About an adaptively weighted Kaplan-Meier estimate.
Plante, Jean-François
2009-09-01
The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.
Gerds, Thomas A.
2016-01-01
Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.
van Walraven, Carl; McAlister, Finlay A
2016-01-01
Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.
The Kaplan-Meier Integral in the Presence of Covariates
DEFF Research Database (Denmark)
Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis
2017-01-01
In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...
Understanding survival analysis: Kaplan-Meier estimate.
Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal
2010-10-01
Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.
Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A
2015-11-01
Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and
Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J
2012-02-01
The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Modified Weighted Kaplan-Meier Estimator
Directory of Open Access Journals (Sweden)
Mohammad Shafiq
2007-01-01
Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.
Directory of Open Access Journals (Sweden)
Guyot Patricia
2012-02-01
Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method
Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia
2011-01-01
Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the
Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J
2015-12-10
With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A
2018-01-01
Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Gerds, Thomas Alexander
2016-01-01
Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...
J. Szymszal; A. Gierek; J. Kliś
2010-01-01
The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Directory of Open Access Journals (Sweden)
Arnd Gross
Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
International Nuclear Information System (INIS)
Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.
1996-01-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs
Energy Technology Data Exchange (ETDEWEB)
Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)
1996-12-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912
Verification of Kaplan turbine cam curves realization accuracy at power plant
Directory of Open Access Journals (Sweden)
Džepčeski Dane
2016-01-01
Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.
International Nuclear Information System (INIS)
Mould, Richard F.
1995-01-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method
Energy Technology Data Exchange (ETDEWEB)
Mould, Richard F
1995-07-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.
2017-10-01
of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to
Directory of Open Access Journals (Sweden)
Béranger Lueza
2016-03-01
Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect
2017-08-01
28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival
Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing
2017-04-01
Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.
Deciphering the Adaptive Immune Response to Ovarian Cancer
2013-10-01
positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Directory of Open Access Journals (Sweden)
Jie Zhao
2015-01-01
Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.
Age at sexual initiation and factors associated with it among youths ...
African Journals Online (AJOL)
Bernt Lindtjorn
Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.
Wan, Xiaomin; Peng, Liubao; Li, Yuanjian
2015-01-01
In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.
Dose-response curves from incomplete data
International Nuclear Information System (INIS)
Groer, P.G.
1978-01-01
Frequently many different responses occur in populations (animal or human) exposed to ionizing radiation. To obtain a dose-response curve, the exposed population is first divided into sub-groups whose members received the same radiation dose. To estimate the response, the fraction of subjects in each sub-group that showed the particular response of interest is determined. These fractions are plotted against dose to give the dose-response curve. This procedure of plotting the fractions versus the radiation dose is not the correct way to estimate the time distribution for a particular response at the different dose levels. Other observed responses competed for the individuals in the exposed population and therefore prevented manifestation of the complete information on the response-time distribution for one specific response. Such data are called incomplete in the statistical literature. A procedure is described which uses the by now classical Kaplan-Meier estimator, to establish dose-response curves from incomplete data under the assumption that the different observed responses are statistically independent. It is demonstrated that there is insufficient information in the observed survival functions to estimate the time distribution for one particular response if the assumption of independence is dropped. In addition, it is not possible to determine from the data (i.e. type of response and when it occurred) whether or not the different response-time distributions are independent. However, it is possible to give sharp bounds between which the response has to lie. This implies that for incomplete data, only a 'dose-response band' can be established if independence of the competing responses cannot be assumed. Examples are given using actual data to illustrate the estimation procedures
Applying Kaplan-Meier to Item Response Data
McNeish, Daniel
2018-01-01
Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…
Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
[Survival analysis with competing risks: estimating failure probability].
Llorca, Javier; Delgado-Rodríguez, Miguel
2004-01-01
To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...
Directory of Open Access Journals (Sweden)
Javier Llorca
2004-10-01
Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study
DEFF Research Database (Denmark)
Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars
2015-01-01
patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...
DEFF Research Database (Denmark)
Wells, J Connor; Stukalin, Igor; Norton, Craig
2017-01-01
and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...
Analyzing survival curves at a fixed point in time for paired and clustered right-censored data
Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De
2018-01-01
In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280
Epilepsy in Rett syndrome--lessons from the Rett networked database
DEFF Research Database (Denmark)
Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori
2015-01-01
collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...
Genetics Home Reference: Meier-Gorlin syndrome
... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...
Birth interval and its predictors among married women in Dabat ...
African Journals Online (AJOL)
2008-12-30
Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...
Role of IKK-alpha in the EGFR Signaling Regulation
2014-09-01
expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100
MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY
Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar
2016-01-01
Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...
Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel
2009-01-01
To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.
2017-08-01
We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P < 0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P < 0.0001) and the triple-negative subtype tumors (P = 0.0039), but not for tumors of the HER2 subtype (P = 0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.
Meier-Gorlin syndrome Clinical genetics and genomics
S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia
Meier-Gorlin syndrome Clinical genetics and genomics
De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Kaplan SpellRead. What Works Clearinghouse Intervention Report
What Works Clearinghouse, 2007
2007-01-01
"Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…
Energy Technology Data Exchange (ETDEWEB)
Sevcik, Petr
2009-07-01
The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.
Directory of Open Access Journals (Sweden)
Mahdis Bagherian
2015-03-01
Full Text Available Introduction: Root canal instrumentation is an important phase in root canal therapy. Since success in endodontic treatment depends on file defect and fracture, the aim of this study was to compare the evaluation of defect and fracture in rotary and reciproc files in severe curved root canals. Materials & Methods: In this experimental study, 60 mesial canals of human closed apex molars with more than 30° canal curvature were randomly divided into two groups. In first group M-two rotary files number# 15, 20, and 25 and in second group R25 reciproc file were used for filing, respectively. A ×8 magnifier was applied to evaluate the defect or fracture presence in each side and if it were observed, a new file would be replaced. Therefore, the number of prepared canals with each file and fractured or defective files and the place of fracture in root canal were recorded. Kaplan Meier curve and log rank test were done by using SPSS v.22. Results: In rotary group, seven and two files were fractured and defected, respectively and four files were fractured and no defect was observed in reciproc group. Although the mean of the number of prepared canals until fracture or defect in rotary and reciproc groups was 3.3 and 7.06, respectively, there were no significant differences between two systems. All file’s fractures occurred in apical regions . Conclusion: The results showed that there was no significant difference in defects or fractures of rotary and reciproc systems. Reciproc instruments can be more effective than rotary ones because the root canal preparation in rotary instruments is longer than in reciproc system.
Rossman, Allan; Kaplan, Danny
2017-01-01
Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…
KO, Pohan; MATSUMOTO, Kiyoshi; OHTAKE, Norio; DING, Hua
2016-11-01
As for turbomachine off-design performance improvement is challenging but critical for maximising the performing area. In this paper, a curved draft tube for a medium head Kaplan type hydro turbine is introduced and discussed for its significant effect on expanding operating head range. Without adding any extra structure and working fluid for swirl destruction and damping, a carefully designed outline shape of draft tube with the selected placement of center-piers successfully supresses the growth of turbulence eddy and the transport of the swirl to the outlet. Also, more kinetic energy is recovered and the head lost is improved. Finally, the model test results are also presented. The obvious performance improvement was found in the lower net head area, where the maximum efficiency improvement was measured up to 20% without compromising the best efficiency point. Additionally, this design results in a new draft tube more compact in size and so leads to better construction and manufacturing cost performance for prototype. The draft tube geometry parameter designing process was concerning the best efficiency point together with the off-design points covering various water net heads and discharges. The hydraulic performance and flow behavior was numerically previewed and visualized by solving Reynolds-Averaged Navier-Stokes equations with Shear Stress Transport turbulence model. The simulation was under the assumption of steady-state incompressible turbulence flow inside the flow passage, and the inlet boundary condition was the carefully simulated flow pattern from the runner outlet. For confirmation, the corresponding turbine efficiency performance of the entire operating area was verified by model test.
Role of IKK-alpha in EGFR Signaling Regulation
2013-09-01
heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3
Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2
DEFF Research Database (Denmark)
Sarkisian, Laura; Saaby, L.; Poulsen, T. S.
2015-01-01
-year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
International Nuclear Information System (INIS)
Weili, L; Jinling, L; Xingqi, L; Yuan, L
2010-01-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Energy Technology Data Exchange (ETDEWEB)
Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)
2010-08-15
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.
2010-08-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Meier-Gorlin syndrome Clinical genetics and genomics
Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...
Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola
2009-01-01
We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092
Water hammer 2 phase analysis hydraulic system with a Kaplan turbine
Dudlik, A.; Koutnik, J.
2009-01-01
This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...
Computer Aided Design of Kaplan Turbine Piston with SolidWorks
Camelia Jianu
2010-01-01
The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
Directory of Open Access Journals (Sweden)
Estela Azeka
2009-02-01
Full Text Available OBJECTIVE: The aim of this study was to report a single center experience of organ and tissue transplantation INTRODUCTION: This is the first report of organ and tissue transplantation at the Hospital das Clínicas of the University of Sao Paulo Medical School. METHODS: We collected data from each type of organ transplantation from 2002 to 2007. The data collected were patient characteristics and actuarial survival Kaplan-Meier curves at 30 days, one year, and five years RESULTS: There were a total of 3,321 transplants at our institution and the 5-year survival curve ranged from 53% to 88%. CONCLUSION: This report shows that solid organ and tissue transplants are feasible within the institution and allow us to expect that the quality of transplantation will improve in the future.
Survival of Patients With Cervical Cancer in Rural India
Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy
2015-01-01
Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...
Energy Technology Data Exchange (ETDEWEB)
Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)
2012-10-15
Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)
Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.
Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang
The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Energy Technology Data Exchange (ETDEWEB)
Petit, O; Nilsson, H [Division of Fluid Mechanics, Chalmers University of Technology, Hoersalsvaegen 7A, SE-41296 Goeteborg (Sweden); Mulu, B; Cervantes, M, E-mail: olivierp@chalmers.s [Division of Fluid Mechanics, Luleaa University of Technology, SE-971 87 Luleaa (Sweden)
2010-08-15
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Petit, O.; Mulu, B.; Nilsson, H.; Cervantes, M.
2010-08-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Petit, O; Nilsson, H; Mulu, B; Cervantes, M
2010-01-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Predicting long-term graft survival in adult kidney transplant recipients
Directory of Open Access Journals (Sweden)
Brett W Pinsky
2012-01-01
Full Text Available The ability to accurately predict a population′s long-term survival has important implications for quantifying the benefits of transplantation. To identify a model that can accurately predict a kidney transplant population′s long-term graft survival, we retrospectively studied the United Network of Organ Sharing data from 13,111 kidney-only transplants completed in 1988- 1989. Nineteen-year death-censored graft survival (DCGS projections were calculated and com-pared with the population′s actual graft survival. The projection curves were created using a two-part estimation model that (1 fits a Kaplan-Meier survival curve immediately after transplant (Part A and (2 uses truncated observational data to model a survival function for long-term projection (Part B. Projection curves were examined using varying amounts of time to fit both parts of the model. The accuracy of the projection curve was determined by examining whether predicted sur-vival fell within the 95% confidence interval for the 19-year Kaplan-Meier survival, and the sample size needed to detect the difference in projected versus observed survival in a clinical trial. The 19-year DCGS was 40.7% (39.8-41.6%. Excellent predictability (41.3% can be achieved when Part A is fit for three years and Part B is projected using two additional years of data. Using less than five total years of data tended to overestimate the population′s long-term survival, accurate prediction of long-term DCGS is possible, but requires attention to the quantity data used in the projection method.
Estimating a population cumulative incidence under calendar time trends
DEFF Research Database (Denmark)
Hansen, Stefan N; Overgaard, Morten; Andersen, Per K
2017-01-01
BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date....... It is common practice to apply the Kaplan-Meier or Aalen-Johansen estimator to the total sample and report either the estimated cumulative incidence curve or just a single point on the curve as a description of the disease risk. METHODS: We argue that, whenever the disease or disorder of interest is influenced...
Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal
2018-06-01
Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Pablo Martínez-Camblor
2009-12-01
sobrestimación tanto de la probabilidad de recidiva como de la mortalidad debida a la enfermedad.Objective: To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. Methods: All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival were also studied. Results: Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Conclusions: Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu
2015-01-01
Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
Perturbative analysis for Kaplan's lattice chiral fermions
International Nuclear Information System (INIS)
Aoki, S.; Hirose, H.
1994-01-01
Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls
Stewart, David J.; Behrens, Carmen; Roth, Jack; Wistuba, Ignacio I.
2010-01-01
Background For processes that follow first order kinetics, exponential decay nonlinear regression analysis (EDNRA) may delineate curve characteristics and suggest processes affecting curve shape. We conducted a preliminary feasibility assessment of EDNRA of patient survival curves. Methods EDNRA was performed on Kaplan-Meier overall survival (OS) and time-to-relapse (TTR) curves for 323 patients with resected NSCLC and on OS and progression-free survival (PFS) curves from selected publications. Results and Conclusions In our resected patients, TTR curves were triphasic with a “cured” fraction of 60.7% (half-life [t1/2] >100,000 months), a rapidly-relapsing group (7.4%, t1/2=5.9 months) and a slowly-relapsing group (31.9%, t1/2=23.6 months). OS was uniphasic (t1/2=74.3 months), suggesting an impact of co-morbidities; hence, tumor molecular characteristics would more likely predict TTR than OS. Of 172 published curves analyzed, 72 (42%) were uniphasic, 92 (53%) were biphasic, 8 (5%) were triphasic. With first-line chemotherapy in advanced NSCLC, 87.5% of curves from 2-3 drug regimens were uniphasic vs only 20% of those with best supportive care or 1 drug (p<0.001). 54% of curves from 2-3 drug regimens had convex rapid-decay phases vs 0% with fewer agents (p<0.001). Curve convexities suggest that discontinuing chemotherapy after 3-6 cycles “synchronizes” patient progression and death. With postoperative adjuvant chemotherapy, the PFS rapid-decay phase accounted for a smaller proportion of the population than in controls (p=0.02) with no significant difference in rapid-decay t1/2, suggesting adjuvant chemotherapy may move a subpopulation of patients with sensitive tumors from the relapsing group to the cured group, with minimal impact on time to relapse for a larger group of patients with resistant tumors. In untreated patients, the proportion of patients in the rapid-decay phase increased (p=0.04) while rapid-decay t1/2 decreased (p=0.0004) with increasing
International Nuclear Information System (INIS)
Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan
2009-01-01
This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)
Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
Analysis of the Kaplan turbine draft tube effect
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Obrovsky, J
2010-01-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Energy Technology Data Exchange (ETDEWEB)
Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)
2010-08-15
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Motycak, L.; Skotak, A.; Obrovsky, J.
2010-08-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Locke, S; Osborne, M; O'Rourke, P
2011-02-01
The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
International Nuclear Information System (INIS)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao
2017-01-01
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
Kristoffersen, Doris Tove; Helgeland, Jon; Waage, Halfrid Persdatter; Thalamus, Jacob; Clemens, Dirk; Lindman, Anja Schou; Rygh, Liv Helen; Tjomsland, Ole
2015-03-25
To evaluate survival curves (Kaplan-Meier) as a means of identifying areas in the clinical pathway amenable to quality improvement. Observational before-after study. In Norway, annual public reporting of nationwide 30-day in-and-out-of-hospital mortality (30D) for three medical conditions started in 2011: first time acute myocardial infarction (AMI), stroke and hip fracture; reported for 2009. 12 of 61 hospitals had statistically significant lower/higher mortality compared with the hospital mean. Three hospitals with significantly higher mortality requested detailed analyses for quality improvement purposes: Telemark Hospital Trust Skien (AMI and stroke), Østfold Hospital Trust Fredrikstad (stroke), Innlandet Hospital Trust Gjøvik (hip fracture). Survival curves, crude and risk-adjusted 30D before (2008-2009) and after (2012-2013). Unadjusted survival curves for the outlier hospitals were compared to curves based on pooled data from the other hospitals for the 30-day period 2008-2009. For patients admitted with AMI (Skien), stroke (Fredrikstad) and hip fracture (Gjøvik), the curves suggested increased mortality from the initial part of the clinical pathway. For stroke (Skien), increased mortality appeared after about 8 days. The curve profiles were thought to reflect suboptimal care in various phases in the clinical pathway. This informed improvement efforts. For 2008-2009, hospital-specific curves differed from other hospitals: borderline significant for AMI (p=0.064), highly significant (p≤0.005) for the remainder. After intervention, no difference was found (p>0.188). Before-after comparison of the curves within each hospital revealed a significant change for Fredrikstad (p=0.006). For the three hospitals, crude 30D declined and they were non-outliers for risk-adjusted 30D for 2013. Survival curves as a supplement to 30D may be useful for identifying suboptimal care in the clinical pathway, and thus informing design of quality improvement projects
Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids
Gustafsson, Martin
2013-01-01
To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...
Directory of Open Access Journals (Sweden)
Hee Jin Lee
Full Text Available Several methods are used to assess the pathologic response of breast cancer after neoadjuvant chemotherapy (NAC to predict clinical outcome. However, the clinical utility of these systems for each molecular subtype of breast cancer is unclear. Therefore, we applied six pathologic response assessment systems to specific subtypes of breast cancer and compared the results.Five hundred and eighty eight breast cancer patients treated with anthracycline with/without taxane-based NAC were retrospectively analyzed, and the ypTNM stage, residual cancer burden (RCB, residual disease in breast and nodes (RDBN, tumor response ratio, Sataloff's classification, and Miller-Payne grading system were evaluated. The results obtained for each assessment system were analyzed in terms of patient survival.In triple-negative tumors, all systems were significantly associated with disease-free survival and Kaplan-Meier survival curves for disease-free survival were clearly separated by all assessment methods. For HR+/HER2- tumors, systems assessing the residual tumor (ypTNM stage, RCB, and RDBN had prognostic significance. However, for HER2+ tumors, the association between patient survival and the pathologic response assessment results varied according to the system used, and none resulted in distinct Kaplan-Meier curves.Most of the currently available pathologic assessment systems used after anthracycline with/without taxane-based NAC effectively classified triple-negative breast cancers into groups showing different prognoses. The pathologic assessment systems evaluating residual tumors only also had prognostic significance in HR+/HER2- tumors. However, new assessment methods are required to effectively evaluate the pathologic response of HR+/HER2+ and HR-/HER2+ tumors to anthracycline with/without taxane-based NAC.
Kaplan og Norton bør læses af hele ledelsen
DEFF Research Database (Denmark)
Bukh, Per Nikolaj
2009-01-01
Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...
Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test
International Nuclear Information System (INIS)
Aoki, S.; Levien, R.B.
1995-01-01
We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories
Case Report: Meier-Gorlin syndrome: Report of an additional patient ...
African Journals Online (AJOL)
We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.
Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin
Fjærvold, Lars
2012-01-01
The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...
Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S
2013-01-01
The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.
Directory of Open Access Journals (Sweden)
Bender Ralf
2011-09-01
Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.
Lendínez-Cano, G; Osman García, I; Congregado Ruiz, C B; Conde Sánchez, J M; Medina López, R A
2018-03-07
To analyse the learning curve for the management of tyrosine kinase inhibitors as the first line of treatment for patients with metastatic renal cancer. We evaluated 32 consecutive patients treated in our department for metastatic renal cancer with tyrosine kinase inhibitors (pazopanib or sunitinib) as first-line treatment between September 2012 and November 2015. We retrospectively analysed this sample. We measured the time to the withdrawal of the first-line treatment, the time to progression and overall survival using Kaplan-Meier curves. The learning curve was analysed with the cumulative sum (CUSUM) methodology. In our series, the median time to the withdrawal of the first-line treatment was 11 months (95% CI 4.9-17.1). The mean time to progression was 30.4 months (95% CI 22.7-38.1), and the mean overall survival was 34.9 months (95% CI 27.8-42). By applying the CUSUM methodology, we obtained a graph for the CUSUM value of the time to withdrawal of the first-line treatment (CUSUM TW), observing 3 well-differentiated phases: phase 1 or initial learning phase (1-15), phase 2 (16-26) in which the management of the drug progressively improved and phase 3 (27-32) of maximum experience or mastery of the management of these drugs. The number of treated patients needed to achieve the proper management of these patients was estimated at 15. Despite the limitations of the sample size and follow-up time, we estimated (in 15 patients) the number needed to reach the necessary experience in the management of these patients with tyrosine kinase inhibitors. We observed no relationship between the time to the withdrawal of the first-line treatment for any cause and progression. Copyright © 2018 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.
Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System
Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola
2011-01-01
Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…
Comparison of colorectal and gastric cancer: Survival and prognostic factors
International Nuclear Information System (INIS)
Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R
2009-01-01
Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)
Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming
2015-12-01
Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
Energy Technology Data Exchange (ETDEWEB)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)
2017-03-15
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng
2017-05-23
BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.
Multi-objective shape optimization of runner blade for Kaplan turbine
International Nuclear Information System (INIS)
Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V
2014-01-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads
Multi-objective shape optimization of runner blade for Kaplan turbine
Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.
2014-03-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.
Red cell distribution width and its association with mortality in neonatal sepsis.
Martin, Snehal L; Desai, Saumil; Nanavati, Ruchi; Colah, Roshan B; Ghosh, Kanjaksha; Mukherjee, Malay B
2018-01-08
Neonatal sepsis is a major cause of mortality in the developing countries. However, with current severity scores and laboratory parameters, predicting outcomes of neonatal sepsis is a serious challenge. Red cell distribution width (RDW) is a readily available pragmatic means to predict outcomes of various comorbidities in adults and children, without causing any additional blood loss. However, its utility in neonates remains unexplored. Hence, the objective of the present study was to evaluate the association of RDW with neonatal sepsis and its role as a predictive marker for mortality. This Prospective observational study was carried out in a Level IIIB NICU for a period of 3 years. It involved comparison of RDW values of septic neonates with those of controls (matched for gestational age and birth weight) with an equal allocation ratio. A total of 251 septic neonates along with 251 controls >28 weeks of gestational age were enrolled. The RDW was derived from complete blood count done within first 6 hours of life. After arranging the RDW (median; interquartile range (IQR)), the values were categorized as those above the 50th percentile i.e. ≥20% and those below the 50th percentile i.e. rates of the above two groups were assessed using the Kaplan-Meier curve and the log rank test. RDW levels were significantly higher among the neonatal sepsis cases (19.90%) as compared to the controls (18.90%) with a p value of < .001. RDW was significantly higher amongst the nonsurvivors than survivors (p < .003). Kaplan-Meier curve showed that septic neonates having RDW values ≥20% had significantly increased mortality (p < .02) with a hazard ratio of 0.5. High RDW is associated with neonatal sepsis and is an independent outcome predictor for mortality associated with neonatal sepsis.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
International Nuclear Information System (INIS)
Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H
2012-01-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.
2012-11-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Directory of Open Access Journals (Sweden)
Jaya M. Satagopan
2017-06-01
Full Text Available The data presented in this article are related to the research article entitled “Measuring differential treatment benefit across marker specific subgroups: the choice of outcome scale” (Satagopan and Iasonos, 2015 [1]. These data were digitally reconstructed from figures published in Larkin et al. (2015 [2]. This article describes the steps to digitally reconstruct patient-level data on time-to-event outcome and treatment and biomarker groups using published Kaplan-Meier survival curves. The reconstructed data set and the corresponding computer programs are made publicly available to enable further statistical methodology research.
DEFF Research Database (Denmark)
Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R
2010-01-01
OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...
DEFF Research Database (Denmark)
Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul
2016-01-01
OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...
Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer
DEFF Research Database (Denmark)
Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim
2017-01-01
OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...
Energy Technology Data Exchange (ETDEWEB)
Ulyte, Agne [Vilnius University, Faculty of Medicine, Vilnius (Lithuania); Katsaros, Vasileios K. [General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Advanced Imaging Modalities - CT and MRI, Athens (Greece); University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Liouta, Evangelia; Stranjalis, Georgios [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Boskos, Christos [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Radiation Oncology, Athens (Greece); Papanikolaou, Nickolas [Champalimaud Foundation, Department of Radiology, Centre for the Unknown, Lisbon (Portugal); Usinskiene, Jurgita [National Cancer Institute, Vilnius (Lithuania); Affidea Lietuva, Vilnius (Lithuania); Bisdas, Sotirios [University College London Hospitals, Department of Neuroradiology, The National Hospital for Neurology and Neurosurgery, London (United Kingdom)
2016-12-15
The prognostic value of the dynamic contrast-enhanced (DCE) MRI perfusion and its histogram analysis-derived metrics is not well established for high-grade glioma (HGG) patients. The aim of this prospective study was to investigate DCE perfusion transfer coefficient (K{sup trans}), vascular plasma volume fraction (v{sub p}), extracellular volume fraction (v{sub e}), reverse transfer constant (k{sub ep}), and initial area under gadolinium concentration time curve (IAUGC) as predictors of progression-free (PFS) and overall survival (OS) in HGG patients. Sixty-nine patients with suspected anaplastic astrocytoma or glioblastoma underwent preoperative DCE-MRI scans. DCE perfusion whole tumor region histogram parameters, clinical details, and PFS and OS data were obtained. Univariate, multivariate, and Kaplan-Meier survival analyses were conducted. Receiver operating characteristic (ROC) curve analysis was employed to identify perfusion parameters with the best differentiation performance. On univariate analysis, v{sub e} and skewness of v{sub p} had significant negative impacts, while k{sub ep} had significant positive impact on OS (P < 0.05). v{sub e} was also a negative predictor of PFS (P < 0.05). Patients with lower v{sub e} and IAUGC had longer median PFS and OS on Kaplan-Meier analysis (P < 0.05). K{sup trans} and v{sub e} could also differentiate grade III from IV gliomas (area under the curve 0.819 and 0.791, respectively). High v{sub e} is a consistent predictor of worse PFS and OS in HGG glioma patients. v{sub p} skewness and k{sub ep} are also predictive for OS. K{sup trans} and v{sub e} demonstrated the best diagnostic performance for differentiating grade III from IV gliomas. (orig.)
Kaplan turbine tip vortex cavitation - analysis and prevention
Motycak, L.; Skotak, A.; Kupcik, R.
2012-11-01
The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-09-17
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.
High mortality risk among individuals assumed to be TB-negative can be predicted using a simple test
DEFF Research Database (Denmark)
Rabna, Paulo; Andersen, Andreas; Wejse, Christian
2009-01-01
1007 aTBneg individuals who were enrolled from 2004 to 2006; 4983 age-matched controls were followed for comparison. Plasma suPAR levels were measured using the suPARnostic ELISA. Survival was analysed using Cox regression, ROC curves and Kaplan-Meier analysis. RESULTS: After 3 months of follow......-up, mortality was 21 per 100 person-year-observation (PYO) among aTBneg individuals and three per 100 PYO among the control population [mortality rate ratio (MRR) = 6.92 (95% CI 4.48-10.7)]. SuPAR values ranged between 0.9 and 45 ng/ml in aTBneg individuals. A log-linear relationship was found between su......PAR levels linear range, a 1 ng/ml increase was associated with a 46% increase in the mortality rate: MRR = 1.46 (95% CI 1.34-1.59). The area under the ROC curves was 0.88 for HIV-positive individuals and 0.79 for HIV-negative individuals. CONCLUSIONS: Our study showed...
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Prita Meier, Swahili Port Cities: The Architecture of Elsewhere
Longair, Sarah
2018-01-01
Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...
Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post
Nikiforov, Raivo
2005-01-01
Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest
Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines
Energy Technology Data Exchange (ETDEWEB)
Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)
2015-10-01
Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.
