.84). On multivariate analysis, age <50, tumor <8 cm, negative margins and radiotherapy delivery were significant predictors of improved survival. Chemotherapy was not associated with significant survival improvement (Hazard Ratios [HR]: 0.89, P = 0.28). Adjuvant radiotherapy was associated with improved survival in high-grade NRA-STS. Chemotherapy was not associated with a survival improvement; however, further studies are needed to refine treatment strategies. © 2017 John Wiley & Sons Australia, Ltd.

Human papilloma virus and survival of oropharyngeal cancer patients treated with surgery and adjuvant radiotherapy.

Science.gov (United States)

Broglie, Martina A; Soltermann, Alex; Haile, Sarah R; Huber, Gerhard F; Stoeckli, Sandro J

2015-07-01

Impact of p16 protein, a surrogate marker for human papilloma virus induced cancer, p53 and EGFR as well as clinical factors on survival in a patient cohort with oropharyngeal squamous cell carcinoma (OPSCC) treated by surgical resection and adjuvant radiotherapy (RT) ± concomitant chemotherapy (CT). This is a retrospective analysis of patient's charts and tumor tissue. 57 patients were consecutively included and their tumor tissue assembled on a tissue microarray following immunohistochemical analysis. Survival times were estimated by means of Kaplan-Meier analysis. The importance of clinical and immunohistochemical factors for outcome was estimated by cox proportional hazard models. With 88% 5-year overall survival, 91% 5-year disease-specific survival and 91% 5-year disease-free survival, respectively, we found excellent survival rates in this surgically treated patient cohort of mainly advanced OPSCC (93% AJCC stage III or IV). The only factors positively influencing survival were p16 overexpression as well as p53 negativity and even more pronounced the combination of those biomarkers. Survival analysis of patients classified into three risk categories according to an algorithm based on p16, smoking, T- and N-category revealed a low, intermediate and high-risk group with significant survival differences between the low and the high-risk group. Patients with OPSCC can be successfully treated by surgery and adjuvant RT ± CT with a clear survival benefit of p16 positive, p53 negative patients. We recommend considering a combination of immunohistochemical (p16, p53) and clinical factors (smoking, T- and N-category) for risk stratification.

Determinants of IPO survival on the Johannesburg securities exchange

Directory of Open Access Journals (Sweden)

Brownhilder Ngek Neneh

2014-10-01

Full Text Available The purpose of this paper was to establish the determinants of IPO survival on the Johannesburg Securities Exchange (JSE. Using the Kaplan-Meier test, this study established that firms less than five years prior to listing on the JSE have a significant smaller mean survival time; firms with a gross proceed less than the median have a significant shorter mean survival time; overpriced IPOs have a significant higher survival time; IPOs listed during the hot market period on the JSE have a significant smaller mean survival time and IPOs with return on asset, operating profit margin, and return on equity less than or equal to zero have a low mean survival time. Also, being in the internet industry significantly shortens the mean survival time of an IPO. Moreover, based on the Cox Proportional Hazard model, it was established that the determinants of IPO survivability on the JSE are the firms’ age, size, market period, return on equity and operating profit margin are. These findings provide investors and companies in the JSE with empirical evidence of the determinants of IPO survivability of the JSE. As such, investors are advised to consider these factors when selecting their portfolios

Acute lymphoblastic leukemia in children and adolescents: prognostic factors and analysis of survival

Directory of Open Access Journals (Sweden)

Daniel Willian Lustosa de Sousa

2015-08-01

Full Text Available OBJECTIVE: To describe the clinical and laboratory features of children and adolescents with acute lymphoblastic leukemia treated at three referral centers in Ceará and evaluate prognostic factors for survival, including age, gender, presenting white blood cell count, immunophenotype, DNA index and early response to treatment.METHODS: Seventy-six under 19-year-old patients with newly diagnosed acute lymphoblastic leukemia treated with the Grupo Brasileiro de Tratamento de Leucemia da Infância - acute lymphoblastic leukemia-93 and -99 protocols between September 2007 and December 2009 were analyzed. The diagnosis was based on cytological, immunophenotypic and cytogenetic criteria. Associations between variables, prognostic factors and response to treatment were analyzed using the chi-square test and Fisher's exact test. Overall and event-free survival were estimated by Kaplan-Meier analysis and compared using the log-rank test. A Cox proportional hazards model was used to identify independent prognostic factors.RESULTS: The average age at diagnosis was 6.3 ± 0.5 years and males were predominant (65%. The most frequently observed clinical features were hepatomegaly, splenomegaly and lymphadenopathy. Central nervous system involvement and mediastinal enlargement occurred in 6.6% and 11.8%, respectively. B-acute lymphoblastic leukemia was more common (89.5% than T-acute lymphoblastic leukemia. A DNA index >1.16 was found in 19% of patients and was associated with favorable prognosis. On Day 8 of induction therapy, 95% of the patients had lymphoblast counts <1000/µL and white blood cell counts <5.0 Ã- 109/L. The remission induction rate was 95%, the induction mortality rate was 2.6% and overall survival was 72%.CONCLUSION: The prognostic factors identified are compatible with the literature. The 5-year overall and event-free survival rates were lower than those reported for developed countries. As shown by the multivariate analysis, age

Association of the AA genotype of the BCL2 (-938C>A) promoter polymorphism with better survival in ovarian cancer.

Science.gov (United States)

Heubner, Martin; Wimberger, Pauline; Otterbach, Friedrich; Kasimir-Bauer, Sabine; Siffert, Winfried; Kimmig, Rainer; Nückel, Holger

2009-01-01

Bcl-2 plays a key role in the regulation of apoptosis. Recently, a novel regulatory single nucleotide polymorphism (-938C>A) in the inhibitory P2 BCL2 promoter was described. In this study we investigated its potential association with survival in epithelial ovarian cancer. Patients (n=110) with primary epithelial ovarian cancer were retrospectively genotyped by pyrosequencing. Genotype distribution was not significantly different between 110 ovarian cancer patients and 120 healthy controls, suggesting that genotypes of this polymorphism do not increase the susceptibility to ovarian cancer. Kaplan-Meier curves showed a significant association of the AA genotype with increased survival (p=0.002). Multivariate analysis revealed that the BCL2-938AC/CC genotype (hazard ratio 4.5; p=0.003) was an independent prognostic factor compared to other prognostic factors such as age, histological grade or tumor stage. The results suggest a role for the BCL2-938C>A polymorphism as a marker for survival in patients with epithelial ovarian cancer.

STAT3 inhibitor enhances chemotherapy drug efficacy by ...

African Journals Online (AJOL)

Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.

Tumors of the ampulla of vater: histopathologic classification and predictors of survival.

Science.gov (United States)

Carter, Jonathan T; Grenert, James P; Rubenstein, Laura; Stewart, Lygia; Way, Lawrence W

2008-08-01

The histology and clinical behavior of ampullary tumors vary substantially. We speculated that this might reflect the presence of two kinds of ampullary adenocarcinoma: pancreaticobiliary and intestinal. We analyzed patient demographics, presentation, survival (mean followup 44 months), and tumor histology for 157 consecutive ampullary tumors resected from 1989 to 2006. Histologic features were reviewed by a pathologist blinded to clinical outcomes. Survival was compared using Kaplan-Meier/Cox proportional hazards analysis. There were 33 benign (32 adenomas and 1 paraganglioma) and 124 malignant (118 adenocarcinomas and 6 neuroendocrine) tumors. One hundred fifteen (73%) patients underwent a Whipple procedure, 32 (20%) a local resection, and 10 (7%) a palliative operation. For adenocarcinomas, survival in univariate models was affected by jaundice, histologic grade, lymphovascular, or perineural invasion, T stage, nodal metastasis, and pancreaticobiliary subtype (p jaundice more often than those with the intestinal kind (p = 0.01) and had worse survival. In addition to other factors, tumor type (intestinal versus pancreaticobiliary) had a major effect on survival in patients with ampullary adenocarcinoma. The current concept of ampullary adenocarcinoma as a unique entity, distinct from duodenal and pancreatic adenocarcinoma, might be wrong. Intestinal ampullary adenocarcinomas behaved like their duodenal counterparts, but pancreaticobiliary ones were more aggressive and behaved like pancreatic adenocarcinomas.

Breastfeeding practices in a public health field practice area in Sri Lanka: a survival analysis

Directory of Open Access Journals (Sweden)

Agampodi Thilini C

2007-10-01

Full Text Available Abstract Background Exclusive breastfeeding up to the completion of the sixth month of age is the national infant feeding recommendation for Sri Lanka. The objective of the present study was to collect data on exclusive breastfeeding up to six months and to describe the association between exclusive breastfeeding and selected socio-demographic factors. Methods A clinic based cross-sectional study was conducted in the Medical Officer of Health area, Beruwala, Sri Lanka in June 2006. Mothers with infants aged 4 to 12 months, attending the 19 child welfare clinics in the area were included in the study. Infants with specific feeding problems (cleft lip and palate and primary lactose intolerance were excluded. Cluster sampling technique was used and consecutive infants fulfilling the inclusion criteria were enrolled. A total of 219 mothers participated in the study. The statistical tests used were survival analysis (Kaplan-Meier survival curves and Cox proportional Hazard model. Results All 219 mothers had initiated breastfeeding. The median duration of exclusive breastfeeding was four months (95% CI 3.75, 4.25. The rates of exclusive breastfeeding at 4 and 6 months were 61.6% (135/219 and 15.5% (24/155 respectively. Bivariate analysis showed that the Muslim ethnicity (p = 0.004, lower levels of parental education (p Conclusion The rate of breastfeeding initiation and exclusive breastfeeding up to the fourth month is very high in Medical Officer of Health area, Beruwala, Sri Lanka. However exclusive breastfeeding up to six months is still low and the prevalence of inappropriate feeding practices is high.

Effect of smoking on survival of patients with hepatocellular carcinoma.

Science.gov (United States)

Kolly, Philippe; Knöpfli, Marina; Dufour, Jean-François

2017-11-01

Lifestyle factors such as smoking, obesity and physical activity have gained interest in the field of hepatocellular carcinoma. These factors play a significant role in the development of hepatocellular carcinoma. Several studies revealed the impact of tobacco consumption on the development of hepatocellular carcinoma and its synergistic effects with viral etiologies (hepatitis B and C). The effects of smoking on survival in patients with a diagnosed hepatocellular carcinoma have not yet been investigated in a Western cohort where hepatitis C infection is a major risk factor. Using data from a prospective cohort of patients with hepatocellular carcinoma who were followed at the University Hospital of Bern, Switzerland, survival was compared by Kaplan-Meier analysis in smokers and nonsmokers, and multivariate Cox regression was applied to control for confounding variables. Of 238 eligible hepatocellular carcinoma patients, 64 were smokers at the time of inclusion and 174 were nonsmokers. Smokers had a significant worse overall survival than nonsmokers (hazard ratio 1.77, 95% confidence interval: 1.22-2.58, P=.003). Analysis of patients according to their underlying liver disease, revealed that smoking, and not nonsmoking, affected survival of hepatitis B virus and C virus-infected patients only. In this subgroup, smoking was an independent predictor for survival (hazard ratio 2.99, 95% confidence interval: 1.7-5.23, Phepatocellular carcinoma. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Neutrophil-to-lymphocyte ratio as an independent predictor for survival in patients with localized clear cell renal cell carcinoma after radiofrequency ablation: a propensity score matching analysis.

Science.gov (United States)

Chang, Xiaofeng; Zhang, Fan; Liu, Tieshi; Wang, Wei; Guo, Hongqian

2017-06-01

To investigate the role of neutrophil-to-lymphocyte ratio as a prognostic indicator in patients with localized clear cell renal cell carcinoma treated with radiofrequency ablation. We retrospectively analyzed data from patients with renal cell carcinoma who underwent radiofrequency ablation from 2006 to 2013. The Kaplan-Meier method was used to generate the survival curves according to different categories of neutrophil-to-lymphocyte ratio. Relationships between preoperative neutrophil-to-lymphocyte ratio or the change of neutrophil-to-lymphocyte ratio and survival were evaluated with multivariable Cox proportional hazards regression analysis. A propensity score matching analysis was carried out to avoid confounding bias. A total of 185 patients were included in present study. When stratified by preoperative neutrophil-to-lymphocyte ratio cutoff value of 2.79, 5-year recurrence-free survival, 5-year disease-free survival, and 5-year overall survival rates of neutrophil-to-lymphocyte ratio analysis, 5-year recurrence-free survival, 5-year disease-free survival, and 5-year overall survival rates of neutrophil-to-lymphocyte ratio ratio with the change of neutrophil-to-lymphocyte ratio, patients with both preoperative neutrophil-to-lymphocyte ratio ≥2.79 and the change of neutrophil-to-lymphocyte ratio ≥0.40 had the worst disease-free survival. Results of multivariable analysis showed that preoperative neutrophil-to-lymphocyte ratio and the change of neutrophil-to-lymphocyte ratio correlated with cancer relapse remarkably. High preoperative neutrophil-to-lymphocyte ratio and elevated postoperative neutrophil-to-lymphocyte ratio are associated with significant increase in risk of local recurrence as well as distant metastasis. The combination of neutrophil-to-lymphocyte ratio with the other prognostic indicators can be applied in the evaluation of relapse risk in patients with clear cell renal cell carcinoma after radiofrequency ablation.

The effect of clinical performance on the survival estimates of direct restorations

Directory of Open Access Journals (Sweden)

Kyou-Li Kim

2013-02-01

Full Text Available Objectives In most retrospective studies, the clinical performance of restorations had not been considered in survival analysis. This study investigated the effect of including the clinically unacceptable cases according to modified United States Public Health Service (USPHS criteria into the failed data on the survival analysis of direct restorations as to the longevity and prognostic variables. Materials and Methods Nine hundred and sixty-seven direct restorations were evaluated. The data of 204 retreated restorations were collected from the records, and clinical performance of 763 restorations in function was evaluated according to modified USPHS criteria by two observers. The longevity and prognostic variables of the restorations were compared with a factor of involving clinically unacceptable cases into the failures using Kaplan-Meier survival analysis and Cox proportional hazard model. Results The median survival times of amalgam, composite resin and glass ionomer were 11.8, 11.0 and 6.8 years, respectively. Glass ionomer showed significantly lower longevity than composite resin and amalgam. When clinically unacceptable restorations were included into the failure, the median survival times of them decreased to 8.9, 9.7 and 6.4 years, respectively. Conclusions After considering the clinical performance, composite resin was the only material that showed a difference in the longevity (p < 0.05 and the significantly higher relative risk of student group than professor group disappeared in operator groups. Even in the design of retrospective study, clinical evaluation needs to be included.

Cetuximab Concomitant with Second-Line Radiation Therapy in Patients with Locally Advanced Recurrent Squamous Cell Head and Neck Cancer

Directory of Open Access Journals (Sweden)

Muge Akmansu

2010-12-01

Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.

Natural history definition and a suggested clinical approach to Buerger's disease: a case-control study with survival analysis.

Science.gov (United States)

Fazeli, Bahare; Ravari, Hassan; Assadi, Reza

2012-08-01

The aim of this study was first to describe the natural history of Buerger's disease (BD) and then to discuss a clinical approach to this disease based on multivariate analysis. One hundred eight patients who corresponded with Shionoya's criteria were selected from 2000 to 2007 for this study. Major amputation was considered the ultimate adverse event. Survival analyses were performed by Kaplan-Meier curves. Independent variables including gender, duration of smoking, number of cigarettes smoked per day, minor amputation events and type of treatments, were determined by multivariate Cox regression analysis. The recorded data demonstrated that BD may present in four forms, including relapsing-remitting (75%), secondary progressive (4.6%), primary progressive (14.2%) and benign BD (6.2%). Most of the amputations occurred due to relapses within the six years after diagnosis of BD. In multivariate analysis, duration of smoking of more than 20 years had a significant relationship with further major amputation among patients with BD. Smoking cessation programs with experienced psychotherapists are strongly recommended for those areas in which Buerger's disease is common. Patients who have smoked for more than 20 years should be encouraged to quit smoking, but should also be recommended for more advanced treatment for limb salvage.

KRAS polymorphisms are associated with survival of CRC in Chinese population.

Science.gov (United States)

Dai, Qiong; Wei, Hui Lian; Huang, Juan; Zhou, Tie Jun; Chai, Li; Yang, Zhi-Hui

2016-04-01

rs12245, rs12587, rs9266, rs1137282, rs61764370, and rs712 of KRAS oncogene are characterized in the 3'UTR. The study highlights the important role of these polymorphisms playing in the susceptibility, oxaliplatin-based chemotherapy sensitivity, progression, and prognosis of CRC. Improved multiplex ligation detection reaction (iMLDR) technique is used for genotyping. An unconditional logistic regression model was used to estimate the association of certain polymorphism and CRC risk. The Kaplan-Meier method, log-rank test, and Cox regression model were used to evaluate the effects of polymorphisms on survival analysis. Results demonstrated that TT genotype and T allele of rs712 were associated with the increased risk of CRC; the patients with GG genotype and G allele of rs61764370 had a shorter survival and a higher risk of relapse or metastasis of CRC. Our studies supported the conclusions that rs61764370 and rs712 polymorphisms of the KRAS are functional and it may play an important role in the development of CRC and oxaliplatin-based chemotherapy efficiency and prognosis of CRC.

A Comparative Study of Survival Rate in High Grade Glioma Tumors Being Treated by Radiotherapy Alone Versus Chemoradiation With Nitrosourea.

Science.gov (United States)

Houshyari, Mohammad; Hajalikhani, Farzaneh; Rakhsha, Afshin; Hajian, Parastoo

2015-03-25

In adults, malignant glioma (high-grade glioma) is one of the most common brain tumors. In spite of different types of treatment, the outcome is still not likely to be favorable. The aim of this study was to determine the difference between survival rate in adult patients with high grade glioma treated by radiotherapy only and those treated by a combination of radiotherapy and nitrosurea-based chemotherapy. This study was conducted using the records of 48 patients with grade 3 or 4 of glial brain tumor referred to the radiation-oncology ward of Shohada-e-Tajrish Hospital in Tehran, Iran from 2005 to 2012. The patients had undergone radiotherapy alone or adjuvant chemoradiation with nitrosourea. The median survival of patients after receiving the different types of treatment were evaluated using the Kaplan-Meier method and the log -rank exam. Data were analyzed using univariate analysis for median survival regarding to the patients' age, gender, extent of surgery, Karnofsky performance status (KPS) with the Kaplan-Meier method, and the log-rank exam. We used the Cox-model for multivariate analysis. Records of 48 patients were studied (34 men and 14 women). The mean survival were 18 months for men and 15.2 months for women (P=0.05). Around 58% (28 patients) were more than 50 years old, and 42% (20 patients) were less than 50, and mean survival for the two age groups were 13 and 20 months, respectively (P<0.001). Then, the patients were divided into three groups according to the extent of surgery, i.e., excisional biopsy (11 patients), stereotactic biopsy (22 patients), and resection (15 patients), and the mean survival for the three groups were 14.7, 17.3, and 18.8 months, respectively. There was no significant statistical difference for mean survival between the three groups (P=0.23). The KPS was greater than 70% in 23 patients and less than 70% in 21 patients, and the mean survival for the former and latter groups were 17.6 and 16 months, respectively (P=0

Early Pancreatic Ductal Adenocarcinoma Survival Is Dependent on Size: Positive Implications for Future Targeted Screening.

Science.gov (United States)

Hur, Chin; Tramontano, Angela C; Dowling, Emily C; Brooks, Gabriel A; Jeon, Alvin; Brugge, William R; Gazelle, G Scott; Kong, Chung Yin; Pandharipande, Pari V

2016-08-01

Pancreatic ductal adenocarcinoma (PDAC) has not experienced a meaningful mortality improvement for the past few decades. Successful screening is difficult to accomplish because most PDACs present late in their natural history, and current interventions have not provided significant benefit. Our goal was to identify determinants of survival for early PDAC to help inform future screening strategies. Early PDACs from the National Cancer Institute's Surveillance, Epidemiology, and End Results Program database (2000-2010) were analyzed. We stratified by size and included carcinomas in situ (Tis). Overall cancer-specific survival was calculated. A Cox proportional hazards model was developed and the significance of key covariates for survival prediction was evaluated. A Kaplan-Meier plot demonstrated significant differences in survival by size at diagnosis; these survival benefits persisted after adjustment for key covariates in the Cox proportional hazards analysis. In addition, relatively weaker predictors of worse survival included older age, male sex, black race, nodal involvement, tumor location within the head of the pancreas, and no surgery or radiotherapy. For early PDAC, we found tumor size to be the strongest predictor of survival, even after adjustment for other patient characteristics. Our findings suggest that early PDAC detection can have clinical benefit, which has positive implications for future screening strategies.

Marital status and survival in patients with rectal cancer: An analysis of the Surveillance, Epidemiology and End Results (SEER) database.

Science.gov (United States)

Wang, Xiangyang; Cao, Weilan; Zheng, Chenguo; Hu, Wanle; Liu, Changbao

2018-06-01

Marital status has been validated as an independent prognostic factor for survival in several cancer types, but is controversial in rectal cancer (RC). The objective of this study was to investigate the impact of marital status on the survival outcomes of patients with RC. We extracted data of 27,498 eligible patients diagnosed with RC between 2004 and 2009 from the Surveillance, Epidemiology and End Results (SEER) database. Patients were categorized into married, never married, divorced/separated and widowed groups.We used Chi-square tests to compare characteristics of patients with different marital status.Rectal cancer specific survival was compared using the Kaplan-Meier method,and multivariate Cox regression analyses was used to analyze the survival outcome risk factors in different marital status. The widowed group had the highest percentage of elderly patients and women,higher proportion of adenocarcinomas, and more stage I/II in tumor stage (P married group (76.7% VS 85.4%). Compared with the married patients, the never married (HR 1.40), widowed (HR 1.61,) and divorced/separated patients (HR 1.16) had an increased overall 5-year mortality. A further analysis showed that widowed patients had an increased overall 5-year cause-specific survival(CSS) compared with married patients at stage I(HR 1.92),stage II (HR 1.65),stage III (HR 1.73),and stage IV (HR 1.38). Our study showed marriage was associated with better outcomes of RC patients, but unmarried RC patients, especially widowed patients,are at greater risk of cancer specific mortality. Copyright © 2018 Elsevier Ltd. All rights reserved.

3D Quantitative tumour burden analysis in patients with hepatocellular carcinoma before TACE: comparing single-lesion vs. multi-lesion imaging biomarkers as predictors of patient survival

International Nuclear Information System (INIS)

Fleckenstein, Florian N.; Schernthaner, Ruediger E.; Duran, Rafael; Sohn, Jae Ho; Sahu, Sonia; Zhao, Yan; Hamm, Bernd; Gebauer, Bernhard; Lin, MingDe; Geschwind, Jean-Francois; Chapiro, Julius

2016-01-01

To compare the ability of single- vs. multi-lesion assessment on baseline MRI using 1D- and 3D-based measurements to predict overall survival (OS) in patients with hepatocellular carcinoma (HCC) before transarterial chemoembolization (TACE). This retrospective analysis included 122 patients. A quantitative 3D analysis was performed on baseline MRI to calculate enhancing tumour volume (ETV [cm 3 ]) and enhancing tumour burden (ETB [%]) (ratio between ETV [cm 3 ] and liver volume). Furthermore, enhancing and overall tumour diameters were measured. Patients were stratified into two groups using thresholds derived from the BCLC staging system. Statistical analysis included Kaplan-Meier plots, uni- and multivariate cox proportional hazard ratios (HR) and concordances. All methods achieved good separation of the survival curves (p < 0.05). Multivariate analysis showed an HR of 5.2 (95 % CI 3.1-8.8, p < 0.001) for ETV [cm 3 ] and HR 6.6 (95 % CI 3.7-11.5, p < 0.001) for ETB [%] vs. HR 2.6 (95 % CI 1.2-5.6, p = 0.012) for overall diameter and HR 3.0 (95 % CI 1.5-6.3, p = 0.003) for enhancing diameter. Concordances were highest for ETB [%], with no added predictive power for multi-lesion assessment (difference between concordances not significant). 3D quantitative assessment is a stronger predictor of survival as compared to diameter-based measurements. Assessing multiple lesions provides no substantial improvement in predicting OS than evaluating the dominant lesion alone. (orig.)

Improved survival for rectal cancer compared to colon cancer: the four cohort study.

Science.gov (United States)

Buchwald, Pamela; Hall, Claire; Davidson, Callum; Dixon, Liane; Dobbs, Bruce; Robinson, Bridget; Frizelle, Frank

2018-03-01

Colorectal cancer (CRC) is the third most common cancer worldwide. This study was undertaken to evaluate survival outcomes and changes of disease outcomes of CRC patients over the last decades. A retrospective analysis of CRC patients in Christchurch was performed in four patient cohorts at 5 yearly intervals; 1993-94, 1998-99, 2004-05 and 2009. Data on cancer location, stage, surgical and oncological treatment and survival were collected. Univariate, multivariate and Kaplan-Meier survival analysis were performed. There were 1391 patients (355, 317, 419 and 300 per cohort), 1037 colon and 354 rectal cancers, respectively. For colon cancer, right-sided cancers appeared more common in later cohorts (P = 0.01). There was a significant decrease in the number of permanent stomas for colon cancer patients (P = 0.001). There was an analogous trend for rectal cancers (P = 0.075). More CRC patients with stage IV disease were treated surgically (P = 0.001) and colon cancer stages I and II tended to have increased survival if operated by a colorectal surgeon (P = 0.06). Oncology referrals have increased remarkably (P = 0.001). Overall 56% of patients were alive at 5 years however rectal cancer patients had significantly better 5-year survival than those with colon cancer (P rectal cancer patients have a better 5-year survival than colon cancer patients. The improved survival with early stage colon cancers operated on by specialist colorectal surgeons needs further exploration. © 2016 Royal Australasian College of Surgeons.

Epilepsy in Rett syndrome--lessons from the Rett networked database

DEFF Research Database (Denmark)

Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori

2015-01-01

collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...

Survival benefit of postoperative radiation in papillary meningioma: Analysis of the National Cancer Data Base.

Science.gov (United States)

Sumner, Whitney A; Amini, Arya; Hankinson, Todd C; Foreman, Nicholas K; Gaspar, Laurie E; Kavanagh, Brian D; Karam, Sana D; Rusthoven, Chad G; Liu, Arthur K

2017-01-01

Papillary meningioma represents a rare subset of World Health Organization (WHO) Grade III meningioma that portends an overall poor prognosis. There is relatively limited data regarding the benefit of postoperative radiation therapy (PORT). We used the National Cancer Data Base (NCDB) to compare overall survival (OS) outcomes of surgically resected papillary meningioma cases undergoing PORT compared to post-operative observation. The NCDB was queried for patients with papillary meningioma, diagnosed between 2004 and 2013, who underwent upfront surgery with or without PORT. Overall survival (OS) was determined using the Kaplan-Meier method. Univariate (UVA) and multivariate (MVA) analyses were performed. In total, 190 patients were identified; 89 patients underwent PORT, 101 patients were observed. Eleven patients received chemotherapy (6 with PORT, 5 without). 2-Year OS was significantly improved with PORT vs. no PORT (93.0% vs. 74.4%), as was 5-year OS (78.5% vs. 62.5%) (hazard ratio [HR], 0.48; 95% confidence interval [CI], 0.27-0.85; p  = 0.01). On MVA, patients receiving PORT had improved OS compared to observation (HR, 0.41; 95% CI, 0.22-0.76; p  = 0.005). On subset analysis by age group, the benefit of PORT vs. no PORT was significant in patients ≤18 years ( n  = 13), with 2-year OS of 85.7% vs. 50.0% (HR, 0.08; 95% CI, 0.01-0.80; p  = 0.032) and for patients >18 years ( n  = 184), with 2-year OS of 94.7% vs. 76.1% (HR, 0.55; 95% CI, 0.31-1.00; p  = 0.049), respectively. In this large contemporary analysis, PORT was associated with improved survival for both adult and pediatric patients with papillary meningioma. PORT should be considered in those who present with this rare, aggressive tumor.

Stereotactic Radiosurgery in the Management of Brain Metastases: An Institutional Retrospective Analysis of Survival

International Nuclear Information System (INIS)

Frazier, James L.; Batra, Sachin; Kapor, Sumit; Vellimana, Ananth; Gandhi, Rahul; Carson, Kathryn A.; Shokek, Ori; Lim, Michael; Kleinberg, Lawrence; Rigamonti, Daniele

2010-01-01

Purpose: The objective of this study was to report our experience with stereotactic radiosurgery performed with the Gamma Knife (GK) in the treatment of patients with brain metastases and to compare survival for those treated with radiosurgery alone with survival for those treated with radiosurgery and whole-brain radiotherapy. Methods and Materials: Prospectively collected demographic and clinical characteristics and treatment and survival data on 237 patients with intracranial metastases who underwent radiosurgery with the GK between 2003 and 2007 were reviewed. Kaplan-Meier and Cox proportional hazards regression analyses were used to compare survival by demographic and clinical characteristics and treatment. Results: The mean age of the patient population was 56 years. The most common tumor histologies were non-small-cell lung carcinoma (34.2%) and breast cancer (13.9%). The median overall survival time was 8.5 months from the time of treatment. The median survival times for patients with one, two/three, and four or more brain metastases were 8.5, 9.4, and 6.7 months, respectively. Patients aged 65 years or greater and those aged less than 65 years had median survival times of 7.8 and 9 months, respectively (p = 0.008). The Karnofsky Performance Score (KPS) at the time of treatment was a significant predictor of survival: those patients with a KPS of 70 or less had a median survival of 2.9 months compared with 10.3 months (p = 0.034) for those with a KPS of 80 or greater. There was no statistically significant difference in survival between patients treated with radiosurgery alone and those treated with radiosurgery plus whole-brain radiotherapy. Conclusions: Radiosurgery with the GK is an efficacious treatment modality for brain metastases. A KPS greater than 70, histology of breast cancer, smaller tumor volume, and age less than 65 years were associated with a longer median survival in our study.

Survival in the pre-senile dementia frontotemporal lobar degeneration with TDP-43 proteinopathy: effects of genetic, demographic and neuropathological variables

Directory of Open Access Journals (Sweden)

Richard A. Armstrong

2016-06-01

Full Text Available Factors associated with survival were studied in 84 neuropathologically documented cases of the pre-senile dementia frontotemporal dementia lobar degeneration (FTLD with transactive response (TAR DNA-binding protein of 43 kDa (TDP-43 proteinopathy (FTLD-TDP. Kaplan-Meier survival analysis estimated mean survival as 7.9 years (range: 1-19 years, SD = 4.64. Familial and sporadic cases exhibited similar survival, including progranulin (GRN gene mutation cases. No significant differences in survival were associated with sex, disease onset, Braak disease stage, or disease subtype, but higher survival was associated with lower post-mortem brain weight. Survival was significantly reduced in cases with associated motor neuron disease (FTLD-MND but increased with Alzheimer’s disease (AD or hippocampal sclerosis (HS co-morbidity. Cox regression analysis suggested that reduced survival was associated with increased densities of neuronal cytoplasmic inclusions (NCI while increased survival was associated with greater densities of enlarged neurons (EN in the frontal and temporal lobes. The data suggest that: (1 survival in FTLD-TDP is more prolonged than typical in pre-senile dementia but shorter than some clinical subtypes such as the semantic variant of primary progressive aphasia (svPPA, (2 MND co-morbidity predicts poor survival, and (3 NCI may develop early and EN later in the disease. The data have implications for both neuropathological characterization and subtyping of FTLD-TDP.

Modelos estimados de análisis de supervivencia para el tiempo de permanencia de los estudiantes de la Universidad Francisco de Paula Santander

OpenAIRE

Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón

2016-01-01

The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...

Applying Kaplan-Meier to Item Response Data

Science.gov (United States)

McNeish, Daniel

2018-01-01

Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…

Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine

Directory of Open Access Journals (Sweden)

Doina Frunzaverde

2011-01-01

Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.

Primary mediastinal large B-cell lymphoma: Clinical features, prognostic factors and survival with RCHOP in Arab patients in the PET scan era.

Science.gov (United States)

Al Shemmari, Salem; Sankaranarayanan, Sreedharan P; Krishnan, Yamini

2014-07-01

PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified.

Solitary plasmacytoma: population-based analysis of survival trends and effect of various treatment modalities in the USA.

Science.gov (United States)

Thumallapally, Nishitha; Meshref, Ahmed; Mousa, Mohammed; Terjanian, Terenig

2017-01-05

Solitary plasmacytoma (SP) is a localized neoplastic plasma cell disorder with an annual incidence of less than 450 cases. Given the rarity of this disorder, it is difficult to conduct large-scale population studies. Consequently, very limited information on the disorder is available, making it difficult to estimate the incidence and survival rates. Furthermore, limited information is available on the efficacy of various treatment modalities in relation to primary tumor sites. The data for this retrospective study were drawn from the Surveillance, Epidemiology and End Results (SEER) database, which comprises 18 registries; patient demographics, treatment modalities and survival rates were obtained for those diagnosed with SP from 1998 to 2007. Various prognostic factors were analyzed via Kaplan-Meier analysis and log-rank test, with 5-year relative survival rate defined as the primary outcome of interest. Cox regression analysis was employed in the multivariate analysis. The SEER search from 1998 to 2007 yielded records for 1691 SP patients. The median age at diagnosis was 63 years. The patient cohort was 62.4% male, 37.6% female, 80% Caucasian, 14.6% African American and 5.4% other races. Additionally, 57.8% had osseous plasmacytoma, and 31.9% had extraosseous involvement. Unspecified plasmacytoma was noted in 10.2% of patients. The most common treatment modalities were radiotherapy (RT) (48.8%), followed by combination surgery with RT (21.2%) and surgery alone (11.6%). Univariate analysis of prognostic factors revealed that the survival outcomes were better for younger male patients who received RT with surgery (p multiple myeloma (MM) was noted in 551 patients. Age >60 years was associated with a lower 5-year survival in patients who progressed to MM compared to those who were diagnosed initially with MM (15.1 vs 16.6%). Finally, those who received RT and progressed to MM still had a higher chance of survival than those who were diagnosed with MM initially and

Metformin Use and Endometrial Cancer Survival

Science.gov (United States)

Nevadunsky, Nicole S.; Van Arsdale, Anne; Strickler, Howard D.; Moadel, Alyson; Kaur, Gurpreet; Frimer, Marina; Conroy, Erin; Goldberg, Gary L.; Einstein, Mark H.

2013-01-01

Objective Impaired glucose tolerance and diabetes are risk factors for the development of uterine cancer. Although greater progression free survival among diabetic patients with ovarian and breast cancer using metformin have been reported, no studies have assessed the association of metformin use with survival in women with endometrial cancer (EC). Methods We conducted a single-institution retrospective cohort study of all patients treated for uterine cancer from January 1999 through December 2009. Demographic, medical, social, and survival data were abstracted from medical records and the national death registry. Overall survival (OS) was estimated using Kaplan-Meier methods. Cox models were utilized for multivariate analysis. All statistical tests were two-sided. Results Of 985 patients, 114 (12%) had diabetes and were treated with metformin, 136 (14%) were diabetic but did not use metformin, and 735 (74%) had not been diagnosed with diabetes. Greater OS was observed in diabetics with non-endometrioid EC who used metformin than in diabetic cases not using metformin and non-endometrioid EC cases without diabetes (log rank test (p=0.02)). This association remained significant (hazard ratio = 0.54, 95% CI: 0.30–0.97, p<0.04) after adjusting for age, clinical stage, grade, chemotherapy treatment, radiation treatment and presence of hyperlipidemia in multivariate analysis. No association between metformin use and OS in diabetics with endometrioid histology was observed. Conclusion Diabetic EC patients with non-endometrioid tumors who used metformin had lower risk of death than women with EC who did not use metformin. These data suggest that metformin might be useful as adjuvant therapy for non-endometrioid EC. PMID:24189334

Melanoma Patients with Unknown Primary Site or Nodal Recurrence after Initial Diagnosis Have a Favourable Survival Compared to Those with Synchronous Lymph Node Metastasis and Primary Tumour

OpenAIRE

Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus

2013-01-01

BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...

Delay of Treatment Initiation Does Not Adversely Affect Survival Outcome in Breast Cancer.

Science.gov (United States)

Yoo, Tae-Kyung; Han, Wonshik; Moon, Hyeong-Gon; Kim, Jisun; Lee, Jun Woo; Kim, Min Kyoon; Lee, Eunshin; Kim, Jongjin; Noh, Dong-Young

2016-07-01

Previous studies examining the relationship between time to treatment and survival outcome in breast cancer have shown inconsistent results. The aim of this study was to analyze the overall impact of delay of treatment initiation on patient survival and to determine whether certain subgroups require more prompt initiation of treatment. This study is a retrospective analysis of stage I-III patients who were treated in a single tertiary institution between 2005 and 2008. Kaplan-Meier survival analysis and Cox proportional hazards regression model were used to evaluate the impact of interval between diagnosis and treatment initiation in breast cancer and various subgroups. A total of 1,702 patients were included. Factors associated with longer delay of treatment initiation were diagnosis at another hospital, medical comorbidities, and procedures performed before admission for surgery. An interval between diagnosis and treatment initiation as a continuous variable or with a cutoff value of 15, 30, 45, and 60 days had no impact on disease-free survival (DFS). Subgroup analyses for hormone-responsiveness, triple-negative breast cancer, young age, clinical stage, and type of initial treatment showed no significant association between longer delay of treatment initiation and DFS. Our results show that an interval between diagnosis and treatment initiation of 60 days or shorter does not appear to adversely affect DFS in breast cancer.

The development of a new algorithm to calculate a survival function in non-parametric ways

International Nuclear Information System (INIS)

Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo

2001-01-01

In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory

Median Survival Time of Endometrial Cancer Patients with Lymphovascular Invasion at the Hospital Universiti Sains Malaysia.

Science.gov (United States)

Asyikeen, Wan Adnan Wan Nor; Siti-Azrin, Ab Hamid; Jalil, Nur Asyilla Che; Zin, Anani Aila Mat; Othman, Nor Hayati

2016-11-01

Endometrial cancer is the most common gynaecologic malignancy among females worldwide. The purpose of this study was to determine the median survival time of endometrial cancer patients at the Hospital Universiti Sains Malaysia (USM). A list of 121 endometrial cancer cases registered at Hospital USM between 2000 until 2011 was retrospectively reviewed. The survival time of the endometrial cancer patients was estimated by Kaplan-Meier survival analysis. Log-rank tests were performed to compare the survival of the patients based on socio-demographics and clinical presentation. Only 108 patients, 87.0%, were included who were of Malay ethnicity. Previous history included menopause in 67.6% of patients and diabetes mellitus in 39.8% of patients; additionally, 63.4% of patients were nulliparous. Tumour staging was as follows: 24.5% stage I, 10.8% stage II, 26.5% stage III and 38.2% stage IV. The overall median survival time of the endometrial cancer patients was 70.20 months (95% confidence interval (CI): 51.79, 88.61). The significant factors were age, the presence of lymphovascular invasion and treatment received. The overall survival of endometrial cancer was low. A prospective study needs to be carried out to discover more effective and accurate tests for the early detection of endometrial cancer.

Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

Science.gov (United States)

Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

2011-12-01

To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

OpenAIRE

Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

2009-01-01

Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...

One year Survival Rate of Ketac Molar versus Vitro Molar for Occlusoproximal ART Restorations: a RCT

Directory of Open Access Journals (Sweden)

PACHECO Anna Luisa de Brito

2017-11-01

Full Text Available Abstract Good survival rates for single-surface Atraumatic Restorative Treatment (ART restorations have been reported, while multi-surface ART restorations have not shown similar results. The aim of this study was to evaluate the survival rate of occluso-proximal ART restorations using two different filling materials: Ketac Molar EasyMix (3M ESPE and Vitro Molar (DFL. A total of 117 primary molars with occluso-proximal caries lesions were selected in 4 to 8 years old children in Barueri city, Brazil. Only one tooth was selected per child. The subjetcs were randomly allocated in two groups according to the filling material. All treatments were performed following the ART premises and all restorations were evaluated after 2, 6 and 12 months. Restoration survival was evaluated using Kaplan-Meier survival analysis and Log-rank test, while Cox regression analysis was used for testing association with clinical factors (α = 5%. There was no difference in survival rate between the materials tested, (HR = 1.60, CI = 0.98–2.62, p = 0.058. The overall survival rate of restorations was 42.74% and the survival rate per group was Ketac Molar = 50,8% and Vitro Molar G2 = 34.5%. Cox regression test showed no association between the analyzed clinical variables and the success of the restorations. After 12 months evaluation, no difference in the survival rate of ART occluso-proximal restorations was found between tested materials.

The Impact of Chemoembolization Endpoints on Survival in Hepatocellular Carcinoma Patients

Science.gov (United States)

Jin, Brian; Wang, Dingxin; Lewandowski, Robert J.; Riaz, Ahsun; Ryu, Robert K.; Sato, Kent T.; Larson, Andrew C.; Salem, Riad; Omary, Reed A.

