About an adaptively weighted Kaplan-Meier estimate.
Plante, Jean-François
2009-09-01
The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.
Gerds, Thomas A.
2016-01-01
Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.
The Kaplan-Meier Integral in the Presence of Covariates
DEFF Research Database (Denmark)
Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis
2017-01-01
In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...
van Walraven, Carl; McAlister, Finlay A
2016-01-01
Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.
Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A
2015-11-01
Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and
Understanding survival analysis: Kaplan-Meier estimate.
Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal
2010-10-01
Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.
Modified Weighted Kaplan-Meier Estimator
Directory of Open Access Journals (Sweden)
Mohammad Shafiq
2007-01-01
Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.
The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method
Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia
2011-01-01
Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A
2018-01-01
Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Gerds, Thomas Alexander
2016-01-01
Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...
J. Szymszal; A. Gierek; J. Kliś
2010-01-01
The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...
International Nuclear Information System (INIS)
Mould, Richard F.
1995-01-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method
Energy Technology Data Exchange (ETDEWEB)
Mould, Richard F
1995-07-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Directory of Open Access Journals (Sweden)
Arnd Gross
Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912
International Nuclear Information System (INIS)
Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.
1996-01-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs
Energy Technology Data Exchange (ETDEWEB)
Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)
1996-12-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.
Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J
2012-02-01
The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Directory of Open Access Journals (Sweden)
Guyot Patricia
2012-02-01
Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Censoring: a new approach for detection limits in total-reflection X-ray fluorescence
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.
2004-01-01
It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for
Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J
2015-12-10
With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.
Large mass limit of the continuum theories in Kaplan's formulation
International Nuclear Information System (INIS)
Kawano, T.; Kikukawa, Y.
1994-01-01
Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense
Censoring approach to the detection limits in X-ray fluorescence analysis
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.
2004-01-01
We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples
Applying Kaplan-Meier to Item Response Data
McNeish, Daniel
2018-01-01
Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…
Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...
Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin
Fjærvold, Lars
2012-01-01
The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...
Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test
International Nuclear Information System (INIS)
Aoki, S.; Levien, R.B.
1995-01-01
We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories
Genetics Home Reference: Meier-Gorlin syndrome
... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...
MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY
Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar
2016-01-01
Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...
Directory of Open Access Journals (Sweden)
Javier Llorca
2004-10-01
Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
[Survival analysis with competing risks: estimating failure probability].
Llorca, Javier; Delgado-Rodríguez, Miguel
2004-01-01
To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Meier-Gorlin syndrome Clinical genetics and genomics
S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia
Meier-Gorlin syndrome Clinical genetics and genomics
De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Kaplan SpellRead. What Works Clearinghouse Intervention Report
What Works Clearinghouse, 2007
2007-01-01
"Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…
Energy Technology Data Exchange (ETDEWEB)
Sevcik, Petr
2009-07-01
The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.
Unsteady load on an oscillating Kaplan turbine runner
Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.
2013-02-01
A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.
DEFF Research Database (Denmark)
Agerbo, Esben
2007-01-01
longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....
Rossman, Allan; Kaplan, Danny
2017-01-01
Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Directory of Open Access Journals (Sweden)
Jie Zhao
2015-01-01
Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.
Meier-Gorlin syndrome Clinical genetics and genomics
Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...
Tinkle, Christopher L; Fernandez-Pineda, Israel; Sykes, April; Lu, Zhaohua; Hua, Chia-Ho; Neel, Michael D; Bahrami, Armita; Shulkin, Barry L; Kaste, Sue C; Pappo, Alberto; Spunt, Sheri L; Krasin, Matthew J
2017-11-15
Indications for and delivery of adjuvant therapies for pediatric nonrhabdomyosarcoma soft tissue sarcoma (NRSTS) have been derived largely from adult studies; therefore, significant concern remains regarding radiation exposure to normal tissue. The authors report long-term treatment outcomes and toxicities for pediatric and young adult patients with high-grade NRSTS who were treated on a prospective trial using limited-margin radiotherapy. Sixty-two patients (ages 3-22 years) with predominantly high-grade NRSTS requiring radiation were treated on a phase 2 institutional study of conformal external-beam radiotherapy and/or brachytherapy using a 1.5-cm to 2-cm anatomically constrained margin. The estimated cumulative incidence of local failure, Gray's method estimated cumulative incidence of local failure, Kaplan-Meier method estimated survival, competing-risk regression model determined predictors of disease outcome, and toxicity was reported according to CTCAE v2.0. At a median follow-up of 5.1 years (range, 0.2-10.9 years), 9 patients had experienced local failure. The 5-year overall cumulative incidence of local failure was 14.8% (95% confidence interval [CI], 7.2%-25%), and all but 1 local failure occurred outside the highest-dose irradiation volume. The 5-year Kaplan-Meier estimates for event-free and overall survival were 49.3% (95% CI, 36.3%-61.1%) and 67.9% (95% CI, 54.2%-78.3%), respectively. Multivariable analysis indicated that younger age was the only independent predictor of local recurrence (P = .004). The 5-year cumulative incidence of grade 3 or 4 late toxicity was 15% (95% CI, 7.2%-25.3%). The delivery of limited-margin radiotherapy using conformal external-beam radiotherapy or brachytherapy provides a high rate of local tumor control without an increase in marginal failures and with acceptable treatment-related morbidity. Cancer 2017;123:4419-29. © 2017 American Cancer Society. © 2017 American Cancer Society.
Directory of Open Access Journals (Sweden)
Béranger Lueza
2016-03-01
Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect
Water hammer 2 phase analysis hydraulic system with a Kaplan turbine
Dudlik, A.; Koutnik, J.
2009-01-01
This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...
Computer Aided Design of Kaplan Turbine Piston with SolidWorks
Camelia Jianu
2010-01-01
The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
DEFF Research Database (Denmark)
Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R
2010-01-01
OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...
Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat
2013-01-01
There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu
2015-01-01
Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...
2017-08-01
28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival
2017-10-01
of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to
Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
Analysis of the Kaplan turbine draft tube effect
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Obrovsky, J
2010-01-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Energy Technology Data Exchange (ETDEWEB)
Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)
2010-08-15
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Motycak, L.; Skotak, A.; Obrovsky, J.
2010-08-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids
Gustafsson, Martin
2013-01-01
To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...
Kaplan og Norton bør læses af hele ledelsen
DEFF Research Database (Denmark)
Bukh, Per Nikolaj
2009-01-01
Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...
DEFF Research Database (Denmark)
Søgaard, Mette; Nørgaard, Mette; Sørensen, Henrik Toft
2009-01-01
for age, gender, coexisting chronic diseases, marital status, use of immunosuppressives, and calendar period. Further, we conducted analyses restricted to patients a discharge diagnose of infectious diseases (ICD-10 codes A00-B99). Results: In total, 1,665 (8.2%) patients had positive blood culture...... System. We computed Kaplan-Meier curves and product limit estimates for the main study variables. Next, time-dependent Cox regression analyses was used to compare the risk of death in patients with positive blood cultures and patients with negative cultures at days 0-7, 8-30, and 31-180, controlling...
Case Report: Meier-Gorlin syndrome: Report of an additional patient ...
African Journals Online (AJOL)
We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.
Directory of Open Access Journals (Sweden)
Bender Ralf
2011-09-01
Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.
Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel
2009-01-01
To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System
Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola
2011-01-01
Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…
Multi-objective shape optimization of runner blade for Kaplan turbine
International Nuclear Information System (INIS)
Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V
2014-01-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads
Multi-objective shape optimization of runner blade for Kaplan turbine
Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.
2014-03-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
International Nuclear Information System (INIS)
Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H
2012-01-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.
2012-11-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Kaplan turbine tip vortex cavitation - analysis and prevention
Motycak, L.; Skotak, A.; Kupcik, R.
2012-11-01
The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-09-17
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.
Prita Meier, Swahili Port Cities: The Architecture of Elsewhere
Longair, Sarah
2018-01-01
Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...
Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post
Nikiforov, Raivo
2005-01-01
Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest
Locke, S; Osborne, M; O'Rourke, P
2011-02-01
The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.
Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P
2018-01-01
The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.
Verification of Kaplan turbine cam curves realization accuracy at power plant
Directory of Open Access Journals (Sweden)
Džepčeski Dane
2016-01-01
Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.
Ackerman, Ari
2008-01-01
This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…
Kaplan turbine tip vortex cavitation – analysis and prevention
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Kupcik, R
2012-01-01
The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Numerical investigation of hub clearance flow in a Kaplan turbine
Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.
2012-11-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Numerical investigation of hub clearance flow in a Kaplan turbine
International Nuclear Information System (INIS)
Wu, H; Feng, J J; Wu, G K; Luo, X Q
2012-01-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Deciphering the Adaptive Immune Response to Ovarian Cancer
2013-10-01
positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor
De 'wraak van de geografie' volgens Robert D. Kaplan
Mamadouh, V.
2013-01-01
De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor
Directory of Open Access Journals (Sweden)
Pablo Martínez-Camblor
2009-12-01
Full Text Available Objetivo: Analizar el tiempo de supervivencia libre de enfermedad y la supervivencia relativa en mujeres diagnosticadas de cáncer de mama en la provincia de Gipuzkoa en un contexto de riesgos competitivos, valorando las diferencias encontradas entre el uso directo del estimador de Kaplan-Meier y el método de decrementos múltiples por un lado y la supervivencia relativa por otro. Métodos: Se consideraron todos los casos de cáncer de mama registrados en la provincia de Gipuzkoa durante los años 1995 y 1996 en estadio distinto del IV, y se hizo un seguimiento de 8 años para la recidiva y de 10 años para la supervivencia. Se analizó el tiempo de supervivencia libre de enfermedad mediante el método de decrementos múltiples. Asimismo, también se analizó el tiempo de supervivencia observado y corregido por la mortalidad esperada de la población, conocido como supervivencia relativa. Resultados: La estimación de la probabilidad de recidiva a los 8 años por el método de decrementos múltiples es un 8,8% inferior a la obtenida por el método de Kaplan-Meier. La diferencia entre la supervivencia observada y la relativa a los 10 años es del 10,8%. Ambos resultados indican que, en este caso, el método de Kaplan-Meier sobrestima tanto la probabilidad de recaída como la de muerte por la enfermedad. Conclusiones: Dos cuestiones que muchas veces se obvian al realizar un análisis de supervivencia son, por un lado, que la no independencia entre el tiempo de supervivencia y el tiempo de censura hacen no interpretables los resultados obtenidos por el estimador de Kaplan-Meier, y por otro el hecho, hasta hora incuestionable, de que de una manera u otra todos causamos fallo y, desde este planteamiento, en el estudio del tiempo de supervivencia hay que tener presente la probabilidad de fallo en la población general de referencia. En los resultados obtenidos se observa que utilizar de manera superficial el estimador de Kaplan-Meier comporta una
DEFF Research Database (Denmark)
Mickley, H; Nielsen, J R; Berning, J
1995-01-01
infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...
Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines
Directory of Open Access Journals (Sweden)
Ana-Maria Budai
2010-10-01
Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
International Nuclear Information System (INIS)
Weili, L; Jinling, L; Xingqi, L; Yuan, L
2010-01-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Energy Technology Data Exchange (ETDEWEB)
Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)
2010-08-15
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.
2010-08-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Coupled skinny baker's maps and the Kaplan-Yorke conjecture
Gröger, Maik; Hunt, Brian R.
2013-09-01
The Kaplan-Yorke conjecture states that for ‘typical’ dynamical systems with a physical measure, the information dimension and the Lyapunov dimension coincide. We explore this conjecture in a neighborhood of a system for which the two dimensions do not coincide because the system consists of two uncoupled subsystems. We are interested in whether coupling ‘typically’ restores the equality of the dimensions. The particular subsystems we consider are skinny baker's maps, and we consider uni-directional coupling. For coupling in one of the possible directions, we prove that the dimensions coincide for a prevalent set of coupling functions, but for coupling in the other direction we show that the dimensions remain unequal for all coupling functions. We conjecture that the dimensions prevalently coincide for bi-directional coupling. On the other hand, we conjecture that the phenomenon we observe for a particular class of systems with uni-directional coupling, where the information and Lyapunov dimensions differ robustly, occurs more generally for many classes of uni-directionally coupled systems (also called skew-product systems) in higher dimensions.
The development of a new algorithm to calculate a survival function in non-parametric ways
International Nuclear Information System (INIS)
Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo
2001-01-01
In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory
Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2
DEFF Research Database (Denmark)
Sarkisian, Laura; Saaby, L.; Poulsen, T. S.
2015-01-01
-year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...
International Nuclear Information System (INIS)
Ko, P; Kurosawa, S
2014-01-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine
Ko, P.; Kurosawa, S.
2014-03-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.
Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.
Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F
2018-05-01
The individual kinematic roles of the anterolateral ligament (ALL) and the distal iliotibial band Kaplan fibers in the setting of anterior cruciate ligament (ACL) deficiency require further clarification. This will improve understanding of their potential contribution to residual anterolateral rotational laxity after ACL reconstruction and may influence selection of an anterolateral extra-articular reconstruction technique, which is currently a matter of debate. Hypothesis/Purpose: To compare the role of the ALL and the Kaplan fibers in stabilizing the knee against tibial internal rotation, anterior tibial translation, and the pivot shift in ACL-deficient knees. We hypothesized that the Kaplan fibers would provide greater tibial internal rotation restraint than the ALL in ACL-deficient knees and that both structures would provide restraint against internal rotation during a simulated pivot-shift test. Controlled laboratory study. Ten paired fresh-frozen cadaveric knees (n = 20) were used to investigate the effect of sectioning the ALL and the Kaplan fibers in ACL-deficient knees with a 6 degrees of freedom robotic testing system. After ACL sectioning, sectioning was randomly performed for the ALL and the Kaplan fibers. An established robotic testing protocol was utilized to assess knee kinematics when the specimens were subjected to a 5-N·m internal rotation torque (0°-90° at 15° increments), a simulated pivot shift with 10-N·m valgus and 5-N·m internal rotation torque (15° and 30°), and an 88-N anterior tibial load (30° and 90°). Sectioning of the ACL led to significantly increased tibial internal rotation (from 0° to 90°) and anterior tibial translation (30° and 90°) as compared with the intact state. Significantly increased internal rotation occurred with further sectioning of the ALL (15°-90°) and Kaplan fibers (15°, 60°-90°). At higher flexion angles (60°-90°), sectioning the Kaplan fibers led to significantly greater internal rotation
Can a polynomial interpolation improve on the Kaplan-Yorke dimension?
International Nuclear Information System (INIS)
Richter, Hendrik
2008-01-01
The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems
Adding gauge fields to Kaplan's fermions
International Nuclear Information System (INIS)
Blum, T.; Kaerkkaeinen, L.
1994-01-01
We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)
International Nuclear Information System (INIS)
Bergant, A; Gregorc, B; Gale, J
2012-01-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Bergant, A.; Gregorc, B.; Gale, J.
2012-11-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas
2017-11-15
This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.
2012-01-01
MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex
de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.
2012-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This
Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A
2018-06-01
Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
XRF and XANES Data for Kaplan U Paper
The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).
Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine
Directory of Open Access Journals (Sweden)
Doina Frunzaverde
2011-01-01
Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.
International Nuclear Information System (INIS)
Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan
2009-01-01
This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)
DEFF Research Database (Denmark)
Sidenius, N; Sier, C.F.M.; Ullum, H
2000-01-01
levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...
Perturbative analysis for Kaplan's lattice chiral fermions
International Nuclear Information System (INIS)
Aoki, S.; Hirose, H.
1994-01-01
Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
Schmidt, H.; Kirschner, O.; Riedelbauch, S.; Necker, J.; Kopf, E.; Rieg, M.; Arantes, G.; Wessiak, M.; Mayrhuber, J.
2014-03-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation.
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
International Nuclear Information System (INIS)
Schmidt, H; Kirschner, O; Riedelbauch, S; Necker, J; Kopf, E; Rieg, M; Arantes, G; Wessiak, M; Mayrhuber, J
2014-01-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation
Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim
2012-01-01
Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Directory of Open Access Journals (Sweden)
Yibeltal Assefa
Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Measuring survival time: a probability-based approach useful in healthcare decision-making.
2011-01-01
In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.
Comparison of extended colectomy and limited resection in patients with Lynch syndrome.
Natarajan, Nagendra; Watson, Patrice; Silva-Lopez, Edibaldo; Lynch, Henry T
2010-01-01
The purpose of the study was to determine the advantages and disadvantages of prophylactic/extended colectomy (subtotal colectomy) in patients with Lynch syndrome who manifest colorectal cancer. A retrospective cohort using Creighton University's hereditary cancer database was used to identify cases and controls. Cases are patients who underwent subtotal colectomy, either with no colorectal cancer diagnosis (prophylactic) or at diagnosis of first colorectal cancer; controls for these 2 types of cases were, respectively, patients who underwent no colon surgery or those having limited resection at time of diagnosis of first colorectal cancer. The Kaplan-Meier and proportional hazard regression models from the Statistical Analysis Software program was used to calculate the difference in survival, time to subsequent colorectal cancer, and subsequent abdominal surgery between cases and controls. The event-free survival of our study did not reach 50%, so we used the event-free survival at 5 years as our parameter to compare the 2 groups. The event-free survival for subsequent colorectal cancer, subsequent abdominal surgery, and death was 94%, 84%, and 93%, respectively, for cases and 74%, 63%, and 88%, respectively, for controls. Times to subsequent colorectal cancer and subsequent abdominal surgery were significantly shorter in the control group (P Lynch syndrome.
A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines
Pennacchi, P.; Borghesani, P.; Chatterton, S.
2015-08-01
Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.
DEFF Research Database (Denmark)
Cannon, Christopher P; Husted, Steen; Harrington, Robert A
2007-01-01
, or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...
Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease
Directory of Open Access Journals (Sweden)
Rabah M. Shawky
2014-10-01
Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.
Air injection test on a Kaplan turbine: prototype - model comparison
Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.
2016-11-01
Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.
Energy Technology Data Exchange (ETDEWEB)
Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)
2008-07-01
In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)
Is early limited surgery associated with a more benign disease course in Crohn’s disease?
Golovics, Petra Anna; Lakatos, Laszlo; Nagy, Attila; Pandur, Tunde; Szita, Istvan; Balogh, Mihaly; Molnar, Csaba; Komaromi, Erzsebet; Lovasz, Barbara Dorottya; Mandel, Michael; Veres, Gabor; Kiss, Lajos S; Vegh, Zsuzsanna; Lakatos, Peter Laszlo
2013-01-01
AIM: To analyze the difference in disease course and need for surgery in patients with Crohn’s disease (CD). METHODS: Data of 506 patients with incident CD were analyzed (age at diagnosis: 31.5 ± 13.8 years). Both hospital and outpatient records were collected prospectively with a complete clinical follow-up and comprehensively reviewed in the population-based Veszprem province database, which includes incident CD patients diagnosed between January 1, 1977 and December 31, 2008. Follow-up data were collected until December 31, 2009. All patients included had at least 1 year of follow-up available. Patients with indeterminate colitis at diagnosis were excluded from the analysis. RESULTS: Overall, 73 patients (14.4%) required resective surgery within 1 year of diagnosis. Steroid exposure and need for biological therapy were lower in patients with early limited surgery (P < 0.001 and P = 0.09). In addition, surgery rates during follow-up in patients with and without early surgery differed significantly after matching on propensity scores (P < 0.001, HR = 0.23). The need for reoperation was also lower in patients with early limited resective surgery (P = 0.038, HR = 0.42) in a Kaplan-Meier and multivariate Cox regression (P = 0.04) analysis. However, this advantage was not observed after matching on propensity scores (PLogrank = 0.656, PBreslow = 0.498). CONCLUSION: Long-term surgery rates and overall exposure to steroids and biological agents were lower in patients with early limited resective surgery, but reoperation rates did not differ. PMID:24282358
TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier
Tursk, Eda
2004-01-01
Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan
Age at hysterectomy as a predictor for subsequent pelvic organ prolapse repair
DEFF Research Database (Denmark)
Lykke, Rune; Blaakær, Jan; Ottesen, Bent
2016-01-01
from 1977 to 2009 from the Danish National Patient Registry. The cohort consisted of 154,882 hysterectomized women, who were followed up for up to 32 years. Survival analysis for each age group at hysterectomy was performed using Kaplan-Meier product limit methods. RESULTS: For all hysterectomized......INTRODUCTION AND HYPOTHESIS: The aim of this study was to investigate the association between patient age at the time of hysterectomy and subsequent pelvic organ prolapse (POP) surgery. METHODS: We gathered data on all benign hysterectomies and POP surgeries performed in Denmark on Danish women...... women, we found that low age at hysterectomy yielded a lower risk of subsequent POP surgery than did hysterectomy at an older age. This difference diminished after stratification by indication; all non-POP hysterectomies had a low cumulative incidence at 8-11 % at the end of the follow-up period...
The prognostic implications of growth-related gene product β in laryngeal squamous cell carcinoma.
Tang, Mingming; Xu, Xinjiang; Chen, Juanjuan; Huang, Jiangfei; Jiang, Bin; Han, Liang
2017-09-01
Growth-related gene product β (GROβ) is an angiogenic chemokine that belongs to the CXC chemokine family, and a number of studies have suggested that GROβ is associated with tumor development and progression. However, a number of studies have investigated the association between GROβ expression and the clinical attributes of laryngeal squamous cell carcinoma (LSCC). In the present study, one-step quantitative polymerase chain reaction and immunohistochemistry analysis were used to detect GROβ expression and evaluate the association between its expression and the clinicopathological characteristics of LSCC. The results demonstrated that the GROβ mRNA and protein expression levels were significantly increased in LSCC compared with the corresponding non-cancerous tissues. GROβ protein expression in LSCC was associated with tumor-node-metastasis stage, lymph node metastasis and histopathological grade. The Kaplan-Meier method and Cox multi-factor analysis indicated that high GROβ expression, lymph node metastasis and histopathological grade were significantly associated with poor survival of patients with LSCC. These data indicated that GROβ may be a novel prognostic biomarker of LSCC.
Castro-Otero, C.
2017-04-01
Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.
Relationship of employee-reported work limitations to work productivity.
Lerner, Debra; Amick, Benjamin C; Lee, Jennifer C; Rooney, Ted; Rogers, William H; Chang, Hong; Berndt, Ernst R
2003-05-01
Work limitation rates are crucial indicators of the health status of working people. If related to work productivity, work limitation rates may also supply important information about the economic burden of illness. Our objective was to assess the productivity impact of on-the-job work limitations due to employees' physical or mental health problems. Subjects were asked to complete a self-administered survey on the job during 3 consecutive months. Using robust regression analysis, we tested the relationship of objectively-measured work productivity to employee-reported work limitations. We attempted to survey employees of a large firm within 3 different jobs. The survey response rate was 2245 (85.9%). Full survey and productivity data were available for 1827 respondents. Each survey included a validated self-report instrument, the Work Limitations Questionnaire (WLQ). The firm provided objective, employee-level work productivity data. In adjusted regression analyses (n = 1827), employee work productivity (measured as the log of units produced/hour) was significantly associated with 3 dimensions of work limitations: limitations handling the job's time and scheduling demands (P = 0.003), physical job demands (P = 0.001), and output demands (P = 0.006). For every 10% increase in on-the-job work limitations reported on each of the 3 WLQ scales, work productivity declined approximately 4 to 5%. Employee work limitations have a negative impact on work productivity. Employee assessments of their work limitations supply important proxies for the economic burden of health problems.
Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky
2017-01-01
The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n = 304) and 11-25 ( n = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.
DEFF Research Database (Denmark)
Lange, Jeppe; Troelsen, Anders; Solgaard, Søren
2018-01-01
was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...
High serum uric acid concentration predicts poor survival in patients with breast cancer.
Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min
2017-10-01
Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
International Nuclear Information System (INIS)
Lakatos, K; Szamosi, Z; Bereczkei, S
2012-01-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
Lakatos, K.; Szamosi, Z.; Bereczkei, S.
2012-11-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Numerical investigation of tip clearance cavitation in Kaplan runners
Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.
2016-11-01
There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.
Perceived factors limiting rice production in Pategi Local ...
African Journals Online (AJOL)
user
perceived limiting factors in rice production include lack of rice processing ... This production increase has not been enough to meet the consumption demand of ... of Kwara State, Nigeria seeks to determine some of the factors limiting rice ...
Nested Cohort - R software package
NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.
Schein, Jeffrey; Caplan, Eric
2014-01-01
The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…
Age is not a limiting factor for radical radiotherapy in pelvic malignancies
International Nuclear Information System (INIS)
Pignon, T.; Horiot, J.C.; Bolla, M.; Poppel, H. van; Bartelink, H.; Roelofsen, F.; Pene, F.; Gerard, A.; Einhorn, N.; Nguyen, T.D.; Vanglabbeke, M.; Scalliet, P.
1997-01-01
Background and purpose: Pelvic radiotherapy (RT) toxicity in the elderly is poorly documented. We developed a study aiming to evaluate whether or not a limit of age could be identified beyond which toxicities in patients receiving pelvic RT were more frequent or more severe. Material and methods: 1619 patients with pelvic cancers enrolled in nine EORTC trials, RT arms, were retrospectively studied. Patients were split into six age ranges from 50 years to 70 years and over. Survivals and late toxicity occurrence were calculated with the Kaplan-Meier method and comparison between age groups with the logrank test. A trend test was done to examine if chronological age had an impact on acute toxicity occurrence. Results: Survival was comparable in each age group for prostate (P=0.18), uterus (0.41), anal canal cancer (P=0.6) and slightly better for the younger group of rectum cancer (P=0.04). A total of 1722 acute and 514 late grade ≥1 were recorded. Acute nausea/vomiting, skin complications and performance status deterioration were significantly more frequent in younger patients. There was no trend toward more aged patients to experience diarrhea (P=0.149) and after adjustment on RT dose, acute urinary complications were observed equally in each age range (P=0.32). Eighty percent of patients were free of late complication at 5 years in each age range (P=0.79). For the grade >2 late side-effects, a plateau was observed after 1 year at near 9% without any difference (P=0.06) nor trend (P=0.13) between age-groups. Conclusion: Age per se is not a limiting factor for radical radiotherapy in pelvic malignancies
ORIGINAL ARTICLES Antiretroviral treatment for children
African Journals Online (AJOL)
Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.
Ultra-processed foods and the limits of product reformulation.
Scrinis, Gyorgy; Monteiro, Carlos Augusto
2018-01-01
The nutritional reformulation of processed food and beverage products has been promoted as an important means of addressing the nutritional imbalances in contemporary dietary patterns. The focus of most reformulation policies is the reduction in quantities of nutrients-to-limit - Na, free sugars, SFA, trans-fatty acids and total energy. The present commentary examines the limitations of what we refer to as 'nutrients-to-limit reformulation' policies and practices, particularly when applied to ultra-processed foods and drink products. Beyond these nutrients-to-limit, there are a range of other potentially harmful processed and industrially produced ingredients used in the production of ultra-processed products that are not usually removed during reformulation. The sources of nutrients-to-limit in these products may be replaced with other highly processed ingredients and additives, rather than with whole or minimally processed foods. Reformulation policies may also legitimise current levels of consumption of ultra-processed products in high-income countries and increased levels of consumption in emerging markets in the global South.
Directory of Open Access Journals (Sweden)
Min-jie Mao
2017-01-01
Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.
Competing approaches to analysis of failure times with competing risks.
Farley, T M; Ali, M M; Slaymaker, E
2001-12-15
For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.
AKaplan-Meier estimators of distance distributions for spatial point processes
Baddeley, A.J.; Gill, R.D.
1997-01-01
When a spatial point process is observed through a bounded window, edge effects hamper the estimation of characteristics such as the empty space function $F$, the nearest neighbour distance distribution $G$, and the reduced second order moment function $K$. Here we propose and study product-limit
Application of the standard lymphadenectomy in gastric adenocarcinoma
International Nuclear Information System (INIS)
Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro
2011-01-01
The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
International Nuclear Information System (INIS)
Amiri, K; Cervantes, M J; Mulu, B; Raisee, M
2014-01-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
Amiri, K.; Mulu, B.; Raisee, M.; Cervantes, M. J.
2014-03-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR.
Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study
DEFF Research Database (Denmark)
Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars
2015-01-01
patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...
DEFF Research Database (Denmark)
Wells, J Connor; Stukalin, Igor; Norton, Craig
2017-01-01
and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...
Impurity production and transport at limiters
International Nuclear Information System (INIS)
Matthews, G.F.
1989-01-01
This paper concentrates on the description and evaluation of experiments on the DITE tokamak. These are designed to characterise the processes involved in the production and transport of neutral and ionised impurities near carbon limiters. The need for good diagnostics in the scrape-off layer is highlighted. Langmuir probes are used to provide input data for models of impurity production at limiters. Observations of the radial profiles of carbon and oxygen impurities are compared with the code predictions. Changeover experiments involving hydrogen and helium plasmas are used as a means for investigating the role of the atomic physics and chemistry. The impurity control limiter (ICL) experiment is described which shows how geometry plays an important role in determining the spatial distributions of the neutral and ionised carbon. New diagnostics are required to study the flux and charge state distribution of impurities in the boundary. Preliminary results from an in-situ plasma ion mass-spectrometer are presented. The role of oxygen and the importance of evaluating the wall sources of impurity are emphasised. (orig.)
Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.
2000-01-01
Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de
Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam
2011-03-28
The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Bowden, T J; Bricknell, I R; Preziosi, B M
2018-01-01
Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.
Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines
Energy Technology Data Exchange (ETDEWEB)
Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)
2015-10-01
Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...
Modelling the survivorship of Nigeria children in their first 10 years of ...
African Journals Online (AJOL)
Fagbamigbe
Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...
Energy Technology Data Exchange (ETDEWEB)
Ukonsaari; Jan
2012-08-15
This study concerns environmentally adapted Kaplan runners, which have no oil for lubricating the blade regulation mechanisms and bearings. The runners are water or air filled with self lubricated bearings. Recent design also includes regulation system pressure increase and servo motor placement below runner centre and environmentally adapted synthetic ester as hydraulic fluid. These together with power output increase and efficiency optimization are suspected sources of poor runner function. Of 37 runners 43 % have had some kind of problem and 30 % bearing or mechanism related ones. When the axial blade bearing problems are excluded the problems occurred at 16 %. Deeper look into the design of newer runners shows that only bronze based runner hubs is significantly more problem dense regarding regulation mechanisms (50 %). Hidden figures of increased runner regulation forces are suspected. All problems cannot be explained and the young machines limit the experiences. The working group's opinion and bring ups of historical and present examples during the work show evidence that the old oil filled runners function is far from perfect, nor the life length. The future is not with oil filled runner hubs. Main parts of the discovered problems have been solved and can be resolved by thorough design analysis. One future concern is what effects the recent design changes will cause due to increase demand for power output changes including the number of starts and stops. That is why the working group's recommendation is to put joint effort into material fatigue and in which a first step is to identify the real forces the runners are exposed to.
DEFF Research Database (Denmark)
Kilic, Onur Alper; Akkerman, Renzo; Grunow, Martin
2009-01-01
In the food industry products are usually characterized by their recipes, which are specified by various quality attributes. For end products, this is given by customer requirements, but for intermediate products, the recipes can be chosen in such a way that raw material procurement costs and pro...... with production and inventory planning, thereby considering the production and storage capacity limitations. The resulting model can be used to solve an important practical problem typical for many food processing industries.......In the food industry products are usually characterized by their recipes, which are specified by various quality attributes. For end products, this is given by customer requirements, but for intermediate products, the recipes can be chosen in such a way that raw material procurement costs...... and processing costs are minimized. However, this product selection process is bound by production and storage capacity limitations, such as the number and size of storage tanks or silos. In this paper, we present a mathematical programming approach that combines decision making on product selection...
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Javadi, Ardalan; Nilsson, Håkan
2014-01-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
Javadi, Ardalan; Nilsson, Håkan
2014-03-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.
Togashi, K; Koike, T; Emura, I; Usuda, H
2008-07-01
Non-invasive lung cancers showed a good prognosis after limited surgery. But it is still uncertain about invasive lung cancers. We investigated the indications for limited surgery for small lung cancer tumors measuring 1 cm or less in diameter on preoperative computed tomography (CT). This study retrospectively analyzed of 1,245 patients who underwent complete resection of lung cancer between 1989 and 2004 in our hospital. Sixty-two patients (5%) had tumors measuring 1 cm or less in diameter. The probability of survival was calculated using the Kaplan-Meier method. All diseases were detected by medical checkup, 52 % of the patients were not definitively diagnosed with lung cancer before surgery. Adenocarcinoma was histologically diagnosed in 49 patients (79%). Other histologic types included squamous cell carcinoma (8), large cell carcinoma (1), small cell carcinoma (1), carcinoid (2), and adenosquamous cell carcinoma (1). Fifty-seven patients (92%) showed pathologic stage IA. The other stages were IB (2), IIA (1), and IIIB (2). There were 14 bronchioloalveolar carcinomas (25% of IA diseases). The 5-year survival rates of IA patients were 90%. The 5-year survival rate of patients with tumors measuring 1cm or less diameter was 91% after lobectomy or pneumonectomy, and 90% after wedge resection or segmentectomy. There were 3 deaths from cancer recurrence, while there were no deaths in 14 patients with bronchioloalveolar carcinoma After limited surgery, non-invasive cancer showed good long-term results, while invasive cancer showed a recurrence rate of 2.3% to 79% even though the tumor measured 1 cm or less in diameter on preoperative CT.
Survival analysis II: Cox regression
Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.
2011-01-01
In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the
STAT3 inhibitor enhances chemotherapy drug efficacy by ...
African Journals Online (AJOL)
Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.
The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis
DEFF Research Database (Denmark)
Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik
2016-01-01
OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...
Is there racial/ethnic variance in cervical cancer- specific survival of ...
African Journals Online (AJOL)
incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...
Survival Analysis of Patients with End Stage Renal Disease
Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.
2015-06-01
This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.