Directory of Open Access Journals (Sweden)
Coco Claudio
2012-09-01
Full Text Available Abstract Background Expression levels of CD133, a cancer stem cell marker, and of the α-subunit of the dystroglycan (α-DG complex, have been previously reported to be altered in colorectal cancers. Methods Expression levels of CD133 and α-DG were assessed by immunohistochemistry in a series of colon cancers and their prognostic significance was evaluated. Results Scattered cells positive for CD133 were rarely detected at the bases of the crypts in normal colonic mucosa while in cancer cells the median percentage of positive cells was 5% (range 0–80. A significant correlation was observed with pT parameter and tumor stage but not with tumor grade and N status. Recurrence and death from disease were significantly more frequent in CD133-high expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor groups for both disease-free (p = 0.002 and overall (p = 0.008 survival. Expression of α-DG was reduced in a significant fraction of tumors but low α-DG staining did not correlate with any of the classical clinical-pathological parameters. Recurrence and death from the disease were significantly more frequent in α-DG-low expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor tumors for both disease-free (p = 0.02 and overall (p = 0.02 survival. Increased expression of CD133, but not loss of α-DG, confirmed to be an independent prognostic parameters at a multivariate analysis associated with an increased risk of recurrence (RR = 2.4; p = 0.002 and death (RR = 2.3; p = 0.003. Conclusions Loss of α-DG and increased CD133 expression are frequent events in human colon cancer and evaluation of CD133 expression could help to identify high-risk colon cancer patients.
Energy Technology Data Exchange (ETDEWEB)
Young, M; Craft, D [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States)
2016-06-15
Purpose: To develop an efficient, pathway-based classification system using network biology statistics to assist in patient-specific response predictions to radiation and drug therapies across multiple cancer types. Methods: We developed PICS (Pathway Informed Classification System), a novel two-step cancer classification algorithm. In PICS, a matrix m of mRNA expression values for a patient cohort is collapsed into a matrix p of biological pathways. The entries of p, which we term pathway scores, are obtained from either principal component analysis (PCA), normal tissue centroid (NTC), or gene expression deviation (GED). The pathway score matrix is clustered using both k-means and hierarchical clustering, and a clustering is judged by how well it groups patients into distinct survival classes. The most effective pathway scoring/clustering combination, per clustering p-value, thus generates various ‘signatures’ for conventional and functional cancer classification. Results: PICS successfully regularized large dimension gene data, separated normal and cancerous tissues, and clustered a large patient cohort spanning six cancer types. Furthermore, PICS clustered patient cohorts into distinct, statistically-significant survival groups. For a suboptimally-debulked ovarian cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00127) showed significant improvement over that of a prior gene expression-classified study (p = .0179). For a pancreatic cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00141) showed significant improvement over that of a prior gene expression-classified study (p = .04). Pathway-based classification confirmed biomarkers for the pyrimidine, WNT-signaling, glycerophosphoglycerol, beta-alanine, and panthothenic acid pathways for ovarian cancer. Despite its robust nature, PICS requires significantly less run time than current pathway scoring methods. Conclusion: This work validates the PICS method to improve
Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P
2018-01-01
The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.
International Nuclear Information System (INIS)
Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo
2009-01-01
Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es
Ackerman, Ari
2008-01-01
This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…
Kaplan turbine tip vortex cavitation – analysis and prevention
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Kupcik, R
2012-01-01
The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Numerical investigation of hub clearance flow in a Kaplan turbine
Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.
2012-11-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Numerical investigation of hub clearance flow in a Kaplan turbine
International Nuclear Information System (INIS)
Wu, H; Feng, J J; Wu, G K; Luo, X Q
2012-01-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
De 'wraak van de geografie' volgens Robert D. Kaplan
Mamadouh, V.
2013-01-01
De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor
Unsteady load on an oscillating Kaplan turbine runner
Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.
2013-02-01
A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.
DEFF Research Database (Denmark)
Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V
2015-01-01
AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...
Growth pattern of colorectal liver metastasis as a marker of recurrence risk
DEFF Research Database (Denmark)
Eefsen, R L; Vermeulen, P B; Christensen, I J
2015-01-01
from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...
DEFF Research Database (Denmark)
Søgaard, Mette; Nørgaard, Mette; Sørensen, Henrik Toft
2009-01-01
for age, gender, coexisting chronic diseases, marital status, use of immunosuppressives, and calendar period. Further, we conducted analyses restricted to patients a discharge diagnose of infectious diseases (ICD-10 codes A00-B99). Results: In total, 1,665 (8.2%) patients had positive blood culture...... System. We computed Kaplan-Meier curves and product limit estimates for the main study variables. Next, time-dependent Cox regression analyses was used to compare the risk of death in patients with positive blood cultures and patients with negative cultures at days 0-7, 8-30, and 31-180, controlling...
International Nuclear Information System (INIS)
Tai, Bee-Choo; Grundy, Richard G.; Machin, David
2010-01-01
Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.
Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit
2017-01-01
Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.
International Nuclear Information System (INIS)
Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li
2011-01-01
Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)
Wang, Qin; Hu, Ke-Jie; Ren, Ye-Ping; Dong, Jie; Han, Qing-Feng; Zhu, Tong-Ying; Chen, Jiang-Hua; Zhao, Hui-Ping; Chen, Meng-Hua; Xu, Rong; Wang, Yue; Hao, Chuan-Ming; Zhang, Xiao-Hui; Wang, Mei; Tian, Na; Wang, Hai-Yan
2016-01-01
♦ Research indicates that the socioeconomic status (SES) of individuals and the area where they live are related to initial peritonitis and outcomes in peritoneal dialysis (PD). We conducted a retrospective, multi-center cohort study in China to examine these associations. ♦ Data on 2,171 PD patients were collected from 7 centers, including baseline demographic, socioeconomic, and laboratory data. We explored the potential risk factors for initial peritonitis and outcomes using univariate Cox regression and unadjusted binary logistic regression. Then, we used propensity score matching to balance statistically significant risk factors for initial peritonitis and outcomes, and Kaplan-Meier survival analysis to compare differences in peritonitis-free rates between different groups of participants after matching. ♦ A total of 563 (25.9%) initial episodes of peritonitis occurred during the study period. The Kaplan-Meier peritonitis-free rate curve showed high-income patients had a significantly lower risk than low-income patients (p = 0.007) after matching for age, hemoglobin, albumin, and regional SES and PD center. The risk of treatment failure was significantly lower in the high-income than the low-income group after matching for the organism causing peritonitis and PD center: odds ratio (OR) = 0.27 (0.09 - 0.80, p = 0.018). Regional SES and education were not associated with initial peritonitis and outcomes. ♦ Our study demonstrates low individual income is a risk factor for the initial onset of peritonitis and treatment failure after initial peritonitis. Copyright © 2016 International Society for Peritoneal Dialysis.
Chang, Wei-Chin; Lin, Chun-Shu; Yang, Cheng-Yu; Lin, Chih-Kung; Chen, Yuan-Wu
2018-04-01
Lymph node metastasis in oral squamous cell carcinoma (OSCC) is a poor prognostic factor. The histopathologic stage (e.g., pN) is used to evaluate the severity of lymph node metastasis; however, the current staging system insufficiently predicts survival and recurrence. We investigated clinical outcomes and lymph node density (LND) in betel nut-chewing individuals. We retrospectively analyzed 389 betel nut-exposed patients with primary OSCC who underwent surgical resection in 2002-2015. The prognostic significance of LND was evaluated by overall survival (OS) and disease-free survival (DFS) using the Kaplan-Meier method. Kaplan-Meier analyses showed that the 5-year OS and DFS rates in all patients were 60.9 and 48.9%, respectively. Multivariate analysis showed that variables independently prognostic for OS were aged population (hazard ratio [HR] = 1.6, 95% confidence interval [95% CI] = 1.1-2.5; P = .025), and cell differentiation classification (HR = 2.4, 95% CI = 1.4-4.2; P = .002). In pathologic N-positive patients, a receiver operating characteristic (ROC) curve for OS was used and indicated the best cutoff of 0.05, and the multivariate analysis showed that LND was an independent predictor of OS (HR = 2.2, 95% CI = 1.3-3.7; P = .004). Lymph node density, at a cutoff of 0.05, was an independent predictor of OS and DFS. OS and DFS underwent multiple analyses, and LND remained significant. The pathologic N stage had no influence in the OS analysis. LND is a more reliable predictor of survival in betel nut-chewing patients for further post operation adjuvant treatment, such as reoperation or adjuvant radiotherapy.
DEFF Research Database (Denmark)
Mickley, H; Nielsen, J R; Berning, J
1995-01-01
infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...
Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines
Directory of Open Access Journals (Sweden)
Ana-Maria Budai
2010-10-01
Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.
Censoring: a new approach for detection limits in total-reflection X-ray fluorescence
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.
2004-01-01
It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for
The development of a new algorithm to calculate a survival function in non-parametric ways
International Nuclear Information System (INIS)
Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo
2001-01-01
In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory
International Nuclear Information System (INIS)
Ko, P; Kurosawa, S
2014-01-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine
Ko, P.; Kurosawa, S.
2014-03-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.
Directory of Open Access Journals (Sweden)
Min-jie Mao
2017-01-01
Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.
Cruz-Oliver, D M; Malmstrom, T K; Allen, C M; Tumosa, N; Morley, J E
2012-07-01
To evaluate predictive validity of cognitive dysfunction of the Saint Louis University mental status (SLUMS) exam or mini-mental state exam (MMSE) for institutionalization and mortality after 7.5-years. Longitudinal study. Geriatric Research, Education and Clinical Center Veterans Affairs Hospital St. Louis, MO. Patients (N=705) were screened for cognitive dysfunction in 2003 using the SLUMS exam and MMSE, and mortality and institutionalization up to 7.5-years later were evaluated as outcome measures. The associations between outcome measures and MMSE and SLUMS exam total scores, and cognitive status were examined using Kaplan-Meier curves and Cox proportional-hazards regression. Five hundred thirty-three charts were reviewed, 176/533(33%) patients had died and 31/526 (6%) were institutionalized during 7.5-year follow-up period. All subjects were male with a mean age of 75 years and most had high school education or greater (71%). MMSE dementia, SLUMS dementia (ps<.001) and MCI (p<.05) groups had significantly lower survival rates than normal cognition group in the Kaplan-Meier curves. Scores classified as dementia on SLUMS (HR=2.4, 95% CI 1.6-3.7; p <.001) or MMSE (HR=2.3, 95% CI 1.5-3.6; p <.001) both predicted mortality and, also, institutionalization (SLUMS: HR=3.5, 95% CI 1.3-9.1; p <.01; MMSE: HR=3.8, 95% CI 1.6-9.0; p <.001) after adjustment for covariates. Unadjusted SLUMS exam MCI predicted morality (HR=1.5, 95% CI 1.1-2.2; p <.019) but not institutionalization. The SLUMS exam and MMSE both predict mortality and institutionalization for male patients screened as positive for dementia.
Adjuvant Medications That Improve Survival after Locoregional Therapy.
Boas, F Edward; Ziv, Etay; Yarmohammadi, Hooman; Brown, Karen T; Erinjeri, Joseph P; Sofocleous, Constantinos T; Harding, James J; Solomon, Stephen B
2017-07-01
To determine if outpatient medications taken at the time of liver tumor embolization or ablation affect survival. A retrospective review was done of 2,032 liver tumor embolization, radioembolization, and ablation procedures performed in 1,092 patients from June 2009 to April 2016. Pathology, hepatocellular carcinoma (HCC) stage (American Joint Committee on Cancer), neuroendocrine tumor (NET) grade, initial locoregional therapy, overall survival after initial locoregional therapy, Child-Pugh score, Eastern Cooperative Oncology Group performance status, Charlson Comorbidity Index, and outpatient medications taken at the time of locoregional therapy were analyzed for each patient. Kaplan-Meier survival curves were calculated for patients taking 29 medications or medication classes (including prescription and nonprescription medications) for reasons unrelated to their primary cancer diagnosis. Kaplan-Meier curves were compared using the log-rank test. For patients with HCC initially treated with embolization (n = 304 patients), the following medications were associated with improved survival when taken at the time of embolization: beta-blockers (P = .0007), aspirin (P = .0008) and other nonsteroidal antiinflammatory drugs (P = .009), proton pump inhibitors (P = .004), and antivirals for hepatitis B or C (P = .01). For colorectal liver metastases initially treated with ablation (n = 172 patients), beta-blockers were associated with improved survival when taken at the time of ablation (P = .02). Aspirin and beta-blockers are associated with significantly improved survival when taken at the time of embolization for HCC. Aspirin was not associated with survival differences after locoregional therapy for NET or colorectal liver metastases, suggesting an HCC-specific effect. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuh-Fang Chen
Full Text Available PURPOSE: To study the association between retinitis pigmentosa (RP and the progression of diabetic retinopathy (DR. METHODS: Using the Longitudinal Health Insurance Database 2000 of Taiwan, we identified individuals with an initial diagnosis for RP during the period of 1997-2008. A non-RP comparison group, 10-fold frequency matched by sex, age, index year and the year of diabetes diagnosed, were randomly selected from the same database. The occurrence of DR was observed for all subjects until the end of 2009. The Kaplan-Meier curves were used to illustrate the cumulative probability of developing DR for the RP group and comparison groups. The hazard ratio (HR of DR for the RP group relative to the comparison group was estimated using Cox proportional hazards model after adjusting for potential confounders. RESULTS: The Kaplan-Meier curves were not statistically significant different between the RP group and the comparison group. However, the RP group had a higher cumulative probability of developing DR during the first six to seven years. The cumulative probability kept increasing and became higher in the comparison group but remained unchanged in the RP group. The HR for the RP patients comparing with the comparison group was 0.96 (95% confidence interval (CI = 0.43-2.14. Stratified by severity, RP was associated with a non-statistically significant reduced risk of proliferative DR (PDR (HR = 0.70, 95% CI = 0.16-3.14. The HR for non-proliferative DR (NPDR was 1.08 (95% CI = 0.40-2.86. CONCLUSION: In this study, RP was not statistically significant associated with the incidence of DR.
Yang, Ya-Hsu; Teng, Hao-Wei; Lai, Yen-Ting; Li, Szu-Yuan; Lin, Chih-Ching; Yang, Albert C; Chan, Hsiang-Lin; Hsieh, Yi-Hsuan; Lin, Chiao-Fan; Hsu, Fu-Ying; Liu, Chih-Kuang; Liu, Wen-Sheng
2015-01-01
Patients with late-onset depression (LOD) have been reported to run a higher risk of subsequent dementia. The present study was conducted to assess whether statins can reduce the risk of dementia in these patients. We used the data from National Health Insurance of Taiwan during 1996-2009. Standardized Incidence Ratios (SIRs) were calculated for LOD and subsequent dementia. The criteria for LOD diagnoses included age ≥65 years, diagnosis of depression after 65 years of age, at least three service claims, and treatment with antidepressants. The time-dependent Cox proportional hazards model was applied for multivariate analyses. Propensity scores with the one-to-one nearest-neighbor matching model were used to select matching patients for validation studies. Kaplan-Meier curve estimate was used to measure the group of patients with dementia living after diagnosis of LOD. Totally 45,973 patients aged ≥65 years were enrolled. The prevalence of LOD was 12.9% (5,952/45,973). Patients with LOD showed to have a higher incidence of subsequent dementia compared with those without LOD (Odds Ratio: 2.785; 95% CI 2.619-2.958). Among patients with LOD, lipid lowering agent (LLA) users (for at least 3 months) had lower incidence of subsequent dementia than non-users (Hazard Ratio = 0.781, 95% CI 0.685-0.891). Nevertheless, only statins users showed to have reduced risk of dementia (Hazard Ratio = 0.674, 95% CI 0.547-0.832) while other LLAs did not, which was further validated by Kaplan-Meier estimates after we used the propensity scores with the one-to-one nearest-neighbor matching model to control the confounding factors. Statins may reduce the risk of subsequent dementia in patients with LOD.
Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei
2017-04-01
The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.
Diekmann, Theresa; Schrems-Hoesl, Laura M; Mardin, Christian Y; Laemmer, Robert; Horn, Folkert K; Kruse, Friedrich E; Schrems, Wolfgang A
2018-02-01
The purpose of this study was to compare the ability of scanning laser polarimetry (SLP) and spectral-domain optical coherence tomography (SD-OCT) to predict future visual field conversion of subjects with ocular hypertension and early glaucoma. All patients were recruited from the Erlangen glaucoma registry and examined using standard automated perimetry, 24-hour intraocular pressure profile, and optic disc photography. Peripapillary retinal nerve fiber layer thickness (RNFL) measurements were obtained by SLP (GDx-VCC) and SD-OCT (Spectralis OCT). Positive and negative predictive values (PPV, NPV) were calculated for morphologic parameters of SLP and SD-OCT. Kaplan-Meier survival curves were plotted and log-rank tests were performed to compare the survival distributions. Contingency tables and Venn-diagrams were calculated to compare the predictive ability. The study included 207 patients-75 with ocular hypertension, 85 with early glaucoma, and 47 controls. Median follow-up was 4.5 years. A total of 29 patients (14.0%) developed visual field conversion during follow-up. SLP temporal-inferior RNFL [0.667; 95% confidence interval (CI), 0.281-0.935] and SD-OCT temporal-inferior RNFL (0.571; 95% CI, 0.317-0.802) achieved the highest PPV; nerve fiber indicator (0.923; 95% CI, 0.876-0.957) and SD-OCT mean (0.898; 95% CI, 0.847-0.937) achieved the highest NPV of all investigated parameters. The Kaplan-Meier curves confirmed significantly higher survival for subjects within normal limits of measurements of both devices (P<0.001). Venn diagrams tested with McNemar test statistics showed no significant difference for PPV (P=0.219) or NPV (P=0.678). Both GDx-VCC and SD-OCT demonstrate comparable results in predicting future visual field conversion if taking typical scans for GDx-VCC. In addition, the likelihood ratios suggest that GDx-VCC's nerve fiber indicator<30 may be the most useful parameter to confirm future nonconversion. (http://www.ClinicalTrials.gov number, NTC
Cao, Bangrong; Luo, Liping; Feng, Lin; Ma, Shiqi; Chen, Tingqing; Ren, Yuan; Zha, Xiao; Cheng, Shujun; Zhang, Kaitai; Chen, Changmin
2017-12-13
The clinical benefit of adjuvant chemotherapy for stage II colorectal cancer (CRC) is controversial. This study aimed to explore novel gene signature to predict outcome benefit of postoperative 5-Fu-based therapy in stage II CRC. Gene-expression profiles of stage II CRCs from two datasets with 5-Fu-based adjuvant chemotherapy (training dataset, n = 212; validation dataset, n = 85) were analyzed to identify the indicator. A systemic approach by integrating gene-expression and protein-protein interaction (PPI) network was implemented to develop the predictive signature. Kaplan-Meier curves and Cox proportional hazards model were used to determine the survival benefit of adjuvant chemotherapy. Experiments with shRNA knock-down were carried out to confirm the signature identified in this study. In the training dataset, we identified 44 PPI sub-modules, by which we separate patients into two clusters (1 and 2) having different chemotherapeutic benefit. A predictor of 11 PPI sub-modules (11-PPI-Mod) was established to discriminate the two sub-groups, with an overall accuracy of 90.1%. This signature was independently validated in an external validation dataset. Kaplan-Meier curves showed an improved outcome for patients who received adjuvant chemotherapy in Cluster 1 sub-group, but even worse survival for those in Cluster 2 sub-group. Similar results were found in both the training and the validation dataset. Multivariate Cox regression revealed an interaction effect between 11-PPI-Mod signature and adjuvant therapy treatment in the training dataset (RFS, p = 0.007; OS, p = 0.006) and the validation dataset (RFS, p = 0.002). From the signature, we found that PTGES gene was up-regulated in CRC cells which were more resistant to 5-Fu. Knock-down of PTGES indicated a growth inhibition and up-regulation of apoptotic markers induced by 5-Fu in CRC cells. Only a small proportion of stage II CRC patients could benefit from adjuvant therapy. The 11-PPI-Mod as
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
International Nuclear Information System (INIS)
Hawighorst, H.; Knopp, M.V.; Schoenberg, S.O.; Essig, M.; Kaick, G. van; Schaeffer, U.; Knapstein, P.G.; Weikel, W.
1998-01-01
Purpose: Purpose of this study is to compare functional MRI parameters with histomorphological markers of tumor microvessel density (MVD) and permeability (vascular endothelial growth factor) and to determine the ultimate value of both approaches by correlation with disease outcome in patients with primary cancer of the uterine cervix. Method: Pharmacokinetic parameters were calculated from contrast-enhanced dynamic MR imaging series in 37 patients with biopsy-proven primary cervical cancer. On the operative whole mount specimens, histomorphological markers of tumor angiogenesis (MVD, VEGF) were compared with the MRI-derived parameters. For MRI and histomorphological data, Kaplan-Meier survival curves were calculated and compared using logrank statistics. Results: Significant (p [de
Magnitude of bacteraemia predicts one-year mortality
DEFF Research Database (Denmark)
Gradel, Kim Oren; Schønheyder, Henrik Carl; Søgaard, Mette
Objectives: All hospitals in our region use the BacT/Alert® blood culture (BC) system with a 3-bottle BC set for adults. We hypothesized that the magnitude of bacteremia (i.e., number of positive bottles in the initial BC set) predicted one-year mortality. Methods In a population-based study we...... with a BC index of 1 (i.e., one positive bottle) were chosen as the reference group. We computed Kaplan-Meier curves and performed Cox regression analyses to estimate mortality rate ratios (MRRs) with 95 % confidence intervals [CIs] 30 and 365 days after the initial BC sampling date, first in crude analyses...... mortality....
Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F
2018-05-01
The individual kinematic roles of the anterolateral ligament (ALL) and the distal iliotibial band Kaplan fibers in the setting of anterior cruciate ligament (ACL) deficiency require further clarification. This will improve understanding of their potential contribution to residual anterolateral rotational laxity after ACL reconstruction and may influence selection of an anterolateral extra-articular reconstruction technique, which is currently a matter of debate. Hypothesis/Purpose: To compare the role of the ALL and the Kaplan fibers in stabilizing the knee against tibial internal rotation, anterior tibial translation, and the pivot shift in ACL-deficient knees. We hypothesized that the Kaplan fibers would provide greater tibial internal rotation restraint than the ALL in ACL-deficient knees and that both structures would provide restraint against internal rotation during a simulated pivot-shift test. Controlled laboratory study. Ten paired fresh-frozen cadaveric knees (n = 20) were used to investigate the effect of sectioning the ALL and the Kaplan fibers in ACL-deficient knees with a 6 degrees of freedom robotic testing system. After ACL sectioning, sectioning was randomly performed for the ALL and the Kaplan fibers. An established robotic testing protocol was utilized to assess knee kinematics when the specimens were subjected to a 5-N·m internal rotation torque (0°-90° at 15° increments), a simulated pivot shift with 10-N·m valgus and 5-N·m internal rotation torque (15° and 30°), and an 88-N anterior tibial load (30° and 90°). Sectioning of the ACL led to significantly increased tibial internal rotation (from 0° to 90°) and anterior tibial translation (30° and 90°) as compared with the intact state. Significantly increased internal rotation occurred with further sectioning of the ALL (15°-90°) and Kaplan fibers (15°, 60°-90°). At higher flexion angles (60°-90°), sectioning the Kaplan fibers led to significantly greater internal rotation
Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco
2015-12-01
This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.
Can a polynomial interpolation improve on the Kaplan-Yorke dimension?
International Nuclear Information System (INIS)
Richter, Hendrik
2008-01-01
The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems
Survival Analysis of Patients with End Stage Renal Disease
Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.
2015-06-01
This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.
Adding gauge fields to Kaplan's fermions
International Nuclear Information System (INIS)
Blum, T.; Kaerkkaeinen, L.
1994-01-01
We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)
International Nuclear Information System (INIS)
Bergant, A; Gregorc, B; Gale, J
2012-01-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Bergant, A.; Gregorc, B.; Gale, J.
2012-11-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.
2012-01-01
MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex
de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.
2012-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This
Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A
2018-06-01
Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Time trends in recurrence of juvenile nasopharyngeal angiofibroma: Experience of the past 4 decades.
Mishra, Anupam; Mishra, Subhash Chandra
2016-01-01
An analysis of time distribution of juvenile nasopharyngeal angiofibroma (JNA) from the last 4 decades is presented. Sixty recurrences were analyzed as per actuarial survival. SPSS software was used to generate Kaplan-Meier (KM) curves and time distributions were compared by Log-rank, Breslow and Tarone-Ware test. The overall recurrence rate was 17.59%. Majority underwent open transpalatal approach(es) without embolization. The probability of detecting a recurrence was 95% in first 24months and comparison of KM curves of 4 different time periods was not significant. This is the first and largest series to address the time-distribution. The required follow up period is 2years. Our recurrence is just half of the largest series (reported so far) suggesting the superiority of transpalatal techniques. The similarity of curves suggests less likelihood for recent technical advances to influence the recurrence that as per our hypothesis is more likely to reflect tumor biology per se. Copyright © 2016 Elsevier Inc. All rights reserved.
XRF and XANES Data for Kaplan U Paper
The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).
Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine
Directory of Open Access Journals (Sweden)
Doina Frunzaverde
2011-01-01
Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.
DEFF Research Database (Denmark)
Sidenius, N; Sier, C.F.M.; Ullum, H
2000-01-01
levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Javadi, Ardalan; Nilsson, Håkan
2014-01-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
Javadi, Ardalan; Nilsson, Håkan
2014-03-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.
Estimating a population cumulative incidence under calendar time trends
DEFF Research Database (Denmark)
Hansen, Stefan N; Overgaard, Morten; Andersen, Per K
2017-01-01
BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date...... by calendar time trends, the total sample Kaplan-Meier and Aalen-Johansen estimators do not provide useful estimates of the general risk in the target population. We present some alternatives to this type of analysis. RESULTS: We show how a proportional hazards model may be used to extrapolate disease risk...... estimates if proportionality is a reasonable assumption. If not reasonable, we instead advocate that a more useful description of the disease risk lies in the age-specific cumulative incidence curves across strata given by time of entry or perhaps just the end of follow-up estimates across all strata...
Mwango, Albert; Stringer, Jeffrey; Ledergerber, Bruno; Mulenga, Lloyd; Bucher, Heiner C.; Westfall, Andrew O.; Calmy, Alexandra; Boulle, Andrew; Chintu, Namwinga; Egger, Matthias; Chi, Benjamin H.
2011-01-01
Background Loss to follow-up (LTFU) is common in antiretroviral therapy (ART) programmes. Mortality is a competing risk (CR) for LTFU; however, it is often overlooked in cohort analyses. We examined how the CR of death affected LTFU estimates in Zambia and Switzerland. Methods and Findings HIV-infected patients aged ≥18 years who started ART 2004–2008 in observational cohorts in Zambia and Switzerland were included. We compared standard Kaplan-Meier curves with CR cumulative incidence. We calculated hazard ratios for LTFU across CD4 cell count strata using cause-specific Cox models, or Fine and Gray subdistribution models, adjusting for age, gender, body mass index and clinical stage. 89,339 patients from Zambia and 1,860 patients from Switzerland were included. 12,237 patients (13.7%) in Zambia and 129 patients (6.9%) in Switzerland were LTFU and 8,498 (9.5%) and 29 patients (1.6%), respectively, died. In Zambia, the probability of LTFU was overestimated in Kaplan-Meier curves: estimates at 3.5 years were 29.3% for patients starting ART with CD4 cells Switzerland since only few patients died. The results from Cox and Fine and Gray models were similar: in Zambia the risk of loss to follow-up and death increased with decreasing CD4 counts at the start of ART, whereas in Switzerland there was a trend in the opposite direction, with patients with higher CD4 cell counts more likely to be lost to follow-up. Conclusions In ART programmes in low-income settings the competing risk of death can substantially bias standard analyses of LTFU. The CD4 cell count and other prognostic factors may be differentially associated with LTFU in low-income and high-income settings. PMID:22205933
A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines
Pennacchi, P.; Borghesani, P.; Chatterton, S.
2015-08-01
Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.