2010-01-01

OBJECTIVE To investigate the relationship between angiographic embolic endpoints of transarterial chemoembolization (TACE) and survival in patients with hepatocellular carcinoma (HCC). MATERIALS AND METHODS This study retrospectively assessed 105 patients with surgically unresectable HCC who underwent TACE. Patients were classified according to a previously established subjective angiographic chemoembolization endpoint (SACE) scale. Only one patient was classified as SACE level 1 and thus excluded from all subsequent analysis. Survival was evaluated with Kaplan-Meier analysis. Multivariate analysis with Cox’s proportional hazard regression model was used to determine independent prognostic risk factors of survival. RESULTS Overall median survival was 21.1 months (95% confidence interval [CI], 15.9–26.4). Patients embolized to SACE levels 2 and 3 were aggregated and had a significantly higher median survival (25.6 months; 95% CI, 16.2–35.0) than patients embolized to SACE level 4 (17.1 months; 95% CI, 13.3–20.9) (p = 0.035). Multivariate analysis indicated that SACE level 4 (Hazard ratio [HR], 2.49; 95% CI, 1.41–4.42; p = 0.002), European Cooperative Oncology Group performance status > 0 (HR, 1.97; 95% CI, 1.15–3.37; p = 0.013), American Joint Committee on Cancer stage 3 or 4 (HR, 2.42; 95% CI, 1.27–4.60; p = 0.007), and Child-Pugh class B (HR, 1.94; 95% CI, 1.09–3.46; p = 0.025) were all independent negative prognostic indicators of survival. CONCLUSION Embolization to an intermediate, sub-stasis endpoint (SACE levels 2 and 3) during TACE improves survival compared to embolization to a higher, stasis endpoint (SACE level 4). Interventional oncologists should consider targeting these intermediate, sub-stasis angiographic endpoints during TACE. PMID:21427346

Preoperative Comorbidity Correlates Inversely with Survival after Intestinal and Multivisceral Transplantation in Adults

Directory of Open Access Journals (Sweden)

Rajesh Sivaprakasam

2013-01-01

Full Text Available We investigated the relationship between preoperative comorbidity and postoperative survival after intestinal transplantation. Each patient received a score for preoperative comorbidity. Each comorbidity was given a score based on the degree it impaired function (score range 0–3. A total score was derived from the summation of individual comorbidity scores. Patients (72 adults (M : F, 33 : 39 received an isolated intestinal graft (27 or a cluster graft (45. Mean (standard deviation survival was 1501 (1444 days. The Kaplan-Meier analysis revealed a significant inverse association between survival and comorbidity score (logrank test for trend, . Patients grouped into comorbidity scores of 0 and 1, 2 and 3, 4 and 5, 6, and above had hazard ratios (95% confidence intervals for death (compared to group 0 + 1, which increased with comorbidity scores: 1.945 (0.7622–5.816, 5.075 (3.314–36.17, and 13.77 (463.3–120100, respectively, (. Receiver-operator curves at 1, 3, 5, and 10 years postoperative had “C” statistics of 0.88, 0.85, 0.88, and 0.92, respectively. When evaluating patients for transplantation, the degree of comorbidity should be considered as a major factor influencing postoperative survival.

Treatment and survival outcomes of small cell carcinoma of the esophagus: an analysis of the National Cancer Data Base.

Science.gov (United States)

Wong, Andrew T; Shao, Meng; Rineer, Justin; Osborn, Virginia; Schwartz, David; Schreiber, David

2017-02-01

Given the paucity of esophageal small cell carcinoma (SCC) cases, there are few large studies evaluating this disease. In this study, the National Cancer Data Base (NCDB) was utilized to analyze the clinical features, treatment, and survival of patients with esophageal SCC in a large, population-based dataset. We selected patients diagnosed with esophageal SCC from 1998 to 2011. Patients were identified as having no treatment, chemotherapy alone, radiation ± sequential chemotherapy, concurrent chemoradiation, and esophagectomy ± chemotherapy and/or radiation. Overall survival (OS) was analyzed using the Kaplan-Meier method and compared using the log-rank test. Multivariate Cox regression analysis was conducted to identify factors associated with OS. A total of 583 patients were identified. Most patients had stage IV disease (41.7%). Regarding treatment selection, chemoradiation was the most commonly utilized for patients with nonmetasatic disease, whereas chemotherapy alone was most common for metastatic patients. Esophagectomy (median survival 44.9 months with 3 year OS 50.5%) was associated with the best OS for patients with localized (node-negative) disease compared with chemotherapy alone (p < 0.001) or chemoradiation (p = 0.01). For locoregional (node-positive) disease, treatment with chemoradiation resulted in a median survival of 17.8 months and a 3 year OS 31.6%. On multivariate analysis, treatment with chemotherapy alone (p = 0.003) was associated with worse OS while esophagectomy (p = 0.04) was associated with improved OS compared to chemoradiation. Esophageal SCC is an aggressive malignancy with most patients presenting with metastatic disease. Either esophagectomy or chemoradiation as part of multimodality treatment appear to improve OS for selected patients with nonmetastatic disease. © 2016 International Society for Diseases of the Esophagus.

[Comparative evaluation of survival prognosis using MELD or Child-Pugh scores in patients with liver cirrhosis in Chile].

Science.gov (United States)

Sanhueza, Edgar; Contreras, Jorge; Zapata, Rodrigo; Sanhueza, Matías; Elgueta, Fabián; López, Constanza; Jerez, Sigrid; Jerez, Verónica; Delgado, Iris

2017-01-01

Currently, most liver units use the Child-Pugh (CP) or the Model for End-Stage Liver Disease (MELD) scores to establish survival prognosis among patients with liver cirrhosis. Which classification is superior, is not well defined. To compare CP and MELD classification scores to predict survival among adult patients with liver cirrhosis in Chile. Follow-up of 137 consecutive adult patients with liver cirrhosis aged 59 ± 12 years (55% women). The diagnosis was reached by clinical, laboratory and image studies at three different centers of Santiago. Patients were staged with CP and MELD classification scores at baseline and followed over a period of 12 months. The predictive capacity of the scores for survival was analyzed using a multivariate statistical analysis (Kaplan-Meier curves). The most common etiology was alcohol (37.9%). The actuarial survival rate was 79.6% at 12 months of follow-up. When comparing groups with areas under curve of receiver operating characteristic curves (AUROC), there was no statistically significant difference in survival between less severe and advanced disease, assessed with both survival scales. The AUROC for MELD and CP were 0.80 and 0.81, respectively. This clinical study did not find a statistically significant difference between the two classifications for the prediction of 12 months survival in patients with cirrhosis.

Fifteen-Year Biochemical Relapse-Free Survival, Cause-Specific Survival, and Overall Survival Following I125 Prostate Brachytherapy in Clinically Localized Prostate Cancer: Seattle Experience

International Nuclear Information System (INIS)

Sylvester, John E.; Grimm, Peter D.; Wong, Jason; Galbreath, Robert W.; Merrick, Gregory; Blasko, John C.

2011-01-01

Purpose: To report 15-year biochemical relapse-free survival (BRFS), cause-specific survival (CSS), and overall survival (OS) outcomes of patients treated with I 125 brachytherapy monotherapy for clinically localized prostate cancer early in the Seattle experience. Methods and Materials: Two hundred fifteen patients with clinically localized prostate cancer were consecutively treated from 1988 to 1992 with I 125 monotherapy. They were prospectively followed as a tight cohort. They were evaluated for BRFS, CSS, and OS. Multivariate analysis was used to evaluate outcomes by pretreatment clinical prognostic factors. BRFS was analyzed by the Phoenix (nadir + 2 ng/mL) definition. CSS and OS were evaluated by chart review, death certificates, and referring physician follow-up notes. Gleason scoring was performed by general pathologists at a community hospital in Seattle. Time to biochemical failure (BF) was calculated and compared by Kaplan-Meier plots. Results: Fifteen-year BRFS for the entire cohort was 80.4%. BRFS by D'Amico risk group classification cohort analysis was 85.9%, 79.9%, and 62.2% for low, intermediate, and high-risk patients, respectively. Follow-up ranged from 3.6 to 18.4 years; median follow-up was 15.4 years for biochemically free of disease patients. Overall median follow-up was 11.7 years. The median time to BF in those who failed was 5.1 years. CSS was 84%. OS was 37.1%. Average age at time of treatment was 70 years. There was no significant difference in BRFS between low and intermediate risk groups. Conclusion: I 125 monotherapy results in excellent 15-year BRFS and CSS, especially when taking into account the era of treatment effect.

Number of Lymph Nodes Removed and Survival after Gastric Cancer Resection: An Analysis from the US Gastric Cancer Collaborative.

Science.gov (United States)

Gholami, Sepideh; Janson, Lucas; Worhunsky, David J; Tran, Thuy B; Squires, Malcolm Hart; Jin, Linda X; Spolverato, Gaya; Votanopoulos, Konstantinos I; Schmidt, Carl; Weber, Sharon M; Bloomston, Mark; Cho, Clifford S; Levine, Edward A; Fields, Ryan C; Pawlik, Timothy M; Maithel, Shishir K; Efron, Bradley; Norton, Jeffrey A; Poultsides, George A

2015-08-01

Examination of at least 16 lymph nodes (LNs) has been traditionally recommended during gastric adenocarcinoma resection to optimize staging, but the impact of this strategy on survival is uncertain. Because recent randomized trials have demonstrated a therapeutic benefit from extended lymphadenectomy, we sought to investigate the impact of the number of LNs removed on prognosis after gastric adenocarcinoma resection. We analyzed patients who underwent gastrectomy for gastric adenocarcinoma from 2000 to 2012, at 7 US academic institutions. Patients with M1 disease or R2 resections were excluded. Disease-specific survival (DSS) was calculated using the Kaplan-Meier method and compared using log-rank and Cox regression analyses. Of 742 patients, 257 (35%) had 7 to 15 LNs removed and 485 (65%) had ≥16 LNs removed. Disease-specific survival was not significantly longer after removal of ≥16 vs 7 to 15 LNs (10-year survival, 55% vs 47%, respectively; p = 0.53) for the entire cohort, but was significantly improved in the subset of patients with stage IA to IIIA (10-year survival, 74% vs 57%, respectively; p = 0.018) or N0-2 disease (72% vs 55%, respectively; p = 0.023). Similarly, for patients who were classified to more likely be "true N0-2," based on frequentist analysis incorporating both the number of positive and of total LNs removed, the hazard ratio for disease-related death (adjusted for T stage, R status, grade, receipt of neoadjuvant and adjuvant therapy, and institution) significantly decreased as the number of LNs removed increased. The number of LNs removed during gastrectomy for adenocarcinoma appears itself to have prognostic implications for long-term survival. Copyright © 2015 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Science.gov (United States)

Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

2017-01-01

Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Directory of Open Access Journals (Sweden)

Sang Y Lee

Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

Prognostic value of MLH1 promoter methylation in male patients with esophageal squamous cell carcinoma.

Science.gov (United States)

Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei

2017-04-01

The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.

RELATIONSHIP BETWEEN THE PROANGIOGENIC ROLE OF EG-VEGF, CLINICOPATHOLOGICAL CHARACTERISTICS AND SURVIVAL IN TUMORAL OVARY.

Science.gov (United States)

Lozneanu, Ludmila; Avădănei, Roxana; Cîmpean, Anca Maria; Giuşcă, Simona Eliza; Amălinei, Cornelia; Căruntu, Irina-Draga

2015-01-01

To prove the presence of EG-VEGF in tumor ovary and to analyze its involvement in the ovarian carcinogenesis, as promoter of angiogenesis, in relationship with the clinicopathological prognostic factors and survival. The study group comprises tumor tissue specimens from 50 cases of surgically treated ovarian cancer that were immunohistochemically investigated. A scoring system based on the percentage of positive cells and the intensity of staining was applied for the semiquantitative assessment of EG-VEGF, as negative or positive. Statistics involved χ2 test, and Kaplan-Meier and log-rank test. EG-VEGF was positive in 35 cases (70%) and negative in 15 cases (30%). Our data confirmed the predominance of EG-VEGF positivity in the serous subiype as compared to endometrioid and clear cell subtypes, and its absence in mucinous subtype. Moreover, we demonstrated that EG-VEGF is overexpressed mainly in high-grade ovarian carcinomas (type II) than in low-grade ones. Significant differences were registered between the EG-VEGF positive or negative expression and tumor stage and histological subtypes, respectively. Survival analysis showed no differences in patient's survival and EG-VEGF positive and negative cases. The analysis of EG-VEGF expression in ovarian tumors points out the relationship between the enhanced potential for tumor angiogenesis and the tumor aggressivity.

Analyzing survival curves at a fixed point in time for paired and clustered right-censored data

Science.gov (United States)

Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De

2018-01-01

In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280

A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines

Science.gov (United States)

Pennacchi, P.; Borghesani, P.; Chatterton, S.

2015-08-01

Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.

The Poor Survival among Pulmonary Tuberculosis Patients in Chiapas, Mexico: The Case of Los Altos Region

Science.gov (United States)

Nájera-Ortiz, J. C.; Sánchez-Pérez, H. J.; Ochoa-Díaz-López, H.; Leal-Fernández, G.; Navarro-Giné, A.

2012-01-01

Objective. To analyse survival in patients with pulmonary tuberculosis (PTB) and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years) and treatment duration (under six months) were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years. PMID:22701170

The Poor Survival among Pulmonary Tuberculosis Patients in Chiapas, Mexico: The Case of Los Altos Region

Directory of Open Access Journals (Sweden)

J. C. Nájera-Ortiz

2012-01-01

Full Text Available Objective. To analyse survival in patients with pulmonary tuberculosis (PTB and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years and treatment duration (under six months were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years.

Biochemical Control With Radiotherapy Improves Overall Survival in Intermediate and High-Risk Prostate Cancer Patients Who Have an Estimated 10-Year Overall Survival of >90%

International Nuclear Information System (INIS)

Herbert, Christopher; Liu, Mitchell; Tyldesley, Scott; Morris, W. James; Joffres, Michel; Khaira, Mandip; Kwan, Winkle; Moiseenko, Vitali; Pickles, Thomas

2012-01-01

Purpose: To identify subgroups of patients with carcinoma of the prostate treated with radical radiotherapy that have improved overall survival when disease is biochemically controlled. Methods and Materials: A cohort of 1,060 prostate cancer patients treated with radical radiotherapy was divided into nine subgroups based on National Comprehensive Cancer Network risk category and estimated 10-year overall survival (eOS 10y) derived from the age adjusted Charlson Comorbidity Index. Patients with and without biochemical control were compared with respect to overall survival. Actuarial estimates of overall survival were calculated using the Kaplan-Meier method. Univariate and multivariate Cox proportional hazards models were used for analysis of overall survival. Results: Median follow-up was 125 months (range, 51–176 months). Only the subgroups with high or intermediate risk disease and an eOS 10y of >90% had a statistically significantly improved overall survival when prostate cancer was biochemically controlled. In all other groups, biochemical control made no significant difference to overall survival. In the subgroup with high-risk disease and eOS 10y >90%, actuarial overall survival was 86.3% (95% confidence interval [CI] 78.5%–94.1%) and 62.1% (95% CI 52.9%–71.3%) for patients with biochemical control and biochemical relapse respectively (p = 0.002). In the intermediate risk group with eOS >90%, actuarial overall survival was 95.3% (95% CI 89.0%–100%) and 79.8% (95% CI 68.0%–91.6%) for biochemically controlled and biochemically relapsed patients (p = 0.033). On multivariate analysis, National Comprehensive Cancer Network risk group (p = 0.005), biochemical control (p = 0.033) and eOS 10y (p 90%.

Water hammer 2 phase analysis hydraulic system with a Kaplan turbine

OpenAIRE

Dudlik, A.; Koutnik, J.

2009-01-01

This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...

Application of the BAR score as a predictor of short- and long-term survival in liver transplantation patients.

Science.gov (United States)

de Campos Junior, Ivan Dias; Stucchi, Raquel Silveira Bello; Udo, Elisabete Yoko; Boin, Ilka de Fátima Santana Ferreira

2015-01-01

The balance of risk (BAR) is a prediction system after liver transplantation. To assess the BAR system, a retrospective observational study was performed in 402 patients who had transplant surgery between 1997 and 2012. The BAR score was computed for each patient. Receiver operating characteristic curve analysis with the Hosmer-Lemeshow test was used to calculate sensitivity, specificity, and model calibration. The cutoff value with the best Youden index was selected. Statistical analysis employed the Kaplan-Meier method (log-rank test) for survival, the Mann-Whitney test for group comparison, and multiple logistic regression analysis. 3-month survival was 46% for BAR ≥ 11 and 77% for BAR BAR ≥ 11 and 69% for BAR BAR ≥ 11 [odds ratio (OR) 3.08; 95% confidence interval (CI) 1.75-5.42; p = 0.001] and intrasurgical use of packed red blood cells (RBC) above 6 units (OR 4.49; 95% CI 2.73-7.39; p = 0.001). For survival BAR ≥ 11 (OR 2.94; 95% CI 1.67-5.16; p = 0.001) and RBC >6 units (OR 2.99; 95% CI 1.92-4.64; p = 0.001). Our study contributes to the incorporation of the BAR system into Brazilian transplantation centers.

Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

Science.gov (United States)

Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

2011-03-28

The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis

DEFF Research Database (Denmark)

Egeberg, Alexander; Skov, Lone; Zachariae, Claus

2018-01-01

It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....

Prognostic significance of hemoglobin level in patients with congestive heart failure and normal ejection fraction.

Science.gov (United States)

Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G

2006-10-01

Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.

[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].

Science.gov (United States)

Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing

2016-02-01

To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.

Analysis of the Kaplan turbine draft tube effect

International Nuclear Information System (INIS)

Motycak, L; Skotak, A; Obrovsky, J

2010-01-01

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Analysis of the Kaplan turbine draft tube effect

Energy Technology Data Exchange (ETDEWEB)

Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)

2010-08-15

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Analysis of the Kaplan turbine draft tube effect

Science.gov (United States)

Motycak, L.; Skotak, A.; Obrovsky, J.

2010-08-01

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Dedifferentiated chondrosarcoma: A survival analysis of 159 cases from the SEER database (2001-2011).

Science.gov (United States)

Strotman, Patrick K; Reif, Taylor J; Kliethermes, Stephanie A; Sandhu, Jasmin K; Nystrom, Lukas M

2017-08-01

Dedifferentiated chondrosarcoma is a rare malignancy with reported 5-year overall survival rates ranging from 7% to 24%. The purpose of this investigation is to determine the overall survival of dedifferentiated chondrosarcoma in a modern patient series and how it is impacted by patient demographics, tumor characteristics, and surgical treatment factors. This is a retrospective review of the Surveillance, Epidemiology, and End Results (SEER) database from 2001 to 2011. Kaplan Meier analyses were used for overall and disease-specific survival. Univariable and multivariable cox regression models were used to identify prognostic factors. Five year overall- and disease-specific survival was 18% (95% CI: 12-26%) and 28% (95% CI: 18-37%), respectively. Individuals with extremity tumors had a worse prognosis than individuals with a primary tumor in the chest wall or axial skeleton (HR 0.20, 95% CI: 0.07-0.56; P = 0.002 and HR 0.60, 95% CI: 0.36-0.99; P = 0.04, respectively). Patients with AJCC stage III or IV disease (HR 2.51, 95% CI: 1.50-4.20; P = 0.001), tumors larger than 8 cm (HR 2.17, 95% CI: 1.11-4.27; P = 0.046), metastatic disease at diagnosis (HR 3.25, 95% CI: 1.98-5.33; P chondrosarcoma is poor with a 5-year overall survival of 18%. Patients with a primary tumor located in the chest wall had a better prognosis. Tumors larger than 8 cm, presence of metastases at diagnosis, and treatment without surgical resection were significant predictors of mortality. © 2017 Wiley Periodicals, Inc.

Impact of housing on the survival of persons with AIDS

Directory of Open Access Journals (Sweden)

Vittinghoff Eric

2009-07-01

Full Text Available Abstract Background Homeless persons with HIV/AIDS have greater morbidity and mortality, more hospitalizations, less use of antiretroviral therapy, and worse medication adherence than HIV-infected persons who are stably housed. We examined the effect of homelessness on the mortality of persons with AIDS and measured the effect of supportive housing on AIDS survival. Methods The San Francisco AIDS registry was used to identify homeless and housed persons who were diagnosed with AIDS between 1996 and 2006. The registry was computer-matched with a housing database of homeless persons who received housing after their AIDS diagnosis. The Kaplan-Meier product limit method was used to compare survival between persons who were homeless at AIDS diagnosis and those who were housed. Proportional hazards models were used to estimate the independent effects of homelessness and supportive housing on survival after AIDS diagnosis. Results Of the 6,558 AIDS cases, 9.8% were homeless at diagnosis. Sixty-seven percent of the persons who were homeless survived five years compared with 81% of those who were housed (p Conclusion Supportive housing ameliorates the negative effect of homelessness on survival with AIDS.

Meier-Gorlin syndrome

NARCIS (Netherlands)

Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

ROCK I Has More Accurate Prognostic Value than MET in Predicting Patient Survival in Colorectal Cancer.

Science.gov (United States)

Li, Jian; Bharadwaj, Shruthi S; Guzman, Grace; Vishnubhotla, Ramana; Glover, Sarah C

2015-06-01

Colorectal cancer remains the second leading cause of death in the United States despite improvements in incidence rates and advancements in screening. The present study evaluated the prognostic value of two tumor markers, MET and ROCK I, which have been noted in other cancers to provide more accurate prognoses of patient outcomes than tumor staging alone. We constructed a tissue microarray from surgical specimens of adenocarcinomas from 108 colorectal cancer patients. Using immunohistochemistry, we examined the expression levels of tumor markers MET and ROCK I, with a pathologist blinded to patient identities and clinical outcomes providing the scoring of MET and ROCK I expression. We then used retrospective analysis of patients' survival data to provide correlations with expression levels of MET and ROCK I. Both MET and ROCK I were significantly over-expressed in colorectal cancer tissues, relative to the unaffected adjacent mucosa. Kaplan-Meier survival analysis revealed that patients' 5-year survival was inversely correlated with levels of expression of ROCK I. In contrast, MET was less strongly correlated with five-year survival. ROCK I provides better efficacy in predicting patient outcomes, compared to either tumor staging or MET expression. As a result, ROCK I may provide a less invasive method of assessing patient prognoses and directing therapeutic interventions. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

The prognostic value of the suPARnosticTM ELISA assay in HIV-1 infected individuals is not affected by uPAR promoter polymorphisms

DEFF Research Database (Denmark)

Schneider, Uffe; Nielsen, Rikke; Pedersen, Court

2007-01-01

. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...

Lung cancer: Incidence and survival in Rabat, Morocco.

Science.gov (United States)

Lachgar, A; Tazi, M A; Afif, M; Er-Raki, A; Kebdani, T; Benjaafar, N

2016-12-01

Lung cancer is the most common cancer worldwide, but epidemiologic data from developing countries are lacking. This article reports lung cancer incidence and survival in Rabat, the capital of Morocco. All lung cancer cases diagnosed between 2005 and 2008 were analyzed using data provided by the Rabat Cancer Registry. The standardized rate was reported using age adjustment with respect to the world standard population, and the observed survival rates were calculated using the Kaplan-Meier method. Three hundred fifty-one cases were registered (314 males and 37 females), aged 27-90 years (median, 59 years). The most common pathological type was adenocarcinoma (40.2%) followed by squamous cell carcinoma (31.9%); the majority of cases were diagnosed at stage IV (52%). The age-standardized incidence rate was 25.1 and 2.7 per 100,000 for males and females, respectively, and the overall observed survival rates at 1 and 5 years were 31.7% and 3.4%, respectively. The clinical stage of disease was the only independent predictor of survival. The survival rate of lung cancer in Rabat is very poor. This finding explains the need for measures to reduce the prevalence of tobacco and to improve diagnostic and therapeutic facilities for lung cancer. Copyright © 2016. Published by Elsevier Masson SAS.

Marital Status and Survival in Patients with Carcinoid Tumors.

Science.gov (United States)

Greenleaf, Erin K; Cooper, Amanda B; Hollenbeak, Christopher S

2016-01-01

Marital status is a known prognostic factor in overall and disease-specific survival in several types of cancer. The impact of marital status on survival in patients with carcinoid tumors remains unknown. We hypothesized that married patients have higher rates of survival than similar unmarried patients with carcinoid tumors. Using the Surveillance, Epidemiology, and End Results database, we identified 23,126 people diagnosed with a carcinoid tumor between 2000 and 2011 and stratified them according to marital status. Univariate and multivariable analyses were performed to compare the characteristics and outcomes between patient cohorts. Overall and cancer-related survival were analyzed using the Kaplan-Meier method. Multivariable survival analyses were performed using Cox proportional hazards models (hazards ratio [HR]), controlling for demographics and tumor-related and treatment-related variables. Propensity score analysis was performed to determine surgical intervention distributions among married and unmarried (ie, single, separated, divorced, widowed) patients. Marital status was significantly related to both overall and cancer-related survival in patients with carcinoid tumors. Divorced and widowed patients had worse overall survival (HR, 1.33 [95% confidence interval {CI}, 1.08-1.33] and 1.34 [95% CI, 1.22-1.46], respectively) and cancer-related survival (HR, 1.15 [95% CI, 1.00-1.31] and 1.15 [95% CI, 1.03-1.29], respectively) than married patients over five years. Single and separated patients had worse overall survival (HR, 1.20 [95% CI, 1.08-1.33] and 1.62 [95% CI, 1.25-2.11], respectively) than married patients over five years, but not worse cancer-related survival. Unmarried patients were more likely than matched married patients to undergo definitive surgical intervention (62.67% vs 53.11%, respectively, P married patients have a survival advantage after diagnosis of any carcinoid tumor, potentially reflecting better social support and financial means

Cancer survival among Alaska Native people.

Science.gov (United States)

Nash, Sarah H; Meisner, Angela L W; Zimpelman, Garrett L; Barry, Marc; Wiggins, Charles L

2018-03-26

Recent cancer survival trends among American Indian and Alaska Native (AN) people are not well understood; survival has not been reported among AN people since 2001. This study examined cause-specific survival among AN cancer patients for lung, colorectal, female breast, prostate, and kidney cancers. It evaluated whether survival differed between cancers diagnosed in 1992-2002 (the earlier period) and cancers diagnosed in 2003-2013 (the later period) and by the age at diagnosis (<65 vs ≥65 years), stage at diagnosis (local or regional/distant/unknown), and sex. Kaplan-Meier and Cox proportional hazards models were used to estimate univariate and multivariate-adjusted cause-specific survival for each cancer. An improvement was observed in 5-year survival over time from lung cancer (hazard ratio [HR] for the later period vs the earlier period, 0.83; 95% confidence interval [CI], 0.72-0.97), and a marginally nonsignificant improvement was observed for colorectal cancer (HR, 0.81; 95% CI, 0.66-1.01). Site-specific differences in survival were observed by age and stage at diagnosis. This study presents the first data on cancer survival among AN people in almost 2 decades. During this time, AN people have experienced improvements in survival from lung and colorectal cancers. The reasons for these improvements may include increased access to care (including screening) as well as improvements in treatment. Improving cancer survival should be a priority for reducing the burden of cancer among AN people and eliminating cancer disparities. Cancer 2018. © 2018 American Cancer Society. © 2018 American Cancer Society.

Left ventricular dyssynchrony assessed by gated SPECT phase analysis is an independent predictor of death in patients with advanced coronary artery disease and reduced left ventricular function not undergoing cardiac resynchronization therapy

Energy Technology Data Exchange (ETDEWEB)

Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)

2012-10-15

Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)

Invasive micropapillary carcinoma of the breast has a better long-term survival than invasive ductal carcinoma of the breast in spite of its aggressive clinical presentations: a comparison based on large population database and case-control analysis.

Science.gov (United States)

Chen, Hongliang; Wu, Kejin; Wang, Maoli; Wang, Fuwen; Zhang, Mingdi; Zhang, Peng

2017-12-01

There are controversies in the comparison of overall survival between invasive micropapillary carcinoma of the breast (IMPC) and invasive ductal carcinoma (IDC). The objective of this study was to compare the long-term survival outcome between non-metastatic IMPC and IDC. The Surveillance, Epidemiology, and End Results database was searched to identify women with non-metastatic IMPC and IDC diagnosed between 2001 and 2013. Comparisons of patient and tumor characteristics were performed using Pearson's chi-square. The propensity score matching method was applied with each IMPC matched to one IDC. Breast cancer-specific survival (BCSS) and overall survival (OS) were estimated using the Kaplan-Meier product limit method and compared across groups using the log-rank statistic. Multivariate analysis was performed through Cox models. IMPC was presented with aggressive clinical presentations such as larger tumor, more positive lymph nodes, and more advanced stage compared with IDC. A higher rate of estrogen receptor (ER)/progesterone receptor (PR) positivity was also observed in IMPC. With a median follow-up of 64 months, IMPC had a better BCSS (P = 0.031) and OS (P = 0.012) compared with IDC. In a case-control analysis IMPC was still an independent favorable prognostic factor for BCSS (HR = 0.410, P analysis, IMPC always showed a better survival outcome compared with IDC except in AJCC stage I and histologic grade I disease. IMPC has a better long-term survival outcome compared with IDC in spite of its highly aggressive clinical presentation. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Application of the standard lymphadenectomy in gastric adenocarcinoma

International Nuclear Information System (INIS)

Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro

2011-01-01

The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined

A genetic polymorphism in TOX3 is associated with survival of gastric cancer in a Chinese population.

Directory of Open Access Journals (Sweden)

Xiaojing Zhang

Full Text Available PURPOSE: Recently, genetic polymorphism (rs3803662C>T in TOX3 was reported to induce the risk of breast cancer. In this study, we hypothesized that rs3803662 could influence gastric cancer survival outcomes. METHODS: With multiplex SNaPshot method, we genotyped TOX3 rs3803662 in 880 gastric patients with surgical resection. The association between genotype and survival outcomes was performed by the Kaplan-Meier method, Cox regression analysis models and the log-rank test. RESULTS: There was no association in the analyses of rs3803662 and survival of gastric cancer. However, the stratified analysis by histology showed that rs3803662 CT/TT genotype was associated with a significantly better survival for diffuse-type gastric cancer (log-rank p = 0.030, hazard ratio [HR]  = 0.67, 95% confidence interval [CI]  = 0.46-0.96, than the CC genotype. In addition, this favorable effect was especially obvious among gastric cancer patients with tumor size >5 cm, T3 and T4 depth of invasion, lymph node metastasis, no drinking, no distant metastasis, no chemotherapy and gastric cardia cancer. CONCLUSIONS: TOX3 rs3803662 might play an important role in the prognostic outcome and treatment of gastric cancer, especially perhaps further help in explaining the reduced risk of death associated with diffuse-type gastric cancer.

High SHIP2 Expression Indicates Poor Survival in Colorectal Cancer

Directory of Open Access Journals (Sweden)

Ju Yang

2014-01-01

Full Text Available SH2-containing inositol 5′-phosphatase 2 (SHIP2, which generally regulates insulin signaling, cytoskeleton remodeling, and receptor endocytosis, has been suggested to play a significant role in tumor development and progression. However, the associations between SHIP2 expression and the clinical features to evaluate its clinicopathologic significance in colorectal cancer (CRC have not been determined yet. In the present study, one-step quantitative real-time polymerase chain reaction (qPCR test and immunohistochemistry (IHC analysis with CRC tissue microarrays (TMA were employed to evaluate the mRNA and protein expression of SHIP2 in CRC. The results showed that SHIP2 expression in the mRNA and protein levels was significantly higher in CRC tissues than that in corresponding noncancerous tissues (both P<0.05. The expression of SHIP2 protein in CRC was related to lymph node metastasis (P=0.036, distant metastasis (P=0.001, and overall survival (P=0.009. Kaplan-Meier method and Cox multifactor analysis suggested that high SHIP2 protein level (P=0.040 and positive distant metastasis (P=0.048 were critically associated with the unfavorable survival of CRC patients. The findings suggested that SHIP2 may be identified as a useful prognostic marker in CRC and targeting CRC may provide novel strategy for CRC treatment.

Prognostic impact of marital status on survival of women with epithelial ovarian cancer.

Science.gov (United States)

Mahdi, Haider; Kumar, Sanjeev; Munkarah, Adnan R; Abdalamir, Moshrik; Doherty, Mark; Swensen, Ron

2013-01-01

The objective of this study is to examine the impact of marital status on survival of patients with epithelial ovarian cancer (EOC). Patients with a diagnosis of EOC were identified from the Surveillance, Epidemiology, and End Results Program for the period 1988-2006 and divided into married and unmarried groups. Statistical analysis using Student's t-test, Kaplan-Meier, and Cox regression proportional hazards was performed. In 49,777 patients with EOC, 51.2% were married and 48.8% were unmarried. White women were likely to be married compared with African Americans (52.0% vs 32.4%, p vs 43.4%, p vs 33.8%, p married patients compared with unmarried patients. Staging lymphadenectomy was performed more frequently in married than unmarried patients (39.9% vs 29.8%, p married patients and 33.1% for unmarried patients, p Married patients had a better survival compared with unmarried patients within each racial subgroup: 44.5% vs 33.3% for White women (p vs 24.9% for African Americans (p vs 42.7% for others (p married patients had a significantly improved survival compared with unmarried patients (HR 0.8, 95% CI 0.78-0.83, p < 0.001). In this epidemiologic study, the social institution of marriage is associated with improved survival in women with ovarian cancer. Copyright © 2011 John Wiley & Sons, Ltd.

Tanacetum parthenium leaf extract mediated survival protection in lethally irradiated Swiss albino mice

International Nuclear Information System (INIS)

Shetty, Prashanth; Pooja, S.; Suchetha Kumari, N.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.

2016-01-01

Search for less-toxic radioprotectors has spurred interest in the development of natural products. In Ayurveda, the traditional medicine, Tanacetum species have been used to treat ailments since ancient times throughout the world. Effects of the administration of different concentrations of Tanacetum parthenium leaf aqueous extract (TPLA), Tanacetum parthenium leaf ethanolic extract (TPLE) were investigated in Swiss albino mice. Mice (20-25 g) were randomly divided into 8 groups of ten animals each. The control group and the radiation group were treated daily with oral administration of saline for 15 days. Each subgroups of TPLA and TPLE were treated with doses of 50, 100 and 250 mg/kg daily for 15 days. On the 15th day, all were irradiated with 10 Gy whole body irradiation. Survival was observed daily up to 30th post-irradiation day. Data were analysed using the Kaplan-Meier survival curves. The significance difference in survival between control, radiation and treatment groups were observed (P < 0.001). Current studies revealed the protective effect of Tanacetum parthenium rendering high survivability in lethally irradiated mice. (author)

Marital status and survival of patients with oral cavity squamous cell carcinoma: a population-based study.

Science.gov (United States)

Shi, Xiao; Zhang, Ting-Ting; Hu, Wei-Ping; Ji, Qing-Hai

2017-04-25

The relationship between marital status and oral cavity squamous cell carcinoma (OCSCC) survival has not been explored. The objective of our study was to evaluate the impact of marital status on OCSCC survival and investigate the potential mechanisms. Married patients had better 5-year cancer-specific survival (CSS) (66.7% vs 54.9%) and 5-year overall survival (OS) (56.0% vs 41.1%). In multivariate Cox regression models, unmarried patients also showed higher mortality risk for both CSS (Hazard Ratio [HR]: 1.260, 95% confidence interval (CI): 1.187-1.339, P married patients were more likely to be diagnosed at earlier stage (P Married patients still demonstrated better prognosis in the 1:1 matched group analysis (CSS: 62.9% vs 60.8%, OS: 52.3% vs 46.5%). 11022 eligible OCSCC patients were identified from Surveillance, Epidemiology, and End Results (SEER) database, including 5902 married and 5120 unmarried individuals. Kaplan-Meier analysis, Log-rank test and Cox proportional hazards regression model were used to analyze survival and mortality risk. Influence of marital status on stage, age at diagnosis and selection of treatment was determined by binomial and multinomial logistic regression. Propensity score matching method was adopted to perform a 1:1 matched cohort. Marriage has an independently protective effect on OCSCC survival. Earlier diagnosis and more sufficient treatment are possible explanations. Besides, even after 1:1 matching, survival advantage of married group still exists, indicating that spousal support from other aspects may also play an important role.

Retrospective analysis of dental implants placed and restored by advanced prosthodontic residents.

Science.gov (United States)

Barias, Pamela A; Lee, Damian J; Yuan, Judy Chia-Chun; Sukotjo, Cortino; Campbell, Stephen D; Knoernschild, Kent L

2013-02-01

The purposes of this retrospective clinical review were to: (1) describe the demographics of implant patients, types of implant treatment and implant-supported prostheses in an Advanced Education in Prosthodontic Program, (2) evaluate the survival rate of dental implants placed by prosthodontic residents from 2006 to 2008, and (3) analyze the relationship between resident year of training and implant survival rate. All patients who received dental implants placed by prosthodontic residents from January 2006 to October of 2008 in the Advanced Prosthodontic Program at the University of Illinois at Chicago College of Dentistry were selected for this study. Age, gender, implant diameter, length, implant locations, surgical and restorative detail, and year of prosthodontic residency training were collected and analyzed. Life-table and Kaplan-Meier survival analyses were performed based on implants overall, locations, year of training, and use of a computer-generated surgical guide. A Logrank statistic was performed between implant survival and year of prosthodontic residency training, location, and use of computer-generated surgical guide (α= 0.05). Three hundred and six implants were placed, and of these, seven failed. Life-table and Kaplan-Meier analyses computed a cumulative survival rate (CSR) of 97% for overall implants and implants placed with a computer-generated surgical guide. No statistical difference was found in implant survival rates as a function of year of training (P= 0.85). Dental implants placed by prosthodontic residents had a CSR comparable to previously published studies by other specialties. The year of prosthodontic residency training and implant failure rate did not have any significant relationship. © 2012 by the American College of Prosthodontists.

Parathyroid carcinoma survival: improvements in the era of intact parathyroid hormone monitoring?

Directory of Open Access Journals (Sweden)

Steve R. Martinez

2013-02-01

Full Text Available The intact parathyroid hormone (iPTH assay is a critical test in the diagnosis and management of PTH-mediated hypercalcemia, including parathyroid carcinoma (PCa. We hypothesized that the survival of patients diagnosed with PCa has improved since adoption of the iPTH assay into clinical practice. We identified all confirmed cases of PCa within the Surveillance, Epidemiology and End Results database from 1973 to 2006. Patients were categorized into two eras based upon introduction of the iPTH assay: 1973 to 1997 (era I and 1997 to 2006 (era II, when the iPTH assay was in standard use. We estimated overall survival (OS and disease-specific survival (DSS using the Kaplan-Meier method, with differences among survival curves assessed via log rank. Multivariate Cox proportional hazards models compared the survival rates between treatment eras while controlling for patient age, sex, race/ethnicity, tumor size, nodal status, extent of disease, and type of surgery. Multivariate models included patients undergoing potentially curative surgery and excluded those with dis- tant metastases. Risks of overall and disease-specific mortality were reported as hazard ratios with 95% confidence intervals. Study criteria were met by 370 patients. Median survival was 15.6 years. Five-year rates of OS and DSS were 78% and 88% for era I and 82% and 96% for era II. On multivariate analysis, age, black race, and unknown extent of disease predicted an increased risk of death from any cause. Treatment era did not predict OS. No factor predicted PCa-specific mortality. In multivariate analysis, neither OS nor DSS have improved in the current era that utilizes iPTH for the detection and management of PCa.

Predictors of survival in surgically treated patients of spinal metastasis

Directory of Open Access Journals (Sweden)

Pravin Padalkar

2011-01-01

Full Text Available Background: The spinal metastasis occurs in up to 40% of cancer patient. We compared the Tokuhashi and Tomita scoring systems, two commonly used scoring systems for prognosis in spinal metastases. We also assessed the different variables separately with respect to their value in predicting postsurgical life expectancy. Finally, we suggest criteria for selecting patients for surgery based on the postoperative survival pattern. Materials and Methods: We retrospectively analyzed 102 patients who had been operated for metastatic disease of the spine. Predictive scoring was done according to the scoring systems proposed by Tokuhashi and Tomita. Overall survival was assessed using Kaplan-Meier survival analysis. Using the log rank test and Cox regression model we assessed the value of the individual components of each scoring system for predicting survival in these patients. Result: The factors that were most significantly associated with survival were the general condition score (Karnofsky Performance Scale (P=.000, log rank test, metastasis to internal organs (P=.0002 log rank test, and number of extraspinal bone metastases (P=.0058. Type of primary tumor was not found to be significantly associated with survival according to the revised Tokuhashi scoring system (P=.9131, log rank test. Stepwise logistic regression revealed that the Tomita score correlated more closely with survival than the Tokuhashi score. Conclusion: The patient′s performance status, extent of visceral metastasis, and extent of bone metastases are significant predictors of survival in patients with metastatic disease. Both revised Tokuhashi and Tomita scores were significantly correlated with survival. A revised Tokuhashi score of 7 or more and a Tomita score of 6 or less indicated >50% chance of surviving 6 months postoperatively. We recommend that the Tomita score be used for prognostication in patients who are contemplating surgery, as it is simpler to score and has a higher

ABO blood type correlates with survival on prostate cancer vaccine therapy.