Possibilities and limitations for sustainable bioenergy production systems
International Nuclear Information System (INIS)
Smeets, Edward Martinus Wilhelmus Utrecht University
2008-05-01
The main objective of this thesis is to investigate the possibilities and limitations of sustainable bioenergy production. To this end, the following research questions have been formulated: (1). What is the potential of different world regions to produce biomass for energy generation in the year 2050, taking account of biological and climatological limitations, the use of biomass to produce food, materials and traditional bioenergy, as well as the need to maintain existing forests and thus protect biodiversity?; (2) What are the main bottlenecks to formulating and implementing sustainability criteria for bioenergy production?; (3) To what extent does complying with sustainability criteria have impacts on the costs and potential of bioenergy production?; (4) To what extent do fertilizer- and manure-induced nitrous oxide (N2O) emissions due to energy crop production have an impact on the reduction of greenhouse gas (GHG) emissions when conventional transportation fuels are replaced by first-generation biofuels?; (5) In terms of economic and environmental performance, how does Europe's production, storage and transport of miscanthus and switchgrass in 2004 compare to that in 2030? Throughout this thesis, specific attention is paid to knowledge gaps and their potential impact on results, the aim being to identify priorities for future research and development. Another key element of our research is that we evaluate the possibilities and limitations of strategies that are designed to improve the performance of bioenergy production systems and that may be incorporated in bioenergy certification schemes and bioenergy promoting policies
Age at sexual initiation and factors associated with it among youths ...
African Journals Online (AJOL)
Bernt Lindtjorn
Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.
Epilepsy in Rett syndrome--lessons from the Rett networked database
DEFF Research Database (Denmark)
Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori
2015-01-01
collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...
Survival of Root-filled Teeth in the Swedish Adult Population
DEFF Research Database (Denmark)
Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik
2016-01-01
INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...
Experimental limits from ATLAS on Standard Model Higgs production.
ATLAS, collaboration
2012-01-01
Experimental limits from ATLAS on Standard Model Higgs production in the mass range 110-600 GeV. The solid curve reflects the observed experimental limits for the production of a Higgs of each possible mass value (horizontal axis). The region for which the solid curve dips below the horizontal line at the value of 1 is excluded with a 95% confidence level (CL). The dashed curve shows the expected limit in the absence of the Higgs boson, based on simulations. The green and yellow bands correspond (respectively) to 68%, and 95% confidence level regions from the expected limits. Higgs masses in the narrow range 123-130 GeV are the only masses not excluded at 95% CL
Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan
Krikun, Andrew
2010-01-01
Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…
Neutrino Charm Production and a Limit to Neutrino Oscillations
Energy Technology Data Exchange (ETDEWEB)
Bailey, David Charles [McGill U.
1983-10-01
The production of charmed particles and a limit to tau lepton production have been measured using a hybrid emulsion spectrometer in the Fermilab wide-band neutrino beam. The relative cross section for charged current charmed particle production is $\\sigma(\
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.
1998-01-01
We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766
Physiology limits commercially viable photoautotrophic production of microalgal biofuels.
Kenny, Philip; Flynn, Kevin J
2017-01-01
Algal biofuels have been offered as an alternative to fossil fuels, based on claims that microalgae can provide a highly productive source of compounds as feedstocks for sustainable transport fuels. Life cycle analyses identify algal productivity as a critical factor affecting commercial and environmental viability. Here, we use mechanistic modelling of the biological processes driving microalgal growth to explore optimal production scenarios in an industrial setting, enabling us to quantify limits to algal biofuels potential. We demonstrate how physiological and operational trade-offs combine to restrict the potential for solar-powered algal-biodiesel production in open ponds to a ceiling of ca. 8000 L ha -1 year -1 . For industrial-scale operations, practical considerations limit production to ca. 6000 L ha -1 year -1 . According to published economic models and life cycle analyses, such production rates cannot support long-term viable commercialisation of solar-powered cultivation of natural microalgae strains exclusively as feedstock for biofuels. The commercial viability of microalgal biofuels depends critically upon limitations in microalgal physiology (primarily in rates of C-fixation); we discuss the scope for addressing this bottleneck concluding that even deployment of genetically modified microalgae with radically enhanced characteristics would leave a very significant logistical if not financial burden.
Energy Technology Data Exchange (ETDEWEB)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik
2002-08-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent
ASURV: Astronomical SURVival Statistics
Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.
2014-06-01
ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.
First line chemotherapy plus trastuzumab in metastatic breast cancer ...
African Journals Online (AJOL)
First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...
Influence of antiviral therapy on survival of patients with hepatitis B ...
African Journals Online (AJOL)
The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...
DEFF Research Database (Denmark)
Kirk, O; Mocroft, A; Pradier, C
2001-01-01
-up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...
Strategic analysis of International Forest Products Limited
Modesto, Robin M.
2005-01-01
International Forest Products Limited is a sawmilling company that produces softwood lumber for sale in domestic and international markets including the United States and Japan. Production facilities located in British Columbia, Washington and Oregon produce nearly 1.5 billion board feet of lumber annually. Timber is secured through Crown forest tenure holdings and external open market purchases. This paper includes: a strategic analysis of the firm; an industry analysis; a strategic fit anal...
Axial U(1) current in Grabowska and Kaplan's formulation
Hamada, Yu; Kawai, Hikaru
2017-06-01
Recently, Grabowska and Kaplan [Phys. Rev. Lett. 116, 211602 (2016); Phys. Rev. D 94, 114504 (2016)] suggested a nonperturbative formulation of a chiral gauge theory, which consists of the conventional domain-wall fermion and a gauge field that evolves by gradient flow from one domain wall to the other. We introduce two sets of domain-wall fermions belonging to complex conjugate representations so that the effective theory is a 4D vector-like gauge theory. Then, as a natural definition of the axial-vector current, we consider a current that generates simultaneous phase transformations for the massless modes in 4 dimensions. However, this current is exactly conserved and does not reproduce the correct anomaly. In order to investigate this point precisely, we consider the mechanism of the conservation. We find that this current includes not only the axial current on the domain wall but also a contribution from the bulk, which is nonlocal in the sense of 4D fields. Therefore, the local current is obtained by subtracting the bulk contribution from it.
Latzman, Robert D.; Markon, Kristian E.
2010-01-01
There has been an increased interest in the structure of and relations among executive functions.The present study examined the factor structure as well as age-related factorial invariance of the Delis-Kaplan Executive Function System (D-KEFS), a widely used inventory aimed at assessing executive functions. Analyses were first conducted using data…
DEFF Research Database (Denmark)
Andersson, U.; Osterman, P.; Sjostrom, S.
2009-01-01
was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...
Birth interval and its predictors among married women in Dabat ...
African Journals Online (AJOL)
2008-12-30
Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
International Nuclear Information System (INIS)
Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F
2012-01-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.
2012-11-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Jacobs, Benjamin M.
2009-01-01
This historical study focuses on how John Dewey's theory of education as socialization and Mordecai Kaplan's theory of Judaism as a civilization together served as an ideological base and pedagogical framework for the creation of "progressive," "reconstructed" American Jewish school programs in the early 20th century…
Lee, L.; Helsel, D.
2007-01-01
Analysis of low concentrations of trace contaminants in environmental media often results in left-censored data that are below some limit of analytical precision. Interpretation of values becomes complicated when there are multiple detection limits in the data-perhaps as a result of changing analytical precision over time. Parametric and semi-parametric methods, such as maximum likelihood estimation and robust regression on order statistics, can be employed to model distributions of multiply censored data and provide estimates of summary statistics. However, these methods are based on assumptions about the underlying distribution of data. Nonparametric methods provide an alternative that does not require such assumptions. A standard nonparametric method for estimating summary statistics of multiply-censored data is the Kaplan-Meier (K-M) method. This method has seen widespread usage in the medical sciences within a general framework termed "survival analysis" where it is employed with right-censored time-to-failure data. However, K-M methods are equally valid for the left-censored data common in the geosciences. Our S-language software provides an analytical framework based on K-M methods that is tailored to the needs of the earth and environmental sciences community. This includes routines for the generation of empirical cumulative distribution functions, prediction or exceedance probabilities, and related confidence limits computation. Additionally, our software contains K-M-based routines for nonparametric hypothesis testing among an unlimited number of grouping variables. A primary characteristic of K-M methods is that they do not perform extrapolation and interpolation. Thus, these routines cannot be used to model statistics beyond the observed data range or when linear interpolation is desired. For such applications, the aforementioned parametric and semi-parametric methods must be used.
Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies
International Nuclear Information System (INIS)
Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.
2007-01-01
Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients
Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A
2017-09-30
For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
International Nuclear Information System (INIS)
Rieger, Johannes; Hautmann, Hubert; Linsenmaier, Ulrich; Weber, Cristoph; Treitl, Markus; Huber, R.M.; Pfeifer, Klaus-Juergen
2004-01-01
Over the last few years various types of metal wire stents have been increasingly employed in the treatment of both malignant and benign tracheobronchial obstruction. To date, however, few studies have investigated the in vivo properties of different stent types. We implanted 26 balloon-expandable tantalum Strecker stents (18 patients) and 18 self-expandable Wallstents (16 patients) into the tracheobronchial system of 30 patients with combined stenting in 4 patients. Mean age was 51 years (range: 0.5-79 years). Malignant disease was present in 23 patients, benign disease in seven patients. Both patients and individual stents were monitored clinically and radiographically. The probability of stents remaining within the tracheobronchial system, and of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for both stent types. Average stent follow-up time was 112 days until explantation and 115 days until patients' death or discharge. Kaplan-Meier analysis revealed a higher probability for the Wallstent to remain within the tracheobronchial system. Dislocation and compression occurred more rarely. Explantation, however, if desired, was more difficult compared to the Strecker stent. The Wallstent also led to the formation of granulation tissue, especially at the proximal stent end, frequently requiring reintervention. Both stent types proved to be effective therapeutic options in the management of obstructive tracheobronchial disease. The mechanical properties of the Strecker stent seem to be less favorable compared to the Wallstent but removal is easy. For benign disease, however, the Wallstent reveals limitations due to significant side effects
Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa
2016-03-01
Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.
Role of IKK-alpha in the EGFR Signaling Regulation
2014-09-01
expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100
Willrodt, Christian; Hoschek, Anna; Bühler, Bruno; Schmid, Andreas; Julsing, Mattijs K
2016-06-01
The microbial production of isoprenoids has recently developed into a prime example for successful bottom-up synthetic biology or top-down systems biology strategies. Respective fermentation processes typically rely on growing recombinant microorganisms. However, the fermentative production of isoprenoids has to compete with cellular maintenance and growth for carbon and energy. Non-growing but metabolically active E. coli cells were evaluated in this study as alternative biocatalyst configurations to reduce energy and carbon loss towards biomass formation. The use of non-growing cells in an optimized fermentation medium resulted in more than fivefold increased specific limonene yields on cell dry weight and glucose, as compared to the traditional growing-cell-approach. Initially, the stability of the resting-cell activity was limited. This instability was overcome via the optimization of the minimal fermentation medium enabling high and stable limonene production rates for up to 8 h and a high specific yield of ≥50 mg limonene per gram cell dry weight. Omitting MgSO4 from the fermentation medium was very promising to prohibit growth and allow high productivities. Applying a MgSO4 -limitation also improved limonene formation by growing cells during non-exponential growth involving a reduced biomass yield on glucose and a fourfold increase in specific limonene yields on biomass as compared to non-limited cultures. The control of microbial growth via the medium composition was identified as a key but yet underrated strategy for efficient isoprenoid production. Biotechnol. Bioeng. 2016;113: 1305-1314. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
[Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].
Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong
2017-07-01
To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.
Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis
DEFF Research Database (Denmark)
Egeberg, Alexander; Skov, Lone; Zachariae, Claus
2018-01-01
It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....
Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal
2018-06-01
Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Duong, Cuong P.; Demitriou, Helen; Thompson, Anne; Williams, David; Thomas, Robert J.S.; Weih, LeAnn; Hicks, Rodney J.
2006-01-01
To evaluate the clinical impact of FDG-PET in staging oesophageal cancer and whether this information improves prognostic stratification. Impact was based on comparison of a prospectively recorded pre-PET plan with post-PET treatment in 68 consecutive patients undergoing primary staging. Survival was analysed using the Kaplan-Meier product limit method and the Cox proportional hazards regression model. FDG-PET findings impacted on the management of 27/68 patients (40%): in 12 therapy was changed from curative to palliative and in three from palliative to curative, while in 12 other patients there was a change in the treatment modality or delivery but not in the treatment intent. The median survival was 21 months, with post-PET stage and treatment intent both strongly associated with survival (p<0.001). Conventional stage was not able to clearly stratify this population. The use of FDG-PET for primary staging of oesophageal cancer changed the clinical management of more than one-third of patients and provided superior prognostic stratification compared with conventional investigations. (orig.)
Combined chemotherapy and radiation therapy in limited disease small-cell lung cancer
Energy Technology Data Exchange (ETDEWEB)
Kim, Moon Kyung; Ahn, Yong Chan; Park, Keun Chil; Lim Do Hoon; Huh, Seung Jae; Kim, Dae Yong; Shin, Kyung Hwan; Lee, Kyu Chan; Kwon, O Jung [College of Medicine, Sungkyunkwan Univ., Seoul (Korea, Republic of)
1999-03-01
This is a retrospective study to evaluate the response rate, acute toxicity, and survival rate of a combined chemotherapy and radiation therapy in limited disease small cell lung cancer. Forty six patients with limited disease small-cell lung cancer who underwent combined chemotherapy and radiation therapy between October 1994 and April 1998 were evaluated. Six cycles of chemotherapy were planned either using a VIP regimen (etoposide, ifosfamide, and cis-platin) or a EP regimen (etoposide and cis-platin). Thoracic radiation therapy was planned to deliver 44 Gy using 10MV X-ray, starting concurrently with chemotherapy. Response was evaluated 4 weeks after the completion of the planned chemotherapy and radiation therapy, and the prophylactic cranial irradiation was planned only for the patients with complete responses. Acute toxicity was evaluated using the SWOG toxicity criteria, and the overall survival and disease-free survival were calculated using the Kaplan-Meier Method. The median follow-up period was 16 months (range:2 to 41 months). Complete response was achieved in 30 (65%) patients, of which 22 patients received prophylactic cranial irradiations. Acute toxicities over grade III were granulocytopenia in 23 (50%), anemia in 17 (37%), thrombo-cytopenia in nine (20%), alopecia in nine (20%), nausea/vomiting in five (11%), and peripheral neuropathy in one (2%). Chemotherapy was delayed in one patient, and the chemotherapy doses were reduced in 58 (24%) out of the total 246 cycles. No radiation esophagitis over grade III was observed, while interruption during radiation therapy for a mean of 8.3 days occurred in 21 patients. The local recurrences were observed in 8 patients and local progressions were in 6 patients, and the distant metastases in 17 patients. Among these, four patients had both the local relapse and the distant metastasis. Brain was the most common metastatic site (10 patients), followed by the liver as the next common site (4 patients). The
Combined chemotherapy and radiation therapy in limited disease small-cell lung cancer
International Nuclear Information System (INIS)
Kim, Moon Kyung; Ahn, Yong Chan; Park, Keun Chil; Lim Do Hoon; Huh, Seung Jae; Kim, Dae Yong; Shin, Kyung Hwan; Lee, Kyu Chan; Kwon, O Jung
1999-01-01
This is a retrospective study to evaluate the response rate, acute toxicity, and survival rate of a combined chemotherapy and radiation therapy in limited disease small cell lung cancer. Forty six patients with limited disease small-cell lung cancer who underwent combined chemotherapy and radiation therapy between October 1994 and April 1998 were evaluated. Six cycles of chemotherapy were planned either using a VIP regimen (etoposide, ifosfamide, and cis-platin) or a EP regimen (etoposide and cis-platin). Thoracic radiation therapy was planned to deliver 44 Gy using 10MV X-ray, starting concurrently with chemotherapy. Response was evaluated 4 weeks after the completion of the planned chemotherapy and radiation therapy, and the prophylactic cranial irradiation was planned only for the patients with complete responses. Acute toxicity was evaluated using the SWOG toxicity criteria, and the overall survival and disease-free survival were calculated using the Kaplan-Meier Method. The median follow-up period was 16 months (range:2 to 41 months). Complete response was achieved in 30 (65%) patients, of which 22 patients received prophylactic cranial irradiations. Acute toxicities over grade III were granulocytopenia in 23 (50%), anemia in 17 (37%), thrombo-cytopenia in nine (20%), alopecia in nine (20%), nausea/vomiting in five (11%), and peripheral neuropathy in one (2%). Chemotherapy was delayed in one patient, and the chemotherapy doses were reduced in 58 (24%) out of the total 246 cycles. No radiation esophagitis over grade III was observed, while interruption during radiation therapy for a mean of 8.3 days occurred in 21 patients. The local recurrences were observed in 8 patients and local progressions were in 6 patients, and the distant metastases in 17 patients. Among these, four patients had both the local relapse and the distant metastasis. Brain was the most common metastatic site (10 patients), followed by the liver as the next common site (4 patients). The
Post, Wendy; Moser, Marvin; Kaplan, Norman
2005-10-01
Following a hypertension symposium in Baltimore, MD, on June 1, 2005, Dr. Wendy Post from the Johns Hopkins University School of Medicine, Baltimore, MD, had the opportunity to interview two of the outstanding hypertension experts in the United States on several controversial issues in hypertension management. Dr. Norman Kaplan is Clinical Professor of Medicine at the Southwestern Health Science Center in Dallas, TX, and Dr. Marvin Moser is Clinical Professor of Medicine at the Yale University School of Medicine, New Haven, CT. Both have been leaders in the field of hypertension treatment and education for more than 40 years. Dr. Kaplan's book Clinical Hypertension has been a standard textbook since 1973 and is now in its ninth edition. Dr. Marvin Moser was the Senior Medical Consultant to the National High Blood Pressure Education Program from 1974 to 2002 and was Chairman of the first Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure and a member of the six subsequent committees. His book Clinical Management of Hypertension is in its seventh edition. Drs. Moser and Kaplan were corecipients of the 2004 International Society of Hypertension Award for Outstanding Contributions to Hypertension Treatment and Education and have lectured extensively throughout the United States and overseas.
Lack of pollinators limits fruit production in commercial blueberry (Vaccinium corymbosum).
Benjamin, Faye E; Winfree, Rachael
2014-12-01
Modern agriculture relies on domesticated pollinators such as the honey bee (Apis mellifera L.), and to a lesser extent on native pollinators, for the production of animal-pollinated crops. There is growing concern that pollinator availability may not keep pace with increasing agricultural production. However, whether crop production is in fact pollen-limited at the field scale has rarely been studied. Here, we ask whether commercial highbush blueberry (Vaccinium corymbosum L.) production in New Jersey is limited by a lack of pollination even when growers provide honey bees at recommended densities. We studied two varieties of blueberry over 3 yr to determine whether blueberry crop production is pollen-limited and to measure the relative contributions of honey bees and native bees to blueberry pollination. We found two lines of evidence for pollen limitation. First, berries receiving supplemental hand-pollination were generally heavier than berries receiving ambient pollination. Second, mean berry mass increased significantly and nonasymptotically with honey bee flower visitation rate. While honey bees provided 86% of pollination and thus drove the findings reported above, native bees still contributed 14% of total pollination even in our conventionally managed, high-input agricultural system. Honey bees and native bees were also similarly efficient as pollinators on a per-visit basis. Overall, our study shows that pollination can be a limiting factor in commercial fruit production. Yields might increase with increased honey bee stocking rates and improved dispersal of hives within crop fields, and with habitat restoration to increase pollination provided by native bees.
Distribution of the product confidence limits for the indirect effect: Program PRODCLIN
MacKinnon, David P.; Fritz, Matthew S.; Williams, Jason; Lockwood, Chondra M.
2010-01-01
This article describes a program, PRODCLIN (distribution of the PRODuct Confidence Limits for INdirect effects), written for SAS, SPSS, and R, that computes confidence limits for the product of two normal random variables. The program is important because it can be used to obtain more accurate confidence limits for the indirect effect, as demonstrated in several recent articles (MacKinnon, Lockwood, & Williams, 2004; Pituch, Whittaker, & Stapleton, 2005). Tests of the significance of and confidence limits for indirect effects based on the distribution of the product method have more accurate Type I error rates and more power than other, more commonly used tests. Values for the two paths involved in the indirect effect and their standard errors are entered in the PRODCLIN program, and distribution of the product confidence limits are computed. Several examples are used to illustrate the PRODCLIN program. The PRODCLIN programs in rich text format may be downloaded from www.psychonomic.org/archive. PMID:17958149
Development of low head Kaplan turbine for power station rehabilitation project
Lim, S. M.; Ohtake, N.; Kurosawa, S.; Suzuki, T.; Yamasaki, T.; Nishi, H.
2012-11-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Development of low head Kaplan turbine for power station rehabilitation project
International Nuclear Information System (INIS)
Lim, S M; Ohtake, N; Kurosawa, S; Suzuki, T; Yamasaki, T; Nishi, H
2012-01-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Sum rule limitations of kinetic particle-production models
International Nuclear Information System (INIS)
Knoll, J.; CEA Centre d'Etudes Nucleaires de Grenoble, 38; Guet, C.
1988-04-01
Photoproduction and absorption sum rules generalized to systems at finite temperature provide a stringent check on the validity of kinetic models for the production of hard photons in intermediate energy nuclear collisions. We inspect such models for the case of nuclear matter at finite temperature employed in a kinetic regime which copes those encountered in energetic nuclear collisions, and find photon production rates which significantly exceed the limits imposed by the sum rule even under favourable concession. This suggests that coherence effects are quite important and the production of photons cannot be considered as an incoherent addition of individual NNγ production processes. The deficiencies of present kinetic models may also apply for the production of probes such as the pion which do not couple perturbatively to the nuclear currents. (orig.)
Rivetti, A.; Angulo, M.; Lucino, C.; Hene, M.; Capezio, O.; Liscia, S.
2016-11-01
Blade tip cavitation is a well-known phenomenon that affects the performance of large-diameter Kaplan turbines and induces structural vibration. Injection of pressurized air has been found to yield promising results in reducing those damaging effects. In this work, the results of an experimental test of air injection on a 9.5-m-diameter Kaplan turbine are reported. Experiments were performed for several load conditions and for two different net heads. Accelerations, pressure pulsation and noise emission were monitored for every tested condition. Results show that, at the expense of a maximum efficiency drop of 0.2%, air injection induces a decrease on the level of vibration from 57% up to 84%, depending on the load condition. Such decrease is seen to be proportional to the air flow rate, in the range from 0.06 to 0.8‰ (respect to the discharge at the best efficiency point).
Directory of Open Access Journals (Sweden)
Araujo Marcos -Vinícius
2016-01-01
Full Text Available From the consumer pressure to healthier and sustainable food, and the search for quality of life, companies in various activities have reinvented to meet this demand. Organic products that have features to meet this trend, also took their place in the Brazilian wine industry, that is entered in this field to stay competitive. On the other hand, they found limiting factors that inhibiting the growth in supply of this product. In this perspective, the objective of this study is to describe and analyze what are the limiting factors for organic wine production in Brazil. To this end, an exploratory research was conducted from in-depth interviews, secondary data and direct observation. The collected data were crossed between companies and theory. The results are presented in the following chain of organic wine, based on primary resources - production - distribution - marketing and stakeholders. For conclusion, it is notable that wineries holding a major concern to maintain the certification, but the biggest challenge is to produce goodorganic grapes. On the other hand, it still requires marketing efforts, so that the product value can reach the end consumer
Let’s limit our waste production and let’s’ sort it!
HSE Unit
2013-01-01
Let’s limit our waste production! – Why ? Preventing the production of waste is the best solution to avoid environmental issues, economic impacts and technical constraints. So, whenever you are involved in the design, manufacturing, distribution, use or dismantling of a product or an activity in general, always remember that the best waste is that which is not produced. The limitation of waste production being an HSE objective declared in 2013 by the CERN Director-General, we encourage everyone to help limit the amount of waste produced through CERN activities. Let’s sort it! – Why ? Since the 90s, CERN has implemented a policy to promote recovery of the waste* generated by its activities. Nowadays, CERN is committed to continuously improving its sorting and recovery and therefore various initiatives have been started by GS-IS to improve the recovery of waste (e.g. recovery of organic waste from restaurants; implementation of solar trash compactors - see Bulletin 27-...
Drenkard, Cristina; Bao, Gaobin; Dennis, Greg; Kan, Hong J; Jhingran, Priti M; Molta, Charles T; Lim, S Sam
2014-06-01
To examine the burden of systemic lupus erythematosus (SLE) on work loss, unemployment, and work productivity impairment in an SLE cohort from the southeastern US. We examined 689 SLE patients ages 18-64 years from the Georgians Organized Against Lupus (GOAL) cohort. GOAL is a longitudinal cohort predominantly derived from the Georgia Lupus Registry, a population-based registry established in metropolitan Atlanta. We used the Kaplan-Meier method to assess the proportion of patients who self-reported work loss since diagnosis. We compared unemployment between SLE patients and the general population from the same geographic area, calculating the standardized unemployment ratio (SUR) within demographic and disease strata. We also calculated the percentage of work productivity impairment by disease outcomes. Of 511 patients employed at diagnosis, 249 (49%) experienced work loss within an average disease duration of 13 years. The proportion of patients who lost their jobs since diagnosis was almost twice for African Americans than for whites. However, the SURs were similar across demographic characteristics, including race. Patients with severe disease activity and severe organ damage had the highest SUR at 4.4 and 5.6, respectively. Among those that remained employed, patients with severe fatigue, neurocognitive symptoms, and musculoskeletal symptoms had the highest impairment of work productivity. SLE imposes a substantial toll on individuals and burden on society. Major factors that negatively impact work outcomes are fatigue, disease activity, and organ damage. More effective treatments along with coping strategies at the workplace are needed to reduce the burden of SLE on work outcomes. Copyright © 2014 by the American College of Rheumatology.
Design for Limit Variability in Quality of Industrial Products: A Case ...
African Journals Online (AJOL)
The area under the normal curve of the distribution was evaluated as 0.94 falling within acceptable limit for processes in control. ... 0.76 while the probability of any sample observation being within the control limit is 0.94, showing that the process in control. Keywords: limit variability, quality of products, control limits, process
Nutrient availability limits biological production in Arctic sea ice melt ponds
DEFF Research Database (Denmark)
Sørensen, Heidi Louise; Thamdrup, Bo; Jeppesen, Erik
2017-01-01
nutrient limitation in melt ponds. We also document that the addition of nutrients, although at relative high concentrations, can stimulate biological productivity at several trophic levels. Given the projected increase in first-year ice, increased melt pond coverage during the Arctic spring and potential......Every spring and summer melt ponds form at the surface of polar sea ice and become habitats where biological production may take place. Previous studies report a large variability in the productivity, but the causes are unknown. We investigated if nutrients limit the productivity in these first...... additional nutrient supply from, e.g. terrestrial sources imply that biological activity of melt ponds may become increasingly important for the sympagic carbon cycling in the future Arctic....
Possibilities and limitations for sustainable bioenergy production systems
Smeets, E.M.W.
2008-01-01
The focus of this thesis is on the possibilities and limitations of sustainable bioenergy production systems. First, the potential contribution of bioenergy to the energy supply in different world regions in the year 2050 from different biomass sources (dedicated woody energy crops, residues and
Fusar-Poli, P; Schultze-Lutter, F
2016-02-01
Prediction of psychosis in patients at clinical high risk (CHR) has become a mainstream focus of clinical and research interest worldwide. When using CHR instruments for clinical purposes, the predicted outcome is but only a probability; and, consequently, any therapeutic action following the assessment is based on probabilistic prognostic reasoning. Yet, probabilistic reasoning makes considerable demands on the clinicians. We provide here a scholarly practical guide summarising the key concepts to support clinicians with probabilistic prognostic reasoning in the CHR state. We review risk or cumulative incidence of psychosis in, person-time rate of psychosis, Kaplan-Meier estimates of psychosis risk, measures of prognostic accuracy, sensitivity and specificity in receiver operator characteristic curves, positive and negative predictive values, Bayes' theorem, likelihood ratios, potentials and limits of real-life applications of prognostic probabilistic reasoning in the CHR state. Understanding basic measures used for prognostic probabilistic reasoning is a prerequisite for successfully implementing the early detection and prevention of psychosis in clinical practice. Future refinement of these measures for CHR patients may actually influence risk management, especially as regards initiating or withholding treatment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Limiting factors in the production of deep microstructures
Tolfree, David W. L.; O'Neill, William; Tunna, Leslie; Sutcliffe, Christopher
1999-10-01
Microsystems increasingly require precision deep microstructures that can be cost-effectively designed and manufactured. New products must be able to meet the demands of the rapidly growing markets for microfluidic, micro- optical and micromechanical devices in industrial sectors which include chemicals, pharmaceuticals, biosciences, medicine and food. The realization of such products, first requires an effective process to design and manufacture prototypes. Two process methods used for the fabrication of high aspect-ratio microstructures are based on X-ray beam lithography with electroforming processes and direct micromachining with a frequency multiplied Nd:YAG laser using nanosecond pulse widths. Factors which limit the efficiency and precision obtainable using such processes are important parameters when deciding on the best fabrication method to use. A basic microstructure with narrow channels suitable for a microfluidic mixer have been fabricated using both these techniques and comparisons made of the limitations and suitability of the processes in respect of fast prototyping and manufacture or working devices.
Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S
2013-01-01
The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.
Entropy production of a Brownian ellipsoid in the overdamped limit.
Marino, Raffaele; Eichhorn, Ralf; Aurell, Erik
2016-01-01
We analyze the translational and rotational motion of an ellipsoidal Brownian particle from the viewpoint of stochastic thermodynamics. The particle's Brownian motion is driven by external forces and torques and takes place in an heterogeneous thermal environment where friction coefficients and (local) temperature depend on space and time. Our analysis of the particle's stochastic thermodynamics is based on the entropy production associated with single particle trajectories. It is motivated by the recent discovery that the overdamped limit of vanishing inertia effects (as compared to viscous fricion) produces a so-called "anomalous" contribution to the entropy production, which has no counterpart in the overdamped approximation, when inertia effects are simply discarded. Here we show that rotational Brownian motion in the overdamped limit generates an additional contribution to the "anomalous" entropy. We calculate its specific form by performing a systematic singular perturbation analysis for the generating function of the entropy production. As a side result, we also obtain the (well-known) equations of motion in the overdamped limit. We furthermore investigate the effects of particle shape and give explicit expressions of the "anomalous entropy" for prolate and oblate spheroids and for near-spherical Brownian particles.
Factors limiting heterotrophic bacterial production in the southern Pacific Ocean
Directory of Open Access Journals (Sweden)
F. Van Wambeke
2008-05-01
Full Text Available The role of potential factors limiting bacterial growth was investigated along vertical and longitudinal gradients across the South Eastern Pacific Gyre. The effects of glucose, nitrate, ammonium and phosphate additions on heterotrophic bacterial production (using leucine technique were studied in parallel in unfiltered seawater samples incubated under natural daily irradiance. The enrichments realized on the subsurface showed three types of responses. From 141° W (Marquesas plateau to approx 125° W, bacteria were not bottom-up controlled, as confirmed by the huge potential of growth in non-enriched seawater (median of enhancement factor×39 in 24 h. Within the Gyre (125° W–95° W, nitrogen alone stimulated leucine incorporation rates (median×4.2, but rapidly labile carbon (glucose became a second limiting factor (median×37 when the two elements were added. Finally from the border of the gyre to the Chilean upwelling (95° W–73° W, labile carbon was the only factor stimulating heterotrophic bacterial production. Interaction between phytoplankton and heterotrophic bacterial communities and the direct versus indirect effect of iron and macronutrients on bacterial production were also investigated in four selected sites: two sites on the vicinity of the Marquesas plateau, the centre of the gyre and the Eastern border of the gyre. Both phytoplankton and heterotrophic bacteria were limited by availability of nitrogen within the gyre, but not by iron. Iron limited phytoplankton at Marquesas plateau and at the eastern border of the gyre. However 48 h enrichment experiments were not sufficient to show any clear limitation of heterotrophic bacteria within Marquesas plateau and showed a limitation of these organisms by labile carbon in the eastern border of the Gyre.
Directory of Open Access Journals (Sweden)
Vasile Cojocaru
2011-09-01
Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.
Limiting the usage of blood products in cardiovascular surgery.
Horowitz, P E; Lorenzen, C M; Rhydderch, R D
1991-03-01
We studied the effect of the initiation of a five part program of blood component conservation on blood product utilization in patients undergoing major cardiovascular surgery. We encouraged physicians and nurses to adhere to a set of guidelines that would limit the exposure of these patients to complications associated with blood product administration. Through this effort the amounts of packed red cells, fresh frozen plasma, platelets, and cryoprecipitate used were markedly reduced. After the start of the conservation program, overall blood product usage was reduced 29% despite a 46% increase in the surgical caseload, and there was a 53% decrease in the amount of donor exposure (units of individual blood products administered) per patient.
MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer
2012-12-01
hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA
Application of Enlisted Force Retention Levels and Career Field Stability
2017-03-23
APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial
Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón
2016-01-01
The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...
Impact of phosphate limitation on PHA production in a feast-famine process.
Korkakaki, Emmanouela; van Loosdrecht, Mark C M; Kleerebezem, Robbert
2017-12-01
Double-limitation systems have shown to induce polyhydroxyalkanoates (PHA) production in chemostat studies limited in e.g. carbon and phosphate. In this work the impact of double substrate limitation on the enrichment of a PHA producing community was studied in a sequencing batch process. Enrichments at different C/P concentration ratios in the influent were established and the effect on the PHA production capacity and the enrichment community structure was investigated. Experimental results demonstrated that when a double substrate limitation is imposed at a C/P ratio in the influent in a range of 150 (C-mol/mol), the P-content of the biomass and the specific substrate uptake rates decreased. Nonetheless, the PHA storage capacity remained high (with a maximum of 84 wt%). At a C/P ratio of 300, competition in the microbial community is based on phosphate uptake, and the PHA production capacity is lost. Biomass specific substrate uptake rates are a linear function of the cellular P-content, offering advantages for scaling-up the PHA production process due to lower oxygen requirements. Copyright © 2017 Elsevier Ltd. All rights reserved.