Coupled skinny baker's maps and the Kaplan-Yorke conjecture
Gröger, Maik; Hunt, Brian R.
2013-09-01
The Kaplan-Yorke conjecture states that for ‘typical’ dynamical systems with a physical measure, the information dimension and the Lyapunov dimension coincide. We explore this conjecture in a neighborhood of a system for which the two dimensions do not coincide because the system consists of two uncoupled subsystems. We are interested in whether coupling ‘typically’ restores the equality of the dimensions. The particular subsystems we consider are skinny baker's maps, and we consider uni-directional coupling. For coupling in one of the possible directions, we prove that the dimensions coincide for a prevalent set of coupling functions, but for coupling in the other direction we show that the dimensions remain unequal for all coupling functions. We conjecture that the dimensions prevalently coincide for bi-directional coupling. On the other hand, we conjecture that the phenomenon we observe for a particular class of systems with uni-directional coupling, where the information and Lyapunov dimensions differ robustly, occurs more generally for many classes of uni-directionally coupled systems (also called skew-product systems) in higher dimensions.
Large mass limit of the continuum theories in Kaplan's formulation
International Nuclear Information System (INIS)
Kawano, T.; Kikukawa, Y.
1994-01-01
Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense
DEFF Research Database (Denmark)
Cannon, Christopher P; Husted, Steen; Harrington, Robert A
2007-01-01
, or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...
Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease
Directory of Open Access Journals (Sweden)
Rabah M. Shawky
2014-10-01
Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.
Air injection test on a Kaplan turbine: prototype - model comparison
Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.
2016-11-01
Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.
Energy Technology Data Exchange (ETDEWEB)
Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)
2008-07-01
In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)
A Bayesian CUSUM plot: Diagnosing quality of treatment.
Rosthøj, Steen; Jacobsen, Rikke-Line
2017-12-01
To present a CUSUM plot based on Bayesian diagnostic reasoning displaying evidence in favour of "healthy" rather than "sick" quality of treatment (QOT), and to demonstrate a technique using Kaplan-Meier survival curves permitting application to case series with ongoing follow-up. For a case series with known final outcomes: Consider each case a diagnostic test of good versus poor QOT (expected vs. increased failure rates), determine the likelihood ratio (LR) of the observed outcome, convert LR to weight taking log to base 2, and add up weights sequentially in a plot showing how many times odds in favour of good QOT have been doubled. For a series with observed survival times and an expected survival curve: Divide the curve into time intervals, determine "healthy" and specify "sick" risks of failure in each interval, construct a "sick" survival curve, determine the LR of survival or failure at the given observation times, convert to weights, and add up. The Bayesian plot was applied retrospectively to 39 children with acute lymphoblastic leukaemia with completed follow-up, using Nordic collaborative results as reference, showing equal odds between good and poor QOT. In the ongoing treatment trial, with 22 of 37 children still at risk for event, QOT has been monitored with average survival curves as reference, odds so far favoring good QOT 2:1. QOT in small patient series can be assessed with a Bayesian CUSUM plot, retrospectively when all treatment outcomes are known, but also in ongoing series with unfinished follow-up. © 2017 John Wiley & Sons, Ltd.
Bernal-Morell, Enrique; García-Villalba, Eva; Vera, Maria Del Carmen; Medina, Blanca; Martinez, Monica; Callejo, Victoria; Valero, Salvador; Cinesi, Cesar; Piñera, Pascual; Alcaraz, Antonia; Marin, Irene; Muñoz, Angeles; Cano, Alfredo
2018-03-01
Midregional proadrenomedullin (MR-proADM) is a prognostic biomarker in patients with community-acquired pneumonia (CAP) and sepsis. In this paper, we examined the ability of MR-proADM to predict organ damage and long-term mortality in sepsis patients, compared to that of procalcitonin, C-reactive protein and lactate. This was a prospective observational cohort, enrolling severe sepsis or septic shock patients admitted to internal service department. The association between biomarkers and 90-day mortality was assessed by Cox regression analysis and Kaplan-Meier curves. The accuracy of biomarkers for mortality was determined by area under the receiver operating characteristic curve (AUROC) analysis. A total of 148 patients with severe sepsis, according to the criteria of the campaign to survive sepsis, were enrolled. Eighty-five (57.4%) had sepsis according to the new criteria of Sepsis-3. MR-proADM showed the best AUROC to predict sepsis as defined by the Sepsis-3 criteria (AUROC of 0.771, 95% CI 0.692-0.850, p scale, especially when scores are low. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón
2016-01-01
The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...
Heubner, Martin; Wimberger, Pauline; Otterbach, Friedrich; Kasimir-Bauer, Sabine; Siffert, Winfried; Kimmig, Rainer; Nückel, Holger
2009-01-01
Bcl-2 plays a key role in the regulation of apoptosis. Recently, a novel regulatory single nucleotide polymorphism (-938C>A) in the inhibitory P2 BCL2 promoter was described. In this study we investigated its potential association with survival in epithelial ovarian cancer. Patients (n=110) with primary epithelial ovarian cancer were retrospectively genotyped by pyrosequencing. Genotype distribution was not significantly different between 110 ovarian cancer patients and 120 healthy controls, suggesting that genotypes of this polymorphism do not increase the susceptibility to ovarian cancer. Kaplan-Meier curves showed a significant association of the AA genotype with increased survival (p=0.002). Multivariate analysis revealed that the BCL2-938AC/CC genotype (hazard ratio 4.5; p=0.003) was an independent prognostic factor compared to other prognostic factors such as age, histological grade or tumor stage. The results suggest a role for the BCL2-938C>A polymorphism as a marker for survival in patients with epithelial ovarian cancer.
de Maio Carrillho, Claudia M D; Gaudereto, Juliana J; Martins, Roberta Cristina Ruedas; de Castro Lima, Victor Augusto Camarinha; de Oliveira, Larissa M; Urbano, Mariana R; Perozin, Jamile S; Levin, Anna Sara; Costa, Silvia F
2017-03-01
We described 27 polyclonal colistin-resistant Enterobacteriaceae (MIC 4-16 μg/mL) infections (12 pneumonia, 12 urinary tract infection (UTI), two Bacteremia, and one skin/soft tissue infection) in which 74% harbored KPC. The isolates were polyclonal, 6 STs were identified and the colistin resistance was due to chromosome mutations. Eight patients with UTI received monotherapy, and combination therapy was given to 19 patients. Overall mortality was 37%. In vitro synergy using time-kill assay was observed in 14 of 19 (74%) isolates tested; the synergistic effect was observed for almost all isolates for the combination of three drugs: colistin, amikacin, and tigecycline. The Kaplan-Meier survival curve showed no significant difference comparing combination therapy with 2, 3, or more drugs and risk factors associated with death were dialysis and shock. These findings reinforce the fact that colistin in combination with other classes of drugs can be useful in treating infections caused by colistin-resistant CRE. Copyright © 2016 Elsevier Inc. All rights reserved.
ALLOGENEIC STEM CELL TRANSPLANTATION FOR ADULT PATIENTS WITH ACUTE LEUKEMIA – 14 YEARS EXPERIENCE
Directory of Open Access Journals (Sweden)
Jože Pretnar
2004-12-01
Full Text Available Background. This study was designed to evaluate the impact of various prognostic factors on long-term survival and event free survival after allogeneic hematopoietic stem cell transplantation for patients with acute leukemia.Methods and patients. Between years 1989 and 2002 44 patients with acute leukemia (30 with AML and 14 with ALL were transplanted. Survival curves using the Kaplan-Meier method were calculated for patients transplanted with two different sources of stem cells – bone marrow and peripheral blood and separately for patients with female donor.Results. Estimated 10 years survival for AML is 43% and 64% for ALL patients which is not statistically different. There are no significant differences in outcome regarding source of stem cells and in donors’ gender.Conclusions. To conclude, our results show that neither source of stem cells nor donor’s gender has impact on the long-term survival after hematopoietic stem cell transplantation. As published previously patients transplanted beyond the first remission have significantly worse outcome.
Su, Yu-Ping; Chang, Chin-Kuo; Hayes, Richard D; Perera, Gayan; Broadbent, Matthew; To, David; Hotopf, Matthew; Stewart, Robert
2014-01-01
Lower levels of cognitive function have been found to be associated with higher mortality in older people, particularly in dementia, but the association in people with other mental disorders is still inconclusive. Data were analysed from a large mental health case register serving a geographic catchment of 1.23 million residents, and associations were investigated between cognitive function measured by the Mini-Mental State Examination (MMSE) and survival in patients aged 65 years old and over. Cox regressions were carried out, adjusting for age, gender, psychiatric diagnosis, ethnicity, marital status, and area-level socioeconomic index. A total of 6,704 subjects were involved, including 3,368 of them having a dementia diagnosis and 3,336 of them with depression or other diagnoses. Descriptive outcomes by Kaplan-Meier curves showed significant differences between those with normal and impaired cognitive function (MMSE scoremental health services regardless of a dementia diagnosis. Causal pathways between this exposure and outcome (for example, suboptimal healthcare) need further investigation.
Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center
Directory of Open Access Journals (Sweden)
Claudio Calazan do Carmo
2011-08-01
Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (p<0.001. There was seen a dose-response relationship between mortality and clinical staging, ranging from 27.8 to 749.6 per 1,000 cases-year in women stage I and IV, respectively. CONCLUSIONS: The study showed that early detection through prevention programs is crucial to increase cervical cancer survival.
Rivetti, A.; Angulo, M.; Lucino, C.; Hene, M.; Capezio, O.; Liscia, S.
2016-11-01
Blade tip cavitation is a well-known phenomenon that affects the performance of large-diameter Kaplan turbines and induces structural vibration. Injection of pressurized air has been found to yield promising results in reducing those damaging effects. In this work, the results of an experimental test of air injection on a 9.5-m-diameter Kaplan turbine are reported. Experiments were performed for several load conditions and for two different net heads. Accelerations, pressure pulsation and noise emission were monitored for every tested condition. Results show that, at the expense of a maximum efficiency drop of 0.2%, air injection induces a decrease on the level of vibration from 57% up to 84%, depending on the load condition. Such decrease is seen to be proportional to the air flow rate, in the range from 0.06 to 0.8‰ (respect to the discharge at the best efficiency point).
Directory of Open Access Journals (Sweden)
Vasile Cojocaru
2011-09-01
Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.
TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier
Tursk, Eda
2004-01-01
Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan
International Nuclear Information System (INIS)
Zhu Yueqi; Li Minghua; Fang Chun; Wang Wu; Zhang Peilei; Cheng Yingsheng; Tan Huaqiao; Wang Jianbo
2010-01-01
Objective: Complicated aneurysms located in the cisternal segment of the internal carotid artery(ICA-CSA) present unique therapeutic difficulties. This study is to discuss the feasibility of the Willis stent-graft in treating complicated ICA-CSA by comparing its effect with that of coiling therapy. Methods: Willis covered stents were employed in 19 complicated ICA-CSAs (group A), while coils were used in 17 complicated ICA-CSAs (group B). Follow-up angiography was performed to investigate aneurysm recurrence, endoleak and parent artery (PA) stenosis. Kaplan-Meier curves were constructed to compare the recurrence-free and PA stenosis-free rate in both groups. Results: Total exclusion was immediately achieved in 13 ICA-CSAs and minor endoleaks presented in 5 cases in group A. Total or near-total occlusion was achieved in 7 ICA-CSAs, subtotal occlusion in 8 and partial occlusion in 2 cases in group B after coiling. Acute thrombosis occurred in 1 patient in either group and re-hemorrhage happened in 1 patient after coiling. Follow-up angiography in group A revealed that 16 ICA-CSAs were completely isolated, with two parent arteries showing mild in-stent stenosis. Eighteen months after the procedure, Kaplan-Meier analysis showed that the recurrence-free rate was 93.3% and 50%, while the stenosis-free rate of parent artery was 87.5% and 100% in group A and in Group B, respectively. In group A and group Bthe clinical neurological symptoms were fully recovered in 9 and 9, obviously improved in 3 and 5, unchanged in 2 and 2, and aggravated in one and 0 patients, respectively. Conclusion: The implantation of Willis stent-graft is a feasible endovascular therapy for complicated ICA-CSAs. When the parent artery is very tortuous or when the risk that a main collateral branch may be wrongly covered and occluded is present, the implantation of Willis covered stent can not be taken as the treatment of first choice. (authors)
DEFF Research Database (Denmark)
Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck
2014-01-01
and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....
Equity and improvement in outcome of breast cancer in Denmark
DEFF Research Database (Denmark)
Andreasen, A H; Mouridsen, H T; Andersen, K W
1994-01-01
The trend in the prognosis for female breast cancer patients was investigated by comparing Kaplan-Meier survival curves of different patient cohorts diagnosed during the period 1948-87. The study is based on 71,448 patients from the Danish Cancer Registry. The cohorts were defined by age...... in other parts of Denmark. For patients diagnosed in 1978-87 the prognosis, however, reached an equal level in all parts of the country. Thus, it is reasonable to assume that the national programme introduced in 1977 by the Danish Breast Cancer Cooperative Group (DBCG) has played an important role...... and not only brought about therapeutic improvements in breast cancer treatment in Denmark, but also ensured equity in the outcome on a national scale....
DEFF Research Database (Denmark)
Vladimirov, B S; Schiødt, Morten
2009-01-01
smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p
Castro-Otero, C.
2017-04-01
Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.
DEFF Research Database (Denmark)
Heeran, Mel C; Rask, Lene; Høgdall, Claus K
2015-01-01
of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...
Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky
2017-01-01
The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n = 304) and 11-25 ( n = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.
Hall, David O; Hooper, Clare E; Searle, Julie; Darby, Michael; White, Paul; Harvey, John E; Braybrooke, Jeremy P; Maskell, Nick A; Masani, Vidan; Lyburn, Iain D
2018-02-01
The purpose of this study was to compare the use of fluorine-18-fluorodeoxyglucose (F-FDG) PET with computed tomography (CT) and dynamic contrast-enhanced (DCE) MRI to predict prognosis and monitor treatment in malignant pleural mesothelioma. F-FDG PET/CT and DCE-MRI studies carried out as part of the South West Area Mesothelioma Pemetrexed trial were used. F-FDG PET/CT and DCE-MRI studies were carried out before treatment, and after two cycles of chemotherapy, on patients treated with pemetrexed and cisplatin. A total of 73 patients were recruited, of whom 65 had PET/CT and DCE-MRI scans. Baseline measurements from F-FDG PET/CT (maximum standardized uptake value, metabolic tumour volume and total lesion glycolysis) and DCE-MRI (integrated area under the first 90s of the curve and washout slope) were compared with overall survival (OS) using Kaplan-Meier and Cox regression analyses, and changes in imaging measurements were compared with disease progression. PET/CT and DCE-MRI measurements were not correlated with each other. Maximum standardized uptake value, metabolic tumour volume and total lesion glycolysis were significantly related to OS with Cox regression analysis and Kaplan-Meir analysis, and DCE-MRI washout curve shape was significantly related to OS. DCE-MRI curve shape can be combined with F-FDG PET/CT to give additional prognostic information. Changes in measurements were not related to progression-free survival. F-FDG PET/CT and DCE-MRI give prognostic information in malignant pleural mesothelioma. Neither PET/CT nor DCE-MRI is useful for monitoring disease progression.
Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Numerical investigation of tip clearance cavitation in Kaplan runners
Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.
2016-11-01
There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.
Impact of tumour volume on prediction of progression-free survival in sinonasal cancer
International Nuclear Information System (INIS)
Hennersdorf, Florian; Mauz, Paul-Stefan; Adam, Patrick; Welz, Stefan; Sievert, Anne; Ernemann, Ulrike; Bisdas, Sotirios
2015-01-01
The present study aimed to analyse potential prognostic factors, with emphasis on tumour volume, in determining progression free survival (PFS) for malignancies of the nasal cavity and the paranasal sinuses. Retrospective analysis of 106 patients with primary sinonasal malignancies treated and followed-up between March 2006 and October 2012. Possible predictive parameters for PFS were entered into univariate and multivariate Cox regression analysis. Kaplan-Meier curve analysis included age, sex, baseline tumour volume (based on MR imaging), histology type, TNM stage and prognostic groups according to the American Joint Committee on Cancer (AJCC) classification. Receiver operating characteristic (ROC) curve analysis concerning the predictive value of tumour volume for recurrence was also conducted. The main histological subgroup consisted of epithelial tumours (77%). The majority of the patients (68%) showed advanced tumour burden (AJCC stage III–IV). Lymph node involvement was present in 18 cases. The mean tumour volume was 26.6 ± 21.2 cm 3 . The median PFS for all patients was 24.9 months (range: 2.5–84.5 months). The ROC curve analysis for the tumour volume showed 58.1% sensitivity and 75.4% specificity for predicting recurrence. Tumour volume, AJCC staging, T- and N- stage were significant predictors in the univariate analysis. Positive lymph node status and tumour volume remained significant and independent predictors in the multivariate analysis. Radiological tumour volume proofed to be a statistically reliable predictor of PFS. In the multivariate analysis, T-, N- and overall AJCC staging did not show significant prognostic value
Nested Cohort - R software package
NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.
Hung, Kuo-Feng; Hsu, Ching-Ping; Chiang, Jen-Huai; Lin, Hung-Jen; Kuo, Yi-Ting; Sun, Mao-Feng; Yen, Hung-Rong
2017-03-06
Many patients with gastric cancer seek traditional medicine consultations in Asian countries. This study aimed to investigate the prescription of Chinese herbal medicine (CHM) and its benefits for the patients with gastric cancer in Taiwan. From the Registry for Catastrophic Illness Patients Database, we included all patients with gastric cancer whose age at diagnosis was ≥18 from 1997 to 2010 in Taiwan. We used 1:1 frequency matching by age, sex, Charlson comorbidity score, treatment and index year to compare the CHM users and non-CHM users. We used the Cox regression model to compare the hazard ratios (HR) for the risk of mortality and the Kaplan-Meier curve for the survival time. There was a total of 1333 patients in the CHM-cohort and 44786 patients in the non-CHM cohort. After matching, we compared 962 newly diagnosed CHM users and 962 non-CHM users. Adjusted HRs (aHR) were higher among patients of above 60-year-old group, with a Charlson Comorbidity Index score ≥2 before the index date, and those who need surgery combined with chemotherapy or radiotherapy. CHM users had a lower HR of mortality risk (adjusted HR: 0.55, 95% CI: 0.48-0.62). Compared to the non-CHM users, the aHR among CHM-users is 0.37 (95% CI:0.2-0.67) for those who used CHM more than 180 days annually. The Kaplan-Meier curve revealed that the survival probability was higher for complementary CHM-users. Bai-Hua-She-She-Cao (Herba Hedyotidis Diffusae) was the most commonly used single herb and Xiang-Sha-Liu-Jun-Zi-Tang was the most commonly used herbal formula among CHM prescriptions. Complementary CHM improves the overall survival among patients with gastric cancer in Taiwan. Further ethnopharmacological investigations and clinical trials are required to validate the efficacy and safety. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Salavati, Ali [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); University of Minnesota, Department of Radiology, Minneapolis, MN (United States); Duan, Fenghai [Brown University School of Public Health, Department of Biostatistics and Center for Statistical Sciences, Providence, RI (United States); Snyder, Bradley S. [Brown University School of Public Health, Center for Statistical Sciences, Providence, RI (United States); Wei, Bo [Emory University, Department of Biostatistics, Rollins School of Public Health, Atlanta, GA (United States); Houshmand, Sina; Alavi, Abass [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Khiewvan, Benjapa [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Mahidol University, Division of Nuclear Medicine, Department of Radiology, Faculty of Medicine Siriraj Hospital, Bangkok (Thailand); Opanowski, Adam [ACR Center for Research and Innovation, American College of Radiology, Philadelphia, PA (United States); Simone, Charles B. [University of Maryland Medical Center, Department of Radiation Oncology, Baltimore, MD (United States); Siegel, Barry A. [Washington University School of Medicine, Mallinckrodt Institute of Radiology and the Alvin J. Siteman Cancer Center, St, Louis, MO (United States); Machtay, Mitchell [Case Western Reserve University and University Hospitals Case Medical Center, Department of Radiation Oncology, Cleveland, OH (United States)
2017-11-15
In recent years, multiple studies have demonstrated the value of volumetric FDG-PET/CT parameters as independent prognostic factors in patients with non-small cell lung cancer (NSCLC). We aimed to determine the optimal cut-off points of pretreatment volumetric FDG-PET/CT parameters in predicting overall survival (OS) in patients with locally advanced NSCLC and to recommend imaging biomarkers appropriate for routine clinical applications. Patients with inoperable stage IIB/III NSCLC enrolled in ACRIN 6668/RTOG 0235 were included. Pretreatment FDG-PET scans were quantified using semiautomatic adaptive contrast-oriented thresholding and local-background partial-volume-effect-correction algorithms. For each patient, the following indices were measured: metabolic tumor volume (MTV), total lesion glycolysis (TLG), SUVmax, SUVmean, partial-volume-corrected TLG (pvcTLG), and pvcSUVmean for the whole-body, primary tumor, and regional lymph nodes. The association between each index and patient outcome was assessed using Cox proportional hazards regression. Optimal cut-off points were estimated using recursive binary partitioning in a conditional inference framework and used in Kaplan-Meier curves with log-rank testing. The discriminatory ability of each index was examined using time-dependent receiver operating characteristic (ROC) curves and corresponding area under the curve (AUC(t)). The study included 196 patients. Pretreatment whole-body and primary tumor MTV, TLG, and pvcTLG were independently prognostic of OS. Optimal cut-off points were 175.0, 270.9, and 35.5 cm{sup 3} for whole-body TLG, pvcTLG, and MTV, and were 168.2, 239.8, and 17.4 cm{sup 3} for primary tumor TLG, pvcTLG, and MTV, respectively. In time-dependent ROC analysis, AUC(t) for MTV and TLG were uniformly higher than that of SUV measures over all time points. Primary tumor and whole-body parameters demonstrated similar patterns of separation for those patients above versus below the optimal cut
Schein, Jeffrey; Caplan, Eric
2014-01-01
The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…
ORIGINAL ARTICLES Antiretroviral treatment for children
African Journals Online (AJOL)
Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.
Chen, Shulin; Lai, Yanzhen; He, Zhengqiang; Li, Jianpei; He, Xia; Shen, Rui; Ding, Qiuying; Chen, Hao; Peng, Songguo; Liu, Wanli
2018-05-04
This study aimed to establish an effective predictive nomogram for non-small cell lung cancer (NSCLC) patients with chronic hepatitis B viral (HBV) infection. The nomogram was based on a retrospective study of 230 NSCLC patients with chronic HBV infection. The predictive accuracy and discriminative ability of the nomogram were determined by a concordance index (C-index), calibration plot and decision curve analysis and were compared with the current tumor, node, and metastasis (TNM) staging system. Independent factors derived from Kaplan-Meier analysis of the primary cohort to predict overall survival (OS) were all assembled into a Cox proportional hazards regression model to build the nomogram model. The final model included age, tumor size, TNM stage, treatment, apolipoprotein A-I, apolipoprotein B, glutamyl transpeptidase and lactate dehydrogenase. The calibration curve for the probability of OS showed that the nomogram-based predictions were in good agreement with the actual observations. The C-index of the model for predicting OS had a superior discrimination power compared with the TNM staging system [0.780 (95% CI 0.733-0.827) vs. 0.693 (95% CI 0.640-0.746), P 20.0). The proposed nomogram model resulted in more accurate prognostic prediction for NSCLC patients with chronic HBV infection.
DEFF Research Database (Denmark)
Axén, Iben; Bodin, Lennart; Kongsted, Alice
2012-01-01
to recovery? This question was answered using survival analysis, illustrated in Kaplan-Meier curves, Proportional Hazard regression analyses and spline regression analyses. 4: How is the repeatedly measured data associated with baseline (predictor) variables? This question was answered using generalized...... involves some challenges. Vital issues to consider are the within-subject correlation, the between measurement occasion correlation and the presence of missing values. The overall aim of this commentary is to describe different methods of analyzing repeated data. It is meant to give an overview...... for the clinical researcher in order for complex outcome measures to be interpreted in a clinically meaningful way. METHODS: A model data set was formed using data from two clinical studies, where patients with low back pain were followed with weekly text messages for 18 weeks. Different research questions...
International Nuclear Information System (INIS)
Sharmila, K.P.; Bhandary, B. Satheesh Kumar; Suchetha Kumari, N.; Bhat, Vadish S.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.; Fernandes, Ronald
2016-01-01
To investigate the protective effect of Asparagus Racemosus Root ethanolic extract (ARE) in Swiss albino mice against acute lethal total - body Electron beam irradiation. Swiss Albino mice were used for the assessment of radiation induced sickness and 30 day survival analysis. Survival studies were determined using the Kaplan-Meier survival curves. The maximum survival was observed in the experimental mice pretreated with 200 mg/kg.b.wt. of ARE which also reduced the radiation sickness characteristics. This dose was considered as an optimal dose for radioprotection. Treatment of mice with ARE before irradiation delayed the onset of mortality as compared with the untreated irradiated controls. Present findings demonstrate the potential of ARE in mitigating radiation-induced mortality, which may be attributed to its free radical scavenging and increased antioxidant potential
Hao, Yanni; Lin, Peggy L; Xie, Jipan; Li, Nanxin; Koo, Valerie; Ohashi, Erika; Wu, Eric Q; Rogerio, Jaqueline
2015-08-01
Assessing real-world effectiveness of everolimus-based therapy (EVE) versus fulvestrant monotherapy (FUL) among postmenopausal women with hormone receptor-positive (HR(+))/HER2(-) metastatic breast cancer (mBC) after progression on nonsteroidal aromatase inhibitor (NSAI). Medical charts of community-based patients who received EVE or FUL for mBC after NSAI were examined. Progression-free survival (PFS), time on treatment and time to chemotherapy were compared using Kaplan-Meier curves and Cox proportional hazards models adjusting for line of therapy and patient characteristics. 192 patients received EVE and 156 FUL. After adjusting for patient characteristics, EVE was associated with significantly longer PFS than FUL (hazard ratio: 0.71; p = 0.045). EVE was associated with better PFS than FUL among NSAI-refractory postmenopausal HR(+)/HER2(-) mBC patients.
DEFF Research Database (Denmark)
Loeve, Martine; Hop, Wim C. J.; de Bruijne, Marleen
2012-01-01
Rationale: Up to a third of cystic fibrosis (CF) patients awaiting lung transplantation (LTX) die while waiting. Inclusion of computed tomography (CT) scores may improve survival prediction models such as the lung allocation score (LAS). Objectives: This study investigated the association between...... CT and survival in CF patients screened for LTX. Methods: Clinical data and chest CTs of 411 CF patients screened for LTX between 1990 and 2005 were collected from 17 centers. CTs were scored with the Severe Advanced Lung Disease (SALD) 4-category scoring system, including the components "infection....../inflammation" (INF), air trapping/hypoperfusion (AT), normal/hyperperfusion (NOR) and bulla/cysts (BUL). The volume of each component was computed using semi-automated software. Survival analysis included Kaplan-Meier curves, and Cox-regression models. Measurements and main results: 366 (186 males) out of 411...
Competing approaches to analysis of failure times with competing risks.
Farley, T M; Ali, M M; Slaymaker, E
2001-12-15
For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.
Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment
2010-08-01
overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-01-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...