Science.gov (United States)

Muthana, Saddam M; Gulley, James L; Hodge, James W; Schlom, Jeffrey; Gildersleeve, Jeffrey C

2015-10-13

Immunotherapies for cancer are transforming patient care, but clinical responses vary considerably from patient to patient. Simple, inexpensive strategies to target treatment to likely responders could substantially improve efficacy while simultaneously reducing health care costs, but identification of reliable biomarkers has proven challenging. Previously, we found that pre-treatment serum IgM to blood group A (BG-A) correlated with survival for patients treated with PROSTVAC-VF, a therapeutic cancer vaccine in phase III clinical trials for the treatment of prostate cancer. These results suggested that ABO blood type might influence efficacy. Unfortunately, blood types were not available in the clinical records for all but 8 patients and insufficient amounts of sera were left for standard blood typing methods. To test the hypothesis, therefore, we developed a new glycan microarray-based method for determining ABO blood type. The method requires only 4 μL of serum, provides 97% accuracy, and allows simultaneous profiling of many other serum anti-glycan antibodies. After validation with 220 healthy subjects of known blood type, the method was then applied to 74 PROSTVAC-VF patients and 37 control patients from a phase II trial. In this retrospective study, we found that type B and O PROSTVAC-VF patients demonstrated markedly improved clinical outcomes relative to A and AB patients, including longer median survival, longer median survival relative to Halabi predicted survival, and improved overall survival via Kaplan-Meier survival analysis (p = 0.006). Consequently, blood type may provide an inexpensive screen to pre-select patients likely to benefit from PROSTVAC-VF therapy.

Fluorescent in situ hybridization (FISH) on corneal impression cytology specimens (CICS): study of epithelial cell survival after keratoplasty.

Science.gov (United States)

Catanese, Muriel; Popovici, Cornel; Proust, Hélène; Hoffart, Louis; Matonti, Frédéric; Cochereau, Isabelle; Conrath, John; Gabison, Eric E

2011-02-22

To assess corneal epithelial cell survival after keratoplasty. Corneal impression cytology (CIC) was performed on sex-mismatched corneal transplants. Fluorescent in situ hybridization (FISH) with sex chromosome-specific probes was performed to identify epithelial cell mosaicism and therefore allocate the donor or recipient origin of the cells. Twenty-four samples of corneal epithelial cells derived from 21 transplanted patients were analyzed. All patients received post-operative treatment using dexamethasone eye drops, with progressive tapering over 18 months, and nine patients also received 2% cyclosporine eye drops. Out of the 24 samples reaching quality criteria, sex mosaicism was found in 13, demonstrating the presence of donor-derived cells at the center of the graft for at least 211 days post keratoplasty. Kaplan-Meier analysis established a median survival of donor corneal epithelial cells of 385 days. Although not statistically significant, the disappearance of donor cells seemed to be delayed and the average number of persistent cells appeared to be greater when 2% cyclosporine was used topically as an additional immunosuppressive therapy. The combination of corneal impressions and FISH analysis is a valuable tool with negligible side effects to investigate the presence of epithelial cell mosaicism in sex-mismatched donor transplants. Epithelial cells survived at the center of the graft with a median survival of more than one year, suggesting slower epithelial turnover than previously described.

A 10-year cohort analysis of routine paediatric ART data in a rural South African setting.

Science.gov (United States)

Lilian, R R; Mutasa, B; Railton, J; Mongwe, W; McINTYRE, J A; Struthers, H E; Peters, R P H

2017-01-01

South Africa's paediatric antiretroviral therapy (ART) programme is managed using a monitoring and evaluation tool known as TIER.Net. This electronic system has several advantages over paper-based systems, allowing profiling of the paediatric ART programme over time. We analysed anonymized TIER.Net data for HIV-infected children aged ART in a rural district of South Africa between 2005 and 2014. We performed Kaplan-Meier survival analysis to assess outcomes over time. Records of 5461 children were available for analysis; 3593 (66%) children were retained in care. Losses from the programme were higher in children initiated on treatment in more recent years (P ART programme and highlights interventions to improve programme performance.

Lean body mass predicts long-term survival in Chinese patients on peritoneal dialysis.

Directory of Open Access Journals (Sweden)

Jenq-Wen Huang

Full Text Available BACKGROUND: Reduced lean body mass (LBM is one of the main indicators in malnutrition inflammation syndrome among patients on dialysis. However, the influence of LBM on peritoneal dialysis (PD patients' outcomes and the factors related to increasing LBM are seldom reported. METHODS: We enrolled 103 incident PD patients between 2002 and 2003, and followed them until December 2011. Clinical characteristics, PD-associated parameters, residual renal function, and serum chemistry profiles of each patient were collected at 1 month and 1 year after initiating PD. LBM was estimated using creatinine index corrected with body weight. Multiple linear regression analysis, Kaplan-Meier survival analysis, and Cox regression proportional hazard analysis were used to define independent variables and compare survival between groups. RESULTS: Using the median LBM value (70% for men and 64% for women, patients were divided into group 1 (n = 52; low LBM and group 2 (n = 51; high LBM. Group 1 patients had higher rates of peritonitis (1.6 vs. 1.1/100 patient months; p<0.05 and hospitalization (14.6 vs. 9.7/100 patient months; p<0.05. Group 1 patients also had shorter overall survival and technique survival (p<0.01. Each percentage point increase in LBM reduced the hazard ratio for mortality by 8% after adjustment for diabetes, age, sex, and body mass index (BMI. Changes in residual renal function and protein catabolic rate were independently associated with changes in LBM in the first year of PD. CONCLUSIONS: LBM serves as a good parameter in addition to BMI to predict the survival of patients on PD. Preserving residual renal function and increasing protein intake can increase LBM.

Over-expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene expression correlates with shortened survival

Directory of Open Access Journals (Sweden)

Lincoln Douglas

2006-06-01

Full Text Available Abstract Background Increased expression of Eph receptor tyrosine kinases and their ephrin ligands has been implicated in tumor progression in a number of malignancies. This report describes aberrant expression of these genes in ovarian cancer, the commonest cause of death amongst gynaecological malignancies. Methods Eph and ephrin expression was determined using quantitative real time RT-PCR. Correlation of gene expression was measured using Spearman's rho statistic. Survival was analysed using log-rank analysis and (was visualised by Kaplan-Meier survival curves. Results Greater than 10 fold over-expression of EphA1 and a more modest over-expression of EphA2 were observed in partially overlapping subsets of tumors. Over-expression of EphA1 strongly correlated (r = 0.801; p Conclusion These data imply that increased levels of ephrins A1 and A5 in the presence of high expression of Ephs A1 and A2 lead to a more aggressive tumor phenotype. The known functions of Eph/ephrin signalling in cell de-adhesion and movement may explain the observed correlation of ephrin expression with poor prognosis.

Early survival prediction after intra-arterial therapies: a 3D quantitative MRI assessment of tumour response after TACE or radioembolization of colorectal cancer metastases to the liver

International Nuclear Information System (INIS)

Chapiro, Julius; Savic, Lynn Jeanette; Duran, Rafael; Schernthaner, Ruediger; Wang, Zhijun; Geschwind, Jean-Francois; Lin, MingDe; Lesage, David

2015-01-01

This study evaluated the predictive role of 1D, 2D and 3D quantitative, enhancement-based MRI regarding overall survival (OS) in patients with colorectal liver metastases (CLM) following intra-arterial therapies (IAT). This retrospective analysis included 29 patients who underwent transarterial chemoembolization (TACE) or radioembolization and received MRI within 6 weeks after therapy. Tumour response was assessed using 1D and 2D criteria (such as European Association for the Study of the Liver guidelines [EASL] and modified Response Evaluation Criteria in Solid Tumors [mRECIST]). In addition, a segmentation-based 3D quantification of overall (volumetric [v] RECIST) and enhancing lesion volume (quantitative [q] EASL) was performed on portal venous phase MRI. Accordingly, patients were classified as responders (R) and non-responders (NR). Survival was evaluated using Kaplan-Meier analysis and compared using Cox proportional hazard ratios (HR). Only enhancement-based criteria identified patients as responders. EASL and mRECIST did not predict patient survival (P = 0.27 and P = 0.44, respectively). Using uni- and multivariate analysis, qEASL was identified as the sole predictor of patient survival (9.9 months for R, 6.9 months for NR; P = 0.038; HR 0.4). The ability of qEASL to predict survival early after IAT provides evidence for potential advantages of 3D quantitative tumour analysis. (orig.)

Early survival prediction after intra-arterial therapies: a 3D quantitative MRI assessment of tumour response after TACE or radioembolization of colorectal cancer metastases to the liver

Energy Technology Data Exchange (ETDEWEB)

Chapiro, Julius; Savic, Lynn Jeanette [The Johns Hopkins Hospital, Russell H. Morgan Department of Radiology and Radiological Science, Division of Vascular and Interventional Radiology, Baltimore, MD (United States); Charite Universitaetsmedizin, Department of Diagnostic and Interventional Radiology, Berlin (Germany); Duran, Rafael; Schernthaner, Ruediger; Wang, Zhijun; Geschwind, Jean-Francois [The Johns Hopkins Hospital, Russell H. Morgan Department of Radiology and Radiological Science, Division of Vascular and Interventional Radiology, Baltimore, MD (United States); Lin, MingDe [The Johns Hopkins Hospital, Russell H. Morgan Department of Radiology and Radiological Science, Division of Vascular and Interventional Radiology, Baltimore, MD (United States); U/S Imaging and Interventions (UII), Philips Research North America, Briarcliff Manor, NY (United States); Lesage, David [Philips Research, Medisys, Suresnes (France)

2015-07-15

This study evaluated the predictive role of 1D, 2D and 3D quantitative, enhancement-based MRI regarding overall survival (OS) in patients with colorectal liver metastases (CLM) following intra-arterial therapies (IAT). This retrospective analysis included 29 patients who underwent transarterial chemoembolization (TACE) or radioembolization and received MRI within 6 weeks after therapy. Tumour response was assessed using 1D and 2D criteria (such as European Association for the Study of the Liver guidelines [EASL] and modified Response Evaluation Criteria in Solid Tumors [mRECIST]). In addition, a segmentation-based 3D quantification of overall (volumetric [v] RECIST) and enhancing lesion volume (quantitative [q] EASL) was performed on portal venous phase MRI. Accordingly, patients were classified as responders (R) and non-responders (NR). Survival was evaluated using Kaplan-Meier analysis and compared using Cox proportional hazard ratios (HR). Only enhancement-based criteria identified patients as responders. EASL and mRECIST did not predict patient survival (P = 0.27 and P = 0.44, respectively). Using uni- and multivariate analysis, qEASL was identified as the sole predictor of patient survival (9.9 months for R, 6.9 months for NR; P = 0.038; HR 0.4). The ability of qEASL to predict survival early after IAT provides evidence for potential advantages of 3D quantitative tumour analysis. (orig.)

Albumin-Bilirubin and Platelet-Albumin-Bilirubin Grades Accurately Predict Overall Survival in High-Risk Patients Undergoing Conventional Transarterial Chemoembolization for Hepatocellular Carcinoma.

Science.gov (United States)

Hansmann, Jan; Evers, Maximilian J; Bui, James T; Lokken, R Peter; Lipnik, Andrew J; Gaba, Ron C; Ray, Charles E

2017-09-01

To evaluate albumin-bilirubin (ALBI) and platelet-albumin-bilirubin (PALBI) grades in predicting overall survival in high-risk patients undergoing conventional transarterial chemoembolization for hepatocellular carcinoma (HCC). This single-center retrospective study included 180 high-risk patients (142 men, 59 y ± 9) between April 2007 and January 2015. Patients were considered high-risk based on laboratory abnormalities before the procedure (bilirubin > 2.0 mg/dL, albumin 1.2 mg/dL); presence of ascites, encephalopathy, portal vein thrombus, or transjugular intrahepatic portosystemic shunt; or Model for End-Stage Liver Disease score > 15. Serum albumin, bilirubin, and platelet values were used to determine ALBI and PALBI grades. Overall survival was stratified by ALBI and PALBI grades with substratification by Child-Pugh class (CPC) and Barcelona Liver Clinic Cancer (BCLC) stage using Kaplan-Meier analysis. C-index was used to determine discriminatory ability and survival prediction accuracy. Median survival for 79 ALBI grade 2 patients and 101 ALBI grade 3 patients was 20.3 and 10.7 months, respectively (P  .05). ALBI and PALBI grades are accurate survival metrics in high-risk patients undergoing conventional transarterial chemoembolization for HCC. Use of these scores allows for more refined survival stratification within CPC and BCLC stage. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

Prognostic value of pre-treatment DCE-MRI parameters in predicting disease free and overall survival for breast cancer patients undergoing neoadjuvant chemotherapy

International Nuclear Information System (INIS)

Pickles, Martin D.; Manton, David J.; Lowry, Martin; Turnbull, Lindsay W.

2009-01-01

The purpose of this study was to investigate whether dynamic contrast enhanced MRI (DCE-MRI) data, both pharmacokinetic and empirical, can predict, prior to neoadjuvant chemotherapy, which patients are likely to have a shorter disease free survival (DFS) and overall survival (OS) interval following surgery. Traditional prognostic parameters were also included in the survival analysis. Consequently, a comparison of the prognostic value could be made between all the parameters studied. MR examinations were conducted on a 1.5 T system in 68 patients prior to the initiation of neoadjuvant chemotherapy. DCE-MRI consisted of a fast spoiled gradient echo sequence acquired over 35 phases with a mean temporal resolution of 11.3 s. Both pharmacokinetic and empirical parameters were derived from the DCE-MRI data. Kaplan-Meier survival plots were generated for each parameter and group comparisons were made utilising logrank tests. The results from the 54 patients entered into the univariate survival analysis demonstrated that traditional prognostic parameters (tumour grade, hormonal status and size), empirical parameters (maximum enhancement index, enhancement index at 30 s, area under the curve and initial slope) and adjuvant therapies demonstrated significant differences in survival intervals. Further multivariate Cox regression survival analysis revealed that empirical enhancement parameters contributed the greatest prediction of both DFS and OS in the resulting models. In conclusion, this study has demonstrated that in patients who exhibit high levels of perfusion and vessel permeability pre-treatment, evidenced by elevated empirical DCE-MRI parameters, a significantly lower disease free survival and overall survival can be expected.

Prognostic value of pre-treatment DCE-MRI parameters in predicting disease free and overall survival for breast cancer patients undergoing neoadjuvant chemotherapy

Energy Technology Data Exchange (ETDEWEB)

Pickles, Martin D. [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: m.pickles@hull.ac.uk; Manton, David J. [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: d.j.manton@hull.ac.uk; Lowry, Martin [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: m.lowry@hull.ac.uk; Turnbull, Lindsay W. [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: l.w.turnbull@hull.ac.uk

2009-09-15

The purpose of this study was to investigate whether dynamic contrast enhanced MRI (DCE-MRI) data, both pharmacokinetic and empirical, can predict, prior to neoadjuvant chemotherapy, which patients are likely to have a shorter disease free survival (DFS) and overall survival (OS) interval following surgery. Traditional prognostic parameters were also included in the survival analysis. Consequently, a comparison of the prognostic value could be made between all the parameters studied. MR examinations were conducted on a 1.5 T system in 68 patients prior to the initiation of neoadjuvant chemotherapy. DCE-MRI consisted of a fast spoiled gradient echo sequence acquired over 35 phases with a mean temporal resolution of 11.3 s. Both pharmacokinetic and empirical parameters were derived from the DCE-MRI data. Kaplan-Meier survival plots were generated for each parameter and group comparisons were made utilising logrank tests. The results from the 54 patients entered into the univariate survival analysis demonstrated that traditional prognostic parameters (tumour grade, hormonal status and size), empirical parameters (maximum enhancement index, enhancement index at 30 s, area under the curve and initial slope) and adjuvant therapies demonstrated significant differences in survival intervals. Further multivariate Cox regression survival analysis revealed that empirical enhancement parameters contributed the greatest prediction of both DFS and OS in the resulting models. In conclusion, this study has demonstrated that in patients who exhibit high levels of perfusion and vessel permeability pre-treatment, evidenced by elevated empirical DCE-MRI parameters, a significantly lower disease free survival and overall survival can be expected.

Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies

International Nuclear Information System (INIS)

Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.

2007-01-01

Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients

Impact of Marital Status on Tumor Stage at Diagnosis and on Survival in Male Breast Cancer.

Science.gov (United States)

Adekolujo, Orimisan Samuel; Tadisina, Shourya; Koduru, Ujwala; Gernand, Jill; Smith, Susan Jane; Kakarala, Radhika Ramani

2017-07-01

The effect of marital status (MS) on survival varies according to cancer type and gender. There has been no report on the impact of MS on survival in male breast cancer (MBC). This study aims to determine the influence of MS on tumor stage at diagnosis and survival in MBC. Men with MBC ≥18 years of age in the SEER database from 1990 to 2011 were included in the study. MS was classified as married and unmarried (including single, divorced, separated, widowed). Kaplan-Meier method was used to estimate the 5-year cancer-specific survival. Multivariate regression analyses were done to determine the effect of MS on presence of Stage IV disease at diagnosis and on cancer-specific mortality. The study included 3,761 men; 2,647 (70.4%) were married. Unmarried men were more often diagnosed with Stage IV MBC compared with married (10.7% vs. 5.5%, p Unmarried men (compared with married) were significantly less likely to undergo surgery (92.4% vs. 96.7%, p unmarried males with Stages II, III, and IV MBC have significantly worse 5-year cancer-specific survival compared with married. On multivariate analysis, being unmarried was associated with increased hazard of death (HR = 1.43, p Unmarried males with breast cancer are at greater risk for Stage IV disease at diagnosis and poorer outcomes compared with married males.

Correlations of Hemoglobin Level and Perioperative Blood Transfusion with the Prognosis of Gastric Cancer: A Retrospective Study.

Science.gov (United States)

Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng

2017-05-23

BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.

Chronic kidney disease in dogs in UK veterinary practices: prevalence, risk factors, and survival.

Science.gov (United States)

O'Neill, D G; Elliott, J; Church, D B; McGreevy, P D; Thomson, P C; Brodbelt, D C

2013-01-01

The prevalence for chronic kidney disease (CKD) in dogs varies widely (0.05-3.74%). Identified risk factors include advancing age, specific breeds, small body size, and periodontal disease. To estimate the prevalence and identify risk factors associated with CKD diagnosis and survival in dogs. Purebred dogs were hypothesized to have higher CKD risk and poorer survival characteristics than crossbred dogs. A merged clinical database of 107,214 dogs attending 89 UK veterinary practices over a 2-year period (January 2010-December 2011). A longitudinal study design estimated the apparent prevalence (AP) whereas the true prevalence (TP) was estimated using Bayesian analysis. A nested case-control study design evaluated risk factors. Survival analysis used the Kaplan-Meier survival curve method and multivariable Cox proportional hazards regression modeling. The CKD AP was 0.21% (95% CI: 0.19-0.24%) and TP was 0.37% (95% posterior credibility interval 0.02-1.44%). Significant risk factors included increasing age, being insured, and certain breeds (Cocker Spaniel, Cavalier King Charles Spaniel). Cardiac disease was a significant comorbid disorder. Significant clinical signs included halitosis, weight loss, polyuria/polydipsia, urinary incontinence, vomiting, decreased appetite, lethargy, and diarrhea. The median survival time from diagnosis was 226 days (95% CI 112-326 days). International Renal Interest Society stage and blood urea nitrogen concentration at diagnosis were significantly associated with hazard of death due to CKD. Chronic kidney disease compromises dog welfare. Increased awareness of CKD risk factors and association of blood biochemistry results with survival time should facilitate diagnosis and optimize case management to improve animal survival and welfare. Copyright © 2013 by the American College of Veterinary Internal Medicine.

C-reactive protein-to-albumin ratio is a predictor of hepatitis B virus related decompensated cirrhosis: time-dependent receiver operating characteristics and decision curve analysis.

Science.gov (United States)

Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing

2017-04-01

Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.

Postmastectomy Radiation Therapy Is Associated With Improved Survival in Node-Positive Male Breast Cancer: A Population Analysis

Energy Technology Data Exchange (ETDEWEB)

Abrams, Matthew J., E-mail: mabrams@tuftsmedicalcenter.org [Department of Radiation Oncology, Tufts University School of Medicine, Tufts Medical Center, Boston, Massachusetts (United States); Koffer, Paul P. [Department of Radiation Oncology, Tufts University School of Medicine, Tufts Medical Center, Boston, Massachusetts (United States); Wazer, David E. [Department of Radiation Oncology, Tufts University School of Medicine, Tufts Medical Center, Boston, Massachusetts (United States); Department of Radiation Oncology, The Alpert Medical School of Brown University, Rhode Island Hospital, Providence, Rhode Island (United States); Hepel, Jaroslaw T. [Department of Radiation Oncology, The Alpert Medical School of Brown University, Rhode Island Hospital, Providence, Rhode Island (United States)

2017-06-01

Purpose: Because of its rarity, there are no randomized trials investigating postmastectomy radiation therapy (PMRT) in male breast cancer. This study retrospectively examines the impact of PMRT in male breast cancer patients in the National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) database. Methods and Materials: The SEER database 8.3.2 was queried for men ages 20+ with a diagnosis of localized or regional nonmetastatic invasive ductal/lobular carcinoma from 1998 to 2013. Included patients were treated by modified radical mastectomy (MRM), with or without adjuvant external beam radiation. Univariate and multivariate analyses evaluated predictors for PMRT use after MRM. Kaplan-Meier overall survival (OS) curves of the entire cohort and a case-matched cohort were calculated and compared by the log-rank test. Cox regression was used for multivariate survival analyses. Results: A total of 1933 patients were included in the unmatched cohort. There was no difference in 5-year OS between those who received PMRT and those who did not (78% vs 77%, respectively, P=.371); however, in the case-matched analysis, PMRT was associated with improved OS at 5 years (83% vs 54%, P<.001). On subset analysis of the unmatched cohort, PMRT was associated with improved OS in men with 1 to 3 positive nodes (5-year OS 79% vs 72% P=.05) and those with 4+ positive nodes (5-year OS 73% vs 53% P<.001). On multivariate analysis of the unmatched cohort, independent predictors for improved OS were use of PMRT: HR=0.551 (0.412-0.737) and estrogen receptor–positive disease: HR=0.577 (0.339-0.983). Predictors for a survival detriment were higher grade 3/4: HR=1.825 (1.105-3.015), larger tumor T2: HR=1.783 (1.357-2.342), T3/T4: HR=2.683 (1.809-3.978), higher N-stage: N1 HR=1.574 (1.184-2.091), N2/N3: HR=2.328 (1.684-3.218), black race: HR=1.689 (1.222-2.336), and older age 81+: HR=4.164 (1.497-11.582). Conclusions: There may be a survival benefit with the

Characterization of Pediatric Acute Lymphoblastic Leukemia Survival Patterns by Age at Diagnosis

International Nuclear Information System (INIS)

Hossain, M. J.; Xie, L.; McCahan, S. M.; Hossain, M. J.

2014-01-01

Age at diagnosis is a key prognostic factor in pediatric acute lymphoblastic leukemia (ALL) survivorship. However, literature providing adequate assessment of the survival variability by age at diagnosis is scarce. The aim of this study is to assess the impact of this prognostic factor in pediatric ALL survival. We estimated incidence rate of mortality, 5-year survival rate, Kaplan-Meier survival function, and hazard ratio using the Surveillance Epidemiology and End Results (SEER) data during 1973-2009. There was significant variability in pediatric ALL survival by age at diagnosis. Survival peaked among children diagnosed at 1-4 years and steadily declined among those diagnosed at older ages. Infants (<1 year) had the lowest survivorship. In a multivariable Cox proportional hazard model stratified by year of diagnosis, those diagnosed in age groups 1-4, 5-9, 10-14, and 15-19 years were 82%, 75%, 57%, and 32% less likely to die compared to children diagnosed in infancy, respectively. Age at diagnosis remained to be a crucial determinant of the survival variability of pediatric ALL patients, after adjusting for sex, race, radiation therapy, primary tumor sites, immuno phenotype, and year of diagnosis. Further research is warranted to disentangle the effects of age-dependent biological and environmental processes on this association.

Survival and mortality among users and non-users of hydroxyurea with sickle cell disease.

Science.gov (United States)

de Araujo, Olinda Maria Rodrigues; Ivo, Maria Lúcia; Ferreira Júnior, Marcos Antonio; Pontes, Elenir Rose Jardim Cury; Bispo, Ieda Maria Gonçalves Pacce; de Oliveira, Eveny Cristine Luna

2015-01-01

to estimate survival, mortality and cause of death among users or not of hydroxyurea with sickle cell disease. cohort study with retrospective data collection, from 1980 to 2010 of patients receiving inpatient treatment in two Brazilian public hospitals. The survival probability was determined using the Kaplan-Meier estimator, survival calculations (SPSS version 10.0), comparison between survival curves, using the log rank method. The level of significance was p=0.05. of 63 patients, 87% had sickle cell anemia, with 39 using hydroxyurea, with a mean time of use of the drug of 20.0±10.0 years and a mean dose of 17.37±5.4 to 20.94±7.2 mg/kg/day, raising the fetal hemoglobin. In the comparison between those using hydroxyurea and those not, the survival curve was greater among the users (p=0.014). A total of 10 deaths occurred, with a mean age of 28.1 years old, and with Acute Respiratory Failure as the main cause. the survival curve is greater among the users of hydroxyurea. The results indicate the importance of the nurse incorporating therapeutic advances of hydroxyurea in her care actions.

Volume-Based F-18 FDG PET/CT Imaging Markers Provide Supplemental Prognostic Information to Histologic Grading in Patients With High-Grade Bone or Soft Tissue Sarcoma

DEFF Research Database (Denmark)

Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid

2015-01-01

analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...

In situ immune response after neoadjuvant chemotherapy for breast cancer predicts survival.

Science.gov (United States)

Ladoire, Sylvain; Mignot, Grégoire; Dabakuyo, Sandrine; Arnould, Laurent; Apetoh, Lionel; Rébé, Cedric; Coudert, Bruno; Martin, Francois; Bizollon, Marie Hélène; Vanoli, André; Coutant, Charles; Fumoleau, Pierre; Bonnetain, Franck; Ghiringhelli, François

2011-07-01

Accumulating preclinical evidence suggests that anticancer immune responses contribute to the success of chemotherapy. However, the predictive value of tumour-infiltrating lymphocytes after neoadjuvant chemotherapy for breast cancer remains unknown. We hypothesized that the nature of the immune infiltrate following neoadjuvant chemotherapy would predict patient survival. In a series of 111 consecutive HER2- and a series of 51 non-HER2-overexpressing breast cancer patients treated by neoadjuvant chemotherapy, we studied by immunohistochemistry tumour infiltration by FOXP3 and CD8 T lymphocytes before and after chemotherapy. Kaplan-Meier analysis and Cox modelling were used to assess relapse-free survival (RFS) and overall survival (OS). A predictive scoring system using American Joint Committee on Cancer (AJCC) pathological staging and immunological markers was created. Association of high CD8 and low FOXP3 cell infiltrates after chemotherapy was significantly associated with improved RFS (p = 0.02) and OS (p = 0.002), and outperformed classical predictive factors in multivariate analysis. A combined score associating CD8/FOXP3 ratio and pathological AJCC staging isolated a subgroup of patients with a long-term overall survival of 100%. Importantly, this score also identified patients with a favourable prognosis in an independent cohort of HER2-negative breast cancer patients. These results suggest that immunological CD8 and FOXP3 cell infiltrate after treatment is an independent predictive factor of survival in breast cancer patients treated with neoadjuvant chemotherapy and provides new insights into the role of the immune milieu and cancer. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Improved survival in HIV treatment programs in Asia

Science.gov (United States)

De La Mata, Nicole L; Kumarasamy, Nagalingeswaran; Khol, Vohith; Ng, Oon Tek; Van Nguyen, Kinh; Merati, Tuti Parwati; Pham, Thuy Thanh; Lee, Man Po; Durier, Nicolas; Law, Matthew

2016-01-01

Background Antiretroviral treatment (ART) for HIV-positive patients has expanded rapidly in Asia over the last ten years. Our study aimed to describe the time trends and risk factors for overall survival in patients receiving first-line ART in Asia. Methods We included HIV-positive adult patients who initiated ART between 2003–2013 (n=16 546), from seven sites across six Asia-Pacific countries. Patient follow-up was to May 2014. We compared survival for each country and overall by time period of ART initiation using Kaplan-Meier curves. Factors associated with mortality were assessed using Cox regression, stratified by site. We also summarized first-line ART regimens, CD4 count at ART initiation, and CD4 and HIV viral load testing frequencies. Results There were 880 deaths observed over 54 532 person-years of follow-up, a crude rate of 1.61 (1.51, 1.72) per 100 person-years. Survival significantly improved in more recent years of ART initiation. The survival probabilities at 4 years follow-up for those initiating ART in 2003–05 was 92.1%, 2006–09 was 94.3% and 2010–2013 was 94.5% (pAsia have improved survival in more recent years of ART initiation. This is likely a consequence of improvements in treatment and, patient management and monitoring over time. PMID:26961354

Primary localization and tumor thickness as prognostic factors of survival in patients with mucosal melanoma.

Directory of Open Access Journals (Sweden)

Tarun Mehra

Full Text Available Data on survival with mucosal melanoma and on prognostic factors of are scarce. It is still unclear if the disease course allows for mucosal melanoma to be treated as primary cutaneous melanoma or if differences in overall survival patterns require adapted therapeutic approaches. Furthermore, this investigation is the first to present 10-year survival rates for mucosal melanomas of different anatomical localizations.116 cases from Sep 10 1984 until Feb 15 2011 retrieved from the Comprehensive Cancer Center and of the Central Register of the German Dermatologic Society databases in Tübingen were included in our analysis. We recorded anatomical location and tumor thickness, and estimated overall survival at 2, 5 and 10 years and the mean overall survival time. Survival times were analyzed with the Kaplan-Meier method. The log-rank test was used to compare survival times by localizations and by T-stages.We found a median overall survival time of 80.9 months, with an overall 2-year survival of 71.7%, 5-year survival of 55.8% and 10-year survival of 38.3%. The 10-year survival rates for patients with T1, T2, T3 or T4 stage tumors were 100.0%, 77.9%, 66.3% and 10.6% respectively. 10-year survival of patients with melanomas of the vulva was 64.5% in comparison to 22.3% of patients with non-vulva mucosal melanomas.Survival times differed significantly between patients with melanomas of the vulva compared to the rest (p = 0.0006. It also depends on T-stage at the time of diagnosis (p < 0.0001.

HIV testing in the maternity ward and the start of breastfeeding: a survival analysis

Directory of Open Access Journals (Sweden)

Glaucia T. Possolli

2015-08-01

Full Text Available OBJECTIVE: The purpose of this study was to analyze the factors that influence of the time between birth and the beginning of breastfeeding, especially at the moment of the rapid HIV test results at hospital admission for delivery.METHODS: Cohort study of 932 pregnant women who underwent rapid HIV test admitted in the hospital for delivery in Baby-Friendly Hospitals. The survival curves of time from birth to the first feeding were estimated by the Kaplan-Meier method and the joint effect of independent variables by the Cox model with a hierarchical analysis. As the survival curves were not homogeneous among the five hospitals, hindering the principle of proportionality of risks, the data were divided into two groups according to the median time of onset of breastfeeding at birth in women undergoing rapid HIV testing.RESULTS: Hospitals with median time to breastfeeding onset at birth of up to 60 min were considered as early breastfeeding onset and those with higher medians were considered as late breastfeeding onset at birth. Risk factors common to hospitals considered to be with early and late breastfeeding onset at birth were: cesarean section (RR = 1.75 [95% CI: 1.38-2.22]; RR = 3.83 [95% CI: 3.03-4.85] and rapid test result after birth (RR = 1.45 [95% CI: 1.12-1.89]; RR = 1.65 [95% CI: 1.35-2.02], respectively; and hospitals with late onset: starting prenatal care in the third trimester (RR = 1.86 [95% CI: 1.16-2.97].CONCLUSIONS: The onset of breastfeeding is postponed, even in Baby-Friendly Hospitals, when the results of the rapid HIV test requested in the maternity are not available at the time of delivery.

Role of BRCA2 mutation status on overall survival among breast cancer patients from Sardinia

International Nuclear Information System (INIS)

Budroni, Mario; Palmieri, Giuseppe; Cesaraccio, Rosaria; Coviello, Vincenzo; Sechi, Ornelia; Pirino, Daniela; Cossu, Antonio; Tanda, Francesco; Pisano, Marina; Palomba, Grazia

2009-01-01

Germline mutations in BRCA1 or BRCA2 genes have been demonstrated to increase the risk of developing breast cancer. Conversely, the impact of BRCA mutations on prognosis and survival of breast cancer patients is still debated. In this study, we investigated the role of such mutations on breast cancer-specific survival among patients from North Sardinia. Among incident cases during the period 1997–2002, a total of 512 breast cancer patients gave their consent to undergo BRCA mutation screening by DHPLC analysis and automated DNA sequencing. The Hakulinen, Kaplan-Meier, and Cox regression methods were used for both relative survival assessment and statistical analysis. In our series, patients carrying a germline mutation in coding regions and splice boundaries of BRCA1 and BRCA2 genes were 48/512 (9%). Effect on overall survival was evaluated taking into consideration BRCA2 carriers, who represented the vast majority (44/48; 92%) of mutation-positive patients. A lower breast cancer-specific overall survival rate was observed in BRCA2 mutation carriers after the first two years from diagnosis. However, survival rates were similar in both groups after five years from diagnosis. No significant difference was found for age of onset, disease stage, and primary tumour histopathology between the two subsets. In Sardinian breast cancer population, BRCA2 was the most affected gene and the effects of BRCA2 germline mutations on patients' survival were demonstrated to vary within the first two years from diagnosis. After a longer follow-up observation, breast cancer-specific rates of death were instead similar for BRCA2 mutation carriers and non-carriers

The survival rate of self-immolators in Kermanshah Province 2010- 2011

Directory of Open Access Journals (Sweden)

Farid Najafi

2013-12-01

Full Text Available Background: Self-immolation is one of the most violent methods of suicide, which is spreading in Iran. The highest rate of deaths due to committing suicide and self-immolation in Iran is observed in Kermanshah province. This research was conducted to study the survival rate and the factors that influence survival among the ones who commit self-immolation in Kermanshah province. Methods: In this study, all the cases who did not survive, as well as all the ones who were hospitalized due to self-immolation in Kermanshah province during 2010 and 2011 were examined. The Kaplan-Meier method was used to estimate the survival function, and in order to do the comparisons, Logrank test and Cox Regression were employed using Stata 12 software. Results: The results indicated that during 2010 and 2011, 343 individuals committed self-immolation in Kermanshah Province, while, 288 (84% were women. Also, it was found that 184 (53% did not survive, the mean and median of survival time in those who committed suicide deliberately, were 33±2.6 and 11±2 days respectively. Estimation of survival rate using Logrank test indicated that survival rate had a significant relationship with age, mental disorders, drug addiction, and TBSA (Total Body Surface Area, while it did not suggest a statistically significant relationship with gender, marital status and cause of injury. After multivariate analysis using Cox regression, only two variables of age and TBSA could remain in the model and the other variables were excluded from the model. Conclusion: The death toll due to self-immolation is very high and the mean and median of survival time among the people who committed self-immolation is very low. Therefore, it is recommended that remedial action be performed quickly without wasting time.

Effect of Interval to Definitive Breast Surgery on Clinical Presentation and Survival in Early-Stage Invasive Breast Cancer

International Nuclear Information System (INIS)

Vujovic, Olga; Yu, Edward; Cherian, Anil; Perera, Francisco; Dar, A. Rashid; Stitt, Larry; Hammond, A.

2009-01-01

Purpose: To examine the effect of clinical presentation and interval to breast surgery on local recurrence and survival in early-stage breast cancer. Methods and Materials: The data from 397 patients with Stage T1-T2N0 breast carcinoma treated with conservative surgery and breast radiotherapy between 1985 and 1992 were reviewed at the London Regional Cancer Program. The clinical presentation consisted of a mammogram finding or a palpable lump. The intervals from clinical presentation to definitive breast surgery used for analysis were 0-4, >4-12, and >12 weeks. The Kaplan-Meier estimates of the time to local recurrence, disease-free survival, and cause-specific survival were determined for the three groups. Cox regression analysis was used to evaluate the effect of clinical presentation and interval to definitive surgery on survival. Results: The median follow-up was 11.2 years. No statistically significant difference was found in local recurrence as a function of the interval to definitive surgery (p = .424). A significant difference was noted in disease-free survival (p = .040) and cause-specific survival (p = .006) with an interval of >12 weeks to definitive breast surgery. However, the interval to definitive surgery was dependent on the presentation for cause-specific survival, with a substantial effect for patients with a mammographic presentation and a negligible effect for patients with a lump presentation (interaction p = .041). Conclusion: The results of this study suggest that an interval of >12 weeks to breast surgery might be associated with decreased survival for patients with a mammographic presentation, but it appeared to have no effect on survival for patients presenting with a palpable breast lump.

Radical Nephrectomy for Primary Retroperitoneal Liposarcoma Near the Kidney has a Beneficial Effect on Disease-Free Survival.

Science.gov (United States)

Rhu, Jinsoo; Cho, Chan Woo; Lee, Kyo Won; Park, Hyojun; Park, Jae Berm; Choi, Yoon-La; Kim, Sung Joo

2018-01-01

The purpose of this study is to analyze the clinical impact of radical nephrectomy on retroperitoneal liposarcoma near the kidney. Data of patients who underwent surgery for unilateral primary retroperitoneal liposarcoma near the kidney were retrospectively collected. Patients were divided into four groups according to whether they underwent nephrectomy and combined resection of other organs. Kaplan-Meier survival analysis was used to estimate disease-free survival and overall survival. Multivariable Cox analysis was used to analyze factors related to disease-free survival and overall survival. Nephrectomy (HR = 0.260, CI = 0.078-0.873, p = 0.029) had a beneficial effect on disease-free survival, while interaction model of nephrectomy*other organ resection (HR = 4.655, CI = 1.767-12.263, p = 0.002) showed poor disease-free survival. Other organ resection was not related to disease-free survival (HR = 1.543, CI = 0.146-16.251, p = 0.718). Operation method (p = 0.007) and FNCLCC grade (p free survival. While combined organ resection without nephrectomy group (HR = 1.604, CI = 0.167-15.370, p = 0.682) and radical nephrectomy with combined organ resection group (HR = 1.309, CI = 0.448-3.825, p = 0.622) did not show significant difference in disease-free survival from the mass excision only group, radical nephrectomy without combined organ resection group (HR = 0.279, CI = 0.078-0.991, p = 0.048) showed superior disease-free survival. Radical nephrectomy of unilateral primary retroperitoneal liposarcoma near the kidney has a beneficial effect on disease-free survival.

Impact of forced vital capacity loss on survival after the onset of chronic lung allograft dysfunction.

Science.gov (United States)

Todd, Jamie L; Jain, Rahil; Pavlisko, Elizabeth N; Finlen Copeland, C Ashley; Reynolds, John M; Snyder, Laurie D; Palmer, Scott M

2014-01-15

Emerging evidence suggests a restrictive phenotype of chronic lung allograft dysfunction (CLAD) exists; however, the optimal approach to its diagnosis and clinical significance is uncertain. To evaluate the hypothesis that spirometric indices more suggestive of a restrictive ventilatory defect, such as loss of FVC, identify patients with distinct clinical, radiographic, and pathologic features, including worse survival. Retrospective, single-center analysis of 566 consecutive first bilateral lung recipients transplanted over a 12-year period. A total of 216 patients developed CLAD during follow-up. CLAD was categorized at its onset into discrete physiologic groups based on spirometric criteria. Imaging and histologic studies were reviewed when available. Survival after CLAD diagnosis was assessed using Kaplan-Meier and Cox proportional hazards models. Among patients with CLAD, 30% demonstrated an FVC decrement at its onset. These patients were more likely to be female, have radiographic alveolar or interstitial changes, and histologic findings of interstitial fibrosis. Patients with FVC decline at CLAD onset had significantly worse survival after CLAD when compared with those with preserved FVC (P model including baseline demographic and clinical factors (P < 0.0001; adjusted hazard ratio, 2.73; 95% confidence interval, 1.86-4.04). At CLAD onset, a subset of patients demonstrating physiology more suggestive of restriction experience worse clinical outcomes. Further study of the biologic mechanisms underlying CLAD phenotypes is critical to improving long-term survival after lung transplantation.

Impact of obesity on secondary cytoreductive surgery and overall survival in women with recurrent ovarian cancer.

Science.gov (United States)

Tran, Arthur-Quan; Cohen, Joshua G; Li, Andrew J

2015-08-01

Obesity may negatively influence tumor biology in women with epithelial ovarian cancers. To date, only body mass indices (BMI) determined at the time of diagnosis have correlated with clinical outcome. We hypothesized that obesity negatively affects survival throughout the disease course, and sought to determine the prognostic role of BMI at the time of secondary cytoreductive surgery (SCS) for recurrent ovarian cancer. We performed a review of patients undergoing SCS for recurrent epithelial ovarian or peritoneal cancer between 1997 and 2012. We retrospectively reviewed data which were analyzed using Fisher's exact test, Kaplan-Meier survival, and Cox regression analysis. BMI was defined according to the National Institutes of Health's categorizations. We identified 104 patients; 2 were underweight, 46 were of ideal body weight, 32 were overweight, and 24 were obese. Overall, 90 patients underwent optimal resection and BMI did not correlate with ability to perform optimal SCS (p=0.25). When examining BMI strata (underweight, ideal, overweight, and obese), we observed a statistical trend between increasing BMI and poor outcome; median survival was undetermined (greater than 50 months), 46 months, 38 months, and 34 months, respectively (p=0.04). In a multivariate analysis, BMI was an independent predictor of survival (p=0.02). In this cohort of women undergoing SCS for recurrent ovarian cancer, BMI significantly and independently correlated with overall survival. This observation suggests an effect of excess weight on tumor biology and/or response to treatment that is prevalent throughout the disease course. Copyright © 2015 Elsevier Inc. All rights reserved.