Asymptotically optimal production policies in dynamic stochastic jobshops with limited buffers
Hou, Yumei; Sethi, Suresh P.; Zhang, Hanqin; Zhang, Qing
2006-05-01
We consider a production planning problem for a jobshop with unreliable machines producing a number of products. There are upper and lower bounds on intermediate parts and an upper bound on finished parts. The machine capacities are modelled as finite state Markov chains. The objective is to choose the rate of production so as to minimize the total discounted cost of inventory and production. Finding an optimal control policy for this problem is difficult. Instead, we derive an asymptotic approximation by letting the rates of change of the machine states approach infinity. The asymptotic analysis leads to a limiting problem in which the stochastic machine capacities are replaced by their equilibrium mean capacities. The value function for the original problem is shown to converge to the value function of the limiting problem. The convergence rate of the value function together with the error estimate for the constructed asymptotic optimal production policies are established.
Resultado do tratamento cirúrgico das neoplasias do seio piriforme
Directory of Open Access Journals (Sweden)
Costa Claudiney C.
2003-01-01
Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.
Limitation of productivity by trace metals in the sea
International Nuclear Information System (INIS)
Morel, F.M.M.; Price, N.M.; Hudson, R.J.M.
1991-01-01
Some trace metals such as Fe, Ni, Cu, and Zn are essential for the growth of phytoplankton. The concentrations of these essential trace elements in seawater are so low as to limit their availability to aquatic microbiota. Trace element uptake is ultimately limited by kinetics of reaction with transport ligands or by diffusion to the cell. From what the authors know of the characteristics of the uptake systems of phytoplankton and their trace metal requirements they can estimate that Fe and Zn may at some times in some place limit phytoplankton productivity, which is in accord with available field data on trace metal enrichments
Directory of Open Access Journals (Sweden)
Giuseppe Bonaccorso
2014-06-01
Full Text Available Il contributo proposto ha l’obiettivo di analizzare alcuni significativi brani del tessuto urbano della periferia est di Roma, adottando metodi interpretativi legati alla storia, alla società, alla programmazione urbanistica e alla costruzione. Gli aspetti salienti del quadrante orientale della periferia romana verranno così delineati partendo “dal di dentro”, sottolineandone i percorsi, gli spazi e i nuclei compositivi che sono all’origine della struttura e della forma stessa dei quartieri disposti a cavallo del Grande Raccordo Anulare. In questo ambito, si pone l’attenzione su alcuni episodi chiave che vedono protagoniste le nuove chiese che riescono a creare una centralità all’interno dei quartieri periferici sostituendo le biblioteche, le piazze e i centri commerciali. Analizzando da vicino questi esempi, si scopre come di recente sono state realizzate chiese firmate da architetti di fama internazionale proprio allo scopo di rafforzare, o meglio di costruire, un fattore identitario per ciascun quartiere ubicato nel settore orientale della città. Partendo quindi dal generale si arriva a indagare una chiesa e un quartiere che possono essere considerati un modello da seguire per tutta la periferia a ridosso del GRA: la chiesa giubilare di Dio Padre Misericordioso progettata da Richard Meier nel quartiere di Tor Tre Teste. La sequenzialità degli eventi che hanno contraddistinto il concorso per la progettazione della chiesa, la scelta della proposta di Richard Meier, la complessità del cantiere, l’analisi tecnica, stilistica e simbolica della realizzazione finale sono quindi analizzate nell’ambito del rapporto con il quartiere e del tentativo di realizzare (attraverso di essa un centro di attrazione per tutta la periferia. The article analyses some significant parts of the urban tissue at the eastern periphery of Rome, using the interpretative methods inherent to history, society, urban programming and construction
Li, Yong; Niu, Shuli; Yu, Guirui
2016-02-01
Nitrogen (N) and phosphorus (P), either individually or in combination, have been demonstrated to limit biomass production in terrestrial ecosystems. Field studies have been extensively synthesized to assess global patterns of N impacts on terrestrial ecosystem processes. However, to our knowledge, no synthesis has been done so far to reveal global patterns of P impacts on terrestrial ecosystems, especially under different nitrogen (N) levels. Here, we conducted a meta-analysis of impacts of P addition, either alone or with N addition, on aboveground (AGB) and belowground biomass production (BGB), plant and soil P concentrations, and N : P ratio in terrestrial ecosystems. Overall, our meta-analysis quantitatively confirmed existing notions: (i) colimitation of N and P on biomass production and (ii) more P limitation in tropical forest than other ecosystems. More importantly, our analysis revealed new findings: (i) P limitation on biomass production was aggravated by N enrichment and (ii) plant P concentration was a better indicator of P limitation than soil P availability. Specifically, P addition increased AGB and BGB by 34% and 13%, respectively. The effect size of P addition on biomass production was larger in tropical forest than grassland, wetland, and tundra and varied with P fertilizer forms, P addition rates, or experimental durations. The P-induced increase in biomass production and plant P concentration was larger under elevated than ambient N. Our findings suggest that the global limitation of P on biomass production will become severer under increasing N fertilizer and deposition in the future. © 2015 John Wiley & Sons Ltd.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Energy Technology Data Exchange (ETDEWEB)
Petit, O; Nilsson, H [Division of Fluid Mechanics, Chalmers University of Technology, Hoersalsvaegen 7A, SE-41296 Goeteborg (Sweden); Mulu, B; Cervantes, M, E-mail: olivierp@chalmers.s [Division of Fluid Mechanics, Luleaa University of Technology, SE-971 87 Luleaa (Sweden)
2010-08-15
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Petit, O.; Mulu, B.; Nilsson, H.; Cervantes, M.
2010-08-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Petit, O; Nilsson, H; Mulu, B; Cervantes, M
2010-01-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Impact of housing on the survival of persons with AIDS
Directory of Open Access Journals (Sweden)
Vittinghoff Eric
2009-07-01
Full Text Available Abstract Background Homeless persons with HIV/AIDS have greater morbidity and mortality, more hospitalizations, less use of antiretroviral therapy, and worse medication adherence than HIV-infected persons who are stably housed. We examined the effect of homelessness on the mortality of persons with AIDS and measured the effect of supportive housing on AIDS survival. Methods The San Francisco AIDS registry was used to identify homeless and housed persons who were diagnosed with AIDS between 1996 and 2006. The registry was computer-matched with a housing database of homeless persons who received housing after their AIDS diagnosis. The Kaplan-Meier product limit method was used to compare survival between persons who were homeless at AIDS diagnosis and those who were housed. Proportional hazards models were used to estimate the independent effects of homelessness and supportive housing on survival after AIDS diagnosis. Results Of the 6,558 AIDS cases, 9.8% were homeless at diagnosis. Sixty-seven percent of the persons who were homeless survived five years compared with 81% of those who were housed (p Conclusion Supportive housing ameliorates the negative effect of homelessness on survival with AIDS.
Tiriveedhi, Venkataswarup; Tucker, Natalia; Herndon, John; Li, Lijin; Sturmoski, Mark; Ellis, Matthew; Ma, Cynthia; Naughton, Michael; Lockhart, A Craig; Gao, Feng; Fleming, Timothy; Goedegebuure, Peter; Mohanakumar, Thalachallour; Gillanders, William E
2014-12-01
Mammaglobin-A (MAM-A) is overexpressed in 40% to 80% of primary breast cancers. We initiated a phase I clinical trial of a MAM-A DNA vaccine to evaluate its safety and biologic efficacy. Patients with breast cancer with stable metastatic disease were eligible for enrollment. Safety was monitored with clinical and laboratory assessments. The CD8 T-cell response was measured by ELISPOT, flow cytometry, and cytotoxicity assays. Progression-free survival (PFS) was described using the Kaplan-Meier product limit estimator. Fourteen subjects have been treated with the MAM-A DNA vaccine and no significant adverse events have been observed. Eight of 14 subjects were HLA-A2(+), and the CD8 T-cell response to vaccination was studied in detail. Flow cytometry demonstrated a significant increase in the frequency of MAM-A-specific CD8 T cells after vaccination (0.9% ± 0.5% vs. 3.8% ± 1.2%; P cells (41 ± 32 vs. 215 ± 67 spm; P cell responses, and preliminary evidence suggests improved PFS. Additional studies are required to define the potential of the MAM-A DNA vaccine for breast cancer prevention and/or therapy. ©2014 American Association for Cancer Research.
Nutrient and Light Limitations on Grass Productivity in a Southern African Savanna
Ries, L. P.; Shugart, H. H.; Caylor, K. K.; Okin, G. S.; Kgope, B.
2006-12-01
Despite the ubiquity of sub-tropical savannas throughout the earth, limitations of savanna productivity are understudied relative to other terrestrial systems. In particular, there has been little attention on the role of phosphorus (P) in savanna productivity and structure. This study examined the role of increased nitrogen (N) and P in grass productivity in a woodland savanna in Botswana. We added aqueous forms of N and P individually and together to selected grasses. During the following growing season we measured foliar nutrient concentrations, aboveground biomass productivity and photosynthetic response at various levels of incident photosynthetically active radiation to estimate the productivity response. As expected, we observed an increase in foliar P concentrations in P and N+P treatments. However, there was no increase in foliar N for any treatments. We also observed a significant increase in net carbon assimilation and Amax for all treatments relative to the control grasses. Despite a higher rate of leaf level carbon assimilation in the N treatment, the aboveground biomass production was smaller than that of the N+P treatment. These results suggest that the aboveground productivity of these woodland savanna grasses is limited by both N and P. Additionally, under constant CO2 availability, photosynthesis appears to be limited by nutrients for light levels greater than 500 μmol m-2s-1. This research will help broaden our understanding of the biogeochemical processes that govern savanna productivity. Ultimately, these data can be used to model canopy productivity and ecological succession of savannas under scenarios in which bush encroachment and desertification may alter light and nutrients availability.
Weiner, Lois; Kaplan, Andy
2014-01-01
In this commentary, Andy Kaplan discusses with Lois Weiner, Diane Ravitch's latest book "The Reign of Error," which combines scholarly argument and scrupulous research in defense of democratic education. Weiner notes, the book will prove an important resource in the ongoing struggle for the survival of public schooling. Weiner adds,…
DEFF Research Database (Denmark)
Freilich, Jonatan; Manouchehrinia, Ali; Trusheim, Mark
2017-01-01
Previous research characterizing factors influencing multiple sclerosis (MS) disease progression has typically been based on time to disease milestones (Kaplan-Meier, Cox hazard regression, etc.). A limitation of these methods is the handling of the often large groups of patients not reaching...... the milestone. To characterize clinical factors influencing MS disease progression as annual transitions from each Expanded Disability Status Scale (EDSS). The annual progression of 11,964 patients from the Swedish MS Registry was analysed with 10 multinomial logistic regressions, that is, one for transition...... from each full EDSS with explanatory variables age, sex, age at onset, time in current EDSS, highest prior EDSS, MS course and treatment. All factors (except sex) investigated had statistically significant impacts on transitions from at least one EDSS. However, significance and size of the effect...
Breast-conserving treatment of early breast cancer
International Nuclear Information System (INIS)
Pirtoli, L.; Bellezza, A.; Pepi, F.; Tucci, E.; Crociani, M.; Crastolla, A.M.; Farzad, M.; Bindi, M.
1993-01-01
Results of large prospective trials, often based on selected series and optimal treatment techniques, indicate that breast conserving therapy is appropriate for most patients with early breast cancer. Questions remain regarding the therapeutic outcome in common practice. We report on a series of 206 consecutive, unselected patients treated with current radiotherapy procedures. The Kaplan-Meier evaluation showed 5- and 8-year survival rates (93%, 91%), distant disease-free survival rates (87%, 85%) and local relapse-free survival rates (90%, 88%) that were comparable to those of the conservative arms in reported randomised trials and to the data from retrospective studies reported by authoritative institutions. However, subanalysis according to prognostic factors such as menopausal status, age and axillary nodal status was of limited value, due to the small number of cases. (orig.)
Role of IKK-alpha in EGFR Signaling Regulation
2013-09-01
heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3
DEFF Research Database (Denmark)
Heeran, Mel C; Rask, Lene; Høgdall, Claus K
2015-01-01
of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...
Directory of Open Access Journals (Sweden)
Muge Akmansu
2010-12-01
Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.
Runaway transient simulation of a model Kaplan turbine
Energy Technology Data Exchange (ETDEWEB)
Liu, S; Liu, D; Wu, Y [State Key Laboratory of Hydroscience and Engineering, Department of Thermal Eng., Tsinghua University, Beijing, 100084 (China); Zhou, D [Water Conservancy and Hydropower Eng., Hohai University, Nanjing. 210098 (China); Nishi, M, E-mail: liushuhong@tsinghua.edu.c [Kyushu Inst. Tech. Senior Academy, Kitakyushu, 804-8550 (Japan)
2010-08-15
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-{epsilon} turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
Liu, S.; Zhou, D.; Liu, D.; Wu, Y.; Nishi, M.
2010-08-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-epsilon turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
International Nuclear Information System (INIS)
Liu, S; Liu, D; Wu, Y; Zhou, D; Nishi, M
2010-01-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-ε turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Directory of Open Access Journals (Sweden)
Ana – Maria Budai
2010-10-01
Full Text Available The paper present an analytical method that can be used to determianted fatigue life time duration in service for runner blade mechanism of Kaplan turbines. The study was made for lever button of runer blade mechanism using two analytical relation to calculate the maximum number of stress cycles whereupon the mechanism work without any damage. To estimate fatigue life time duration will be used a formula obtained from one of most comon cumulative damage methodology taking in consideration the real exploatation conditions of a specified Kapaln turbine.
A theoretical study of impurity production at limiters in tokamaks
International Nuclear Information System (INIS)
Pitcher, C.S.; Matthews, G.F.; Goodall, D.H.J.; McCracken, G.M.; Stangeby, P.C.
1988-01-01
The spatial distribution of neutral impurity emissions around graphite limiters in the DITE tokamak is investigated using a Monte Carlo neutral transport code based on physical sputtering. The Monte Carlo code results are compared with experiments for the CI distributions observed toroidally around the probe limiter and radially around the fixed limiter. The comparison between code and experiment demonstrates the ability of camera observations and Langmuir probe measurements to provide detailed information on the production of impurities at limiters. From the Monte Carlo simulation it is shown that the toroidal distribution of impurity emission is determined mainly by the geometry of the limiter and the radial variation of the sputtering yield, while the radial distribution is sensitive mainly to the sputtered atom velocity distribution and the rate coefficients for ionization and excitation
Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.
Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J
2016-12-01
A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.
McAuley, Paul A; Keteyian, Steven J; Brawner, Clinton A; Dardari, Zeina A; Al Rifai, Mahmoud; Ehrman, Jonathan K; Al-Mallah, Mouaz H; Whelton, Seamus P; Blaha, Michael J
2018-05-03
To assess the influence of exercise capacity and body mass index (BMI) on 10-year mortality in patients with heart failure (HF) and to synthesize these results with those of previous studies. This large biracial sample included 774 men and women (mean age, 60±13 years; 372 [48%] black) with a baseline diagnosis of HF from the Henry Ford Exercise Testing (FIT) Project. All patients completed a symptom-limited maximal treadmill stress test from January 1, 1991, through May 31, 2009. Patients were grouped by World Health Organization BMI categories for Kaplan-Meier survival analyses and stratified by exercise capacity (<4 and ≥4 metabolic equivalents [METs] of task). Associations of BMI and exercise capacity with all-cause mortality were assessed using multivariable-adjusted Cox proportional hazards models. During a mean follow-up of 10.1±4.6 years, 380 patients (49%) died. Kaplan-Meier survival plots revealed a significant positive association between BMI category and survival for exercise capacity less than 4 METs (log-rank, P=.05), but not greater than or equal to 4 METs (P=.76). In the multivariable-adjusted models, exercise capacity (per 1 MET) was inversely associated, but BMI was not associated, with all-cause mortality (hazard ratio, 0.89; 95% CI, 0.85-0.94; P<.001 and hazard ratio, 0.99; 95% CI, 0.97-1.01; P=.16, respectively). Maximal exercise capacity modified the relationship between BMI and long-term survival in patients with HF, upholding the presence of an exercise capacity-obesity paradox dichotomy as observed over the short-term in previous studies. Copyright © 2018 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.
Teófilo, Eugénio; Rocha-Pereira, Nuno; Kuhlmann, Birger; Antela, Antonio; Knechten, Heribert; Santos, Jesús; Jiménez-Expósito, Maria Jesús
2016-02-01
Boosted protease inhibitors (PIs), including ritonavir-boosted atazanavir (ATV/r), are a recommended option for the initial treatment of HIV-1 infection based upon clinical trial data; however, long-term real-life clinical data are limited. We evaluated the long-term use of ATV/r as a component of antiretroviral combination therapy in the real-life setting in the REMAIN study. This was an observational cohort study conducted at sites across Germany, Portugal, and Spain. Retrospective historical and prospective longitudinal follow-up data were extracted every six months from medical records of HIV-infected treatment-naïve patients aged ≥ 18 years initiating a first-line ATV/r-containing regimen. Eligible patients (n = 517) were followed up for a median of 3.4 years. The proportion remaining on ATV/r at 5 years was 51.5% with an estimated Kaplan-Meier median time to treatment discontinuation of 4.9 years. Principal reasons for discontinuation were adverse events (15.9%; 8.9% due to hyperbilirubinemia) and virologic failure (6.8%). The Kaplan-Meier probability of not having virologic failure (HIV-1 RNA treatment-emergent major PI resistance occurred. ATV/r was generally well tolerated during long-term treatment with no significant changes in estimated glomerular filtration rate over five years. In a real-life clinical setting over five years, treatment-naïve patients with HIV-1 infection initiating an ATV/r-based regimen showed sustained virologic suppression, an overall treatment persistence rate of 51.5%, an absence of treatment-emergent major PI resistance mutations at virologic failure, a long-term safety profile consistent with that observed in clinical trials, and no significant decline in renal function.
A survey of major constraints limiting commercial poultry production ...
African Journals Online (AJOL)
In a survey of major constraints limiting commercial poultry production in Gombe metropolis, 2,121 poultry cases were presented at the Gombe State Veterinary Clinic between January 1995 and December 2004. Out of the total number of cases presented, Newcastle disease (ND) accounted for 14.66%, chronic respiratory ...
Modelling the bioconversion of cellulose into microbial products: rate limitations
Energy Technology Data Exchange (ETDEWEB)
Asenjo, J A
1984-12-01
The direct bioconversion of cellulose into microbial products carried out as a simultaneous saccharification and fermentation has a strong effect on the rates of cellulose degradation because cellobiose and glucose inhibition of the reaction are circumvented. A general mathematical model of the kinetics of this bioconversion has been developed. Its use in representing aerobic systems and in the analysis of the kinetic limitations has been investigated. Simulations have been carried out to find the rate limiting steps in slow fermentations and in rapid ones as determined by the specific rate of product formation. The requirements for solubilising and depolymerising enzyme activities (cellulase and cellobiase) in these systems has been determined. The activity that have been obtained for fungal cellulases are adequate for the kinetic requirements of the fastest fermentative strains. The results also show that for simultaneous bioconversions where strong cellobiose and glucose inhibition is overcome, no additional cellobiase is necessary to increase the rate of product formation. These results are useful for the selection of cellolytic micro-organisms and in the determination of enzymes to be cloned in recombinant strains. 17 references.
Blade profile optimization of kaplan turbine using cfd analysis
International Nuclear Information System (INIS)
Janjua, A.B.; Khalil, M.S.
2013-01-01
Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)
Blade Profile Optimization of Kaplan Turbine Using CFD Analysis
Directory of Open Access Journals (Sweden)
Aijaz Bashir Janjua
2013-10-01
Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.
Sutton, Virginia Kay
This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.
Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents
International Nuclear Information System (INIS)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.
2002-01-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
International Nuclear Information System (INIS)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho
2010-01-01
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate
Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D
2011-12-01
To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.
Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.
Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak
Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].
Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing
2016-02-01
To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.
Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.
Pion, J; Lenoir, M; Vandorpe, B; Segers, V
2015-11-01
This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.
Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola
2009-01-01
We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
Energy Technology Data Exchange (ETDEWEB)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)
2010-08-15
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.
Limits on the production of neutral penetrating states in a beam dump
International Nuclear Information System (INIS)
LoSecco, J.; Sulak, L.; Galik, R.; Horstkotte, J.; Knauer, J.; Williams, H.H.; Soukas, A.; Wanderer, P.; Weng, W.
1981-01-01
We present limits on the production of neutral penetrating states produced in 28 GeV proton nucleus collisions. We obtain limits for light, heavy and unstable neutral states. For light stable states our limit sigmasub(I)sigmasub(P) -69 cm 4 /nucleon 2 is more than a factor of 5.5 better than previous limits. Time of flight techniques are used to study heavy states. We have poor sensitivity to short-lived states. (orig.)
Production capacity of equipment for medium and large hydroelectric power plant in China
Energy Technology Data Exchange (ETDEWEB)
Huang Shenyang [Ministry of Electric Power, Beijing (China). Bureau of Electric Power Machinery
1995-07-01
This document presents an overview on the production capacity of equipment for medium and large hydroelectric power plant in China. The document approaches general aspects, production capability and testing facilities related to Francis, Kaplan, tubular and impulse hydroelectric generating sets, and the introduction of main manufacturers as well.
Impact of housing on the survival of persons with AIDS.
Schwarcz, Sandra K; Hsu, Ling C; Vittinghoff, Eric; Vu, Annie; Bamberger, Joshua D; Katz, Mitchell H
2009-07-07
Homeless persons with HIV/AIDS have greater morbidity and mortality, more hospitalizations, less use of antiretroviral therapy, and worse medication adherence than HIV-infected persons who are stably housed. We examined the effect of homelessness on the mortality of persons with AIDS and measured the effect of supportive housing on AIDS survival. The San Francisco AIDS registry was used to identify homeless and housed persons who were diagnosed with AIDS between 1996 and 2006. The registry was computer-matched with a housing database of homeless persons who received housing after their AIDS diagnosis. The Kaplan-Meier product limit method was used to compare survival between persons who were homeless at AIDS diagnosis and those who were housed. Proportional hazards models were used to estimate the independent effects of homelessness and supportive housing on survival after AIDS diagnosis. Of the 6,558 AIDS cases, 9.8% were homeless at diagnosis. Sixty-seven percent of the persons who were homeless survived five years compared with 81% of those who were housed (p Homelessness increased the risk of death (adjusted relative hazard [RH] 1.20; 95% confidence limits [CL] 1.03, 1.41). Homeless persons with AIDS who obtained supportive housing had a lower risk of death than those who did not (adjusted RH 0.20; 95% CL 0.05, 0.81). Supportive housing ameliorates the negative effect of homelessness on survival with AIDS.
High-energy neutrino background: Limitations on models of deuterium production
International Nuclear Information System (INIS)
Eichler, D.
1979-01-01
It is pointed out that Epstein's model for deuterium production via high-energy spallation reactions produces high-energy neutrinos in sufficient quantity to stand out above those that are produced by cosmic-ray interactions in the Earth's atmosphere. That the Reines experiment detected neutrinos of atmospheric origin without detecting any cosmic component restricts deuterium production by spallation reactions to very high redshifts (z> or approx. =300). Improved neutrino experiments may be able to push these limits back to recombination
A qualitative risk assessment approach for Swiss dairy products: opportunities and limitations.
Menéndez González, S; Hartnack, S; Berger, T; Doherr, M; Breidenbach, E
2011-05-01
Switzerland implemented a risk-based monitoring of Swiss dairy products in 2002 based on a risk assessment (RA) that considered the probability of exceeding a microbiological limit value set by law. A new RA was launched in 2007 to review and further develop the previous assessment, and to make recommendations for future risk-based monitoring according to current risks. The resulting qualitative RA was designed to ascertain the risk to human health from the consumption of Swiss dairy products. The products and microbial hazards to be considered in the RA were determined based on a risk profile. The hazards included Campylobacter spp., Listeria monocytogenes, Salmonella spp., Shiga toxin-producing Escherichia coli, coagulase-positive staphylococci and Staphylococcus aureus enterotoxin. The release assessment considered the prevalence of the hazards in bulk milk samples, the influence of the process parameters on the microorganisms, and the influence of the type of dairy. The exposure assessment was linked to the production volume. An overall probability was estimated combining the probabilities of release and exposure for each combination of hazard, dairy product and type of dairy. This overall probability represents the likelihood of a product from a certain type of dairy exceeding the microbiological limit value and being passed on to the consumer. The consequences could not be fully assessed due to lack of detailed information on the number of disease cases caused by the consumption of dairy products. The results were expressed as a ranking of overall probabilities. Finally, recommendations for the design of the risk-based monitoring programme and for filling the identified data gaps were given. The aims of this work were (i) to present the qualitative RA approach for Swiss dairy products, which could be adapted to other settings and (ii) to discuss the opportunities and limitations of the qualitative method. © 2010 Blackwell Verlag GmbH.
Survival of Patients With Cervical Cancer in Rural India
Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy
2015-01-01
Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...
Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus
2013-01-01
BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...
International Nuclear Information System (INIS)
Badwe, R.A.
1999-01-01
The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model
Directory of Open Access Journals (Sweden)
Peña Carlos F
2011-02-01
Full Text Available Abstract Background The oxygen transfer rate (OTR and dissolved oxygen tension (DOT play an important role in determining alginate production and its composition; however, no systematic study has been reported about the independent influence of the OTR and DOT. In this paper, we report a study about alginate production and the evolution of the molecular mass of the polymer produced by a wild-type A. vinelandii strain ATCC 9046, in terms of the maximum oxygen transfer rate (OTRmax in cultures where the dissolved oxygen tension (DOT was kept constant. Results The results revealed that in the two dissolved oxygen conditions evaluated, strictly controlled by gas blending at 0.5 and 5% DOT, an increase in the agitation rate (from 300 to 700 rpm caused a significant increase in the OTRmax (from 17 to 100 mmol L-1 h-1 for DOT of 5% and from 6 to 70 mmol L-1 h-1 for DOT of 0.5%. This increase in the OTRmax improved alginate production, as well as the specific alginate production rate (SAPR, reaching a maximal alginate concentration of 3.1 g L-1 and a SAPR of 0.031 g alg g biom-1 h-1 in the cultures at OTRmax of 100 mmol L-1 h-1. In contrast, the mean molecular mass (MMM of the alginate isolated from cultures developed under non-oxygen limited conditions increased by decreasing the OTRmax, reaching a maximal of 550 kDa at an OTRmax of 17 mmol L-1 h-1 . However, in the cultures developed under oxygen limitation (0.5% DOT, the MMM of the polymer was practically the same (around 200 kDa at 300 and 700 rpm, and this remained constant throughout the cultivation. Conclusions Overall, our results showed that under oxygen-limited and non oxygen-limited conditions, alginate production and its molecular mass are linked to the OTRmax, independently of the DOT of the culture.
Shoari, Niloofar; Dubé, Jean-Sébastien; Chenouri, Shoja'eddin
2015-11-01
In environmental studies, concentration measurements frequently fall below detection limits of measuring instruments, resulting in left-censored data. Some studies employ parametric methods such as the maximum likelihood estimator (MLE), robust regression on order statistic (rROS), and gamma regression on order statistic (GROS), while others suggest a non-parametric approach, the Kaplan-Meier method (KM). Using examples of real data from a soil characterization study in Montreal, we highlight the need for additional investigations that aim at unifying the existing literature. A number of studies have examined this issue; however, those considering data skewness and model misspecification are rare. These aspects are investigated in this paper through simulations. Among other findings, results show that for low skewed data, the performance of different statistical methods is comparable, regardless of the censoring percentage and sample size. For highly skewed data, the performance of the MLE method under lognormal and Weibull distributions is questionable; particularly, when the sample size is small or censoring percentage is high. In such conditions, MLE under gamma distribution, rROS, GROS, and KM are less sensitive to skewness. Related to model misspecification, MLE based on lognormal and Weibull distributions provides poor estimates when the true distribution of data is misspecified. However, the methods of rROS, GROS, and MLE under gamma distribution are generally robust to model misspecifications regardless of skewness, sample size, and censoring percentage. Since the characteristics of environmental data (e.g., type of distribution and skewness) are unknown a priori, we suggest using MLE based on gamma distribution, rROS and GROS. Copyright © 2015 Elsevier Ltd. All rights reserved.
Trebše, Andrej J.
2004-01-01
The paper deals with efficiency measurement of Kaplan turbine with relative method (index test) and adjustment of operating of runner and guide vane governing system. At certain longer penstocks the looses in conduit at turbineload operation change the net head. On basis of model test on Kaplan turbine and relative turbine efficiency measurement on prototype the turbine governing system was optimized in accordance with comparative method. Prispevek obravnava meritev izkoristka kaplanove tu...
Examining the Latent Structure of the Delis-Kaplan Executive Function System.
Karr, Justin E; Hofer, Scott M; Iverson, Grant L; Garcia-Barrera, Mauricio A
2018-05-04
The current study aimed to determine whether the Delis-Kaplan Executive Function System (D-KEFS) taps into three executive function factors (inhibition, shifting, fluency) and to assess the relationship between these factors and tests of executive-related constructs less often measured in latent variable research: reasoning, abstraction, and problem solving. Participants included 425 adults from the D-KEFS standardization sample (20-49 years old; 50.1% female; 70.1% White). Eight alternative measurement models were compared based on model fit, with test scores assigned a priori to three factors: inhibition (Color-Word Interference, Tower), shifting (Trail Making, Sorting, Design Fluency), and fluency (Verbal/Design Fluency). The Twenty Questions, Word Context, and Proverb Tests were predicted in separate structural models. The three-factor model fit the data well (CFI = 0.938; RMSEA = 0.047), although a two-factor model, with shifting and fluency merged, fit similarly well (CFI = 0.929; RMSEA = 0.048). A bifactor model fit best (CFI = 0.977; RMSEA = 0.032) and explained the most variance in shifting indicators, but rarely converged among 5,000 bootstrapped samples. When the three first-order factors simultaneously predicted the criterion variables, only shifting was uniquely predictive (p measuring executive-related constructs and provide a framework through which clinicians can interpret D-KEFS results.
Directory of Open Access Journals (Sweden)
Mladenović Dragana D.
2016-01-01
Full Text Available In line with the goals of sustainable development and environmental protection today great attention is directed towards new technologies for waste and industrial by-products utilization. Waste products represent potentially good raw material for production other valuable products, such as bioethanol, biogas, biodiesel, organic acids, enzymes, microbial biomass, etc. Since the first industrial production to the present, lactic acid has found wide application in food, cosmetic, pharmaceutical and chemical industries. In recent years, the demand for lactic acid has been increasing considerably owing to its potential use as a monomer for the production of poly-lactic acid (PLA polymers which are biodegradable and biocompatible with wide applications. Waste and industrial by-products such are whey, molasses, stillage, waste starch and lignocellulosic materials are a good source of fermentable sugars and many other substances of great importance for the growth of microorganisms, such as proteins, minerals and vitamins. Utilization of waste products for production of lactic acid could help to reduce the total cost of lactic acid production and except the economic viability of the process offers a solution of their disposal. Fermentation process depends on chemical and physical nature of feedstocks and the lactic acid producer. This review describes the characteristics, abilities and limits of microorganisms involved in lactic acid production, as well as the characteristics and types of waste products for lactic acid production. The fermentation methods that have been recently reported to improve lactic acid production are summarized and compared. In order to improve processes and productivity, fed-batch fermentation, fermentation with immobilized cell systems and mixed cultures and opportunities of open (non-sterilized fermentation have been investigated.
Wang, Dahui; Chen, Feifei; Wei, Gongyuan; Jiang, Min; Dong, Mingsheng
2015-08-20
Batch culture of Aureobasidium pullulans CCTCC M 2012259 for pullulan production at different concentrations of ammonium sulfate and yeast extract was investigated. Increased pullulan production was obtained under nitrogen-limiting conditions, as compared to that without nitrogen limitation. The mechanism of nitrogen limitation favoring to pullulan overproduction was revealed by determining the activity as well as gene expression of key enzymes, and energy supply for pullulan biosynthesis. Results indicated that nitrogen limitation increased the activities of α-phosphoglucose mutase and glucosyltransferase, up-regulated the transcriptional levels of pgm1 and fks genes, and supplied more ATP intracellularly, which were propitious to further pullulan biosynthesis. The economic analysis of batch pullulan production indicated that nitrogen limitation could reduce more than one third of the cost of raw materials when glucose was supplemented to a total concentration of 70 g/L. This study also helps to understand the mechanism of other polysaccharide overproduction by nitrogen limitation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Phytoplankton virus production negatively affected by iron limitation
Directory of Open Access Journals (Sweden)
Hans A Slagter
2016-08-01
Full Text Available Fe-limited monocultures of the ubiquitous algae Micromonas pusilla and Phaeocystis globosa were infected with their respective viruses (MpV and PgV to ascertain the effect of Fe-limitation on phytoplankton host-virus dynamics. The effect of the viral shunt on Fe concentrations and bioavailability is starting to gain attention, since not only is Fe released through lysis, but also its solubility is increased by the simultaneous release of Fe-binding dissolved organic ligands. However, the effect of Fe-limitation on the process of viral lysis itself is poorly understood. In this study fine adjustment of a seawater-based culture medium including the use of ultra-clean trace metal conditions and protocols allowed for Fe-limited growth at nanomolar amounts as opposed to micromolar amounts typically employed in culturing. Viral lysates derived from Fe-limited and Fe-replete (for comparison hosts were cross-inoculated in hosts of both Fe treatments, to judge the quality of the resulting lysate as well as the effect of Fe introduction after initial infection. For both phytoplankton host-virus systems, the virus burst size reduced strongly under Fe stress, i.e. on average 28 ±1% of replete. Moreover, the MpV virus progeny showed highly reduced infectivity of 30±7%, whereas PgV infectivity was not affected. A small addition of Fe to Fe-limited cultures coming from the Fe-replete lysate counteracted the negative effect of Fe-limitation on phytoplankton virus production to some extent (but still half of replete, implying that the physiological history of the host at the moment of infection was an important underlying factor. These results indicate that Fe-limitation has the strong potential to reduce the loss of phytoplankton due to virus infection, thereby affecting the extent of Fe-cycling through the viral shunt. To what extent this affects the contribution of viral lysis-induced organic ligand release needs further study.