Dowen, Frances; Sidhu, Karishma; Broadbent, Elizabeth; Pilmore, Helen
2017-09-21
Mortality in end stage renal disease (ESRD) is higher than many malignancies. There is no data about the optimal way to present information about projected survival to patients with ESRD. In other areas, graphs have been shown to be more easily understood than narrative. We examined patient comprehension and perspectives on graphs in communicating projected survival in chronic kidney disease (CKD). One hundred seventy-seven patients with CKD were shown 4 different graphs presenting post transplantation survival data. Patients were asked to interpret a Kaplan Meier curve, pie chart, histogram and pictograph and answer a multi-choice question to determine understanding. We measured interpretation, usefulness and preference for the graphs. Most patients correctly interpreted the graphs. There was asignificant difference in the percentage of correct answers when comparing different graph types (p = 0.0439). The pictograph was correctly interpreted by 81% of participants, the histogram by 79%, pie chart by 77% and Kaplan Meier by 69%. Correct interpretation of the histogram was associated with educational level (p = 0.008) and inversely associated with age > 65 (p = 0.008). Of those who interpreted all four graphs correctly, there was an association with employment (p = 0.001) and New Zealand European ethnicity (p = 0.002). 87% of patients found the graphs useful. The pie chart was the most preferred graph (p 0.002). The readability of the graphs may have been improved with an alternative colour choice, especially in the setting of visual impairment. Visual aids, can be beneficial adjuncts to discussing survival in CKD.
Directory of Open Access Journals (Sweden)
Anissa Gramatges Ortiz
2002-08-01
Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated
Ma, Xinlong; Shang, Feng; Zhu, Weidong; Lin, Qingtang
2017-09-01
CXCR4 is an oncogene in glioblastoma multiforme (GBM) but the mechanism of its dysregulation and its prognostic value in GBM have not been fully understood. Bioinformatic analysis was performed by using R2 and the UCSC Xena browser based on data from GSE16011 in GEO datasets and in GBM cohort in TCGA database (TCGA-GBM). Kaplan Meier curves of overall survival (OS) were generated to assess the association between CXCR4 expression/methylation and OS in patients with GBM. GBM patients with high CXCR4 expression had significantly worse 5 and 10 yrs OS (p GBM subtypes, there was an inverse relationship between overall DNA methylation and CXCR4 expression. CXCR4 expression was significantly lower in CpG island methylation phenotype (CIMP) group than in non CIMP group. Log rank test results showed that patients with high CXCR4 methylation (first tertile) had significantly better 5 yrs OS (p = 0.038). CXCR4 expression is regulated by DNA methylation in GBM and its low expression or hypermethylation might indicate favorable OS in GBM patients.
Su, Ho-Ming; Tsai, Wei-Chung; Lin, Tsung-Hsien; Hsu, Po-Chao; Lee, Wen-Hsien; Lin, Ming-Yen; Chen, Szu-Chia; Lee, Chee-Siong; Voon, Wen-Chol; Lai, Wen-Ter; Sheu, Sheng-Hsiung
2012-01-01
The P wave parameters measured by 12-lead electrocardiogram (ECG) are commonly used as noninvasive tools to assess for left atrial enlargement. There are limited studies to evaluate whether P wave parameters are independently associated with decline in renal function. Accordingly, the aim of this study is to assess whether P wave parameters are independently associated with progression to renal end point of ≥25% decline in estimated glomerular filtration rate (eGFR). This longitudinal study included 166 patients. The renal end point was defined as ≥25% decline in eGFR. We measured two ECG P wave parameters corrected by heart rate, i.e. corrected P wave dispersion (PWdisperC) and corrected P wave maximum duration (PWdurMaxC). Heart function and structure were measured from echocardiography. Clinical data, P wave parameters, and echocardiographic measurements were compared and analyzed. Forty-three patients (25.9%) reached renal end point. Kaplan-Meier curves for renal end point-free survival showed PWdisperC > median (63.0 ms) (log-rank P = 0.004) and PWdurMaxC > median (117.9 ms) (log-rank Pfunction decline.
The effect of semirigid dressings on below-knee amputations.
MacLean, N; Fick, G H
1994-07-01
The effect of using semirigid dressings (SRDs) on the residual limb of individuals who have had below-knee amputations as a consequence of peripheral vascular disease was investigated, with the primary question being: Does the time to readiness for prosthetic fitting for patients treated with the SRDs differ from that of patients treated with soft dressings? Forty patients entered the study and were alternately assigned to one of two groups. Nineteen patients were assigned to the SRD group, and 21 patients were assigned to the soft dressing group. The time from surgery to readiness for prosthetic fitting was recorded for each patient. Kaplan-Meier survival curves were generated for each group, and the results were analyzed with the log-rank test. There was a difference between the two curves, and an examination of the curves suggests that the expected time to readiness for prosthetic fitting for patients treated with the SRDs would be less than half that of patients treated with soft dressings. The results suggest that a patient may be ready for prosthetic fitting sooner if treated with SRDs instead of soft dressings.
Survival and mortality among users and non-users of hydroxyurea with sickle cell disease.
de Araujo, Olinda Maria Rodrigues; Ivo, Maria Lúcia; Ferreira Júnior, Marcos Antonio; Pontes, Elenir Rose Jardim Cury; Bispo, Ieda Maria Gonçalves Pacce; de Oliveira, Eveny Cristine Luna
2015-01-01
to estimate survival, mortality and cause of death among users or not of hydroxyurea with sickle cell disease. cohort study with retrospective data collection, from 1980 to 2010 of patients receiving inpatient treatment in two Brazilian public hospitals. The survival probability was determined using the Kaplan-Meier estimator, survival calculations (SPSS version 10.0), comparison between survival curves, using the log rank method. The level of significance was p=0.05. of 63 patients, 87% had sickle cell anemia, with 39 using hydroxyurea, with a mean time of use of the drug of 20.0±10.0 years and a mean dose of 17.37±5.4 to 20.94±7.2 mg/kg/day, raising the fetal hemoglobin. In the comparison between those using hydroxyurea and those not, the survival curve was greater among the users (p=0.014). A total of 10 deaths occurred, with a mean age of 28.1 years old, and with Acute Respiratory Failure as the main cause. the survival curve is greater among the users of hydroxyurea. The results indicate the importance of the nurse incorporating therapeutic advances of hydroxyurea in her care actions.
Application of the standard lymphadenectomy in gastric adenocarcinoma
International Nuclear Information System (INIS)
Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro
2011-01-01
The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined
International Nuclear Information System (INIS)
Hyun, Seung Hyup; Choi, Joon Young; Lee, Kyung-Han; Eo, Jae Seon; Lee, Jeong Won; Na, Sae Jung; Hong, Il Ki; Oh, Jin Kyoung; Chung, Yong An; Song, Bong-Il; Kim, Tae-Sung; Kim, Kyung Sik; Moon, Dae Hyuk; Yun, Mijin
2016-01-01
We evaluated the prognostic value of pretreatment 18 F-fluorodeoxyglucose positron emission tomography with computed tomography (FDG PET/CT) in patients with Barcelona Clinic Liver Cancer (BCLC) stage 0 or A hepatocellular carcinoma (HCC) who had received curative treatment or transarterial chemoembolization (TACE). Between 2009 and 2010, 317 patients diagnosed with HCC at seven hospitals were enrolled. Among these, 195 patients underwent curative treatments including resection, liver transplantation, and radiofrequency ablation. TACE was performed in 122 patients. The tumor-to-normal liver standardized uptake value ratio (TLR) of the primary tumor was measured using pretreatment FDG PET/CT. The prognostic significance of TLR and other clinical variables was assessed using Cox regression models. Differences in the overall survival (OS) associated with TLR or other significant clinical factors were examined using the Kaplan-Meier method. Over a median follow-up period of 46 months, 77 patients died from cancer. In the curative cohort, higher TLR (≥2) was significantly associated with death (hazard ratio [HR] = 2.68; 95 % CI, 1.16-6.15; P = 0.020) in multivariable analysis. Patients with a higher TLR had significantly worse OS than patients with a lower TLR (5-year overall survival, 61 % vs. 79.4 %; P = 0.006). In the TACE cohort, the Model for End-Stage Liver Disease (MELD) score (≥8) was a significant independent prognostic factor for OS (HR = 3.34; 95 % CI, 1.49-7.48; P = 0.003), whereas TLR was not associated with OS. The Kaplan-Meier curves showed significantly poorer OS in patients with higher MELD scores (≥8) than in those with lower MELD scores (5-year survival rate, 33.1 % vs. 79.6 %; P < 0.001). Pretreatment TLR measured using FDG PET/CT was an independent prognostic factor for OS in patients with BCLC stage 0 or A HCC undergoing curative treatment. In contrast, underlying liver function appeared to be important in predicting the prognosis of patients
International Nuclear Information System (INIS)
Xue Bo; Zhang Peilei; Wang Jue; Li Minghua; Zhao Jungong; Zhu Yueqi; Tan Huaqiao; Wang Jianbo
2011-01-01
Objective: To evaluate batroxobin in preventing vascular restenosis in diabetic patients after infrapopliteal arterial angioplasty through comparing the clinical results of the combination use of batroxobin and aspirin with that of simple use of aspirin. Methods: After a successful angioplasty, fifty-two diabetic patients with symptomatic infrapopliteal obstructions were randomly divided into the study group (n=26) and the control group (n=26). Patients in both groups received 100 aspirin everyday, but the patients in study group additionally received 5 IU batroxobin intravenous drip every day for six times. At the end of the follow-up period lasting for 12 months, magnetic resonance angiography (MRA) or Doppler ultrasonic angiography was performed to check the vessels to see if there was any restenosis or reocclusion. The relief degree of clinical symptoms were observed, and both preoperative and postoperative ankle-brachial index (ABI) were regularly determined and compared. Kaplan-Meier curves were constructed to evaluate restenosis/reocclusion-free rate, limb salvage rate and amputation-free rate. Results: During the follow-up period the occurrence of restenosis/reocclusion in study group and control group was 22.0% and 34.5% respectively (P=0.0307). Statistically significant difference in ABI existed between two groups both after the procedure (P<0.05) and at 12 months after the treatment (P=0.0094). Clinical improvement and tissue healing in study group and control group were observed in 23 and 19 patients respectively (P=0.0544). Twelve months after angioplasty, Kaplan-Meier analysis showed that the restenosis/reocclusion-free rate, the limb salvage rate and the amputation-free rate for study group were 74.0%, 96.2% and 84.6% respectively, while they was 54.8%, 92.3% and 84.6% respectively for control group. Conclusion: The results of this study indicate that the use of the clinical therapeutic efficacy and markedly relieve the symptoms, although this
Spiess, Philippe E; Levy, David A; Mouraviev, Vladimir; Pisters, Louis L; Jones, J Stephen
2013-08-01
What's known on the subject? and what does the study add?: Previous studies have identified the most important prognostic factors of the likely outcomes of salvage prostate whole-gland ablation, including initial clinical stage, biopsy Gleason score, and PSA (total and doubling time). There is potential for further optimization of candidate selection for salvage cryoablation with curative intent and nadir PSA achieved after whole-gland cryotherapy may provide additional prognostic value. The study shows that the most important prognostic factors of biochemical progression-free survival for patients who have undergone whole-gland salvage prostate cryotherapy are nadir PSA achieved after therapy and pre-therapy biopsy Gleason score. Based on these two prognostic variables, we have identified risk stratification groups (low, intermediate and high) which help predict the expected outcomes of salvage whole-gland prostate cryotherapy in a given patient. This risk stratification constitutes a useful clinical tool in defining which patients maybe best suited for this local salvage treatment method. To assess the prognostic variables predicting the risk of biochemical progression-free survival (bPFS) after salvage prostate whole-gland cryotherapy using the Phoenix definition of bPFS. A total of 132 patients underwent prostate whole-gland salvage cryotherapy with curative intent. No patient underwent neoadjuvant/adjuvant hormonal ablative therapy, and all had extended post-salvage prostate-specific antigen (PSA) follow-up data. Cox univariate and multivariate logistic regression analyses of potential predictors of bPFS were conducted. Kaplan-Meier analyses of bPFS was also performed. At a mean (range) follow-up of 4.3 (0.9-12.7) years, the median (range) post-cryotherapy nadir PSA achieved was 0.17 (0-33.9) ng/mL. On multivariate analysis, predictors of bPFS were nadir PSA post-cryotherapy and pre-salvage biopsy Gleason score (P 2.5 ng/mL or biopsy Gleason score ≥ 7, with
Hyperfractionation in carcinoma of the cervix: tumor control and late bowel complications
International Nuclear Information System (INIS)
Viswanathan, Faith Rangad; Varghese, Cherian; Peedicayil, Abraham; Lakshmanan, Jeyaseelan; Narayan, Viswanathan Perungulam
1999-01-01
Purpose: Hyperfractionation has been advocated to improve local tumor control by increasing radiation dose without increasing late normal tissue complications. The aim of this study was to determine if hyperfractionation decreased late bowel complications. Methods and Materials: Thirty patients with Stage II and III cervical cancer were randomized to receive either hyperfractionation or conventional fractionation. Patients were followed for 5 years and monitored for tumor control, recurrence, and bowel complications. The relative risks of tumor control and bowel complications were computed at 1 year and 5 years of follow-up. Kaplan-Meier survival curves were plotted to determine probabilities of being tumor-free and bowel complication-free. Results: There were 15 patients in each group. At 1 year of follow-up, 2 patients in the hyperfractionation group (13%) and 7 patients in the conventional treatment group (45%) had tumor (relative risk [RR] 0.3; 95% confidence interval [CI] 0.1, 1.1; p = 0.054). Delayed bowel complications were seen in 8 patients in the hyperfractionation group and 1 patient in the conventional treatment group (RR 7.5; 95% CI 1.1, 52; p = 0.014). At 5 years, 2 patients in the hyperfractionation group and 8 patients in the conventional treatment group had tumor (RR 0.3; 95% CI 0.1, 1.1; p = 0.04). Delayed bowel complications (Grades 2 and 3) occurred in 9 women in the hyperfractionation group and 2 patients in the conventional group (RR 5.4; 95% CI 1.5, 19.5; p 0.0006). Kaplan-Meier analysis showed that the hyperfractionation group had significantly more bowel complications over the 5 years of follow-up (p 0.024). Conclusion: Hyperfractionation may result in better tumor control both at 1 year and at 5 years following treatment of cervical cancer. However, hyperfractionation could lead to increased late bowel complications and must be used judiciously in the treatment of cervical cancer
Graft survival rate of renal transplantation during a period of 10 years in Iran
Directory of Open Access Journals (Sweden)
Fatemeh Shahbazi
2015-01-01
Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.
Resistance within hemodialysis shunts predicts patency.
Bui, Trung D; Gordon, Ian L; Parashar, Amish; Vo, David; Wilson, Samuel E
2006-01-01
The authors examined the relationship between patency after thrombectomy of clotted dialysis grafts and intraoperative measurements of flow (Q), pressure gradient (PGR), and longitudinal resistance (RL). Eighteen thrombosed arteriovenous (AV) grafts underwent 21 thrombectomies. Pressures at arterial (P1) and venous (P2) ends of the AV grafts were determined with 22-gauge catheters and standard transducers; flow was measured with transit-time probes; arithmetic averaging of waveforms was used to compute mean Q, PGR, and RL. Kaplan-Meier patency curves were analyzed by using log rank methods. Mean patency for all grafts was 164 +/-152 days. For each variable, the 21 measurements were split and the patency curve for the grafts with the 11 lowest value grafts was compared to the curve representing the 10 highest value grafts. The difference between high RL versus low RL patency curves was significant with high-resistance grafts having a median patency of 55 days and low-resistance grafts having a median patency greater than 151 days (p = 0.0089). In contrast, the high Q group median patency was 151 days versus 174 days for the low Q group (p = 0.86). Median patency for the low PGR group was 115 days compared to 62 days for the high PGR group (p = 0.162). Longitudinal resistance within AV grafts, but not flow or pressure gradient, showed a significant correlation with patency after thrombectomy. Increased resistance to flow within AV grafts appears to be an important factor affecting the propensity of dialysis grafts to thrombose.
Martínez, Sol Sáez; de la Rosa, Félix Martínez; Rojas, Sergio
2017-01-01
In Advanced Calculus, our students wonder if it is possible to graphically represent a tornado by means of a three-dimensional curve. In this paper, we show it is possible by providing the parametric equations of such tornado-shaped curves.
Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.
2000-01-01
Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de
Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam
2011-03-28
The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Bowden, T J; Bricknell, I R; Preziosi, B M
2018-01-01
Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.
Effect of combination therapy with irradiation and ACNU on rectal cancer in mice
Energy Technology Data Exchange (ETDEWEB)
Suzuki, Masahiko; Nakajima, Atsushi; Kato, Koichiro; Eiraku, Hitoshi (Tokyo Medical Coll. (Japan))
1992-03-01
Colon 26, a transplantable strain of colon cancer, was implanted in BALB/C mice, and the effect of combination therapy with irradiation and ACNU on the mice was studied. Regional irradiation with 9 MeV electron beams was administered once without anesthetization, and ACNU was injected intraperitoneally. The 102 mice used as subjects were divided into 6 groups: nontreated group, 3 Gy irradiation group, 9 Gy irradiation group, 20 mg/kg ACNU group, 40 mg/kg ACNU group, and 3 Gy irradiation + 20 mg/kg ACNU group. Antitumor effects were evaluated based on survival time and inhibition of tumor volume growth, which were calculated from mean days of survival, Kaplan-Meier survival rate curves, and tumor volume growth curves, and the results were compared among these 6 groups. In addition, pathological and cytological studies were performed. As a result, antitumor effect was found to be significantly remarkable in the group receiving the combination of irradiation and ACNU compared to any other group given either irradiation or ACNU alone, suggesting that the antitumor effect of irradiation was potentiated by ACNU. (author).
Censoring approach to the detection limits in X-ray fluorescence analysis
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.
2004-01-01
We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples
Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.
Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak
Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].
Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing
2016-02-01
To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.
Xing, Xiaofang; Du, Hong; Zhou, Chunlian; Zhang, Qingyun; Hao, Chunyi; Wen, Xianzi; Ji, Jiafu
2016-01-01
Background Lysosome-associated transmembrane-4 beta (LAPTM4B) is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients. Method Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort), 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher’s exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model. Results LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts). LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045). Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS) in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively), but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively). Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR) = 0.432; 95% confidence interval (CI) = 0.243–0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638–1.804 and 0.998, HR = 1.000, 95% CI = 0.663–1.530, respectively). Conclusion These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might
Directory of Open Access Journals (Sweden)
Xiaojing Cheng
Full Text Available Lysosome-associated transmembrane-4 beta (LAPTM4B is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients.Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort, 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher's exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model.LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts. LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045. Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively, but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively. Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR = 0.432; 95% confidence interval (CI = 0.243-0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638-1.804 and 0.998, HR = 1.000, 95% CI = 0.663-1.530, respectively.These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might be a useful prognostic indicator for
Energy Technology Data Exchange (ETDEWEB)
Piccardo, Arnoldo [Galliera Hospital, Nuclear Medicine Unit, Genoa (Italy); E.O. Ospedali Galliera, Department of Nuclear Medicine, Genoa (Italy); Puntoni, Matteo [Galliera Hospital, Clinical Trial Research Unit, Genoa (Italy); Lopci, Egesta; Fanti, Stefano [Sant' Orsola-Malpighi Hospital, Nuclear Medicine Unit, Bologna (Italy); Conte, Massimo; Sorrentino, Stefania; Garaventa, Alberto [G. Gaslini Children' s Hospital, Department of Hematology-Oncology, Genoa (Italy); Foppiani, Luca [Galliera Hospital, Internal Medicine, Genoa (Italy); Morana, Giovanni [G. Gaslini Children' s Hospital, Department of Pathology and Radiology, Genoa (Italy); Naseri, Mehrdad; Villavecchia, Giampiero [Galliera Hospital, Nuclear Medicine Unit, Genoa (Italy); Cistaro, Angelina [IRMET, PET Centre, Turin (Italy)
2014-06-15
The aim of this study was to investigate the relationship between {sup 123}I-metaiodobenzylguanidine (MIBG) scan semi-quantification and a new {sup 18}F-DOPA positron emission tomography (PET)/CT score in patients with suspected or documented neuroblastoma (NB) relapse and to assess the association between these two parameters and progression-free survival (PFS)/overall survival (OS). We analysed 24 NB patients who had undergone {sup 123}I-MIBG and {sup 18}F-DOPA PET/CT scans at the time of suspected relapse, after applying a proper scoring system for each scan. In time-to-event analyses, the score distributions were regarded as continuous and were categorized in tertiles and medians. We used Kaplan-Meier curves and Cox proportional hazard models for PFS and OS in order to estimate the independent prognostic impact of {sup 123}I-MIBG and {sup 18}F-DOPA PET/CT scans. The {sup 123}I-MIBG and {sup 18}F-DOPA scores were highly and positively correlated (Spearman's rho = 0.8, p < 0.001). Over a median follow-up of 14 months (range 6-82), 12 cases of disease progression and 6 deaths occurred. Multivariate Cox models showed a higher risk of disease progression [hazard ratio (HR) 17.0, 95 % confidence interval (CI) 2.7-109] in NB patients with {sup 123}I-MIBG score > 3 (3rd tertile) and an even higher risk (HR:37.2, 95 % CI 2.4-574) in those with {sup 18}F-DOPA whole-body metabolic burden (WBMB) >7.5 (median), after adjustment for all main clinical/pathological factors considered. Kaplan-Meier analyses showed a significant association with OS (log-rank p = 0.01 and p = 0.03 for {sup 123}I-MIBG and {sup 18}F-DOPA WBMB, respectively). Our results confirm the good agreement between {sup 18}F-DOPA PET/CT and {sup 123}I-MIBG scan in patients affected by NB relapse. In time-to-event analyses, {sup 123}I-MIBG scan and {sup 18}F-DOPA PET/CT scores were independently and significantly associated with disease progression. (orig.)
Cortés-Alaguero, Caterina; González-Mirasol, Esteban; Morales-Roselló, José; Poblet-Martinez, Enrique
2017-03-15
To determine whether medical history, clinical examination and human papilloma virus (HPV) genotype influence spontaneous regression in cervical intraepithelial neoplasia grade I (CIN-I). We retrospectively evaluated 232 women who were histologically diagnosed as have CIN-I by means of Kaplan-Meier curves, the pattern of spontaneous regression according to the medical history, clinical examination, and HPV genotype. Spontaneous regression occurred in most patients and was influenced by the presence of multiple HPV genotypes but not by the HPV genotype itself. In addition, regression frequency was diminished when more than 50% of the cervix surface was affected or when an abnormal cytology was present at the beginning of follow-up. The frequency of regression in CIN-I is high, making long-term follow-up and conservative management advisable. Data from clinical examination and HPV genotyping might help to anticipate which lesions will regress.
Trends in adult leukemia incidence and survival in Denmark, 1943-2003
DEFF Research Database (Denmark)
Thygesen, Lau Caspar; Nielsen, Ove Juul; Johansen, Christoffer
2009-01-01
The etiology of leukemia is largely unknown. Ecological data indicating trends in incidence and survival can provide information about changes in risk factors, can reflect underlying changes in diagnostic classification, and can measure therapeutic advances. From the records of the Danish Cancer...... Registry with registration starting from 1943, we calculated age-specific, period-specific, and age-standardized (world standard) incidence rates of chronic lymphoid leukemia (CLL), acute lymphoid leukemia (ALL), chronic myeloid leukemia (CML), and acute myeloid leukemia (AML) for persons above the age...... of 18. Kaplan-Meier survival curves and median survival times were calculated. Between 1943 and 2003, there were 26,036 cases of leukemia reported. The age-specific incidence rates of CLL, CML, and AML were higher for older men and women, while the incidence rates of ALL by age were more homogeneous...
Gafni-Kane, Adam; Botros, Sylvia M; Du, Hongyan; Sand, Robert I; Sand, Peter K
2013-02-01
The purpose of this study was to investigate change in bladder capacity as a measure of response to combined intravesical dimethyl sulfoxide (DMSO) and triamcinolone instillations for the treatment of newly diagnosed bladder pain syndrome/interstitial cystitis (BPS/IC). 141 newly diagnosed women were identified retrospectively. 79 were treated with weekly DMSO/triamcinolone instillations. Change in bladder capacity with bladder retrofill, daytime urinary frequency, nocturia episodes per night, and Likert scale symptom scores were reviewed. Wilcoxon signed-rank tests, Wilcoxon rank-sum tests, Spearman's rank correlations, COX regression analysis, and a Kaplan-Meier survival curve were performed. Significant changes (median (25(th)-percentile to 75(th)-percentile) were noted for bladder capacity (75 mL (25 to 130 mL), p measure of response to intravesical DMSO/triamcinolone for newly diagnosed BPS/IC. Clinical outcomes do not differ based upon presence of DO.
DEFF Research Database (Denmark)
Chaparro, M; Verreth, A; Lobaton, T
2018-01-01
OBJECTIVES: The long-term safety of exposure to anti-tumor necrosis factor (anti-TNFα) drugs during pregnancy has received little attention. We aimed to compare the relative risk of severe infections in children of mothers with inflammatory bowel disease (IBD) who were exposed to anti-TNFα drugs...... in utero with that of children who were not exposed to the drugs. METHODS: Retrospective multicenter cohort study. Exposed cohort: children from mothers with IBD receiving anti-TNFα medication (with or without thiopurines) at any time during pregnancy or during the 3 months before conception. Non......-exposed cohort: children from mothers with IBD not treated with anti-TNFα agents or thiopurines at any time during pregnancy or the 3 months before conception. The cumulative incidence of severe infections after birth was estimated using Kaplan-Meier curves, which were compared using the log-rank test. Cox...
Survival pathological prognosis factors in breast cancer
International Nuclear Information System (INIS)
Gonzalez-Longoria Boada, Lourdes B.
2012-01-01
A descriptive and longitudinal study of 273 women with breast cancer belonging to Granma province was carried out from 2003 to 2004, in order to analyze the survival of this female population, reason why the method of Kaplan Meier was used for the calculation of the mentioned variable and the Log Rank test was used for the comparison of curves. Patients with higher survival at 5 years were those who had tumors of 2 cm or less (87.5%), histological grade I (90.3%), nuclear grade I (88.3%), as well as the absence of vascular, lymphatic or lymph node invasion (with 80.6; 74.9 and 6.1% respectively). Also, tumor size, histological and nuclear grade, nodal status, as well as lymphatic and vascular invasion constituted prognosis factors, which favored the individualization of therapeutic behaviors
DEFF Research Database (Denmark)
Wilke, Thomas; Mueller, Sabrina; Groth, Antje
2015-01-01
BACKGROUND: The aim of this study was to analyse which factors predict the real-world macro-/microvascular event, hospitalisation and death risk in patients with type 2 diabetes mellitus. Furthermore, we aimed to investigate whether there exists both an under- and over-treatment risk...... of these patients. METHODS: We used a German claims/clinical data set covering the years 2010-12. Diabetes-related events were defined as (1) macro-, (2) microvascular events leading to inpatient hospitalisation, (3) other hospitalisations with type 2 diabetes mellitus as main diagnosis, (4) all-cause death and (5......) a composite outcome including all event categories 1-4. Factors associated with event risk were analysed by a Kaplan-Meier curve analysis and by multivariable Cox regression models. RESULTS: 229,042 patients with type 2 diabetes mellitus (mean age 70.2 years; mean CCI 6.03) were included. Among factors...
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...
Modelling the survivorship of Nigeria children in their first 10 years of ...
African Journals Online (AJOL)
Fagbamigbe
Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...
Energy Technology Data Exchange (ETDEWEB)
Ukonsaari; Jan
2012-08-15
This study concerns environmentally adapted Kaplan runners, which have no oil for lubricating the blade regulation mechanisms and bearings. The runners are water or air filled with self lubricated bearings. Recent design also includes regulation system pressure increase and servo motor placement below runner centre and environmentally adapted synthetic ester as hydraulic fluid. These together with power output increase and efficiency optimization are suspected sources of poor runner function. Of 37 runners 43 % have had some kind of problem and 30 % bearing or mechanism related ones. When the axial blade bearing problems are excluded the problems occurred at 16 %. Deeper look into the design of newer runners shows that only bronze based runner hubs is significantly more problem dense regarding regulation mechanisms (50 %). Hidden figures of increased runner regulation forces are suspected. All problems cannot be explained and the young machines limit the experiences. The working group's opinion and bring ups of historical and present examples during the work show evidence that the old oil filled runners function is far from perfect, nor the life length. The future is not with oil filled runner hubs. Main parts of the discovered problems have been solved and can be resolved by thorough design analysis. One future concern is what effects the recent design changes will cause due to increase demand for power output changes including the number of starts and stops. That is why the working group's recommendation is to put joint effort into material fatigue and in which a first step is to identify the real forces the runners are exposed to.