Transcatheter arterial Chemoembolization for infiltrative hepatocellular carcinoma: Clinical safety and efficacy and factors influencing patient survival

International Nuclear Information System (INIS)

Han, Kichang; Kim, Jin Hyoung; Yoon, Hee Mang; Kim, Eun Joung; Gwon, Dong Il; Ko, Gi Young; Yoon, Hyun Ki; Ko, Heung Kyu

2014-01-01

To evaluate the safety and efficacy of transcatheter arterial chemoembolization (TACE) in patients with infiltrative hepatocellular carcinoma (HCC) and to identify the prognostic factors associated with patient survival. Fifty two patients who underwent TACE for infiltrative HCC were evaluated between 2007 and 2010. The maximum diameter of the tumors ranged from 7 cm to 22 cm (median 15 cm). Of 46 infiltrative HCC patients with portal vein tumor thrombosis, 32 patients received adjuvant radiation therapy for portal vein tumor thrombosis after TACE. The tumor response by European Association for the Study of the Liver criteria was partial in 18%, stable in 47%, and progressive in 35% of the patients. The median survival time was 5.7 months (Kaplan-Meier analysis). The survival rates were 48% at six months, 25% at one year, and 12% at two years. In the multivariable Cox regression analysis, Child-Pugh class (p = 0.02), adjuvant radiotherapy (p 0.003) and tumor response after TACE (p = 0.004) were significant factors associated with patient survival. Major complications occurred in nine patients. The major complication rate was significantly higher in patients with Child-Pugh B than in patients with Child-Pugh A (p = 0.049, x 2 test). Transcatheter arterial chemoembolization can be a safe treatment option in infiltrative HCC patients with Child Pugh class A. Child Pugh class A, radiotherapy for portal vein tumor thrombosis after TACE and tumor response are good prognostic factors for an increased survival after TACE in patients with infiltrative HCCs.

Adjuvant treatment for resected rectal cancer: impact of standard and intensified postoperative chemotherapy on disease-free survival in patients undergoing preoperative chemoradiation-a propensity score-matched analysis of an observational database.

Science.gov (United States)

Garlipp, Benjamin; Ptok, Henry; Benedix, Frank; Otto, Ronny; Popp, Felix; Ridwelski, Karsten; Gastinger, Ingo; Benckert, Christoph; Lippert, Hans; Bruns, Christiane

2016-12-01

Adjuvant chemotherapy for resected rectal cancer is widely used. However, studies on adjuvant treatment following neoadjuvant chemoradiotherapy (CRT) and total mesorectal excision (TME) have yielded conflicting results. Recent studies have focused on adding oxaliplatin to both preoperative and postoperative therapy, making it difficult to assess the impact of adjuvant oxaliplatin alone. This study was aimed at determining the impact of (i) any adjuvant treatment and (ii) oxaliplatin-containing adjuvant treatment on disease-free survival in CRT-pretreated, R0-resected rectal cancer patients. Patients undergoing R0 TME following 5-fluorouracil (5FU)-only-based CRT between January 1, 2008, and December 31, 2010, were selected from a nationwide registry. After propensity score matching (PSM), comparison of disease-free survival (DFS) using Kaplan-Meier analysis and log-rank test was performed in (i) patients receiving no vs. any adjuvant treatment and (ii) patients treated with adjuvant 5FU/capecitabine without vs. with oxaliplatin. Out of 1497 patients, 520 matched pairs were generated for analysis of no vs. any adjuvant treatment. Mean DFS was significantly prolonged with adjuvant treatment (81.8 ± 2.06 vs. 70.1 ± 3.02 months, p rectal cancer patients treated with neoadjuvant CRT and TME surgery under routine conditions, adjuvant chemotherapy significantly improved DFS. No benefit was observed for the addition of oxaliplatin to adjuvant chemotherapy in this setting.

Influence of socioeconomic status on allograft and patient survival following kidney transplantation.

Science.gov (United States)

Ward, Frank L; O'Kelly, Patrick; Donohue, Fionnuala; ÓhAiseadha, Coilin; Haase, Trutz; Pratschke, Jonathan; deFreitas, Declan G; Johnson, Howard; Conlon, Peter J; O'Seaghdha, Conall M

2015-06-01

Whether socioeconomic status confers worse outcomes after kidney transplantation is unknown. Its influence on allograft and patient survival following kidney transplantation in Ireland was examined. A retrospective, observational cohort study of adult deceased-donor first kidney transplant recipients from 1990 to 2009 was performed. Those with a valid Irish postal address were assigned a socioeconomic status score based on the Pobal Hasse-Pratschke deprivation index and compared in quartiles. Cox proportional hazards models and Kaplan-Meier survival analysis were used to investigate any significant association of socioeconomic status with patient and allograft outcomes. A total of 1944 eligible kidney transplant recipients were identified. The median follow-up time was 8.2 years (interquartile range 4.4-13.3 years). Socioeconomic status was not associated with uncensored or death-censored allograft survival (hazard ratio (HR) 1.0, 95% confidence interval (CI) 0.99-1.00, P = 0.33 and HR 1.0, 95% CI 0.99-1.00, P = 0.37, respectively). Patient survival was not associated with socioeconomic status quartile (HR 1.0, 95% CI 0.93-1.08, P = 0.88). There was no significant difference among quartiles for uncensored or death-censored allograft survival at 5 and 10 years. There was no socioeconomic disparity in allograft or patient outcomes following kidney transplantation, which may be partly attributable to the Irish healthcare model. This may give further impetus to calls in other jurisdictions for universal healthcare and medication coverage for kidney transplant recipients. © 2015 Asian Pacific Society of Nephrology.

Competing approaches to analysis of failure times with competing risks.

Science.gov (United States)

Farley, T M; Ali, M M; Slaymaker, E

2001-12-15

For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.

Meier-Gorlin syndrome

OpenAIRE

de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...

CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

International Nuclear Information System (INIS)

Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.

2017-01-01

The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy

International Nuclear Information System (INIS)

Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.

2000-01-01

Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de

High RBM3 expression is associated with an improved survival and oxaliplatin response in patients with metastatic colorectal cancer.

Directory of Open Access Journals (Sweden)

Christina Siesing

Full Text Available High expression of the RNA-binding motif protein 3 (RBM3 has been shown to correlate, with prolonged survival in several malignant diseases and with the benefit of platinum-based chemotherapy in ovarian cancer. The aim of this study was to evaluate RBM3 in metastatic colorectal cancer (mCRC as a prognostic factor for overall survival and in relation to benefit of first-line chemotherapy.Immunohistochemical staining was conducted and evaluated in tumours from 455 mCRC patients. Kaplan-Meier analysis and Cox regression proportional hazards models were used to access the impact of RBM3 expression on overall survival (OS and progression-free survival (PFS.High RBM3 expression, both nuclear and cytoplasmic, was an independent prognostic factor for prolonged OS (hazard ratio [HR] 0.67, 95% confidence interval [CI] 0.50-0.90 and HR 0.66, 95% CI 0.48-0.91, respectively. PFS was significantly longer in patients with high RBM3 expression who had received first-line oxaliplatin based treatment, compared to those who had received irinotecan based treatment, both regarding nuclear and cytoplasmic expression (p-value 0.020 and 0.022 respectively.High RBM3 expression is an independent predictor of prolonged survival in mCRC patients, in particular in patients treated with first-line oxaliplatin based chemotherapy.

Survival rate of breast cancer patients in Malaysia: a population-based study.

Science.gov (United States)

Abdullah, Nor Aini; Wan Mahiyuddin, Wan Rozita; Muhammad, Nor Asiah; Ali, Zainudin Mohamad; Ibrahim, Lailanor; Ibrahim Tamim, Nor Saleha; Mustafa, Amal Nasir; Kamaluddin, Muhammad Amir

2013-01-01

Breast cancer is the most common cancer among Malaysian women. Other than hospital-based results, there are no documented population-based survival rates of Malaysian women for breast cancers. This population- based retrospective cohort study was therefore conducted. Data were obtained from Health Informatics Centre, Ministry of Health Malaysia, National Cancer Registry and National Registration Department for the period from 1st Jan 2000 to 31st December 2005. Cases were captured by ICD-10 and linked to death certificates to identify the status. Only complete data were analysed. Survival time was calculated from the estimated date of diagnosis to the date of death or date of loss to follow-up. Observed survival rates were estimated by Kaplan- Meier method using SPSS Statistical Software version 17. A total of 10,230 complete data sets were analysed. The mean age at diagnosis was 50.6 years old. The overall 5-year survival rate was 49% with median survival time of 68.1 months. Indian women had a higher survival rate of 54% compared to Chinese women (49%) and Malays (45%). The overall 5-year survival rate of breast cancer patient among Malaysian women was still low for the cohort of 2000 to 2005 as compared to survival rates in developed nations. Therefore, it is necessary to enhance the strategies for early detection and intervention.

Progression-free Survival Following Stereotactic Body Radiotherapy for Oligometastatic Prostate Cancer Treatment-naive Recurrence: A Multi-institutional Analysis.

Science.gov (United States)

Ost, Piet; Jereczek-Fossa, Barbara Alicja; As, Nicholas Van; Zilli, Thomas; Muacevic, Alexander; Olivier, Kenneth; Henderson, Daniel; Casamassima, Franco; Orecchia, Roberto; Surgo, Alessia; Brown, Lindsay; Tree, Alison; Miralbell, Raymond; De Meerleer, Gert

2016-01-01

The literature on metastasis-directed therapy for oligometastatic prostate cancer (PCa) recurrence consists of small heterogeneous studies. This study aimed to reduce the heterogeneity by pooling individual patient data from different institutions treating oligometastatic PCa recurrence with stereotactic body radiotherapy (SBRT). We focussed on patients who were treatment naive, with the aim of determining if SBRT could delay disease progression. We included patients with three or fewer metastases. The Kaplan-Meier method was used to estimate distant progression-free survival (DPFS) and local progression-free survival (LPFS). Toxicity was scored using the Common Terminology Criteria for Adverse Events. In total, 163 metastases were treated in 119 patients. The median DPFS was 21 mo (95% confidence interval, 15-26 mo). A lower radiotherapy dose predicted a higher local recurrence rate with a 3-yr LPFS of 79% for patients treated with a biologically effective dose ≤100Gy versus 99% for patients treated with >100Gy (p=0.01). Seventeen patients (14%) developed toxicity classified as grade 1, and three patients (3%) developed grade 2 toxicity. No grade ≥3 toxicity occurred. These results should serve as a benchmark for future prospective trials. This multi-institutional study pools all of the available data on the use of stereotactic body radiotherapy for limited prostate cancer metastases. We concluded that this approach is safe and associated with a prolonged treatment progression-free survival. Copyright © 2015. Published by Elsevier B.V.

Association of versican turnover with all-cause mortality in patients on haemodialysis

DEFF Research Database (Denmark)

Genovese, Federica; Karsdal, Morten A; Leeming, Diana J

2014-01-01

with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...

Choline kinase alpha and hexokinase-2 protein expression in hepatocellular carcinoma: association with survival.

Directory of Open Access Journals (Sweden)

Sandi A Kwee

Full Text Available PURPOSE: Hexokinase-2 (HK2 and more recently choline kinase alpha (CKA expression has been correlated with clinical outcomes in several major cancers. This study examines the protein expression of HK2 and CKA in hepatocellular carcinoma (HCC in association with patient survival and other clinicopathologic parameters. METHODS: Immunohistochemical analysis for HK2 and CKA expression was performed on a tissue microarray of 157 HCC tumor samples. Results were analyzed in relation to clinicopathologic data from Surveillance, Epidemiology, and End-Results Program registries. Mortality rates were assessed by Kaplan-Meier estimates and compared using log-rank tests. Predictors of overall survival were assessed using proportional hazards regression. RESULTS: Immunohistochemical expression of HK2 and CKA was detected in 71 (45% and 55 (35% tumor samples, respectively. Differences in tumor HK2 expression were associated with tumor grade (p = 0.008 and cancer stage (p = 0.001, while CKA expression differed significantly only across cancer stage (p = 0.048. Increased mortality was associated with tumor HK2 expression (p = 0.003 as well as CKA expression (p = 0.03 with hazard ratios of 1.86 (95% confidence interval (CI 1.23-2.83 and 1.59 (95% CI 1.04-2.41, respectively. Similar effects on overall survival were noted in a subset analysis of early stage (I and II HCC. Tumor HK2 expression, but not CKA expression, remained a significant predictor of survival in multivariable analyses. CONCLUSION: HK2 and CKA expression may have biologic and prognostic significance in HCC, with tumor HK2 expression being a potential independent predictor of survival.

Survival in patients with oral and maxillofacial diffuse large B-cell lymphoma

Directory of Open Access Journals (Sweden)

Janet Ofelia Guevara-Canales

2013-11-01

Full Text Available The purpose of this study was to determine the survival and prognostic factors of patients with diffuse large B-cell lymphoma (DLBCL of the oral cavity and maxillofacial region. Retrospectively, the clinical records of patients with a primary diagnosis of DLBCL of the oral cavity and maxillofacial region treated at the A.C. Camargo Hospital for Cancer, São Paulo, Brazil, between January 1980 and December 2005 were evaluated to determine (A overall survival (OS at 2 and 5 years and the individual survival percentage for each possible prognostic factor by means of the actuarial technique (also known as mortality tables, and the Kaplan Meier product limit method (which provided the survival value curves for each possible prognostic factor; (B prognostic factors subject to univariate evaluation with the log-rank test (also known as Mantel-Cox, and multivariate analysis with Cox's regression model (all the variables together. The data were considered significant at p ≤ 0.05. From 1980 to 2005, 3513 new cases of lymphomas were treated, of which 151 (4.3% occurred in the oral cavity and maxillofacial region. Of these 151 lesions, 48 were diffuse large B-cell lymphoma, with 64% for OS at 2 years and 45% for OS at 5 years. Of the variables studied as possible prognostic factors, multivariate analysis found the following variables have statistically significant values: age (p = 0.042, clinical stage (p = 0.007 and performance status (p = 0.031. These data suggest that patients have a higher risk of mortality if they are older, at a later clinical stage, and have a higher performance status.

Neoadjuvant treatment and adjuvant radiotherapy for patients with high risk prostate cancer and radical prostatectomy

International Nuclear Information System (INIS)

Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo

2009-01-01

Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es

Acute myeloid leukemia: survival analysisof patients at a university hospital of Paraná

Directory of Open Access Journals (Sweden)

Sergio Lunardon Padilha

2015-02-01

Full Text Available Objective: The aim of this study was to analyze the prognostic factors correlated with survival of patients with acute myeloid leukemia at the Hospital de Clínicas, Universidade Federal do Paraná between 2003 and 2009, as well as to investigate the clinical and epidemiological profile. Methods: The overall survival and disease-free survival were statistically evaluated using the Kaplan-Meier method, the log-rank test and multivariate evaluation by Cox regression analysis. Results: The study population was predominantly younger than 60 years old (81,6%, had intermediate cytogenetic risk (40.8%, in first complete remission after induction chemotherapy (46.9%, with a white blood count at diagnosis of less than 30 × 109 /L (57.1% and de novo acute myeloid leukemia (62.2%. Survival curves showed that better prognosis was related to age below 60 years (median:12,4 months; p-value = 0,2227; Odds Ratio = 0,6676, good pro- gnostic cytogenetic markers (median: 97.7 months; p-value = 0.0037; Odds Ratio = 0.4239 and white blood cell count at diagnosis of less than 30 × 109 /L (median survival: 23.6 months; p- value = 0.0001; Odds Ratio = 0.3651. Regarding the French-American-British subgroups, the median overall survival was 23.5 months for M0, M1 and M2, 97.7 months for M3 and 7.4 months for M4, M5, M6, and M7 (p-value = 0.0288. Conclusion: Prognostic factors strongly influenced patient survival, as well as guided treat- ment. Moreover, these factors were consistent with the available literature adjusted for the population in question.

Evaluation of the effects of red blood cell distribution width on survival in lung cancer patients.

Science.gov (United States)

Kos, Mehmet; Hocazade, Cemil; Kos, F Tugba; Uncu, Dogan; Karakas, Esra; Dogan, Mutlu; Uncu, Hikmet G; Ozdemir, Nuriye; Zengin, Nurullah

2016-01-01

Data are available indicating that red blood cell distribution width (RDW) is higher in cancer patients compared to healthy individuals or benign events. In our study, we aimed to investigate the influence of different RDW levels on survival in lung cancer patients. Clinical and laboratory data from 146 patients with lung cancer and 40 healthy subjects were retrospectively studied. RDW was recorded before the application of any treatment. Patients were categorised according to four different RDW cut-off values (median RDW, RDW determined by ROC curve analysis, the upper limit at the automatic blood count device, and RDW cut of value which used in previous studies). Kaplan-Meier survival analysis was used to examine the effect of RDW on survival for each cut-off level. The median age of patients was 56.5 years (range: 26-83 years). The difference in median RDW between patients and the control group was statistically significant (14.0 and 13.8, respectively, p = 0.04). There was no difference with regard to overall survival when patients with RDW ≥ 14.0 were compared to those with RDW < 14.0 (p = 0.70); however, overall survival was 3.0 months shorter in low values of its own group in each of the following cut-off values: ≥ 14.2 (p = 0.34), ≥ 14.5 (p = 0.25), ≥ 15 (p = 0.59), although no results were statistically significant. We consider that the difference between low and high RDW values according to certain cut-off values may reflect the statistics of larger studies although there is a statistically negative correlation between RDW level and survival.

Nested Cohort - R software package

Science.gov (United States)

NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.

Incidence, treatment, and survival patterns for sacral chordoma in the United States, 1974-2011

Directory of Open Access Journals (Sweden)

Esther Yu

2016-09-01

Full Text Available IntroductionSacral chordomas represent one half of all chordomas, a rare neoplasm of notochordal remnants. Current NCCN guidelines recommend surgical resection with or without adjuvant radiotherapy, or definitive radiation for unresectable cases. Recent advances in radiation for chordomas include conformal photon and proton beam radiation. We investigated incidence, treatment, and survival outcomes to observe any trends in response to improvements in surgical and radiation techniques over a near 40 year time period.Materials and Methods345 microscopically confirmed cases of sacral chordoma were identified between 1974 and 2011 from the Surveillance, Epidemiology, and End Results (SEER program of the National Cancer Institute. Cases were divided into three cohorts by calendar year, 1974-1989, 1990-1999, and 2000-2011, as well as into two groups by age less than or equal to 65 versus greater than 65 to investigate trends over time and age via Chi-square analysis. Kaplan-Meier analyses were performed to determine effects of treatment on survival. Multivariate Cox regression analysis was performed to determine predictors of overall survival.Results5-year overall survival for the entire cohort was 60.0%. Overall survival correlated significantly with treatment modality, with 44% surviving at 5 years with no treatment, 52% with radiation alone, 82% surgery alone, and 78% surgery and radiation (p<.001. Age greater than 65 was significantly associated with non-surgical management with radiation alone or no treatment (p<.001. Relatively fewer patients received radiation between 2000 and 2011 compared to prior time periods (p=.03 versus surgery, for which rates which did not vary significantly over time (p=.55. However, 5-year overall survival was not significantly different by time period. Age group and treatment modality were predictive for overall survival on multivariate analysis (p<.001. ConclusionSurgery remains an important component in the

Nutritional factors as predictors of response to radio-chemotherapy and survival in unresectable squamous head and neck carcinoma

International Nuclear Information System (INIS)

Salas, Sebastien; Deville, Jean-Laurent; Giorgi, Roch; Pignon, Thierry; Bagarry, Danielle; Barrau, Karine; Zanaret, Michel; Giovanni, Antoine; Bourgeois, Aude; Favre, Roger; Duffaud, Florence

2008-01-01

Background and purpose: This study sought to evaluate nutritional prognostic factors before treatment in patients with unresectable head and neck cancer treated by concomitant radio-chemotherapy. Methods and materials: Seventy-two consecutive patients were treated. We studied the potential effects of CRP, Alb, preAlb, orosomucoid, weight, weight history, BMI, PINI, OPR and NRI on response to treatment, Event-Free Survival (EFS) and Overall Survival (OS). Effects of potential risk factors on OS and on EFS were analyzed by computing Kaplan-Meier estimates, and curves were compared using the log-rank test. Results: All biological nutritional factors were statistically correlated with the response to radio-chemotherapy. In multivariate analysis, only CRP (p = 0.004) remained statistically significant. A statistical correlation was found between Alb and EFS in multivariate analysis (p = 0.04). The factors influencing OS in univariate analysis were Alb (p = 0.008), CRP (p = 0.004), orosomucoid (p = 0.01) and NRI (p = 0.01), response to radio-chemotherapy (p < 0.001) and staging (p = 0.04). In multivariate analysis, only the response to radio-chemotherapy (p < 0.001) remained significant. Conclusions: This study illustrates the prognostic value of nutritional status. CRP and Alb may be useful in the assessment of advanced head and neck cancer patients at diagnosis and for stratifying patients taking part in randomized trials

Disparities in cervical cancer survival among Asian American women

Science.gov (United States)

Nghiem, Van T.; Davies, Kalatu R.; Chan, Wenyaw; Mulla, Zuber D.; Cantor, Scott B.

2015-01-01

Purpose We compared overall survival and influencing factors between Asian American women as a whole and by subgroup with white women with cervical cancer. Methods Cervical cancer data were from the Surveillance, Epidemiology, and End Results registry; socioeconomic information was from the Area Health Resource File. We used standard tests to compare characteristics between groups; the Kaplan-Meier method with log-rank test to assess overall survival and compare it between groups; and Cox proportional hazards models to determine the effect of race and other covariates on overall survival (with/without age-stratification). Results Being 3.3 years older than white women at diagnosis (pAsian American women were more likely to be in a spousal relationship, had more progressive disease, and were better off socioeconomically. Women of Filipino, Japanese, and Korean origin had similar clinical characteristics compared with white women. Asian American women had higher 36- and 60-month survival rates (p=0.004 and p=0.013, respectively), higher overall survival rates (p=0.049), and longer overall survival durations after adjusting for age and other covariates (hazard ratio=0.77, 95% confidence interval: 0.68–0.86). Overall survival differed across age strata between the two racial groups. With the exception of women of Japanese or Korean origin, Asian American women grouped by geographic origin had better overall survival than white women. Conclusions Although Asian American women, except those of Japanese or Korean origin, had better overall survival than white women, their older age at cervical cancer diagnosis suggests that they have less access to screening programs. PMID:26552330

Disparities in cervical cancer survival among Asian-American women.

Science.gov (United States)

Nghiem, Van T; Davies, Kalatu R; Chan, Wenyaw; Mulla, Zuber D; Cantor, Scott B

2016-01-01

We compared overall survival and influencing factors between Asian-American women as a whole and by subgroup with white women with cervical cancer. Cervical cancer data were from the Surveillance, Epidemiology, and End Results registry; socioeconomic information was from the Area Health Resource File. We used standard tests to compare characteristics between groups; the Kaplan-Meier method with log-rank test to assess overall survival and compare it between groups; and Cox proportional hazards models to determine the effect of race and other covariates on overall survival (with and/or without age stratification). Being 3.3 years older than white women at diagnosis (P Asian-American women were more likely to be in a spousal relationship, had more progressive disease, and were better off socioeconomically. Women of Filipino, Japanese, and Korean origin had similar clinical characteristics compared to white women. Asian-American women had higher 36- and 60-month survival rates (P = .004 and P = .013, respectively), higher overall survival rates (P = .049), and longer overall survival durations after adjusting for age and other covariates (hazard ratio = 0.77, 95% confidence interval: 0.68-0.86). Overall survival differed across age strata between the two racial groups. With the exception of women of Japanese or Korean origin, Asian-American women grouped by geographic origin had better overall survival than white women. Although Asian-American women, except those of Japanese or Korean origin, had better overall survival than white women, their older age at cervical cancer diagnosis suggests that they have less access to screening programs. Copyright © 2016 Elsevier Inc. All rights reserved.

CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

Energy Technology Data Exchange (ETDEWEB)

Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)

2017-03-15

The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

Impact of housing on the survival of persons with AIDS.

Science.gov (United States)

Schwarcz, Sandra K; Hsu, Ling C; Vittinghoff, Eric; Vu, Annie; Bamberger, Joshua D; Katz, Mitchell H

2009-07-07

Homeless persons with HIV/AIDS have greater morbidity and mortality, more hospitalizations, less use of antiretroviral therapy, and worse medication adherence than HIV-infected persons who are stably housed. We examined the effect of homelessness on the mortality of persons with AIDS and measured the effect of supportive housing on AIDS survival. The San Francisco AIDS registry was used to identify homeless and housed persons who were diagnosed with AIDS between 1996 and 2006. The registry was computer-matched with a housing database of homeless persons who received housing after their AIDS diagnosis. The Kaplan-Meier product limit method was used to compare survival between persons who were homeless at AIDS diagnosis and those who were housed. Proportional hazards models were used to estimate the independent effects of homelessness and supportive housing on survival after AIDS diagnosis. Of the 6,558 AIDS cases, 9.8% were homeless at diagnosis. Sixty-seven percent of the persons who were homeless survived five years compared with 81% of those who were housed (p Homelessness increased the risk of death (adjusted relative hazard [RH] 1.20; 95% confidence limits [CL] 1.03, 1.41). Homeless persons with AIDS who obtained supportive housing had a lower risk of death than those who did not (adjusted RH 0.20; 95% CL 0.05, 0.81). Supportive housing ameliorates the negative effect of homelessness on survival with AIDS.

Important prognostic factors for the long-term survival of lung cancer subjects in Taiwan

International Nuclear Information System (INIS)

Chiang, Tai-An; Chen, Ping-Ho; Wu, Pei-Fen; Wang, Tsu-Nai; Chang, Po-Ya; Ko, Albert Min-Shan; Huang, Ming-Shyan; Ko, Ying-Chin

2008-01-01

This study used a large-scale cancer database in determination of prognostic factors for the survival of lung cancer subjects in Taiwan. Total of 24,910 subjects diagnosed with lung cancer was analysed. Survival estimates by Kaplan-Meier methods. Cox proportional-hazards model estimated the death risk (hazard ratio (HR)) for various prognostic factors. The prognostic indicators associated with a higher risk of lung cancer deaths are male gender (males versus females; HR = 1.07, 95% confidence intervals (CI): 1.03–1.11), males diagnosed in later periods (shown in 1991–1994 versus 1987–1990; HR = 1.13), older age at diagnosis, large cell carcinoma (LCC)/small cell carcinoma (SCC), and supportive care therapy over chemotherapy. The overall 5-year survival rate for lung cancer death was significantly poorer for males (21.3%) than females (23.6%). Subjects with squamous cell carcinoma (SQCC) and treatment by surgical resection alone had better prognosis. We find surgical resections to markedly increase 5-year survival rate from LCC, decreased risk of death from LCC, and no improved survival from SCC. Gender and clinical characteristics (i.e. diagnostic period, diagnostic age, histological type and treatment modality) play important roles in determining lung cancer survival

Breast Cancer Survival Defined by the ER/PR/HER2 Subtypes and a Surrogate Classification according to Tumor Grade and Immunohistochemical Bio markers

International Nuclear Information System (INIS)

Parise, C. A.; Caggiano, V.

2014-01-01

ER, PR, and HER2 are routinely available in breast cancer specimens. The purpose of this study is to contrast breast cancer-specific survival for the eight ER/PR/HER2 subtypes with survival of an immunohistochemical surrogate for the molecular subtype based on the ER/PR/HER2 subtypes and tumor grade. Methods. We identified 123,780 cases of stages 1-3 primary female invasive breast cancer from California Cancer Registry. The surrogate classification was derived using ER/PR/HER2 and tumor grade. Kaplan-Meier survival analysis and Cox proportional hazards modeling were used to assess differences in survival and risk of mortality for the ER/PR/HER2 subtypes and surrogate classification within each stage. Results. The luminal B/HER2− surrogate classification had a higher risk of mortality than the luminal B/HER2+ for all stages of disease. There was no difference in risk of mortality between the ER+/PR+/HER2− and ER+/PR+/HER2+ in stage 3. With one exception in stage 3, the ER-negative subtypes all had an increased risk of mortality when compared with the ER-positive subtypes. Conclusions. Assessment of survival using ER/PR/HER2 illustrates the heterogeneity of HER2+ subtypes. The surrogate classification provides clear separation in survival and adjusted mortality but underestimates the wide variability within the subtypes that make up the classification.

Prognostic factors for survival in patients with colorectal liver metastases: experience of a single brazilian cancer center

Directory of Open Access Journals (Sweden)

Héber Salvador de Castro Ribeiro

2012-12-01

Full Text Available CONTEXT: Liver metastases are a common event in the clinical outcome of patients with colorectal cancer and account for 2/3 of deaths from this disease. There is considerable controversy among the data in the literature regarding the results of surgical treatment and prognostic factors of survival, and no analysis have been done in a large cohort of patients in Brazil. OBJECTIVES: To characterize the results of surgical treatment of patients with colorectal liver metastases, and to establish prognostic factors of survival in a Brazilian population. METHOD: This was a retrospective study of patients undergoing liver resection for colorectal metastases in a tertiary cancer hospital from 1998 to 2009. We analyzed epidemiologic variables and the clinical characteristics of primary tumors, metastatic disease and its treatment, surgical procedures and follow-up, and survival results. Survival analyzes were done by the Kaplan-Meier method and the log-rank test was applied to determine the influence of variables on overall and disease-free survival. All variables associated with survival with P<0.20 in univariate analysis, were included in multivariate analysis using a Cox proportional hazard regression model. RESULTS: During the period analyzed, 209 procedures were performed on 170 patients. Postope-rative mortality in 90 days was 2.9% and 5-year overall survival was 64.9%. Its independent prognostic factors were the presence of extrahepatic disease at diagnosis of liver metastases, bilateral nodules and the occurrence of major complications after liver surgery. The estimated 5-year disease-free survival was 39.1% and its prognostic factors included R1 resection, extrahepatic disease, bilateral nodules, lymph node involvement in the primary tumor and primary tumors located in the rectum. CONCLUSION: Liver resection for colorectal metastases is safe and effective and the analysis of prognostic factors of survival in a large cohort of Brazilian patients

Survival after Radiofrequency Ablation in 122 Patients with Inoperable Colorectal Lung Metastases

Energy Technology Data Exchange (ETDEWEB)

Gillams, Alice, E-mail: alliesorting@gmail.com [The London Clinic, Radiology Department (United Kingdom); Khan, Zahid [Countess of Chester Hospital (United Kingdom); Osborn, Peter [Queen Alexandra Hospital (United Kingdom); Lees, William [University College London Medical School (United Kingdom)

2013-06-15

Purpose. To analyze the factors associated with favorable survival in patients with inoperable colorectal lung metastases treated with percutaneous image-guided radiofrequency ablation. Methods. Between 2002 and 2011, a total of 398 metastases were ablated in 122 patients (87 male, median age 68 years, range 29-90 years) at 256 procedures. Percutaneous CT-guided cool-tip radiofrequency ablation was performed under sedation/general anesthesia. Maximum tumor size, number of tumors ablated, number of procedures, concurrent/prior liver ablation, previous liver or lung resection, systemic chemotherapy, disease-free interval from primary resection to lung metastasis, and survival from first ablation were recorded prospectively. Kaplan-Meier analysis was performed, and factors were compared by log rank test. Results. The initial number of metastases ablated was 2.3 (range 1-8); the total number was 3.3 (range 1-15). The maximum tumor diameter was 1.7 (range 0.5-4) cm, and the number of procedures was 2 (range 1-10). The major complication rate was 3.9 %. Overall median and 3-year survival rate were 41 months and 57 %. Survival was better in patients with smaller tumors-a median of 51 months, with 3-year survival of 64 % for tumors 2 cm or smaller versus 31 months and 44 % for tumors 2.1-4 cm (p = 0.08). The number of metastases ablated and whether the tumors were unilateral or bilateral did not affect survival. The presence of treated liver metastases, systemic chemotherapy, or prior lung resection did not affect survival. Conclusion. Three-year survival of 57 % in patients with inoperable colorectal lung metastases is better than would be expected with chemotherapy alone. Patients with inoperable but small-volume colorectal lung metastases should be referred for ablation.

Effects of marital status on survival of hepatocellular carcinoma by race/ethnicity and gender.

Science.gov (United States)

Wu, Wenrui; Fang, Daiqiong; Shi, Ding; Bian, Xiaoyuan; Li, Lanjuan

2018-01-01

It is well demonstrated that being married is associated with a better prognosis in multiple types of cancer. However, whether the protective effect of marital status varied across race/ethnicity and gender in patients with hepatocellular carcinoma remains unclear. Therefore, we aimed to evaluate the roles of race/ethnicity and gender in this relationship. We identified eligible patients from Surveillance, Epidemiology and End Results (SEER) database during 2004-2012. Overall and cancer-specific survival differences across marital status were compared by Kaplan-Meier curves. We also estimated crude hazard ratios (CHRs) and adjusted hazard ratios (AHRs) with 95% confidence intervals (CIs) for marital status associated with survival by race/ethnicity and gender in Cox proportional hazard models. A total of 12,168 eligible patients diagnosed with hepatocellular carcinoma were included. We observed that married status was an independent protective prognostic factor for overall and cancer-specific survival. In stratified analyses by race/ethnicity, the AHR of overall mortality (unmarried vs married) was highest for Hispanic (AHR =1.25, 95% CI, 1.13-1.39; P married patients obtained better survival advantages. Race/ethnicity and gender could influence the magnitude of associations between marital status and risk of mortality.

ORIGINAL ARTICLES Antiretroviral treatment for children

African Journals Online (AJOL)

Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.

Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe

DEFF Research Database (Denmark)

Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther

2014-01-01

on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...

Improved Metastasis- and Disease-Free Survival With Preoperative Sequential Short-Course Radiation Therapy and FOLFOX Chemotherapy for Rectal Cancer Compared With Neoadjuvant Long-Course Chemoradiotherapy: Results of a Matched Pair Analysis.

Science.gov (United States)

Markovina, Stephanie; Youssef, Fady; Roy, Amit; Aggarwal, Sonya; Khwaja, Shariq; DeWees, Todd; Tan, Benjamin; Hunt, Steven; Myerson, Robert J; Chang, Daniel T; Parikh, Parag J; Olsen, Jeffrey R

2017-10-01

To compare treatment and toxicity outcomes between a phase 2 institutional trial of near total neoadjuvant therapy (nTNT) for locally advanced rectal cancer and a similar historical control cohort treated at Washington University in St. Louis with the current US standard of care, defined as neoadjuvant chemoradiotherapy (NCRT), total mesorectal excision (TME), and adjuvant FOLFOX chemotherapy; to expand the comparison to an additional institution, patients treated with similar NCRT at Stanford University were included. Sixty-nine patients with cT3-4N0-2M0 rectal adenocarcinoma enrolled on the Washington University in St. Louis phase 2 study of nTNT were included for analysis. Patients treated at the same institution with conventional NCRT and adjuvant FOLFOX were matched for exact cTNM stage. Forty-one patients treated with NCRT at Stanford University were included in a second analysis. Kaplan-Meier analysis with log-rank test was used to compare local control, distant metastasis-free survival, disease-free survival, and overall survival. Median follow-up was 49 and 54 months for nTNT and NCRT, respectively. Pathologic complete response and T-downstaging rates were 28% versus 16% (P=.21) and 75% versus 41% (P<.001) in the nTNT and NCRT cohorts, respectively. Three-year disease-free survival (85% vs 68%, P=.032) was significantly better in the nTNT group. Actuarial 3-year local control (92% vs 96%, P=.36) and overall survival (96% vs 88%, P=.67) were similar. The Stanford cohort had significantly lower clinical stage. After controlling for clinical stage, age, tumor location, institution, and number of chemotherapy cycles, nTNT treatment remained significantly associated with lower risk of recurrence (P=.006). Patients treated with nTNT had higher T-downstaging and superior distant metastasis-free survival and disease-free survival compared with conventional NCRT when matched for tumor location and exact cTNM stage. Near total neoadjuvant therapy remained a

The survival analysis on localized prostate cancer treated with neoadjuvant endocrine therapy followed by intensity modulated radiation therapy

International Nuclear Information System (INIS)

Gao Hong; Li Gaofeng; Wu Qinhong; Li Xuenan; Zhong Qiuzi; Xu Yonggang

2010-01-01

Objective: To retrospectively investigate clinical outcomes and prognostic factors in localized prostate cancer treated with neoadjuvant endocrine therapy followed by intensity modulated radiotherapy (IMRT). Methods: Between March 2003 and October 2008, 54 localized prostate cancer treated by IMRT were recruited. All patients had received endocrine therapy before IMRT. The endocrine therapy included surgical castration or medical castration in combination with antiandrogens. The target of IMRT was the prostate and seminal vesicles with or without pelvis. The biochemical failure was defined according to the phoenix definition. By using the risk grouping standard proposed by D'Amico, patients were divided into three groups: low-risk group (n = 5), intermediate-risk group (n = 12), and high-risk group (n = 37). Kaplan-Meier method was used to calculate the overall survival rate. Prognostic factors were analyzed by univariate and multiple Cox regression analysis. Results: The follow-up rate was 98%. The number of patients under follow-up was 39 at 3 years and 25 at 5 years. Potential prognostic factors, including risk groups, mode of endocrine therapy, time of endocrine therapy, phoenix grouping before IMRT, the prostate specific antigen doubling time (PSADT) before radiotherapy, PSA value before IMRT, interval of endocrine therapy and IMRT, irradiation region, and irradiation dose were analyzed by survival analysis. In univariate analysis, time of endocrine therapy (75 % vs 95 %, χ 2 = 6. 45, P = 0. 011), phoenix grouping before IMRT (87% vs 96%, χ 2 = 4. 36, P = 0. 037), interval of endocrine therapy and IMRT (80% vs 95%, χ 2 = 11.60, P= 0. 001), irradiation dose (75% vs 91%, χ 2 =5.92, P= 0. 015) were statistically significant prognostic factors for 3 - year overall survival , and risk groups (85 vs 53 vs 29, χ 2 = 6. 40, P =0. 041) and PSADT before IMRT (62 vs 120, U =24. 50, P =0. 003) were significant factors for the median survival time. In the multiple Cox

The effect of adjuvant radiation on survival in early stage clear cell ovarian carcinoma.

Science.gov (United States)

Hogen, Liat; Thomas, Gillian; Bernardini, Marcus; Bassiouny, Dina; Brar, Harinder; Gien, Lilian T; Rosen, Barry; Le, Lisa; Vicus, Danielle

2016-11-01

To assess the impact of adjuvant radiotherapy (RT) on survival in patients with stage I and II ovarian clear cell carcinoma (OCCC). Data collection and analysis of stage I and II OCCC patients treated at two tertiary centers in Toronto, between 1995 and 2014, was performed. Descriptive statistics and Kaplan-Meier survival probability estimates were completed. The log-rank test was used to compare survival curves. 163 patients were eligible. 44 (27%) patients were treated with adjuvant RT: 37 of them received adjuvant chemotherapy (CT), and 7 had RT only. In the no-RT group, there were 119 patients: 83 patients received adjuvant CT and 36 had no adjuvant treatment. The 10year progression free survival (PFS) was 65% for patients treated with RT, and 59% no-RT patients. There were a total of 41 (25%) recurrences in the cohort: 12 (27.2%) patients in RT group and 29 (24.3%) in the no-RT group. On multivariable analysis, adjuvant RT was not significantly associated with an increased PFS (0.85 (0.44-1.63) p=0.63) or overall survival (OS) (0.84 (0.39-1.82) p=0.66). In the subset of 59 patients defined as high-risk: stage IC with positive cytology and/or surface involvement and stage II: RT was not found to be associated with a better PFS (HR 1.18 (95% CI: 0.55-2.54) or O S(HR 1.04 (95% CI: 0.40-2.69)). Adjuvant RT was not found to be associated with a survival benefit in patients with stage I and II ovarian clear cell carcinoma or in a high risk subset of patients including stage IC cytology positive/surface involvement and stage II patients. Copyright © 2016 Elsevier Inc. All rights reserved.

Prognostic factors for survival of women with unstable spinal bone metastases from breast cancer

International Nuclear Information System (INIS)

Foerster, Robert; Bruckner, Thomas; Bostel, Tilman; Schlampp, Ingmar; Debus, Juergen; Rief, Harald

2015-01-01

Bone metastases are an important clinical issue in women with breast cancer. Particularly, unstable spinal bone metastases (SBM) are a major cause of severe morbidity and reduced quality of life (QoL) due to frequent immobilization. Radiotherapy (RT) is the major treatment modality and is capable of promoting re-ossification and improving stability. Since local therapy response is excellent, survival of these patients with unstable SBM is of high clinical importance. We therefore conducted this analysis to assess survival and to determine prognostic factors for bone survival (BS) in women with breast cancer and unstable SBM. A total population of 92 women with unstable SBM from breast cancer who were treated with RT at our department between January 2000 and January 2012 was retrospectively investigated. We calculated overall survival (OS) and BS (time between first diagnosis of bone metastases until death) with the Kaplan-Meier method and assessed prognostic factors for BS with a Cox regression model. Mean age at first diagnosis of breast cancer was 60.8 years ± SD 12.4 years. OS after 1, 2 and 5 years was 84.8, 66.3 and 50 %, respectively. BS after 1, 2 and 5 years was 62.0, 33.7 and 12 %, respectively. An age > 50 years (p < .001; HR 1.036 [CI 1.015–1.057]), the presence of a single bone metastasis (p = .002; HR 0.469 [CI 0.292–0.753]) and triple negative phenotype (p < .001; HR 1.068 [CI 0.933–1.125]) were identified as independent prognostic factors for BS. Our analysis demonstrated a short survival of women with breast cancer and unstable SBM. Age, presence of a solitary SBM and triple-negative phenotype correlated with survival. Our results may have an impact on therapeutic decisions in the future and offer a rationale for future prospective investigations

MNS16A minisatellite genotypes in relation to risk of glioma and meningioma and to glioblastoma outcome

DEFF Research Database (Denmark)

Andersson, U.; Osterman, P.; Sjostrom, S.