DEFF Research Database (Denmark)
Hartig-Andreasen, Charlotte; Nielsen, Torsten G; Lund, Bent
2017-01-01
To identify factors predicting failure after hip arthroscopy in patients with previous periacetabular osteotomy (PAO) defined as a conversion to total hip replacement (THR) and to evaluate the patient reported outcome scores. Of 55 hips treated with hip arthroscopy after PAO from Aug 2008 to 2012....... Nine hips were converted to a THR. Kaplan-Meier survival rate was 52.8% (95% CI, 10%-83.8%) at 6.5 years follow-up. Statistically significant predictors of failure: joint space width after PAO ...% of the hips. In 42% of the hips cartilage lesions of Becks grade >3 were found. Mean mHHS and HOS were 65.7 and 68.8 respectively at follow-up. A NRS pain score of >3 in rest and during activity were present in respectively, 43% and 62% of the patients. Hip arthroscopy after PAO demonstrated limited clinical...
Confidence Limits for the Indirect Effect: Distribution of the Product and Resampling Methods
MacKinnon, David P.; Lockwood, Chondra M.; Williams, Jason
2010-01-01
The most commonly used method to test an indirect effect is to divide the estimate of the indirect effect by its standard error and compare the resulting z statistic with a critical value from the standard normal distribution. Confidence limits for the indirect effect are also typically based on critical values from the standard normal distribution. This article uses a simulation study to demonstrate that confidence limits are imbalanced because the distribution of the indirect effect is normal only in special cases. Two alternatives for improving the performance of confidence limits for the indirect effect are evaluated: (a) a method based on the distribution of the product of two normal random variables, and (b) resampling methods. In Study 1, confidence limits based on the distribution of the product are more accurate than methods based on an assumed normal distribution but confidence limits are still imbalanced. Study 2 demonstrates that more accurate confidence limits are obtained using resampling methods, with the bias-corrected bootstrap the best method overall. PMID:20157642
Exposure-response relationship of regorafenib efficacy in patients with hepatocellular carcinoma.
Solms, Alexander; Reinecke, Isabel; Fiala-Buskies, Sabine; Keunecke, Anne; Drenth, Henk-Jan; Bruix, Jordi; Meinhardt, Gerold; Cleton, Adriaan; Ploeger, Bart
2017-11-15
To explore the relationship between regorafenib exposure and efficacy in patients with hepatocellular carcinoma (HCC) who had disease progression during sorafenib treatment (RESORCE). Exposure-response (ER) analyses for regorafenib were performed using data from a phase 3, randomized, placebo-controlled trial (RESORCE). Patients received 160mg regorafenib or placebo once daily (3weeks on/1week off in a 4-week cycle) with best supportive care until disease progression, death, or unacceptable toxicity. Kaplan-Meier analyses for overall survival (OS) and time-to-progression (TTP) were performed in which regorafenib-treated patients were grouped into four categories according to their estimated average exposure over 4weeks in cycle 1. While this analysis primarily focused on efficacy, a potential correlation between exposure and treatment-emergent adverse events (TEAEs) was also evaluated. If any differences were observed between Kaplan-Meier plots, the ER analysis continued with a multivariate Cox regression analysis to evaluate the correlation between exposure quartile categories and the efficacy and safety parameters while taking into consideration the effect of the predefined clinically relevant demographic and baseline covariates. The functional form of the ER relationship within the regorafenib treatment group was subsequently evaluated. Based on visual assessment of the Kaplan-Meier plots, no meaningful relationship between the exposure categories and TEAEs were observed, although median OS and TTP tended to be longer in the higher exposure categories. Further ER analyses, which considered the effects of predefined covariates and the different shapes of the ER relationship, focused on efficacy. The baseline risk factors Eastern Cooperative Oncology Group (ECOG) performance status ≥1, alpha-fetoprotein levels ≥400ng/ml, and aspartate transaminase or alanine transaminase levels >3×upper limit of normal were significantly associated with OS (Pregorafenib
International Nuclear Information System (INIS)
Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.
2016-01-01
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.
Directory of Open Access Journals (Sweden)
Raúl Vicente Mantilla Quispe
2008-10-01
Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.
Energy Technology Data Exchange (ETDEWEB)
Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)
2016-07-15
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Potential low-level waste disposal limits for activation products from fusion
International Nuclear Information System (INIS)
Kennedy, W.E. Jr.; Peloquin, R.A.
1983-09-01
Hanford Engineering Development Laboratory (HEDL) scientists are involved in studies considering alternative construction materials for the first wall of commercial fusion reactors. To permit a comparison of radioactivity levels, both the level of activation and an acceptable limit for the radionuclides present must be known. Generic material composition guidelines can be developed using the US Nuclear Regulatory Commission (NRC) regulations governing the near-surface disposal of low-level radioactive wastes. These regulations consider wastes defined as containing source, special nuclear, or by-product materials arising from research, industrial, medical, and nuclear fuel-cycle activities. However, not all of the activation products produced in low-level wastes from fusion reactors are considered by the NRC in their regulations. The purpose of this report is to present potential low-level waste-disposal limits for ten radionuclides resulting from fusion reactor operations that are not considered in the NRC low-level waste regulations. These potential limits will be used by HEDL scientists to complete their generic material composition guidelines for the first wall of commercial fusion reactors
Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment
2010-08-01
overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10
Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis
DEFF Research Database (Denmark)
Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene
2017-01-01
characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p
Improve T Cell Therapy in Neuroblastoma
2015-09-01
bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-01-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...
2010-07-01
... the emission limits for tire production affected sources? 63.5985 Section 63.5985 Protection of... Pollutants: Rubber Tire Manufacturing Emission Limits for Tire Production Affected Sources § 63.5985 What are my alternatives for meeting the emission limits for tire production affected sources? You must use...
Enhanced limonene production in cyanobacteria reveals photosynthesis limitations.
Wang, Xin; Liu, Wei; Xin, Changpeng; Zheng, Yi; Cheng, Yanbing; Sun, Su; Li, Runze; Zhu, Xin-Guang; Dai, Susie Y; Rentzepis, Peter M; Yuan, Joshua S
2016-12-13
Terpenes are the major secondary metabolites produced by plants, and have diverse industrial applications as pharmaceuticals, fragrance, solvents, and biofuels. Cyanobacteria are equipped with efficient carbon fixation mechanism, and are ideal cell factories to produce various fuel and chemical products. Past efforts to produce terpenes in photosynthetic organisms have gained only limited success. Here we engineered the cyanobacterium Synechococcus elongatus PCC 7942 to efficiently produce limonene through modeling guided study. Computational modeling of limonene flux in response to photosynthetic output has revealed the downstream terpene synthase as a key metabolic flux-controlling node in the MEP (2-C-methyl-d-erythritol 4-phosphate) pathway-derived terpene biosynthesis. By enhancing the downstream limonene carbon sink, we achieved over 100-fold increase in limonene productivity, in contrast to the marginal increase achieved through stepwise metabolic engineering. The establishment of a strong limonene flux revealed potential synergy between photosynthate output and terpene biosynthesis, leading to enhanced carbon flux into the MEP pathway. Moreover, we show that enhanced limonene flux would lead to NADPH accumulation, and slow down photosynthesis electron flow. Fine-tuning ATP/NADPH toward terpene biosynthesis could be a key parameter to adapt photosynthesis to support biofuel/bioproduct production in cyanobacteria.
78 FR 54755 - Extension of Port Limits of Indianapolis, IN
2013-09-06
... INFORMATION CONTACT: Roger Kaplan, Office of Field Operations, U.S. Customs and Border Protection, by phone at (202) 325- 4543, or by email at Roger.Kaplan@dhs.gov . SUPPLEMENTARY INFORMATION: I. Background In a... area of Indianapolis, Indiana. This is a no-cost administrative measure and CBP will not need...
40 CFR Table 1 to Subpart Xxxx of... - Emission Limits for Tire Production Affected Sources
2010-07-01
... 40 Protection of Environment 12 2010-07-01 2010-07-01 true Emission Limits for Tire Production Affected Sources 1 Table 1 to Subpart XXXX of Part 63 Protection of Environment ENVIRONMENTAL PROTECTION.... 63, Subpt. XXXX, Table 1 Table 1 to Subpart XXXX of Part 63—Emission Limits for Tire Production...
Numerical Investigation of the Flow Structure in a Kaplan Draft Tube at Part Load
Maddahian, R.; Cervantes, M. J.; Sotoudeh, N.
2016-11-01
This research presents numerical simulation of the unsteady flow field inside the draft tube of a Kaplan turbine at part load condition. Due to curvature of streamlines, the ordinary two-equations turbulence models fail to predict the flow features. Therefore, a modification of the Shear Stress Transport (SST-SAS) model is utilized to approximate the turbulent stresses. A guide vane, complete runner and draft tube are considered to insure the real boundary conditions at the draft tube inlet. The outlet boundary is assumed to discharge into the atmosphere. The obtained pressure fluctuations inside the draft tube are in good agreement with available experimental data. In order to further investigate the RVR formation and its movement, the λ2 criterion, relating the position of the vortex core and strength to the second largest Eigen value of the velocity gradient tensor, is employed. The method used for vortex identification shows the flow structure and vortex motion inside the draft tube accurately.
Limits on likesign dilepton production in nu/sub μ/ interactions
International Nuclear Information System (INIS)
Baker, N.J.; Connolly, P.L.; Kahn, S.A.
1985-01-01
We have searched for the production of likesign dilepton events (nu/sub μ/ + Ne → μ - + e - + ...) in a wideband neutrino beam at FNAL using the 15' bubble chamber. We observe no signal above the background arising from conventional sources. We set 90% confidence level upper limits for the production rates of (nu/sub μ/ + Ne → μ - + e - + ...)/(nu/sub μ/ + Ne → μ - + ...) less than or equal to 8 * 10 -5 and (nu/sub μ/ + Ne → μ - + e - + ...)/(nu/sub μ/ + Ne → μ - + e + + ...) less than or equal to 6 * 10 -2
Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei
2017-04-01
The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.
Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G
2006-10-01
Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
International Nuclear Information System (INIS)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao
2017-01-01
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto
2017-06-01
Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.
Stent placement with the monorail technique for treatment of mesenteric artery stenosis.
Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan
2006-04-01
To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.
Circulating cell death products predict clinical outcome of colorectal cancer patients
International Nuclear Information System (INIS)
Koelink, Pim J; Lamers, Cornelis BHW; Hommes, Daan W; Verspaget, Hein W
2009-01-01
Tumor cell death generates products that can be measured in the circulation of cancer patients. CK18-Asp396 (M30 antigen) is a caspase-degraded product of cytokeratin 18 (CK18), produced by apoptotic epithelial cells, and is elevated in breast and lung cancer patients. We determined the CK18-Asp396 and total CK18 levels in plasma of 49 colorectal cancer patients, before and after surgical resection of the tumor, by ELISA. Correlations with patient and tumor characteristics were determined by Kruskal-Wallis H and Mann-Whitney U tests. Disease-free survival was determined using Kaplan-Meier methodology with Log Rank tests, and univariate and multivariate Cox proportional hazard analysis. Plasma CK18-Asp396 and total CK18 levels in colorectal cancer patients were related to disease stage and tumor diameter, and were predictive of disease-free survival, independent of disease-stage, with hazard ratios (HR) of patients with high levels (> median) compared to those with low levels (≤ median) of 3.58 (95% CI: 1.17–11.02) and 3.58 (95% CI: 0.97–7.71), respectively. The CK18-Asp396/CK18 ratio, which decreased with tumor progression, was also predictive of disease-free survival, with a low ratio (≤ median) associated with worse disease-free survival: HR 2.78 (95% CI: 1.06–7.19). Remarkably, the plasma CK18-Asp396 and total CK18 levels after surgical removal of the tumor were also predictive of disease-free survival, with patients with high levels having a HR of 3.78 (95% CI: 0.77–18.50) and 4.12 (95% CI: 0.84–20.34), respectively, indicating that these parameters can be used also to monitor patients after surgery. CK18-Asp396 and total CK18 levels in the circulation of colorectal cancer patients are predictive of tumor progression and prognosis and might be helpful for treatment selection and monitoring of these patients
Dave, Anushree
2017-12-01
This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.
Mount, David W; Putnam, Charles W; Centouri, Sara M; Manziello, Ann M; Pandey, Ritu; Garland, Linda L; Martinez, Jesse D
2014-06-10
Numerous microarray-based prognostic gene expression signatures of primary neoplasms have been published but often with little concurrence between studies, thus limiting their clinical utility. We describe a methodology using logistic regression, which circumvents limitations of conventional Kaplan Meier analysis. We applied this approach to a thrice-analyzed and published squamous cell carcinoma (SQCC) of the lung data set, with the objective of identifying gene expressions predictive of early death versus long survival in early-stage disease. A similar analysis was applied to a data set of triple negative breast carcinoma cases, which present similar clinical challenges. Important to our approach is the selection of homogenous patient groups for comparison. In the lung study, we selected two groups (including only stages I and II), equal in size, of earliest deaths and longest survivors. Genes varying at least four-fold were tested by logistic regression for accuracy of prediction (area under a ROC plot). The gene list was refined by applying two sliding-window analyses and by validations using a leave-one-out approach and model building with validation subsets. In the breast study, a similar logistic regression analysis was used after selecting appropriate cases for comparison. A total of 8594 variable genes were tested for accuracy in predicting earliest deaths versus longest survivors in SQCC. After applying the two sliding window and the leave-one-out analyses, 24 prognostic genes were identified; most of them were B-cell related. When the same data set of stage I and II cases was analyzed using a conventional Kaplan Meier (KM) approach, we identified fewer immune-related genes among the most statistically significant hits; when stage III cases were included, most of the prognostic genes were missed. Interestingly, logistic regression analysis of the breast cancer data set identified many immune-related genes predictive of clinical outcome. Stratification of
International Nuclear Information System (INIS)
Aziz, M.J.; Boettinger, W.J.
1994-01-01
Short-range diffusion-limited growth, collision-limited growth, and the transition between the two regimes are explained as natural consequences of a single model for the kinetics of alloy solidification. Analytical expressions are developed for the velocity-undercooling function of a planar interface during dilute alloy solidification, using Turnbull's collision-limited growth model and the Continuous Growth Solute Trapping Model of Aziz and Kaplan both with and without a solute drag effect. The interface mobility, -dv/dT, is shown to be very high (proportional to the speed of sound) if the alloy is sufficiently dilute or if the growth rate is sufficiently rapid for nearly complete solute trapping. The interface mobility is reduced by the three orders of magnitude (becoming proportional to the diffusive speed) at intermediate growth rates where partial solute trapping occurs. Differences in low velocity predictions of the models with and without solute drag are also discussed. Comparison of the results of the analytical expressions to numerical solutions of the non-dilute kinetic model for Al-Be alloys shows that the dilute approximation breaks down at melt compositions on the order of 10 at.%. Similar variations in the interface mobility are shown for the disorder-trapping model of Boettinger and Aziz
Directory of Open Access Journals (Sweden)
Zoltan-Iosif Korka
2016-10-01
Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.
A population-based study of survival and discharge status for survivors after head injury
DEFF Research Database (Denmark)
Engberg, Aase Worså; Teasdale, T W
2004-01-01
and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score
Molecular genetics analysis of hereditary breast and ovarian cancer patients in India
Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan
2009-01-01
Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Syncytin immunoreactivity in colorectal cancer
DEFF Research Database (Denmark)
Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen
2009-01-01
monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....
Exploring the Limits of Crop Productivity: High Light Studies with Lettuce
USU Crop Physiology Lab
2015-01-01
There are many different leaf lettuce cultivars and they range in color from light green and yellow to deep green as a result of higher concentrations of chlorophyll in the leaves. We tested four cultivars in high light to explore the limits of lettuce productivity.
Sato, Hiroki; Orishimo, Keita; Shirai, Tomokazu; Hirasawa, Takashi; Nagahisa, Keisuke; Shimizu, Hiroshi; Wachi, Masaaki
2008-07-01
Corynebacterium glutamicum is a biotin auxotrophic bacterium in which glutamate production is induced under biotin-limited conditions. During glutamate production, anaplerotic reactions catalyzed by phosphoenolpyruvate carboxylase (PEPC) and a biotin-containing enzyme pyruvate carboxylase (PC) are believed to play an important role in supplying oxaloacetate in the tricarboxylic acid cycle. To understand the distinct roles of PEPC and PC on glutamate production by C. glutamicum, we observed glutamate production induced under biotin-limited conditions in the disruptants of the genes encoding PEPC (ppc) and PC (pyc), respectively. The pyc disruptant retained the ability to produce high amounts of glutamate, and lactate was simultaneously produced probably due to the increased intracellular pyruvate levels. On the other hand, the ppc knockout mutant could not produce glutamate. Additionally, glutamate production in the pyc disruptant was enhanced by overexpression of ppc rather than disruption of the lactate dehydrogenase gene (ldh), which is involved in lactate production. Metabolic flux analysis based on the 13C-labeling experiment and measurement of 13C-enrichment in glutamate using nuclear magnetic resonance spectroscopy revealed that the flux for anaplerotic reactions in the pyc disruptant was lower than that in the wild type, concomitantly increasing the flux for lactate formation. Moreover, overexpression of ppc increased this flux in both the pyc disruptant and the wild type. Our results suggest that the PEPC-catalyzed anaplerotic reaction is necessary for glutamate production induced under biotin-limited conditions, because PC is not active during glutamate production, and overexpression of ppc effectively enhances glutamate production under biotin-limited conditions.
DEFF Research Database (Denmark)
Brasso, Klaus; Thomsen, Frederik B; Schrader, Andres J
2015-01-01
prostate-specific antigen (PSA) kinetics, patient characteristics, and progression-free survival, respectively. Kaplan-Meier survival analysis and Cox proportional hazard analysis were performed. RESULTS AND LIMITATIONS: We identified 137 patients who prior to enzalutamide had progressed following a median...... of eight cycles of docetaxel and seven courses of abiraterone. The median time on enzalutamide was 3.2 mo; median OS from the time patients started enzalutamide was 8.3 mo (95% confidence interval, 6.8-9.8). Only 45 (38%) and 22 (18%) patients had PSA declines (unconfirmed) >30% and 50%, respectively....... Patients who had more than 30% or 50% falls in PSA had improved survival compared with patients who had no such PSA fall (11.4 mo vs 7.1 mo; p=0.001 and 12.6 vs 7.4 mo; p=0.007, respectively). Poor performance status and low haemoglobin was negatively associated with OS. CONCLUSIONS: Median OS...
2010-07-01
... compliance with the emission limits for tire production affected sources? 63.6004 Section 63.6004 Protection... Pollutants: Rubber Tire Manufacturing Continuous Compliance Requirements for Tire Production Affected Sources § 63.6004 How do I demonstrate continuous compliance with the emission limits for tire production...
Nordström, Tobias; Bratt, Ola; Örtegren, Joakim; Aly, Markus; Adolfsson, Jan; Grönberg, Henrik
2016-01-01
The aim of this study was to determine whether educational length affects prostate-specific antigen (PSA) testing and the time to prostate biopsy for men with raised PSA values. Using register data on all men in Stockholm County in 2013 (n = 1,052,841), the limited-duration point prevalence of PSA testing and time between test and prostate biopsy or repeat testing were analysed. Patterns of follow-up were assessed using Kaplan-Meier product limit estimators and Cox proportional hazard models. Educational length was categorized as short (≤ 9 years), intermediate (10-12 years) or long (≥ 13 years). PSA testing increased with educational length in all age groups. Among men aged 50-69 years, 61% with long and 54% with short education had had a PSA test within the preceding 10 years (p prostate biopsy within 12 months. After adjusting for PSA level and age, educational length was still associated with the chance of having a prostate biopsy in men with PSA 4-10 ng/ml (hazard ratio 1.22, 95% CI 1.12-1.31), but not in men with higher PSA values. PSA testing increased with educational length. Men with long education were more likely to have a prostate biopsy after an increased PSA value below 10 ng/ml than men with short education. These differences may contribute to the worse prostate cancer outcomes observed among men with lower socioeconomic status.
International Nuclear Information System (INIS)
Shirvani, Shervin M.; Komaki, Ritsuko; Heymach, John V.; Fossella, Frank V.; Chang, Joe Y.
2012-01-01
Purpose: Omitting elective nodal irradiation from planning target volumes does not compromise outcomes in patients with non–small-cell lung cancer, but whether the same is true for those with limited-stage small-cell lung cancer (LS-SCLC) is unknown. Therefore, in the present study, we sought to determine the clinical outcomes and the frequency of elective nodal failure in patients with LS-SCLC staged using positron emission tomography/computed tomography and treated with involved-field intensity-modulated radiotherapy. Methods and Materials: Between 2005 and 2008, 60 patients with LS-SCLC at our institution underwent disease staging using positron emission tomography/computed tomography before treatment using an intensity-modulated radiotherapy plan in which elective nodal irradiation was intentionally omitted from the planning target volume (mode and median dose, 45 Gy in 30 fractions; range, 40.5 Gy in 27 fractions to 63.8 Gy in 35 fractions). In most cases, concurrent platinum-based chemotherapy was administered. We retrospectively reviewed the clinical outcomes to determine the overall survival, relapse-free survival, and failure patterns. Elective nodal failure was defined as recurrence in initially uninvolved hilar, mediastinal, or supraclavicular nodes. Survival was assessed using the Kaplan-Meier method. Results: The median age of the study patients at diagnosis was 63 years (range, 39–86). The median follow-up duration was 21 months (range, 4–58) in all patients and 26 months (range, 4–58) in the survivors. The 2-year actuarial overall survival and relapse-free survival rate were 58% and 43%, respectively. Of the 30 patients with recurrence, 23 had metastatic disease and 7 had locoregional failure. We observed only one isolated elective nodal failure. Conclusions: To our knowledge, this is the first study to examine the outcomes in patients with LS-SCLC staged with positron emission tomography/computed tomography and treated with definitive
Energy Technology Data Exchange (ETDEWEB)
Shirvani, Shervin M.; Komaki, Ritsuko [Department of Radiation Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States); Heymach, John V.; Fossella, Frank V. [Department of Thoracic/Head and Neck Medical Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States); Chang, Joe Y., E-mail: jychang@mdanderson.org [Department of Radiation Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX (United States)
2012-01-01
Purpose: Omitting elective nodal irradiation from planning target volumes does not compromise outcomes in patients with non-small-cell lung cancer, but whether the same is true for those with limited-stage small-cell lung cancer (LS-SCLC) is unknown. Therefore, in the present study, we sought to determine the clinical outcomes and the frequency of elective nodal failure in patients with LS-SCLC staged using positron emission tomography/computed tomography and treated with involved-field intensity-modulated radiotherapy. Methods and Materials: Between 2005 and 2008, 60 patients with LS-SCLC at our institution underwent disease staging using positron emission tomography/computed tomography before treatment using an intensity-modulated radiotherapy plan in which elective nodal irradiation was intentionally omitted from the planning target volume (mode and median dose, 45 Gy in 30 fractions; range, 40.5 Gy in 27 fractions to 63.8 Gy in 35 fractions). In most cases, concurrent platinum-based chemotherapy was administered. We retrospectively reviewed the clinical outcomes to determine the overall survival, relapse-free survival, and failure patterns. Elective nodal failure was defined as recurrence in initially uninvolved hilar, mediastinal, or supraclavicular nodes. Survival was assessed using the Kaplan-Meier method. Results: The median age of the study patients at diagnosis was 63 years (range, 39-86). The median follow-up duration was 21 months (range, 4-58) in all patients and 26 months (range, 4-58) in the survivors. The 2-year actuarial overall survival and relapse-free survival rate were 58% and 43%, respectively. Of the 30 patients with recurrence, 23 had metastatic disease and 7 had locoregional failure. We observed only one isolated elective nodal failure. Conclusions: To our knowledge, this is the first study to examine the outcomes in patients with LS-SCLC staged with positron emission tomography/computed tomography and treated with definitive intensity
Wan, Xiaomin; Peng, Liubao; Li, Yuanjian
2015-01-01
In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.
Sayers, Adrian; Crowther, Michael J; Judge, Andrew; Whitehouse, Michael R; Blom, Ashley W
2017-08-28
The use of benchmarks to assess the performance of implants such as those used in arthroplasty surgery is a widespread practice. It provides surgeons, patients and regulatory authorities with the reassurance that implants used are safe and effective. However, it is not currently clear how or how many implants should be statistically compared with a benchmark to assess whether or not that implant is superior, equivalent, non-inferior or inferior to the performance benchmark of interest.We aim to describe the methods and sample size required to conduct a one-sample non-inferiority study of a medical device for the purposes of benchmarking. Simulation study. Simulation study of a national register of medical devices. We simulated data, with and without a non-informative competing risk, to represent an arthroplasty population and describe three methods of analysis (z-test, 1-Kaplan-Meier and competing risks) commonly used in surgical research. We evaluate the performance of each method using power, bias, root-mean-square error, coverage and CI width. 1-Kaplan-Meier provides an unbiased estimate of implant net failure, which can be used to assess if a surgical device is non-inferior to an external benchmark. Small non-inferiority margins require significantly more individuals to be at risk compared with current benchmarking standards. A non-inferiority testing paradigm provides a useful framework for determining if an implant meets the required performance defined by an external benchmark. Current contemporary benchmarking standards have limited power to detect non-inferiority, and substantially larger samples sizes, in excess of 3200 procedures, are required to achieve a power greater than 60%. It is clear when benchmarking implant performance, net failure estimated using 1-KM is preferential to crude failure estimated by competing risk models. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No
Diekmann, Theresa; Schrems-Hoesl, Laura M; Mardin, Christian Y; Laemmer, Robert; Horn, Folkert K; Kruse, Friedrich E; Schrems, Wolfgang A
2018-02-01
The purpose of this study was to compare the ability of scanning laser polarimetry (SLP) and spectral-domain optical coherence tomography (SD-OCT) to predict future visual field conversion of subjects with ocular hypertension and early glaucoma. All patients were recruited from the Erlangen glaucoma registry and examined using standard automated perimetry, 24-hour intraocular pressure profile, and optic disc photography. Peripapillary retinal nerve fiber layer thickness (RNFL) measurements were obtained by SLP (GDx-VCC) and SD-OCT (Spectralis OCT). Positive and negative predictive values (PPV, NPV) were calculated for morphologic parameters of SLP and SD-OCT. Kaplan-Meier survival curves were plotted and log-rank tests were performed to compare the survival distributions. Contingency tables and Venn-diagrams were calculated to compare the predictive ability. The study included 207 patients-75 with ocular hypertension, 85 with early glaucoma, and 47 controls. Median follow-up was 4.5 years. A total of 29 patients (14.0%) developed visual field conversion during follow-up. SLP temporal-inferior RNFL [0.667; 95% confidence interval (CI), 0.281-0.935] and SD-OCT temporal-inferior RNFL (0.571; 95% CI, 0.317-0.802) achieved the highest PPV; nerve fiber indicator (0.923; 95% CI, 0.876-0.957) and SD-OCT mean (0.898; 95% CI, 0.847-0.937) achieved the highest NPV of all investigated parameters. The Kaplan-Meier curves confirmed significantly higher survival for subjects within normal limits of measurements of both devices (P<0.001). Venn diagrams tested with McNemar test statistics showed no significant difference for PPV (P=0.219) or NPV (P=0.678). Both GDx-VCC and SD-OCT demonstrate comparable results in predicting future visual field conversion if taking typical scans for GDx-VCC. In addition, the likelihood ratios suggest that GDx-VCC's nerve fiber indicator<30 may be the most useful parameter to confirm future nonconversion. (http://www.ClinicalTrials.gov number, NTC
The long-term outcomes of epilepsy surgery
Keller, Simon; Nicolson, Andrew; Biswas, Shubhabrata; Smith, David; Osman Farah, Jibril; Eldridge, Paul; Wieshmann, Udo
2018-01-01
Objective Despite modern anti-epileptic drug treatment, approximately 30% of epilepsies remain medically refractory and for these patients, epilepsy surgery may be a treatment option. There have been numerous studies demonstrating good outcome of epilepsy surgery in the short to median term however, there are a limited number of studies looking at the long-term outcomes. The aim of this study was to ascertain the long-term outcome of resective epilepsy surgery in a large neurosurgery hospital in the U.K. Methods This a retrospective analysis of prospectively collected data. We used the 2001 International League Against Epilepsy (ILAE) classification system to classify seizure freedom and Kaplan-Meier survival analysis to estimate the probability of seizure freedom. Results We included 284 patients who underwent epilepsy surgery (178 anterior temporal lobe resections, 37 selective amygdalohippocampectomies, 33 temporal lesionectomies, 36 extratemporal lesionectomies), and had a prospective median follow-up of 5 years (range 1–27). Kaplan-Meier estimates showed that 47% (95% CI 40–58) remained seizure free (apart from simple partial seizures) at 5 years and 38% (95% CI 31–45) at 10 years after surgery. 74% (95% CI 69–80) had a greater than 50% seizure reduction at 5 years and 70% (95% CI 64–77) at 10 years. Patients who had an amygdalohippocampectomy were more likely to have seizure recurrence than patients who had an anterior temporal lobe resection (p = 0.006) and temporal lesionectomy (p = 0.029). There was no significant difference between extra temporal and temporal lesionectomies. Hippocampal sclerosis was associated with a good outcome but declined in relative frequency over the years. Conclusion The vast majority of patients who were not seizure free experienced at least a substantial and long-lasting reduction in seizure frequency. A positive long-term outcome after epilepsy surgery is possible for many patients and especially those with
Susan L. Eggert; J. Bruce Wallace
2003-01-01
Leaf inputs in temperate forest streams may limit caddisfly production because leaf detritus serves both as a food and case-material resource. We estimated Pycnopsyche gentilis produdion in a stream experimentally decoupled fmm its riparian habitat and a reference stream for 8 y in the southern Appalachians. We also examined laboratory survivorship,...
Immunological effects of Sizofiran (SPG) combined with irradiation in patients with oral cancer
International Nuclear Information System (INIS)
Tominaga, Kazuhiro; Tominaga, Naohiro; Tokuhisa, Michio
1995-01-01
Effects of Sizofiran (SPG) combined with irradiation for primary oral squamous cell carcinoma were evaluated with regard to cell-mediated immunity. Twenty-four patients, who were managed with irradiation from 1989 to 1993, were divided into two groups, a SPG group and a control group. Thirteen patients received concomitant administration of SPG intramuscularly with irradiation as SPG group, and 11 patients were not administered any biological response modifiers as the control group. In the SPG group, depression of blastoid transformation of lymphocytes, IL-2 production and LAK activity due to irradiation were prevented, and recovery of blastoid transformation was promoted, while peripheral monocytes tended to increase. Upon comparison for survival (Kaplan-Meier method) between the SPG group and control group, the survival rate of the SPG group tended to be superior to that of the control group. However, no significant difference was observed between them. (author)
Prognostic role of syncytin expression in breast cancer
DEFF Research Database (Denmark)
Larsson, Lars-Inge; Holck, Susanne; Christensen, Ib Jarle
2007-01-01
Breast cancer cells were recently found to produce syncytin, an endogenous retroviral protein implicated in cell fusion, immune regulation, and nitric oxide synthase expression. To determine whether syncytin has a prognostic role in breast cancer, we investigated a series of 165 premenopausal lymph...... node-negative women for syncytin expression using an immunocytochemical scoring system. Results were analyzed with the Kaplan-Meier method and with the Cox proportional hazard model. Syncytin expression was observed in 38% of the patients, and the degree of syncytin expression constituted a positive...
Association of versican turnover with all-cause mortality in patients on haemodialysis
DEFF Research Database (Denmark)
Genovese, Federica; Karsdal, Morten A; Leeming, Diana J
2014-01-01
with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...
DEFF Research Database (Denmark)
Schnack, Tine H; Sørensen, Rie D; Nedergaard, Lotte
2014-01-01
OBJECTIVES: Invasive serous adenocarcinomas may present as primary ovarian (POC), primary fallopian tube (PFC) or primary peritoneal (PPC) carcinomas. Whether they are variants of the same malignancy or develop through different pathways is debated. METHODS: Population-based prospectively collected...... data on POC (n=1443), PPC (n=268) and PFC (n=171) cases was obtained from the Danish Gynecological Cancer Database (2005-2013). Chi-square, Fisher's or Wilcoxon-Mann-Whitney test, multivariate logistic regression, Kaplan-Meier and multivariate Cox-regression were used as appropriate. Statistical tests...
Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming
2016-11-01
Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard-Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200-440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ˜ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.
Energy Technology Data Exchange (ETDEWEB)
Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming, E-mail: bmcheng@nsrrc.org.tw [National Synchrotron Radiation Research Center, No. 101, Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China)
2016-11-20
Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.
International Nuclear Information System (INIS)
Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming
2016-01-01
Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.
Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication.
Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin; de Boer, Hugo
2018-03-01
Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono-substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry-based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence-based identification are necessary before DNA-based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd.
40 CFR 63.8055 - How do I comply with a weight percent HAP limit in coating products?
2010-07-01
... HAP limit in coating products? 63.8055 Section 63.8055 Protection of Environment ENVIRONMENTAL...: Miscellaneous Coating Manufacturing Alternative Means of Compliance § 63.8055 How do I comply with a weight percent HAP limit in coating products? (a) As an alternative to complying with the requirements in Table 1...