Blade profile optimization of kaplan turbine using cfd analysis
International Nuclear Information System (INIS)
Janjua, A.B.; Khalil, M.S.
2013-01-01
Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)
Blade Profile Optimization of Kaplan Turbine Using CFD Analysis
Directory of Open Access Journals (Sweden)
Aijaz Bashir Janjua
2013-10-01
Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.
Runaway transient simulation of a model Kaplan turbine
Energy Technology Data Exchange (ETDEWEB)
Liu, S; Liu, D; Wu, Y [State Key Laboratory of Hydroscience and Engineering, Department of Thermal Eng., Tsinghua University, Beijing, 100084 (China); Zhou, D [Water Conservancy and Hydropower Eng., Hohai University, Nanjing. 210098 (China); Nishi, M, E-mail: liushuhong@tsinghua.edu.c [Kyushu Inst. Tech. Senior Academy, Kitakyushu, 804-8550 (Japan)
2010-08-15
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-{epsilon} turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
Liu, S.; Zhou, D.; Liu, D.; Wu, Y.; Nishi, M.
2010-08-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-epsilon turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
International Nuclear Information System (INIS)
Liu, S; Liu, D; Wu, Y; Zhou, D; Nishi, M
2010-01-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-ε turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis
Directory of Open Access Journals (Sweden)
Amal Saki Malehi
2016-01-01
Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.
Survival analysis II: Cox regression
Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.
2011-01-01
In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the
STAT3 inhibitor enhances chemotherapy drug efficacy by ...
African Journals Online (AJOL)
Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.
The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis
DEFF Research Database (Denmark)
Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik
2016-01-01
OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...
Is there racial/ethnic variance in cervical cancer- specific survival of ...
African Journals Online (AJOL)
incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...
Directory of Open Access Journals (Sweden)
YE Peiyan
2013-04-01
Full Text Available ObjectiveTo identify the risk factors associated with progression of acute-on-chronic liver failure (ACLF occurring in patients with chronic hepatitis B virus (HBV infection (CHB. MethodsThe clinical, demographic, treatment and outcome data of 180 ACLF patients with concomitant CHB managed in our hospital between June 2009 and September 2012 were retrospectively reviewed. Clinical data, taken at baseline, included markers of inflammation/infection (white blood cell (WBC count, coagulation (prothrombin time (PT and prothrombin activity (PTA, and liver function (alanine aminotransferase (ALT, aspartate aminotransferase (AST, total bilirubin (TBil, direct bilirubin (DBil, choninesterase (CHE, albumin (Alb, globulin (Glb, total cholesterol (TC, and ammonia. In-hospital treatments included supplementation with traditional Chinese medicine-based therapies, such as Tuihuang decoction and detoxification enema. The primary outcome was survival during hospitalization. The patients were grouped for analysis according to ACLF stage (early, n=93; mid, n=61; late, n=26 and the risk factors associated with each stage were identified by using univariate (log-rank test and multivariate (Cox’s test regression analyses. The association of risk factors with patient survival was assessed by Kaplan-Meier curve analysis. ResultsThe three ACLF groups showed significantly different amounts of leukocytes, with the late ACLF group showing the highest WBC. The late ACLF group also showed significantly lower Glb and TC. There was a trend in reduced cumulative survival rate and shorter time to death that significantly corresponded to progressive stages of ACLF (early ACLF>mid ACLF>late ACLF; all P<0.001. One-hundred-and-twenty-six (70.0% of the patients died during their hospitalization, and multivariate regression analysis of this entire patient population identified absence of colonic enema, presence of hepatic encephalopathy, presence of hepatorenal syndrome, PTA
Numerical Investigation of the Flow Structure in a Kaplan Draft Tube at Part Load
Maddahian, R.; Cervantes, M. J.; Sotoudeh, N.
2016-11-01
This research presents numerical simulation of the unsteady flow field inside the draft tube of a Kaplan turbine at part load condition. Due to curvature of streamlines, the ordinary two-equations turbulence models fail to predict the flow features. Therefore, a modification of the Shear Stress Transport (SST-SAS) model is utilized to approximate the turbulent stresses. A guide vane, complete runner and draft tube are considered to insure the real boundary conditions at the draft tube inlet. The outlet boundary is assumed to discharge into the atmosphere. The obtained pressure fluctuations inside the draft tube are in good agreement with available experimental data. In order to further investigate the RVR formation and its movement, the λ2 criterion, relating the position of the vortex core and strength to the second largest Eigen value of the velocity gradient tensor, is employed. The method used for vortex identification shows the flow structure and vortex motion inside the draft tube accurately.
Prevalence and mortality of cancer among HIV-infected inpatients in Beijing, China.
Yang, Jun; Su, Shu; Zhao, Hongxin; Wang, Dennis; Wang, Jiali; Zhang, Fujie; Zhao, Yan
2016-02-16
Cancer is responsible for elevated HIV-related morbidity and mortality. Research on HIV-infected patients with concurrent cancer is rare in China. The purpose of our study was to investigate the prevalence and risk factors associated with cancer among HIV-infected inpatients in Beijing, and to investigate the mortality and risk factors among HIV-infected inpatients with cancer. Hospital records from a total of 1946 HIV-infected patients were collected from the Beijing Ditan Hospital. The data, from 2008 to 2013, were collected retrospectively. The cancer diagnoses included AIDS-defining cancers (ADC) and non-AIDS defining cancers (NADC). Logistic regression was used to identify risk factors predicting the concurrence of cancer with HIV. Mortality was examined using Kaplan-Meier estimates and Cox proportional hazards models. 7.7 % (149 cases) of all HIV-infected inpatients had concurrent cancer at their first hospital admission; of those, 33.6 % (50 cases) had ADCs, and 66.4 % (99 cases) had NADCs. The most prevalent NADCs were Hodgkin's lymphoma, gastrointestinal cancer, liver cancer, and lung cancer. Patients who did not accept antiretroviral therapy (ART) were more likely to suffer from cancer [AOR = 2.07 (1.42-3.01), p = 0.001]. Kaplan-Meier curves indicated that the survival probability of HIV-positive cancer patients was significantly lower than that of HIV-positive cancer-free patients (log-rank test, p cancer, the mortality was also higher among those who did not receive ART [AHR = 2.19 (1.84-2.61), p cancer concurrence among hospitalized HIV-infected patients was 7.7 %. Concurrent cancer also increased mortality among HIV-infected patients. ART was protective against concurrent cancer as well as mortality among HIV-infected cancer patients. These results highlight the importance of promoting cancer screening and early ART initiation among HIV-infected patients.
Exclusive breastfeeding duration and determinants among Brazilian children under two years of age
Directory of Open Access Journals (Sweden)
Sarah Warkentin
2013-06-01
Full Text Available OBJECTIVE: The present study described the duration and identified the determinants of exclusive breastfeeding. METHODS: The study used data from the Pesquisa Nacional de Demografia e Saúde da Criança e da Mulher 2006 (National Demographic and Health Survey on Women and Children 2006. Data were collected using questionnaires administered by trained professionals and refer to a subsample of 1,704 children aged less than 24 months. The estimated durations of exclusive breastfeeding are presented according to socioeconomic, demographic and epidemiological variables. Kaplan Meier estimator curves were used to produce valid estimates of breastfeeding duration and the Cox's proportional hazards model was fitted to identify risks. RESULTS: The median estimated duration of exclusive breastfeeding was 60 days. The final Cox model consisted of mother's age <20 years (hazard ratio=1.53, 95% confidence interval=1.11-1.48, use of pacifier (hazard ratio=1.53, 95% confidence interval=1.37-1.71, not residing in the country's southeast region (hazard ratio=1.22, 95% confidence interval=1.07-1.40 and socioeconomic status (hazard ratio=1.28, 95% confidence interval=1.06-1.55. CONCLUSION: The Kaplan Meier estimator corrected the underestimated duration of breastfeeding in the country when calculated by the current status methodology. Despite the national efforts done in the last decades to promote breastfeeding, the results indicate that the duration of exclusive breastfeeding is still half of that recommended for this dietary practice to promote health. Ways to revert this situation would be ongoing educational activities involving the educational and health systems, associated with advertising campaigns on television and radio mainly targeting young mothers with low education level and low income, identified as those at high risk of weaning their children early.
Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.
Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J
2016-12-01
A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.
Armstrong, James; Forrest, Helen; Crawford, Mark W
2015-10-01
Discharge criteria based on physiological scoring systems can be used in the postanesthesia care unit (PACU) to fast-track patients after ambulatory surgery; however, studies comparing physiological scoring systems with traditional time-based discharge criteria are lacking. The purpose of this study was to compare PACU discharge readiness times using physiological vs time-based discharge criteria in pediatric ambulatory surgical patients. We recorded physiological observations from consecutive American Society of Anesthesiologists physical status I-III patients aged 1-18 yr who were admitted to the PACU after undergoing ambulatory surgery in a tertiary academic pediatric hospital. The physiological score was a combination of the Aldrete and Chung systems. Scores were recorded every 15 min starting upon arrival in the PACU. Patients were considered fit for discharge once they attained a score ≥12 (maximum score, 14), provided no score was zero, with the time to achieve a score ≥12 defining the criteria-based discharge (CBD) time. Patients were discharged from the PACU when both the CBD and the existing time-based discharge (TBD) criteria were met. The CBD and TBD data were compared using Kaplan-Meier and log-rank analysis. Observations from 506 children are presented. Median (interquartile range [IQR]) age was 5.5 [2.8-9.9] yr. Median [IQR] CBD and TBD PACU discharge readiness times were 30 [15-45] min and 60 [45-60] min, respectively. Analysis of Kaplan-Meier curves indicated a significant difference in discharge times using the different criteria (hazard ratio, 5.43; 95% confidence interval, 4.51 to 6.53; P < 0.001). All patients were discharged home without incident. This prospective study suggests that discharge decisions based on physiological criteria have the potential for significantly speeding the transit of children through the PACU, thereby enhancing PACU efficiency and resource utilization.
Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin
2017-05-01
Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic
International Nuclear Information System (INIS)
Nagata, Masaki; Takahashi, Katsu; Kodama, Naoki; Kawase, Tomoyuki; Hoshina, Hideyuki; Ikeda, Nobuyuki; Shingaki, Susumu; Takagi, Ritsuo; Noman, Arhab A; Suzuki, Kenji; Kurita, Hiroshi; Ohnishi, Makoto; Ohyama, Tokio; Kitamura, Nobutaka; Kobayashi, Takanori; Uematsu, Kohya
2013-01-01
Molecular biomarkers are essential for monitoring treatment effects, predicting prognosis, and improving survival rate in oral squamous cell carcinoma. This study sought to verify the effectiveness of two integrin gene expression ratios as biomarkers. Gene expression analyses of integrin α3 (ITGA3), integrin β4 (ITGB4), CD9 antigen (CD9), and plakoglobin (JUP) by quantitative real-time PCR were conducted on total RNA from 270 OSCC cases. The logrank test, Cox proportional hazards model, and Kaplan-Meier estimates were performed on the gene expression ratios of ITGA3/CD9 and ITGB4/JUP and on the clinicopathological parameters for major clinical events. A high rate (around 80%) of lymph node metastasis was found in cases with a high ITGA3/CD9 ratio (high-ITGA3/CD9) and invasive histopathology (YK4). Primary site recurrence (PSR) was associated with high-ITGA3/CD9, T3-4 (TNM class), and positive margin, indicating that PSR is synergistically influenced by treatment failure and biological malignancy. A high ITGB4/JUP ratio (high-ITGB4/JUP) was revealed to be a primary contributor to distant metastasis without the involvement of clinicopathological factors, suggesting intervention of a critical step dependent on the function of the integrin β4 subunit. Kaplan-Meier curves revealed positive margin as a lethal treatment consequence in high-ITGA3/CD9 and YK4 double-positive cases. Two types of metastatic trait were found in OSCC: locoregional dissemination, which was reflected by high-ITGA3/CD9, and distant metastasis through hematogenous dissemination, uniquely distinguished by high-ITGB4/JUP. The clinical significance of the integrin biomarkers implies that biological mechanisms such as cancer cell motility and anchorage-independent survival are vital for OSCC recurrence and metastasis
Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat
2013-01-01
There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer
Survival of Root-filled Teeth in the Swedish Adult Population
DEFF Research Database (Denmark)
Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik
2016-01-01
INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...
Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan
Krikun, Andrew
2010-01-01
Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…
Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V
2016-01-01
To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.
Neuteboom, J.H.; Struik, P.C.
2005-01-01
The impact of clustering on rank abundance, species-individual (S-N)and species-area curves was investigated using a computer programme for in silico sampling. In a rank abundance curve the abundances of species are plotted on log-scale against species sequence. In an S-N curve the number of species
de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.
1998-01-01
We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766
Curve Boxplot: Generalization of Boxplot for Ensembles of Curves.
Mirzargar, Mahsa; Whitaker, Ross T; Kirby, Robert M
2014-12-01
In simulation science, computational scientists often study the behavior of their simulations by repeated solutions with variations in parameters and/or boundary values or initial conditions. Through such simulation ensembles, one can try to understand or quantify the variability or uncertainty in a solution as a function of the various inputs or model assumptions. In response to a growing interest in simulation ensembles, the visualization community has developed a suite of methods for allowing users to observe and understand the properties of these ensembles in an efficient and effective manner. An important aspect of visualizing simulations is the analysis of derived features, often represented as points, surfaces, or curves. In this paper, we present a novel, nonparametric method for summarizing ensembles of 2D and 3D curves. We propose an extension of a method from descriptive statistics, data depth, to curves. We also demonstrate a set of rendering and visualization strategies for showing rank statistics of an ensemble of curves, which is a generalization of traditional whisker plots or boxplots to multidimensional curves. Results are presented for applications in neuroimaging, hurricane forecasting and fluid dynamics.
Sanhueza, Edgar; Contreras, Jorge; Zapata, Rodrigo; Sanhueza, Matías; Elgueta, Fabián; López, Constanza; Jerez, Sigrid; Jerez, Verónica; Delgado, Iris
2017-01-01
Currently, most liver units use the Child-Pugh (CP) or the Model for End-Stage Liver Disease (MELD) scores to establish survival prognosis among patients with liver cirrhosis. Which classification is superior, is not well defined. To compare CP and MELD classification scores to predict survival among adult patients with liver cirrhosis in Chile. Follow-up of 137 consecutive adult patients with liver cirrhosis aged 59 ± 12 years (55% women). The diagnosis was reached by clinical, laboratory and image studies at three different centers of Santiago. Patients were staged with CP and MELD classification scores at baseline and followed over a period of 12 months. The predictive capacity of the scores for survival was analyzed using a multivariate statistical analysis (Kaplan-Meier curves). The most common etiology was alcohol (37.9%). The actuarial survival rate was 79.6% at 12 months of follow-up. When comparing groups with areas under curve of receiver operating characteristic curves (AUROC), there was no statistically significant difference in survival between less severe and advanced disease, assessed with both survival scales. The AUROC for MELD and CP were 0.80 and 0.81, respectively. This clinical study did not find a statistically significant difference between the two classifications for the prediction of 12 months survival in patients with cirrhosis.
Henley, Amy J; DiGennaro Reed, Florence D; Reed, Derek D; Kaplan, Brent A
2016-09-01
Incentives are a popular method to achieve desired employee performance; however, research on optimal incentive magnitude is lacking. Behavioral economic demand curves model persistence of responding in the face of increasing cost and may be suitable to examine the reinforcing value of incentives on work performance. The present use-inspired basic study integrated an experiential human operant task within a crowdsourcing platform to evaluate the applicability of behavioral economics for quantifying changes in workforce attrition. Participants included 88 Amazon Mechanical Turk Workers who earned either a $0.05 or $0.10 incentive for completing a progressively increasing response requirement. Analyses revealed statistically significant differences in breakpoint between the two groups. Additionally, a novel translation of the Kaplan-Meier survival-curve analyses for use within a demand curve framework allowed for examination of elasticity of workforce attrition. Results indicate greater inelastic attrition in the $0.05 group. We discuss the benefits of a behavioral economic approach to modeling employee behavior, how the metrics obtained from the elasticity of workforce attrition analyses (e.g., P max ) may be used to set goals for employee behavior while balancing organizational costs, and how economy type may have influenced observed outcomes. © 2016 Society for the Experimental Analysis of Behavior.
Energy Technology Data Exchange (ETDEWEB)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik
2002-08-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent
DEFF Research Database (Denmark)
Chesnaye, Nicholas C.; Van Stralen, Karlijn J.; Bonthuis, Marjolein
2017-01-01
from the ESPN/ERA-EDTA Registry. The effect of donor and recipient age combinations on 5-year graft-failure risk, stratified by donor source, was estimated using Kaplan-Meier survival curves and Cox regression, while adjusting for sex, primary renal diseases with a high risk of recurrence, pre......Background The impact of donor age in paediatric kidney transplantation is unclear. We therefore examined the association of donor-recipient age combinations with graft survival in children. Methods Data for 4686 first kidney transplantations performed in 13 countries in 1990-2013 were extracted......-emptive transplantation, year of transplantation and country. Results The risk of graft failure in older living donors (50-75 years old) was similar to that of younger living donors {adjusted hazard ratio [aHR] 0.74 [95% confidence interval (CI) 0.38-1.47]}. Deceased donor (DD) age was non-linearly associated with graft...
The influence of unilateral oophorectomy on the age of menopause
DEFF Research Database (Denmark)
Rosendahl, M; Simonsen, M K; Kjer, J J
2017-01-01
OBJECTIVE: To determine the age of menopause after premenopausal unilateral oophorectomy (UO) and to establish whether UO at a young age leads to menopause at a younger age than if UO occurs at an older age. METHODS: A cohort of 28 731 women, of whom 17 781 (62%) were menopausal, was investigated....... Information on menopause was obtained from self-reported questionnaires. Surgical data were obtained from the National Patient Register to avoid recollection bias. Age of menopause after UO/not UO was determined using Kaplan-Meier curves. Cox regression was used to identify factors of importance for early...... menopause. RESULTS: UO was performed in 1148 women. Women with UO after the age of 45 years, premenopausal hysterectomy, bilateral oophorectomy and cancer were excluded, leaving 236 in the analysis. Menopause occurred 1.8 years earlier after UO compared to women with two intact ovaries (mean 49.5 vs. 51...
DEFF Research Database (Denmark)
Vestergaard, Per; Licht, Rasmus Wentzer; Brodersen, Anders Torp
1998-01-01
The purpose of the study was to examine the outcome of long-term lithium treatment in consecutively admitted affective disorder patients assigned to high and low serum lithium levels. A total of 91 patients were diagnosed according to DSM-III criteria and randomly allocated to two open treatment...... groups in which prophylactic lithium was administered in high (serum lithium 0.8-1.0 mmol L-1) and low (serum lithium 0.5-0.8 mmol L-1) doses, respectively. The patients were followed for 2 years or until discontinuation of lithium treatment or readmission to hospital for recurrence of affective illness....... The main outcome of the treatment groups was compared with Kaplan-Meier survival curves and by Cox regression analysis. A total of 31 patients (34%) completed 24 months of prophylactic lithium treatment without recurrence and readmission to hospital. In total, 18 patients (20%) suffered a recurrence...
DEFF Research Database (Denmark)
Schrama, Johannes Cornelis; Fenstad, Anne M; Dale, Håvard
2015-01-01
Background and purpose-Medical treatment of rheumatoid arthritis (RA) has changed dramatically over the last 15 years, including immune modulation. We investigated the risk of revision for infection after primary total hip replacement (THR) in patients with rheumatoid arthritis over a 16-year...... period, and compared it with that in THR patients with osteoarthritis (OA).Patients and methods-We identified 13,384 THRs in RA patients and 377,287 THRs in OA patients from 1995 through 2010 in a dataset from the Nordic Arthroplasty Register Association (NARA). Kaplan-Meier survival curves......, with revision for infection as the endpoint, were constructed. Cox regression analyses were performed to calculate the relative risk (RR) of revision for infection adjusted for age, sex, fixation technique, and year of primary surgery.Results-RA patients had a 1.3 times (95% CI 1.0-1.6) higher risk of revision...
Association between poor clinical prognosis and sleep duration among breast cancer patients
Directory of Open Access Journals (Sweden)
Thalyta Cristina Mansano-Schlosser
Full Text Available ABSTRACT Objective: to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. Method: longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression, using the Kaplan-Meier curve, Log-rank test and Cox proportional model. Results: a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173. Conclusion: the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses.
DEFF Research Database (Denmark)
Hansen, N; Obel, N; Christensen, P B
2009-01-01
Predictive factors for initiation of antiviral therapy in chronically infected hepatitis C virus (HCV) patients are not fully elucidated. The aim of this study was to determine predictive factors for initiation of treatment with standard or pegylated interferon either alone or combined...... with ribavirin. A Danish cohort of individuals chronically infected with HCV was used and observation time was calculated from the date of inclusion in the cohort to date of death, last clinical observation, 1 January 2007, or start of HCV antiviral treatment in treatment-naïve patients. Kaplan-Meier survival...... analysis was used to construct time to event curves. Cox regression was used to determine the incidence rate ratios as estimates of relative risk (RR) and 95% confidence intervals (CI). A total of 1780 patients were enrolled in the study. The cumulative chance of treatment initiation over 5 years was 33...
ASURV: Astronomical SURVival Statistics
Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.
2014-06-01
ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.
First line chemotherapy plus trastuzumab in metastatic breast cancer ...
African Journals Online (AJOL)
First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...
Influence of antiviral therapy on survival of patients with hepatitis B ...
African Journals Online (AJOL)
The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...
DEFF Research Database (Denmark)
Kirk, O; Mocroft, A; Pradier, C
2001-01-01
-up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...
Experience in the management of ECMO therapy as a mortality risk factor.
Guilló Moreno, V; Gutiérrez Martínez, A; Romero Berrocal, A; Sánchez Castilla, M; García-Fernández, J
2018-02-01
The extracorporeal oxygenation membrane (ECMO) is a system that provides circulatory and respiratory assistance to patients in cardiac or respiratory failure refractory to conventional treatment. It is a therapy with numerous associated complications and high mortality. Multidisciplinary management and experienced teams increase survival. Our purpose is to evaluate and analyse the effect of the learning curve on mortality. Retrospective and observational study of 31 patients, from January 2012 to December 2015. Patients were separated into 2periods. These periods were divided by the establishment of an ECMO protocol. We compared the quantitative variables by performing the Mann-Whitney U test. For the categorical qualitative variables we performed the chi-square test or Fisher exact statistic as appropriate. The survival curve was computed using the Kaplan-Meier method, and the analysis of statistical significance using the Log-rank test. Data analysis was performed with the STATA programme 14. Survival curves show the tendency to lower mortality in the subsequent period (P=0.0601). The overall mortality rate in the initial period was higher than in the subsequent period (P=0.042). In another analysis, we compared the characteristics of the 2groups and concluded that they were homogeneous. The degree of experience is an independent factor for mortality. The application of a care protocol is fundamental to facilitate the management of ECMO therapy. Copyright © 2017 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.
Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A
2011-02-27
Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.
Axial U(1) current in Grabowska and Kaplan's formulation
Hamada, Yu; Kawai, Hikaru
2017-06-01
Recently, Grabowska and Kaplan [Phys. Rev. Lett. 116, 211602 (2016); Phys. Rev. D 94, 114504 (2016)] suggested a nonperturbative formulation of a chiral gauge theory, which consists of the conventional domain-wall fermion and a gauge field that evolves by gradient flow from one domain wall to the other. We introduce two sets of domain-wall fermions belonging to complex conjugate representations so that the effective theory is a 4D vector-like gauge theory. Then, as a natural definition of the axial-vector current, we consider a current that generates simultaneous phase transformations for the massless modes in 4 dimensions. However, this current is exactly conserved and does not reproduce the correct anomaly. In order to investigate this point precisely, we consider the mechanism of the conservation. We find that this current includes not only the axial current on the domain wall but also a contribution from the bulk, which is nonlocal in the sense of 4D fields. Therefore, the local current is obtained by subtracting the bulk contribution from it.
Latzman, Robert D.; Markon, Kristian E.
2010-01-01
There has been an increased interest in the structure of and relations among executive functions.The present study examined the factor structure as well as age-related factorial invariance of the Delis-Kaplan Executive Function System (D-KEFS), a widely used inventory aimed at assessing executive functions. Analyses were first conducted using data…
String Sigma Models on Curved Supermanifolds
Directory of Open Access Journals (Sweden)
Roberto Catenacci
2018-04-01
Full Text Available We use the techniques of integral forms to analyze the easiest example of two-dimensional sigma models on a supermanifold. We write the action as an integral of a top integral form over a D = 2 supermanifold, and we show how to interpolate between different superspace actions. Then, we consider curved supermanifolds, and we show that the definitions used for flat supermanifolds can also be used for curved supermanifolds. We prove it by first considering the case of a curved rigid supermanifold and then the case of a generic curved supermanifold described by a single superfield E.
Energy Technology Data Exchange (ETDEWEB)
Lee, Jeong-Won [Sungkyunkwan University School of Medicine, Department of Obstetrics and Gynecology, Seoul (Korea, Republic of); Sungkyunkwan University School of Medicine, Samsung Advanced Institute for Health Sciences and Technology, Seoul (Korea, Republic of); Heo, Eun Jin [Sungkyunkwan University School of Medicine, Department of Obstetrics and Gynecology, Seoul (Korea, Republic of); Moon, Seung Hwan [Sungkyunkwan University School of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Lee, Hyunjong; Cheon, Gi Jeong [Seoul National University College of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Lee, Maria; Kim, Hee Seung; Chung, Hyun Hoon [Seoul National University College of Medicine, Department of Obstetrics and Gynecology, Cancer Research Institute, Seoul (Korea, Republic of)
2016-11-15
To investigate the relationship between functional tumour parameters measured during preoperative {sup 18}F-FDG PET/CT and clinical outcomes in patients with uterine carcinosarcoma. For patients with pathologically proven uterine carcinosarcoma, we determined the maximal and average standardized uptake values, cumulative total lesion glycolysis (TLG) and sum of all metabolic tumour volumes (MTVs). Their predictive value for recurrence and the effects of pretreatment functional tumour activity on patient survival were compared. Clinicopathological data from 28 eligible patients were reviewed. The median duration of progression-free survival was 18.6 months (range 6.1-84.5 months), and 10 (35.7 %) patients experienced recurrences. Univariate analyses showed significant associations between recurrence and tumour size, lymph node metastasis, high TLG and MTV values, and ovarian invasion. Multivariate analysis identified high TLG value as an independent risk factor for recurrence (p = 0.048, hazard ratio 115.261, 95 % confidence interval 1.041-12,765.483). Kaplan-Meier survival curves showed that progression-free survival significantly differed in groups categorized according to TLG (p = 0.007, log-rank test). Preoperative TLG measured with {sup 18}F-FDG PET/CT was statistically significantly associated with uterine carcinosarcoma recurrence. Metabolic parameters can provide useful quantitative criteria for disease prognostication in patients with uterine carcinosarcoma before treatment. (orig.)