2009-01-01

was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...

Primary Squamous Cell Carcinoma of the Thyroid: A Population-Based Analysis.

Science.gov (United States)

Au, Joshua K; Alonso, Jose; Kuan, Edward C; Arshi, Armin; St John, Maie A

2017-07-01

Objectives To analyze the epidemiology and describe the prognostic indicators of patients with primary squamous cell carcinoma of the thyroid. Study Design and Setting Retrospective cohort study based on a national database. Methods The US National Cancer Institute's SEER registry (Surveillance, Epidemiology, and End Results) was reviewed for patients with primary squamous cell carcinoma of the thyroid from 1973 to 2012. Study variables included age, sex, race, tumor size, tumor grade, regional and distant metastases, and treatment modality. Survival measures included overall survival (OS) and disease-specific survival (DSS). Results A total of 199 cases of primary squamous cell carcinoma of the thyroid were identified. Mean age at diagnosis was 68.1 years; 58.3% were female; and 79.4% were white. Following diagnosis, 46.3% of patients underwent surgery; 55.7%, radiation therapy; and 45.8%, surgery with radiation therapy. Kaplan-Meier analysis demonstrated OS and DSS of 16% and 21% at 5 years, respectively. Median survival after diagnosis was 9.1 months. Multivariate Cox regression analysis showed that predictors of OS and DSS included age ( P Squamous cell carcinoma of the thyroid is a rare malignancy with a very poor prognosis. Surgical resection confers an overall survival benefit. Age, tumor grade, and tumor size are predictors of OS and DSS.

Amyotrophic lateral sclerosis: impact of pulmonary follow-up and mechanical ventilation on survival. A study of 114 cases.

Science.gov (United States)

Sanjuán-López, Pilar; Valiño-López, Paz; Ricoy-Gabaldón, Jorge; Verea-Hernando, Héctor

2014-12-01

To study the impact of ventilatory management and treatment on the survival of patients with amyotrophic lateral sclerosis (ALS). Retrospective analysis of 114 consecutive patients admitted to a general hospital, evaluating demographic data, type of presentation, clinical management, treatment with mechanical ventilation and survival. descriptive and Kaplan-Meier estimator. Sixty four patients presented initial bulbar involvement. Overall mean survival after diagnosis was 28.0 months (95%CI, 21.1-34.8). Seventy patients were referred to the pulmonary specialist (61.4%) and 43 received non-invasive ventilation (NIV) at 12.7 months (median) after diagnosis. Thirty seven patients continued to receive NIV with no subsequent invasive ventilation. The mean survival of these patients was 23.3 months (95%CI, 16.7-28.8), higher in those without bulbar involvement, although below the range of significance. Survival in the 26 patients receiving programmed NIV was higher than in the 11 patients in whom this was indicated without prior pulmonary assessment (considered following diagnosis, P<.012, and in accordance with the start of ventilation, P<.004). A total of 7 patients were treated invasively; mean survival in this group was 72 months (95%CI, 14.36-129.6), median 49.6±17.5 (95%CI, 15.3-83.8), and despite the difficulties involved in home care, acceptance and tolerance was acceptable. Long-term mechanical ventilation prolongs survival in ALS. Programmed pulmonary assessment has a positive impact on survival of ALS patients and is key to the multidisciplinary management of this disease. Copyright © 2014 SEPAR. Published by Elsevier Espana. All rights reserved.

Yttrium-90 Radioembolization for Unresectable Standard-chemorefractory Intrahepatic Cholangiocarcinoma: Survival, Efficacy, and Safety Study

Energy Technology Data Exchange (ETDEWEB)

Rafi, Shoaib; Piduru, Sarat M. [Emory University School of Medicine, Division of Interventional Radiology and Image Guided Medicine, Department of Radiology (United States); El-Rayes, Bassel; Kauh, John S. [Emory University School of Medicine, Department of Hematology and Medical Oncology (United States); Kooby, David A.; Sarmiento, Juan M. [Emory University School of Medicine, Department of Surgical Oncology in Surgery (United States); Kim, Hyun S., E-mail: kevin.kim@emory.edu [Emory University School of Medicine, Division of Interventional Radiology and Image Guided Medicine, Department of Radiology (United States)

2013-04-15

To assess the overall survival, efficacy, and safety of radioembolization with yttrium-90 (Y90) for unresectable standard-chemorefractory intrahepatic cholangiocarcinoma (ICC). Patients with unresectable standard-chemorefractory ICC treated with Y90 were studied. Survival was calculated from the date of first Y90 procedure. Tumor response was assessed with the Response Evaluation Criteria in Solid Tumors criteria on follow-up computed tomography or magnetic resonance imaging scans. National Cancer Institute Common Terminology Criteria (NCI CTCAE), version 3, were used for complications. Statistical analysis was performed by the Kaplan-Meier estimator by the log rank test. Nineteen patients underwent a total of 24 resin-based Y90 treatments. Median survival from the time of diagnosis and first Y90 procedure was 752 {+-} 193 [95 % confidence interval (CI) 374-1130] and 345 {+-} 128 (95 % CI 95-595) days, respectively. Median survival with Eastern Cooperative Oncology Group (ECOG) performance status 1 (n = 15) and ECOG performance status 2 (n = 4) was 450 {+-} 190 (95 % CI 78-822) and 345 {+-} 227 (95 % CI 0-790) days, respectively (p = .214). Patients with extrahepatic metastasis (n = 11) had a median survival of 404 {+-} 309 (95 % CI 0-1010) days versus 345 {+-} 117 (95 % CI 115-575) days for patients without metastasis (n = 8) (p = .491). No mortality was reported within 30 days from first Y90 radioembolization. One patient developed grade 3 thrombocytopenia as assessed by NCI CTCAE. Fatigue and transient abdominal pain were observed in 4 (21 %) and 6 (32 %) patients, respectively. Y90 radioembolization is effective for unresectable standard-chemorefractory ICC.

Reporting of loss to follow-up information in randomised controlled trials with time-to-event outcomes: a literature survey

Directory of Open Access Journals (Sweden)

Bender Ralf

2011-09-01

Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.

RBPJ and EphrinB2 as Molecular Targets to Treat Brain Arteriovenous Malformation in Notch4 Induced Mouse Model

Science.gov (United States)

2017-10-01

of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to

Chondrosarcoma of the Osseous Spine: An Analysis of Epidemiology, Patient Outcomes, and Prognostic Factors Using the SEER Registry From 1973 to 2012.

Science.gov (United States)

Arshi, Armin; Sharim, Justin; Park, Don Y; Park, Howard Y; Bernthal, Nicholas M; Yazdanshenas, Hamed; Shamie, Arya N

2017-05-01

Retrospective analysis. To determine the epidemiology and prognostic indicators in patients with chondrosarcoma of the osseous spine. Chondrosarcoma of the spine is rare, with limited data on its epidemiology, clinicopathologic features, and treatment outcomes. Therapy centers on complete en bloc resection with radiotherapy reserved for subtotal resection or advanced disease. The Surveillance, Epidemiology, and End Results Registry was queried for patients with chondrosarcoma of the osseous spine from 1973 to 2012. Study variables included age, sex, race, year of diagnosis, size, grade, extent of disease, and treatment modality. The search identified 973 cases of spinal chondrosarcoma. Mean age at diagnosis was 51.6 years, and 627% of patients were males. Surgical resection and radiotherapy were performed in 75.2% and 21.3% of cases, respectively. Kaplan-Meier analysis demonstrated overall survival (OS) and disease-specific survival (DSS) of 53% and 64%, respectively, at 5 years. Multivariate Cox regression analysis showed that age (OS, P chondrosarcoma of the spine independent of extent of disease. Radiotherapy improves survival in patients with metastatic disease and worsens outcomes in patients with confined and locally invasive disease. 4.

Multifactorial risk assessment for survival of abutments of removable partial dentures based on practice-based longitudinal study.

Science.gov (United States)

Tada, Sayaka; Ikebe, Kazunori; Matsuda, Ken-Ichi; Maeda, Yoshinobu

2013-12-01

Predicting the tooth survival is such a great challenge for evidence-based dentistry. To prevent further tooth loss of partially edentulous patients, estimation of individualized risk and benefit for each residual tooth is important to the clinical decision-making. While there are several reports indicating a risk of losing the abutment teeth of RPDs, there are no existing reports exploring the cause of abutment loss by multifactorial analysis. The aim of this practice-based longitudinal study was to determine the prognostic factors affecting the survival period of RPD abutments using a multifactorial risk assessment. One hundred and forty-seven patients had been previously provided with a total of 236 new RPDs at the Osaka University Dental Hospital; the 856 abutments for these RPDs were analyzed. Survival of abutment teeth was estimated using the Kaplan-Meier method. Multivariate analysis was conducted by Cox's proportional hazard modelling. The 5-year survival rates were 86.6% for direct abutments and 93.1% for indirect abutments, compared with 95.8% survival in non-abutment teeth. The multivariate analysis showed that abutment survival was significantly associated with crown-root ratio (hazard ratio (HR): 3.13), root canal treatment (HR: 2.93), pocket depth (HR: 2.51), type of abutments (HR: 2.19) and occlusal support (HR: 1.90). From this practice-based longitudinal study, we concluded that RPD abutment teeth are more likely to be lost than other residual teeth. From the multifactorial risk factor assessment, several prognostic factors, such as occlusal support, crown-root ratio, root canal treatment, and pocket depth were suggested. These results could be used to estimate the individualized risk for the residual teeth, to predict the prognosis of RPD abutments and to facilitate an evidence-based clinical decision making. Copyright © 2013 Elsevier Ltd. All rights reserved.

Risk analysis for autonomous underwater vehicle operations in extreme environments.

Science.gov (United States)

Brito, Mario Paulo; Griffiths, Gwyn; Challenor, Peter

2010-12-01

Autonomous underwater vehicles (AUVs) are used increasingly to explore hazardous marine environments. Risk assessment for such complex systems is based on subjective judgment and expert knowledge as much as on hard statistics. Here, we describe the use of a risk management process tailored to AUV operations, the implementation of which requires the elicitation of expert judgment. We conducted a formal judgment elicitation process where eight world experts in AUV design and operation were asked to assign a probability of AUV loss given the emergence of each fault or incident from the vehicle's life history of 63 faults and incidents. After discussing methods of aggregation and analysis, we show how the aggregated risk estimates obtained from the expert judgments were used to create a risk model. To estimate AUV survival with mission distance, we adopted a statistical survival function based on the nonparametric Kaplan-Meier estimator. We present theoretical formulations for the estimator, its variance, and confidence limits. We also present a numerical example where the approach is applied to estimate the probability that the Autosub3 AUV would survive a set of missions under Pine Island Glacier, Antarctica in January-March 2009. © 2010 Society for Risk Analysis.

Glycolytic activity in breast cancer using 18F-FDG PET/CT as prognostic predictor: A molecular phenotype approach.

Science.gov (United States)

Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V

2016-01-01

To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.

Adjacent segment pathology following anterior decompression and fusion using cage and plate for the treatment of degenerative cervical spinal diseases.

Science.gov (United States)

Song, Kyung-Jin; Choi, Byung-Wan; Kim, Jong-Kil

2014-12-01

Retrospective study. To analyze the incidence and prevalence of clinical adjacent segment pathology (CASP) following anterior decompression and fusion with cage and plate augmentation for degenerative cervical diseases. No long-term data on the use of cage and plate augmentation have been reported. The study population consisted of 231 patients who underwent anterior cervical discectomy and fusion (ACDF) with cage and plate for degenerative cervical spinal disease. The incidence and prevalence of CASP was determined by using the Kaplan-Meier survival analysis. To analyze the factors that influence CASP, data on preoperative and postoperative sagittal alignment, spinal canal diameter, the distance between the plate and adjacent disc, extent of fusion level, and the presence or absence of adjacent segment degenerative changes by imaging studies were evaluated. CASP occurred in 15 of the cases, of which 9 required additional surgery. At 8-year follow-up, the average yearly incidence was 1.1%. The rate of disease-free survival based on Kaplan-Meier survival analysis was 93.6% at 5 years and 90.2% at 8 years. No statistically significant differences in CASP incidence based on radiological analysis were observed. Significantly high incidence of CASP was observed in the presence of increased adjacent segment degenerative changes (pdegenerative cervical disease is associated with a lower incidence in CSAP by 1.1% per year, and the extent of preoperative adjacent segment degenerative changes has been shown as a risk factor for CASP.

PROGNOSTIC FACTORS FOR SURVIVAL AT 6-MONTH FOLLOW-UP OF HOSPITALIZED PATIENTS WITH DECOMPENSATED CONGESTIVE HEART FAILURE

Directory of Open Access Journals (Sweden)

Mostafa Cheraghi

2010-12-01

Full Text Available Abstract:BACKGROUND: The prevalence of Congestive Heart Failure (CHF is increasing in recent years. Factors associated with mortality in CHF patients are important to be determined in order to select therapeutic modality by physicians. The purpose of the current study was to declare predictors of 6-months survival in patients hospitalized for decompensated CHF in Isfahan.METHODS: A cohort of 301 hospitalized patients with decompensated CHF were recruited in this study. The diagnosis of CHF was based on previous hospitalizations and Framingham criteria for heart failure (HF. Information regarding past history, accompanying diseases such as cerebrovascular accidents (CVA, chronic obstructive pulmonary diseases (COPD, clinical data, medications and echocardiography were obtained by a cardiologist. Patients were followed for their survival for 6 months by telephone calls. Kaplan-Meier method was used for uni variate survival analysis and Cox proportional hazard model was used for multivariate analysis.RESULTS: Mean age of patients was 71.9 ± 12.2 years and 59.8% was male. During 6-months follow-up 138 (45.8% patients died. Mean survival was 119.2 ± 4.4 days (Mean ± SEM. Significant prognostic factors for 6 months survival were high education level (HR = 0.74, CI 95% 0.59—0.93, COPD (HR = 1.91, CI 95% 1.2—3.04, CVA (HR = 1.69, CI 95% 1.03—2.78, Angiotensin Converting enzyme (ACE inhibitors use (HR = 0.44, CI 95% 0.3—0.66 and Diuretics (HR = 0.63, CI 95% 0.41-0.96.CONCLUSION: Six-month survival of hospitalized decompensated CHF patients in Iran is not favorable. Many factors particularly accompanying diseases and medications affected the patient’s 6-months survival.Keywords: Heart failure, Survival,  Mortality.

Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.

Directory of Open Access Journals (Sweden)

Jeban Ganesalingam

2009-09-01

Full Text Available Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes.Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method.The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001.The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.

Protein Kinase CK2 Expression Predicts Relapse Survival in ERα Dependent Breast Cancer, and Modulates ERα Expression in Vitro

Directory of Open Access Journals (Sweden)

Marlon D. Williams

2015-12-01

Full Text Available The heterotetrameric protein kinase CK2 has been associated with oncogenic transformation, and our previous studies have shown that it may affect estrogenic signaling. Here, we investigate the role of the protein kinase CK2 in regulating ERα (estrogen receptor α signaling in breast cancer. We determined the correlation of CK2α expression with relapse free breast cancer patient survival utilizing Kaplan Meier Plotter (kmplot.com/analysis/ to mine breast cancer microarrays repositories. Patients were stratified according to ERα status, histological grade, and hormonal therapy. Luciferase reporter assays and flow cytometry were implemented to determine the impact of CK2 inhibition on ERE-mediated gene expression and expression of ERα protein. CK2α expression is associated with shorter relapse free survival among ERα (+ patients with grade 1 or 2 tumors, as well as among those patients receiving hormonal therapy. Biochemical inhibition of CK2 activity results in increased ER-transactivation as well as increased expression among ERα (+ and ERα (− breast cancer cell lines. These findings suggest that CK2 may contribute to estrogen-independent cell proliferation and breast tumor progression, and may potentially serve as a biomarker and pharmacological target in breast cancer.

Complementary Chinese herbal medicine therapy improves survival of patients with gastric cancer in Taiwan: A nationwide retrospective matched-cohort study.

Science.gov (United States)

Hung, Kuo-Feng; Hsu, Ching-Ping; Chiang, Jen-Huai; Lin, Hung-Jen; Kuo, Yi-Ting; Sun, Mao-Feng; Yen, Hung-Rong

2017-03-06

Many patients with gastric cancer seek traditional medicine consultations in Asian countries. This study aimed to investigate the prescription of Chinese herbal medicine (CHM) and its benefits for the patients with gastric cancer in Taiwan. From the Registry for Catastrophic Illness Patients Database, we included all patients with gastric cancer whose age at diagnosis was ≥18 from 1997 to 2010 in Taiwan. We used 1:1 frequency matching by age, sex, Charlson comorbidity score, treatment and index year to compare the CHM users and non-CHM users. We used the Cox regression model to compare the hazard ratios (HR) for the risk of mortality and the Kaplan-Meier curve for the survival time. There was a total of 1333 patients in the CHM-cohort and 44786 patients in the non-CHM cohort. After matching, we compared 962 newly diagnosed CHM users and 962 non-CHM users. Adjusted HRs (aHR) were higher among patients of above 60-year-old group, with a Charlson Comorbidity Index score ≥2 before the index date, and those who need surgery combined with chemotherapy or radiotherapy. CHM users had a lower HR of mortality risk (adjusted HR: 0.55, 95% CI: 0.48-0.62). Compared to the non-CHM users, the aHR among CHM-users is 0.37 (95% CI:0.2-0.67) for those who used CHM more than 180 days annually. The Kaplan-Meier curve revealed that the survival probability was higher for complementary CHM-users. Bai-Hua-She-She-Cao (Herba Hedyotidis Diffusae) was the most commonly used single herb and Xiang-Sha-Liu-Jun-Zi-Tang was the most commonly used herbal formula among CHM prescriptions. Complementary CHM improves the overall survival among patients with gastric cancer in Taiwan. Further ethnopharmacological investigations and clinical trials are required to validate the efficacy and safety. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

NM23 protein expression in colorectal carcinoma using TMA (tissue microarray: association with metastases and survival

Directory of Open Access Journals (Sweden)

Levindo Alves de Oliveira

2010-12-01

Full Text Available CONTEXT: NM23, a metastasis suppressor gene, may be associated with prognosis in patients with colorectal carcinoma. OBJECTIVE: To analyze NM23 expression and its association with the presence of lymph node and liver metastases and survival in patients operated on for colorectal carcinoma. METHODS: One hundred thirty patients operated on for colorectal carcinoma were investigated. Tissue microarray blocks containing neoplastic tissue and tumor-adjacent non-neoplastic mucosa were obtained and analyzed by immunohistochemical staining using a monoclonal anti-NM23 antibody. Immunohistochemical expression was assessed using a semiquantitative scoring method, counting the percentage of stained cells. The results were compared regarding morphological and histological characteristics of the colorectal carcinoma, presence of lymph node and liver metastases, tumor staging, and patient survival. Statistical analysis was performed using the Mann-Whitney test, the Kruskal-Wallis test and Fisher's exact test. Survival analysis was performed using the Kaplan-Meier method and the log-rank test. RESULTS: NM23 expression was higher in colorectal carcinoma tissue than in adjacent non-neoplastic mucosa (P<0.0001. NM23 protein expression did not correlate with degree of cell differentiation (P = 0.57, vascular invasion (P = 0.85, lymphatic invasion (P = 0.41, perineural infiltration (P = 0.46, staging (P = 0.19, lymph node metastases (P = 0.08, or liver metastases (P = 0.59. Disease-free survival showed significant association (P = 0.01 with the intensity of NM23 protein immunohistochemical expression in colorectal carcinoma tissue, whereas overall survival showed no association with NM23 protein expression (P = 0.13. CONCLUSIONS: NM23 protein expression was higher in neoplastic colorectal carcinoma tissue than in adjacent non-neoplastic mucosa, showing no correlation with morphological aspects, presence of lymph node or liver metastases, colorectal carcinoma

Diffusion-weighted magnetic resonance imaging predicts survival in patients with liver-predominant metastatic colorectal cancer shortly after selective internal radiation therapy

Energy Technology Data Exchange (ETDEWEB)

Schmeel, Frederic Carsten; Simon, Birgit; Luetkens, Julian Alexander; Traeber, Frank; Schmeel, Leonard Christopher; Schild, Hans Heinz; Hadizadeh, Dariusch Reza [University Hospital Bonn, Rheinische-Friedrich-Wilhelms-Universitaet Bonn, Department of Radiology, Bonn (Germany); Sabet, Amir [University Hospital Bonn, Rheinische-Friedrich-Wilhelms-Universitaet Bonn, Department of Nuclear Medicine, Bonn (Germany); University Hospital Essen, Universitaet Duisburg-Essen, Department of Nuclear Medicine, Essen (Germany); Ezziddin, Samer [University Hospital Bonn, Rheinische-Friedrich-Wilhelms-Universitaet Bonn, Department of Nuclear Medicine, Bonn (Germany); University Hospital Saarland, Universitaet des Saarlandes, Department of Nuclear Medicine, Homburg (Germany)

2017-03-15

To investigate whether quantifications of apparent diffusion coefficient (ADC) on diffusion-weighted imaging (DWI) can predict overall survival (OS) in patients with liver-predominant metastatic colorectal cancer (CRC) following selective internal radiation therapy with {sup 90}Yttrium-microspheres (SIRT). Forty-four patients underwent DWI 19 ± 16 days before and 36 ± 10 days after SIRT. Tumour-size and intratumoral minimal ADC (minADC) values were measured for 132 liver metastases on baseline and follow-up DWI. Optimal functional imaging response to treatment was determined by receiver operating characteristics and defined as ≥22 % increase in post-therapeutic minADC. Survival analysis was performed with the Kaplan-Meier method and Cox-regression comparing various variables with potential impact on OS. Median OS was 8 months. The following parameters were significantly associated with median OS: optimal functional imaging response (18 vs. 5 months; p < 0.001), hepatic tumour burden <50 % (8 vs. 5 months; p = 0.018), Eastern Cooperative Oncology Group performance scale <1 (10 vs. 4 months; p = 0.012) and progressive disease according to Response and Evaluation Criteria in Solid Tumours (8 vs. 3 months; p = 0.001). On multivariate analysis, optimal functional imaging response and hepatic tumour burden remained independent predictors of OS. Functional imaging response assessment using minADC changes on DWI may predict survival in CRC shortly after SIRT. (orig.)

Intravoxel Incoherent Motion Metrics as Potential Biomarkers for Survival in Glioblastoma.

Directory of Open Access Journals (Sweden)

Josep Puig

Full Text Available Intravoxel incoherent motion (IVIM is an MRI technique with potential applications in measuring brain tumor perfusion, but its clinical impact remains to be determined. We assessed the usefulness of IVIM-metrics in predicting survival in newly diagnosed glioblastoma.Fifteen patients with glioblastoma underwent MRI including spin-echo echo-planar DWI using 13 b-values ranging from 0 to 1000 s/mm2. Parametric maps for diffusion coefficient (D, pseudodiffusion coefficient (D*, and perfusion fraction (f were generated for contrast-enhancing regions (CER and non-enhancing regions (NCER. Regions of interest were manually drawn in regions of maximum f and on the corresponding dynamic susceptibility contrast images. Prognostic factors were evaluated by Kaplan-Meier survival and Cox proportional hazards analyses.We found that fCER and D*CER correlated with rCBFCER. The best cutoffs for 6-month survival were fCER>9.86% and D*CER>21.712 x10-3mm2/s (100% sensitivity, 71.4% specificity, 100% and 80% positive predictive values, and 80% and 100% negative predictive values; AUC:0.893 and 0.857, respectively. Treatment yielded the highest hazard ratio (5.484; 95% CI: 1.162-25.88; AUC: 0.723; P = 0.031; fCER combined with treatment predicted survival with 100% accuracy.The IVIM-metrics fCER and D*CER are promising biomarkers of 6-month survival in newly diagnosed glioblastoma.

Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

International Nuclear Information System (INIS)

Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H

2012-01-01

The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

Science.gov (United States)

Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.

2012-11-01

The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

Differential Survival for Men and Women with HIV/AIDS-Related Neurologic Diagnoses.

Directory of Open Access Journals (Sweden)

Martha L Carvour

Full Text Available Neurologic complications of human immunodeficiency virus (HIV infection and acquired immune deficiency syndrome (AIDS frequently lead to disability or death in affected patients. The aim of this study was to determine whether survival patterns differ between men and women with HIV/AIDS-related neurologic disease (neuro-AIDS.Retrospective cohort data from a statewide surveillance database for HIV/AIDS were used to characterize survival following an HIV/AIDS-related neurologic diagnosis for men and women with one or more of the following conditions: cryptococcosis, toxoplasmosis, primary central nervous system lymphoma, progressive multifocal leukoencephalopathy, and HIV-associated dementia. A second, non-independent cohort was formed using university-based cases to confirm and extend the findings from the statewide data. Kaplan-Meier analysis was used to compare the survival experiences for men and women in the cohorts. Cox regression was employed to characterize survival while controlling for potential confounders in the study population.Women (n=27 had significantly poorer outcomes than men (n=198 in the statewide cohort (adjusted hazard ratio=2.31, 95% CI: 1.22 to 4.35, and a similar, non-significant trend was observed among university-based cases (n=17 women, 154 men. Secondary analyses suggested that this difference persisted over the course of the AIDS epidemic and was not attributable to differential antiretroviral therapy responses among men and women.The survival disadvantage of women compared to men should be confirmed and the mechanisms underlying this disparity elucidated. If this relationship is confirmed, targeted clinical and public health efforts might be directed towards screening, treatment, and support for women affected by neuro-AIDS.

Factors Affecting Adjuvant Therapy in Stage III Pancreatic Cancer—Analysis of the National Cancer Database

Directory of Open Access Journals (Sweden)

Mridula Krishnan

2017-08-01

Full Text Available Background: Adjuvant therapy after curative resection is associated with survival benefit in stage III pancreatic cancer. We analyzed the factors affecting the outcome of adjuvant therapy in stage III pancreatic cancer and compared overall survival with different modalities of adjuvant treatment. Methods: This is a retrospective study of patients with stage III pancreatic cancer listed in the National Cancer Database (NCDB who were diagnosed between 2004 and 2012. Patients were stratified based on adjuvant therapy they received. Unadjusted Kaplan-Meier and multivariable Cox regression analysis were performed. Results: We analyzed a cohort included 1731 patients who were recipients of adjuvant therapy for stage III pancreatic cancer within the limits of our database. Patients who received adjuvant chemoradiation had the longest postdiagnosis survival time, followed by patients who received adjuvant chemotherapy, and finally patients who received no adjuvant therapy. On multivariate analysis, advancing age and patients with Medicaid had worse survival, whereas Spanish origin and lower Charlson comorbidity score had better survival. Conclusions: Our study is the largest trial using the NCDB addressing the effects of adjuvant therapy specifically in stage III pancreatic cancer. Within the limits of our study, survival benefit with adjuvant therapy was more apparent with longer duration from date of diagnosis.

The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

Science.gov (United States)

2014-03-01

8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

Survival and clinical outcome of dogs with ischaemic stroke.

Science.gov (United States)

Gredal, H; Toft, N; Westrup, U; Motta, L; Gideon, P; Arlien-Søborg, P; Skerritt, G C; Berendt, M

2013-06-01

The objectives of the present study were to investigate survival time, possible predictors of survival and clinical outcome in dogs with ischaemic stroke. A retrospective study of dogs with a previous diagnosis of ischaemic stroke diagnosed by magnetic resonance imaging (MRI) was performed. The association between survival and the hypothesised risk factors was examined using univariable exact logistic regression. Survival was examined using Kaplan-Meier and Cox regression. Twenty-two dogs were identified. Five dogs (23%) died within the first 30days of the stroke event. Median survival in 30-day survivors was 505days. Four dogs (18%) were still alive by the end of the study. Right-sided lesions posed a significantly increased risk of mortality with a median survival time in dogs with right-sided lesions of 24days vs. 602days in dogs with left sided lesions (P=0.006). Clinical outcome was considered excellent in seven of 17 (41%) 30-day survivors. Another seven 30-day survivors experienced new acute neurological signs within 6-17months of the initial stroke event; in two of those cases a new ischaemic stroke was confirmed by MRI. In conclusion, dogs with ischaemic stroke have a fair to good prognosis in terms of survival and clinical outcome. However, owners should be informed of the risk of acute death within 30days and of the possibility of new neurological events in survivors. Mortality was increased in dogs with right-sided lesions in this study. Copyright © 2012 Elsevier Ltd. All rights reserved.

Brachytherapy Is Associated With Improved Survival in Inoperable Stage I Endometrial Adenocarcinoma: A Population-Based Analysis

Energy Technology Data Exchange (ETDEWEB)

Acharya, Sahaja; Perkins, Stephanie M.; DeWees, Todd; Fischer-Valuck, Benjamin W. [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Mutch, David G.; Powell, Matthew A. [Department of Obstetrics and Gynecology, Washington University School of Medicine, St. Louis, Missouri (United States); Schwarz, Julie K. [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Grigsby, Perry W., E-mail: pgrigsby@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States)

2015-11-01

Purpose: To assess the use of brachytherapy (BT) with or without external beam radiation (EBRT) in inoperable stage I endometrial adenocarcinoma in the United States and to determine the effect of BT on overall survival (OS) and cause-specific survival (CSS). Methods and Materials: Data between 1998 and 2011 from the National Cancer Institute's Surveillance, Epidemiology and End Results database were analyzed. Coarsened exact matching was used to adjust for differences in age and grade between patients who received BT and those who did not. Prognostic factors affecting OS and CSS were evaluated using the Kaplan-Meier product-limit method and a Cox proportional hazards regression model. Results: A total of 460 patients with inoperable stage I endometrial adenocarcinoma treated with radiation therapy were identified. Radiation consisted of either EBRT (n=260) or BT with or without EBRT (n=200). The only factor associated with BT use was younger patient age (median age, 72 vs 76 years, P=.001). Patients who received BT had a higher 3-year OS (60% vs 47%, P<.001) and CSS (82% vs 74%, P=.032) compared with those who did not. On multivariate analysis, BT use was independently associated with an improved OS (hazard ratio [HR] 0.67, 95% confidence interval [CI] 0.52-0.87) and CSS (HR 0.61, 95% CI 0.39-0.93). When patients were matched on age, BT use remained significant on multivariate analysis for OS (HR 0.65, 95% CI 0.48-0.87) and CSS (HR 0.52, 95% CI 0.31-0.84). When matched on age and grade, BT remained independently associated with improved OS and CSS (OS HR 0.62, 95% CI 0.46-0.83; CSS HR 0.57, 95% CI 0.34-0.92). Conclusion: Brachytherapy is independently associated with improved OS and CSS. It should be considered as part of the treatment regimen for stage I inoperable endometrial cancer patients undergoing radiation.

Brachytherapy Is Associated With Improved Survival in Inoperable Stage I Endometrial Adenocarcinoma: A Population-Based Analysis

International Nuclear Information System (INIS)

Acharya, Sahaja; Perkins, Stephanie M.; DeWees, Todd; Fischer-Valuck, Benjamin W.; Mutch, David G.; Powell, Matthew A.; Schwarz, Julie K.; Grigsby, Perry W.

2015-01-01

Purpose: To assess the use of brachytherapy (BT) with or without external beam radiation (EBRT) in inoperable stage I endometrial adenocarcinoma in the United States and to determine the effect of BT on overall survival (OS) and cause-specific survival (CSS). Methods and Materials: Data between 1998 and 2011 from the National Cancer Institute's Surveillance, Epidemiology and End Results database were analyzed. Coarsened exact matching was used to adjust for differences in age and grade between patients who received BT and those who did not. Prognostic factors affecting OS and CSS were evaluated using the Kaplan-Meier product-limit method and a Cox proportional hazards regression model. Results: A total of 460 patients with inoperable stage I endometrial adenocarcinoma treated with radiation therapy were identified. Radiation consisted of either EBRT (n=260) or BT with or without EBRT (n=200). The only factor associated with BT use was younger patient age (median age, 72 vs 76 years, P=.001). Patients who received BT had a higher 3-year OS (60% vs 47%, P<.001) and CSS (82% vs 74%, P=.032) compared with those who did not. On multivariate analysis, BT use was independently associated with an improved OS (hazard ratio [HR] 0.67, 95% confidence interval [CI] 0.52-0.87) and CSS (HR 0.61, 95% CI 0.39-0.93). When patients were matched on age, BT use remained significant on multivariate analysis for OS (HR 0.65, 95% CI 0.48-0.87) and CSS (HR 0.52, 95% CI 0.31-0.84). When matched on age and grade, BT remained independently associated with improved OS and CSS (OS HR 0.62, 95% CI 0.46-0.83; CSS HR 0.57, 95% CI 0.34-0.92). Conclusion: Brachytherapy is independently associated with improved OS and CSS. It should be considered as part of the treatment regimen for stage I inoperable endometrial cancer patients undergoing radiation.

Novel Inflammation-Based Prognostic Score for Predicting Survival in Patients with Metastatic Urothelial Carcinoma.

Directory of Open Access Journals (Sweden)

Yu-Li Su

Full Text Available We developed a novel inflammation-based model (NPS, which consisted of a neutrophil to lymphocyte ratio (NLR and platelet count (PC, for assessing the prognostic role in patients with metastatic urothelial carcinoma (UC.We performed a retrospective analysis of patients with metastatic UC who underwent systemic chemotherapy between January 1997 and December 2014 in Kaohsiung Chang Gung Memorial Hospital. The defined cutoff values for the NLR and PC were 3.0 and 400 × 103/μL, respectively. Patients were scored 1 for either an elevated NLR or PC, and 0 otherwise. The NPS was calculated by summing the scores, ranging from 0 to 2. The primary endpoint was overall survival (OS by using Kaplan-Meier analysis. Multivariate Cox regression analysis was used to identify the independent prognostic factors for OS.In total, 256 metastatic UC patients were enrolled. Univariate analysis revealed that patients with either a high NLR or PC had a significantly shorter survival rate compared with those with a low NLR (P = .001 or PC (P < .0001. The median OS in patients with NPS 0, 1, and 2 was 19.0, 12.8, and 9.3 months, respectively (P < .0001. Multivariate analysis revealed that NPS, along with the histologic variant, liver metastasis, age, and white cell count, was an independent factor facilitating OS prediction (hazard ratio 1.64, 95% confidence interval 1.20-2.24, P = .002.The NLR and PC are independent prognostic factors for OS in patients with metastatic UC. The NPS model has excellent discriminant ability for OS.

Maternal smoking during pregnancy and the risk of pediatric cardiovascular diseases of the offspring: A population-based cohort study with up to 18-years of follow up.

Science.gov (United States)

Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal

2018-06-01

Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.

Socioeconomic Status, Not Race, Is Associated With Reduced Survival in Esophagectomy Patients.

Science.gov (United States)

Erhunmwunsee, Loretta; Gulack, Brian C; Rushing, Christel; Niedzwiecki, Donna; Berry, Mark F; Hartwig, Matthew G

2017-07-01

Black patients with esophageal cancer have worse survival than white patients. This study examines this racial disparity in conjunction with socioeconomic status (SES) and explores whether race-based outcome differences exist using a national database. The associations between race and SES with overall survival of patients treated with esophagectomy for stages I to III esophageal cancer between 2003 and 2011 in the National Cancer Data Base were investigated using the Kaplan-Meier method and proportional hazards analyses. Median income by zip code and proportion of the zip code residents without a high school diploma were grouped into income and education quartiles, respectively and used as surrogates for SES. The association between race and overall survival stratified by SES is explored. Of 11,599 esophagectomy patients who met study criteria, 3,503 (30.2%) were in the highest income quartile, 2,847 (24.5%) were in the highest education quartile, and 610 patients (5%) were black. Before adjustment for SES, black patients had worse overall survival than white patients (median survival 23.0 versus 34.7 months, log rank p race was not. Prior studies have suggested that survival of esophageal cancer patients after esophagectomy is associated with race. Our study suggests that race is not significantly related to overall survival when adjusted for other prognostic variables. Socioeconomic status, however, remains significantly related to overall survival in our model. Copyright © 2017 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

High survival rates and associated factors among ebola virus disease patients hospitalized at donka national hospital, conakry, Guinea.

Science.gov (United States)

Qureshi, Adnan I; Chughtai, Morad; Bah, Elhadj Ibrahima; Barry, Moumié; Béavogui, Kézély; Loua, Tokpagnan Oscar; Malik, Ahmed A

2015-02-01

Anecdotal reports suggesting that survival rates among hospitalized patients with Ebola virus disease in Guinea are higher than the 29.2% rate observed in the current epidemic in West Africa. Survival after symptom onset was determined using Kaplan Meier survival methods among patients with confirmed Ebola virus disease treated in Conakry, Guinea from March 25, 2014, to August 5, 2014. We analyzed the relationship between survival and patient factors, including demographics and clinical features. Of the 70 patients analyzed [mean age ± standard deviation (SD), 34 ± 14.1; 44 were men], 42 were discharged alive with a survival rate among hospitalized patients of 60% (95% confidence interval, 41.5-78.5%). The survival rate was 28 (71.8%) among 39 patients under 34 years of age, and 14 (46.7%) among 30 patients aged 35 years or greater (p = 0.034). The rates of myalgia (3 of 42 versus 7 of 28, p = 0.036) and hiccups (1 of 42 versus 5 of 28, p = 0.023) were significantly lower among patients who survived. Our results provide insights into a cohort of hospitalized patients with Ebola virus disease in whom survival is prominently higher than seen in other cohorts of hospitalized patients.

Post-Operative Infection Is an Independent Risk Factor for Worse Long-Term Survival after Colorectal Cancer Surgery.

Science.gov (United States)

Kerin Povšič, Milena; Ihan, Alojz; Beovič, Bojana

2016-12-01

Colorectal cancer surgery is associated with a high incidence of post-operative infections, the outcome of which may be improved if diagnosed and treated early enough. We compared white blood cell (WBC) count, C-reactive protein (CRP), and procalcitonin (PCT) as predictors of post-operative infections and analyzed their impact on long-term survival. This retrospective study included 186 patients undergoing colorectal surgery. Post-operative values of WBC, CRP, and PCT were analyzed by the receiver operating characteristic (ROC) analysis. We followed infections 30 d after the surgery. A five-year survival was analyzed by Kaplan-Meier method and prognostic factors by Cox regression model. Fifty-five patients (29.5%) developed post-operative infection, the most frequent of which was surgical site infection (SSI). C-reactive protein on post-operative day three and PCT on post-operative day two demonstrated the highest diagnostic accuracy for infection (area under the curve [AUC] 0.739 and 0.735). C-reactive protein on post-operative day three was an independent predictor of infection. Five-year survival was higher in the non-infected group (70.8%), compared with the infected group (52.1%). The worst survival (40.9%) was identified in patients with organ/space SSI. Post-operative infection and tumor stage III-IV were independent predictors of a worse five-year survival. C-reactive protein on post-operative day three and PCT on post-operative day two may be early predictors of infection after colorectal cancer surgery. Post-operative infections in particular organ/space SSI have a negative impact on long-term survival.

Chemokine-like factor-like MARVEL transmembrane domain-containing 3 expression is associated with a favorable prognosis in esophageal squamous cell carcinoma.

Science.gov (United States)

Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin

2017-05-01

Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic

Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center Sobrevida de mujeres con cáncer de cuello uterino diagnosticadas en un centro brasileño Sobrevida de mulheres com câncer de colo uterino diagnosticadas em um centro brasileiro

Directory of Open Access Journals (Sweden)

Claudio Calazan do Carmo

2011-08-01

Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (pOBJETIVO: Evaluar la sobrevida global de mujeres con cáncer de cuello uterino e identificar factores pronósticos relacionados. MÉTODOS: Todos los 3.341 casos tratados en el Instituto Nacional de Cáncer, Rio de Janeiro, Sureste de Brasil, entre 1999 y 2004 fueron seleccionados y sus datos clínicos, anatomo-patológicos y de seguimiento fueron colectados. Se utilizaron la curva de Kaplan-meier y el modelo de Cox par evaluación de la sobrevida y para análisis logística múltiple, respectivamente. RESULTADOS: De los casos estudiados, 68,3% presentaban enfermedad localmente avanzada. La sobrevida en cinco años fue de 48%. Posterior al análisis múltiple, el estadio clínico al diagnóstico fue la única variable significativamente asociada con el pronóstico (pOBJETIVO: Avaliar a sobrevida global de mulheres com câncer de colo uterino e identificar fatores prognósticos relacionados. MÉTODOS: Todos os 3.341 casos tratados no Instituto Nacional de Câncer, Rio de Janeiro, RJ, entre 1999 e 2004 foram selecionados e seus dados clínicos, anatomo-patológicos e de seguimento foram coletados. Foram utilizados a curva de Kaplan-Meier e o modelo de Cox para avaliação da sobrevida e para análise logística m

Edge Contrast of the FLAIR Hyperintense Region Predicts Survival in Patients with High-Grade Gliomas following Treatment with Bevacizumab.