Directory of Open Access Journals (Sweden)
Enqing Hou
Full Text Available Nitrogen (N is considered the dominant limiting nutrient in temperate regions, while phosphorus (P limitation frequently occurs in tropical regions, but in subtropical regions nutrient limitation is poorly understood. In this study, we investigated N and P contents and N:P ratios of foliage, forest floors, fine roots and mineral soils, and their relationships with community biomass, litterfall C, N and P productions, forest floor turnover rate, and microbial processes in eight mature and old-growth subtropical forests (stand age >80 yr at Dinghushan Biosphere Reserve, China. Average N:P ratios (mass based in foliage, litter (L layer and mixture of fermentation and humus (F/H layer, and fine roots were 28.3, 42.3, 32.0 and 32.7, respectively. These values are higher than the critical N:P ratios for P limitation proposed (16-20 for foliage, ca. 25 for forest floors. The markedly high N:P ratios were mainly attributed to the high N concentrations of these plant materials. Community biomass, litterfall C, N and P productions, forest floor turnover rate and microbial properties were more strongly related to measures of P than N and frequently negatively related to the N:P ratios, suggesting a significant role of P availability in determining ecosystem production and productivity and nutrient cycling at all the study sites except for one prescribed disturbed site where N availability may also be important. We propose that N enrichment is probably a significant driver of the potential P limitation in the study area. Low P parent material may also contribute to the potential P limitation. In general, our results provided strong evidence supporting a significant role for P availability, rather than N availability, in determining ecosystem primary productivity and ecosystem processes in subtropical forests of China.
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus
2009-01-01
In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778
Directory of Open Access Journals (Sweden)
Marisa Aparecida Amaro Malvestio
2008-08-01
Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized
2010-01-01
... 101 of the Consumer Product Safety Improvement Act for certain electronic devices. 1500.88 Section... from lead limits under section 101 of the Consumer Product Safety Improvement Act for certain electronic devices. (a) The Consumer Product Safety Improvement Act (CPSIA) provides for specific lead limits...
Production of fungal alpha-amylase by Saccharomyces kluyveri in glucose-limited cultivations
DEFF Research Database (Denmark)
Møller, Kasper; Sharif, M.Z.; Olsson, Lisbeth
2004-01-01
Heterologous protein production by the yeast Saccharomyces kluyveri was investigated under aerobic glucose-limited conditions. alpha-Amylase from Aspergillus oryzae was used as model protein and the gene was expressed from a S. cerevisiae 2 mu plasmid. For comparison, strains of both S. kluyveri ...
Comparison of colorectal and gastric cancer: Survival and prognostic factors
International Nuclear Information System (INIS)
Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R
2009-01-01
Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)
Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V
2016-01-01
To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.
Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin
2016-01-01
Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.
Song, Kyung-Jin; Choi, Byung-Wan; Kim, Jong-Kil
2014-12-01
Retrospective study. To analyze the incidence and prevalence of clinical adjacent segment pathology (CASP) following anterior decompression and fusion with cage and plate augmentation for degenerative cervical diseases. No long-term data on the use of cage and plate augmentation have been reported. The study population consisted of 231 patients who underwent anterior cervical discectomy and fusion (ACDF) with cage and plate for degenerative cervical spinal disease. The incidence and prevalence of CASP was determined by using the Kaplan-Meier survival analysis. To analyze the factors that influence CASP, data on preoperative and postoperative sagittal alignment, spinal canal diameter, the distance between the plate and adjacent disc, extent of fusion level, and the presence or absence of adjacent segment degenerative changes by imaging studies were evaluated. CASP occurred in 15 of the cases, of which 9 required additional surgery. At 8-year follow-up, the average yearly incidence was 1.1%. The rate of disease-free survival based on Kaplan-Meier survival analysis was 93.6% at 5 years and 90.2% at 8 years. No statistically significant differences in CASP incidence based on radiological analysis were observed. Significantly high incidence of CASP was observed in the presence of increased adjacent segment degenerative changes (pdegenerative cervical disease is associated with a lower incidence in CSAP by 1.1% per year, and the extent of preoperative adjacent segment degenerative changes has been shown as a risk factor for CASP.
Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming
2015-12-01
Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
Energy Technology Data Exchange (ETDEWEB)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)
2017-03-15
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
High Rab27A expression indicates favorable prognosis in CRC.
Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng
2015-06-13
Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.
Ti, Lianping; Richardson, Lindsey; DeBeck, Kora; Nguyen, Paul; Montaner, Julio; Wood, Evan; Kerr, Thomas
2014-08-01
Despite the growing prevalence of illicit stimulant drug use internationally, and the widespread involvement of people who inject drugs (IDU) within street-based drug markets, little is known about the impact of different types of street-based income generation activities on the cessation of stimulant use among IDU. Data were derived from an open prospective cohort of IDU in Vancouver, Canada. We used Kaplan-Meier methods and Cox proportional hazards regression to examine the effect of different types of street-based income generation activities (e.g., sex work, drug dealing, and scavenging) on time to cessation of stimulant use. Between December, 2005 and November, 2012, 887 IDU who use stimulant drugs (cocaine, crack cocaine, or crystal methamphetamine) were prospectively followed-up for a median duration of 47 months. In Kaplan-Meier analyses, compared to those who did not engage in street-based income generation activities, participants who reported sex work, drug dealing, scavenging, or more than one of these activities were significantly less likely to report stimulant drug use cessation (all pstreet-based income generation activity remained significantly associated with a slower time to stimulant drug cessation (all p<0.005). Our findings highlight the urgent need for strategies to address stimulant dependence, including novel pharmacotherapies. Also important, structural interventions, such as low-threshold employment opportunities, availability of supportive housing, legal reforms regarding drug use, and evidence-based approaches that reduce harm among IDU are urgently required. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Phosphorus-32 therapy for cystic craniopharyngiomas
International Nuclear Information System (INIS)
Barriger, Robert Bryan; Chang, Andrew; Lo, Simon S.; Timmerman, Robert D.; DesRosiers, Colleen; Boaz, Joel C.; Fakiris, Achilles J.
2011-01-01
Background and purpose: To examine control rates for predominantly cystic craniopharyngiomas treated with intracavitary phosphorus-32 (P-32). Material and methods: 22 patients with predominantly cystic craniopharyngiomas were treated at Indiana University between October 1997 and December 2006. Nineteen patients with follow-up of at least 6 months were evaluated. The median patient age was 11 years, median cyst volume was 9 ml, a median dose of 300 Gy was prescribed to the cyst wall, and median follow-up was 62 months. Results: Overall cyst control rate after the initial P-32 treatment was 67%. Complete tumor control after P-32 was 42%. Kaplan-Meier 1-, 3-, and 5-year initial freedom-from-progression rates were 68%, 49%, and 31%, respectively. Following salvage therapy, the Kaplan-Meier 1-, 3-, and 5-year ultimate freedom-from-progression rates were 95%, 95%, and 86%, respectively. All patients were alive at the last follow-up. Visual function was stable or improved in 81% when compared prior to P-32 therapy. Pituitary function remained stable in 74% of patients following P-32 therapy. Conclusions: Intracystic P-32 can be an effective and tolerable treatment for controlling cystic components of craniopharyngiomas as a primary treatment or after prior therapies, but frequently allows for progression of solid tumor components. Disease progression in the form of solid tumor progression, re-accumulation of cystic fluid, or development of new cysts may require further radiotherapy or surgical intervention for optimal long-term disease control.
Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng
2017-05-23
BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.
An electronic health record-enabled obesity database
Directory of Open Access Journals (Sweden)
Wood G
2012-05-01
Full Text Available Abstract Background The effectiveness of weight loss therapies is commonly measured using body mass index and other obesity-related variables. Although these data are often stored in electronic health records (EHRs and potentially very accessible, few studies on obesity and weight loss have used data derived from EHRs. We developed processes for obtaining data from the EHR in order to construct a database on patients undergoing Roux-en-Y gastric bypass (RYGB surgery. Methods Clinical data obtained as part of standard of care in a bariatric surgery program at an integrated health delivery system were extracted from the EHR and deposited into a data warehouse. Data files were extracted, cleaned, and stored in research datasets. To illustrate the utility of the data, Kaplan-Meier analysis was used to estimate length of post-operative follow-up. Results Demographic, laboratory, medication, co-morbidity, and survey data were obtained from 2028 patients who had undergone RYGB at the same institution since 2004. Pre-and post-operative diagnostic and prescribing information were available on all patients, while survey laboratory data were available on a majority of patients. The number of patients with post-operative laboratory test results varied by test. Based on Kaplan-Meier estimates, over 74% of patients had post-operative weight data available at 4 years. Conclusion A variety of EHR-derived data related to obesity can be efficiently obtained and used to study important outcomes following RYGB.
Directory of Open Access Journals (Sweden)
Dong-dong Cheng
2015-07-01
Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.
Factors affecting commencement and cessation of smoking behaviour in Malaysian adults
Directory of Open Access Journals (Sweden)
Ghani Wan
2012-03-01
Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.
Roy, Laurent-Olivier; Poirier, Marie-Belle; Fortin, David
2018-04-08
Glioblastoma (GBM) represents the most common and aggressive malignant primary brain tumors in adults. Response to standard treatment is transitory and the survival of clinical trial cohorts are little more than 14 months. GBM are characterized by excessive proliferation, invasiveness, and radio-/chemoresistance features; which are strongly upregulated by transforming growth factor-beta (TGF-β). We hypothesized that TGF-β gene expression could correlate with overall survival (OS) and serve as a prognostic biomarker. TGF-β₁ and -β₂ expression were analyzed by qPCR in 159 GBM tumor specimens. Kaplan-Meier and multivariate analyses were used to correlate expression with OS and progression-free survival (PFS). In GBM, TGF-β₁ and -β₂ levels were 33- and 11-fold higher respectively than in non-tumoral samples. Kaplan-Meier and multivariate analyses revealed that high to moderate expressions of TGF-β₁ significantly conferred a strikingly poorer OS and PFS in newly diagnosed patients. Interestingly, at relapse, neither isoforms had meaningful impact on clinical evolution. We demonstrate that TGF-β₁ is the dominant isoform in newly diagnosed GBM rather than the previously acknowledged TGF-β₂. We believe our study is the first to unveil a significant relationship between TGF-β₁ expression and OS or PFS in newly diagnosed GBM. TGF-β₁ could serve as a prognostic biomarker or target affecting treatment planning and patient follow-up.
Directory of Open Access Journals (Sweden)
Køber Lars
2010-01-01
Full Text Available Abstract Background The optimal duration of clopidogrel treatment after percutaneous coronary intervention (PCI is unclear. We studied the risk of death or recurrent myocardial infarction (MI in relation to 6- and 12-months clopidogrel treatment among MI patients treated with PCI. Methods Using nationwide registers of hospitalizations and drug dispensing from pharmacies we identified 11 680 patients admitted with MI, treated with PCI and clopidogrel. Clopidogrel treatment was categorized in a 6-months and a 12-months regimen. Rates of death, recurrent MI or a combination of both were analyzed by the Kaplan Meier method and Cox proportional hazards models. Bleedings were compared between treatment regimens. Results The Kaplan Meier analysis indicated no benefit of the 12-months regimen compared with the 6-months in all endpoints. The Cox proportional hazards analysis confirmed these findings with hazard ratios for the 12-months regimen (the 6-months regimen used as reference for the composite endpoint of 1.01 (confidence intervals 0.81-1.26 and 1.24 (confidence intervals 0.95-1.62 for Day 0-179 and Day 180-540 after discharge. Bleedings occurred in 3.5% and 4.1% of the patients in the 6-months and 12-months regimen (p = 0.06. Conclusions We found comparable rates of death and recurrent MI in patients treated with 6- and 12-months' clopidogrel. The potential benefit of prolonged clopidogrel treatment in a real-life setting remains uncertain.
Schoepfer, Shane D.; Algeo, Thomas J.; Ward, Peter D.; Williford, Kenneth H.; Haggart, James W.
2016-10-01
The end-Triassic mass extinction has been characterized as a 'greenhouse extinction', related to rapid atmospheric warming and associated changes in ocean circulation and oxygenation. The response of the marine nitrogen cycle to these oceanographic changes, and the extent to which mass extinction intervals represent a deviation in nitrogen cycling from other ice-free 'greenhouse' periods of Earth history, remain poorly understood. The well-studied Kennecott Point section in Haida Gwaii, British Columbia, Canada, was deposited in the open Panthalassic Ocean, and is used here as a test case to better understand changes in the nitrogen cycle and marine productivity from the pre-crisis greenhouse of the Rhaetian to the latest-Rhaetian crisis interval. We estimated marine productivity from the late Norian to the early Hettangian using TOC- and P-based paleoproductivity transform equations, and then compared these estimates to records of sedimentary nitrogen isotopes, redox-sensitive trace elements, and biomarker data. Major negative excursions in δ15N (to ≤ 0 ‰) correspond to periods of depressed marine productivity. During these episodes, the development of a stable pycnocline below the base of the photic zone suppressed vertical mixing and limited N availability in surface waters, leading to low productivity and increased nitrogen fixation, as well as ecological stresses in the photic zone. The subsequent shoaling of euxinic waters into the ocean surface layer was fatal for most Triassic marine fauna, although the introduction of regenerated NH4+ into the photic zone may have allowed phytoplankton productivity to recover. These results indicate that the open-ocean nitrogen cycle was influenced by climatic changes during the latest Triassic, despite having existed in a greenhouse state for over 50 million years previously, and that low N availability limited marine productivity for hundreds of thousands of years during the end-Triassic crisis.
International Nuclear Information System (INIS)
Espinosa Ramirez, M.; Garza Cedillo, R.; Andrade limas, E.; Belmonte Serrato, F.
2009-01-01
The limiting factors in agricultural production, defined as those properties and characteristics of the geographical environment that influence the development of crops, can be diverse and are grouped with the physical environment of soil. They are the result of soil characteristics and soil degradation processes by anthropogenic influence. Due to the above, the objective of this study was to identify and surveying the limitative factors to agricultural production, as well as to define its ability land use capacity in San Fernando district, Tamaulipas. (Author) 7 refs.
Nutrient limitation of primary productivity in the Southeast Pacific (BIOSOPE cruise
Directory of Open Access Journals (Sweden)
S. Bonnet
2008-02-01
Full Text Available Iron is an essential nutrient involved in a variety of biological processes in the ocean, including photosynthesis, respiration and dinitrogen fixation. Atmospheric deposition of aerosols is recognized as the main source of iron for the surface ocean. In high nutrient, low chlorophyll areas, it is now clearly established that iron limits phytoplankton productivity but its biogeochemical role in low nutrient, low chlorophyll environments has been poorly studied. We investigated this question in the unexplored southeast Pacific, arguably the most oligotrophic area of the global ocean. Situated far from any continental aerosol source, the atmospheric iron flux to this province is amongst the lowest of the world ocean. Here we report that, despite low dissolved iron concentrations (~0.1 nmol l−1 across the whole gyre (3 stations located in the center and at the western and the eastern edges, primary productivity are only limited by iron availability at the border of the gyre, but not in the center. The seasonal stability of the gyre has apparently allowed for the development of populations acclimated to these extreme oligotrophic conditions. Moreover, despite clear evidence of nitrogen limitation in the central gyre, we were unable to measure dinitrogen fixation in our experiments, even after iron and/or phosphate additions, and cyanobacterial nif H gene abundances were extremely low compared to the North Pacific Gyre. The South Pacific gyre is therefore unique with respect to the physiological status of its phytoplankton populations.
Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.
Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E
2018-02-02
In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.
DEFF Research Database (Denmark)
Birkbak, Nicolai Juul; Kochupurakkal, Bose; Gonzalez-Izarzugaza, Jose Maria
2013-01-01
drugs and relative to non-mutation carriers present a favorable clinical outcome following therapy. Genome sequencing studies have shown a high number of mutations in the tumor genome in patients carrying BRCA1 or BRCA2 mutations (mBRCA). The present study used exome-sequencing and SNP 6 array data...... between low Nmut and shorter PFS and OS in mBRCA HGSOC by Cox regression and Kaplan-Meier analyses. The association was also significant when the analysis was limited to germline BRCA1 or BRCA2 mutated patients with SNP array-determined loss of heterozygosity of the BRCA1 or BRCA2 locus in the tumors....... In the mBRCA HGSOC tumors, Nmut was correlated with the genome fraction with loss of heterozygosity and with number of telomeric allelic imbalance, genomic measures evaluating chromosomal instability. However, no significant association between Nmut and PFS or OS was found in HGSOC carrying wild-type BRCA1...
Mendizabal, Adam M; Garcia-Gonzalez, Pat; Levine, Paul H
2013-06-01
The epidemiology of chronic myeloid leukemia (CML) in low and middle income countries is limited. As a result, we analyzed a contemporary cohort of patients from low and middle income countries treated with Imatinib through The Glivec(®) International Patient Assistance Program (GIPAP). Generalized estimating equations (GEE) and Kaplan-Meier estimation were utilized to test for regional variations in age at diagnosis and overall survival among 33,985 patients from 94 countries. Patients participated from Asia (79.2%), Africa (9.4%), Latin America (8.7%) and Southern/Eastern Europe (2.5%). Sixty-one (61.2%) percent were male. Mean age at diagnosis was 38.5 years (9.4% 1 year; decreasing to 15.5% in 2010 (p 1-year (p 400 mg (p age at diagnosis and overall survival exist within and between regions. Additional epidemiological studies should be conducted to assess for possible environmental factors associated with the earlier age at onset. Copyright © 2013 Elsevier Ltd. All rights reserved.
PRAME gene expression profile in medulloblastoma
Directory of Open Access Journals (Sweden)
Tânia Maria Vulcani-Freitas
2011-02-01
Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.
Directory of Open Access Journals (Sweden)
Jaya M. Satagopan
2017-06-01
Full Text Available The data presented in this article are related to the research article entitled “Measuring differential treatment benefit across marker specific subgroups: the choice of outcome scale” (Satagopan and Iasonos, 2015 [1]. These data were digitally reconstructed from figures published in Larkin et al. (2015 [2]. This article describes the steps to digitally reconstruct patient-level data on time-to-event outcome and treatment and biomarker groups using published Kaplan-Meier survival curves. The reconstructed data set and the corresponding computer programs are made publicly available to enable further statistical methodology research.
DEFF Research Database (Denmark)
Charlot, Mette; Grove, Erik; Hansen, Peter Riis
2011-01-01
: All aspirin treated patients surviving 30 days after a first myocardial infarction from 1997 to 2006, with follow-up for one year. Patients treated with clopidogrel were excluded. MAIN OUTCOME MEASURES: The risk of the combined end point of cardiovascular death, myocardial infarction, or stroke...... associated with use of proton pump inhibitors was analysed using Kaplan-Meier analysis, Cox proportional hazard models, and propensity score matched Cox proportional hazard models. Results 3366 of 19 925 (16.9%) aspirin treated patients experienced recurrent myocardial infarction, stroke, or cardiovascular...
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper
1999-01-01
for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...
Duración del desempleo y canales de búsqueda de empleo en Colombia
Carlos Augusto Viáfara L; José Ignacio Uribe G
2009-01-01
Este artículo estudia la duración del desempleo en Colombia como indicador de la efectividad de los canales de búsqueda de empleo, con información de la Encuesta Continua de Hogares (ECH) del segundo trimestre de 2006. Se estiman modelos de duración paramétricos (Weibull de riesgos proporcionales) y no paramétricos (Kaplan-Meier). Los resultados indican que en la duración del desempleo influye considerablemente el canal de búsqueda que usan los empleados para conseguir empleo y los desocupado...
DEFF Research Database (Denmark)
Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela
2011-01-01
In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...
DEFF Research Database (Denmark)
Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid
2015-01-01
analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...
DEFF Research Database (Denmark)
Badawy, Mona; Fenstad, Anne M.; Bartz-Johannessen, Christoffer A.
2017-01-01
Background: High procedure volume and dedication to unicompartmental knee arthroplasty (UKA) has been suggested to improve revision rates. This study aimed to quantify the annual hospital volume effect on revision risk in Oxfordu? nicompartmental knee arthroplasty in the Nordic countries. Methods......). The outcome was revision risk after 2 and 10 years calculated using Kaplan Meier method. Multivariate Cox regression analysis was used to assess the Hazard Ratio (HR) of any revision due to specific reasons with 95% confidence intervals (CI). Results: The implant survival was 80% at 10 years in the volume...
DEFF Research Database (Denmark)
Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul
2016-01-01
OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...
DEFF Research Database (Denmark)
van Keimpema, Loes; Nevens, Frederik; Adam, René
2011-01-01
Patients with end-stage isolated polycystic liver disease (PCLD) suffer from incapacitating symptoms because of very large liver volumes. Liver transplantation (LT) is the only curative option. This study assesses the feasibility of LT in PCLD. We used the European Liver Transplant Registry (ELTR......) database to extract demographics and outcomes of 58 PCLD patients. We used Kaplan-Meier survival analysis for survival rates. Severe abdominal pain (75%) was the most prominent symptom, while portal hypertension (35%) was the most common complication in PCLD. The explantation of the polycystic liver...
Reexamining trends in premarital sex in the United States
Lawrence L. Wu; Steven Martin; Paula England
2018-01-01
Background: In a heavily cited paper, Finer (2007) asserted that by age 30, 82Š of US women born 1939-1948 engaged in premarital sex, increasing to 94Š for those born 1969-1978. Using the same data, our age 30 estimates are 55Š and 87Š for women born 1939-1948 and 1969-1978. Our analyses thus document strikingly different levels and trends. Methods: We replicate Finer's single-decrement Kaplan-Meier estimates of premarital sex using Cycles 3-6 of the National Survey of Family Growth, the s...
Christian J Díaz
2009-01-01
Se analizó la deserción estudiantil universitaria, en estudiantes de carreras de ingeniería de la cohorte del año 2004 hasta enero del año 2007. Se evaluó la retención utilizando un modelo de Kaplan-Meier, y se determinaron factores de la deserción con un modelo de riesgos proporcionales de Cox. Los resultados muestran que la mayor probabilidad de desertar se presenta en los tres primeros semestres, y en estudiantes que provienen de colegios financiados por el estado. Son factores determinant...
Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer
DEFF Research Database (Denmark)
Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim
2017-01-01
OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...
Clinical Features in a Danish Population-Based Cohort of Probable Multiple System Atrophy Patients
DEFF Research Database (Denmark)
Starhof, Charlotte; Korbo, Lise; Lassen, Christina Funch
2016-01-01
Background: Multiple system atrophy (MSA) is a rare, sporadic and progressive neurodegenerative disorder. We aimed to describe the clinical features of Danish probable MSA patients, evaluate their initial response to dopaminergic therapy and examine mortality. Methods: From the Danish National...... the criteria for probable MSA. We recorded clinical features, examined differences by MSA subtype and used Kaplan-Meier survival analysis to examine mortality. Results: The mean age at onset of patients with probable MSA was 60.2 years (range 36-75 years) and mean time to wheelchair dependency was 4.7 years...
Eremosparton songoricum (Litv.) Vass. is a rare, central Asian desert species which shows lower fruit set and seed set (<16%) than most hermaphroditic species. We hypothesized that fruit production was limited by pollen and resources. To evaluate potential fruit abortion due to pollen limitation, su...
2010-07-01
... with the emission limits for tire production affected sources? 63.5996 Section 63.5996 Protection of... Pollutants: Rubber Tire Manufacturing Testing and Initial Compliance Requirements for Tire Production Affected Sources § 63.5996 How do I demonstrate initial compliance with the emission limits for tire...
Limits on heavy axion production from the reaction n(p,a)d
International Nuclear Information System (INIS)
Enghardt, W.; Kaun, K.H.; Prade, H.; Bluemlein, J.; Lanius, K.
1987-01-01
A search has been made for the creation of shortlived axions in the isovector transition n(p,a)d decaying into e + e - -pairs. The production of Peccei-Quinn axions can be excluded for 1.21 a -2 (90% CL). Limits on variant axion models are derived. (author)
Deoxynivalenol. Derivation of concentration limits in wheat and wheat containing food products
Pieters MN; Fiolet DCM; Baars AJ; CSR
1999-01-01
The mycotoxin deoxynivalenol (DON) produced by fungi of the Fusarium genus may occur in various cereal crops. A provisional TDI of 1.1 ug per kg body weight was derived to calculate concentration limits for the mycotoxin, deoxynivalenol (DON), in wheat and wheat food products. Children (1-4 years
2010-07-01
... with the emission limits for tire cord production affected sources? 63.5999 Section 63.5999 Protection... Pollutants: Rubber Tire Manufacturing Testing and Initial Compliance Requirements for Tire Cord Production Affected Sources § 63.5999 How do I demonstrate initial compliance with the emission limits for tire cord...
Upper limits on beauty meson production in π- collisions at 280 GeV/c
International Nuclear Information System (INIS)
Badier, J.; Bourotte, J.; Mine, P.; Vanderhaghen, R.; Weisz, S.; Boucrot, J.; Callot, O.; Decamp, D.; Karyotakis, Y.; Lefrancois, J.; Crozon, M.; Delpierre, P.; Leray, T.; Maillard, J.; Tilquin, A.; Valentin, J.
1983-01-01
From events with two like-sign muons, or with three or four muons, observed in the NA3 spectrometer with 280 GeV/c incoming π - beam, we deduce upper limits on the production of beauty meson pairs Banti B. We use the leptonic branching ratios of B meson measured at CESR storage rings, and assume that no nuclear effects occur in the platinum target. We find sigma(Banti B) < 2 nb/nucleon for centrally produced Banti B pairs, and sigma(Banti B) < 10 nb/nucleon for a diffractive production. These values are one order of magnitude lower than previously published limits. As a consequence, the psipsi events observed in our experiment cannot come from Banti B decays. (orig.)
International Nuclear Information System (INIS)
Andrade, C.S.; Rosa, L.P.
1984-01-01
Since Brazil has favourable conditions for biomass production, as regards land mass, soil and climate, several agricultural products have been proposed as alternatives to petroleum-derived fuels. An analysis is made of the potential and limitations of energy systems using biomass production aimed at the use of vegetable oils in diesel engines compared with the experience acquired in Brazil with alcohol fuel in Otto engines. The current status of the national programme for alcohol production (PNA) within the framework of Brazilian agriculture in the last few years is presented, taking into account its objectives, achievements and impacts. Regarding vegetable oils, it must be emphasized that freight and mass passenger transport is being researched in every aspect - from the agricultural production of oleaginous plants to the use of oils in diesel engines. To assess the potential of oleaginous plant production, land needs for the years 1990 and 2000 have been estimated. From the study of some selected oleaginous plants and their potential expansion in a realistic way it was concluded that the viability of this alternative to diesel oil is limited in the short and medium term compared with alcohol, which provides better conditions for great expansion in the short term. It is believed that the option is viable, provided that it is launched gradually to avoid repeating the negative impacts that (according to some experts) were generated by PNA. (author)
Discussion about the number of machines in SHP; Discussao sobre o numero de maquinas em PCH's
Energy Technology Data Exchange (ETDEWEB)
Santos, Afonso Henriques Moreira [MS Consultoria Ltda, Itajuba, MG (Brazil); Universidade Federal de Itajuba (UNIFEI), MG (Brazil); Horta, Fabio [IX Consultoria e Representacoes Ltda, Itajuba, MG (Brazil); Batista, Thiago Roberto [IX Consultoria e Representacoes Ltda, Itajuba, MG (Brazil); Universidade Federal de Itajuba (UNIFEI), MG (Brazil)
2010-07-01
Given the current economic and regulatory conditions, the axial SHP turbines have spread to the country only recently, with the prevailing culture of Francis turbines. It is often used double Francis, with various groups, to avoid a Kaplan option, expensive and sometimes unavailable. This paper deals with the choice between generating sets Francis and Kaplan, in order to present the basic steps for energy production calculating and operational limitations. Then, it develops a reliability analysis of small hydropower plants inserted into the electrical system, either in terms of forced or scheduled unavailability. (author)
International Nuclear Information System (INIS)
Duong, Cuong P.; Thomas, Robert J.S.; Hicks, Rodney J.; Drummond, Elizabeth; Weih, LeAnn; Leong, Trevor; Michael, Michael
2006-01-01
The purpose of this study was to evaluate the impact of FDG-PET following chemoradiotherapy (CRT) on treatment planning and survival in patients with oesophageal cancer (OC). Fifty-three consecutive OC patients had a post-treatment PET scan to evaluate tumour response to CRT prior to possible surgery. Baseline pre-CRT PET was performed in 33 patients. Prospectively recorded post-CRT management plans were compared with post-PET treatment. High impact was defined as a change in treatment intent or modality. Survival was analysed using the Kaplan-Meier product limit method and Cox proportional hazards regression model. After completion of CRT, 23/53 patients (43%) achieved complete metabolic response (CMR), as compared with only four (8%) with complete response on computed tomography. High PET impact was observed in 19 patients (36%). CMR was strongly predictive of survival (p<0.008) on multivariate analysis. CMR patients in whom resection was not performed had comparable survival to those (CMR and non-CMR) who underwent resection. The use of post-treatment FDG-PET for assessment of tumour response after CRT changed the clinical management of more than one-third of OC patients. CMR status as assessed by PET powerfully stratified prognosis. Even in the absence of a baseline study, normalisation of uptake at all sites of known tumoral involvement carries a good medium-term prognosis. (orig.)
International Nuclear Information System (INIS)
Rotolo, Jimmy A.; Maj, Jerzy G.; Feldman, Regina; Ren, Decheng; Haimovitz-Friedman, Adriana; Cordon-Cardo, Carlos; Cheng, Emily H.-Y.; Kolesnick, Richard; Fuks, Zvi
2008-01-01
Purpose: To address in vivo the issue of whether Bax and Bak are functionally redundant in signaling apoptosis, capable of substituting for each other. Methods and Materials: Mice were exposed to whole-body radiation, and endothelial cell apoptosis was quantified using double immunostaining with TUNEL and anti-CD31 antibody. Crypt survival was determined at 3.5 days after whole-body radiation by the microcolony survival assay. Actuarial animal survival was calculated by the product-limit Kaplan-Meier method, and autopsies were performed to establish cause of death. Results: Radiation exposure of Bax- and Bak-deficient mice, both expressing a wild-type acid sphingomyelinase (ASMase) phenotype, indicated that Bax and Bak are both mandatory, though mutually independent, for the intestinal endothelial apoptotic response. However, neither affected epithelial apoptosis at crypt positions 4-5, indicating specificity toward endothelium. Furthermore, Bax deficiency and Bak deficiency each individually mimicked ASMase deficiency in inhibiting crypt lethality in the microcolony assay and in rescuing mice from the lethal gastrointestinal syndrome. Conclusions: The data indicate that Bax and Bak have nonredundant functional roles in the apoptotic response of the irradiated intestinal endothelium. The observation that Bax deficiency and Bak deficiency also protect crypts in the microcolony assay provides strong evidence that the microvascular apoptotic component is germane to the mechanism of radiation-induced damage to mouse intestines, regulating reproductive cell death of crypt stem cell clonogens
Elite athletes: is survival shortened in boxers?
Bianco, M; Fabbricatore, C; Sanna, N; Fabiano, C; Palmieri, V; Zeppilli, P
2007-08-01
Moderate exercise and intense physical training are associated with increased life expectancy (LE). Boxing is characterized by intentional and repetitive head blows, sometimes causing brain injury, possibly reducing LE. We examined a sample of male athletes born between 1860 and 1930 selected from the international "hall of fame" inductees in baseball (n = 154), ice hockey (n = 130), tennis (n = 83), football (n = 81), boxing (n = 81), track and field (n = 59), basketball (n = 58), swimming (n = 37) and wrestling (n = 32). In boxing, we analyzed the number of disputed bouts/rounds and career records. Sports were also analyzed according to physiological demand and occurrence and kind of contact (intentional, unintentional). The Kaplan-Meier product limit method was used to compare survival curves (significance: p LE of the samples was 76.0 yrs and no differences were observed in different sports, although it was lower in boxers (73.0 yrs) and higher in tennis players (79.0 yrs). Sports of different physiological demand were similar in respect to LE. No differences in LE were found related to occurrence and kind of impact. Similar LE was found in boxers of different weight or career records. In conclusion, this study indicates that LE in top-level athletes is unaffected by the type of discipline, and not related to physiological demand and intentional contact.
Final Progress Report on Model-Based Diagnosis of Soil Limitations to Forest Productivity
Energy Technology Data Exchange (ETDEWEB)
Luxmoore, R.J.
2004-08-30
This project was undertaken in support of the forest industry to link modeling of nutrients and productivity with field research to identify methods for enhancing soil quality and forest productivity and for alleviating soil limitations to sustainable forest productivity. The project consisted of a series of related tasks, including (1) simulation of changes in biomass and soil carbon with nitrogen fertilization, (2) development of spreadsheet modeling tools for soil nutrient availability and tree nutrient requirements, (3) additional modeling studies, and (4) evaluation of factors involved in the establishment and productivity of southern pine plantations in seasonally wet soils. This report also describes the two Web sites that were developed from the research to assist forest managers with nutrient management of Douglas-fir and loblolly pine plantations.
Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping
2015-12-03
Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Sorrell, Brian K; Safi, Karl; Hawes, Ian
2013-01-01
We compared planktonic primary and secondary production across twenty meltwater ponds on the surface of the McMurdo Ice Shelf in January 2007, including some ponds with basal brines created by meromictic stratification. Primary production ranged from 1.07 to 65.72 mgC m −3 h −1 in surface waters. In stratified ponds primary production was always more than ten times higher in basal brines than in the corresponding mixolimnion. Regression tree analysis (r 2 = 0.80) identified inorganic nitrogen (as NH 4 + ) as the main factor limiting planktonic primary production. However, there was also evidence of inorganic carbon co-limitation of photosynthesis in some of the more oligotrophic waters. Neither C nor N limited carbon fixation at [NH 4 –N] > 50 mg m −3 , with photoinhibition the factor most likely limiting photosynthesis under such conditions. Primary production was the only factor significantly correlated to bacterial production and the relationship (r 2 = 0.56) was non-linear. Nitrogen limitation and tight coupling of planktonic primary and bacterial production is surprising in these ponds, as all have large pools of dissolved organic carbon (1.2–260 g m −3 ) and organic nitrogen (all >130 mg m −3 ). The dissolved pools of organic carbon and nitrogen appear to be recalcitrant and bacterial production to be constrained by limited release of labile organics from phytoplankton. (letter)
Gallon, Alessandra Vasconcelos; Universidade Federal do Ceará (UFC); Nascimento, Cristiano; Universidade Federal do Paraná - UFPR; Pfitscher, Elisete Dahmer; Universidade Federal de Santa Catarina
2011-01-01
Bivalve farming (mussels and oysters), a major component in the socio-economic development of the state of Santa Catarina, Brazil, combines the activities of public and private agencies in fish farming. Current analysis deals with the management and the operational limitations of the local bivalve production chain. Current exploratory research, undertaken by direct observations and the literature on the subject, employs data quality. Results show that the bivalve production chain, comprising ...