Long-term efficacy and safety of ExPress implantation for treatment of open angle glaucoma
Directory of Open Access Journals (Sweden)
Geun Young Lee
2017-09-01
Full Text Available AIM: To compare the long-term efficacy and safety of ExPress implantation and standard trabeculectomy in patients with primary open angle glaucoma (POAG. METHODS: In this retrospective study, we compared 17 eyes treated by ExPress implantation with 23 eyes treated by trabeculectomy. Efficacy was assessed according to the relevant intraocular pressure (IOP values and success rates during the first year of follow-up. Postoperative corneal endothelial cell loss was also compared. RESULTS: The number of antiglaucoma medications and the IOP reduction were similar between the 2 groups during the follow-up period. Although the mean IOP was similar, the IOP-fluctuation rate during the early postoperative period was significantly lower in the ExPress group than in the trabeculectomy group (P=0.038. A Kaplan-Meier survival curve analysis showed no significant success-rate difference between the groups (P=0.810. The corneal endothelial cell loss rate, moreover, was significantly lower in the ExPress group (P=0.05. CONCLUSION: ExPress implantation compared with trabeculectomy showed similar IOP-reduction and success rates along with lower IOP fluctuation and endothelial cell loss rates. For this reason, it can be considered to be the treatment of choice for patients with advanced glaucoma or low corneal endothelial cell density.
Long-term efficacy and safety of ExPress implantation for treatment of open angle glaucoma.
Lee, Geun Young; Lee, Chong Eun; Lee, Kyoo Won; Seo, Sam
2017-01-01
To compare the long-term efficacy and safety of ExPress implantation and standard trabeculectomy in patients with primary open angle glaucoma (POAG). In this retrospective study, we compared 17 eyes treated by ExPress implantation with 23 eyes treated by trabeculectomy. Efficacy was assessed according to the relevant intraocular pressure (IOP) values and success rates during the first year of follow-up. Postoperative corneal endothelial cell loss was also compared. The number of antiglaucoma medications and the IOP reduction were similar between the 2 groups during the follow-up period. Although the mean IOP was similar, the IOP-fluctuation rate during the early postoperative period was significantly lower in the ExPress group than in the trabeculectomy group ( P =0.038). A Kaplan-Meier survival curve analysis showed no significant success-rate difference between the groups ( P =0.810). The corneal endothelial cell loss rate, moreover, was significantly lower in the ExPress group ( P =0.05). ExPress implantation compared with trabeculectomy showed similar IOP-reduction and success rates along with lower IOP fluctuation and endothelial cell loss rates. For this reason, it can be considered to be the treatment of choice for patients with advanced glaucoma or low corneal endothelial cell density.
Long-term efficacy and safety of ExPress implantation for treatment of open angle glaucoma
Lee, Geun Young; Lee, Chong Eun; Lee, Kyoo Won; Seo, Sam
2017-01-01
AIM To compare the long-term efficacy and safety of ExPress implantation and standard trabeculectomy in patients with primary open angle glaucoma (POAG). METHODS In this retrospective study, we compared 17 eyes treated by ExPress implantation with 23 eyes treated by trabeculectomy. Efficacy was assessed according to the relevant intraocular pressure (IOP) values and success rates during the first year of follow-up. Postoperative corneal endothelial cell loss was also compared. RESULTS The number of antiglaucoma medications and the IOP reduction were similar between the 2 groups during the follow-up period. Although the mean IOP was similar, the IOP-fluctuation rate during the early postoperative period was significantly lower in the ExPress group than in the trabeculectomy group (P=0.038). A Kaplan-Meier survival curve analysis showed no significant success-rate difference between the groups (P=0.810). The corneal endothelial cell loss rate, moreover, was significantly lower in the ExPress group (P=0.05). CONCLUSION ExPress implantation compared with trabeculectomy showed similar IOP-reduction and success rates along with lower IOP fluctuation and endothelial cell loss rates. For this reason, it can be considered to be the treatment of choice for patients with advanced glaucoma or low corneal endothelial cell density. PMID:28944196
DEFF Research Database (Denmark)
Andersson, U.; Osterman, P.; Sjostrom, S.
2009-01-01
was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
International Nuclear Information System (INIS)
Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F
2012-01-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.
2012-11-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Jacobs, Benjamin M.
2009-01-01
This historical study focuses on how John Dewey's theory of education as socialization and Mordecai Kaplan's theory of Judaism as a civilization together served as an ideological base and pedagogical framework for the creation of "progressive," "reconstructed" American Jewish school programs in the early 20th century…
Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M
2015-03-01
This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.
Buonanno, Paolo; Fergusson, Leopoldo; Vargas, Juan Fernando
2014-01-01
We document the existence of a Crime Kuznets Curve in US states since the 1970s. As income levels have risen, crime has followed an inverted U-shaped pattern, first increasing and then dropping. The Crime Kuznets Curve is not explained by income inequality. In fact, we show that during the sample period inequality has risen monotonically with income, ruling out the traditional Kuznets Curve. Our finding is robust to adding a large set of controls that are used in the literature to explain the...
Multiple myeloma in Nigeria: An insight to the clinical, laboratory ...
African Journals Online (AJOL)
The average percentage of bone marrow plasmacytosis at diagnosis ... of autologous stem cell transplantation (ASCT) for white, black, and ... Hospital Cancer Registry and Data Collation Institute. .... Figure 1: (a) Kaplan‑Meier survival curve for all myeloma patients, (b) Kaplan‑Meier survival curve for the different sexes b a ...
International Nuclear Information System (INIS)
Xu Ying; Zhu Yueqi; Zhao Jungong; Wang Jianbo; Tan Huaqiao; Cheng Yingsheng; Li Minghua; Wang Jue; Cheng Yongde
2011-01-01
Objective: To assess the feasibility and efficacy of subintimal angioplasty (SA) for the treatment of below-the-arterial occlusion in diabetic patients with chronic critical limb ischemia (CLI). Methods: SA was adopted for 57 diseased lower limbs in 37 diabetic patients with chronic CLI and occlusive disease of the dorsalis pedis artery (DPA) and/or planter artery (PA), who were not suitable candidates for intraluminal angioplasty or bypass surgery. Of the total 57 diseased lower limbs, tissue loss was seen in 31 (54.4%) and pain was reported in 51 (89.5%). SA was carried out to create continuous arterial flow to the foot for limb salvage. Both before and after the procedure the clinical symptoms, DPA or PA pulse volume scores and ankle-brachial indexes (ABI) were determined in all patients, the results were compared and statistically analysed. During the follow-up period, the healing of the wound, the salvage of the diseased limb and the re-stenosis occurrence of the target vessels were evaluated. Kaplan-Meier curves were constructed to evaluate limb salvage, survival rate and freedom from amputation. Results: A total of 66 below-the-ankle arterial lesions were detected in 57 affected limbs. Of the 66 lesions, SA was successfully performed in 55 (83.3%). Before SA the median pulse volume scores and ABIs were 0.33±0.54 and 0.31±0.19 respectively, which became 2.04±1.05 and 0.80±0.14 respectively after SA, the differences in both median pulse volume scores and ABI were statistically significant (P<0.01 for both). One patient (2.7%) died within 30 days after the procedure. Mild complications, such as bleeding, thrombosis or angiospasm etc. occurred in five patents (13.5%). Twelve months after SA. Kaplan-Meier analysis showed that the limb salvage rate was 94.6%, the freedom from amputation was 89.2% and the survival rate was 97.3%. Conclusion: SA of the dorsalis pedis artery and/or planter artery is an effective technique for lower limb salvage in diabetic
Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies
International Nuclear Information System (INIS)
Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.
2007-01-01
Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients
Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim
2012-01-01
Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Directory of Open Access Journals (Sweden)
Yibeltal Assefa
Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A
2017-09-30
For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
[Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].
Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong
2017-07-01
To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.
Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis
DEFF Research Database (Denmark)
Egeberg, Alexander; Skov, Lone; Zachariae, Claus
2018-01-01
It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....
Prognostic and survival analysis of presbyopia: The healthy twin study
Lira, Adiyani; Sung, Joohon
2015-12-01
Presbyopia, a vision condition in which the eye loses its flexibility to focus on near objects, is part of ageing process which mostly perceptible in the early or mid 40s. It is well known that age is its major risk factor, while sex, alcohol, poor nutrition, ocular and systemic diseases are known as common risk factors. However, many other variables might influence the prognosis. Therefore in this paper we developed a prognostic model to estimate survival from presbyopia. 1645 participants which part of the Healthy Twin Study, a prospective cohort study that has recruited Korean adult twins and their family members based on a nation-wide registry at public health agencies since 2005, were collected and analyzed by univariate analysis as well as Cox proportional hazard model to reveal the prognostic factors for presbyopia while survival curves were calculated by Kaplan-Meier method. Besides age, sex, diabetes, and myopia; the proposed model shows that education level (especially engineering program) also contribute to the occurrence of presbyopia as well. Generally, at 47 years old, the chance of getting presbyopia becomes higher with the survival probability is less than 50%. Furthermore, our study shows that by stratifying the survival curve, MZ has shorter survival with average onset time about 45.8 compare to DZ and siblings with 47.5 years old. By providing factors that have more effects and mainly associate with presbyopia, we expect that we could help to design an intervention to control or delay its onset time.
Directory of Open Access Journals (Sweden)
Tom Stiff
Full Text Available Mutations in ORC1, ORC4, ORC6, CDT1, and CDC6, which encode proteins required for DNA replication origin licensing, cause Meier-Gorlin syndrome (MGS, a disorder conferring microcephaly, primordial dwarfism, underdeveloped ears, and skeletal abnormalities. Mutations in ATR, which also functions during replication, can cause Seckel syndrome, a clinically related disorder. These findings suggest that impaired DNA replication could underlie the developmental defects characteristic of these disorders. Here, we show that although origin licensing capacity is impaired in all patient cells with mutations in origin licensing component proteins, this does not correlate with the rate of progression through S phase. Thus, the replicative capacity in MGS patient cells does not correlate with clinical manifestation. However, ORC1-deficient cells from MGS patients and siRNA-mediated depletion of origin licensing proteins also have impaired centrosome and centriole copy number. As a novel and unexpected finding, we show that they also display a striking defect in the rate of formation of primary cilia. We demonstrate that this impacts sonic hedgehog signalling in ORC1-deficient primary fibroblasts. Additionally, reduced growth factor-dependent signaling via primary cilia affects the kinetics of cell cycle progression following cell cycle exit and re-entry, highlighting an unexpected mechanism whereby origin licensing components can influence cell cycle progression. Finally, using a cell-based model, we show that defects in cilia function impair chondroinduction. Our findings raise the possibility that a reduced efficiency in forming cilia could contribute to the clinical features of MGS, particularly the bone development abnormalities, and could provide a new dimension for considering developmental impacts of licensing deficiency.
Metagenes Associated with Survival in Non-Small Cell Lung Cancer
Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres
2011-01-01
NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068
Randomized controlled study on the effect of adjuvant immunotherapy with OK-432 on malignant gliomas
International Nuclear Information System (INIS)
Shibata, Shobu; Mori, Kazuo; Moriyama, Tadayoshi; Tanaka, Keisei; Moroki, Jiro.
1985-01-01
During periods from January, 1981 to December, 1983, 51 patients (31 malignant astrocytomas, 17 glioblastomas, and others 3) were treated with radiochemotherapy using Nimustine hydrochloride, ACNU (group B) and radiochemoimmunotherapy with Picibanil, OK-432 (group A) by randomized controlled study. Group A consisted of 24 patients and group B of 27 patients. The differences in the background of the two groups were not statistically significant. Survival curves of both groups were shown by the Kaplan-Meier method. The postoperative survival rate at 1 year and 2 years were 70 % and 30 %, respectively, equal in both groups, and the differences between groups A and B were not statistically significant by the Cox-Mantel test. The side effects by group B therapy were most prominent in the bone marrow, and severe leukopenia occurred. However, group A therapy suppressed leukopenia after 2 months. Immunological parameters, such as purified protein derivative skin reaction test did not change, but streptococcal Su-polysaccharide skin reaction test became positive after group A therapy. (author)
Li, Ya-Jun; Yi, Ping-Yong; Li, Ji-Wei; Liu, Xian-Ling; Tang, Tian; Zhang, Pei-Ying; Jiang, Wen-Qi
2017-07-31
The prognostic significance of ABO blood type for lymphoma is largely unknown. We evaluated the prognostic role of ABO blood type in patients with extranodal natural killer (NK)/T-cell lymphoma (ENKTL). We retrospectively analyzed clinical data of 697 patients with newly diagnosed ENKTL from three cancer centers. The prognostic value of ABO blood type was evaluated using Kaplan-Meier curves and Cox proportional hazard models. The prognostic values of the International Prognostic Index (IPI) and the Korean Prognostic Index (KPI) were also evaluated. Compared with patients with blood type O, those with blood type non-O tended to display elevated baseline serum C-reactive protein levels (P = 0.038), lower rate of complete remission (P = 0.005), shorter progression-free survival (PFS, P 60 years (P KPI in distinguishing between the intermediate-to-low- and high-to-intermediate-risk groups. ABO blood type was an independent predictor of clinical outcome for patients with ENKTL.
DEFF Research Database (Denmark)
Desmonde, Sophie; Dicko, Fatoumata; Koueta, Fla
2014-01-01
measurements, including one at ART initiation (baseline) were included. CD4 cell gain on ART was estimated using a multivariable linear mixed model adjusted for baseline variables: age, CD4 cell count, sex, first-line ART regimen. Kaplan-Meier survival curves and a Cox proportional hazards regression model...... compared immune recovery for age within 24 months post-ART. RESULTS: Of the 4808 children initiated on ART, 3014 were enrolled at a median age of 5.6 years; 61.2% were immunodeficient. After 12 months, children at least 4 years at baseline had significantly lower CD4 cell gains compared with children less...... these children, 75% reached immune recovery: 12-month rates were significantly highest in all those aged 2-5 years at ART initiation compared with those less than 2 years. Beyond 12 months on ART, immune recovery was significantly lower in children initiated more than 5 years (adjusted hazard ratio: 0.69, 95...
PRAME gene expression profile in medulloblastoma
Directory of Open Access Journals (Sweden)
Tânia Maria Vulcani-Freitas
2011-02-01
Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.
Outcome and CT differentiation of gallbladder neuroendocrine tumours from adenocarcinomas
Energy Technology Data Exchange (ETDEWEB)
Kim, Tae-Hyung [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Kim, Se Hyung [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Seoul National University Hospital and Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Lee, Kyoung Boon [Seoul National University Hospital, Department of Pathology, Seoul (Korea, Republic of); Han, Joon Koo [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Seoul National University Medical Research Center, Institute of Radiation Medicine, Seoul (Korea, Republic of)
2017-02-15
To retrospectively investigate clinical outcome and differential CT features of gallbladder (GB) neuroendocrine tumours (NETs) from adenocarcinomas (ADCs). Nineteen patients with poorly-differentiated (PD) NETs and 19 patients with PD ADCs were enrolled. Clinical outcome was compared by the Kaplan-Meier method. We assessed qualitative and quantitative CT features to identify significant differential CT features of PD NETs from ADCs using univariate and multivariate analyses. Receiver operating characteristic (ROC) analysis was used for quantitative CT features. PD NETs showed poorer prognosis with significantly shorter median survival days than ADCs (363 vs. 590 days, P = 0.03). On univariate analysis, NETs more frequently manifested as GB-replacing type and showed well-defined margins accompanied with intact overlying mucosa. On multivariate analysis, well-defined margin was the sole significant CT differentiator (odds ratio = 27.817, P = 0.045). Maximum size of hepatic and lymph node (LN) metastases was significantly larger in NETs (11.0 cm and 4.62 cm) than ADCs (2.40 cm and 2.41 cm). Areas under ROC curves for tumour-to-mucosa ratio, maximum size of hepatic and LN metastasis were 0.772, 0.932 and 0.919, respectively (P < 0.05). GB PD NETs show poorer prognosis than ADCs. Well-defined margin, larger hepatic and LN metastases are useful CT differentiators of GB NETs from ADCs. (orig.)
Directory of Open Access Journals (Sweden)
Viviana Volta
Full Text Available Malignant pleural mesothelioma (MPM is a poor prognosis disease lacking adequate therapy. We have previously shown that ascorbic acid administration is toxic to MPM cells. Here we evaluated a new combined therapy consisting of ascorbate/epigallocatechin-3-gallate/gemcitabine mixture (called AND, for Active Nutrients/Drug. In vitro effects of AND therapy on various MPM cell lines revealed a synergistic cytotoxic mechanism. In vivo experiments on a xenograft mouse model for MPM, obtained by REN cells injection in immunocompromised mice, showed that AND strongly reduced the size of primary tumor as well as the number and size of metastases, and prevented abdominal hemorrhage. Kaplan Meier curves and the log-rank test indicated a marked increase in the survival of AND-treated animals. Histochemical analysis of dissected tumors showed that AND induced a shift from cell proliferation to apoptosis in cancer cells. Lysates of tumors from AND-treated mice, analyzed with an antibody array, revealed decreased TIMP-1 and -2 expressions and no effects on angiogenesis regulating factors. Multiplex analysis for signaling protein phosphorylation exhibited inactivation of cell proliferation pathways. The complex of data showed that the AND treatment is synergistic in vitro on MPM cells, and blocks in vivo tumor progression and metastasization in REN-based xenografts. Hence, the AND combination is proposed as a new treatment for MPM.
C-reactive protein and homocysteine predict long-term mortality in young ischemic stroke patients.
Naess, Halvor; Nyland, Harald; Idicula, Titto; Waje-Andreassen, Ulrike
2013-11-01
We investigated the relationship between C-reactive protein (CRP) and homocysteine on follow-up and subsequent mortality in young ischemic stroke patients in a population-based study. Young ischemic stroke patients were followed-up on average 6 years after the index stroke. CRP and homocysteine levels were measured and risk factors were recorded, including myocardial infarction, diabetes mellitus, hypertension, smoking, alcoholism, and cancer. Stroke outcome was measured using the modified Rankin Scale score. Subsequent survival was obtained by examining the official population registry. Cox regression analyses were performed. In total, 198 patients were included in this study (82 [41%] women and 116 [59%] men). The mean age on follow-up was 47.8 years. In total, 36 (18.2%) patients died during the subsequent mean follow-up of 12.4 years. Cox regression analysis revealed that mortality was associated with CRP (hazard ratio [HR] 1.05; P=.001) and homocysteine levels (HR 1.04; P=.02) in patients without dissection. Kaplan-Meier curves grouped by dichotomized CRP (CRP≤1 v >1 mg/L) showed increasing separation between the survival curves, and likewise for dichotomized homocysteine (≤9 v >9 μg/L). There is an independent association between CRP and homocysteine levels obtained several years after ischemic stroke in young adults and subsequent mortality, even when adjusting for traditional risk factors. This association seems to continue for at least 12 years after the measurements. Copyright © 2013 National Stroke Association. Published by Elsevier Inc. All rights reserved.
Lagrangian Curves on Spectral Curves of Monopoles
International Nuclear Information System (INIS)
Guilfoyle, Brendan; Khalid, Madeeha; Ramon Mari, Jose J.
2010-01-01
We study Lagrangian points on smooth holomorphic curves in TP 1 equipped with a natural neutral Kaehler structure, and prove that they must form real curves. By virtue of the identification of TP 1 with the space LE 3 of oriented affine lines in Euclidean 3-space, these Lagrangian curves give rise to ruled surfaces in E 3 , which we prove have zero Gauss curvature. Each ruled surface is shown to be the tangent lines to a curve in E 3 , called the edge of regression of the ruled surface. We give an alternative characterization of these curves as the points in E 3 where the number of oriented lines in the complex curve Σ that pass through the point is less than the degree of Σ. We then apply these results to the spectral curves of certain monopoles and construct the ruled surfaces and edges of regression generated by the Lagrangian curves.
Post, Wendy; Moser, Marvin; Kaplan, Norman
2005-10-01
Following a hypertension symposium in Baltimore, MD, on June 1, 2005, Dr. Wendy Post from the Johns Hopkins University School of Medicine, Baltimore, MD, had the opportunity to interview two of the outstanding hypertension experts in the United States on several controversial issues in hypertension management. Dr. Norman Kaplan is Clinical Professor of Medicine at the Southwestern Health Science Center in Dallas, TX, and Dr. Marvin Moser is Clinical Professor of Medicine at the Yale University School of Medicine, New Haven, CT. Both have been leaders in the field of hypertension treatment and education for more than 40 years. Dr. Kaplan's book Clinical Hypertension has been a standard textbook since 1973 and is now in its ninth edition. Dr. Marvin Moser was the Senior Medical Consultant to the National High Blood Pressure Education Program from 1974 to 2002 and was Chairman of the first Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure and a member of the six subsequent committees. His book Clinical Management of Hypertension is in its seventh edition. Drs. Moser and Kaplan were corecipients of the 2004 International Society of Hypertension Award for Outstanding Contributions to Hypertension Treatment and Education and have lectured extensively throughout the United States and overseas.
DEFF Research Database (Denmark)
Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels
2009-01-01
bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...
Photoelectic BV Light Curves of Algol and the Interpretations of the Light Curves
Directory of Open Access Journals (Sweden)
Ho-Il Kim
1985-06-01
Full Text Available Standardized B and V photoelectric light curves of Algol are made with the observations obtained during 1982-84 with the 40-cm and the 61-cm reflectors of Yonsei University Observatory. These light curves show asymmetry between ascending and descending shoulders. The ascending shoulder is 0.02 mag brighter than descending shoulder in V light curve and 0.03 mag in B light curve. These asymmetric light curves are interpreted as the result of inhomogeneous energy distribution on the surface of one star of the eclipsing pair rather than the result of gaseous stream flowing from KOIV to B8V star. The 180-year periodicity, so called great inequality, are most likely the result proposed by Kim et al. (1983 that the abrupt and discrete mass losses of cooler component may be the cause of this orbital change. The amount of mass loss deduced from these discrete period changes turned out to be of the order of 10^(-6 - 10^(-5 Msolar.
Shen, Yun; Zhang, Xueli; Pan, Xiaoping; Xu, Yiting; Xiong, Qin; Lu, Zhigang; Ma, Xiaojing; Bao, Yuqian; Jia, Weiping
2017-08-18
The relationship between fibroblast growth factor 21 (FGF21) and cardiovascular disease has been well established in recent studies. This study aimed to investigate the relationship between FGF21 and left ventricular systolic dysfunction and cardiac death. Two-dimensional echocardiography was used to measure the left ventricular ejection fraction (LVEF) to estimate left ventricular systolic function. The optimal cutoff of FGF21 for identifying left ventricular systolic dysfunction at baseline was analyzed via receiver operating characteristic (ROC) curves. The identification of different serum levels of FGF21 and their association with cardiac death was analyzed via Kaplan-Meier survival curves. Serum FGF21 level was measured by an enzyme-linked immunosorbent assay kit, and serum N-terminal pro-brain natriuretic peptide (NT-pro-BNP) level was determined by a chemiluminescent immunoassay. A total of 253 patients were recruited for this study at baseline. Patients were excluded if they lacked echocardiography or laboratory measurement data, and there were 218 patients enrolled in the final analysis. The average age was 66.32 ± 10.10 years. The optimal cutoff values of FGF21 and NT-pro-BNP for identifying left ventricular systolic dysfunction at baseline were 321.5 pg/mL and 131.3 ng/L, respectively, determined separately via ROC analysis. The areas under the curves were non-significant among FGF21, NT-pro-BNP and FGF21 + NT-pro-BNP as determined by pairwise comparisons. Both a higher serum level of FGF21 and a higher serum level of NT-pro-BNP were independent risk factors for left ventricular systolic dysfunction at baseline (odd ratio (OR) 3.138 [1.037-9.500], P = 0.043, OR 9.207 [2.036-41.643], P = 0.004, separately). Further Kaplan-Meier survival analysis indicated an association between both a higher serum level of FGF21 and a higher serum level of NT-pro-BNP with cardiac death in 5 years [RR 5.000 (1.326-18.861), P = 0.026; RR 9.643 (2
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
Schmidt, H.; Kirschner, O.; Riedelbauch, S.; Necker, J.; Kopf, E.; Rieg, M.; Arantes, G.; Wessiak, M.; Mayrhuber, J.
2014-03-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation.
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
International Nuclear Information System (INIS)
Schmidt, H; Kirschner, O; Riedelbauch, S; Necker, J; Kopf, E; Rieg, M; Arantes, G; Wessiak, M; Mayrhuber, J
2014-01-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation
Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.
Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E
2018-02-02
In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.
Development of low head Kaplan turbine for power station rehabilitation project
Lim, S. M.; Ohtake, N.; Kurosawa, S.; Suzuki, T.; Yamasaki, T.; Nishi, H.
2012-11-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Development of low head Kaplan turbine for power station rehabilitation project
International Nuclear Information System (INIS)
Lim, S M; Ohtake, N; Kurosawa, S; Suzuki, T; Yamasaki, T; Nishi, H
2012-01-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Directory of Open Access Journals (Sweden)
Masahiro Kitamura
2017-01-01
Full Text Available Aims. To examine the relationship between activities of daily living (ADL and readmission within 90 days and assess the cutoff value of ADL to predict readmission in hospitalized elderly patients with heart failure (HF. Methods. This cohort study comprised 589 consecutive patients with HF aged ≥65 years, who underwent cardiac rehabilitation from May 2012 to May 2016 and were discharged home. We investigated patients’ characteristics, basic attributes, and ADL (motor and cognitive Functional Independence Measure [FIM]. We analyzed the data using the unpaired t-test, χ2 test, Cox proportional hazard model, receiver operating characteristic (ROC curve, and Kaplan-Meier method. Results. Of 589 patients, 113 met the criteria, and they were divided into the nonreadmission (n=90 and readmission groups (n=23. Age, body mass index, New York Heart Association class, hemoglobin level, and motor FIM score were significantly different between the two groups (p<0.05. The body mass index (hazard ratio [HR]: 0.87; p<0.05 and motor FIM score (HR: 0.94; p<0.01 remained statistically significant. The cutoff value for the motor FIM score determined by ROC curve analysis was 74.5 points (area under the curve = 0.78; p<0.001. Conclusion. The motor FIM score in elderly patients with HF was an independent predictor of rehospitalization within 90 days.
Super-quantum curves from super-eigenvalue models
Energy Technology Data Exchange (ETDEWEB)
Ciosmak, Paweł [Faculty of Mathematics, Informatics and Mechanics, University of Warsaw,ul. Banacha 2, 02-097 Warsaw (Poland); Hadasz, Leszek [M. Smoluchowski Institute of Physics, Jagiellonian University,ul. Łojasiewicza 11, 30-348 Kraków (Poland); Manabe, Masahide [Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland); Sułkowski, Piotr [Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland); Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E. California Blvd, Pasadena, CA 91125 (United States)
2016-10-10
In modern mathematical and theoretical physics various generalizations, in particular supersymmetric or quantum, of Riemann surfaces and complex algebraic curves play a prominent role. We show that such supersymmetric and quantum generalizations can be combined together, and construct supersymmetric quantum curves, or super-quantum curves for short. Our analysis is conducted in the formalism of super-eigenvalue models: we introduce β-deformed version of those models, and derive differential equations for associated α/β-deformed super-matrix integrals. We show that for a given model there exists an infinite number of such differential equations, which we identify as super-quantum curves, and which are in one-to-one correspondence with, and have the structure of, super-Virasoro singular vectors. We discuss potential applications of super-quantum curves and prospects of other generalizations.
Super-quantum curves from super-eigenvalue models
International Nuclear Information System (INIS)
Ciosmak, Paweł; Hadasz, Leszek; Manabe, Masahide; Sułkowski, Piotr
2016-01-01
In modern mathematical and theoretical physics various generalizations, in particular supersymmetric or quantum, of Riemann surfaces and complex algebraic curves play a prominent role. We show that such supersymmetric and quantum generalizations can be combined together, and construct supersymmetric quantum curves, or super-quantum curves for short. Our analysis is conducted in the formalism of super-eigenvalue models: we introduce β-deformed version of those models, and derive differential equations for associated α/β-deformed super-matrix integrals. We show that for a given model there exists an infinite number of such differential equations, which we identify as super-quantum curves, and which are in one-to-one correspondence with, and have the structure of, super-Virasoro singular vectors. We discuss potential applications of super-quantum curves and prospects of other generalizations.