Science.gov (United States)

Bahrami, N; Piccioni, D; Karunamuni, R; Chang, Y-H; White, N; Delfanti, R; Seibert, T M; Hattangadi-Gluth, J A; Dale, A; Farid, N; McDonald, C R

2018-04-05

Treatment with bevacizumab is standard of care for recurrent high-grade gliomas; however, monitoring response to treatment following bevacizumab remains a challenge. The purpose of this study was to determine whether quantifying the sharpness of the fluid-attenuated inversion recovery hyperintense border using a measure derived from texture analysis-edge contrast-improves the evaluation of response to bevacizumab in patients with high-grade gliomas. MRIs were evaluated in 33 patients with high-grade gliomas before and after the initiation of bevacizumab. Volumes of interest within the FLAIR hyperintense region were segmented. Edge contrast magnitude for each VOI was extracted using gradients of the 3D FLAIR images. Cox proportional hazards models were generated to determine the relationship between edge contrast and progression-free survival/overall survival using age and the extent of surgical resection as covariates. After bevacizumab, lower edge contrast of the FLAIR hyperintense region was associated with poorer progression-free survival ( P = .009) and overall survival ( P = .022) among patients with high-grade gliomas. Kaplan-Meier curves revealed that edge contrast cutoff significantly stratified patients for both progression-free survival (log-rank χ 2 = 8.3, P = .003) and overall survival (log-rank χ 2 = 5.5, P = .019). Texture analysis using edge contrast of the FLAIR hyperintense region may be an important predictive indicator in patients with high-grade gliomas following treatment with bevacizumab. Specifically, low FLAIR edge contrast may partially reflect areas of early tumor infiltration. This study adds to a growing body of literature proposing that quantifying features may be important for determining outcomes in patients with high-grade gliomas. © 2018 by American Journal of Neuroradiology.

Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

International Nuclear Information System (INIS)

Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao

2017-01-01

The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

The prognostic factors affecting survival in muscle invasive bladder cancer treated with radiotherapy

International Nuclear Information System (INIS)

Chung, Woong Ki; Oh, Bong Ryoul; Ahn, Sung Ja; Nah, Byung Sik; Kwon, Dong Deuk; Park, Kwang Sung; Ryu, Soo Bang; Park, Yang Il

2002-01-01

This study analyzed the prognostic factors affecting the survival rate and evaluated the role of radiation therapy in muscle-invading bladder cancer. Twenty eight patient with bladder cancer who completed planned definitive radiotherapy in the Departments of Therapeutic Radiology and Urology, Chonnam National University Hospital between Jan. 1986 to Dec. 1998 were retrospectively analyzed. The reviews were performed based on the patients' medical records. There were 21 males and 7 females in this study. The median of age was 72 years old ranging from 49 to 84 years. All patients were confirmed as having transitional cell carcinoma with histological grade 1 in one patient, grade 2 in 15, grade 3 in 9, and uniformed in 3. Radiation therapy was performed using a linear accelerator with 6 or 10 MV X-rays. Radiation was delivered daily with a 1.8 or 2.0 Gy fraction size by 4 ports (anterior-posterior, both lateral, alternatively) or 3 ports (Anterior and both lateral). The median radiation dose delivered to the isocenter of the target volume was 61.24 Gy ranging from 59 to 66.6 Gy. The survival rate was calculated by the Kaplan-Meier method. Multivariate analysis was performed on the prognostic factors affecting the survival rate. The survival rate was 76%, 46%, 33%, 33% at 1, 2, 3, 5 years, respectively, with 19 months of median survival. The potential factors of age (less than 70 years vs above 70), sex, diabetes mellitus, hypertension, hydronephrosis, T-stage (T3a vs T3b), TUR, chemotherapy, total duration of radiotherapy, radiation dose (less than 60 Gy vs above 60 Gy), and the treatment response were investigated with uni- and multivariate analysis. In univariate analysis, the T-stage (ρ 0.078) and radiation dose (ρ = 0.051) were marginally significant, and the treatment response (ρ = 0.011) was a statistically significant factor on the survival rate. Multivariate analysis showed there were no significant prognostic factors affecting the survival rate. The

The prognostic factors affecting survival in muscle invasive bladder cancer treated with radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Chung, Woong Ki; Oh, Bong Ryoul; Ahn, Sung Ja; Nah, Byung Sik; Kwon, Dong Deuk; Park, Kwang Sung; Ryu, Soo Bang; Park, Yang Il [Chonnam National University Medical School, Chonnam National University Hospital, Kwangju (Korea, Republic of)

2002-06-15

This study analyzed the prognostic factors affecting the survival rate and evaluated the role of radiation therapy in muscle-invading bladder cancer. Twenty eight patient with bladder cancer who completed planned definitive radiotherapy in the Departments of Therapeutic Radiology and Urology, Chonnam National University Hospital between Jan. 1986 to Dec. 1998 were retrospectively analyzed. The reviews were performed based on the patients' medical records. There were 21 males and 7 females in this study. The median of age was 72 years old ranging from 49 to 84 years. All patients were confirmed as having transitional cell carcinoma with histological grade 1 in one patient, grade 2 in 15, grade 3 in 9, and uniformed in 3. Radiation therapy was performed using a linear accelerator with 6 or 10 MV X-rays. Radiation was delivered daily with a 1.8 or 2.0 Gy fraction size by 4 ports (anterior-posterior, both lateral, alternatively) or 3 ports (Anterior and both lateral). The median radiation dose delivered to the isocenter of the target volume was 61.24 Gy ranging from 59 to 66.6 Gy. The survival rate was calculated by the Kaplan-Meier method. Multivariate analysis was performed on the prognostic factors affecting the survival rate. The survival rate was 76%, 46%, 33%, 33% at 1, 2, 3, 5 years, respectively, with 19 months of median survival. The potential factors of age (less than 70 years vs above 70), sex, diabetes mellitus, hypertension, hydronephrosis, T-stage (T3a vs T3b), TUR, chemotherapy, total duration of radiotherapy, radiation dose (less than 60 Gy vs above 60 Gy), and the treatment response were investigated with uni- and multivariate analysis. In univariate analysis, the T-stage ({rho} 0.078) and radiation dose ({rho} = 0.051) were marginally significant, and the treatment response ({rho} = 0.011) was a statistically significant factor on the survival rate. Multivariate analysis showed there were no significant prognostic factors affecting the survival

Evaluation of the effects of red blood cell distribution width on survival in lung cancer patients

Directory of Open Access Journals (Sweden)

Mehmet Kos

2016-06-01

Full Text Available Aim of the study : Data are available indicating that red blood cell distribution width (RDW is higher in cancer patients compared to healthy individuals or benign events. In our study, we aimed to investigate the influence of different RDW levels on survival in lung cancer patients. Material and methods: Clinical and laboratory data from 146 patients with lung cancer and 40 healthy subjects were retrospectively studied. RDW was recorded before the application of any treatment. Patients were categorised according to four different RDW cut-off values (median RDW, RDW determined by ROC curve analysis, the upper limit at the automatic blood count device, and RDW cut of value which used in previous studies. Kaplan-Meier survival analysis was used to examine the effect of RDW on survival for each cut-off level. Results : The median age of patients was 56.5 years (range: 26–83 years. The difference in median RDW between patients and the control group was statistically significant (14.0 and 13.8, respectively, p = 0.04. There was no difference with regard to overall survival when patients with RDW ≥ 14.0 were compared to those with RDW < 14.0 (p = 0.70; however, overall survival was 3.0 months shorter in low values of its own group in each of the following cut-off values: ≥ 14.2 (p = 0.34, ≥ 14.5 (p = 0.25, ≥ 15 (p = 0.59, although no results were statistically significant. Discussion : We consider that the difference between low and high RDW values according to certain cut-off values may reflect the statistics of larger studies although there is a statistically negative correlation between RDW level and survival.

Pretreatment oral hygiene habits and survival of head and neck squamous cell carcinoma (HNSCC) patients.

Science.gov (United States)

Friemel, Juliane; Foraita, Ronja; Günther, Kathrin; Heibeck, Mathias; Günther, Frauke; Pflueger, Maren; Pohlabeln, Hermann; Behrens, Thomas; Bullerdiek, Jörn; Nimzyk, Rolf; Ahrens, Wolfgang

2016-03-11

The survival time of patients with head and neck squamous cell carcinoma (HNSCC) is related to health behavior, such as tobacco smoking and alcohol consumption. Poor oral health (OH), dental care (DC) and the frequent use of mouthwash have been shown to represent independent risk factors for head and neck cancerogenesis, but their impact on the survival of HNSCC patients has not been systematically investigated. Two hundred seventy-six incident HNSCC cases recruited for the ARCAGE study were followed through a period of 6-10 years. Interview-based information on wearing of dentures, gum bleeding, teeth brushing, use of floss and dentist visits were grouped into weighted composite scores, i.e. oral health (OH) and dental care (DH). Use of mouthwash was assessed as frequency per day. Also obtained were other types of health behavior, such as smoking, alcohol drinking and diet, appreciated as both confounding and study variables. Endpoints were progression-free survival, overall survival and tumor-specific survival. Prognostic values were estimated using Kaplan-Meier analysis and Cox proportional hazards regression models. A good dental care score, summarizing annual dental visits, daily teeth cleaning and use of floss was associated with longer overall survival time (p = .001). The results of the Cox regression models similarly suggested a higher risk of tumor progression and shortened overall survival in patients with poor dental care, but the results lost their statistical significance after other types of health behavior had been controlled for. Frequent use of mouthwash (≥ 2 times/day) significantly increased the risk of tumor-specific death (HR = 2.26; CI = 1.19-4.32). Alcohol consumption and tobacco smoking were dose-dependently associated with tumor progression and shorter overall survival. Frequent mouthwash use of ≥ 2 times/day seems to elevate the risk of tumor-specific death in HNSCC patients. Good dental care scores are associated with longer overall

Factors Affecting the Recurrence of Giant Cell Tumor of Bone After Surgery: A Clinicopathological Study of 80 Cases from a Single Center

Directory of Open Access Journals (Sweden)

Dong-dong Cheng

2015-07-01

Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.

Longevity of anterior resin-bonded bridges: survival rates of two tooth preparation designs.

Science.gov (United States)

Abuzar, M; Locke, J; Burt, G; Clausen, G; Escobar, K

2018-04-16

Significant developments have occurred in the design of resin-bonded bridges (RBB) over the past two decades. They are commonly used as an alternative treatment option for a single missing tooth. The longevity of these bridges needs to be further investigated to evaluate long-term outcomes for this option to remain relevant. A cohort of patients who received anterior resin-bonded bridges (ARBB) over two decades was studied retrospectively. Longevity of 206 ARBB was assessed using Kaplan-Meier probability estimates. The two modified tooth preparation designs investigated were: (A) mesial and distal vertical grooves only; and (B) one proximal groove adjacent to the pontic and two palatal grooves. Age and gender of the patient cohort were also recorded. Overall survival rate of ARBB was 98% at 5 years, 97.2% at 10 years, and 95.1% from 12 years till 21 years. Survival curves showed minor differences when compared for the two designs, age groups and gender of ARBB recipients. Differences in the proportion of surviving bridges for design A (95.96%) and design B (98.13%) were not statistically significant (Fisher's exact test). Anterior RBB with described tooth preparation designs demonstrate a high survival rate. © 2018 Australian Dental Association.

Survival and Predictive Factors of Lethality in Hemodyalisis: D/I Polymorphism of The Angiotensin I-Converting Enzyme and of the Angiotensinogen M235T Genes

Energy Technology Data Exchange (ETDEWEB)

Alves, Mauro, E-mail: malves@cardiol.br; Silva, Nelson Albuquerque de Souza e; Salis, Lucia Helena Alvares; Pereira, Basilio de Bragança; Godoy, Paulo Henrique; Nascimento, Emília Matos do [Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ (Brazil); Oliveira, Jose Mario Franco [Universidade Federal Fluminense, Niterói, RJ (Brazil)

2014-09-15

End-stage kidney disease patients continue to have markedly increased cardiovascular disease morbidity and mortality. Analysis of genetic factors connected with the renin-angiotensin system that influences the survival of the patients with end-stage kidney disease supports the ongoing search for improved outcomes. To assess survival and its association with the polymorphism of renin-angiotensin system genes: angiotensin I-converting enzyme insertion/deletion and angiotensinogen M235T in patients undergoing hemodialysis. Our study was designed to examine the role of renin-angiotensin system genes. It was an observational study. We analyzed 473 chronic hemodialysis patients in four dialysis units in the state of Rio de Janeiro. Survival rates were calculated by the Kaplan-Meier method and the differences between the curves were evaluated by Tarone-Ware, Peto-Prentice, and log rank tests. We also used logistic regression analysis and the multinomial model. A p value ≤ 0.05 was considered to be statistically significant. The local medical ethics committee gave their approval to this study. The mean age of patients was 45.8 years old. The overall survival rate was 48% at 11 years. The major causes of death were cardiovascular diseases (34%) and infections (15%). Logistic regression analysis found statistical significance for the following variables: age (p = 0.000038), TT angiotensinogen (p = 0.08261), and family income greater than five times the minimum wage (p = 0.03089), the latter being a protective factor. The survival of hemodialysis patients is likely to be influenced by the TT of the angiotensinogen M235T gene.

Survival and Predictive Factors of Lethality in Hemodyalisis: D/I Polymorphism of The Angiotensin I-Converting Enzyme and of the Angiotensinogen M235T Genes

International Nuclear Information System (INIS)

Alves, Mauro; Silva, Nelson Albuquerque de Souza e; Salis, Lucia Helena Alvares; Pereira, Basilio de Bragança; Godoy, Paulo Henrique; Nascimento, Emília Matos do; Oliveira, Jose Mario Franco

2014-01-01

End-stage kidney disease patients continue to have markedly increased cardiovascular disease morbidity and mortality. Analysis of genetic factors connected with the renin-angiotensin system that influences the survival of the patients with end-stage kidney disease supports the ongoing search for improved outcomes. To assess survival and its association with the polymorphism of renin-angiotensin system genes: angiotensin I-converting enzyme insertion/deletion and angiotensinogen M235T in patients undergoing hemodialysis. Our study was designed to examine the role of renin-angiotensin system genes. It was an observational study. We analyzed 473 chronic hemodialysis patients in four dialysis units in the state of Rio de Janeiro. Survival rates were calculated by the Kaplan-Meier method and the differences between the curves were evaluated by Tarone-Ware, Peto-Prentice, and log rank tests. We also used logistic regression analysis and the multinomial model. A p value ≤ 0.05 was considered to be statistically significant. The local medical ethics committee gave their approval to this study. The mean age of patients was 45.8 years old. The overall survival rate was 48% at 11 years. The major causes of death were cardiovascular diseases (34%) and infections (15%). Logistic regression analysis found statistical significance for the following variables: age (p = 0.000038), TT angiotensinogen (p = 0.08261), and family income greater than five times the minimum wage (p = 0.03089), the latter being a protective factor. The survival of hemodialysis patients is likely to be influenced by the TT of the angiotensinogen M235T gene

Clinical outcomes in patients with node-negative breast cancer treated based on the recurrence score results: evidence from a large prospectively designed registry.

Science.gov (United States)

Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky

2017-01-01

The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n  = 304) and 11-25 ( n  = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.

Breast Cancer Survival Defined by the ER/PR/HER2 Subtypes and a Surrogate Classification according to Tumor Grade and Immunohistochemical Biomarkers

Directory of Open Access Journals (Sweden)

Carol A. Parise

2014-01-01

Full Text Available Introduction. ER, PR, and HER2 are routinely available in breast cancer specimens. The purpose of this study is to contrast breast cancer-specific survival for the eight ER/PR/HER2 subtypes with survival of an immunohistochemical surrogate for the molecular subtype based on the ER/PR/HER2 subtypes and tumor grade. Methods. We identified 123,780 cases of stages 1–3 primary female invasive breast cancer from California Cancer Registry. The surrogate classification was derived using ER/PR/HER2 and tumor grade. Kaplan-Meier survival analysis and Cox proportional hazards modeling were used to assess differences in survival and risk of mortality for the ER/PR/HER2 subtypes and surrogate classification within each stage. Results. The luminal B/HER2− surrogate classification had a higher risk of mortality than the luminal B/HER2+ for all stages of disease. There was no difference in risk of mortality between the ER+/PR+/HER2− and ER+/PR+/HER2+ in stage 3. With one exception in stage 3, the ER-negative subtypes all had an increased risk of mortality when compared with the ER-positive subtypes. Conclusions. Assessment of survival using ER/PR/HER2 illustrates the heterogeneity of HER2+ subtypes. The surrogate classification provides clear separation in survival and adjusted mortality but underestimates the wide variability within the subtypes that make up the classification.

Metformin Increases Overall Survival in Patients with Diabetes Undergoing Surgery for Colorectal Cancer

DEFF Research Database (Denmark)

Fransgaard, Tina; Thygesen, Lau Caspar; Gögenur, Ismail

2015-01-01

-Meier estimator and the Cox regression model adjusted for important clinical risk factors were used. RESULTS: A total of 30,493 patients were included in the study, of which 3391 were diagnosed with diabetes and 1962 were treated with metformin. The adjusted HR of all-cause mortality for the diabetes group was 1......BACKGROUND: Emerging evidence suggests that metformin decreases the risk of developing colorectal cancer in patients with diabetes, but only few studies have examined potential survival benefits after surgery for colorectal cancer (CRC). The purpose of the study was to examine the association......'s National Clinical Database (DCCG). The Danish National Patient Register (NPR) records all hospital contacts in Denmark, and the diagnosis of diabetes was identified by combining NPR data with use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The Kaplan...

Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study

DEFF Research Database (Denmark)

Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars

2015-01-01

patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...

Survival of patients with head and neck cancer. Impact of physical status and comorbidities

Energy Technology Data Exchange (ETDEWEB)

Sadat, F. [Friedrich Alexander Univ., Erlangen (Germany). Clinic of Radiotherapy; Wienke, A. [Martin Luther Univ. Halle-Wittenberg, Halle/Saale (Germany). Inst. of Medical Epidemiology; Dunst, J. [Schleswig-Holstein Univ., Luebeck (Germany). Clinic of Radiotherapy; Kuhnt, T. [Rostock Univ. (Germany). Dept. of Radiation Oncology

2012-01-15

Prognostic factors (e.g., gender, tumor stage, and hypoxia) have an impact on survival in patients with head and neck cancer. Thus, the impact of physical status and comorbidities on treatment decision and survival were evaluated. Patients and methods A total of 169 primary, inoperable patients with squamous cell cancer of the head and neck were retrospectively investigated. Patients were treated with hyperfractionated accelerated radio(chemo)therapy (HARcT) or hypofractionated radio(chemo)therapy (HypoRcT). Depending on the individual patient's situation (Karnofsky Performance Index, KPI), treatment for patients with a KPI of 80-100% was generally radiochemotherapy and for patients with a KPI {<=} 70% treatment was radiotherapy alone. In addition, all comorbidities were evaluated. Uni- and multivariate proportional hazards model were used, and overall survival (OS) was estimated by the Kaplan-Meier method. Results Treatment consisted of HARcT for 76 patients (45%), HART for 28 patients (17%), HypoRcT for 14 patients(8%), and HypoRT for 51 patients (30%). Of the patients, 107 patients (63%) presented with a KPI of 80-100%. OS (20%) was significantly better for patients with a KPI of 80-100%, while the OS for patients with a KPI {<=} 70% was 8% (p < 0.001). Good KPI, total irradiation dose (> 70 Gy), and chemotherapy were significant prognostic factors for better OS. Conclusion Our retrospective analysis shows that performance status with dependency on comorbidities was an independent risk factor for OS. (orig.)

Survival of patients with head and neck cancer. Impact of physical status and comorbidities.

Science.gov (United States)

Sadat, F; Wienke, A; Dunst, J; Kuhnt, T

2012-01-01

Prognostic factors (e.g., gender, tumor stage, and hypoxia) have an impact on survival in patients with head and neck cancer. Thus, the impact of physical status and comorbidities on treatment decision and survival were evaluated. A total of 169 primary, inoperable patients with squamous cell cancer of the head and neck were retrospectively investigated. Patients were treated with hyperfractionated accelerated radio(chemo)therapy (HARcT) or hypofractionated radio(chemo)therapy (HypoRcT). Depending on the individual patient's situation (Karnofsky Performance Index, KPI), treatment for patients with a KPI of 80-100% was generally radiochemotherapy and for patients with a KPI ≤ 70% treatment was radiotherapy alone. In addition, all comorbidities were evaluated. Uni- and multivariate proportional hazards model were used, and overall survival (OS) was estimated by the Kaplan-Meier method. Treatment consisted of HARcT for 76 patients (45%), HART for 28 patients (17%), HypoRcT for 14 patients(8%), and HypoRT for 51 patients (30%). Of the patients, 107 patients (63%) presented with a KPI of 80-100%. OS (20%) was significantly better for patients with a KPI of 80-100%, while the OS for patients with a KPI ≤ 70% was 8% (p KPI, total irradiation dose (> 70 Gy), and chemotherapy were significant prognostic factors for better OS. Our retrospective analysis shows that performance status with dependency on comorbidities was an independent risk factor for OS.

Survival of patients with head and neck cancer. Impact of physical status and comorbidities

International Nuclear Information System (INIS)

Sadat, F.; Wienke, A.; Dunst, J.; Kuhnt, T.

2012-01-01

Prognostic factors (e.g., gender, tumor stage, and hypoxia) have an impact on survival in patients with head and neck cancer. Thus, the impact of physical status and comorbidities on treatment decision and survival were evaluated. Patients and methods A total of 169 primary, inoperable patients with squamous cell cancer of the head and neck were retrospectively investigated. Patients were treated with hyperfractionated accelerated radio(chemo)therapy (HARcT) or hypofractionated radio(chemo)therapy (HypoRcT). Depending on the individual patient's situation (Karnofsky Performance Index, KPI), treatment for patients with a KPI of 80-100% was generally radiochemotherapy and for patients with a KPI ≤ 70% treatment was radiotherapy alone. In addition, all comorbidities were evaluated. Uni- and multivariate proportional hazards model were used, and overall survival (OS) was estimated by the Kaplan-Meier method. Results Treatment consisted of HARcT for 76 patients (45%), HART for 28 patients (17%), HypoRcT for 14 patients(8%), and HypoRT for 51 patients (30%). Of the patients, 107 patients (63%) presented with a KPI of 80-100%. OS (20%) was significantly better for patients with a KPI of 80-100%, while the OS for patients with a KPI ≤ 70% was 8% (p 70 Gy), and chemotherapy were significant prognostic factors for better OS. Conclusion Our retrospective analysis shows that performance status with dependency on comorbidities was an independent risk factor for OS. (orig.)

Impact of Blood Transfusions on Survival of Locally Advanced Cervical Cancer Patients Undergoing Neoadjuvant Chemotherapy Plus Radical Surgery.

Science.gov (United States)

Bogani, Giorgio; Ditto, Antonino; Martinelli, Fabio; Signorelli, Mauro; Chiappa, Valentina; Lopez, Carlos; Indini, Alice; Leone Roberti Maggiore, Umberto; Sabatucci, Ilaria; Lorusso, Domenica; Raspagliesi, Francesco

2017-03-01

Transfusions represent one of the main progresses of modern medicine. However, accumulating evidence supports that transfusions correlate with worse survival outcomes in patients affected by solid cancers. In the present study, we aimed to investigate the effects of perioperative blood transfusion in locally advanced cervical cancer. Data of consecutive patients affected by locally advanced cervical cancer scheduled to undergo neoadjuvant chemotherapy plus radical surgery were retrospectively searched to test the impact of perioperative transfusions on survival outcomes. Five-year survival outcomes were evaluated using Kaplan-Meier and Cox models. The study included 275 patients. Overall, 170 (62%) patients had blood transfusion. Via univariate analysis, we observed that transfusion correlated with an increased risk of developing recurrence (hazard ratio [HR], 2.2; 95% confidence interval [CI], 1.09-4.40; P = 0.02). Other factors associated with 5-year disease-free survival were noncomplete clinical response after neoadjuvant chemotherapy (HR, 2.99; 95% CI, 0.92-9.63; P = 0.06) and pathological (P = 0.03) response at neoadjuvant chemotherapy as well as parametrial (P = 0.004), vaginal (P < 0.001), and lymph node (P = 0.002) involvements. However, via multivariate analysis, only vaginal (HR, 3.07; 95% CI, 1.20-7.85; P = 0.01) and lymph node involvements (HR, 2.4; 95% CI, 1.00-6.06; P = 0.05) correlate with worse disease-free survival. No association with worse outcomes was observed for patients undergoing blood transfusion (HR, 2.71; 95% CI, 0.91-8.03; P = 0.07). Looking at factors influencing overall survival, we observed that lymph node status (P = 0.01) and vaginal involvement (P = 0.06) were independently associated with survival. The role of blood transfusions in increasing the risk of developing recurrence in LAAC patients treated by neoadjuvant chemotherapy plus radical surgery remains unclear; further prospective studies are warranted.

Causes of death in long-term lung cancer survivors: a SEER database analysis.

Science.gov (United States)

Abdel-Rahman, Omar

2017-07-01

Long-term (>5 years) lung cancer survivors represent a small but distinct subgroup of lung cancer patients and information about the causes of death of this subgroup is scarce. The Surveillance, Epidemiology and End Results (SEER) database (1988-2008) was utilized to determine the causes of death of long-term survivors of lung cancer. Survival analysis was conducted using Kaplan-Meier analysis and multivariate analysis was conducted using a Cox proportional hazard model. Clinicopathological characteristics and survival outcomes were assessed for the whole cohort. A total of 78,701 lung cancer patients with >5 years survival were identified. This cohort included 54,488 patients surviving 5-10 years and 24,213 patients surviving >10 years. Among patients surviving 5-10 years, 21.8% were dead because of primary lung cancer, 10.2% were dead because of other cancers, 6.8% were dead because of cardiac disease and 5.3% were dead because of non-malignant pulmonary disease. Among patients surviving >10 years, 12% were dead because of primary lung cancer, 6% were dead because of other cancers, 6.9% were dead because of cardiac disease and 5.6% were dead because of non-malignant pulmonary disease. On multivariate analysis, factors associated with longer cardiac-disease-specific survival in multivariate analysis include younger age at diagnosis (p death from primary lung cancer is still significant among other causes of death even 20 years after diagnosis of lung cancer. Moreover, cardiac as well as non-malignant pulmonary causes contribute a considerable proportion of deaths in long-term lung cancer survivors.

Childhood cancer incidence and survival in Japan and England: A population-based study (1993-2010).

Science.gov (United States)

Nakata, Kayo; Ito, Yuri; Magadi, Winnie; Bonaventure, Audrey; Stiller, Charles A; Katanoda, Kota; Matsuda, Tomohiro; Miyashiro, Isao; Pritchard-Jones, Kathy; Rachet, Bernard

2018-02-01

The present study aimed to compare cancer incidence and trends in survival for children diagnosed in Japan and England, using population-based cancer registry data. The analysis was based on 5192 children with cancer (age 0-14 years) from 6 prefectural cancer registries in Japan and 21 295 children diagnosed in England during 1993-2010. Differences in incidence rates between the 2 countries were measured with Poisson regression models. Overall survival was estimated using the Kaplan-Meier method. Incidence rates for Hodgkin lymphoma, renal tumors and Ewing sarcomas in England were more than twice as high as those in Japan. Incidence of germ cell tumors, hepatic tumors, neuroblastoma and acute myeloid leukemia (AML) was higher in Japan than in England. Incidence of all cancers combined decreased in Japan throughout the period 1993 to 2010, which was mainly explained by a decrease in registration of neuroblastoma in infants. For many cancers, 5-year survival improved in both countries. The improvement in survival in chronic myeloid leukemia (CML) was particularly dramatic in both countries. However, 5-year survival remained less than 80% in 2005-2008 in both countries for AML, brain tumors, soft tissue sarcomas, malignant bone tumors and neuroblastoma (age 1-14 years). There were significant differences in incidence of several cancers between countries, suggesting variation in genetic susceptibility and possibly environmental factors. The decrease in incidence for all cancers combined in Japan was related to the cessation of the national screening program for neuroblastoma. The large improvement in survival in CML coincided with the introduction of effective therapy (imatinib). © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Survival, durable tumor remission, and long-term safety in patients with advanced melanoma receiving nivolumab.

Science.gov (United States)

Topalian, Suzanne L; Sznol, Mario; McDermott, David F; Kluger, Harriet M; Carvajal, Richard D; Sharfman, William H; Brahmer, Julie R; Lawrence, Donald P; Atkins, Michael B; Powderly, John D; Leming, Philip D; Lipson, Evan J; Puzanov, Igor; Smith, David C; Taube, Janis M; Wigginton, Jon M; Kollia, Georgia D; Gupta, Ashok; Pardoll, Drew M; Sosman, Jeffrey A; Hodi, F Stephen

2014-04-01

Programmed cell death 1 (PD-1) is an inhibitory receptor expressed by activated T cells that downmodulates effector functions and limits the generation of immune memory. PD-1 blockade can mediate tumor regression in a substantial proportion of patients with melanoma, but it is not known whether this is associated with extended survival or maintenance of response after treatment is discontinued. Patients with advanced melanoma (N = 107) enrolled between 2008 and 2012 received intravenous nivolumab in an outpatient setting every 2 weeks for up to 96 weeks and were observed for overall survival, long-term safety, and response duration after treatment discontinuation. Median overall survival in nivolumab-treated patients (62% with two to five prior systemic therapies) was 16.8 months, and 1- and 2-year survival rates were 62% and 43%, respectively. Among 33 patients with objective tumor regressions (31%), the Kaplan-Meier estimated median response duration was 2 years. Seventeen patients discontinued therapy for reasons other than disease progression, and 12 (71%) of 17 maintained responses off-therapy for at least 16 weeks (range, 16 to 56+ weeks). Objective response and toxicity rates were similar to those reported previously; in an extended analysis of all 306 patients treated on this trial (including those with other cancer types), exposure-adjusted toxicity rates were not cumulative. Overall survival following nivolumab treatment in patients with advanced treatment-refractory melanoma compares favorably with that in literature studies of similar patient populations. Responses were durable and persisted after drug discontinuation. Long-term safety was acceptable. Ongoing randomized clinical trials will further assess the impact of nivolumab therapy on overall survival in patients with metastatic melanoma.

Long-term results of interventional treatment of large unresectable hepatocellular carcinoma (HCC): significant survival benefit from combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) compared to TACE monotherapy

International Nuclear Information System (INIS)

Lubienski, A.; Bitsch, R.G.; Grenacher, L.; Kauffmann, G.W.; Schemmer, P.; Duex, M.

2004-01-01

Purpose: A retrospective analysis of long-term efficacy of combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) and TACE monotherapy was conducted in patients with large, non-resectable hepatocellular carcinoma (HCC). Methods and Materials: Fifty patients with large, unresectable HCC lesions underwent selective TACE. Liver cirrhosis was present in 42 patients, due to alcohol abuse (n = 22) and viral infection (n = 17). In three patients, the underlying cause for liver cirrhosis remained unclear. Child A cirrhosis was found in 22 and Child B cirrhosis in 20 patients. Repeated and combined TACE and PEI were performed in 22 patients and repeated TACE monotherapy was performed in 28 patients. Survival and complication rates were determined and compared. Results: The 6-, 12-, 24- and 36-month survival rates were 61%, 21%, 4%, and 4% for TACE monotherapy and 77%, 55%, 39% and 22% for combined TACE and PEI (Kaplan-Meier method). The kind of treatment significantly affected the survival rate (p=0.002 log-rank test). Severe side effects were present in two patients of the monotherapy group and in three patients of the combination therapy group. (orig.)

Metastatic volume: an old oncologic concept and a new prognostic factor for stage IV melanoma patients.

Science.gov (United States)

Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S

2013-01-01

The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.

Radiation therapy improves survival in rectal small cell cancer - Analysis of Surveillance Epidemiology and End Results (SEER) data.

Science.gov (United States)

Modrek, Aram S; Hsu, Howard C; Leichman, Cynthia G; Du, Kevin L

2015-04-24

Small cell carcinoma of the rectum is a rare neoplasm with scant literature to guide treatment. We used the Surveillance Epidemiology and End Results (SEER) database to investigate the role of radiation therapy in the treatment of this cancer. The SEER database (National Cancer Institute) was queried for locoregional cases of small cell rectal cancer. Years of diagnosis were limited to 1988-2010 (most recent available) to reduce variability in staging criteria or longitudinal changes in surgery and radiation techniques. Two month conditional survival was applied to minimize bias by excluding patients who did not survive long enough to receive cancer-directed therapy. Patient demographics between the RT and No_RT groups were compared using Pearson Chi-Square tests. Overall survival was compared between patients who received radiotherapy (RT, n = 43) and those who did not (No_RT, n = 28) using the Kaplan-Meier method. Multivariate Cox proportional hazards model was used to evaluate important covariates. Median survival was significantly longer for patients who received radiation compared to those who were not treated with radiation; 26 mo vs. 8 mo, respectively (log-rank P = 0.009). We also noted a higher 1-year overall survival rate for those who received radiation (71.1% vs. 37.8%). Unadjusted hazard ratio for death (HR) was 0.495 with the use of radiation (95% CI 0.286-0.858). Among surgery, radiotherapy, sex and age at diagnosis, radiation therapy was the only significant factor for overall survival with a multivariate HR for death of 0.393 (95% CI 0.206-0.750, P = 0.005). Using SEER data, we have identified a significant survival advantage with the use of radiation therapy in the setting of rectal small cell carcinoma. Limitations of the SEER data apply to this study, particularly the lack of information on chemotherapy usage. Our findings strongly support the use of radiation therapy for patients with locoregional small cell rectal cancer.

Cannabinoid receptor-2 immunoreactivity is associated with survival in squamous cell carcinoma of the head and neck.

Science.gov (United States)

Klein Nulent, Thomas J W; Van Diest, Paul J; van der Groep, Petra; Leusink, Frank K J; Kruitwagen, Cas L J J; Koole, Ronald; Van Cann, Ellen M

2013-10-01

The prediction of progression of individual tumours, prognosis, and survival in squamous cell carcinoma (SCC) of the head and neck is difficult. Cannabinoid-1 (CB1) and cannabinoid-2 (CB2) receptor expression is related to survival in several types of cancer, and the aim of this study was to find out whether the expression of CB1 and CB2 receptors is associated with survival in primary SCC of the head and neck. We made immunohistochemical analyses of the cannabinoid receptors on tissue arrays from 240 patients with the disease. Receptor immunoreactivity was classified as none, weak, moderate, or strong staining. Overall survival and disease-specific survival were plotted using Kaplan-Meier survival curves. A multivariate Cox proportional hazard model was created with all the relevant clinical and pathological features. Strong immunoreactivity of the CB2 receptor was significantly associated with reduced disease-specific survival (p=0.007). Cox-proportional hazard ratio (HR) showed that CB2 receptor immunoreactivity contributed to the prediction of survival (HR 3.6, 95% CI 1.5-8.7, p=0.004). Depth of invasion (HR 2.2, 95% CI 1.2-4.2, p=0.01) and vascular invasion (HR 2.5, 95% CI 1.4-4.5, p=0.001) were also associated with survival. Copyright © 2013 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Tamoxifen therapy improves overall survival in luminal A subtype of ductal carcinoma in situ: a study based on nationwide Korean Breast Cancer Registry database.

Science.gov (United States)

Hwang, Ki-Tae; Kim, Eun-Kyu; Jung, Sung Hoo; Lee, Eun Sook; Kim, Seung Il; Lee, Seokwon; Park, Heung Kyu; Kim, Jongjin; Oh, Sohee; Kim, Young A

2018-06-01

To determine the prognostic role of tamoxifen therapy for patients with ductal carcinoma in situ (DCIS) according to molecular subtypes. Data of 14,944 patients with DCIS were analyzed. Molecular subtypes were classified into four categories based on expression of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2). Kaplan-Meier estimator was used for overall survival analysis while Cox proportional hazards model was used for univariate and multivariate analyses. Luminal A subtype (ER/PR+, HER2-) showed higher (P = .009) survival rate than triple-negative (TN) subtype. Tamoxifen therapy group showed superior (P < .001) survival than no-tamoxifen therapy group. It had survival benefit only for luminal A subtype (P = .001). Tamoxifen therapy resulted in higher survival rate in subgroups with positive ER (P = .006), positive PR (P = .009), and negative HER2 (P < .001). In luminal A subtype, tamoxifen therapy showed lower hazard ratio (HR) compared to no-tamoxifen therapy (HR, 0.420; 95% CI 0.250-0.705; P = .001). Tamoxifen therapy was a significant independent factor by multivariate analysis (HR, 0.538; 95% CI 0.306-0.946; P = .031) as well as univariate analysis. Tamoxifen therapy group showed superior prognosis than the no-tamoxifen therapy group. Its prognostic influence was only effective for luminal A subtype. Patients with luminal A subtype showed higher survival rate than those with TN subtype. Active tamoxifen therapy is recommended for DCIS patients with luminal A subtype, and routine tests for ER, PR, and HER2 should be considered for DCIS.

Circulating microRNAs in relation to EGFR status and survival of lung adenocarcinoma in female non-smokers.

Directory of Open Access Journals (Sweden)

Huan Zhang

Full Text Available OBJECTIVES: Lung adenocarcinoma is considered a unique disease for Asian female non-smokers. We investigated whether plasma microRNA (miRNA expression profiles are different by the EGFR status and are associated with survival outcomes of the patients. METHODS: Using real-time RT-PCR, we analyzed the expression of 20 miRNAs in the plasma of 105 female patients with lung adenocarcinoma. Kaplan-Meier survival analysis and Cox proportional hazards regression were performed to determine the association between miRNA expression and overall survival. Time dependent receiver operating characteristic (ROC analysis was also performed. RESULTS: In the 20 miRNAs, miR-122 were found differently expressed between wild and mutant EGFR carriers (P=0.018. Advanced disease stage and tumor metastasis were independently associated with poor prognosis of patients with lung adenocarcinoma (P=0.010 and 1.0×10(-4. Plasma levels of miR-195 and miR-122 expression were also associated with overall survival in the patients, especially in those with advanced stage (HR=0.23, 95%CI:0.07-0.84; and HR=0.22, 95%CI:0.06-0.77 and EGFR mutation (HR=0.27, 95%CI:0.08-0.96; and HR=0.23, 95%CI=0.06-0.81. Moreover, a model including miR-195, miR-122 may predict survival outcomes of female patients with lung adenocarcinoma (AUC=0.707. CONCLUSIONS: Circulating miR-195 and miR-122 may have prognostic values in predicting the overall survival as well as predicting EGFR mutation status in non-smoking female patients with lung adenocarcinoma. Measuring plasma levels of miR-195 and miR-122 may especially be useful in EGFR mutant patients with lung adenocarcinoma.

Comparative Survival in Patients With Postresection Recurrent Versus Newly Diagnosed Non-Small-Cell Lung Cancer Treated With Radiotherapy

International Nuclear Information System (INIS)

Cai Xuwei; Xu Luying; Wang Li; Hayman, James A.; Chang, Andrew C.; Pickens, Allan; Cease, Kemp B.; Orringer, Mark B.; Kong, F.-M.

2010-01-01

Purpose: To compare the survival of postresection recurrent vs. newly diagnosed non-small-cell lung cancer (NSCLC) patients treated with radiotherapy or chemoradiotherapy. Methods and Materials: The study population consisted of 661 consecutive patients with NSCLC registered in the radiation oncology databases at two medical centers in the United States between 1992 and 2004. Of the 661 patients, 54 had postresection recurrent NSCLC and 607 had newly diagnosed NSCLC. Kaplan-Meier and Cox regression models were used for the survival analyses. Results: The distribution of relevant clinical factors between these two groups was similar. The median survival time and 5-year overall survival rates were 19.8 months (95% confidence interval [CI], 13.9-25.7) and 14.8% (95% confidence interval, 5.4-24.2%) vs. 12.2 months (95% CI, 10.8-13.6) and 11.0% (95% CI, 8.5-13.5%) for recurrent vs. newly diagnosed patients, respectively (p = .037). For Stage I-III patients, no significant difference was observed in the 5-year overall survival (p = .297) or progression-free survival (p = .935) between recurrent and newly diagnosed patients. For the 46 patients with Stage I-III recurrent disease, multivariate analysis showed that chemotherapy was a significant prognostic factor for 5-year progression-free survival (hazard ratio, 0.45; 95% CI, 0.224-0.914; p = .027). Conclusion: Our institutional data have shown that patients with postresection recurrent NSCLC achieved survival comparable to that of newly diagnosed NSCLC patients when they were both treated with radiotherapy or chemoradiotherapy. These findings suggest that patients with postresection recurrent NSCLC should be treated as aggressively as those with newly diagnosed disease.

Factors affecting survival of women diagnosed with breast cancer in El-Minia Governorate, Egypt.

Science.gov (United States)

Seedhom, Amany Edward; Kamal, Nashwa Nabil

2011-07-01

This study was conducted to determine breast cancer survival time and the association between breast cancer survival and socio-demographic and pathologic factors among women, in El-Minia, Egypt. While there has been much researches regarding prognostic factors for breast cancer but the majority of these studies were from developed countries. El-Minia has a population of approximately 4 million. To date, no research has been performed to determine breast cancer survival and the factors affecting it in El-minia. This retrospective study used data obtained from the cancer registry in the National Institute of Oncology in El-Minia and included 1207 women diagnosed with first primary breast cancer between 1(st) January 2005 and 31(st) December 2009 and followed to 30(th) June 2010. The association between survival and sociodemographic and pathological factors and distant metastasis at diagnosis, and treatment options was investigated using unifactorial chi-square test and multi-factorial (Cox regression) analyses. Kaplan-Meier analysis was used to compare survival time among different groups. Median survival time was 83.8 ± 3.2. Cox regression showed that high vs low educational level (Hazard ratio (HR)= 0.35, 95% CI; 0.27-0.46), metastases to bone (HR = 3.22, 95% CI: 1.71-6.05), metastases to lung (HR= 2.314, 95% CI: 1.225-4.373), tumor size (≤ 2 cm vs ≥ 5 cm: HR = 1.4, 95% CI: 1.1-1.8) and number of involved nodes (1 vs > 10 HR = 5.21, 95%CI: 3.1-9.01) were significantly related to survival. The results showed the need to develop screening programs and standardized treatment regimens in a tax-funded health care system.