On the semi-classical limit of scalar products of the XXZ spin chain
Energy Technology Data Exchange (ETDEWEB)
Jiang, Yunfeng; Brunekreef, Joren [Institut für Theoretische Physik, ETH Zürich,Wolfgang Pauli Strasse 27, CH-8093 Zürich (Switzerland)
2017-03-03
We study the scalar products between Bethe states in the XXZ spin chain with anisotropy |Δ|>1 in the semi-classical limit where the length of the spin chain and the number of magnons tend to infinity with their ratio kept finite and fixed. Our method is a natural yet non-trivial generalization of similar methods developed for the XXX spin chain. The final result can be written in a compact form as a contour integral in terms of Faddeev’s quantum dilogarithm function, which in the isotropic limit reduces to the classical dilogarithm function.
On the semi-classical limit of scalar products of the XXZ spin chain
International Nuclear Information System (INIS)
Jiang, Yunfeng; Brunekreef, Joren
2017-01-01
We study the scalar products between Bethe states in the XXZ spin chain with anisotropy |Δ|>1 in the semi-classical limit where the length of the spin chain and the number of magnons tend to infinity with their ratio kept finite and fixed. Our method is a natural yet non-trivial generalization of similar methods developed for the XXX spin chain. The final result can be written in a compact form as a contour integral in terms of Faddeev’s quantum dilogarithm function, which in the isotropic limit reduces to the classical dilogarithm function.
Increasing water productivity of irrigated crops under limited water supply at field scale
Vazifedoust, M.; Dam, van J.C.; Feddes, R.A.; Feizi, M.
2008-01-01
Borkhar district is located in an and to semi-arid region in Iran and regularly faces widespread drought. Given current water scarcity, the limited available water should be used as efficient and productive as possible. To explore on-farm strategies which result in higher economic gains and water
International Nuclear Information System (INIS)
Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo
2009-01-01
Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es
Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing
2017-04-01
Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.
International Nuclear Information System (INIS)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.
2017-01-01
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
Combination therapy with hormonal, radiation and chemotherapy for stage C prostate cancer
International Nuclear Information System (INIS)
Iwasawa, Toshihisa; Matsumoto, Hidetsugu
1996-01-01
To improve the effectiveness of treatment for patients with stage C prostate cancer, therapy in combination with hormonal, radiation and chemotherapy was given for the initial period, and there after, hormonal therapy was continuously administered to 18 patients with chemotherapy and three patients without it. At the Social Health Insurance Medical Center, between May 1988 and August 1991, 21 patients were diagnosed to have stage C histologically confirmed adenocarcinoma of the prostate. The average age of the patients was 69.0 years. The tumor was well, moderate and poorly differentiated in 5, 6 and 10 patients, respectively. As hormonal therapy, orchiectomy was performed on 19 of the 21 patients. Furthermore, 11 patients were administered estramustine phosphate, 9 chlormadinone acetate, and one diethylstilbesterol diphosphate. As, radiation therapy, all patients were treated with AP-PA parallel opposing technique to small pelvis with a 12 cm x 12 cm treatment field (44-45 Gy) combined with conformation radiotherapy to prostate (20-26 Gy). Chemotherapy was performed using either one or a combination of the following; cis-diamminedichloroplatinum, adriamycin, cyclophosphamide, 5-fluorouracil, methotrexate and etoposide. The observation period was 54.5 months on the average. Recurrence was observed in 3 patients, for all of which the sites were at bone. The 5-year non-recurrence rate was 90.4% by Kaplan-Meier's method. There were 4 deaths, three were due to prostate cancer and one to gastric cancer. The 5-year cumulative survival rate by Kaplan-Meier's method was 90.5%. In conclusion, this treatment was effective for stage C cases of prostate cancer. (author)
International Nuclear Information System (INIS)
Tai, Bee-Choo; Grundy, Richard G.; Machin, David
2010-01-01
Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.
Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit
2017-01-01
Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.
Iverson, Shawn M; Spierer, Oriel; Papachristou, George C; Feuer, William J; Shi, Wei; Greenfield, David S; O'Brien, Terrence P
2018-02-01
To compare corneal graft survival rates after penetrating keratoplasty (PK) and Descemet's stripping endothelial keratoplasty (DSEK) in patients with a glaucoma drainage device (GDD) or medically managed glaucoma. A retrospective chart review was conducted on consecutive patients who underwent primary PK or primary DSEK. Inclusion criteria consisted of eyes with a diagnosis of glaucoma prior to corneal transplantation and a minimum of 6 months of follow-up. Graft failure was defined as an edematous cornea with failure to maintain deturgescence lasting beyond a period of 1 month of intense steroid therapy or vascularization and scarring resulting in irreversible loss of central graft clarity. Corneal graft survival was calculated using Kaplan-Meier survival analysis. Patients were divided into four groups: GDD-PK, GDD-DSEK, medical-PK and medical-DSEK. Fifty-six eyes of 56 patients were identified as meeting inclusion criteria. Among eyes with a GDD, there was no difference in the proportion of failures between PK grafts (48%) and DSEK grafts (50%) (p = 0.90). Failure occurred earlier in DSEK recipients compared to PK recipients, 5.82 ± 6.77 months versus 14.40 ± 7.70 months, respectively (p = 0.04). A Kaplan-Meier analysis did not identify a difference between the four groups with respect to graft failure (p = 0.52). There is no significant difference in graft survival rates between medically and surgically treated glaucoma patients for either PK or DSEK grafts. In patients with GDD, graft failure occurs earlier in DSEK compared to PK.
Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao
2017-08-01
The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li
2011-01-01
Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)
Metagenes Associated with Survival in Non-Small Cell Lung Cancer
Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres
2011-01-01
NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068
Energy Technology Data Exchange (ETDEWEB)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)
2017-03-15
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
Directory of Open Access Journals (Sweden)
Orlei Ribeiro de Araujo
Full Text Available Antibiotic restriction can be useful in maintaining bacterial susceptibility. The objective of this study was verify if restriction of cefepime, the most frequently used cephalosporin in our neonatal intensive care unit (NICU, would ameliorate broad-spectrum susceptibility of Gram-negative isolates. Nine hundred and ninety-five premature and term newborns were divided into 3 cohorts, according to the prevalence of cefepime use in the unit: Group 1 (n=396 comprised patients admitted from January 2002 to December 2003, period in which cefepime was the most used broad-spectrum antibiotic. Patients in Group 2 (n=349 were admitted when piperacillin/tazobactam replaced cefepime (January to December 2004 and in Group 3 (n=250 when cefepime was reintroduced (January to September 2005. Meropenem was the alternative third-line antibiotic for all groups. Multiresistance was defined as resistance to 2 or more unrelated antibiotics, including necessarily a third or fourth generation cephalosporin, piperacillin/tazobactam or meropenem. Statistics involved Kruskal-Wallis, Mann-Whitney and logrank tests, Kaplan-Meier analysis. Groups were comparable in length of stay, time of mechanical ventilation, gestational age and birth weight. Ninety-eight Gram-negative isolates were analyzed. Patients were more likely to remain free of multiresistant isolates by Kaplan-Meier analysis in Group 2 when compared to Group 1 (p=0.017 and Group 3 (p=0.003. There was also a significant difference in meropenem resistance rates. Cefepime has a greater propensity to select multiresistant Gram-negative pathogens than piperacillin/tazobactam and should not be used extensively in neonatal intensive care.
Predicting long-term graft survival in adult kidney transplant recipients
Directory of Open Access Journals (Sweden)
Brett W Pinsky
2012-01-01
Full Text Available The ability to accurately predict a population′s long-term survival has important implications for quantifying the benefits of transplantation. To identify a model that can accurately predict a kidney transplant population′s long-term graft survival, we retrospectively studied the United Network of Organ Sharing data from 13,111 kidney-only transplants completed in 1988- 1989. Nineteen-year death-censored graft survival (DCGS projections were calculated and com-pared with the population′s actual graft survival. The projection curves were created using a two-part estimation model that (1 fits a Kaplan-Meier survival curve immediately after transplant (Part A and (2 uses truncated observational data to model a survival function for long-term projection (Part B. Projection curves were examined using varying amounts of time to fit both parts of the model. The accuracy of the projection curve was determined by examining whether predicted sur-vival fell within the 95% confidence interval for the 19-year Kaplan-Meier survival, and the sample size needed to detect the difference in projected versus observed survival in a clinical trial. The 19-year DCGS was 40.7% (39.8-41.6%. Excellent predictability (41.3% can be achieved when Part A is fit for three years and Part B is projected using two additional years of data. Using less than five total years of data tended to overestimate the population′s long-term survival, accurate prediction of long-term DCGS is possible, but requires attention to the quantity data used in the projection method.
Energy Technology Data Exchange (ETDEWEB)
Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)
2012-10-15
Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)
Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.
Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang
The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.
Choi, Ji Young; Kim, Miso; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Heo, Dae Seog; Jo, Seong Jin
2018-04-05
Despite the successful use of tyrosine kinase inhibitors (TKIs) in cancer patients, their effect on herpes zoster development has not been studied. The aim of this study was to evaluate and compare the effects of epidermal growth factor receptor (EGFR) TKI and cytotoxic chemotherapy on the risk of herpes zoster development in non-small cell lung cancer (NSCLC) patients. We conducted a medical review of all eligible NSCLC patients in Seoul National University hospital between 2002 and 2015. We classified patients based on whether they previously underwent EGFR TKI therapy into either the TKI group or the cytotoxic group. We compared the incidence rates of herpes zoster during TKI therapy and cytotoxic chemotherapy. Additionally, the longitudinal risk of herpes zoster from TKIs was analyzed using the incidence rate ratio (IRR) of the TKI group to the cytotoxic group and the log-rank test of the Kaplan-Meier method. Of the 2,981 NSCLC patients, 54 patients (1.54%) developed herpes zoster. In the TKI group (2,002 patients), the IRR of herpes zoster during TKI therapy compared to that during cytotoxic chemotherapy was 1.05 (95% confidence interval [CI], 0.53 to 2.09). The IRR of the TKI group compared to the cytotoxic group was 1.33 (95% CI, 0.64 to 2.76). The Kaplan-Meier cumulative risk of both groups was not significantly different. Our results show that the incidence rate of herpes zoster in the TKI group was not statistically different from the incidence in the cytotoxic group during and after chemotherapy in NSCLC patients.
Wang, Qin; Hu, Ke-Jie; Ren, Ye-Ping; Dong, Jie; Han, Qing-Feng; Zhu, Tong-Ying; Chen, Jiang-Hua; Zhao, Hui-Ping; Chen, Meng-Hua; Xu, Rong; Wang, Yue; Hao, Chuan-Ming; Zhang, Xiao-Hui; Wang, Mei; Tian, Na; Wang, Hai-Yan
2016-01-01
♦ Research indicates that the socioeconomic status (SES) of individuals and the area where they live are related to initial peritonitis and outcomes in peritoneal dialysis (PD). We conducted a retrospective, multi-center cohort study in China to examine these associations. ♦ Data on 2,171 PD patients were collected from 7 centers, including baseline demographic, socioeconomic, and laboratory data. We explored the potential risk factors for initial peritonitis and outcomes using univariate Cox regression and unadjusted binary logistic regression. Then, we used propensity score matching to balance statistically significant risk factors for initial peritonitis and outcomes, and Kaplan-Meier survival analysis to compare differences in peritonitis-free rates between different groups of participants after matching. ♦ A total of 563 (25.9%) initial episodes of peritonitis occurred during the study period. The Kaplan-Meier peritonitis-free rate curve showed high-income patients had a significantly lower risk than low-income patients (p = 0.007) after matching for age, hemoglobin, albumin, and regional SES and PD center. The risk of treatment failure was significantly lower in the high-income than the low-income group after matching for the organism causing peritonitis and PD center: odds ratio (OR) = 0.27 (0.09 - 0.80, p = 0.018). Regional SES and education were not associated with initial peritonitis and outcomes. ♦ Our study demonstrates low individual income is a risk factor for the initial onset of peritonitis and treatment failure after initial peritonitis. Copyright © 2016 International Society for Peritoneal Dialysis.
Extraneural metastases of medulloblastoma: desmoplastic variants may have prolonged survival.
Young, Robert J; Khakoo, Yasmin; Yhu, Stephen; Wolden, Suzanne; De Braganca, Kevin C; Gilheeney, Stephen W; Dunkel, Ira J
2015-04-01
Extraneural metastases from CNS medulloblastoma are rare and poorly described. The purpose of this study is to describe the clinical and radiological characteristics of a large single institution series of patients with medulloblastoma who developed extraneural metastases. We retrospectively reviewed a departmental database over a 20 year period for all patients with medulloblastoma who developed extraneural metastases. Chart and imaging reviews were performed, and overall survival (OS) estimated by the Kaplan-Meier method. We found 14 patients with medulloblastoma and extraneural metastases. The median age at initial diagnosis was 16.3 years (range, 3.2-44.2), and the most common subtype was desmoplastic (n = 6, 42.9%). After initial gross total resection, most patients received radiation therapy alone (n = 10, 71.4%). Metastases to bone were most common (n = 11, 78.6%) followed by metastases to bone marrow (n = 6, 42.9%), usually to the spine. The median time from initial diagnosis to first extraneural metastasis was 1.5 years (range, 0.2-17.4), and the median OS from extraneural metastasis to death was 3.3 years (range, 0-18). The Kaplan-Meier estimate of 5 year OS from extraneural metastasis diagnosis was 40.0% (95% CI, 20.2-79.2). Extraneural metastases from medulloblastoma may rarely develop after initial diagnosis to involve bone and bone marrow. We found that desmoplastic variant extraneural tumors had longer survival than nondesmoplastic variants, suggesting that histopathological and more recent molecular subtyping have important roles in determining the prognosis of medulloblastoma patients. © 2014 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Wei, Yongjun; Siewers, Verena; Nielsen, Jens
2017-01-01
Cocoa butter (CB) extracted from cocoa beans is the main raw material for chocolate production. However, growing chocolate demands and limited CB production has resulted in a shortage of CB supply. CB is mainly composed of three different kinds of triacylglycerols (TAGs), POP (C16:0–C18:1–C16......, Saccharomyces cerevisiae CEN.PK113-7D, and five oleaginous yeast strains, Trichosporon oleaginosus DSM11815, Rhodotorula graminis DSM 27356, Lipomyces starkeyi DSM 70296, Rhodosporidium toruloides DSM 70398, and Yarrowia lipolytica CBS 6124, in nitrogen-limited medium and compared their CBL production ability...... and POS at levels of 378 mg TAGs/g dry cell weight, hinting that this yeast may have potential as a CBL production host after further metabolic engineering in future....
40 CFR Table 1 to Subpart C - VOC Content Limits by Product Category
2010-07-01
... (weight-percent VOC) Air fresheners: Single-phase 70 Double-phase 30 Liquids/pump sprays 18 Solids/gels 3... 40 Protection of Environment 5 2010-07-01 2010-07-01 false VOC Content Limits by Product Category 1 Table 1 to Subpart C Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR...
Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A
2011-02-27
Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.
DEFF Research Database (Denmark)
Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V
2015-01-01
AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...
Reverse hybrid total hip arthroplasty
DEFF Research Database (Denmark)
Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M
2017-01-01
Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...
Growth pattern of colorectal liver metastasis as a marker of recurrence risk
DEFF Research Database (Denmark)
Eefsen, R L; Vermeulen, P B; Christensen, I J
2015-01-01
from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...
Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe
DEFF Research Database (Denmark)
Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther
2014-01-01
on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...
Directory of Open Access Journals (Sweden)
Michelle Eisenhardt
2013-10-01
Full Text Available Backgound and Objectives: Colorectal cancer (CRC has high incidence, is often treatable and curable if diagnosed early. This study aimed to identify the epidemiological characteristic and assess overall survival in patients with CRC treated at a center specializing in oncology. Methods: Medical records of 127 patients with CRC were retrospectively evaluated. Clinical and epidemiological characteristics, in addition to treatment protocols and adverse reactions presented by patients were reviewed. The association of significance was assessed by chi-square and Fisher exact tests. The survival analyses were performed using the Kaplan-Meier method. The confidence interval was of 95% (p
DEFF Research Database (Denmark)
Kronborg, Mads Brix; Johansen, Jens Brock; Haarbo, Jens
2017-01-01
/mid-ventricular/apical for the LV-LP, and as apical/non-apical for the RV-LP. Appropriate and inappropriate therapies were registered during follow-up via remote monitoring or at device interrogations. Time to event was summarized with Kaplan-Meier plots, and competed risk regression analysis was used to calculate adjusted hazard...... with an apical. We observed no significant association between appropriate therapy and LV-LP in left anterior oblique or right anterior oblique views or inappropriate therapy between any lead positions. Conclusion: An apical RV-LP is associated with an increased risk of appropriate therapy for ventricular...
Effect of darapladib on major coronary events after an acute coronary syndrome
DEFF Research Database (Denmark)
O'Donoghue, Michelle L; Braunwald, Eugene; White, Harvey D
2014-01-01
]) at 868 sites in 36 countries. INTERVENTIONS: Patients were randomized to either once-daily darapladib (160 mg) or placebo on a background of guideline-recommended therapy. Patients were followed up for a median of 2.5 years between December 7, 2009, and December 6, 2013. MAIN OUTCOMES AND MEASURES......: The primary end point (major coronary events) was the composite of coronary heart disease (CHD) death, MI, or urgent coronary revascularization for myocardial ischemia. Kaplan-Meier event rates are reported at 3 years. RESULTS: During a median duration of 2.5 years, the primary end point occurred in 903...
Epidemiology of Massive Transfusion
DEFF Research Database (Denmark)
Halmin, Märit; Chiesa, Flaminia; Vasan, Senthil K
2016-01-01
in Sweden from 1987 and in Denmark from 1996. A total of 92,057 patients were included. Patients were followed until the end of 2012. MEASUREMENTS AND MAIN RESULTS: Descriptive statistics were used to characterize the patients and indications. Post transfusion mortality was expressed as crude 30-day...... mortality and as long-term mortality using the Kaplan-Meier method and using standardized mortality ratios. The incidence of massive transfusion was higher in Denmark (4.5 per 10,000) than in Sweden (2.5 per 10,000). The most common indication for massive transfusion was major surgery (61.2%) followed...
DEFF Research Database (Denmark)
Schneider, Uffe; Nielsen, Rikke; Pedersen, Court
2007-01-01
. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...
DEFF Research Database (Denmark)
Ewertz, M.; Kempel, M.M.; During, M.
2008-01-01
patients in Denmark. PATIENTS AND METHODS: To evaluate the results of this treatment, we performed a nationwide population-based follow-up study of patients aged less than 75 years treated in Denmark from 1989 to 1998 based on the database of Danish Breast Cancer Cooperative Group. RESULTS: At 15 years...... of follow-up, the Kaplan-Meier estimate of overall survival was 69% among 3 758 patients who received the recommended treatment. Within the first 10 years of follow-up, the cumulative incidences of loco-regional recurrences, distant metastases or other malignant disease, or death as a first event were 9...
DEFF Research Database (Denmark)
Schnack, Tine H; Høgdall, Estrid; Nedergaard, Lotte
2016-01-01
-based prospectively collected data on oCCC (n = 179) and oSAC (n = 2363) cases were obtained from the Danish Gynecological Cancer Database. χ, Fischer or Wilcoxon-Mann-Whitney, multivariate logistic regression, univariate Kaplan-Meier, and multivariate Cox regression tests were used. Statistical tests were 2-sided. P......, 0.62; 95% confidence interval, 0.37-0.92).Although more oSAC than oCCC cases diagnosed in stage III or IV were referred to neoadjuvant chemotherapy, a higher proportion of oCCC achieved complete cytoreduction at primary debulking surgery and/or had lymphadenectomy performed; overall survival were...
DEFF Research Database (Denmark)
Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels
2009-01-01
bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...
Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer
DEFF Research Database (Denmark)
Fransgaard, T; Thygesen, L C; Gögenur, I
2016-01-01
with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...
Estimating a population cumulative incidence under calendar time trends
DEFF Research Database (Denmark)
Hansen, Stefan N; Overgaard, Morten; Andersen, Per K
2017-01-01
BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date....... It is common practice to apply the Kaplan-Meier or Aalen-Johansen estimator to the total sample and report either the estimated cumulative incidence curve or just a single point on the curve as a description of the disease risk. METHODS: We argue that, whenever the disease or disorder of interest is influenced...
Rinzema, A; Tramper, J; de Bruin, E; Bol, J
In the later stages of a batch fermentation for microbial transglutaminase production by Streptoverticillium mobaraense the availability of a nitrogen source accessible to the microorganism becomes critical. Fed-batch fermentation is investigated with the aim of avoiding this substrate limitation.
Photorespiration and carbon limitation determine productivity in temperate seagrasses.
Buapet, Pimchanok; Rasmusson, Lina M; Gullström, Martin; Björk, Mats
2013-01-01
The gross primary productivity of two seagrasses, Zostera marina and Ruppia maritima, and one green macroalga, Ulva intestinalis, was assessed in laboratory and field experiments to determine whether the photorespiratory pathway operates at a substantial level in these macrophytes and to what extent it is enhanced by naturally occurring shifts in dissolved inorganic carbon (DIC) and O2 in dense vegetation. To achieve these conditions in laboratory experiments, seawater was incubated with U. intestinalis in light to obtain a range of higher pH and O2 levels and lower DIC levels. Gross photosynthetic O2 evolution was then measured in this pretreated seawater (pH, 7.8-9.8; high to low DIC:O2 ratio) at both natural and low O2 concentrations (adjusted by N2 bubbling). The presence of photorespiration was indicated by a lower gross O2 evolution rate under natural O2 conditions than when O2 was reduced. In all three macrophytes, gross photosynthetic rates were negatively affected by higher pH and lower DIC. However, while both seagrasses exhibited significant photorespiratory activity at increasing pH values, the macroalga U. intestinalis exhibited no such activity. Rates of seagrass photosynthesis were then assessed in seawater collected from the natural habitats (i.e., shallow bays characterized by high macrophyte cover and by low DIC and high pH during daytime) and compared with open baymouth water conditions (where seawater DIC is in equilibrium with air, normal DIC, and pH). The gross photosynthetic rates of both seagrasses were significantly higher when incubated in the baymouth water, indicating that these grasses can be significantly carbon limited in shallow bays. Photorespiration was also detected in both seagrasses under shallow bay water conditions. Our findings indicate that natural carbon limitations caused by high community photosynthesis can enhance photorespiration and cause a significant decline in seagrass primary production in shallow waters.
Photorespiration and carbon limitation determine productivity in temperate seagrasses.
Directory of Open Access Journals (Sweden)
Pimchanok Buapet
Full Text Available The gross primary productivity of two seagrasses, Zostera marina and Ruppia maritima, and one green macroalga, Ulva intestinalis, was assessed in laboratory and field experiments to determine whether the photorespiratory pathway operates at a substantial level in these macrophytes and to what extent it is enhanced by naturally occurring shifts in dissolved inorganic carbon (DIC and O2 in dense vegetation. To achieve these conditions in laboratory experiments, seawater was incubated with U. intestinalis in light to obtain a range of higher pH and O2 levels and lower DIC levels. Gross photosynthetic O2 evolution was then measured in this pretreated seawater (pH, 7.8-9.8; high to low DIC:O2 ratio at both natural and low O2 concentrations (adjusted by N2 bubbling. The presence of photorespiration was indicated by a lower gross O2 evolution rate under natural O2 conditions than when O2 was reduced. In all three macrophytes, gross photosynthetic rates were negatively affected by higher pH and lower DIC. However, while both seagrasses exhibited significant photorespiratory activity at increasing pH values, the macroalga U. intestinalis exhibited no such activity. Rates of seagrass photosynthesis were then assessed in seawater collected from the natural habitats (i.e., shallow bays characterized by high macrophyte cover and by low DIC and high pH during daytime and compared with open baymouth water conditions (where seawater DIC is in equilibrium with air, normal DIC, and pH. The gross photosynthetic rates of both seagrasses were significantly higher when incubated in the baymouth water, indicating that these grasses can be significantly carbon limited in shallow bays. Photorespiration was also detected in both seagrasses under shallow bay water conditions. Our findings indicate that natural carbon limitations caused by high community photosynthesis can enhance photorespiration and cause a significant decline in seagrass primary production in shallow
40 CFR Table 2 to Subpart Xxxx of... - Emission Limits for Tire Cord Production Affected Sources
2010-07-01
... 40 Protection of Environment 12 2010-07-01 2010-07-01 true Emission Limits for Tire Cord Production Affected Sources 2 Table 2 to Subpart XXXX of Part 63 Protection of Environment ENVIRONMENTAL... Manufacturing Pt. 63, Subpt. XXXX, Table 2 Table 2 to Subpart XXXX of Part 63—Emission Limits for Tire Cord...
2010-06-07
...-Rolled Carbon-Quality Steel Products from Brazil: Extension of Time Limit for Preliminary Results of...-quality steel products from Brazil. See Agreement Suspending the Countervailing Duty Investigation on Hot... duty order on certain hot-rolled flat-rolled carbon-quality steel products from Brazil. See Initiation...
Limitations in Production and Stocks and their Effect on the Profitability of the Slaughterhouses
DEFF Research Database (Denmark)
Kjærsgaard, Niels Christian
The pig industry is important for the Danish economy with an export value of more than DKK 28 billions in 2006 [Danish Meat Association (2007)] and the competition is increasing. Therefore it is more important than ever to optimize all aspects of Danish pig production, slaughtering processes...... and delivery. The cost of logistical limitations in the equalization room has been estimated to DKK 0.072 per kg or approximately DKK 145 million per year in total for the Danish slaughterhouses The main conclusion is that even relatively simple optimization models can be used to improve the basis...... of the slaughterhouses for decision making considerably, both regarding computing the costs of having limitations in the production as well as the value of improved measurements and increased slaughter weight. Prices vary from one week to another, and consequently a price and cost study should be performed before...
Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P; Iacobuzio-Donahue, Christine A; Kerner, Zachary; Baylin, Stephen B; Wolfgang, Christopher L; Ahuja, Nita
2016-12-27
We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP-/MLH1-U, or CIMP-/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes.
Energy Technology Data Exchange (ETDEWEB)
Kessler, P.; Bloch-Birkholz, A.; Neukam, F.W. [Erlangen-Nuernberg Univ., Erlangen (Germany). Klinik und Poliklinik fuer Mund-, Kiefer-, Gesichtschirurgie; Grabenbauer, G.; Sauer, R. [Erlangen-Nuernberg Univ., Erlangen (Germany). Klinik und Poliklinik fuer Strahlentherapie; Leher, A. [Erlangen-Nuernberg Univ., Erlangen (Germany). Inst. fuer Medizininformatik, Biometrie und Epidemiologie; Vairaktaris, E. [Univ. of Athens Medical School (Greece). Dept. of Maxillofacial Surgery
2007-04-15
Background and Purpose: In recent years, different concepts for the treatment of oral squamous cell carcinomas (OSCC) have been developed; these include preoperative simultaneous neoadjuvant radiochemotherapy and one-stage surgery with tumor ablation and reconstruction. When considering long-term survival, there is substantial evidence that multimodality treatment based on a neoadjuvant radiochemotherapy is superior to adjuvant therapy concepts based on a surgical approach with postoperative irradiation. The aim of this study was to discuss the 5-year survival rate in a neoadjuvant and an adjuvant combination treatment in patients with primary OSCC. Patients and Methods: This nonrandomized longitudinal study prospectively evaluates the long-term tumor-free survival in 128 patients with oral cancer. Two groups consisting of 74 neoadjuvantly and 54 primarily surgically treated patients were formed. 99 patients suffered from stage III and IV disease according to the UICC criteria. Long-term survival was estimated according to the Kaplan-Meier assumption. Results: The neoadjuvant treatment increases the prospect of a long-term tumor-free survival. According to Kaplan-Meier assumption the estimation for a 5-year tumor-free survival in OSCC in category T1 is 83.1% in neoadjuvant, and 70.1% in adjuvant treatment, in T2 79.6% and 57.7%, in T3 68.2% and 33.2%, in T4 51.4% and 30.5%, respectively. Significance (p < 0.05) could be proven for T1 (p = 0.002), T2 (p = 0.028), and T4 (p < 0.0001) tumors. The effectiveness of the preoperative radiochemotherapy was demonstrated in the pathohistological result of tumor-free resection specimens in 28 patients of the neoadjuvant treatment group (37.8%). On the other hand, four patients died during the preoperative combination therapy. 64.8% of the patients in the adjuvant and 71.6% in the neoadjuvant treatment group survived the observation period. Conclusion: Neoadjuvant therapy is highly effective and results in a better 5-year
Statistical reliability analyses of two wood plastic composite extrusion processes
International Nuclear Information System (INIS)
Crookston, Kevin A.; Mark Young, Timothy; Harper, David; Guess, Frank M.
2011-01-01
Estimates of the reliability of wood plastic composites (WPC) are explored for two industrial extrusion lines. The goal of the paper is to use parametric and non-parametric analyses to examine potential differences in the WPC metrics of reliability for the two extrusion lines that may be helpful for use by the practitioner. A parametric analysis of the extrusion lines reveals some similarities and disparities in the best models; however, a non-parametric analysis reveals unique and insightful differences between Kaplan-Meier survival curves for the modulus of elasticity (MOE) and modulus of rupture (MOR) of the WPC industrial data. The distinctive non-parametric comparisons indicate the source of the differences in strength between the 10.2% and 48.0% fractiles [3,183-3,517 MPa] for MOE and for MOR between the 2.0% and 95.1% fractiles [18.9-25.7 MPa]. Distribution fitting as related to selection of the proper statistical methods is discussed with relevance to estimating the reliability of WPC. The ability to detect statistical differences in the product reliability of WPC between extrusion processes may benefit WPC producers in improving product reliability and safety of this widely used house-decking product. The approach can be applied to many other safety and complex system lifetime comparisons.
International Nuclear Information System (INIS)
Godang, R.; Kinoshita, K.; Lai, I.C.; Pomianowski, P.; Schrenk, S.; Bonvicini, G.; Cinabro, D.; Greene, R.; Perera, L.P.; Zhou, G.J.; Barish, B.; Chadha, M.; Chan, S.; Eigen, G.; Miller, J.S.; OGrady, C.; Schmidtler, M.; Urheim, J.; Weinstein, A.J.; Wuerthwein, F.; Asner, D.M.; Bliss, D.W.; Brower, W.S.; Masek, G.; Paar, H.P.; Prell, S.; Sivertz, M.; Sharma, V.; Gronberg, J.; Hill, T.S.; Kutschke, R.; Lange, D.J.; Menary, S.; Morrison, R.J.; Nelson, H.N.; Nelson, T.K.; Qiao, C.; Richman, J.D.; Roberts, D.; Ryd, A.; Witherell, M.S.; Balest, R.; Behrens, B.H.; Cho, K.; Ford, W.T.; Park, H.; Rankin, P.; Roy, J.; Smith, J.G.; Alexander, J.P.; Bebek, C.; Berger, B.E.; Berkelman, K.; Bloom, K.; Cassel, D.G.; Cho, H.A.; Coffman, D.M.; Crowcroft, D.S.; Dickson, M.; Drell, P.S.; Ecklund, K.M.; Ehrlich, R.; Elia, R.; Foland, A.D.; Gaidarev, P.; Galik, R.S.; Gittelman, B.; Gray, S.W.; Hartill, D.L.; Heltsley, B.K.; Hopman, P.I.; Kandaswamy, J.; Katayama, N.; Kim, P.C.; Kreinick, D.L.; Lee, T.; Liu, Y.; Ludwig, G.S.; Masui, J.; Mevissen, J.; Mistry, N.B.; Ng, C.R.; Nordberg, E.; Ogg, M.; Patterson, J.R.; Peterson, D.; Riley, D.; Soffer, A.; Ward, C.; Athanas, M.; Avery, P.; Jones, C.D.; Lohner, M.; Prescott, C.; Yelton, J.; Zheng, J.; Brandenburg, G.; Briere, R.A.; Gao, Y.S.; Kim, D.Y.; Wilson, R.; Yamamoto, H.
1997-01-01
We use the CLEO detector at the Cornell e + e - storage ring, CESR, to search for the two-photon production of the glueball candidate f J (2220) in its decay to K s K s . We present a restrictive upper limit on the product of the two-photon partial width and the K s K s branching fraction, (Γ γγ B K s K s ) f J(2220) . We use this limit to calculate a lower limit on the stickiness, which is a measure of the two-gluon coupling relative to the two-photon coupling. This limit on stickiness indicates that the f J (2220) has substantial glueball content. copyright 1997 The American Physical Society
Chen, Po Ting; Chao, Yun-Peng
2006-10-01
By systematic investigation, glutamate and a mixture of metal ions were identified as factors limiting the production of nattokinase in Bacillus subtilis. Consequently, in medium supplemented with these materials, the recombinant strain secreted 4 times more nattokinase (260 mg l(-1)) than when grown in the unsupplemented medium.