Super-quantum curves from super-eigenvalue models
Ciosmak, Paweł; Hadasz, Leszek; Manabe, Masahide; Sułkowski, Piotr
2016-10-01
In modern mathematical and theoretical physics various generalizations, in particular supersymmetric or quantum, of Riemann surfaces and complex algebraic curves play a prominent role. We show that such supersymmetric and quantum generalizations can be combined together, and construct supersymmetric quantum curves, or super-quantum curves for short. Our analysis is conducted in the formalism of super-eigenvalue models: we introduce β-deformed version of those models, and derive differential equations for associated α/ β-deformed super-matrix integrals. We show that for a given model there exists an infinite number of such differential equations, which we identify as super-quantum curves, and which are in one-to-one correspondence with, and have the structure of, super-Virasoro singular vectors. We discuss potential applications of super-quantum curves and prospects of other generalizations.
Directory of Open Access Journals (Sweden)
Dong-dong Cheng
2015-07-01
Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.
Factors affecting commencement and cessation of smoking behaviour in Malaysian adults
Directory of Open Access Journals (Sweden)
Ghani Wan
2012-03-01
Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.
Martínez-Pastor, Juan C.; Muñoz-Mahamud, Ernesto; Vilchez, Félix; García-Ramiro, Sebastián; Bori, Guillem; Sierra, Josep; Martínez, José A.; Font, Lluis; Mensa, Josep; Soriano, Alex
2009-01-01
The aim of our study was to evaluate the outcome of acute prosthetic joint infections (PJIs) due to gram-negative bacilli (GNB) treated without implant removal. Patients with an acute PJI due to GNB diagnosed from 2000 to 2007 were prospectively registered. Demographics, comorbidity, type of implant, microbiology data, surgical treatment, antimicrobial therapy, and outcome were recorded. Classification and regression tree analysis, the Kaplan-Meier survival method, and the Cox regression model were applied. Forty-seven patients were included. The mean age was 70.7 years, and there were 15 hip prostheses and 32 knee prostheses. The median number of days from the time of arthroplasty was 20. The most frequent pathogens were members of the Enterobacteriaceae family in 41 cases and Pseudomonas spp. in 20 cases. Among the Enterobacteriaceae, 14 were resistant to ciprofloxacin, while all Pseudomonas aeruginosa isolates were susceptible to ciprofloxacin. The median durations of intravenous and oral antibiotic treatment were 14 and 64 days, respectively. A total of 35 (74.5%) patients were in remission after a median follow-up of 463 days (interquartile range, 344 to 704) days. By use of the Kaplan-Meier survival curve, a C-reactive protein (CRP) concentration of ≤15 mg/dl (P = 0.03) and receipt of a fluoroquinolone, when all GNB isolated were susceptible (P = 0.0009), were associated with a better outcome. By use of a Cox regression model, a CRP concentration of ≤15 mg/dl (odds ratio [OR], 3.57; 95% confidence interval [CI], 1.05 to 12.5; P = 0.043) and receipt of a fluoroquinolone (OR, 9.09; 95% CI, 1.96 to 50; P = 0.005) were independently associated with better outcomes. Open debridement without removal of the implant had a success rate of 74.5%, and the factors associated with good prognosis were a CRP concentration at the time of diagnosis ≤15 mg/dl and treatment with a fluoroquinolone. PMID:19687237
Learning curves in health professions education.
Pusic, Martin V; Boutis, Kathy; Hatala, Rose; Cook, David A
2015-08-01
Learning curves, which graphically show the relationship between learning effort and achievement, are common in published education research but are not often used in day-to-day educational activities. The purpose of this article is to describe the generation and analysis of learning curves and their applicability to health professions education. The authors argue that the time is right for a closer look at using learning curves-given their desirable properties-to inform both self-directed instruction by individuals and education management by instructors.A typical learning curve is made up of a measure of learning (y-axis), a measure of effort (x-axis), and a mathematical linking function. At the individual level, learning curves make manifest a single person's progress towards competence including his/her rate of learning, the inflection point where learning becomes more effortful, and the remaining distance to mastery attainment. At the group level, overlaid learning curves show the full variation of a group of learners' paths through a given learning domain. Specifically, they make overt the difference between time-based and competency-based approaches to instruction. Additionally, instructors can use learning curve information to more accurately target educational resources to those who most require them.The learning curve approach requires a fine-grained collection of data that will not be possible in all educational settings; however, the increased use of an assessment paradigm that explicitly includes effort and its link to individual achievement could result in increased learner engagement and more effective instructional design.
Mannheim Partner D-Curves in the Euclidean 3-space
Directory of Open Access Journals (Sweden)
Mustafa Kazaz
2015-02-01
Full Text Available In this paper, we consider the idea of Mannheim partner curves for curves lying on surfaces. By considering the Darboux frames of surface curves, we define Mannheim partner D-curves and give the characterizations for these curves. We also find the relations between geodesic curvatures, normal curvatures and geodesic torsions of these associated curves. Furthermore, we show that definition and characterizations of Mannheim partner D-curves include those of Mannheim partner curves in some special cases.
Statistics from dynamics in curved spacetime
International Nuclear Information System (INIS)
Parker, L.; Wang, Y.
1989-01-01
We consider quantum fields of spin 0, 1/2, 1, 3/2, and 2 with a nonzero mass in curved spacetime. We show that the dynamical Bogolubov transformations associated with gravitationally induced particle creation imply the connection between spin and statistics: By embedding two flat regions in a curved spacetime, we find that only when one imposes Bose-Einstein statistics for an integer-spin field and Fermi-Dirac statistics for a half-integer-spin field in the first flat region is the same type of statistics propagated from the first to the second flat region. This derivation of the flat-spacetime spin-statistics theorem makes use of curved-spacetime dynamics and does not reduce to any proof given in flat spacetime. We also show in the same manner that parastatistics, up to the fourth order, are consistent with the dynamical evolution of curved spacetime
The use of coronary stent in hepatic artery stenosis after orthotopic liver transplantation
International Nuclear Information System (INIS)
Huang Mingsheng; Shan Hong; Jiang Zaibo; Li Zhengran; Zhu Kangshun; Guan Shouhai; Qian Jiesheng; Chen Guihua; Lu Minqiang; Yang Yang
2006-01-01
Purpose: This retrospective study was undertaken to evaluate the effectiveness of coronary stent placement in hepatic artery stenosis after orthotopic liver transplantation (OLT). Materials and methods: Of 430 consecutive adult orthotopic liver transplant recipients between November 2003 and September 2005, 17 had hepatic artery stenosis (HAS). Fourteen of them underwent coronary stent placement in the HAS. The technical results, complications, hepatic artery patency and clinical outcome were reviewed. Results: Technical and immediate success was 100%. After a mean follow-up of 159.4 days (range, 9-375 days), all patients obtained patent hepatic arteries except 2 patients occurred hepatic artery restenoses at 26 and 45 days after stent placement, respectively. Kaplan-Meier curve of patency showed cumulated stent patency at 3, 6, and 12 months of 78%, 58% and 45%, respectively. During the follow-up, 8 patients survived, 5 died of septic multiple-organ failure, 1 received retransplantation because of refractory biliary infection. Hepatic artery dissection induced by a guiding catheter occurred in one patient and was successfully treated with a coronary stent. Conclusion: Hepatic artery stenosis after OLT can be successfully treated with coronary stent placement with low complication rate and an acceptable 1-year hepatic artery patency rate
Energy Technology Data Exchange (ETDEWEB)
Arenja, Nisha [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Kantonsspital Olten, Department of Cardiology, Solothurner Spitaeler AG, Olten (Switzerland); Riffel, Johannes H.; Halder, Manuel; Djiokou, Charly N.; Fritz, Thomas; Andre, Florian; Siepen, Fabian aus dem; Zelniker, Thomas; Meder, Benjamin; Kayvanpour, Elham; Korosoglou, Grigorios [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Katus, Hugo A. [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); DZHK (German Centre for Cardiovascular Research), partner site Heidelberg, Heidelberg (Germany); Buss, Sebastian J. [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Das Radiologische Zentrum - Radiology Center, Sinsheim-Eberbach-Erbach-Walldorf-Heidelberg (Germany)
2017-09-15
To investigate the association of right ventricular long axis strain (RV-LAS), a parameter of longitudinal function, with outcome in patients with non-ischaemic dilated cardiomyopathy (NIDCM). In 441 patients with NIDCM, RV-LAS was analysed retrospectively by measuring the length between the epicardial border of the left ventricular apex and the middle of a line connecting the origins of the tricuspidal valve leaflets in end-diastole and end-systole on non-contrast standard cine sequences. The primary endpoint (cardiac death or heart transplantation) occurred in 41 patients, whereas 95 reached the combined endpoint (including cardiac decompensation and sustained ventricular arrhythmias) during a median follow-up of 4.2 years. Kaplan-Meier survival curves showed a poor outcome in patients with RV-LAS values below -10% (log-rank, p < 0.0001). In a risk stratification model RV-LAS improved prediction of outcome in addition to RV ejection fraction (RVEF) and presence of late gadolinium enhancement. Assessment of RV-LAS offered incremental information compared to clinical symptoms, biomarkers and RVEF. Even in the subgroup with normal RVEF (>45%, n = 213) reduced RV-LAS was still associated with poor outcome. Assessment of RV-LAS is an independent indicator of outcome in patients with NIDCM and offers incremental information beyond clinical and cardiac MR parameters. (orig.)
Longevity of anterior resin-bonded bridges: survival rates of two tooth preparation designs.
Abuzar, M; Locke, J; Burt, G; Clausen, G; Escobar, K
2018-04-16
Significant developments have occurred in the design of resin-bonded bridges (RBB) over the past two decades. They are commonly used as an alternative treatment option for a single missing tooth. The longevity of these bridges needs to be further investigated to evaluate long-term outcomes for this option to remain relevant. A cohort of patients who received anterior resin-bonded bridges (ARBB) over two decades was studied retrospectively. Longevity of 206 ARBB was assessed using Kaplan-Meier probability estimates. The two modified tooth preparation designs investigated were: (A) mesial and distal vertical grooves only; and (B) one proximal groove adjacent to the pontic and two palatal grooves. Age and gender of the patient cohort were also recorded. Overall survival rate of ARBB was 98% at 5 years, 97.2% at 10 years, and 95.1% from 12 years till 21 years. Survival curves showed minor differences when compared for the two designs, age groups and gender of ARBB recipients. Differences in the proportion of surviving bridges for design A (95.96%) and design B (98.13%) were not statistically significant (Fisher's exact test). Anterior RBB with described tooth preparation designs demonstrate a high survival rate. © 2018 Australian Dental Association.
Min, Yang Won; Jang, Eun Young; Jung, Ji Hey; Lee, Hyuk; Min, Byung-Hoon; Lee, Jun Haeng; Rhee, Poong-Lyul; Kim, Jae J
2017-01-01
Self-expandable metal stent (SEMS) insertion and percutaneous gastrostomy (PG) feeding are commonly used for patients with esophageal cancer and dysphagia. This study aimed to compare outcomes between SEMS insertion and PG feeding for them. We retrospectively analyzed 308 patients with esophageal cancer who underwent fully covered SEMS insertion (stent group) or PG (gastrostomy group) for dysphagia due to tumor. Patients with other causes of dysphagia, such as radiation-induced or postoperative stricture, were excluded from the study. Clinical outcomes were compared between the two groups, including overall survival and need for additional intervention and postprocedural nutritional status. At baseline, the stent group (n = 169) had more stage IV patients, less cervical cancers, and received radiotherapy and esophagectomy less often than the gastrostomy group (n = 64). The Kaplan-Meier curves showed higher overall survival in the gastrostomy group than in the stent group. Multivariate analysis revealed that PG was associated with better survival compared with SEMS insertion (hazard ratio 0.541, 95% confidence interval 0.346-0.848, p = 0.007). In addition, the gastrostomy group needed additional intervention less often (3.1% vs. 21.9%, p esophageal cancer and dysphagia. Stabilized nutritional status by PG may play a role in improving patient survival.
Directory of Open Access Journals (Sweden)
Silvana de Araújo SILVA
2015-04-01
Full Text Available The identification of predictors for the progression of chronic Chagas cardiomyopathy (CCC is essential to ensure adequate patient management. This study looked into a non-concurrent cohort of 165 CCC patients between 1985 and 2010 for independent predictors for CCC progression. The outcomes were worsening of the CCC scores and the onset of left ventricular dysfunction assessed by means of echo-Doppler cardiography. Patients were analyzed for social, demographic, epidemiologic, clinical and workup-related variables. A descriptive analysis was conducted, followed by survival curves based on univariate (Kaplan-Meier and Cox’s univariate model and multivariate (Cox regression model analysis. Patients were followed from two to 20 years (mean: 8.2. Their mean age was 44.8 years (20-77. Comparing both iterations of the study, in the second there was a statistically significant increase in the PR interval and in the QRS duration, despite a reduction in heart rates (Wilcoxon < 0.01. The predictors for CCC progression in the final regression model were male gender (HR = 2.81, Holter monitoring showing pauses equal to or greater than two seconds (HR = 3.02 increased cardiothoracic ratio (HR = 7.87 and time of use of digitalis (HR = 1.41. Patients with multiple predictive factors require stricter follow-up and treatment.
Pendidikan Kesehatan Reproduksi Formal dan Hubungan Seksual Pranikah Remaja Indonesia
Directory of Open Access Journals (Sweden)
Anggriyani Wahyu Pinandari
2015-08-01
by sexual and reproductive revolution. Potential problems in this era are the increase of premarital sexual behavior, unwanted pregnancy, sexual transmitted infection and drug abuse. This study aimed to examine the influence of formal reproductive health education to delay premarital sexual intercourse among Indonesian teenagers and young adults. Cross sectional study analyzed as retrospective cohort used data of Indonesian Teenage Reproductive Health Survey in 2012 (10,980 men and 8,902 women. Effects of formal reproductive health education to delay sexual intercourse behavior was analyzed using kaplan meier curve, log-rank test, and chi square test, meanwhile multivariat analysis used logistic regression. All tests used confidence interval 95% and p value = 0.05. Results of survival analysis of abstinence committing sexual intercourse showed that teenagers who didn’t receive or only receive one of reproductive health education materials had bigger hazard ratio (respectively 1.55 (CI=1.32 – 1.82; 0.99 (CI=0.86 – 1.15 and 2.26 (CI=1.43 – 3.56. Receiving complete information gave longer abstinence time. Drug abuse, smoking, alcohol, men, aged between 20 – 24 years old and poor were more likely to commit premarital sexual intercourse. Receipt of reproductive health information at formal education level may delay the occurrence of premarital sexual intercourse.
Comparison of minocycline and azithromycin for the treatment of mild scrub typhus in northern China.
Zhao, Minxing; Wang, Ting; Yuan, Xiaoyu; Du, Weiming; Lin, Miaoxin; Shen, Yanbo
2016-09-01
Scrub typhus, caused by Orientia tsutsugamushi, has recently emerged in northern China where the disease had not been known to exist. Although doxycycline and azithromycin are the recommended agents for the treatment of scrub typhus, clinical responses depend both on the susceptibilities of various O. tsutsugamushi strains and the severity of the disease. A retrospective analysis was conducted on patients diagnosed with mild scrub typhus from August 2013 to January 2016 in the Affiliated Hospital of Nantong University, northern China. A total of 40 patients who received minocycline treatment and 34 patients who received azithromycin treatment were included in the analysis. All patients except one defervesced within 120 h after initiating antimicrobial therapy. Kaplan-Meier curves in association with log-rank test showed that the median time to defervescence was significantly shorter for the minocycline-treated group than the azithromycin-treated group (P = 0.003). There were no serious adverse events during treatment. No relapse occurred in either group during the 1-month follow-up period. In conclusion, both minocycline and azithromycin are effective and safe for the treatment of mild scrub typhus, but minocycline is more active than azithromycin against O. tsutsugamushi infection acquired in northern China. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Ficheur, Grégoire; Ferreira Careira, Lionel; Beuscart, Régis; Chazard, Emmanuel
2015-01-01
Administrative data can be used for the surveillance of the outcomes of implantable medical devices (IMDs). The objective of this work is to build a web-based tool allowing for an exploratory analysis of time-dependent events that may occur after the implementation of an IMD. This tool should enable a pharmacoepidemiologist to explore on the fly the relationship between a given IMD and a potential outcome. This tool mine the French nationwide database of inpatient stays from 2008 to 2013. The data are preprocessed in order to optimize the queries. A web tool is developed in PHP, MySQL and Javascript. The user selects one or a group of IMD from a tree, and can filter the results using years and hospital names. Four result pages describe the selected inpatient stays: (1) temporal and demographic description, (2) a description of the geographical location of the hospital, (3) a description of the geographical place of residence of the patient and (4) a table showing the rehospitalization reasons by decreasing order of frequency. Then, the user can select one readmission reason and display dynamically the probability of readmission by mean of a Kaplan-Meier curve with confidence intervals. This tool enables to dynamically monitor the occurrence of time-dependent complications of IMD.
Seisen, Thomas; Jindal, Tarun; Karabon, Patrick; Sood, Akshay; Bellmunt, Joaquim; Rouprêt, Morgan; Leow, Jeffrey J; Vetterlein, Malte W; Sun, Maxine; Alanee, Shaheen; Choueiri, Toni K; Trinh, Quoc-Dien; Menon, Mani; Abdollah, Firas
2017-05-01
Given the growing body of evidence supporting the benefit of primary tumor control for a wide range of metastatic malignancies, we hypothesized that chemotherapy plus radical nephroureterectomy (RNU) is associated with an overall survival (OS) benefit compared to chemotherapy alone for metastatic upper tract urothelial carcinoma (mUTUC). Within the National Cancer Data Base (2004-2012), we identified 398 (38.4%) and 637 (61.6%) patients who received chemotherapy plus RNU and chemotherapy alone, respectively. Inverse probability of treatment weighting (IPTW)-adjusted Kaplan-Meier curves showed that 3-yr OS was 16.2% (95% confidence interval [CI] 12.1-20.3) for chemotherapy plus RNU and 6.4% (95%CI 4.1-8.7) for chemotherapy alone (pchemotherapy plus RNU was associated with a significant OS benefit (hazard ratio 0.70, 95% CI 0.61-0.80; pbenefit for fit patients who received chemotherapy plus RNU for mUTUC relative to their counterparts treated with chemotherapy alone. We examined the role of radical nephroureterectomy in addition to systemic chemotherapy for metastatic upper tract urothelial carcinoma. We found that such treatment may be associated with an overall survival benefit compared to chemotherapy alone in fit patients. Copyright © 2016 European Association of Urology. Published by Elsevier B.V. All rights reserved.
Long-Term Outcome of Amyotrophic Lateral Sclerosis in Korean Subjects.
Suh, Mi Ri; Choi, Won Ah; Choi, Young-Chul; Lee, Jang Woo; Hong, Jung Hwa; Park, Jihyun; Kang, Seong-Woong
2017-12-01
To report the latest long-term outcome of amyotrophic lateral sclerosis (ALS) and to analyze the predictors of prognosis. Subjects who were diagnosed with ALS between January 2005 and December 2009 at a single institute were followed up until death or up to December 2014. Data regarding age, sex, date of onset, date of diagnosis, presence of bulbar symptoms on onset, date of initiation of non-invasive ventilation (NIV), and the date of tracheostomy were collected. Survival was assessed using Kaplan-Meier curves and multivariate analyses of the risk of death were performed using the Cox proportional hazards model. Among 212 suspicious subjects, definite ALS was diagnosed in 182 subjects. The survival rate at 3 and 5 years from onset was 61.5% and 40.1%, respectively, and the survival rate at 3 and 5 years post-diagnosis was 49.5% and 24.2%, respectively. Further, 134 patients (134/182, 73.6%) were initiated on NIV, and among them, 90 patients (90/182, 49.5%) underwent tracheostomy. Male gender and onset age of ≥65 years were independent predictors of adverse survival. The analysis of long term survival in ALS showed excellent outcomes considering the overall poor prognosis of this disease.
Lim, Sher-Wei; Eric Nyam, Tee-Tau; Ho, Chung-Han; Shiue, Yow-Ling; Wang, Jhi-Joung; Chio, Chung-Ching; Kuo, Jinn-Rung
2017-10-01
Anxiety or depression (AD) is a common complication after traumatic spinal cord injury (tSCI). This study sought to investigate the role of preexisting hyperlipidemia in new-onset AD after tSCI using a longitudinal population database. This retrospective cohort study used Longitudinal Health Insurance Database data from January 1997 to December 2011. The case and comparison groups were individuals who experienced tSCI and who did and did not have preexisting hyperlipidemia, respectively. Kaplan-Meier curves were plotted, and log-rank test was used to compare the differences between these 2 groups. A Cox regression model was used to estimate the relative risk of AD. A total of 26,892 adult patients were enrolled in this study. After 1:3 matching with age and gender, it showed 1) tSCI patients with preexisting hyperlipidemia have a 1.32-fold adjusted hazard ratio (HR) compared with those without hyperlipidemia (P 2; HR, 1.9; 95% CI 1.2-2.9), and those with a history of stroke (HR, 1.7; 95% CI 1.0-2.7). Preexisting hyperlipidemia is an independent predictor of new-onset AD in patients with tSCI, especially in those who are younger, male, have a higher CCI score, and have stroke. Copyright © 2017 Elsevier Inc. All rights reserved.
Yang, D H; Su, Z Q; Chen, Y; Chen, Z B; Ding, Z N; Weng, Y Y; Li, J; Li, X; Tong, Q L; Han, Y X; Zhang, X
2016-03-08
To assess the predictive value of the albumin to globulin ratio (AGR) in evaluation of disease severity and prognosis in myasthenia gravis patients. A total of 135 myasthenia gravis (MG) patients were enrolled between February 2009 and March 2015. The AGR was detected on the first day of hospitalization and ranked from lowest to highest, and the patients were divided into three equal tertiles according to the AGR values, which were T1 (AGR 1.53). The Kaplan-Meier curve was used to evaluate the prognostic value of AGR. Cox model analysis was used to evaluate the relevant factors. Multivariate Logistic regression analysis was used to find the predictors of myasthenia crisis during hospitalization. The median length of hospital stay for each tertile was: for the T1 21 days (15-35.5), T2 18 days (14-27.5), and T3 16 days (12-22.5) (Pmyasthenia gravis. At the multivariate Cox regression analysis, the AGR (Pmyasthenia gravis patients. Respectively, the hazard ratio (HR) were 4.655 (95% CI: 2.355-9.202) and 0.596 (95% CI: 0.492-0.723). Multivariate Logistic regression analysis showed the AGR (Pmyasthenia crisis. The AGR may represent a simple, potentially useful predictive biomarker for evaluating the disease severity and prognosis of patients with myasthenia gravis.
da Silva Fernandes, Natália Maria; Bastos, Marcus Gomes; Franco, Márcia Regina Gianotti; Chaoubah, Alfredo; da Glória Lima, Maria; Divino-Filho, José Carolino; Qureshi, Abdul Rashid
2013-01-01
OBJECTIVES: To determine the roles of body size and longitudinal body weight changes in the survival of incident peritoneal dialysis patients. PATIENTS AND METHODS: Patients (n = 1911) older than 18 years of age recruited from 114 dialysis centers (Dec/2004-Oct/2007) and participating in the Brazilian Peritoneal Dialysis Multicenter Cohort Study were included. Clinical and laboratory data were collected monthly (except if the patient received a transplant, recovered renal function, was transferred to hemodialysis, or died). RESULTS: Survival analyses were performed using Kaplan-Meier survival curves and Cox proportional hazards. Total follow-up was 34 months. The mean age was 59 years (54% female). The weight category percentages were as follows: underweight: 8%; normal: 51%; overweight: 29%; and obese 12%. The multivariate model showed a higher risk of death for a body mass index 30 kg/m2. Patients were divided into five categories according to quintiles of body weight changes during the first year of dialysis: +7.1%. Patients in the lowest quintile had significantly higher mortality, whereas no negative impact was observed in the other quintiles. CONCLUSION: These findings suggest that overweight/obesity and a positive body weight variation during the first year of peritoneal dialysis therapy do not increase mortality in incident dialysis patients in Brazil. PMID:23420157
Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping
2017-10-01
Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.
Vogl, Vanessa; Hiller, Karl-Anton; Buchalla, Wolfgang; Federlin, Marianne; Schmalz, Gottfried
2016-12-01
A new universal adhesive with corresponding luting composite was recently marketed which can be used both, in a self-etch or in an etch-and-rinse mode. In this study, the clinical performance of partial ceramic crowns (PCCs) inserted with this adhesive and the corresponding luting material used in a self-etch or selective etch approach was compared with a self-adhesive universal luting material. Three PCCs were placed in a split-mouth design in 50 patients. Two PCCs were luted with a combination of a universal adhesive/resin cement (Scotchbond Universal/RelyX Ultimate, 3M ESPE) with (SB+E)/without (SB-E) selective enamel etching. Another PCC was luted with a self-adhesive resin cement (RelyX Unicem 2, 3M ESPE). Forty-eight patients were evaluated clinically according to FDI criteria at baseline and 6, 12 and 18 months. For statistical analyses, the chi-square test (α = 0.05) and Kaplan-Meier analysis were applied. Clinically, no statistically significant differences between groups were detected over time. Within groups, clinically significant increase for criterion "marginal staining" was detected for SB-E over 18 months. Kaplan-Meier analysis revealed significantly higher retention rates for SB+E (97.8 %) and SB-E (95.6 %) in comparison to RXU2 (75.6 %). The 18-month clinical performance of a new universal adhesive/composite combination showed no differences with respect to bonding strategy and may be recommended for luting PCCs. Longer-term evaluation is needed to confirm superiority of SB+E over SB-E. At 18 months, the new multi-mode adhesive, Scotchbond Universal, showed clinically reliable results when used for luting PCCs.
Adjuvant Ab Interno Tumor Treatment After Proton Beam Irradiation.
Seibel, Ira; Riechardt, Aline I; Heufelder, Jens; Cordini, Dino; Joussen, Antonia M
2017-06-01
This study was performed to show long-term outcomes concerning globe preservation in uveal melanoma patients after proton beam therapy with the main focus on outcomes according to different adjuvant ab interno surgical procedures. Retrospective cohort study. All patients treated with primary proton beam therapy for choroidal or ciliary body melanoma between June 1998 and June 2015 were included. A total of 2499 patients underwent primary proton beam therapy, with local tumor control and globe preservation rates of 95.9% and 94.8% after 5 years, respectively. A total of 110 (4.4%) patients required secondary enucleation. Unresponsive neovascular glaucoma was the leading cause of secondary enucleation in 78 of the 2499 patients (3.1%). The 5-year enucleation-free survival rate was 94.8% in the endoresection group, 94.3% in the endodrainage group, and 93.5% in the comparator group. The log-rank test showed P = .014 (comparator group vs endoresection group) and P = .06 (comparator group vs endodrainage-vitrectomy group). Patients treated with endoresection or endodrainage-vitrectomy developed less radiation retinopathy (30.5% and 37.4% after 5 years, P = .001 and P = .048 [Kaplan-Meier], respectively) and less neovascular glaucoma (11.6% and 21.3% after 5 years, P = .001 and P = .01 [Kaplan-Meier], respectively) compared with the comparator group (52.3% radiation retinopathy and 57.8% neovascular glaucoma after 5 years). This study suggests that in larger tumors the enucleation and neovascular glaucoma rates might be reduced by adjuvant surgical procedures. Although endoresection is the most promising adjuvant treatment option, the endodrainage-vitrectomy is recommended in patients who are ineligible for endoresection. Copyright © 2017 Elsevier Inc. All rights reserved.