Resection of oligometastatic lung cancer to the pancreas may yield a survival benefit in select patients--a systematic review.

Science.gov (United States)

DeLuzio, Matthew R; Moores, Craig; Dhamija, Ankit; Wang, Zuoheng; Cha, Charles; Boffa, Daniel J; Detterbeck, Frank C; Kim, Anthony W

2015-01-01

To conduct a systematic review of the existing literature regarding surgical therapy for oligometastatic lung cancer to the pancreas. Data was collected on patients with singular pancreatic metastases from lung cancer from papers published between January 1970 and June 2014. This was performed following the Preferred Reporting Items for Systematic reviews and Meta-analysis (PRISMA) guidelines. Kaplan-Meier and Cox Regression analyses were then used to determine and compare survival. There were 27 papers that fulfilled the search criteria, from which data on 32 patients was collected. Non-small cell lung cancer (NSCLC) was the most prevalent type of primary lung malignancy, and metachronous presentations of metastases were most common. Lesions were most frequently located in the pancreatic head and consequently the most common curative intent metastasectomy was pancreaticoduodenectomy. There was a statistically significant survival benefit for patients whose metastasis were discovered incidentally by surveillance CT as opposed to those whose metastasis were discovered during a work up for new somatic complaints (p = 0.024). The overall median survival for patients undergoing curative intent resection was 29 months, with 2-year and 5-year survivals of 65% and 21% respectively. Palliative surgery or medical only management was associated with a median survival of 8 months and 2-year and 5-year survivals of 25% and 8% respectively. Curative intent resection of isolated pancreatic metastasis from lung cancer may be beneficial in a select group of patients. Copyright © 2015 IAP and EPC. Published by Elsevier B.V. All rights reserved.

Metformin and thiazolidinediones are associated with improved breast cancer-specific survival of diabetic women with HER2+ breast cancer.

Science.gov (United States)

He, X; Esteva, F J; Ensor, J; Hortobagyi, G N; Lee, M-H; Yeung, S-C J

2012-07-01

Insulin/insulin-like growth factor-I (IGF-I) signaling is a mechanism mediating the promoting effect of type 2 diabetes (DM2) on cancer. Human epidermal growth factor receptor (HER2), insulin receptor and IGF-I receptor involve the same PI3K/AKT/mTOR signaling, and different antidiabetic pharmacotherapy may differentially affect this pathway, leading to different prognoses of HER2+ breast cancer. We reviewed 1983 consecutive patients with HER2+ breast cancer treated between 1 January 1998 and 30 September 2010. The overall survival, breast cancer-specific death rate, age, race, nuclear grade, stage, menopausal status, estrogen and progesterone receptor status, body mass index and classes of antidiabetic pharmacotherapy were analyzed. A Cox regression analysis showed that DM2 [P=0.026, hazard ratio (HR)=1.42, 95 % confidence interval (95 % CI) 1.04-1.94] predicted poor survival of stage≥2 HER2+ breast cancer. In Kaplan-Meier analysis, metformin predicted lengthened survival and so did thiazolidinediones. Analyzing only the diabetics, Cox regression showed that metformin (P=0.041, HR=0.52, 95 % CI 0.28-0.97) and thiazolidinediones (P=0.036; HR=0.41, 95% CI 0.18-0.93) predicted lengthened survival, and competing risk analysis showed that metformin and thiazolidinediones were associated with decreased breast cancer-specific mortality (P=0.023, HR=0.47, 95% CI 0.24-0.90 and P=0.044, HR=0.42, 95 % CI 0.18-0.98, respectively). Thiazolidinediones and metformin users are associated with better clinical outcomes than nonusers in diabetics with stage≥2 HER2+ breast cancer. The choice of antidiabetic pharmacotherapy may influence prognosis of this group.

Fontan fenestration closure and event-free survival.

Science.gov (United States)

Imielski, Bartlomiej R; Woods, Ronald K; Mussatto, Kathleen A; Cao, Yumei; Simpson, Pippa M; Tweddell, James S

2013-01-01

The purpose of the present study was to evaluate the association of open and closed Fontan fenestration status with event-free survival. All patients who underwent a fenestrated Fontan procedure at our institution from January 1994 through June 2007 were reviewed. Patient information was obtained from the medical records. The patients were assigned to 1 of 2 study groups, open or closed, according to their most recent fenestration status. Clinically relevant morbid events were tabulated, and Kaplan-Meier event analysis was used to create event-free probability curves with log-rank comparisons. A total of 161 patients were classified as open and 51 as closed. The median interval to an event was 1.1 years (interquartile range, 0.1-3.3 years) after the Fontan procedure. The median interval to closure was 1.2 years (interquartile range, 0.7-3.3 years). The median interval to an event was 1.5 years (interquartile range, 0.1-4.6 years) in the closed group and 1.1 years (interquartile range, 0.1-3.3 years) in the open group. Event-free probability analysis revealed no significant difference between the 2 groups (P = .15). The median follow-up arterial oxygen saturation was greater in the closed group (96.0%; interquartile range, 94.0%-97.0%) than in the open group (91.0%; interquartile range, 86.0%-95.0%; P < .0001). Fenestration closure was associated with greater arterial oxygen saturation but not greater event-free survival. The interval to an event was slightly less than the interval to fenestration closure, suggesting potential merit in the evaluation of earlier fenestration closure. Adoption of specific fenestration management guidelines might help improve the overall outcomes and enhance the quality of future studies. Copyright © 2013 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.

Single nucleotide polymorphisms in the D-loop region of mitochondrial DNA is associated with the kidney survival time in chronic kidney disease patients.

Science.gov (United States)

Xu, Jinsheng; Guo, Zhanjun; Bai, Yaling; Zhang, Junxia; Cui, Liwen; Zhang, Huiran; Zhang, Shenglei; Ai, Xiaolu

2015-02-01

The mitochondrial displacement loop (D-loop) is known to accumulate mutations and SNPs at a higher frequency than other regions of mitochondrial DNA (mtDNA). We had identified chronic kidney disease (CKD) risk-associated SNPs in the D-loop of CKD patients previously. In this study, we investigated the association of SNPs in the D-loop of mtDNA with the kidney survival of CKD. The D-loop region of mtDNA was sequenced for 119 CKD patients from the inpatient of the Fourth Hospital of Hebei Medical University. The Kaplan-Meier method was used to identify disease outcome-associated SNPs in the D-loop of CKD patients. The Cox proportional hazards model was used to identify risk factors for the kidney survival of CKD. In the present study, we identified 20 SNPs with a frequency higher than 5% and assessed the relationship of these SNPs with kidney survival time in CKD patients, a SNP of 146 was identified by log-rank test for statistically significant prediction of the kidney survival time. In an overall multivariate analysis, allele 146 was identified as an independent predictor of kidney survival time in CKD patients. The survival time of kidney in the CKD patients with 146C was significantly shorter than that of kidney in CKD patients with 146T (relative risk, 2.336; 95% CI, 1.319-3.923; p = 0.001). SNPs in the D-loop can predict the kidney survival of CKD patients. Analysis of genetic polymorphisms in the mitochondrial D-loop can help to identify CKD patient subgroup at high risk of a poor disease outcome.

Survival benefit of tamoxifen and aromatase inhibitor in male and female breast cancer.

Science.gov (United States)

Eggemann, Holm; Altmann, Udo; Costa, Serban-Dan; Ignatov, Atanas

2018-02-01

Our goal was to compare the survival advantage of tamoxifen (TAM) and aromatase inhibitor (AI) in female (FBC) and male breast cancer (MBC). We performed a retrospective study of 2785 FBC and 257 MBC patients treated with hormonal therapy. The median follow-up was 106 months (range 3-151 months) and 42 months (range 2-115 months) for FBC and MBC, respectively. The patients were divided into two groups according to the hormonal therapy used: TAM-treated and AI-treated. MBC was characterized by older age, advanced tumor stage, and higher rate of lymph node metastases, in comparison with FBC. Matching analysis was performed using six prognostic criteria: patient age, tumor stage, tumor grade, lymph node status, human epidermal growth factor receptor (HER2) status, and administration of chemotherapy. The female and male patients were matched 2:1. In this analysis, 316 women and 158 men treated with TAM, and 60 women and 30 men treated with AI, were included. The overall survival (OS) was estimated by the Kaplan-Meier method and was compared between FBC and MBC. TAM-treated FBC and MBC patients had similar 5-year OS, 85.1 and 89.2%, respectively (p = 0.972). Notably, FBC patients treated with AI had significantly greater 5-year OS (85.0%) in comparison with AI-treated MBC patients (5-year OS of 73.3%; p = 0.028). The OS of TAM-treated patients with MBC was similar to the OS of TAM-treated FBC patients, whereas AI treatment is associated with poorer survival of MBC patients.

Modelling the survivorship of Nigeria children in their first 10 years of ...

African Journals Online (AJOL)

Fagbamigbe

Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...

Analysis of prognostic factors for survival in patients with primary spinal chordoma using the SEER Registry from 1973 to 2014.

Science.gov (United States)

Pan, Yue; Lu, Lingyun; Chen, Junquan; Zhong, Yong; Dai, Zhehao

2018-04-06

Spinal chordomas are rare primary osseous tumors that arise from the remnants of the notochord. They are commonly considered slow-growing, locally invasive neoplasms with little tendency to metastasize, but the high recurrent rate of spinal chordomas may seriously affect the survival rate and quality of life of patients. The aim of the study is to describe the epidemiological data and determine the prognostic factors for decreased survival in patients with primary spinal chordoma. The Surveillance, Epidemiology, and End Results (SEER) Registry database, a US population-based cancer registry database, was used to identify all patients diagnosed with primary spinal chordoma from 1973 to 2014. We utilized Kaplan-Meier method and Cox proportional hazards regression analysis to evaluate the association between patients overall survival and relevant characteristics, including age, gender, race, disease stage, treatment methods, primary tumor site, marital status, and urban county background. In the data set between 1973 and 2014, a total of 808 patients were identified with primary spinal chordoma. The overall rate of distant metastatic cases in our cohort was only 7.7%. Spinal chordoma was more common occurred in men (62.6%) than women (37.3%). Majority of neoplasms were found in the White (87.9%), while the incidence of the Black is relatively infrequent (3.3%). Three hundred fifty-seven spinal chordomas (44.2%) were located in the vertebral column, while 451 patients' tumor (55.8%) was located in the sacrum or pelvis. Age ≥ 60 years (HR = 2.72; 95%CI, 1.71 to 2.89), distant metastasis (HR = 2.16; 95%CI, 1.54 to 3.02), and non-surgical therapy (HR = 2.14; 95%CI, 1.72 to 2.69) were independent risk factors for survival reduction in analysis. Survival did not significantly differ as a factor of tumor site (vertebrae vs sacrum/pelvis) for primary spinal chordoma (HR = 0.93, P = 0.16). Race (P = 0.52), gender (P = 0.11), marital status (P = 0.94), and

Intraoperative blood loss independently predicts survival and recurrence after resection of colorectal cancer liver metastasis.

Directory of Open Access Journals (Sweden)

Wu Jiang

Full Text Available BACKGROUND: Although numerous prognostic factors have been reported for colorectal cancer liver metastasis (CRLM, few studies have reported intraoperative blood loss (IBL effects on clinical outcome after CRLM resection. METHODS: We retrospectively evaluated the clinical and histopathological characteristics of 139 patients who underwent liver resection for CRLM. The IBL cutoff volume was calculated using receiver operating characteristic curves. Overall survival (OS and recurrence free survival (RFS were assessed using the Kaplan-Meier and Cox regression methods. RESULTS: All patients underwent curative resection. The median follow up period was 25.0 months (range, 2.1-88.8. Body mass index (BMI and CRLM number and tumor size were associated with increased IBL. BMI (P=0.01; 95% CI = 1.3-8.5 and IBL (P500mL were 71%, 33%, and 0%, respectively (P<0.01. RFS of patients within three IBL volumes at the end of the first year were 67%, 38%, and 18%, respectively (P<0.01. CONCLUSIONS: IBL during CRLM resection is an independent predictor of long term survival and tumor recurrence, and its prognostic value was confirmed by a dose-response relationship.

Genetics Home Reference: Meier-Gorlin syndrome

Science.gov (United States)

... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...

Perturbative analysis for Kaplan's lattice chiral fermions

International Nuclear Information System (INIS)

Aoki, S.; Hirose, H.

1994-01-01

Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls

High Expression of PHGDH Predicts Poor Prognosis in Non–Small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Jinhong Zhu

2016-12-01

Full Text Available Tumors have exceptionally high demands for energy and anabolism because of their rapid growth. The de novo serine synthesis pathway initiated by phosphoglycerate dehydrogenase (PHGDH has been recognized as a hallmark of metabolic adaption in carcinogenesis. The oncogenic role and prognostic value of PHGDH have been investigated in multiple cancer types, including breast cancer, melanoma, cervical cancer, and colon cancer. Due to the importance of PHGDH in cancer, we attempted to determine the clinical significance of PHGDH in 319 patients with non–small cell lung cancer (NSCLC. We evaluated the mRNA and protein expression levels of PHGDH gene, using quantitative reverse transcriptase polymerase chain reaction and tissue array–based immunohistochemistry, respectively. Significantly increased PHGDH expression in mRNA and protein levels was identified in tumor tissues versus matched adjacent nontumor tissues. More interestingly, immunohistochemical expression of PHGDH was significantly associated with lymph node metastasis (P = .021 and TNM stage (P = .016. Kaplan-Meier survival analysis indicated that NSCLC patients with low levels of PHGDH outperformed patients with high levels of PHGDH regarding 5-year overall survival. Significantly longer survival in the former suggested the prognostic implication of PHGDH in NSCLC. Multivariate survival analysis using Cox regression model demonstrated that high PHGDH levels and advanced TNM stage (III + IV were independent predictors of prognosis in NSCLC. Moreover, bioinformatics analysis confirmed the increase in PHGDH transcripts (data from The Cancer Genome Atlas and its prognostic value (Kaplan-Meier plotter in NSCLC. In conclusion, this study suggested the clinical implication of PHGDH in NSCLC. PHGDH may be a promising therapeutic target in NSCLC.

Postoperative radiotherapy improves local control and survival in patients with uterine leiomyosarcoma

International Nuclear Information System (INIS)

Wong, Philip; Han, Kathy; Sykes, Jenna; Catton, Charles; Laframboise, Stephane; Fyles, Anthony; Manchul, Lee; Levin, Wilfred; Milosevic, Michael

2013-01-01

To examine the role of radiotherapy (RT) in uterine leiomyosarcomas (LMS) and to determine the patient population who may benefit from RT. From 1998–2008, 69 patients with primary uterine LMS underwent hysterectomy with or without pelvic radiotherapy to a median dose of 45 Gy. Univariate analysis was performed using the Kaplan-Meier method and cumulative-incidence function, and multivariate analyses using Fine and Gray or Cox proportional hazard models. Following surgery, 32 out of 69 patients received RT. There was no evidence of any correlation between patient, disease and treatment characteristics and the use of RT. Median follow-up was 57 months. RT was associated with reduced local recurrence (3y LR 19% vs. 39%; Gray’s p = 0.019) and improved overall survival (3y OS 69% vs. 35%; log-rank p = 0.025) on univariate analysis. Multivariate analysis demonstrated that RT reduced LR (HR: 0.28, CI: 0.11-0.69, p = 0.006) and increased OS (HR: 0.44, CI: 0.23-0.85, p = 0.014) independent of other clinical and pathologic factors. Positive surgical margins increased the odds of LR (HR: 5.6, CI: 2.3-13.4, p = 0.00012). Large tumor size and advanced stage (II-IV) were associated with the development of distant metastases and inferior OS. Postoperative pelvic RT reduces LR and improves OS of patients with uterine LMS

Long-term trends and survival analysis of esophageal and gastric cancer in Yangzhong, 1991-2013.

Directory of Open Access Journals (Sweden)

Zhaolai Hua

Full Text Available To describe the long-term trends of the incidence, mortality and survival of upper digestive tract cancers in a high-risk area of China.We extracted esophageal and gastric cancer cases diagnosed from 1991 to 2013 through the Yangzhong Cancer Registry and calculated the crude and age-standardized incidence and mortality rates. Cancer trends were calculated using the Joinpoint Regression Program and were reported using the annual percentage change (APC. The cancer-specific survival rates were evaluated and compared between groups using the Kaplan-Meier method and log-rank test.The age-standardized incidence rate of esophageal cancer declined from 107.06 per 100,000 person-years (male: 118.05 per 100,000 person-years; female: 97.42 per 100,000 person-years in 1991 to 37.04 per 100,000 person-years (male: 46.43 per 100,000 person-years; female: 27.26 per 100,000 person-years in 2013, with an APC of -2.5% (95% confidence interval (CI: -3.4%, -1.5% for males and -4.9% (95% CI:-5.8%, -3.9% for females. The age-standardized incidence rate of gastric cancer was 165.11 per 100,000 person-years (male: 225.39 per 100,000 person-years; female: 113.34 per 100,000 person-years in 1991 and 53.46 per 100,000 person-years (male: 76.51 per 100,000 person-years; female: 32.43 per 100,000 person-years in 2013, with the APC of -3.6% (95% CI: -4.5%, -2.7% for males and -4.8% (95% CI: -5.7%, -3.9% for females. The median survival time was 3.0 years for patients with esophageal or gastric cancer. Cancer cases detected after 2004 had a better prognosis.The age-standardized incidence rates of both esophageal and gastric cancer continuously decreased since 1991 through 2013, whereas the mortality rate remained stable before 2004 and significantly declined following the massive endoscopic screening program initiated in 2004. The survival probability of patients with esophageal and gastric cancer has improved obviously in recent decades.

Mortality risk and survival in the aftermath of the medieval Black Death.

Science.gov (United States)

DeWitte, Sharon N

2014-01-01

The medieval Black Death (c. 1347-1351) was one of the most devastating epidemics in human history. It killed tens of millions of Europeans, and recent analyses have shown that the disease targeted elderly adults and individuals who had been previously exposed to physiological stressors. Following the epidemic, there were improvements in standards of living, particularly in dietary quality for all socioeconomic strata. This study investigates whether the combination of the selective mortality of the Black Death and post-epidemic improvements in standards of living had detectable effects on survival and mortality in London. Samples are drawn from several pre- and post-Black Death London cemeteries. The pre-Black Death sample comes from the Guildhall Yard (n = 75) and St. Nicholas Shambles (n = 246) cemeteries, which date to the 11th-12th centuries, and from two phases within the St. Mary Spital cemetery, which date to between 1120-1300 (n = 143). The St. Mary Graces cemetery (n = 133) was in use from 1350-1538 and thus represents post-epidemic demographic conditions. By applying Kaplan-Meier analysis and the Gompertz hazard model to transition analysis age estimates, and controlling for changes in birth rates, this study examines differences in survivorship and mortality risk between the pre- and post-Black Death populations of London. The results indicate that there are significant differences in survival and mortality risk, but not birth rates, between the two time periods, which suggest improvements in health following the Black Death, despite repeated outbreaks of plague in the centuries after the Black Death.

Mortality risk and survival in the aftermath of the medieval Black Death.

Directory of Open Access Journals (Sweden)

Sharon N DeWitte

Full Text Available The medieval Black Death (c. 1347-1351 was one of the most devastating epidemics in human history. It killed tens of millions of Europeans, and recent analyses have shown that the disease targeted elderly adults and individuals who had been previously exposed to physiological stressors. Following the epidemic, there were improvements in standards of living, particularly in dietary quality for all socioeconomic strata. This study investigates whether the combination of the selective mortality of the Black Death and post-epidemic improvements in standards of living had detectable effects on survival and mortality in London. Samples are drawn from several pre- and post-Black Death London cemeteries. The pre-Black Death sample comes from the Guildhall Yard (n = 75 and St. Nicholas Shambles (n = 246 cemeteries, which date to the 11th-12th centuries, and from two phases within the St. Mary Spital cemetery, which date to between 1120-1300 (n = 143. The St. Mary Graces cemetery (n = 133 was in use from 1350-1538 and thus represents post-epidemic demographic conditions. By applying Kaplan-Meier analysis and the Gompertz hazard model to transition analysis age estimates, and controlling for changes in birth rates, this study examines differences in survivorship and mortality risk between the pre- and post-Black Death populations of London. The results indicate that there are significant differences in survival and mortality risk, but not birth rates, between the two time periods, which suggest improvements in health following the Black Death, despite repeated outbreaks of plague in the centuries after the Black Death.

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation.

Science.gov (United States)

Zhang, Qing; Deng, Yong-Lin; Liu, Chang; Huang, Li-Hong; Shang, Lei; Chen, Xin-Guo; Wang, Le-Tian; Du, Jin-Zan; Wang, Ying; Wang, Pei-Xiao; Zhang, Hui; Shen, Zhong-Yang

2016-11-21

To determine whether diabetes mellitus (DM) affects prognosis/recurrence after liver transplantation (LT) for hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC). A retrospective study was conducted between January 2000 and August 2013 on 1631 patients with HBV-related HCC who underwent LT with antiviral prophylaxis. Patient data were obtained from the China Liver Transplant Registry (https://www.cltr.org/). To compare the outcomes and tumor recurrence in the HBV-related HCC patients with or without DM, statistical analyses were conducted using χ 2 tests, Mann-Whitney tests, the Kaplan-Meier method, log-rank tests and multivariate step-wise Cox regression analysis. Univariate analysis of 1631 patients who underwent LT found overall 1-, 3- and 5-year survival rates of 79%, 73% and 71% respectively in the DM patients, and 84%, 78% and 76% in the non-DM patients respectively. Overall survival rate differences after LT between the two groups were significant ( P = 0.041), but recurrence-free survival rates were not ( P = 0.096). By stratified analysis, the overall survival rates in DM patients for age > 50 years ( P = 0.002), the presence of vascular invasion ( P = 0.096), tumors ≤ 3 cm ( P = 0.047), two to three tumor nodules ( P = 0.007), Child-Pugh grade B ( P = 0.018), and pre-LT alanine aminotransferase levels between 40 and 80 IU/L ( P = 0.017) were significantly lower than in non-DM patients. Additionally, serum α-fetoprotein level > 2000 ng/mL ( P = 0.052) was associated with a significant survival difference trend between DM and non-DM patients. Multivariate analysis showed that the presence of DM ( P < 0.001, HR = 1.591; 95%CI: 1.239-2.041) was an independent predictor associated with poor survival after LT. HBV-related HCC patients with DM have decreased long-term overall survival and poor LT outcomes. Prevention strategies for HCC patients with DM are recommended.

Correlation between preoperative serum alpha-fetoprotein levels and survival with respect to the surgical treatment of hepatocellular carcinoma at a tertiary care hospital in Veracruz, Mexico

Directory of Open Access Journals (Sweden)

G. Martínez-Mier

2017-10-01

Full Text Available Introduction: Preoperative serum alpha-fetoprotein levels can have predictive value for hepatocellular carcinoma survival. Aim: Our aim was to analyze the correlation between preoperative serum alpha-fetoprotein levels and survival, following the surgical treatment of hepatocellular carcinoma. Methods: Nineteen patients were prospectively followed (07/2005-01/2016. An ROC curve was created to determine the sensitivity and specificity of alpha-fetoprotein in relation to survival (Kaplan-Meier. Results: Of the 19 patients evaluated, 57.9% were men. The mean patient age was 68.1 ± 8.5 years and survival at 1, 3, and 5 years was 89.4, 55.9, and 55.9%. The alpha-fetoprotein cutoff point was 15.1 ng/ml (sensitivity 100%, specificity 99.23%. Preoperative alpha-fetoprotein levels below 15.1, 200, 400, and 463 ng/ml correlated with better 1 and 5-year survival rates than levels above 15.1, 200, 400, and 463 ng/ml (P<.05. Conclusions: Elevated preoperative serum alpha-fetoprotein levels have predictive value for hepatocellular carcinoma survival. Resumen: Introducción: Los niveles séricos de alfafetoproteína (AFP preoperatoria pueden tener valor predictivo para la sobrevida del hepatocarcinoma (HCC. Objetivo: Analizar la correlación entre los niveles séricos de AFP preoperatoria y la sobrevida posterior al tratamiento quirúrgico del HCC. Métodos: Diecinueve pacientes fueron seguidos prospectivamente (julio del 2005-enero del 2016. Se realizó una curva ROC para determinar la sensibilidad y la especificidad de la AFP con relación con la sobrevida (Kaplan-Meier. Resultados: Se evaluó a 19 pacientes, 57.9% hombres, edad media 68.1 ± 8.5 años con sobrevida a 1, 3 y 5 años del 89.4, el 55.9 y el 55.9%. El punto de corte de AFP fue 15.1 ng/ml (sensibilidad 100%, especificidad 99.23%. Los niveles preoperatorios de AFP menores de 15.1, 200, 400 y 463 ng/ml correlacionaron con mejor sobrevida a 1 y 5 años que niveles mayores de AFP (p < 0

Long-term survival of patients with primary oral squamous cell carcinoma. Comparison of two treatment protocols in a prospective study; 5-Jahres-Ueberlebenswahrscheinlichkeit von Patienten mit primaeren Plattenepithelkarzinomen der Mundhoehle. Vergleich von zwei Behandlungsstrategien in einer prospektiven Studie

Energy Technology Data Exchange (ETDEWEB)

Kessler, P.; Bloch-Birkholz, A.; Neukam, F.W. [Erlangen-Nuernberg Univ., Erlangen (Germany). Klinik und Poliklinik fuer Mund-, Kiefer-, Gesichtschirurgie; Grabenbauer, G.; Sauer, R. [Erlangen-Nuernberg Univ., Erlangen (Germany). Klinik und Poliklinik fuer Strahlentherapie; Leher, A. [Erlangen-Nuernberg Univ., Erlangen (Germany). Inst. fuer Medizininformatik, Biometrie und Epidemiologie; Vairaktaris, E. [Univ. of Athens Medical School (Greece). Dept. of Maxillofacial Surgery

2007-04-15

Background and Purpose: In recent years, different concepts for the treatment of oral squamous cell carcinomas (OSCC) have been developed; these include preoperative simultaneous neoadjuvant radiochemotherapy and one-stage surgery with tumor ablation and reconstruction. When considering long-term survival, there is substantial evidence that multimodality treatment based on a neoadjuvant radiochemotherapy is superior to adjuvant therapy concepts based on a surgical approach with postoperative irradiation. The aim of this study was to discuss the 5-year survival rate in a neoadjuvant and an adjuvant combination treatment in patients with primary OSCC. Patients and Methods: This nonrandomized longitudinal study prospectively evaluates the long-term tumor-free survival in 128 patients with oral cancer. Two groups consisting of 74 neoadjuvantly and 54 primarily surgically treated patients were formed. 99 patients suffered from stage III and IV disease according to the UICC criteria. Long-term survival was estimated according to the Kaplan-Meier assumption. Results: The neoadjuvant treatment increases the prospect of a long-term tumor-free survival. According to Kaplan-Meier assumption the estimation for a 5-year tumor-free survival in OSCC in category T1 is 83.1% in neoadjuvant, and 70.1% in adjuvant treatment, in T2 79.6% and 57.7%, in T3 68.2% and 33.2%, in T4 51.4% and 30.5%, respectively. Significance (p < 0.05) could be proven for T1 (p = 0.002), T2 (p = 0.028), and T4 (p < 0.0001) tumors. The effectiveness of the preoperative radiochemotherapy was demonstrated in the pathohistological result of tumor-free resection specimens in 28 patients of the neoadjuvant treatment group (37.8%). On the other hand, four patients died during the preoperative combination therapy. 64.8% of the patients in the adjuvant and 71.6% in the neoadjuvant treatment group survived the observation period. Conclusion: Neoadjuvant therapy is highly effective and results in a better 5-year

Moderate precision of prognostic scoring systems in a consecutive, prospective cohort of 544 patients with metastatic spinal cord compression

DEFF Research Database (Denmark)

Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck

2014-01-01

and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....

Perioperative and mid-term oncologic outcomes of robotic assisted radical cystectomy with totally intracorporeal neobladder: Results of a propensity score matched comparison with open cohort from a single-centre series.

Science.gov (United States)

Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele

2018-04-17

In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

Multi-objective shape optimization of runner blade for Kaplan turbine

International Nuclear Information System (INIS)

Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V

2014-01-01

Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads

Multi-objective shape optimization of runner blade for Kaplan turbine

Science.gov (United States)

Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.

2014-03-01

Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.

Impact of Symptomatic Metastatic Spinal Cord Compression on Survival of Patients with Non-Small-Cell Lung Cancer.

Science.gov (United States)

da Silva, Gustavo Telles; Bergmann, Anke; Thuler, Luiz Claudio Santos

2017-12-01

Non-small-cell lung cancer (NSCLC) is one of the most common primary tumor sites among patients with metastatic spinal cord compression (MSCC). This disorder is related to neurologic dysfunction and can reduce the quality of life, but the association between MSCC and death is unclear. The aim of this study was to analyze the impact of the occurrence of symptomatic MSCC on overall survival of patients with NSCLC. A cohort study was carried out involving 1112 patients with NSCLC who were enrolled between 2006 and 2014 in a single cancer center. Clinical and sociodemographic data were extracted from the physical and electronic records. Survival analysis of patients with NSCLC was conducted using the Kaplan-Meier method. A log-rank test was used to assess differences between survival curves. Cox proportional hazards regression analyses were carried out to quantify the relationship between the independent variable (MSCC) and the outcome (overall survival). During the study period, the incidence of MSCC was 4.1%. Patients who presented with MSCC were 1.43 times more likely to die than were those with no history of MSCC (hazard ratio, 1.43; 95% confidence interval [CI], 1.03-2.00; P = 0.031). The median survival time was 8.04 months (95% CI, 6.13-9.96) for those who presented MSCC and 11.95 months (95% CI, 10.80-13.11) for those who did not presented MSCC during the course of disease (P = 0.002). MSCC is an important and independent predictor of NSCLC worse survival. This effect was not influenced by sociodemographic and clinical factors. Copyright © 2017 Elsevier Inc. All rights reserved.

Temozolomide during radiotherapy of glioblastoma multiforme. Daily administration improves survival

Energy Technology Data Exchange (ETDEWEB)

Nachbichler, Silke Birgit; Schupp, Gabi; Ballhausen, Hendrik; Niyazi, Maximilian; Belka, Claus [LMU Munich, Department of Radiation Oncology, Munich (Germany)

2017-11-15

Temozolomide-(TMZ)-based chemoradiotherapy defines the current gold standard for the treatment of newly diagnosed glioblastoma. Data regarding the influence of TMZ dose density during chemoradiotherapy are currently not available. We retrospectively compared outcomes in patients receiving no TMZ, TMZ during radiotherapy on radiotherapy days only, and TMZ constantly 7 days a week. From 2002-2012, a total of 432 patients with newly diagnosed glioblastoma received radiotherapy in our department: 118 patients had radiotherapy alone, 210 had chemoradiotherapy with TMZ (75 mg/m{sup 2}) daily (7/7), and 104 with TMZ only on radiotherapy days (5/7). Radiotherapy was applied to a total dose of 60 Gy. Median survival after radiotherapy alone was 9.1 months, compared to 12.6 months with 5/7-TMZ and to 15.7 months with 7/7-TMZ. The 1-year survival rates were 33, 52, and 64%, respectively. Kaplan-Meier analysis showed a significant improvement of TMZ-7/7 vs. 5/7 (p = 0.01 by the log-rank test), while 5/7-TMZ was still superior to no TMZ at all (p = 0.02). Multivariate Cox regression showed a significant influence of TMZ regimen (p = 0.009) on hazard rate (+58% between groups) even in the presence of confounding factors age, sex, resection status, and radiotherapy dose concept. Our results confirm the findings of the EORTC/NCIC trial. It seems that also a reduced TMZ scheme can at first prolong the survival of glioblastoma patients, but not as much as the daily administration. (orig.) [German] Eine Temozolomid-(TMZ-)basierte Radiochemotherapie ist der gegenwaertige Goldstandard in der Behandlung von neu diagnostizierten Glioblastomen. Daten bezueglich des Einflusses der TMZ-Dosisdichte waehrend der Radiochemotherapie sind derzeit nicht vorhanden. Wir haben retrospektiv die Ergebnisse von Patienten verglichen, die entweder kein TMZ, TMZ zur Strahlentherapie nur an Bestrahlungstagen oder TMZ konstant 7 Tage/Woche erhalten hatten. Von 2002-2012 bekamen insgesamt 432 Patienten mit

Radiotherapy of the chest wall following mastectomy for early-stage breast cancer: impact on local recurrence and overall survival

International Nuclear Information System (INIS)

Janni, Wolfgang; Dimpfl, Thomas; Braun, Stephan; Knobbe, Angelika; Peschers, Ursula; Rjosk, Dorothea; Lampe, Bjoern; Genz, Thomas

2000-01-01

Introduction: Recent studies have renewed an old controversy about the efficacy of adjuvant radiotherapy following mastectomy for breast cancer. Radiotherapy is usually recommended for advanced disease, but whether or not to use it in pT1-T2 pN0 situations is still being debated. This study was designed to clarify whether or not routine radiotherapy of the chest wall following mastectomy reduces the risk of local recurrence and if it influences the overall survival rate. Methods: Retrospective analysis of patients treated with mastectomy for pT1-T2 pN0 tumors and no systemic treatment. Patients treated with radiotherapy of the chest wall following mastectomy (Group A) are compared with those treated with mastectomy alone (Group B). Results: A total of 918 patients underwent mastectomy. Patients who received adjuvant radiotherapy after mastectomy (n = 114) had a significantly lower risk for local recurrence. Ten years after the primary diagnosis, 98.1% of the patients with radiotherapy were disease free compared to 86.4% of the patients without radiotherapy. The average time interval from primary diagnosis until local recurrence was 8.9 years in Group A and 2.8 years in Group B. The Cox regression analysis including radiotherapy, tumor size and tumor grading found the highest risk for local recurrence for patients without radiotherapy (p < 0.0004). In terms of overall survival however, the Kaplan-Meier analysis showed no difference between the two groups (p = 0.8787) and the Cox regression analysis failed to show any impact on overall survival. Conclusion: With observation spanning over 35 years, this study shows that adjuvant radiotherapy of the chest wall following mastectomy reduces the risk for local recurrence in node-negative patients with pT1-T2 tumors but has no impact on the overall survival rate

Incidence of bone metastases and survival after a diagnosis of bone metastases in breast cancer patients.

Science.gov (United States)

Harries, M; Taylor, A; Holmberg, L; Agbaje, O; Garmo, H; Kabilan, S; Purushotham, A

2014-08-01

Bone is the most common metastatic site associated with breast cancer. Using a database of women with breast cancer treated at Guy's Hospital, London 1976-2006 and followed until end 2010, we determined incidence of and survival after bone metastases. We calculated cumulative incidence of bone metastases considering death without prior bone metastases as a competing risk. Risk of bone metastases was modelled through Cox-regression. Survival after bone metastases diagnosis was calculated using Kaplan-Meier methodology. Of the 7064 women, 589 (22%) developed bone metastases during 8.4 years (mean). Incidence of bone metastases was significantly higher in younger women, tumour size >5 cm, higher tumour grade, lobular carcinoma and ≥ four positive nodes, but was not affected by hormone receptor status. Median survival after bone metastases diagnosis was 2.3 years in women with bone-only metastases compared with early, and proportionately fewer patients in this group. Incidence of bone metastases has decreased but bone metastases remain a highly relevant clinical problem due to the large number of patients being diagnosed with breast cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.

Sequential alternating deferiprone and deferoxamine treatment compared to deferiprone monotherapy: main findings and clinical follow-up of a large multicenter randomized clinical trial in -thalassemia major patients

DEFF Research Database (Denmark)

Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela

2011-01-01

In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...

Natural Killer/T-cell Neoplasms: Analysis of Incidence, Patient Characteristics, and Survival Outcomes in the United States.

Science.gov (United States)

Kommalapati, Anuhya; Tella, Sri Harsha; Ganti, Apar Kishore; Armitage, James O

2018-05-04

Limited data are available regarding the incidence, survival patterns, and long-term outcomes of natural killer (NK)/T-cell neoplasms in the United States. We performed a retrospective study of patients with NK/T-cell neoplasms diagnosed from 2001 to 2014 using the Surveillance, Epidemiology, and End Results program database. The Kaplan-Meier method was used to estimate the overall survival difference among the subgroups. Multivariate analyses were used to determine the factors affecting survival. For the 797 patients with NK/T-cell lymphoma, nasal type, the median age at diagnosis was 53 years, and males tended to be younger at diagnosis (P < .0001). The incidence of the disease increased from 0.4 in 2001 to 0.8 in 2014 per 1,000,000 individuals. The incidence was significantly greater in Hispanic patients compared with that in non-Hispanic patients (rate ratio, 3.03; P = .0001). The median overall survival was 20 months (range, 2-73 months) and varied significantly according to the primary site (P < .0001) and the disease stage at diagnosis (P < .0001). NK/T-cell lymphoma patients had an increased risk of acute myeloid leukemia (standardized incidence ratio, 18.77; 95% confidence interval, 2.27-67.81). For the 105 NK/T-cell leukemia patients, the median age at diagnosis was 58 years (range, 4-95 years). The overall incidence of the disease was 0.09 per 1,000,000 individuals and was significantly greater in males (rate ratio, 0.41; P < .0001). Unlike NK/T-cell lymphoma, no racial disparities were found in the incidence. The median overall survival was 17 months (range, 0-36 months). The incidence of NK/T-cell lymphoma, nasal type, in the United States has at least doubled in the past decade, with the greatest predilection among Hispanics. Patients with NK/T-cell lymphoma might have an increased risk of the subsequent development of acute myeloid leukemia. Copyright © 2018 Elsevier Inc. All rights reserved.

Does race influence survival for esophageal cancers treated on the radiation and chemotherapy arm of RTOG no. 85-01?

International Nuclear Information System (INIS)

Streeter, O.E.; Martz, K.L.; Gaspar, L.E.; DelRowe, J.D.; Asbell, S.O.; Salter, M.M.

1995-01-01

. weight loss within the 6 months preceding trial registration, while 44% of the whites had less than a 10 lbs weight loss. This probably represents a delay in diagnosis for blacks compared to whites in the study. Multivariate analysis shows prognostic significance for age (<70 vs age 70+), p=.0033 and weight loss (<10 lbs vs 10+ lbs), p=.0026 in all evaluable patients (n=119). When all histologies are combined, overall survival was not dependent on race. The Kaplan-Meier median survival estimate for whites is 17 months and for blacks 14.1 (unadjusted Log-rank p=0.2757). Overall, squamous cell histology represented 82% ((97(119))) of the patients evaluated. In the 'squamous only' Cox regression model analysis, race is a significant factor (p=0.0012), along with age over 70 (p=0.0002) and N-stage (p=0.0177). The Kaplan-Meier median survival estimate for whites and blacks in this squamous cell subgroup was 16.9 and 14.1 months (unadjusted Log-rank p=0.1222). Conclusions: This analysis demonstrates when all histologies are combined and treated aggressively with RT+CT, race is not a statistically significant factor in overall survival. However, race, along with age over 70 and positive nodal status are independent variables for survival for patients with a squamous cell histology. We are evaluating the impact of adenocarcinoma on white patients in this study, which appears to eliminate any statistically significant survival advantage of whites vs blacks. This study, along a with growing body of reports from other tumor sites in the RTOG database suggest that race alone does not determine survival when all patients receive the same standard of care

Asbestos Exposure and Survival in Malignant Mesothelioma: A Description of 122 Consecutive Cases at an Occupational Clinic

Directory of Open Access Journals (Sweden)

E Skammeritz

2011-09-01

Full Text Available Background: The natural history and etiology of malignant mesothelioma (MM is already thoroughly described in the literature, but there is still debate on prognostic factors, and details of asbestos exposure and possible context with clinical and demographic data, have not been investigated comprehensively. Objectives: Description of patients with MM, focusing on exposure, occupation, survival and prognostic factors. Methods: Review of medical records of patients with MM from 1984 to 2010 from a Danish Occupational clinic. Survival was estimated using Kaplan-Meier survival analysis and prognostic factors were identified by Cox regression analysis. Results: 110 (90.2% patients were male, and 12 (9.8% were female. The median (interquartile rang [IQR] age was 65 (13 years. Pleural MM was seen in 101 (82.8% patients, and peritoneal in 11 (9.0%; two (1.6% had MM to tunica vaginalis testis, and eight (6.6% to multiple serosal surfaces. We found 68 (55.7% epithelial tumors, 26 (21.3% biphasic, and 6 (4.9% sarcomatoid. 12 (9.8% patients received tri-modal therapy, 66 (54.1% received one-/two-modality treatment, and 36 (29.5% received palliative care. Asbestos exposure was confirmed in 107 (91.0% patients, probable in four (3.3%, and unidentifiable in 11 (9.0%. The median (IQR latency was 42 (12.5 years. Exposure predominantly occurred in shipyards. The median overall survival was 1.05 (95% CI: 0.96–1.39 years; 5-year survival was 5.0% (95% CI: 2.0%–13.0%. Female sex, good WHO performance status (PS, epithelial histology and tri-modal treatment were associated with a favorable prognosis. Conclusion: MM continuously presents a difficult task diagnostically and therapeutically, and challenges occupational physicians with regard to identification and characterization of asbestos exposure.