Modelling antagonic effect of lactic acid eacteria supernatants on some pathogenic bacteria
Directory of Open Access Journals (Sweden)
Augustus Caeser Franke Portella
2009-11-01
Full Text Available This work presents a statistical model of survival analysis for three pathogenic bacterial strains (Escherichia coli, Listeria monocytogenes and Staphylococcus aureus, when treated with neutralized and non-neutralized filtered supernatants broth from cultures of Lactobacillus acidhophilus, Lactobacillus rhamnosus and Lactobacillus sake. Survival analysis is a method employed to determine the period of time from an initial stage up to the occurrence of a particular event of interest, as death or a particular culture growth failure. In order to evaluate the potential efficacy of the ahead mentioned lactic acid bacteria when used as bioprotective starters in foods, experimental data were statistically treated and expressed by simple representative curves. Following the methodology of Cox and Kaplan-Meier, it was possible to make the selection of the best bioprotective lactic starter, as a predictive tool for evaluation of shelf life and prevention of eventual risks in fresh sausages and other similar food products.Este trabalho apresenta um modelo estatístico de análise de sobrevivência para três bactérias patogénicas (Escherichia coli, Listeria monocytogenes e Staphylococcus aureus, quando tratados com sobrenadantes filtrados neutralizado e não neutralizado provenientes de culturas de Lactobacillus acidhophilus, Lactobacillus rhamnosus e Lactobacillus sake. A Análise de sobrevivência é um método utilizado para determinar o período de tempo a partir de uma fase inicial até a ocorrência de um determinado evento de interesse, como a morte ou a inibição de uma particular cultura, a fim de avaliar a eficácia potencial das referidas bactérias lácticas quando usadas como bioproteção em alimentos. Os dados experimentais foram tratados estatisticamente, seguindo a metodologia de Cox e Kaplan-Meier e foi possível fazer a seleção dos melhores fermentos láticos bioprotectivos, como uma ferramenta para avaliação preditiva, vida de
The make or buy debate: Considering the limitations of domestic production in Tanzania
Directory of Open Access Journals (Sweden)
Wilson Kinsley
2012-06-01
Full Text Available Abstract Background In order to ensure their population’s regular access to essential medicines, many least developed countries and developing countries are faced with the policy question of whether to import or manufacture drugs locally, in particular for life-saving antiretroviral medicines for HIV/AIDS patients. In order for domestic manufacturing to be viable and cost-effective, the local industry must be able to compete with international suppliers of medicines by producing sufficiently low cost ARVs. Methods This paper considers the ‘make-or-buy’ dilemma by using Tanzania as a case study. Key informant interviews, event-driven observation, and purposive sampling of documents were used to evaluate the case study. The case study focused on Tanzania’s imitation technology transfer agreement to locally manufacture a first-line ARV (3TC + d4T + NVP, reverse engineering the ARV. Results Tanzania is limited by weak political support for the use of TRIPS flexibilities, limited production capacity for ARVs and limited competitiveness in both domestic and regional markets. The Ministry of Health and Social Welfare encourages the use of flexibilities while others push for increased IP protection. Insufficient production capacity and lack of access to donor-financed tenders make it difficult to obtain economies of scale and provide competitive prices. Conclusions Within the “make-or-buy” context, it was determined that there are significant limitations in domestic manufacturing for developing countries. The case study highlights the difficulty of governments to make use of economies of scale and produce low-cost medicines, attract technology transfer, and utilize the flexibilities of the WTO Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS. The results demonstrate the importance of evaluating barriers to the use of TRIPS flexibilities and long-term planning across sectors in future technology transfer and
The make or buy debate: considering the limitations of domestic production in Tanzania.
Wilson, Kinsley Rose; Kohler, Jillian Clare; Ovtcharenko, Natalia
2012-06-29
In order to ensure their population's regular access to essential medicines, many least developed countries and developing countries are faced with the policy question of whether to import or manufacture drugs locally, in particular for life-saving antiretroviral medicines for HIV/AIDS patients. In order for domestic manufacturing to be viable and cost-effective, the local industry must be able to compete with international suppliers of medicines by producing sufficiently low cost ARVs. This paper considers the 'make-or-buy' dilemma by using Tanzania as a case study. Key informant interviews, event-driven observation, and purposive sampling of documents were used to evaluate the case study. The case study focused on Tanzania's imitation technology transfer agreement to locally manufacture a first-line ARV (3TC + d4T + NVP), reverse engineering the ARV. Tanzania is limited by weak political support for the use of TRIPS flexibilities, limited production capacity for ARVs and limited competitiveness in both domestic and regional markets. The Ministry of Health and Social Welfare encourages the use of flexibilities while others push for increased IP protection. Insufficient production capacity and lack of access to donor-financed tenders make it difficult to obtain economies of scale and provide competitive prices. Within the "make-or-buy" context, it was determined that there are significant limitations in domestic manufacturing for developing countries. The case study highlights the difficulty of governments to make use of economies of scale and produce low-cost medicines, attract technology transfer, and utilize the flexibilities of the WTO Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS). The results demonstrate the importance of evaluating barriers to the use of TRIPS flexibilities and long-term planning across sectors in future technology transfer and manufacturing initiatives.
Pardo-Planas, Oscar; Atiyeh, Hasan K; Prade, Rolf A; Müller, Michael; Wilkins, Mark R
2018-05-01
An A. nidulans strain with a pyridoxine marker was used for continuous production of aryl alcohol oxidase (AAO) in a trickle bed reactor (TBR). Modified medium with reduced zinc, no copper, and 5 g/L ascorbic acid that reduced melanin production and increased AAO productivity under growth limited conditions was used. Two air flow rates, 0.11 L/min (0.1 vvm) and 1.1 L/min (1.0 vvm) were tested. More melanin formation and reduced protein productivity were observed with air flow rate of 1.1 L/min. Three random packings were used as support for the fungus inside the TBR column, two of which were hydrophobic and one which was hydrophilic, and three different dilution rates were tested. The use of GEA BCN 030 hydrophobic packing resulted in greater AAO yield and productivity than the other packings. Increasing dilution rates favored melanin formation and citric, lactic and succinic acid accumulation, which decreased AAO yield and productivity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Arshi, Armin; Sharim, Justin; Park, Don Y; Park, Howard Y; Bernthal, Nicholas M; Yazdanshenas, Hamed; Shamie, Arya N
2017-05-01
Retrospective analysis. To determine the epidemiology and prognostic indicators in patients with chondrosarcoma of the osseous spine. Chondrosarcoma of the spine is rare, with limited data on its epidemiology, clinicopathologic features, and treatment outcomes. Therapy centers on complete en bloc resection with radiotherapy reserved for subtotal resection or advanced disease. The Surveillance, Epidemiology, and End Results Registry was queried for patients with chondrosarcoma of the osseous spine from 1973 to 2012. Study variables included age, sex, race, year of diagnosis, size, grade, extent of disease, and treatment modality. The search identified 973 cases of spinal chondrosarcoma. Mean age at diagnosis was 51.6 years, and 627% of patients were males. Surgical resection and radiotherapy were performed in 75.2% and 21.3% of cases, respectively. Kaplan-Meier analysis demonstrated overall survival (OS) and disease-specific survival (DSS) of 53% and 64%, respectively, at 5 years. Multivariate Cox regression analysis showed that age (OS, P chondrosarcoma of the spine independent of extent of disease. Radiotherapy improves survival in patients with metastatic disease and worsens outcomes in patients with confined and locally invasive disease. 4.
Directory of Open Access Journals (Sweden)
Shingo Hatakeyama
2011-01-01
Full Text Available Vascular access stenosis is a major complication in hemodialysis patients. We prospectively observed 50 patients in whom 50 nitinol shape-memory alloy-recoverable technology (SMART stents were used as salvage therapy for recurrent peripheral venous stenosis. Twenty-five stents each were deployed in native arteriovenous fistula (AVF and synthetic arteriovenous polyurethane graft (AVG cases. Vascular access patency rates were calculated by Kaplan-Meier analysis. The primary patency rates in AVF versus AVG at 3, 6, and 12 months were 80.3% versus 75.6%, 64.9% versus 28.3%, and 32.3% versus 18.9%, respectively. The secondary patency rates in AVF versus AVG at 3, 6, and 12 months were 88.5% versus 75.5%, 82.6% versus 61.8%, and 74.4% versus 61.8%, respectively. Although there were no statistically significant difference in patency between AVF and AVG, AVG showed poor tendency in primary and secondary patency. The usefulness of SMART stents was limited in a short period of time in hemodialysis patients with recurrent vascular access stenosis.
Wei, Xue-Biao; Liu, Yuan-Hui; He, Peng-Cheng; Yu, Dan-Qing; Zhou, Ying-Ling; Tan, Ning; Chen, Ji-Yan
2017-05-01
Background Limited research studies with a large sample size were performed to evaluate the prognostic value of N-terminal pro-B-type natriuretic peptide (NT-proBNP) for in-hospital or long-term poor outcomes in patients with infective endocarditis. Methods A total of 703 patients with infective endocarditis were enrolled and divided into four groups according to admission NT-pro-BNP (pg/mL) quartiles: Q1 (3522). Multivariate regression was used to determine independent risk of NT-proBNP for in-hospital and one-year death. Results In-hospital death occurred in 9.0% of patients. The in-hospital mortality was increased from the lowest to the highest NT-proBNP quartiles (1.1%, 3.4%, 9.1% and 22.3%, P 2260 pg/mL had 76.2% sensitivity and 69.1% specificity for predicting in-hospital death. Kaplan-Meier analysis showed that patients with NT-proBNP > 2260 pg/ml had a worse prognosis than those without (log-rank test 18.84, P endocarditis.
CT volumetric measurement of colorectal cancer helps predict tumor staging and prognosis.
Directory of Open Access Journals (Sweden)
Jin Young Park
Full Text Available To evaluate feasibility of CT colonography (CTC volumetry of colorectal cancer (CRC and its correlation with disease stage and patients' survival.CTC volumetry was performed for 126 patients who underwent preoperative CTC. Reproducibility of tumor volume (Tvol between two readers was assessed. One-way ANOVA and ROC analysis evaluated correlation between Tvol and pTNM staging. ROC analysis compared diagnostic performance to predict pTNM staging between Tvol and radiologist. Kaplan-Meier test compared overall survival.Reproducibility among readers was excellent (interclass correlation = 0.9829. Mean Tvol showed an incremental trend with T stage and Tvol of pT4b stage was significantly larger than other stages (P0.05. Smaller tumor burden (≤12.85cm3, ≤T3, N0, M0 stages, and curative surgery were significantly associated with patients' longer survival (P<0.05.CT volumetry has a limited value to predict N stage; however, it may outperform the radiologist's performance when predicting pT4b and M1b stage and can be a useful prognostic marker.
Su, Ho-Ming; Tsai, Wei-Chung; Lin, Tsung-Hsien; Hsu, Po-Chao; Lee, Wen-Hsien; Lin, Ming-Yen; Chen, Szu-Chia; Lee, Chee-Siong; Voon, Wen-Chol; Lai, Wen-Ter; Sheu, Sheng-Hsiung
2012-01-01
The P wave parameters measured by 12-lead electrocardiogram (ECG) are commonly used as noninvasive tools to assess for left atrial enlargement. There are limited studies to evaluate whether P wave parameters are independently associated with decline in renal function. Accordingly, the aim of this study is to assess whether P wave parameters are independently associated with progression to renal end point of ≥25% decline in estimated glomerular filtration rate (eGFR). This longitudinal study included 166 patients. The renal end point was defined as ≥25% decline in eGFR. We measured two ECG P wave parameters corrected by heart rate, i.e. corrected P wave dispersion (PWdisperC) and corrected P wave maximum duration (PWdurMaxC). Heart function and structure were measured from echocardiography. Clinical data, P wave parameters, and echocardiographic measurements were compared and analyzed. Forty-three patients (25.9%) reached renal end point. Kaplan-Meier curves for renal end point-free survival showed PWdisperC > median (63.0 ms) (log-rank P = 0.004) and PWdurMaxC > median (117.9 ms) (log-rank Pfunction decline.
Directory of Open Access Journals (Sweden)
Tom Stiff
Full Text Available Mutations in ORC1, ORC4, ORC6, CDT1, and CDC6, which encode proteins required for DNA replication origin licensing, cause Meier-Gorlin syndrome (MGS, a disorder conferring microcephaly, primordial dwarfism, underdeveloped ears, and skeletal abnormalities. Mutations in ATR, which also functions during replication, can cause Seckel syndrome, a clinically related disorder. These findings suggest that impaired DNA replication could underlie the developmental defects characteristic of these disorders. Here, we show that although origin licensing capacity is impaired in all patient cells with mutations in origin licensing component proteins, this does not correlate with the rate of progression through S phase. Thus, the replicative capacity in MGS patient cells does not correlate with clinical manifestation. However, ORC1-deficient cells from MGS patients and siRNA-mediated depletion of origin licensing proteins also have impaired centrosome and centriole copy number. As a novel and unexpected finding, we show that they also display a striking defect in the rate of formation of primary cilia. We demonstrate that this impacts sonic hedgehog signalling in ORC1-deficient primary fibroblasts. Additionally, reduced growth factor-dependent signaling via primary cilia affects the kinetics of cell cycle progression following cell cycle exit and re-entry, highlighting an unexpected mechanism whereby origin licensing components can influence cell cycle progression. Finally, using a cell-based model, we show that defects in cilia function impair chondroinduction. Our findings raise the possibility that a reduced efficiency in forming cilia could contribute to the clinical features of MGS, particularly the bone development abnormalities, and could provide a new dimension for considering developmental impacts of licensing deficiency.
Plot showing ATLAS limits on Standard Model Higgs production in the mass range 100-600 GeV
ATLAS Collaboration
2011-01-01
The combined upper limit on the Standard Model Higgs boson production cross section divided by the Standard Model expectation as a function of mH is indicated by the solid line. This is a 95% CL limit using the CLs method in the entire mass range. The dotted line shows the median expected limit in the absence of a signal and the green and yellow bands reflect the corresponding 68% and 95% expected
Plot showing ATLAS limits on Standard Model Higgs production in the mass range 110-150 GeV
ATLAS Collaboration
2011-01-01
The combined upper limit on the Standard Model Higgs boson production cross section divided by the Standard Model expectation as a function of mH is indicated by the solid line. This is a 95% CL limit using the CLs method in in the low mass range. The dotted line shows the median expected limit in the absence of a signal and the green and yellow bands reflect the corresponding 68% and 95% expected
Bioenergy production and sustainable development: science base for policymaking remains limited.
Robledo-Abad, Carmenza; Althaus, Hans-Jörg; Berndes, Göran; Bolwig, Simon; Corbera, Esteve; Creutzig, Felix; Garcia-Ulloa, John; Geddes, Anna; Gregg, Jay S; Haberl, Helmut; Hanger, Susanne; Harper, Richard J; Hunsberger, Carol; Larsen, Rasmus K; Lauk, Christian; Leitner, Stefan; Lilliestam, Johan; Lotze-Campen, Hermann; Muys, Bart; Nordborg, Maria; Ölund, Maria; Orlowsky, Boris; Popp, Alexander; Portugal-Pereira, Joana; Reinhard, Jürgen; Scheiffle, Lena; Smith, Pete
2017-03-01
The possibility of using bioenergy as a climate change mitigation measure has sparked a discussion of whether and how bioenergy production contributes to sustainable development. We undertook a systematic review of the scientific literature to illuminate this relationship and found a limited scientific basis for policymaking. Our results indicate that knowledge on the sustainable development impacts of bioenergy production is concentrated in a few well-studied countries, focuses on environmental and economic impacts, and mostly relates to dedicated agricultural biomass plantations. The scope and methodological approaches in studies differ widely and only a small share of the studies sufficiently reports on context and/or baseline conditions, which makes it difficult to get a general understanding of the attribution of impacts. Nevertheless, we identified regional patterns of positive or negative impacts for all categories - environmental, economic, institutional, social and technological. In general, economic and technological impacts were more frequently reported as positive, while social and environmental impacts were more frequently reported as negative (with the exception of impacts on direct substitution of GHG emission from fossil fuel). More focused and transparent research is needed to validate these patterns and develop a strong science underpinning for establishing policies and governance agreements that prevent/mitigate negative and promote positive impacts from bioenergy production.
International Nuclear Information System (INIS)
Cook, J.R.
2001-01-01
This Special Analysis (SA) develops revised radionuclide inventory limits for trench disposal of low-level radioactive waste in the presence of wood products in the E-Area Low-Level Waste Facility. These limits should be used to modify the Waste Acceptance Criteria (WAC) for trench disposal. Because the work on which this SA is based employed data from tests using 100 percent wood products, the 40 percent limitation on wood products for trench (i.e., slit or engineered trench) disposal is not needed in the modified WAC
2010-07-01
... compliance with the emission limits for tire cord production affected sources? 63.6006 Section 63.6006... Hazardous Air Pollutants: Rubber Tire Manufacturing Continuous Compliance Requirements for Tire Cord... tire cord production affected sources? (a) You must demonstrate continuous compliance with each...
Directory of Open Access Journals (Sweden)
P. Wang
2007-07-01
Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.
Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele
2017-07-01
Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.
International Nuclear Information System (INIS)
Craighead, Peter S.; Smulian, Hubert G.; Groot, Henk J. de; Toit, Pierre F.M. du
1997-01-01
Purpose: To compare patient demographics, treatment resources, practice patterns, and outcome results for squamous cell carcinoma of the uterine cervix (SCC) between the 1978 and 1983 Patterns of Care studies (PCS) in the United States of America (USA) and a nonacademic center within a developing country. Methods and Materials: Patient details (race, age, stage, and number per year), treatment used, and treatment outcome were retrieved from the charts of the 1160 cases registered at this center with SCC of the cervix between 1976 and 1985. Demographic variables and Kaplan-Meier survival estimates were calculated and compared with results from published PCS reviews. Results: There is a significant difference in the racial group presentation of cervix cancer at this center compared with the PCS reviews (p < 0.005), and median ages are significantly lower at this center (t = p < 0.001). The proportion of patients with Stage III or more was significantly higher at this center than the PCS centers (24 vs. 47%, p < 0.001). There were also vast differences in facility resources. Fewer cases at this center underwent intracavitary insertions than at PCS centers. Mean Point A doses were significantly reduced for this center compared with the PCS reviews. Kaplan-Meier estimates were similar for Stage I and II in PCS centers and this center, but were inferior for this center in Stage III patients (p < 0.05 for OS and p < 0.01 for LC). Late morbidity rates were similar for both PCS centers and this center. Conclusion: PCS recommendations may be applicable to nonacademic centers within developing countries, if the latter use staging techniques that are consistent with the PCS staging guidelines
Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping
2017-10-01
Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.
Boynton, Grace E; Raoof, Duna; Niziol, Leslie M; Hussain, Munira; Mian, Shahzad I
2015-07-01
To evaluate the safety and efficacy of topical loteprednol etabonate (LE) 0.5% compared with cyclosporine A (CsA) 0.05% for the prophylaxis and treatment of dry eye syndrome (DES) after hematopoietic stem cell transplantation (HSCT). Seventy-five patients were randomized to LE (n = 76 eyes of 38 patients) or CsA (n = 74 eyes of 37 patients) pre-HSCT. Lissamine green and fluorescein staining, tear break-up time, tear osmolarity (Osm), Schirmer score (Sch), intraocular pressure, visual acuity, and Ocular Surface Disease Index were assessed pre-HSCT, 3, 6, 9, and 12 months post-HSCT. There were no differences in DES incidence (P = 0.22; log-rank test) or progression (P = 0.41; log-rank test) between the 2 treatment arms during the course of the study. Among eyes with no DES at enrollment, the Kaplan-Meier analysis yielded a 90% rate of DES development in cyclosporine-treated eyes and a 79% rate of DES development in LE-treated eyes by 12 months post-HSCT. The Kaplan-Meier analysis of eyes with DES at enrollment demonstrated a 38% rate of disease progression among cyclosporine-treated eyes and a 26% rate of disease progression among loteprednol-treated eyes by 12 months. No patient in either group had an elevation of 10 mm Hg or greater from baseline at any study visit, and no patients had their treatment discontinued for elevation in intraocular pressure. Pre-HSCT initiation of LE 0.5% appears to be safe and may be as effective as CsA 0.5% for the treatment and prophylaxis of DES following HSCT.
Shah, Saloni; Kim, Jane P; Park, Dong Yeon; Kim, Hyun; Yuen, Laura D; Do, Dennis; Dell'Osso, Bernardo; Hooshmand, Farnaz; Miller, Shefali; Wang, Po W; Ketter, Terence A
2017-09-01
To assess differential relationships between lifetime anxiety disorder/current anxiety symptoms and longitudinal depressive severity in bipolar disorder (BD). Stanford BD Clinic outpatients enrolled during 2000-2011 were assessed with the Systematic Treatment Enhancement Program for BD (STEP-BD) Affective Disorders Evaluation and followed with the STEP-BD Clinical Monitoring Form while receiving naturalistic treatment for up to two years. Baseline unfavorable illness characteristics/current mood symptoms and times to depressive recurrence/recovery were compared in patients with versus without lifetime anxiety disorder/current anxiety symptoms. Among 105 currently recovered patients, lifetime anxiety disorder was significantly associated with 10/27 (37.0%) demographic/other unfavorable illness characteristics/current mood symptoms/current psychotropics, hastened depressive recurrence (driven by earlier onset age), and a significantly (> two-fold) higher Kaplan-Meier estimated depressive recurrence rate, whereas current anxiety symptoms were significantly associated with 10/27 (37.0%) demographic/other unfavorable illness characteristics/current mood symptoms/current psychotropics and hastened depressive recurrence (driven by lifetime anxiety disorder), but only a numerically higher Kaplan-Meier estimated depressive recurrence rate. In contrast, among 153 currently depressed patients, lifetime anxiety disorder/current anxiety symptoms were not significantly associated with time to depressive recovery or depressive recovery rate. American tertiary BD clinic referral sample, open naturalistic treatment. Research is needed regarding differential relationships between lifetime anxiety disorder and current anxiety symptoms and hastened/delayed depressive recurrence/recovery - specifically whether lifetime anxiety disorder versus current anxiety symptoms has marginally more robust association with hastened depressive recurrence, and whether both have marginally more robust
Vogl, Vanessa; Hiller, Karl-Anton; Buchalla, Wolfgang; Federlin, Marianne; Schmalz, Gottfried
2016-12-01
A new universal adhesive with corresponding luting composite was recently marketed which can be used both, in a self-etch or in an etch-and-rinse mode. In this study, the clinical performance of partial ceramic crowns (PCCs) inserted with this adhesive and the corresponding luting material used in a self-etch or selective etch approach was compared with a self-adhesive universal luting material. Three PCCs were placed in a split-mouth design in 50 patients. Two PCCs were luted with a combination of a universal adhesive/resin cement (Scotchbond Universal/RelyX Ultimate, 3M ESPE) with (SB+E)/without (SB-E) selective enamel etching. Another PCC was luted with a self-adhesive resin cement (RelyX Unicem 2, 3M ESPE). Forty-eight patients were evaluated clinically according to FDI criteria at baseline and 6, 12 and 18 months. For statistical analyses, the chi-square test (α = 0.05) and Kaplan-Meier analysis were applied. Clinically, no statistically significant differences between groups were detected over time. Within groups, clinically significant increase for criterion "marginal staining" was detected for SB-E over 18 months. Kaplan-Meier analysis revealed significantly higher retention rates for SB+E (97.8 %) and SB-E (95.6 %) in comparison to RXU2 (75.6 %). The 18-month clinical performance of a new universal adhesive/composite combination showed no differences with respect to bonding strategy and may be recommended for luting PCCs. Longer-term evaluation is needed to confirm superiority of SB+E over SB-E. At 18 months, the new multi-mode adhesive, Scotchbond Universal, showed clinically reliable results when used for luting PCCs.
Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng
2017-10-01
A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.
Energy Technology Data Exchange (ETDEWEB)
Ulyte, Agne [Vilnius University, Faculty of Medicine, Vilnius (Lithuania); Katsaros, Vasileios K. [General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Advanced Imaging Modalities - CT and MRI, Athens (Greece); University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Liouta, Evangelia; Stranjalis, Georgios [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Boskos, Christos [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Radiation Oncology, Athens (Greece); Papanikolaou, Nickolas [Champalimaud Foundation, Department of Radiology, Centre for the Unknown, Lisbon (Portugal); Usinskiene, Jurgita [National Cancer Institute, Vilnius (Lithuania); Affidea Lietuva, Vilnius (Lithuania); Bisdas, Sotirios [University College London Hospitals, Department of Neuroradiology, The National Hospital for Neurology and Neurosurgery, London (United Kingdom)
2016-12-15
The prognostic value of the dynamic contrast-enhanced (DCE) MRI perfusion and its histogram analysis-derived metrics is not well established for high-grade glioma (HGG) patients. The aim of this prospective study was to investigate DCE perfusion transfer coefficient (K{sup trans}), vascular plasma volume fraction (v{sub p}), extracellular volume fraction (v{sub e}), reverse transfer constant (k{sub ep}), and initial area under gadolinium concentration time curve (IAUGC) as predictors of progression-free (PFS) and overall survival (OS) in HGG patients. Sixty-nine patients with suspected anaplastic astrocytoma or glioblastoma underwent preoperative DCE-MRI scans. DCE perfusion whole tumor region histogram parameters, clinical details, and PFS and OS data were obtained. Univariate, multivariate, and Kaplan-Meier survival analyses were conducted. Receiver operating characteristic (ROC) curve analysis was employed to identify perfusion parameters with the best differentiation performance. On univariate analysis, v{sub e} and skewness of v{sub p} had significant negative impacts, while k{sub ep} had significant positive impact on OS (P < 0.05). v{sub e} was also a negative predictor of PFS (P < 0.05). Patients with lower v{sub e} and IAUGC had longer median PFS and OS on Kaplan-Meier analysis (P < 0.05). K{sup trans} and v{sub e} could also differentiate grade III from IV gliomas (area under the curve 0.819 and 0.791, respectively). High v{sub e} is a consistent predictor of worse PFS and OS in HGG glioma patients. v{sub p} skewness and k{sub ep} are also predictive for OS. K{sup trans} and v{sub e} demonstrated the best diagnostic performance for differentiating grade III from IV gliomas. (orig.)
Directory of Open Access Journals (Sweden)
Hee Jin Lee
Full Text Available Several methods are used to assess the pathologic response of breast cancer after neoadjuvant chemotherapy (NAC to predict clinical outcome. However, the clinical utility of these systems for each molecular subtype of breast cancer is unclear. Therefore, we applied six pathologic response assessment systems to specific subtypes of breast cancer and compared the results.Five hundred and eighty eight breast cancer patients treated with anthracycline with/without taxane-based NAC were retrospectively analyzed, and the ypTNM stage, residual cancer burden (RCB, residual disease in breast and nodes (RDBN, tumor response ratio, Sataloff's classification, and Miller-Payne grading system were evaluated. The results obtained for each assessment system were analyzed in terms of patient survival.In triple-negative tumors, all systems were significantly associated with disease-free survival and Kaplan-Meier survival curves for disease-free survival were clearly separated by all assessment methods. For HR+/HER2- tumors, systems assessing the residual tumor (ypTNM stage, RCB, and RDBN had prognostic significance. However, for HER2+ tumors, the association between patient survival and the pathologic response assessment results varied according to the system used, and none resulted in distinct Kaplan-Meier curves.Most of the currently available pathologic assessment systems used after anthracycline with/without taxane-based NAC effectively classified triple-negative breast cancers into groups showing different prognoses. The pathologic assessment systems evaluating residual tumors only also had prognostic significance in HR+/HER2- tumors. However, new assessment methods are required to effectively evaluate the pathologic response of HR+/HER2+ and HR-/HER2+ tumors to anthracycline with/without taxane-based NAC.
International Nuclear Information System (INIS)
Barney, Brandon M.; Petersen, Ivy A.; Mariani, Andrea; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.
2013-01-01
Objectives: The optimal adjuvant therapy for International Federation of Gynecology and Obstetrics (FIGO) stage I papillary serous (UPSC) or clear cell (CC) endometrial cancer is unknown. We report on the largest single-institution experience using adjuvant high-dose-rate vaginal brachytherapy (VBT) for surgically staged women with FIGO stage I UPSC or CC endometrial cancer. Methods and Materials: From 1998-2011, 103 women with FIGO 2009 stage I UPSC (n=74), CC (n=21), or mixed UPSC/CC (n=8) endometrial cancer underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy followed by adjuvant high-dose-rate VBT. Nearly all patients (n=98, 95%) also underwent extended lymph node dissection of pelvic and paraortic lymph nodes. All VBT was performed with a vaginal cylinder, treating to a dose of 2100 cGy in 3 fractions. Thirty-five patients (34%) also received adjuvant chemotherapy. Results: At a median follow-up time of 36 months (range, 1-146 months), 2 patients had experienced vaginal recurrence, and the 5-year Kaplan Meier estimate of vaginal recurrence was 3%. The rates of isolated pelvic recurrence, locoregional recurrence (vaginal + pelvic), and extrapelvic recurrence (including intraabdominal) were similarly low, with 5-year Kaplan-Meier estimates of 4%, 7%, and 10%, respectively. The estimated 5-year overall survival was 84%. On univariate analysis, delivery of chemotherapy did not affect recurrence or survival. Conclusions: VBT is effective at preventing vaginal relapse in women with surgical stage I UPSC or CC endometrial cancer. In this cohort of patients who underwent comprehensive surgical staging, the risk of isolated pelvic or extrapelvic relapse was low, implying that more extensive adjuvant radiation therapy is likely unnecessary.
Dowen, Frances; Sidhu, Karishma; Broadbent, Elizabeth; Pilmore, Helen
2017-09-21
Mortality in end stage renal disease (ESRD) is higher than many malignancies. There is no data about the optimal way to present information about projected survival to patients with ESRD. In other areas, graphs have been shown to be more easily understood than narrative. We examined patient comprehension and perspectives on graphs in communicating projected survival in chronic kidney disease (CKD). One hundred seventy-seven patients with CKD were shown 4 different graphs presenting post transplantation survival data. Patients were asked to interpret a Kaplan Meier curve, pie chart, histogram and pictograph and answer a multi-choice question to determine understanding. We measured interpretation, usefulness and preference for the graphs. Most patients correctly interpreted the graphs. There was asignificant difference in the percentage of correct answers when comparing different graph types (p = 0.0439). The pictograph was correctly interpreted by 81% of participants, the histogram by 79%, pie chart by 77% and Kaplan Meier by 69%. Correct interpretation of the histogram was associated with educational level (p = 0.008) and inversely associated with age > 65 (p = 0.008). Of those who interpreted all four graphs correctly, there was an association with employment (p = 0.001) and New Zealand European ethnicity (p = 0.002). 87% of patients found the graphs useful. The pie chart was the most preferred graph (p 0.002). The readability of the graphs may have been improved with an alternative colour choice, especially in the setting of visual impairment. Visual aids, can be beneficial adjuncts to discussing survival in CKD.
Rao, Zilong; Zheng, Huaguang; Wang, Fei; Wang, Anxin; Liu, Liping; Dong, Kehui; Zhao, Xingquan; Wang, Yilong; Cao, Yibin
2017-08-01
To evaluate the role of HTPR in predicting early recurrence of ischemic events in patients with minor ischemic stroke or high-risk TIA. From January 2014 to September 2014, a single center continuously enrolled patients with minor ischemic stroke or high-risk TIA and gave them antiplatelet therapy consisting of aspirin with clopidogrel. HTPR was assessed by TEG after 7 days of antiplatelet therapy and detected CYP2C19 genotype. The incidence of recurrent ischemic events was assessed 3 months after onset. The incidence of recurrent ischemic events was compared between the HTPR and NTPR groups with the Kaplan-Meier method, and multivariate Cox proportional hazards models were used to determine the risk factors associated with recurrent ischemic events. We enrolled 278 eligible patients with minor ischemic stroke or high-risk TIA. Through TEG testing, patients with HTPR were 22.7%, and carriers were not associated with HTPR to ADP by TEG-ADP(%) (p = 0.193). A total of 265 patients completed 3 months of follow-up, and Kaplan-Meier analysis showed that patients with HTPR had a higher percentage of recurrent ischemic events compared with patients with NTPR (p = 0.002). In multivariate Cox proportional hazards models, history of ischemic stroke or TIA (HR 4.45, 95% CI 1.77-11.16, p = 0.001) and HTPR (HR 3.34, 95% CI 1.41-7.91, p = 0.006) was independently associated with recurrent ischemic events. In patients with minor stroke or TIA, the prevalence of HTPR was 22.7%, and HTPR was independently associated with recurrent ischemic events.
Cruz-Oliver, D M; Malmstrom, T K; Allen, C M; Tumosa, N; Morley, J E
2012-07-01
To evaluate predictive validity of cognitive dysfunction of the Saint Louis University mental status (SLUMS) exam or mini-mental state exam (MMSE) for institutionalization and mortality after 7.5-years. Longitudinal study. Geriatric Research, Education and Clinical Center Veterans Affairs Hospital St. Louis, MO. Patients (N=705) were screened for cognitive dysfunction in 2003 using the SLUMS exam and MMSE, and mortality and institutionalization up to 7.5-years later were evaluated as outcome measures. The associations between outcome measures and MMSE and SLUMS exam total scores, and cognitive status were examined using Kaplan-Meier curves and Cox proportional-hazards regression. Five hundred thirty-three charts were reviewed, 176/533(33%) patients had died and 31/526 (6%) were institutionalized during 7.5-year follow-up period. All subjects were male with a mean age of 75 years and most had high school education or greater (71%). MMSE dementia, SLUMS dementia (ps<.001) and MCI (p<.05) groups had significantly lower survival rates than normal cognition group in the Kaplan-Meier curves. Scores classified as dementia on SLUMS (HR=2.4, 95% CI 1.6-3.7; p <.001) or MMSE (HR=2.3, 95% CI 1.5-3.6; p <.001) both predicted mortality and, also, institutionalization (SLUMS: HR=3.5, 95% CI 1.3-9.1; p <.01; MMSE: HR=3.8, 95% CI 1.6-9.0; p <.001) after adjustment for covariates. Unadjusted SLUMS exam MCI predicted morality (HR=1.5, 95% CI 1.1-2.2; p <.019) but not institutionalization. The SLUMS exam and MMSE both predict mortality and institutionalization for male patients screened as positive for dementia.
Evaluation of success after second Ahmed glaucoma valve implantation.
Nilforushan, Naveed; Yadgari, Maryam; Jazayeri, Anis Alsadat; Karimi, Nasser
2016-03-01
To evaluate the outcome of the second Ahmed glaucoma valve (AGV) surgery in eyes with failed previous AGV surgery. Retrospective case series. Following chart review, 36 eyes of 34 patients with second AGV implantation were enrolled in this study. The primary outcome measure was surgical success defined in terms of intraocular pressure (IOP) control using two criteria: Success was defined as IOP ≤21 mmHg (criterion 1) and IOP ≤16 mmHg (criterion 2), with at least 20% reduction in IOP, either with no medication (complete success) or with no more than two medications (qualified success). Kaplan-Meier survival analysis was used to determine the probability of surgical success. The average age of the patients was 32.7 years (range 4-65), and the mean duration of follow-up was 21.4 months (range 6-96). Preoperatively, the mean IOP was 26.94 mmHg (standard deviation [SD] 7.03), and the patients were using 2.8 glaucoma medications on average (SD 0.9). The mean IOP decreased significantly to 13.28 mmHg (SD 3.59) at the last postoperative visit (P = 0.00) while the patients needed even fewer glaucoma medications on average (1.4 ± 1.1, P = 0.00). Surgical success of second glaucoma drainage devices (Kaplan-Meier analysis), according to criterion 1, at 6, 12, 18, and 42 months was 94%, 85%, 80%, and 53% respectively, and according to criterion 2, was 94%, 85%, 75%, and 45%, respectively. Repeated AGV implantation seems to be a safe modality of treatment with acceptable success rate in cases with failed previous AGV surgery.
International Nuclear Information System (INIS)
Hanks, Gerald E.; Hanlon, Alexandra L. M.S.; Schultheiss, Timothy E.; Pinover, Wayne H.; Movsas, Benjamin; Epstein, Barry E.; Hunt, Margie
1998-01-01
Purpose: To report the 5-year outcomes of dose escalation with 3D conformal treatment (3DCRT) of prostate cancer. Methods and Materials: Two hundred thirty-two consecutive patients were treated with 3DCRT alone between 6/89 and 10/92 with ICRU reporting point dose that increased from 63 to 79 Gy. The median follow-up was 60 months, and any patient free of clinical or biochemical evidence of disease was termed bNED. Biochemical failure was defined as prostate-specific antigen (PSA) rising on two consecutive recordings and exceeding 1.5 ng/ml. Morbidity was reported by the Radiation Therapy Oncology Group (RTOG) scale, the Late Effects Normal Tissue (LENT) scale, and a Fox Chase modification of the latter (FC-LENT). All patients were treated with a four-field technique with a 1 cm clinical target volume (CTV) to planning target volume (PTV) margin to the prostate or prostate boost; the CTV and gross tumor volume (GTV) were the same. Actuarial rates of outcome were calculated by Kaplan-Meier and cumulative incidence methods and compared using the log rank and Gray's test statistic, respectively. Cox regression models were used to establish prognostic factors predictive of the various measures of outcome. Five-year Kaplan-Meier bNED rates were utilized by dose group to estimate logit response models for bNED and late morbidity. Results: PSA 10 ng/ml based on 5-year bNED results. No dose response was observed for patients with pretreatment PSA 10 ng/ml strongly suggests that clinical trials employing radiation should investigate the use of 3DCRT and prostate doses of 76-80 Gy
Directory of Open Access Journals (Sweden)
Asaho Nishizawa
Full Text Available To evaluate the influence of phacoemulsification after trabeculectomy on the postoperative intraocular pressure (IOP in eyes with uveitic glaucoma (UG.Kumamoto University Hospital, Kumamoto, Japan.A retrospective cohort study.The medical records of patients with UG who had trabeculectomy with mitomycin-C (MMC were reviewed. Complete and qualified surgical failures were defined by an IOP of ≥21 mmHg (condition A, ≥18 mmHg (condition B, or ≥15 mmHg (condition C without and with glaucoma eye drops, respectively. Kaplan-Meier survival analysis, generalized by the Wilcoxon test, and the Cox proportional hazards model analysis were conducted. Post-trabeculectomy phacoemulsification was treated as a time-dependent variable. In 24 (30% of the included 80 eyes, phacoemulsification was included, and they were divided into two groups: groups I (8 eyes with phacoemulsification within 1 year after trabeculectomy and group II (16 eyes after 1 year following trabeculectomy.Multivariable Cox proportional hazards model analysis showed post-trabeculectomy phacoemulsification was a significant factor in both complete success and qualified success based upon condition C (P = 0.0432 and P = 0.0488, respectively, but not for the other conditions. Kaplan-Meier survival analyses indicated significant differences in success probabilities between groups I and group II for complete success and qualified success based upon condition C (P = 0.020 and P = 0.013, respectively. There was also a significant difference for qualified success based upon condition B (P = 0.034, while there was no significant difference for the other conditions.Post-trabeculectomy phacoemulsification, especially within 1 year, can cause poor prognosis of IOP control of UG eyes after trabeculectomy with MMC.
Sammour, Tarik; Malakorn, Songphol; Bednarski, Brian K; Kaur, Harmeet; Shin, Ui Sup; Messick, Craig; You, Yi-Qian Nancy; Chang, George J
2018-03-01
The aim of this study is to evaluate the oncological outcomes of robotic total mesorectal excision (TME) at an NCI designated cancer center. The effectiveness of laparoscopic TME could not be established, but the robotic-assisted approach may hold some promise, with improved visualization and ergonomics for pelvic dissection. Oncological outcome data is presently lacking. Patients who underwent total mesorectal excision or tumor-specific mesorectal excision for rectal cancer between April 2009 and April 2016 via a robotic approach were identified from a prospective single-institution database. The circumferential resection margin (CRM), distal resection margin, and TME completeness rates were determined. Kaplan-Meier analysis of disease-free survival and overall survival was performed for all patients treated with curative intent. A total of 276 patients underwent robotic proctectomy during the study period. Robotic surgery was performed initially by 1 surgeon with 3 additional surgeons progressively transitioning from open to robotic during the study period with annual increase in the total number of cases performed robotically. Seven patients had involved circumferential resection margins (2.5%), and there were no positive distal or proximal resection margins. One hundred eighty-six patients had TME quality assessed, and only 1 patient (0.5%) had an incomplete TME. Eighty-three patients were followed up for a minimum of 3 years, with a local recurrence rate of 2.4%, and a distant recurrence rate of 16.9%. Five-year disease-free survival on Kaplan-Meier analysis was 82%, and 5-year overall survival was 87%. Robotic proctectomy for rectal cancer can be performed with good short and medium term oncological outcomes in selected patients.
Directory of Open Access Journals (Sweden)
Anissa Gramatges Ortiz
2002-08-01
Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated
Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco
2015-12-01
This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.
International Nuclear Information System (INIS)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel; Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano; Mar Munoz Sanchez, Maria del; Alvarez Cabellos, Ruth; Espinosa Aunion, Ruth
2015-01-01
To explore the relationship between basal 18 F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent 18 F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with 18 F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Adjuvant Ab Interno Tumor Treatment After Proton Beam Irradiation.
Seibel, Ira; Riechardt, Aline I; Heufelder, Jens; Cordini, Dino; Joussen, Antonia M
2017-06-01
This study was performed to show long-term outcomes concerning globe preservation in uveal melanoma patients after proton beam therapy with the main focus on outcomes according to different adjuvant ab interno surgical procedures. Retrospective cohort study. All patients treated with primary proton beam therapy for choroidal or ciliary body melanoma between June 1998 and June 2015 were included. A total of 2499 patients underwent primary proton beam therapy, with local tumor control and globe preservation rates of 95.9% and 94.8% after 5 years, respectively. A total of 110 (4.4%) patients required secondary enucleation. Unresponsive neovascular glaucoma was the leading cause of secondary enucleation in 78 of the 2499 patients (3.1%). The 5-year enucleation-free survival rate was 94.8% in the endoresection group, 94.3% in the endodrainage group, and 93.5% in the comparator group. The log-rank test showed P = .014 (comparator group vs endoresection group) and P = .06 (comparator group vs endodrainage-vitrectomy group). Patients treated with endoresection or endodrainage-vitrectomy developed less radiation retinopathy (30.5% and 37.4% after 5 years, P = .001 and P = .048 [Kaplan-Meier], respectively) and less neovascular glaucoma (11.6% and 21.3% after 5 years, P = .001 and P = .01 [Kaplan-Meier], respectively) compared with the comparator group (52.3% radiation retinopathy and 57.8% neovascular glaucoma after 5 years). This study suggests that in larger tumors the enucleation and neovascular glaucoma rates might be reduced by adjuvant surgical procedures. Although endoresection is the most promising adjuvant treatment option, the endodrainage-vitrectomy is recommended in patients who are ineligible for endoresection. Copyright © 2017 Elsevier Inc. All rights reserved.
Adjuvant Medications That Improve Survival after Locoregional Therapy.
Boas, F Edward; Ziv, Etay; Yarmohammadi, Hooman; Brown, Karen T; Erinjeri, Joseph P; Sofocleous, Constantinos T; Harding, James J; Solomon, Stephen B
2017-07-01
To determine if outpatient medications taken at the time of liver tumor embolization or ablation affect survival. A retrospective review was done of 2,032 liver tumor embolization, radioembolization, and ablation procedures performed in 1,092 patients from June 2009 to April 2016. Pathology, hepatocellular carcinoma (HCC) stage (American Joint Committee on Cancer), neuroendocrine tumor (NET) grade, initial locoregional therapy, overall survival after initial locoregional therapy, Child-Pugh score, Eastern Cooperative Oncology Group performance status, Charlson Comorbidity Index, and outpatient medications taken at the time of locoregional therapy were analyzed for each patient. Kaplan-Meier survival curves were calculated for patients taking 29 medications or medication classes (including prescription and nonprescription medications) for reasons unrelated to their primary cancer diagnosis. Kaplan-Meier curves were compared using the log-rank test. For patients with HCC initially treated with embolization (n = 304 patients), the following medications were associated with improved survival when taken at the time of embolization: beta-blockers (P = .0007), aspirin (P = .0008) and other nonsteroidal antiinflammatory drugs (P = .009), proton pump inhibitors (P = .004), and antivirals for hepatitis B or C (P = .01). For colorectal liver metastases initially treated with ablation (n = 172 patients), beta-blockers were associated with improved survival when taken at the time of ablation (P = .02). Aspirin and beta-blockers are associated with significantly improved survival when taken at the time of embolization for HCC. Aspirin was not associated with survival differences after locoregional therapy for NET or colorectal liver metastases, suggesting an HCC-specific effect. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuh-Fang Chen
Full Text Available PURPOSE: To study the association between retinitis pigmentosa (RP and the progression of diabetic retinopathy (DR. METHODS: Using the Longitudinal Health Insurance Database 2000 of Taiwan, we identified individuals with an initial diagnosis for RP during the period of 1997-2008. A non-RP comparison group, 10-fold frequency matched by sex, age, index year and the year of diabetes diagnosed, were randomly selected from the same database. The occurrence of DR was observed for all subjects until the end of 2009. The Kaplan-Meier curves were used to illustrate the cumulative probability of developing DR for the RP group and comparison groups. The hazard ratio (HR of DR for the RP group relative to the comparison group was estimated using Cox proportional hazards model after adjusting for potential confounders. RESULTS: The Kaplan-Meier curves were not statistically significant different between the RP group and the comparison group. However, the RP group had a higher cumulative probability of developing DR during the first six to seven years. The cumulative probability kept increasing and became higher in the comparison group but remained unchanged in the RP group. The HR for the RP patients comparing with the comparison group was 0.96 (95% confidence interval (CI = 0.43-2.14. Stratified by severity, RP was associated with a non-statistically significant reduced risk of proliferative DR (PDR (HR = 0.70, 95% CI = 0.16-3.14. The HR for non-proliferative DR (NPDR was 1.08 (95% CI = 0.40-2.86. CONCLUSION: In this study, RP was not statistically significant associated with the incidence of DR.
High Expression of PHGDH Predicts Poor Prognosis in Non–Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Jinhong Zhu
2016-12-01
Full Text Available Tumors have exceptionally high demands for energy and anabolism because of their rapid growth. The de novo serine synthesis pathway initiated by phosphoglycerate dehydrogenase (PHGDH has been recognized as a hallmark of metabolic adaption in carcinogenesis. The oncogenic role and prognostic value of PHGDH have been investigated in multiple cancer types, including breast cancer, melanoma, cervical cancer, and colon cancer. Due to the importance of PHGDH in cancer, we attempted to determine the clinical significance of PHGDH in 319 patients with non–small cell lung cancer (NSCLC. We evaluated the mRNA and protein expression levels of PHGDH gene, using quantitative reverse transcriptase polymerase chain reaction and tissue array–based immunohistochemistry, respectively. Significantly increased PHGDH expression in mRNA and protein levels was identified in tumor tissues versus matched adjacent nontumor tissues. More interestingly, immunohistochemical expression of PHGDH was significantly associated with lymph node metastasis (P = .021 and TNM stage (P = .016. Kaplan-Meier survival analysis indicated that NSCLC patients with low levels of PHGDH outperformed patients with high levels of PHGDH regarding 5-year overall survival. Significantly longer survival in the former suggested the prognostic implication of PHGDH in NSCLC. Multivariate survival analysis using Cox regression model demonstrated that high PHGDH levels and advanced TNM stage (III + IV were independent predictors of prognosis in NSCLC. Moreover, bioinformatics analysis confirmed the increase in PHGDH transcripts (data from The Cancer Genome Atlas and its prognostic value (Kaplan-Meier plotter in NSCLC. In conclusion, this study suggested the clinical implication of PHGDH in NSCLC. PHGDH may be a promising therapeutic target in NSCLC.
Energy Technology Data Exchange (ETDEWEB)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel [University General Hospital, Nuclear Medicine Department, Ciudad Real (Spain); Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano [University of Castilla-La Mancha, Department of Mathematics, Ciudad Real (Spain); Mar Munoz Sanchez, Maria del [Virgen de la Luz Hospital, Oncology Department, Cuenca (Spain); Alvarez Cabellos, Ruth [Virgen de la Salud Hospital, Oncology Department, Toledo (Spain); Espinosa Aunion, Ruth [La Mancha Centro Hospital, Oncology Department, Ciudad Real (Spain)
2015-11-15
To explore the relationship between basal {sup 18}F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent {sup 18}F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with {sup 18}F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Retrospective analysis of dental implants placed and restored by advanced prosthodontic residents.
Barias, Pamela A; Lee, Damian J; Yuan, Judy Chia-Chun; Sukotjo, Cortino; Campbell, Stephen D; Knoernschild, Kent L
2013-02-01
The purposes of this retrospective clinical review were to: (1) describe the demographics of implant patients, types of implant treatment and implant-supported prostheses in an Advanced Education in Prosthodontic Program, (2) evaluate the survival rate of dental implants placed by prosthodontic residents from 2006 to 2008, and (3) analyze the relationship between resident year of training and implant survival rate. All patients who received dental implants placed by prosthodontic residents from January 2006 to October of 2008 in the Advanced Prosthodontic Program at the University of Illinois at Chicago College of Dentistry were selected for this study. Age, gender, implant diameter, length, implant locations, surgical and restorative detail, and year of prosthodontic residency training were collected and analyzed. Life-table and Kaplan-Meier survival analyses were performed based on implants overall, locations, year of training, and use of a computer-generated surgical guide. A Logrank statistic was performed between implant survival and year of prosthodontic residency training, location, and use of computer-generated surgical guide (α= 0.05). Three hundred and six implants were placed, and of these, seven failed. Life-table and Kaplan-Meier analyses computed a cumulative survival rate (CSR) of 97% for overall implants and implants placed with a computer-generated surgical guide. No statistical difference was found in implant survival rates as a function of year of training (P= 0.85). Dental implants placed by prosthodontic residents had a CSR comparable to previously published studies by other specialties. The year of prosthodontic residency training and implant failure rate did not have any significant relationship. © 2012 by the American College of Prosthodontists.
Miners’ return to work following injuries in coal mines
Directory of Open Access Journals (Sweden)
Ashis Bhattacherjee
2016-12-01
Full Text Available Background: The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW following a miner’s injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person’s social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners’ injuries. Material and Methods: A study was conducted for 109 injured workers from an underground coal mine in the years 2000–2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. Results: According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners’ return to work included presence of disease, job satisfaction and injury type. Conclusions: The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6:729–742
Xing, Jian; Spradling, Philip R; Moorman, Anne C; Holmberg, Scott D; Teshale, Eyasu H; Rupp, Loralee B; Gordon, Stuart C; Lu, Mei; Boscarino, Joseph A; Schmidt, Mark A; Trinacty, Connie M; Xu, Fujie
2017-11-01
Risk of hepatocellular carcinoma (HCC) may be difficult to determine in the clinical setting. Develop a scoring system to forecast HCC risk among patients with chronic hepatitis C. Using data from the Chronic Hepatitis Cohort Study collected during 2005-2014, we derived HCC risk scores for males and females using an extended Cox model with aspartate aminotransferase-to-platelet ratio index (APRI) as a time-dependent variables and mean Kaplan-Meier survival functions from patient data at two study sites, and used data collected at two separate sites for external validation. For model calibration, we used the Greenwood-Nam-D'Agostino goodness-of-fit statistic to examine differences between predicted and observed risk. Of 12,469 patients (1628 with a history of sustained viral response [SVR]), 504 developed HCC; median follow-up was 6 years. Final predictors in the model included age, alcohol abuse, interferon-based treatment response, and APRI. Point values, ranging from -3 to 14 (males) and -3 to 12 (females), were established using hazard ratios of the predictors aligned with 1-, 3-, and 5-year Kaplan-Meier survival probabilities of HCC. Discriminatory capacity was high (c-index 0.82 males and 0.84 females) and external calibration demonstrated no differences between predicted and observed HCC risk for 1-, 3-, and 5-year forecasts among males (all p values >0.97) and for 3- and 5-year risk among females (all p values >0.87). This scoring system, based on age, alcohol abuse history, treatment response, and APRI, can be used to forecast up to a 5-year risk of HCC among hepatitis C patients before and after SVR.
2010-12-14
...-Rolled Carbon-Quality Steel Products From Brazil: Extension of Time Limit for Final Results of...-Rolled Carbon Quality Steel Products From Brazil: Preliminary Results of Countervailing Duty... administrative review of the countervailing duty order on certain hot-rolled flat-rolled carbon- quality steel...
What limits production of unusual monoenoic fatty acids in transgenic plants?
Suh, Mi Chung; Schultz, David J; Ohlrogge, John B
2002-08-01
Unusual monounsaturated fatty acids are major constituents (greater than 80%) in seeds of Coriandrum sativum L. (coriander) and Thunbergia alata Bojer, as well as in glandular trichomes (greater than 80% derived products) of Pelargonium x hortorum (geranium). These diverged fatty acid structures are produced via distinct plastidial acyl-acyl carrier protein (ACP) desaturases. When expressed in Arabidopsis thaliana (L.) Heynh. under strong seed-specific promoters the unusual acyl-ACP desaturases resulted in accumulation of unusual monoene fatty acids at 1-15% of seed fatty acid mass. In this study, we have examined several factors that potentially limit higher production of unusual monoenes in transgenic oilseeds. (i) Immunoblots indicated that the introduced desaturases were expressed at levels equivalent to or higher than the endogenous delta9 18:0-ACP desaturase. However, the level of unusual fatty acid produced in transgenic plants was not correlated with the level of desaturase expression. (ii) The unusual desaturases were expressed in several backgrounds, including antisense 18:0-ACP desaturase plants, in fab1 mutants, and co-expressed with specialized ACP or ferredoxin isoforms. None of these experiments led to high production of expected products. (iii) No evidence was found for degradation of the unusual fatty acids during seed development. (iv) Petroselinic acid added to developing seeds was incorporated into triacylglycerol as readily as oleic acid, suggesting no major barriers to its metabolism by enzymes of glycerolipid assembly. (v) In vitro and in situ assay of acyl-ACP desaturases revealed a large discrepancy of activity when comparing unusual acyl-ACP desaturases with the endogenous delta9 18:0-ACP desaturase. The combined results, coupled with the sensitivity of acyl-ACP desaturase activity to centrifugation and low salt or detergent suggests low production of unusual monoenes in transgenic plants may be due to the lack of, or incorrect assemble of
LENUS (Irish Health Repository)
Gonzalez-Angulo, Ana M
2011-03-01
To investigate the incidence of germline and somatic BRCA1\\/2 mutations in unselected patients with triple-negative breast cancer (TNBC) and determine the prognostic significance of carrying a mutation. Methods: DNA was obtained from 77 TNBC and normal tissues. BRCA1\\/2 exons\\/flanking regions were sequenced from tumor and patients classified as mutant or wild type (WT). Sequencing was repeated from normal tissue to identify germline and somatic mutations. Patient characteristics were compared with chi-square. Survival was estimated by Kaplan-Meier method and compared with log-rank. Cox proportional hazards models were fit to determine the independent association of mutation status with outcome.
International Nuclear Information System (INIS)
Hawighorst, H.; Knopp, M.V.; Schoenberg, S.O.; Essig, M.; Kaick, G. van; Schaeffer, U.; Knapstein, P.G.; Weikel, W.
1998-01-01
Purpose: Purpose of this study is to compare functional MRI parameters with histomorphological markers of tumor microvessel density (MVD) and permeability (vascular endothelial growth factor) and to determine the ultimate value of both approaches by correlation with disease outcome in patients with primary cancer of the uterine cervix. Method: Pharmacokinetic parameters were calculated from contrast-enhanced dynamic MR imaging series in 37 patients with biopsy-proven primary cervical cancer. On the operative whole mount specimens, histomorphological markers of tumor angiogenesis (MVD, VEGF) were compared with the MRI-derived parameters. For MRI and histomorphological data, Kaplan-Meier survival curves were calculated and compared using logrank statistics. Results: Significant (p [de
The new Wuerzburg data base for radiation therapy
International Nuclear Information System (INIS)
Richter, J.; Richter, E.; Tausch, J.
1991-01-01
Conception, structure and realisation of a new data base for radiation therapy are present. The data base utilizes the commercial data base system ORACLE and the data base language SQL. A program package for statistical analyses including Kaplan-Meier-calculations, logrank test and Gehan/Breslow test was elaborated. The input of the data recorded on form sheets is carried out on a data base of the Tumor Centre in the first instance. From there the data are transfered to the ORACLE data base. Up to now the courses of disease of about 13 000 patients are stored. Therefore, extensive and detailed statistical analyses are practicable. (orig.) [de
Simpson's atherectomy in peripheral arteries
International Nuclear Information System (INIS)
Kueffer, G.; Spengel, F.A.; Hansen, R.; Pfluger, T.; Nathrath, W.; Muenchen Univ.; Muenchen Univ.
1990-01-01
Over a seventeen-month period, a percutaneous transluminal removal of stenosing plaque material from leg and pelvic arteries was performed successfully and without complication in 43 patients. A complete atherectomy in the femoropopliteal vessels succeeded in 99% of cases. In the pelvic region, the primary results were much lower (58%). After six months, the angiographically checked restenosis rate was 17% for femoropopliteal vessels and 11% for iliac arteries, and the corresponding Kaplan-Meier cumulative patency rates were 73.8 and 78.7% respectively. Simpson's atherectomy is the only method of its kind that is therapeutically effective and diagnostically significant, since the removed plaque can be used for further tests. (orig.) [de
DEFF Research Database (Denmark)
Inzitari, Domenico; Pracucci, Giovanni; Poggesi, Anna
2009-01-01
cerebral infarcts and atrophy. MAIN OUTCOME MEASURE: Transition from no disability (defined as a score of 0 or 1 on the instrumental activities of daily living scale) to disability (score >/=2) or death over three year follow-up. Secondary outcomes were incident dementia and stroke. RESULTS: Over a mean...... follow-up period of 2.42 years (SD 0.97, median 2.94 years), information on the main outcome was available for 633 patients. The annual rate of transition or death was 10.5%, 15.1%, and 29.5%, respectively, for patients with mild, moderate, or severe age related changes in white matter (Kaplan-Meier log...
Magnitude of bacteraemia predicts one-year mortality
DEFF Research Database (Denmark)
Gradel, Kim Oren; Schønheyder, Henrik Carl; Søgaard, Mette
Objectives: All hospitals in our region use the BacT/Alert® blood culture (BC) system with a 3-bottle BC set for adults. We hypothesized that the magnitude of bacteremia (i.e., number of positive bottles in the initial BC set) predicted one-year mortality. Methods In a population-based study we...... with a BC index of 1 (i.e., one positive bottle) were chosen as the reference group. We computed Kaplan-Meier curves and performed Cox regression analyses to estimate mortality rate ratios (MRRs) with 95 % confidence intervals [CIs] 30 and 365 days after the initial BC sampling date, first in crude analyses...... mortality....
Markov chains and semi-Markov models in time-to-event analysis.
Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J
2013-10-25
A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.
Gonzalez-Bermejo, Jésus; Morelot-Panzini, Capucine; Arnol, Nathalie; Meininger, Vincent; Kraoua, Salah; Salachas, François; Similowski, Thomas
2013-09-01
Abstract NIV adherence ('quantity' of ventilation) has a prognostic impact in amyotrophic lateral sclerosis (ALS). We hypothesized that NIV effectiveness ('quality') could also have a similar impact. NIV effectiveness was evaluated in 82 patients within the first month (M1) and every three months (symptoms, arterial blood bases, and nocturnal pulsed oxygen saturation - SpO2). Kaplan-Meier survival and risk factors for mortality one year after NIV initiation were evaluated. Forty patients were considered 'correctly ventilated' at M1 (Group 1, less than 5% of nocturnal oximetry time with an SpO2NIV effectiveness to correct nocturnal desaturations is an independent prognostic factor.
Energy Technology Data Exchange (ETDEWEB)
Bouchbika, Z.; Benchakroun, N.; Sellai, N.; Jouhadi, H.; Tawfiq, N.; Sahraoui, S.; Benider, A. [Service radiotherapie-oncologie, CHU Ibn-Rochd, Casablanca (Morocco)
2011-10-15
The authors report the assessment of the local control, global survival and survival without recurrence, and also late complications, based on retrospective study over 8 years of 169 cases Hodgkin lymphoma in patients older than 18 (average age of 34) and who had been submitted to radiotherapy. Survival has been computed according to the Kaplan-Meier method. The authors notice that the recurrence rate is slightly higher than in the literature. During the considered period, radiotherapy was two-dimensional with higher doses than those corresponding to current standards. The improvement of radiotherapy techniques and the decrease of doses within the standards should improve the therapeutic results. Short communication
Rodríguez Alonso, A.; Pita Fernández, S.; González Carreró, J.; Nogueira March, J.L.
2003-01-01
OBJETIVO: Establecer los factores pronósticos de recidiva y progresión en el carcinoma de células transicionales de vejiga en estadio T1, prestando especial atención al valor pronóstico de p53 y ki67. MATERIAL Y MÉTODOS: 175 pacientes con tumor vesical incidente de la categoría T1. El estudio inmunohistoquímico fue realizado con los anticuerpos monoclonales DO7, para p53 y MIB-1, para ki67. Se utilizó la metodología de Kaplan-Meier y se realizó un análisis multivariado de regresión de Cox, pa...
International Nuclear Information System (INIS)
Shetty, Prashanth; Pooja, S.; Suchetha Kumari, N.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.
2016-01-01
Search for less-toxic radioprotectors has spurred interest in the development of natural products. In Ayurveda, the traditional medicine, Tanacetum species have been used to treat ailments since ancient times throughout the world. Effects of the administration of different concentrations of Tanacetum parthenium leaf aqueous extract (TPLA), Tanacetum parthenium leaf ethanolic extract (TPLE) were investigated in Swiss albino mice. Mice (20-25 g) were randomly divided into 8 groups of ten animals each. The control group and the radiation group were treated daily with oral administration of saline for 15 days. Each subgroups of TPLA and TPLE were treated with doses of 50, 100 and 250 mg/kg daily for 15 days. On the 15th day, all were irradiated with 10 Gy whole body irradiation. Survival was observed daily up to 30th post-irradiation day. Data were analysed using the Kaplan-Meier survival curves. The significance difference in survival between control, radiation and treatment groups were observed (P < 0.001). Current studies revealed the protective effect of Tanacetum parthenium rendering high survivability in lethally irradiated mice. (author)
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage.
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-07-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and 2.86 days and were quicker compared with that in the UV only group (4.21 days); (2) zebrafish fins in the UV+comfrey (50 and 100 ppm) groups were 2.05 and 3.25 times more likely to return to normal than those in the UV only group; and (3) comfrey leave extracts had UV-absorbance abilities and significantly reduced ROS production in UV-exposed zebrafish embryos, which may attenuate UV-mediated apoptosis. In conclusion, comfrey leaves extracts may have the potential to be developed as UV-protective agents to protect zebrafish embryos from UV-induced damage.
Directory of Open Access Journals (Sweden)
A. V. Rusanov
2016-12-01
Full Text Available The results of numerical investigation of spatial flow of viscous incompressible fluid in flow part of Kaplan turbine PL20 Kremenchug HPP at optimum setting angle of runner blade φb = 15° and at maximum setting angle φb = 35° are shown. The flow simulation has been carried out on basis of numerical integration of the Reynolds equations with an additional term containing artificial compressibility. The differential two-parameter model of Menter (SST has been applied to take into account turbulent effects. Numerical integration of the equations is carried out using an implicit quasi-monotone Godunov type scheme of second - order accuracy in space and time. The calculations have been conducted with the help of the software system IPMFlow. The analysis of fluid flow in the flow part elements is shown and the values of hydraulic losses and local cavitation coefficient have been obtained. Comparison of calculated and experimental results has been carried out.
Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model
International Nuclear Information System (INIS)
Rivetti, A; Angulo, M; Lucino, C; Liscia, S
2014-01-01
Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors
Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model
Rivetti, A.; Angulo, M.; Lucino, C.; Liscia, S.
2014-03-01
Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors.
Gérald Naro; Denis Travaillé
2009-01-01
International audience; The aim of this paper is to confront the Balanced Scorecard (BSC) with Simons' (1995) levers of control framework and to discuss its role in the various stages of the strategic process. Whereas Kaplan and Norton present the BSC above all as a system of diagnostic control, Simons' (1995) levers of control model leads us to privilege a representation of the BSC in the form of an interactive process. Such an approach presents several theoretical and methodological implica...
International Nuclear Information System (INIS)
Miclosina, C O; Balint, D I; Campian, C V; Frunzaverde, D; Ion, I
2012-01-01
This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from 'Eftimie Murgu' University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.
Miclosina, C. O.; Balint, D. I.; Campian, C. V.; Frunzaverde, D.; Ion, I.
2012-11-01
This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from "Eftimie Murgu" University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.
Torsion limits from t t macr production at the LHC
de Almeida, F. M. L.; de Andrade, F. R.; do Vale, M. A. B.; Nepomuceno, A. A.
2018-04-01
Torsion models constitute a well-known class of extended quantum gravity models. In this work, one investigates the phenomenological consequences of a torsion field interacting with top quarks at the LHC. A torsion field could appear as a new heavy state characterized by its mass and couplings to fermions. This new state would form a resonance decaying into a top antitop pair. The latest ATLAS t t ¯ production results from LHC 13 TeV data are used to set limits on torsion parameters. The integrated luminosity needed to observe torsion resonance at the next LHC upgrades are also evaluated, considering different values for the torsion mass and its couplings to Standard Model fermions. Finally, prospects for torsion exclusion at the future LHC phases II and III are obtained using fast detector simulations.
Compliance of feed limits, does not mean compliance of food limits
Directory of Open Access Journals (Sweden)
van Raamsdonk LWD.
2009-01-01
Full Text Available The carry-over of contaminants from feed to animal food products is an important aspect of the animal production chain. For a proper containment, limits for feed as well food products are fixed for a series of chemicals, e.g. dioxins and dioxin-like PCBs, lead, cadmium, some chlorinated pesticides, and aflatoxin B1 (and its metabolite M1 in milk. The relationship between feed and food limits is an important issue. An ideal goal is to assure that compliance to a feed limits automatically results in compliance to food limits. In order to collect information about this relationship, several simulation models and a large database on transfer factors have been developed. An optimal choice between either a model or an application of data from the Transfer Database is based on both the knowledge level, and on the circumstances of the specific situation. To reach and validate such an optimal choice an Expert System Carry-Over is currently in development, containing four different modules: 1 the different calculation models and the Transfer Database, 2 a decision tree for choosing the optimal strategy, 3 data tables indicating knowledge levels of compound/animal/product parameters, and 4 supporting databases containing information on consumption and composition of daily diets, animal parameters, and amounts of (daily production. Calculations indicate that for dioxins compliance to feed levels does not necessarily mean that food limits are complied as well. Besides an estimation of the compliance to limits, the expert system is a tool for feed related risk assessments, and for planning of future research.
Directory of Open Access Journals (Sweden)
Mridula Krishnan
2017-08-01
Full Text Available Background: Adjuvant therapy after curative resection is associated with survival benefit in stage III pancreatic cancer. We analyzed the factors affecting the outcome of adjuvant therapy in stage III pancreatic cancer and compared overall survival with different modalities of adjuvant treatment. Methods: This is a retrospective study of patients with stage III pancreatic cancer listed in the National Cancer Database (NCDB who were diagnosed between 2004 and 2012. Patients were stratified based on adjuvant therapy they received. Unadjusted Kaplan-Meier and multivariable Cox regression analysis were performed. Results: We analyzed a cohort included 1731 patients who were recipients of adjuvant therapy for stage III pancreatic cancer within the limits of our database. Patients who received adjuvant chemoradiation had the longest postdiagnosis survival time, followed by patients who received adjuvant chemotherapy, and finally patients who received no adjuvant therapy. On multivariate analysis, advancing age and patients with Medicaid had worse survival, whereas Spanish origin and lower Charlson comorbidity score had better survival. Conclusions: Our study is the largest trial using the NCDB addressing the effects of adjuvant therapy specifically in stage III pancreatic cancer. Within the limits of our study, survival benefit with adjuvant therapy was more apparent with longer duration from date of diagnosis.