Survival outcome of malignant minor salivary tumors in Pakistani population

Directory of Open Access Journals (Sweden)

Hassan Iqbal

2014-01-01

Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

Strategy for personalized treatment of human papillomavirus-positive oropharyngeal squamous cell carcinoma

International Nuclear Information System (INIS)

Mizumachi, Takatsugu; Hatakeyama, Hiromitsu; Kano, Satoshi; Sakashita, Tomohiro; Suzuki, Seigo; Homma, Akihiro; Oridate, Nobuhiko; Fukuda, Satoshi

2011-01-01

We performed a retrospective analysis of the association between tumor HPV status and the demographic and clinicopathological parameters of 83 patients with oropharyngeal squamous cell carcinoma at Hokkaido University Hospital, Japan, between 1998 and 2010. The parameters included age, gender, tumor subsite, Tumor-Node-Metastasis (TNM) stage, and overall survival. HPV status was established by multiplex polymerase chain reaction analysis. Of the 83 oropharyngeal cancers, 22 were positive for HPV-16, two for HPV-18, and one for HPV-35 and HPV-58. Kaplan-Meier survival analysis showed improved overall survival rates in patients with HPV-positive tumors (p=0.0024) compared with HPV-negative tumors. Of the 51 patients who received chemoradiotherapy, HPV-positive patients experienced better overall survival than HPV-negative patients (p=0.0024). HPV status is a significantly favorable prognostic factor in oropharyngeal cancer in Japan. (author)

Exponential Decay Nonlinear Regression Analysis of Patient Survival Curves: Preliminary Assessment in Non-Small Cell Lung Cancer

Science.gov (United States)

Stewart, David J.; Behrens, Carmen; Roth, Jack; Wistuba, Ignacio I.

2010-01-01

Background For processes that follow first order kinetics, exponential decay nonlinear regression analysis (EDNRA) may delineate curve characteristics and suggest processes affecting curve shape. We conducted a preliminary feasibility assessment of EDNRA of patient survival curves. Methods EDNRA was performed on Kaplan-Meier overall survival (OS) and time-to-relapse (TTR) curves for 323 patients with resected NSCLC and on OS and progression-free survival (PFS) curves from selected publications. Results and Conclusions In our resected patients, TTR curves were triphasic with a “cured” fraction of 60.7% (half-life [t1/2] >100,000 months), a rapidly-relapsing group (7.4%, t1/2=5.9 months) and a slowly-relapsing group (31.9%, t1/2=23.6 months). OS was uniphasic (t1/2=74.3 months), suggesting an impact of co-morbidities; hence, tumor molecular characteristics would more likely predict TTR than OS. Of 172 published curves analyzed, 72 (42%) were uniphasic, 92 (53%) were biphasic, 8 (5%) were triphasic. With first-line chemotherapy in advanced NSCLC, 87.5% of curves from 2-3 drug regimens were uniphasic vs only 20% of those with best supportive care or 1 drug (p<0.001). 54% of curves from 2-3 drug regimens had convex rapid-decay phases vs 0% with fewer agents (p<0.001). Curve convexities suggest that discontinuing chemotherapy after 3-6 cycles “synchronizes” patient progression and death. With postoperative adjuvant chemotherapy, the PFS rapid-decay phase accounted for a smaller proportion of the population than in controls (p=0.02) with no significant difference in rapid-decay t1/2, suggesting adjuvant chemotherapy may move a subpopulation of patients with sensitive tumors from the relapsing group to the cured group, with minimal impact on time to relapse for a larger group of patients with resistant tumors. In untreated patients, the proportion of patients in the rapid-decay phase increased (p=0.04) while rapid-decay t1/2 decreased (p=0.0004) with increasing

Risk factors affecting survival in heart transplant patients.

Science.gov (United States)

Almenar, L; Cardo, M L; Martínez-Dolz, L; García-Palomar, C; Rueda, J; Zorio, E; Arnau, M A; Osa, A; Palencia, M

2005-11-01

Certain cardiovascular risk factors have been linked to morbidity and mortality in heart transplant (HT) patients. The sum of various risk factors may have a large cumulative negative effect, leading to a substantially worse prognosis and the need to consider whether HT is contraindicated. The objective of this study was to determine whether the risk factors usually available prior to HT result in an excess mortality in our setting that contraindicates transplantation. Consecutive patients who underwent heart transplantation from November 1987 to January 2004 were included. Heart-lung transplants, retransplants, and pediatric transplants were excluded. Of the 384 patients, 89% were men. Mean age was 52 years (range, 12 to 67). Underlying disease included ischemic heart disease (52%), idiopathic dilated cardiomyopathy (36%), valvular disease (8%), and other (4%). Variables considered risk factors were obesity (BMI >25), dyslipidemia, hypertension, prior thoracic surgery, diabetes, and history of ischemic heart disease. Survival curves by number of risk factors using Kaplan-Meier and log-rank for comparison of curves. Overall patient survival at 1, 5, 10, and 13 years was 76%, 68%, 54%, and 47%, respectively. Survival at 10 years, if fewer than two risk factors were present, was 69%; 59% if two or three factors were present; and 37% if more than three associated risk factors were present (P = .04). The presence of certain risk factors in patients undergoing HT resulted in lower survival rates. The combination of various risk factors clearly worsened outcomes. However, we do not believe this should be an absolute contraindication for transplantation.

Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

International Nuclear Information System (INIS)

Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho

2010-01-01

We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate

Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

Energy Technology Data Exchange (ETDEWEB)

Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)

2010-08-15

We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.

Early post-operative magnetic resonance imaging in glioblastoma: correlation among radiological findings and overall survival in 60 patients

International Nuclear Information System (INIS)

Majos, Carles; Cos, Monica; Castaner, Sara; Gil, Miguel; Plans, Gerard; Lucas, Anna; Bruna, Jordi; Aguilera, Carles

2016-01-01

To evaluate early post-operative magnetic resonance (EPMR) as a prognostic tool after resection of glioblastoma. Sixty EPMR examinations were evaluated for perioperative infarct, tumour growth between diagnosis and EPMR, contrast enhancement pattern, and extent of resection (EOR). The EOR was approached with the subjective evaluation of radiologists and by quantifying volumes. These parameters were tested as predictors of survival using the Kaplan-Meier method. Contrast enhancement was found in 59 patients (59/60; 98 %). Showing a thin-linear pattern of enhancement was the most favourable finding. Patients with this pattern survived longer than patients with thick-linear (median overall survival (OS) thin-linear=609 days; thick-linear=432 days; P =.023) or nodular (median OS = 318 days; P =.001) enhancements. The subjective evaluation of the EOR performed better than its quantification. Patients survived longer when resection was total (median OS total resection=609 days; subtotal=371 days; P =.001). When resection was subtotal, patients survived longer if it was superior to 95 % (median OS resection superior to 95 %=559 days; inferior to 95 %=256 days; P =.034). EPMR provides valuable prognostic information after surgical resection of glioblastomas. A thin-linear pattern of contrast enhancement is the most favourable finding. Further prognostic stratification may be obtained by assessing the EOR. (orig.)

Early post-operative magnetic resonance imaging in glioblastoma: correlation among radiological findings and overall survival in 60 patients

Energy Technology Data Exchange (ETDEWEB)

Majos, Carles [IDI Centre Bellvitge, HU de Bellvitge, Department of Radiology, Barcelona (Spain); Centro de Investigacion en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), Barcelona (Spain); Hospital Duran i Reynals, IDI Centre Bellvitge, Barcelona (Spain); Cos, Monica; Castaner, Sara [IDI Centre Bellvitge, HU de Bellvitge, Department of Radiology, Barcelona (Spain); Gil, Miguel [ICO l' Hospitalet, HU de Bellvitge, Department of Medical Onclogy, Barcelona (Spain); Plans, Gerard [HU de Bellvitge, Department of Neurosurgery, Barcelona (Spain); Lucas, Anna [ICO l' Hospitalet, HU de Bellvitge, Department of Radiotherapy Oncology, Barcelona (Spain); Bruna, Jordi [HU de Bellvitge, Department of Neurology, Barcelona (Spain); Aguilera, Carles [IDI Centre Bellvitge, HU de Bellvitge, Department of Radiology, Barcelona (Spain); Centro de Investigacion en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), Barcelona (Spain)

2016-04-15

To evaluate early post-operative magnetic resonance (EPMR) as a prognostic tool after resection of glioblastoma. Sixty EPMR examinations were evaluated for perioperative infarct, tumour growth between diagnosis and EPMR, contrast enhancement pattern, and extent of resection (EOR). The EOR was approached with the subjective evaluation of radiologists and by quantifying volumes. These parameters were tested as predictors of survival using the Kaplan-Meier method. Contrast enhancement was found in 59 patients (59/60; 98 %). Showing a thin-linear pattern of enhancement was the most favourable finding. Patients with this pattern survived longer than patients with thick-linear (median overall survival (OS) thin-linear=609 days; thick-linear=432 days; P =.023) or nodular (median OS = 318 days; P =.001) enhancements. The subjective evaluation of the EOR performed better than its quantification. Patients survived longer when resection was total (median OS total resection=609 days; subtotal=371 days; P =.001). When resection was subtotal, patients survived longer if it was superior to 95 % (median OS resection superior to 95 %=559 days; inferior to 95 %=256 days; P =.034). EPMR provides valuable prognostic information after surgical resection of glioblastomas. A thin-linear pattern of contrast enhancement is the most favourable finding. Further prognostic stratification may be obtained by assessing the EOR. (orig.)

Survival Rate of Dental Implants in Patients with History of Periodontal Disease: A Retrospective Cohort Study.

Science.gov (United States)

Correia, Francisco; Gouveia, Sónia; Felino, António Campos; Costa, Ana Lemos; Almeida, Ricardo Faria

To evaluate the differences between the survival rates of implants placed in patients with no history of periodontal disease (NP) and in patients with a history of chronic periodontal disease (CP). A retrospective cohort study was conducted in which all consenting patients treated with dental implants in a private clinic in Oporto, Portugal, from November 2, 2002 through February 11, 2011 were included. All patients were treated consecutively by the same experimental operator. This study aimed to analyze how the primary outcomes (presence of disease, time of placement, and time of loading) and the secondary outcomes (severity-generalized periodontitis, brand, implant length, prosthesis type, prosthesis metal-ceramic extension) influence the survival rate of dental implants. The survival analysis was performed through the Kaplan-Meier method, and the equality of survival distributions for all groups was tested with the log-rank test with a significance level of .05 for all comparisons. The sample consisted of 202 patients (47% NP and 53% CP) and 689 implants (31% NP and 69% CP). The survival rate in the NP and CP groups showed no statistically significant differences (95.8% versus 93.1%; P ≥ .05). Implants were lost before loading in 54.9% of the cases. The majority of the implants were lost in the first year and stabilized after the second year. Survival rates in the NP and CP patients showed no statistically significant differences when comparing the following factors: subclassification of the disease, implant brands, implant length (short/standard), type of prosthesis, extension of the prosthesis metal-ceramic, and time of placement and loading (P ≥ .05). This work disclosed no statistically significant differences in terms of survival rates when compared with the control group. Placing implants in patients with a history of periodontal disease appears to be viable and safe.

Bronchoscopic management of patients with symptomatic airway stenosis and prognostic factors for survival.

Science.gov (United States)

Okiror, Lawrence; Jiang, Li; Oswald, Nicola; Bille, Andrea; Rajesh, Pala; Bishay, Ehab; Steyn, Richard; Naidu, Babu; Kalkat, Maninder

2015-05-01

Interventional bronchoscopy is effective in the management of patients with symptomatic airway obstruction for both malignant and benign conditions. The main aim of this study is to report our experience with emergency interventional bronchoscopy in patients with symptomatic airway obstruction and identify prognostic factors for survival. This is a retrospective observational study of patients undergoing emergency interventional bronchoscopy over a 4-year period. Survival times were analyzed separately for patients with benign and malignant airway obstruction by the Kaplan-Meier method. Between June 2009 and July 2013, 168 emergency interventional bronchoscopies were performed in 112 patients for airway obstruction. The median age was 63 years (range, 20 to 86), and 91 patients (54%) patients were female. Seventy-two cases (43%) had airway obstruction due to malignant disease. There were 3 in-hospital deaths (2.7%). Median survival of the study population was 5.6 months (range, 0 to 51) with a median follow-up of 7.3 months (range, 0 to 51). Median survival for patients with malignant airway obstruction was 3.5 months (range, 0 to 21), and 9.8 months (range, 0.1 to 51) for those with benign disease. Airway intervention facilitated palliative chemotherapy in 32 patients (44%) of those with malignant airway obstruction. At multivariate analysis in patients with malignant airway obstruction, presence of stridor (hazard ratio 1.919, 95% confidence interval: 1.082 to 3.404, p = 0.026) and not receiving postprocedure chemotherapy (hazard ratio 2.05, 95% confidence interval: 1.156 to 3.636, p = 0.014) were independent prognostic factors for death. Emergency interventional bronchoscopy for airway obstruction is safe, relieved symptoms, and facilitated palliative chemotherapy, which improved survival. Copyright © 2015 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

Prediction of the survival and functional ability of severe stroke patients after ICU therapeutic intervention

Directory of Open Access Journals (Sweden)

Aoun-Bacha Zeina

2008-06-01

Full Text Available Abstract Background This study evaluated the benefits and impact of ICU therapeutic interventions on the survival and functional ability of severe cerebrovascular accident (CVA patients. Methods Sixty-two ICU patients suffering from severe ischemic/haemorrhagic stroke were evaluated for CVA severity using APACHE II and the Glasgow coma scale (GCS. Survival was determined using Kaplan-Meier survival tables and survival prediction factors were determined by Cox multivariate analysis. Functional ability was assessed using the stroke impact scale (SIS-16 and Karnofsky score. Risk factors, life support techniques and neurosurgical interventions were recorded. One year post-CVA dependency was investigated using multivariate analysis based on linear regression. Results The study cohort constituted 6% of all CVA (37.8% haemorrhagic/62.2% ischemic admissions. Patient mean(SD age was 65.8(12.3 years with a 1:1 male: female ratio. During the study period 16 patients had died within the ICU and seven in the year following hospital release. The mean(SD APACHE II score at hospital admission was 14.9(6.0 and ICU mean duration of stay was 11.2(15.4 days. Mechanical ventilation was required in 37.1% of cases. Risk ratios were; GCS at admission 0.8(0.14, (p = 0.024, APACHE II 1.11(0.11, (p = 0.05 and duration of mechanical ventilation 1.07(0.07, (p = 0.046. Linear coefficients were: type of CVA – haemorrhagic versus ischemic: -18.95(4.58 (p = 0.007, GCS at hospital admission: -6.83(1.08, (p = 0.001, and duration of hospital stay -0.38(0.14, (p = 0.40. Conclusion To ensure a better prognosis CVA patients require ICU therapeutic interventions. However, as we have shown, where tests can determine the worst affected patients with a poor vital and functional outcome should treatment be withheld?

Breast conserving treatment of breast carcinoma T2 ({<=} 4 cm) and T3 by neoadjuvant chemotherapy, quadrantectomy, high dose rate brachytherapy as a boost, external beam radiotherapy and adjuvant chemotherapy: local control and overall survival analysis; Tratamento conservador do cancer de mama T2 ({<=} 4 cm) e T3 por quimioterapia neoadjuvante, quadrantectomia, braquiterapia com alta taxa de dose como reforco de dose, teleterapia complementar e quimioterapia adjuvante: analise de controle local e sobrevida global

Energy Technology Data Exchange (ETDEWEB)

Soares, Celia Regina; Miziara Filho, Miguel Abrao; Fogaroli, Ricardo Cesar; Baraldi, Helena Espindola; Pellizzon, Antonio Cassio Assis; Pelosi, Edilson Lopes [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Radioterapia], e-mail: celiarsoares@terra.com.br; Fristachi, Carlos Elias [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Onco-Ginecologia e Mastologia; Paes, Roberto Pinto [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil)

2008-12-15

Objective: to assess the treatment of breast cancer T2 ({<=} 4 cm) and T3 through neoadjuvant chemotherapy, quadrantectomy and high dose rate brachytherapy as a boost, complementary radiotherapy and adjuvant chemotherapy, considering local control and overall survival. Material and method: this clinical prospective descriptive study was based on the evaluation of 88 patients ranging from 30 to 70 years old, with infiltrating ductal carcinoma, clinical stage IIb and IIIa, responsive to the neoadjuvant chemotherapy, treated from June/1995 to December/2006. Median follow-up was 58 months. Using clinical methods the tumor was evaluated before and after three or four cycles of chemotherapy based on anthracyclines. Overall survival and local control were assessed according to Kaplan-Meier methodology. Results: Local control and overall survival in five years were 90% and 73.5%, respectively. Conclusion: local control and overall survival were comparable to other forms of treatment. (author)

Survival and Predictive Factors of Lethality in Hemodyalisis: D/I Polymorphism of The Angiotensin I-Converting Enzyme and of the Angiotensinogen M235T Genes

Directory of Open Access Journals (Sweden)

Mauro Alves

2014-09-01

Full Text Available Background: End-stage kidney disease patients continue to have markedly increased cardiovascular disease morbidity and mortality. Analysis of genetic factors connected with the renin-angiotensin system that influences the survival of the patients with end-stage kidney disease supports the ongoing search for improved outcomes. Objective: To assess survival and its association with the polymorphism of renin-angiotensin system genes: angiotensin I-converting enzyme insertion/deletion and angiotensinogen M235T in patients undergoing hemodialysis. Methods: Our study was designed to examine the role of renin-angiotensin system genes. It was an observational study. We analyzed 473 chronic hemodialysis patients in four dialysis units in the state of Rio de Janeiro. Survival rates were calculated by the Kaplan-Meier method and the differences between the curves were evaluated by Tarone-Ware, Peto-Prentice, and log rank tests. We also used logistic regression analysis and the multinomial model. A p value ≤ 0.05 was considered to be statistically significant. The local medical ethics committee gave their approval to this study. Results: The mean age of patients was 45.8 years old. The overall survival rate was 48% at 11 years. The major causes of death were cardiovascular diseases (34% and infections (15%. Logistic regression analysis found statistical significance for the following variables: age (p = 0.000038, TT angiotensinogen (p = 0.08261, and family income greater than five times the minimum wage (p = 0.03089, the latter being a protective factor. Conclusions: The survival of hemodialysis patients is likely to be influenced by the TT of the angiotensinogen M235T gene.

Survival time and effect of selected predictor variables on survival in owned pet cats seropositive for feline immunodeficiency and leukemia virus attending a referral clinic in northern Italy.

Science.gov (United States)

Spada, Eva; Perego, Roberta; Sgamma, Elena Assunta; Proverbio, Daniela

2018-02-01

Feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV) are among the most important feline infectious diseases worldwide. This retrospective study investigated survival times and effects of selected predictor factors on survival time in a population of owned pet cats in Northern Italy testing positive for the presence of FIV antibodies and FeLV antigen. One hundred and three retrovirus-seropositive cats, 53 FIV-seropositive cats, 40 FeLV-seropositive cats, and 10 FIV+FeLV-seropositive cats were included in the study. A population of 103 retrovirus-seronegative age and sex-matched cats was selected. Survival time was calculated and compared between retrovirus-seronegative, FIV, FeLV and FIV+FeLV-seropositive cats using Kaplan-Meier survival analysis. Cox proportional-hazards regression analysis was used to study the effect of selected predictor factors (male gender, peripheral blood cytopenia as reduced red blood cells - RBC- count, leukopenia, neutropenia and lymphopenia, hypercreatininemia and reduced albumin to globulin ratio) on survival time in retrovirus-seropositive populations. Median survival times for seronegative cats, FIV, FeLV and FIV+FeLV-seropositive cats were 3960, 2040, 714 and 77days, respectively. Compared to retrovirus-seronegative cats median survival time was significantly lower (P<0.000) in FeLV and FIV+FeLV-seropositive cats. Median survival time in FeLV and FIV+FeLV-seropositive cats was also significant lower (P<0.000) when compared to FIV-seropositive cats. Hazard ratio of death in FeLV and FIV+FeLV-seropositive cats being respectively 3.4 and 7.4 times higher, in comparison to seronegative cats and 2.3 and 4.8 times higher in FeLV and FIV+FeLV-seropositive cats as compared to FIV-seropositive cats. A Cox proportional-hazards regression analysis showed that FIV and FeLV-seropositive cats with reduced RBC counts at time of diagnosis of seropositivity had significantly shorter survival times when compared to FIV and Fe

Regional variations in age at diagnosis and overall survival among patients with chronic myeloid leukemia from low and middle income countries.

Science.gov (United States)

Mendizabal, Adam M; Garcia-Gonzalez, Pat; Levine, Paul H

2013-06-01

The epidemiology of chronic myeloid leukemia (CML) in low and middle income countries is limited. As a result, we analyzed a contemporary cohort of patients from low and middle income countries treated with Imatinib through The Glivec(®) International Patient Assistance Program (GIPAP). Generalized estimating equations (GEE) and Kaplan-Meier estimation were utilized to test for regional variations in age at diagnosis and overall survival among 33,985 patients from 94 countries. Patients participated from Asia (79.2%), Africa (9.4%), Latin America (8.7%) and Southern/Eastern Europe (2.5%). Sixty-one (61.2%) percent were male. Mean age at diagnosis was 38.5 years (9.4% 1 year; decreasing to 15.5% in 2010 (p 1-year (p 400 mg (p age at diagnosis and overall survival exist within and between regions. Additional epidemiological studies should be conducted to assess for possible environmental factors associated with the earlier age at onset. Copyright © 2013 Elsevier Ltd. All rights reserved.

Correlation of degree of hypothyroidism with survival outcomes in patients with metastatic renal cell carcinoma receiving vascular endothelial growth factor receptor tyrosine kinase inhibitors.

Science.gov (United States)

Bailey, Erin B; Tantravahi, Srinivas K; Poole, Austin; Agarwal, Archana M; Straubhar, Alli M; Batten, Julia A; Patel, Shiven B; Wells, Chesley E; Stenehjem, David D; Agarwal, Neeraj

2015-06-01

Hypothyroidism is a common adverse effect of vascular endothelial growth factor receptor tyrosine kinase inhibitor (VEGFR-TKI) therapy in patients with metastatic renal cell carcinoma (mRCC). Some studies have shown an association with improved survival. However, hypothyroidism severity has not been correlated with survival outcomes. We report the incidence and severity of VEGFR-TKI therapy-associated hypothyroidism in correlation with the survival outcomes of patients with mRCC. A retrospective analysis of patients with mRCC who received VEGFR-TKIs (2004 through 2013) was conducted from a single institutional database. Hypothyroidism, progression-free survival (PFS), and overall survival (OS) were assessed. Univariate and multivariate analyses were performed using the Kaplan-Meier method and Cox proportional hazard models. Of 125 patients with mRCC, 65 were eligible. Their median age was 59 years (range, 45-79 years), and 46 (70.8%) were male. Hypothyroidism occurred in 25 patients (38.5%), of whom 13 had a peak thyroid-stimulating hormone (TSH) level > 10 mIU/L during treatment. The median OS was significantly longer in patients with a peak TSH > 10 mIU/L than in patients with a peak TSH of ≤ 10 mIU/L (not reached vs. 21.4 months, P = .005). On multivariate analysis, risk criteria, number of previous therapies, and severe hypothyroidism (TSH > 10 mIU/L) during VEGFR-TKI therapy remained significant for improvements in PFS and OS. The severity of VEGFR-TKI therapy-associated hypothyroidism (TSH > 10 mIU/L) was associated with improved survival outcomes in patients with mRCC and should not necessitate a dose reduction or therapy discontinuation. Copyright © 2015 Elsevier Inc. All rights reserved.

Glutathione S-transferase T1, O1 and O2 polymorphisms are associated with survival in muscle invasive bladder cancer patients.

Directory of Open Access Journals (Sweden)

Tatjana I Djukic

Full Text Available OBJECTIVE: To examine the association of six glutathione transferase (GST gene polymorphisms (GSTT1, GSTP1/rs1695, GSTO1/rs4925, GSTO2/rs156697, GSTM1, GSTA1/rs3957357 with the survival of patients with muscle invasive bladder cancer and the genotype modifying effect on chemotherapy. PATIENTS AND METHODS: A total of 105 patients with muscle invasive bladder cancer were included in the study. The follow-up lasted 5 years. The effect of GSTs polymorphisms on predicting mortality was analyzed by the Cox proportional hazard models, while Kaplan-Meier analysis was performed to assess differences in survival. RESULTS: GSTT1 active, GSTO1 Asp140Asp or GSTO2 Asp142Asp genotypes were independent predictors of a higher risk of death among bladder cancer patients (HR = 2.5, P = 0.028; HR = 2.9, P = 0.022; HR = 3.9, P = 0.001; respectively and significantly influenced the overall survival. There was no association between GSTP1, GSTM1 and GSTA1 gene variants with overall mortality. Only GSTO2 polymorphism showed a significant effect on the survival in the subgroup of patients who received chemotherapy (P = 0.006. CONCLUSION: GSTT1 active genotype and GSTO1 Asp140Asp and GSTO2 Asp142Asp genotypes may have a prognostic/pharmacogenomic role in patients with muscle invasive bladder cancer.

[Determinants of survival in HIV patients receiving antiretroviral therapy in Goma, Democratic Republic of Congo].

Science.gov (United States)

Akilimali, P Z; Mutombo, P B; Kayembe, P K; Kaba, D K; Mapatano, M A

2014-06-01

The study aimed to identify factors associated with the survival of patients receiving antiretroviral therapy. A historic cohort of HIV patients from two major hospitals in Goma (Democratic Republic of Congo) was followed from 2004 to 2012. The Kaplan-Meier method was used to describe the probability of survival as a function of time since inclusion into the cohort. The log-rank test was used to compare survival curves based on determinants. The Cox regression model identified the determinants of survival since treatment induction. The median follow-up time was 3.56 years (IQR=2.22-5.39). The mortality rate was 40 deaths per 1000 person-years. Male gender (RR: 2.56; 95 %CI 1.66-4.83), advanced clinical stage (RR: 2.12; 95 %CI 1.15-3.90), low CD4 count (CD4 < 50) (RR: 2.05; 95 %CI : 1.22-3.45), anemia (RR: 3.95; 95 %CI 2.60-6.01), chemoprophylaxis with cotrimoxazole (RR: 4.29, 95 % CI 2.69-6.86) and period of treatment initiation (2010-2011) (RR: 3.34; 95 %CI 1.24-8.98) were statistically associated with short survival. Initiation of treatment at an early stage of the disease with use of less toxic molecules and an increased surveillance especially of male patients are recommended to reduce mortality. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Marital status and survival in patients with rectal cancer: A population-based STROBE cohort study.

Science.gov (United States)

Li, Zhuyue; Wang, Kang; Zhang, Xuemei; Wen, Jin

2018-05-01

To examine the impact of marital status on overall survival (OS) and rectal cancer-specific survival (RCSS) for aged patients.We used the Surveillance, Epidemiology and End Results database to identify aged patients (>65 years) with early stage rectal cancer (RC) (T1-T4, N0, M0) in the United States from 2004 to 2010. Propensity score matching was conducted to avoid potential confounding factors with ratio at 1:1. We used Kaplan-Meier to compare OS and RCSS between the married patients and the unmarried, respectively. We used cox proportion hazard regressions to obtain hazard rates for OS, and proportional subdistribution hazard model was performed to calculate hazard rates for RCSS.Totally, 5196 patients were included. The married (2598 [50%]) aged patients had better crude 5-year overall survival rate (64.2% vs 57.3%, P vs 75.9%, P unmarried (2598 (50%)), respectively. In multivariate analyses, married patients had significantly lower overall death than unmarried patients (HR = 0.77, 95% CI = 0.71-0.83, P married patients had no cancer-specific survival benefit versus the unmarried aged patients (HR = 0.92, 95% CI = 0.81-1.04, P = .17).Among old population, married patients with early stage RC had better OS than the unmarried, while current evidence showed that marital status might have no protective effect on cancer-specific survival.

Age at sexual initiation and factors associated with it among youths ...

African Journals Online (AJOL)

Bernt Lindtjorn

Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.

Survival in Response to Multimodal Therapy in Anaplastic Thyroid Cancer.

Science.gov (United States)

Prasongsook, Naiyarat; Kumar, Aditi; Chintakuntlawar, Ashish V; Foote, Robert L; Kasperbauer, Jan; Molina, Julian; Garces, Yolanda; Ma, Daniel; Wittich, Michelle A Neben; Rubin, Joseph; Richardson, Ronald; Morris, John; Hay, Ian; Fatourechi, Vahab; McIver, Bryan; Ryder, Mabel; Thompson, Geoffrey; Grant, Clive; Richards, Melanie; Sebo, Thomas J; Rivera, Michael; Suman, Vera; Jenkins, Sarah M; Smallridge, Robert C; Bible, Keith C

2017-12-01

Historical outcomes in anaplastic thyroid cancer (ATC) have been dismal. To determine whether an initial intensive multimodal therapy (MMT) is associated with improved ATC survival. MMT was offered to all patients with newly diagnosed ATC treated at the Mayo Clinic from 2003 through 2015; MMT vs care with palliative intent (PI) was individualized considering clinical status and patient preferences. Outcomes were retrospectively analyzed by American Joint Committee on Cancer stage and treatments compared with patient cohort data from 1949 through 1999. Forty-eight patients (60% male; median age, 62 years); 18 treated with PI, 30 with MMT. Overall survival (OS) and progression-free survival determined by Kaplan-Meier method. Median OS and 1-year survival for the later cohort were 9 months [95% confidence interval (CI), 4 to 22 months] and 42% (95% CI, 28% to 56%) vs 3 months and 10% for the earlier cohort. Median OS was 21 months compared with 3.9 months in the pooled MMT vs PI groups for the later cohort [hazard ratio (HR), 0.32; P = 0.0006]. Among only patients in the later cohort who had stage IVB disease, median OS was 22.4 vs 4 months (HR, 0.12; 95% CI, 0.03 to 0.44; P = 0.0001), with 68% vs 0% alive at 1 year (MMT vs PI). Among patients with stage IVC cancer, OS did not differ by therapy. MMT appears to convey longer survival in ATC among patients with stage IVA/B disease. Copyright © 2017 Endocrine Society

The Prognostic Impact of NK/NKT Cell Density in Periampullary Adenocarcinoma Differs by Morphological Type and Adjuvant Treatment.

Science.gov (United States)

Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin

2016-01-01

Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.

Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

Energy Technology Data Exchange (ETDEWEB)

Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)

2017-03-15

The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

High Rab27A expression indicates favorable prognosis in CRC.

Science.gov (United States)

Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng

2015-06-13

Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.

Prognostic factors and survival of colorectal cancer in Kurdistan province, Iran: A population-based study (2009-2014).

Science.gov (United States)

Rasouli, Mohammad Aziz; Moradi, Ghobad; Roshani, Daem; Nikkhoo, Bahram; Ghaderi, Ebrahim; Ghaytasi, Bahman

2017-02-01

Colorectal cancer (CRC) survival varies at individual and geographically level. This population-based study aimed to evaluating various factors affecting the survival rate of CRC patients in Kurdistan province.In a retrospective cohort study, patients diagnosed as CRC were collected through a population-based study from March 1, 2009 to 2014. The data were collected from Kurdistan's Cancer Registry database. Additional information and missing data were collected reference to patients' homes, medical records, and pathology reports. The CRC survival was calculated from the date of diagnosis to the date of cancer-specific death or the end of follow-up (cutoff date: October 2015). Kaplan-Meier method and log-rank test were used for the univariate analysis of survival in various subgroups. The proportional-hazard model Cox was also used in order to consider the effects of different factors on survival including age at diagnosis, place of residence, marital status, occupation, level of education, smoking, economic status, comorbidity, tumor stage, and tumor grade.A total number of 335 patients affected by CRC were assessed and the results showed that 1- and 5-year survival rate were 87% and 33%, respectively. According to the results of Cox's multivariate analysis, the following factors were significantly related to CRC survival: age at diagnosis (≥65 years old) (HR 2.08, 95% CI: 1.17-3.71), single patients (HR 1.62, 95% CI: 1.10-2.40), job (worker) (HR 2.09, 95% CI: 1.22-3.58), educational level: diploma or below (HR 0.61, 95% CI: 0.39-0.92), wealthy economic status (HR 0.51, 95% CI: 0.31-0.82), tumor grade in poorly differentiated (HR 2.25, 95% CI: 1.37-3.69), and undifferentiated/anaplastic grade (HR 2.90, 95% CI: 1.67-4.98).We found that factors such as low education, inappropriate socioeconomic status, and high tumor grade at the time of disease diagnosis were effective in the poor survival of CRC patients in Kurdistan province; this, which need more attention.

The Influence of Total Nodes Examined, Number of Positive Nodes, and Lymph Node Ratio on Survival After Surgical Resection and Adjuvant Chemoradiation for Pancreatic Cancer: A Secondary Analysis of RTOG 9704

Energy Technology Data Exchange (ETDEWEB)

Showalter, Timothy N. [Department of Radiation Oncology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA (United States); Winter, Kathryn A. [Radiation Therapy Oncology Group, RTOG Statistical Center, Philadelphia, PA (United States); Berger, Adam C., E-mail: adam.berger@jefferson.edu [Department of Surgery, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA (United States); Regine, William F. [Department of Radiation Oncology, University of Maryland Medical Center, Baltimore, MD (United States); Abrams, Ross A. [Department of Radiation Oncology, Rush University Medical Center, Chicago, IL (United States); Safran, Howard [Department of Medicine, Miriam Hospital, Brown University Oncology Group, Providence, RI (United States); Hoffman, John P. [Department of Surgical Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Benson, Al B. [Division of Hematology-Oncology, Northwestern University, Chicago, IL (United States); MacDonald, John S. [St. Vincent' s Cancer Care Center, New York, NY (United States); Willett, Christopher G. [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States)

2011-12-01

Purpose: Lymph node status is an important predictor of survival in pancreatic cancer. We performed a secondary analysis of Radiation Therapy Oncology Group (RTOG) 9704, an adjuvant chemotherapy and chemoradiation trial, to determine the influence of lymph node factors-number of positive nodes (NPN), total nodes examined (TNE), and lymph node ratio (LNR ratio of NPN to TNE)-on OS and disease-free survival (DFS). Patient and Methods: Eligible patients from RTOG 9704 form the basis of this secondary analysis of lymph node parameters. Actuarial estimates for OS and DFS were calculated using Kaplan-Meier methods. Cox proportional hazards models were performed to evaluate associations of NPN, TNE, and LNR with OS and DFS. Multivariate Cox proportional hazards models were also performed. Results: There were 538 patients enrolled in the RTOG 9704 trial. Of these, 445 patients were eligible with lymph nodes removed. Overall median NPN was 1 (min-max, 0-18). Increased NPN was associated with worse OS (HR = 1.06, p = 0.001) and DFS (HR = 1.05, p = 0.01). In multivariate analyses, both NPN and TNE were associated with OS and DFS. TNE > 12, and >15 were associated with increased OS for all patients, but not for node-negative patients (n = 142). Increased LNR was associated with worse OS (HR = 1.01, p < 0.0001) and DFS (HR = 1.006, p = 0.002). Conclusion: In patients who undergo surgical resection followed by adjuvant chemoradiation, TNE, NPN, and LNR are associated with OS and DFS. This secondary analysis of a prospective, cooperative group trial supports the influence of these lymph node parameters on outcomes after surgery and adjuvant therapy using contemporary techniques.

[11C]Choline PET/CT predicts survival in hormone-naive prostate cancer patients with biochemical failure after radical prostatectomy

International Nuclear Information System (INIS)

Giovacchini, Giampiero; Incerti, Elena; Mapelli, Paola; Gianolli, Luigi; Picchio, Maria; Kirienko, Margarita; Briganti, Alberto; Gandaglia, Giorgio; Montorsi, Francesco

2015-01-01

Over the last decade, PET/CT with radiolabelled choline has been shown to be useful for restaging patients with prostate cancer (PCa) who develop biochemical failure. The limitations of most clinical studies have been poor validation of [ 11 C]choline PET/CT-positive findings and lack of survival analysis. The aim of this study was to assess whether [ 11 C]choline PET/CT can predict survival in hormone-naive PCa patients with biochemical failure. This retrospective study included 302 hormone-naive PCa patients treated with radical prostatectomy who underwent [ 11 C]choline PET/CT from 1 December 2004 to 31 July 2007 because of biochemical failure (prostate-specific antigen, PSA, >0.2 ng/mL). Median PSA was 1.02 ng/mL. PCa-specific survival was estimated using Kaplan-Meier curves. Cox regression analysis was used to evaluate the association between clinicopathological variables and PCa-specific survival. The coefficients of the covariates included in the Cox regression analysis were used to develop a novel nomogram. Median follow-up was 7.2 years (1.4 - 18.9 years). [ 11 C]Choline PET/CT was positive in 101 of 302 patients (33 %). Median PCa-specific survival after prostatectomy was 14.9 years (95 % CI 9.7 - 20.1 years) in patients with positive [ 11 C]choline PET/CT. Median survival was not achieved in patients with negative [ 11 C]choline PET/CT. The 15-year PCa-specific survival probability was 42.4 % (95 % CI 31.7 - 53.1 %) in patients with positive [ 11 C]choline PET/CT and 95.5 % (95 % CI 93.5 - 97.5 %) in patients with negative [ 11 C]choline PET/CT. In multivariate analysis, [ 11 C]choline PET/CT (hazard ratio 6.36, 95 % CI 2.14 - 18.94, P < 0.001) and Gleason score >7 (hazard ratio 3.11, 95 % CI 1.11 - 8.66, P = 0.030) predicted PCa-specific survival. An internally validated nomogram predicted 15-year PCa-specific survival probability with an accuracy of 80 %. Positive [ 11 C]choline PET/CT after biochemical failure predicts PCa-specific survival in hormone

Survival chance in papillary thyroid cancer in Hungary: individual survival probability estimation using the Markov method

International Nuclear Information System (INIS)

Esik, Olga; Tusnady, Gabor; Daubner, Kornel; Nemeth, Gyoergy; Fuezy, Marton; Szentirmay, Zoltan

1997-01-01

Purpose: The typically benign, but occasionally rapidly fatal clinical course of papillary thyroid cancer has raised the need for individual survival probability estimation, to tailor the treatment strategy exclusively to a given patient. Materials and methods: A retrospective study was performed on 400 papillary thyroid cancer patients with a median follow-up time of 7.1 years to establish a clinical database for uni- and multivariate analysis of the prognostic factors related to survival (Kaplan-Meier product limit method and Cox regression). For a more precise prognosis estimation, the effect of the most important clinical events were then investigated on the basis of a Markov renewal model. The basic concept of this approach is that each patient has an individual disease course which (besides the initial clinical categories) is affected by special events, e.g. internal covariates (local/regional/distant relapses). On the supposition that these events and the cause-specific death are influenced by the same biological processes, the parameters of transient survival probability characterizing the speed of the course of the disease for each clinical event and their sequence were determined. The individual survival curves for each patient were calculated by using these parameters and the independent significant clinical variables selected from multivariate studies, summation of which resulted in a mean cause-specific survival function valid for the entire group. On the basis of this Markov model, prediction of the cause-specific survival probability is possible for extrastudy cases, if it is supposed that the clinical events occur within new patients in the same manner and with the similar probability as within the study population. Results: The patient's age, a distant metastasis at presentation, the extent of the surgical intervention, the primary tumor size and extent (pT), the external irradiation dosage and the degree of TSH suppression proved to be

The clinicopathological and survival differences between never and ever smokers with non-small cell lung cancer.

Science.gov (United States)

Muallaoglu, Sadik; Karadeniz, Cemile; Mertsoylu, Huseyin; Ayberk Besen, Ali; Sezer, Ahmet; Murat Sedef, Ali; Kose, Fatih; Ozyilkan, Ozgur

2014-01-01

Cigarette smoking was regarded as the most important carcinogenic factor of lung cancer, yet in recent years lung cancer in never-smokers is an increasingly prominent public health issue. The aim of this study was to assess the epidemiological and clinicopathological characteristics of never-smoker patients with non small cell lung cancer (NSCLC), focusing on clinical risk factors and survival. We retrospectively analyzed 290 NSCLC patients who presented between 2006 and 2011. Differences in clinical features and survival between never- and ever- smoker patients were analyzed. Student's t-test and Mann-Whitney U-test were used to assess the significance of the variables between the groups. Survival curves were calculated using Kaplan-Meier method. Hazard ratio (HR) for death and its 95% confidence interval (CI) were calculated by Cox regression analysis. There were 243 (83.8%) ever-smokers and 47 (16.2%) never-smokers. In never-smokers females predominated (80.9%) as well as patients with adenocarcinomas (78.7%). At the time of analysis 143 (49.3%) patients had died. The 5-year overall survival (OS) rates were not significantly different between never- and ever-smokers (p=0.410) . The median OS of all patients was 26 months (95% CI: 16.8-35.2). The median OS was 23 months (95% CI: 11.8- 34.2) for never-smokers and 30 months ∥95% CI: 19.7-40.3) for ever-smokers (p=0.410). Never-smokers tended to present with more advanced disease than ever-smokers (pnever- smokers and ever-smokers patients with NSCLC. Future efforts should focus on the underlying biological differences, and on identifying potential non-tobacco related risk factors in order to improve treatment strategies for these two groups of NSCLC patients.