A note on families of fragility curves
International Nuclear Information System (INIS)
Kaplan, S.; Bier, V.M.; Bley, D.C.
1989-01-01
In the quantitative assessment of seismic risk, uncertainty in the fragility of a structural component is usually expressed by putting forth a family of fragility curves, with probability serving as the parameter of the family. Commonly, a lognormal shape is used both for the individual curves and for the expression of uncertainty over the family. A so-called composite single curve can also be drawn and used for purposes of approximation. This composite curve is often regarded as equivalent to the mean curve of the family. The equality seems intuitively reasonable, but according to the authors has never been proven. The paper presented proves this equivalence hypothesis mathematically. Moreover, the authors show that this equivalence hypothesis between fragility curves is itself equivalent to an identity property of the standard normal probability curve. Thus, in the course of proving the fragility curve hypothesis, the authors have also proved a rather obscure, but interesting and perhaps previously unrecognized, property of the standard normal curve
Burruel, Victoria; Klooster, Katie; Barker, Christopher M; Pera, Renee Reijo; Meyers, Stuart
2014-10-13
Human embryos resulting from abnormal early cleavage can result in aneuploidy and failure to develop normally to the blastocyst stage. The nature of paternal influence on early embryo development has not been directly demonstrated although many studies have suggested effects from spermatozoal chromatin packaging, DNA damage, centriolar and mitotic spindle integrity, and plasma membrane integrity. The goal of this study was to determine whether early developmental events were affected by oxidative damage to the fertilizing sperm. Survival analysis was used to compare patterns of blastocyst formation based on P2 duration. Kaplan-Meier survival curves demonstrate that relatively few embryos with short (P2 times reached blastocysts, and the two curves diverged beginning on day 4, with nearly all of the embryos with longer P2 times reaching blastocysts by day 6 (p < .01). We determined that duration of the 2nd to 3rd mitoses were sensitive periods in the presence of spermatozoal oxidative stress. Embryos that displayed either too long or too short cytokineses demonstrated an increased failure to reach blastocyst stage and therefore survive for further development. Although paternal-derived gene expression occurs later in development, this study suggests a specific role in early mitosis that is highly influenced by paternal factors.
Elevated levels of serum nidogen-2 in esophageal squamous cell carcinoma.
Chai, Annie Wai Yeeng; Cheung, Arthur Kwok Leung; Dai, Wei; Ko, Josephine Mun Yee; Lee, Nikki Pui Yue; Chan, Kin Tak; Law, Simon Ying-Kit; Lung, Maria Li
2018-02-14
Nidogen-2 (NID2), a secretory basement membrane protein, has been implicated as a potential biomarker in ovarian cancer and hepatocellular carcinoma. In this study, we aimed to investigate the utility of detecting serum NID2 levels for identification of esophageal squamous cell carcinoma (ESCC) patients and prediction of poor survival outcome. Using an in-house NID2 enzyme-linked immunosorbent assay (ELISA), serum samples from 101 ESCC patients and 50 healthy controls were screened for their NID2 levels. The serum NID2 levels in ESCC patients (median 24.4 μg/L) are significantly higher (p= 4.3e-09) than that of the healthy controls (median 15.85 μg/L). The receiver operating characteristic (ROC) curve demonstrated an area under the curve of 0.756. At the threshold of 17.95 μg/L, the sensitivity and specificity achieved are 0.76 and 0.63, respectively. Kaplan-Meier survival analysis revealed that patients with high serum NID2 levels (⩾ 32.6 μg/L) have significantly higher risk of death (HR = 1.984, 95% CI: 1.175-3.349; log-rank p-value = 0.012) compared to those with low serum NID2 levels (levels has potential diagnostic and prognostic value for ESCC patients.
Li, Jiatong; Dou, Dongwei; Li, Ping; Luo, Wenqi; Lv, Wenxin; Zhang, Chengdong; Song, Xiaowei; Yang, Yuan; Zhang, Yuening; Xu, Yanzhen; Xiao, Feifan; Wei, Yan; Qin, Jian; Li, Hongtao; Yang, Xiaoli
2017-07-01
PARP-1 (poly(ADP-ribose) polymerase-1) plays an important role in tumorigenesis. Since its effects on different populations are varied, this study investigated the impact of PARP-1 on primary hepatocellular carcinoma in a Southern Chinese Zhuang population. We assessed the global PARP-1 messenger RNA expression in patients with hepatocellular carcinoma using The Cancer Genome Atlas dataset. Increased PARP-1 expression, related to alpha-fetoprotein level, was observed. The area under the receiver operating characteristic curve value was 0.833. Kaplan-Meier survival curves indicated that higher PARP-1 expression was not correlated with poorer overall survival and recurrence-free survival. In a Zhuang population, PARP-1 messenger RNA and protein levels were increased in the hepatocellular carcinoma tissue and its adjacent liver tissues as assessed by quantitative polymerase chain reaction, immunohistochemistry, and western blotting. Higher PARP-1 level was associated with a higher tumor stage (p 0.05). Further analysis suggested that H2AX, a PARP-1 protein interaction partner, was coordinated with PARP-1 in hepatocellular carcinoma tumorigenesis. Overall, some new characteristics of PARP-1 expression were noted in the Zhuang population. PARP-1 is a novel promising diagnostic marker for hepatocellular carcinoma in the Southern Chinese Zhuang population.
Energy Technology Data Exchange (ETDEWEB)
Gkretsi, Vasiliki; Stylianou, Andreas; Stylianopoulos, Triantafyllos, E-mail: tstylian@ucy.ac.cy
2017-03-15
A hallmark of cancer cells is their ability to invade surrounding tissues and form metastases. Cell-extracellular matrix (ECM)-adhesion proteins are crucial in metastasis, connecting tumor ECM with actin cytoskeleton thus enabling cells to respond to mechanical cues. Vasodilator-stimulated phosphoprotein (VASP) is an actin-polymerization regulator which interacts with cell-ECM adhesion protein Migfilin, and regulates cell migration. We compared VASP expression in MCF-7 and MDA-MB-231 breast cancer (BC) cells and found that more invasive MDA-MB-231 cells overexpress VASP. We then utilized a 3-dimensional (3D) approach to study metastasis in MDA-MB-231 cells using a system that considers mechanical forces exerted by the ECM. We prepared 3D collagen I gels of increasing concentration, imaged them by atomic force microscopy, and used them to either embed cells or tumor spheroids, in the presence or absence of VASP. We show, for the first time, that VASP silencing downregulated Migfilin, β-catenin and urokinase plasminogen activator both in 2D and 3D, suggesting a matrix-independent mechanism. Tumor spheroids lacking VASP demonstrated impaired invasion, indicating VASP’s involvement in metastasis, which was corroborated by Kaplan-Meier plotter showing high VASP expression to be associated with poor remission-free survival in lymph node-positive BC patients. Hence, VASP may be a novel BC metastasis biomarker. - Highlights: • More invasive MDA-MB-231 overexpress VASP compared to MCF-7 breast cancer cells. • We prepared 3D collagen I gels of increasing concentration and characterized them. • VASP silencing downregulated Migfilin, β-catenin and uPA both in 2D and 3D culture. • Tumor spheroids lacking VASP demonstrated impaired invasion. • Kaplan-Meier plotter shows association of high VASP expression with poor survival.
Compact Hilbert Curve Index Algorithm Based on Gray Code
Directory of Open Access Journals (Sweden)
CAO Xuefeng
2016-12-01
Full Text Available Hilbert curve has best clustering in various kinds of space filling curves, and has been used as an important tools in discrete global grid spatial index design field. But there are lots of redundancies in the standard Hilbert curve index when the data set has large differences between dimensions. In this paper, the construction features of Hilbert curve is analyzed based on Gray code, and then the compact Hilbert curve index algorithm is put forward, in which the redundancy problem has been avoided while Hilbert curve clustering preserved. Finally, experiment results shows that the compact Hilbert curve index outperforms the standard Hilbert index, their 1 computational complexity is nearly equivalent, but the real data set test shows the coding time and storage space decrease 40%, the speedup ratio of sorting speed is nearly 4.3.
Sun, Ming-Hui; Liao, Yaping Joyce
2017-09-01
The optic nerve head is vulnerable to ischemia leading to anterior ischemic optic neuropathy (AION), the most common acute optic neuropathy in those older than 50 years of age. We performed a cross-sectional study of 55 nonarteritic anterior ischemic optic neuropathy (NAION) eyes in 34 patients to assess clinical outcome and perform structure-function correlations. The peak age of NAION onset was between 50 and 55 years. Sixty-seven percent of patients presented with their first event between the ages of 40 and 60 years, and 32% presented at ≤50 years. Those with NAION onset at age ≤50 years did not have significantly better visual outcome per logMAR visual acuity, automated perimetric mean deviation (PMD) or optical coherence tomography (OCT) measurements. Kaplan-Meier survival curve and multivariate Cox proportional regression analysis showed that age >50 years at NAION onset was associated with greater risk of second eye involvement, with hazard ratio of 20. Older age at onset was significantly correlated with greater thinning of the ganglion cell complex (GCC) (P = 0.022) but not with logMAR visual acuity, PMD, or thinning of retinal nerve fiber layer (RNFL). Using area under receiver operating characteristic curve analyses, we found that thinning of RNFL and GCC was best able to predict visual outcome, and that mean RNFL thickness >65 μm or macular GCC thickness >55 μm significantly correlated with good visual field outcome. We showed that NAION onset at age >50 years had a greater risk of second eye involvement. Patients with OCT mean RNFL thickness >65 μm and mean macular ganglion cell complex thickness >55 μm had better visual outcomes.
Fibulin-3 as a diagnostic biomarker in patients with malignant mesothelioma.
Kaya, Halide; Demir, Melike; Taylan, Mahsuk; Sezgi, Cengizhan; Tanrikulu, Abdullah Cetin; Yilmaz, Sureyya; Bayram, Mehmet; Kaplan, Ibrahim; Senyigit, Abdurrahman
2015-01-01
New tumour biomarkers are being intensely investigated for malignant mesothelioma (MM). Fibulin-3 is produced in MM but its role remains uncertain. The aim of this study was to evaluate the validity of measuring serum fibulin-3 in the diagnosis and prognosis of MM. This prospective study was performed on 43 patients and 40 healthy controls who were admitted to our hospital between January 2012 and January 2014. Data from MM patients, including demographic and clinical features, routine laboratory data, levels of serum fibulin-3, and treatment outcomes were defined as potential prognostic factors. The receiver operating characteristic (ROC) curve for fibulin-3 was used to detect the cut-off value with highest sensitivity and specificity. Univariate survival analysis was performed using the Kaplan-Meier method in patients with MM. Afterwards, the possible factors identified with univariate analyses were entered into the cox regression analysis. Our results revealed that patients with MM had significantly higher serum levels of fibulin-3 than controls. The results showed that the best cut-off point was 36.6 ng/ml with an AUC (area under the curve)=0.976, sensitivity=93.0% and specificity=90.0. In our study, the initial significant poor prognostic factors were advanced stage, high white blood cell count, high platelet count, high C-reactive protein (p<0.05 for each variable). Later, according to multivariate analysis the results showed only advanced stage as significant parameter (p=0.040). We determined that real use for serum fibulin-3 was not for prognosis but for diagnosis in MM. Also advanced stage was associated with poor MM prognosis.
Impact of Different Surgeons on Dental Implant Failure.
Chrcanovic, Bruno Ramos; Kisch, Jenö; Albrektsson, Tomas; Wennerberg, Ann
To assess the influence of several factors on the prevalence of dental implant failure, with special consideration of the placement of implants by different dental surgeons. This retrospective study is based on 2,670 patients who received 10,096 implants at one specialist clinic. Only the data of patients and implants treated by surgeons who had inserted a minimum of 200 implants at the clinic were included. Kaplan-Meier curves were stratified with respect to the individual surgeon. A generalized estimating equation (GEE) method was used to account for the fact that repeated observations (several implants) were placed in a single patient. The factors bone quantity, bone quality, implant location, implant surface, and implant system were analyzed with descriptive statistics separately for each individual surgeon. A total of 10 surgeons were eligible. The differences between the survival curves of each individual were statistically significant. The multivariate GEE model showed the following variables to be statistically significant: surgeon, bruxism, intake of antidepressants, location, implant length, and implant system. The surgeon with the highest absolute number of failures was also the one who inserted the most implants in sites of poor bone and used turned implants in most cases, whereas the surgeon with the lowest absolute number of failures used mainly modern implants. Separate survival analyses of turned and modern implants stratified for the individual surgeon showed statistically significant differences in cumulative survival. Different levels of failure incidence could be observed between the surgeons, occasionally reaching significant levels. Although a direct causal relationship could not be ascertained, the results of the present study suggest that the surgeons' technique, skills, and/or judgment may negatively influence implant survival rates.
MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer
2012-12-01
hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA
Application of Enlisted Force Retention Levels and Career Field Stability
2017-03-23
APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial
Directory of Open Access Journals (Sweden)
Marisa Aparecida Amaro Malvestio
2008-08-01
Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized
Resultado do tratamento cirúrgico das neoplasias do seio piriforme
Directory of Open Access Journals (Sweden)
Costa Claudiney C.
2003-01-01
Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.
Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas
2017-11-15
This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still
Directory of Open Access Journals (Sweden)
Giuseppe Bonaccorso
2014-06-01
Full Text Available Il contributo proposto ha l’obiettivo di analizzare alcuni significativi brani del tessuto urbano della periferia est di Roma, adottando metodi interpretativi legati alla storia, alla società, alla programmazione urbanistica e alla costruzione. Gli aspetti salienti del quadrante orientale della periferia romana verranno così delineati partendo “dal di dentro”, sottolineandone i percorsi, gli spazi e i nuclei compositivi che sono all’origine della struttura e della forma stessa dei quartieri disposti a cavallo del Grande Raccordo Anulare. In questo ambito, si pone l’attenzione su alcuni episodi chiave che vedono protagoniste le nuove chiese che riescono a creare una centralità all’interno dei quartieri periferici sostituendo le biblioteche, le piazze e i centri commerciali. Analizzando da vicino questi esempi, si scopre come di recente sono state realizzate chiese firmate da architetti di fama internazionale proprio allo scopo di rafforzare, o meglio di costruire, un fattore identitario per ciascun quartiere ubicato nel settore orientale della città. Partendo quindi dal generale si arriva a indagare una chiesa e un quartiere che possono essere considerati un modello da seguire per tutta la periferia a ridosso del GRA: la chiesa giubilare di Dio Padre Misericordioso progettata da Richard Meier nel quartiere di Tor Tre Teste. La sequenzialità degli eventi che hanno contraddistinto il concorso per la progettazione della chiesa, la scelta della proposta di Richard Meier, la complessità del cantiere, l’analisi tecnica, stilistica e simbolica della realizzazione finale sono quindi analizzate nell’ambito del rapporto con il quartiere e del tentativo di realizzare (attraverso di essa un centro di attrazione per tutta la periferia. The article analyses some significant parts of the urban tissue at the eastern periphery of Rome, using the interpretative methods inherent to history, society, urban programming and construction
Kawabe, Masayuki; Sato, Akira; Hoshi, Tomoya; Endo, Masae; Yoshida, Ikuo; Aonuma, Kazutaka
2017-04-01
B-type natriuretic peptide (BNP) is well known to increase as a result of left ventricular systolic dysfunction and is a useful diagnostic marker for heart failure. The purpose of this study was to assess the incremental value of BNP for predicting obstructive coronary artery disease (CAD) on computed tomography angiography (CTA) in patients with suspected CAD. This was an observational analysis of patients with stable CAD undergoing CTA in our institution between April 2008 and June 2014. Consecutive 947 patients with suspected CAD who underwent 64-slice CTA were enrolled. Obstructive CAD was defined as more than 50% luminal narrowing. We divided the patients into 2 groups according to median BNP value (20.3pg/ml). Duke clinical score for obstructive CAD was calculated for each patient. Obstructive CAD was found in 273 (28.0%) patients. Median follow-up period was 37 months (interquartile range 21-55 months). Kaplan-Meier curves showed that BNP above median was significantly associated with major adverse cardiac events (p=0.001). In multivariable logistic analysis, patients with BNP above median were associated with the presence of obstructive CAD, as compared with BNP below median [odds ratio, 2.55; 95% confidence interval (CI), 1.79-3.63; pvalue of the Duke clinical score and BNP, the predictive value of the Duke clinical score [area under the curve (AUC), 0.714] could be increased by BNP (AUC 0.745 for the combined model; prisk score. Copyright © 2016 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
International Nuclear Information System (INIS)
Amiri, K; Cervantes, M J; Mulu, B; Raisee, M
2014-01-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
Amiri, K.; Mulu, B.; Raisee, M.; Cervantes, M. J.
2014-03-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR.
Preoperative serum lipid profile and outcome in nonmetastatic colorectal cancer
Directory of Open Access Journals (Sweden)
Ting-Ting Hong
2016-12-01
Full Text Available Objective: A large portion of non-metastatic colorectal cancers (non-mCRCs recur after curative surgery. In addition to the traditional tumor-related factors, host-related factors are also required to accurately predict prognosis. A few studies have shown an association between the serum lipid profile and the survival and treatment response of patients with colorectal cancer. Methods: We retrospectively evaluated the prognostic significance of the preoperative serum lipid profile [total cholesterol (TC, triglyceride (TG, low-density lipoprotein cholesterol (LDL-C, and high-density lipoprotein cholesterol (HDL-C] in patients with non-mCRC treated with curative surgery. The Spearman rank correlation test was used to analyze associations between lipid levels and categorical variables. Lipid levels were modeled as four equal-sized quartiles based on the distribution among the whole cohort. Kaplan-Meier curves were used to estimate survival probabilities, and the log-rank test was used to detect differences between them. Multivariate fractional polynomial (MFP analysis was used to model any non-linear effects and avoid categorization. To evaluate the added prognostic value of lipids, the predictive power of two models (with and without lipids as covariates was compared by using Harrell's C-statistic and the Akaike information criterion (AIC. Results: A total of 266 patients with non-mCRC were enrolled in the present study. Spearman rank correlation test showed that TGÂ levels inversely correlated with N stage (r = â0.20, PÂ =Â 0.00 and Tumor-Node-Metastasis (TNM stage (r = â0.19, P = 0.00. HDL-C levels positively correlated with perineural invasion (PNI (r = 0.15, PÂ = 0.02, and LDL-C levels inversely correlated with lymphovascular invasion (LVI (r = â0.12, PÂ =Â 0.04. None of the four lipids predicted overall survival (OS in univariate or multivariate analyses adjusted for age, gender, T stage, N stage, TNM stage
Directory of Open Access Journals (Sweden)
João Carlos F. Leal
2005-09-01
Full Text Available OBJETIVO: Analisar evolução e a influência prognóstica dos níveis séricos da troponina I cardíaca nos pacientes com insuficiência cardíaca congestiva (ICC submetidos a ressincronização interventricular (RV, com seguimento de até 59 meses. MÉTODOS: Foram analisados 33 pacientes com miocardiopatia dilatada idiopática em classe funcional III/IV da NYHA, submetidos a RV. A qualidade de vida (QV foi analisada pré e pós-operatoriamente com o Minnesota Code e a função ventricular através da ecocardiografia. Os níveis séricos da troponina I foram dosados em 23 pacientes, utilizando o teste exato de Fischer para avaliar sua relação com o evento óbito, e a curva de Kaplan-Meier para análise da taxa de sobrevivência. RESULTADOS: A QV foi significantemente melhor após a RV, com mediana de 73 pontos, no pré e 36, no pós (pOBJECTIVE: To analyze the evolution and prognostic influence of the cardiac troponin I serum levels in patients with congestive heart failure (CHF submitted to interventricular resynchronization (VR over a 59-month follow-up period. METHOD: Thirty-three patients with idiopathic dilated myocardiopathy in NYHA functional classes III and IV were submitted to VR. The pre- and post-operative quality of life (QV was analyzed using the Minnesota Code and the left ventricle function was assessed by echocardiography. The cardiac troponin I levels were compared in 23 patients utilizing the Fisher exact test to analyze the correlation with death and the Kaplan-Meier curve was used to analyze the survival rate. RESULTS: The QV was better after VR with a median of 73 points in the pre-operative period and 36 in the postoperative period (p-value < 0.0001. The left ventricle diastolic diameter (LVDD reduced from 65 mm in the preoperative period to 60 mm in the postoperative period (p-value = 0.0014 with an increase in the ejection fraction from 37 to 47% (p-value = 0.0004. In 15 patients with normal cardiac troponin I levels
Grindedal, Eli Marie; Aarset, Harald; Bjørnevoll, Inga; Røyset, Elin; Mæhle, Lovise; Stormorken, Astrid; Heramb, Cecilie; Medvik, Heidi; Møller, Pål; Sjursen, Wenche
2014-01-01
Using immunohistochemistry (IHC) to select cases for mismatch repair (MMR) genetic testing, we failed to identify a large kindred with the deleterious PMS2 mutation c.989-1G > T. The purpose of the study was to examine the sensitivity of IHC and microsatellite instability-analysis (MSI) to identify carriers of the mutation, and to estimate its penetrance and expressions. All carriers and obligate carriers of the mutation were identified. All cancer diagnoses were confirmed. IHC and MSI-analysis were performed on available tumours. Penetrances of cancers included in the Amsterdam and the Bethesda Criteria, for MSI-high tumours and MSI-high and low tumours were calculated by the Kaplan-Meier algorithm. Probability for co-segregation of the mutation and cancers by chance was 0.000004. Fifty-six carriers or obligate carriers were identified. There was normal staining for PMS2 in 15/18 (83.3%) of tumours included in the AMS1/AMS2/Bethesda criteria. MSI-analysis showed that 15/21 (71.4%) of tumours were MSI-high and 4/21 (19.0%) were MSI-low. Penetrance at 70 years was 30.6% for AMS1 cancers (colorectal cancers), 42.8% for AMS2 cancers, 47.2% for Bethesda cancers, 55.6% for MSI-high and MSI-low cancers and 52.2% for MSI-high cancers. The mutation met class 5 criteria for pathogenicity. IHC was insensitive in detecting tumours caused by the mutation. Penetrance of cancers that displayed MSI was 56% at 70 years. Besides colorectal cancers, the most frequent expressions were carcinoma of the endometrium and breast in females and stomach and prostate in males.
2D and 3D CT Radiomics Features Prognostic Performance Comparison in Non-Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Chen Shen
2017-12-01
Full Text Available OBJECTIVE: To compare 2D and 3D radiomics features prognostic performance differences in CT images of non-small cell lung cancer (NSCLC. METHOD: We enrolled 588 NSCLC patients from three independent cohorts. Two sets of 463 patients from two different institutes were used as the training cohort. The remaining cohort with 125 patients was set as the validation cohort. A total of 1014 radiomics features (507 2D features and 507 3D features correspondingly were assessed. Based on the dichotomized survival data, 2D and 3D radiomics indicators were calculated for each patient by trained classifiers. We used the area under the receiver operating characteristic curve (AUC to assess the prediction performance of trained classifiers (the support vector machine and logistic regression. Kaplan–Meier and Cox hazard survival analyses were also employed. Harrell's concordance index (C-Index and Akaike's information criteria (AIC were applied to assess the trained models. RESULTS: Radiomics indicators were built and compared by AUCs. In the training cohort, 2D_AUC = 0.653, 3D_AUC = 0.671. In the validation cohort, 2D_AUC = 0.755, 3D_AUC = 0.663. Both 2D and 3D trained indicators achieved significant results (P < .05 in the Kaplan-Meier analysis and Cox regression. In the validation cohort, 2D Cox model had a C-Index = 0.683 and AIC = 789.047; 3D Cox model obtained a C-Index = 0.632 and AIC = 799.409. CONCLUSION: Both 2D and 3D CT radiomics features have a certain prognostic ability in NSCLC, but 2D features showed better performance in our tests. Considering the cost of the radiomics features calculation, 2D features are more recommended for use in the current study.
Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao
2017-08-01
The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.
Choi, Ji Young; Kim, Miso; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Heo, Dae Seog; Jo, Seong Jin
2018-04-05
Despite the successful use of tyrosine kinase inhibitors (TKIs) in cancer patients, their effect on herpes zoster development has not been studied. The aim of this study was to evaluate and compare the effects of epidermal growth factor receptor (EGFR) TKI and cytotoxic chemotherapy on the risk of herpes zoster development in non-small cell lung cancer (NSCLC) patients. We conducted a medical review of all eligible NSCLC patients in Seoul National University hospital between 2002 and 2015. We classified patients based on whether they previously underwent EGFR TKI therapy into either the TKI group or the cytotoxic group. We compared the incidence rates of herpes zoster during TKI therapy and cytotoxic chemotherapy. Additionally, the longitudinal risk of herpes zoster from TKIs was analyzed using the incidence rate ratio (IRR) of the TKI group to the cytotoxic group and the log-rank test of the Kaplan-Meier method. Of the 2,981 NSCLC patients, 54 patients (1.54%) developed herpes zoster. In the TKI group (2,002 patients), the IRR of herpes zoster during TKI therapy compared to that during cytotoxic chemotherapy was 1.05 (95% confidence interval [CI], 0.53 to 2.09). The IRR of the TKI group compared to the cytotoxic group was 1.33 (95% CI, 0.64 to 2.76). The Kaplan-Meier cumulative risk of both groups was not significantly different. Our results show that the incidence rate of herpes zoster in the TKI group was not statistically different from the incidence in the cytotoxic group during and after chemotherapy in NSCLC patients.
Directory of Open Access Journals (Sweden)
Claudio Calazan do Carmo
2011-08-01
Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (pOBJETIVO: Evaluar la sobrevida global de mujeres con cáncer de cuello uterino e identificar factores pronósticos relacionados. MÉTODOS: Todos los 3.341 casos tratados en el Instituto Nacional de Cáncer, Rio de Janeiro, Sureste de Brasil, entre 1999 y 2004 fueron seleccionados y sus datos clínicos, anatomo-patológicos y de seguimiento fueron colectados. Se utilizaron la curva de Kaplan-meier y el modelo de Cox par evaluación de la sobrevida y para análisis logística múltiple, respectivamente. RESULTADOS: De los casos estudiados, 68,3% presentaban enfermedad localmente avanzada. La sobrevida en cinco años fue de 48%. Posterior al análisis múltiple, el estadio clínico al diagnóstico fue la única variable significativamente asociada con el pronóstico (pOBJETIVO: Avaliar a sobrevida global de mulheres com câncer de colo uterino e identificar fatores prognósticos relacionados. MÉTODOS: Todos os 3.341 casos tratados no Instituto Nacional de Câncer, Rio de Janeiro, RJ, entre 1999 e 2004 foram selecionados e seus dados clínicos, anatomo-patológicos e de seguimento foram coletados. Foram utilizados a curva de Kaplan-Meier e o modelo de Cox para avaliação da sobrevida e para análise logística m
Weiner, Lois; Kaplan, Andy
2014-01-01
In this commentary, Andy Kaplan discusses with Lois Weiner, Diane Ravitch's latest book "The Reign of Error," which combines scholarly argument and scrupulous research in defense of democratic education. Weiner notes, the book will prove an important resource in the ongoing struggle for the survival of public schooling. Weiner adds,…
Deep-learnt classification of light curves
DEFF Research Database (Denmark)
Mahabal, Ashish; Gieseke, Fabian; Pai, Akshay Sadananda Uppinakudru
2017-01-01
is to derive statistical features from the time series and to use machine learning methods, generally supervised, to separate objects into a few of the standard classes. In this work, we transform the time series to two-dimensional light curve representations in order to classify them using modern deep......Astronomy light curves are sparse, gappy, and heteroscedastic. As a result standard time series methods regularly used for financial and similar datasets are of little help and astronomers are usually left to their own instruments and techniques to classify light curves. A common approach...... learning techniques. In particular, we show that convolutional neural networks based classifiers work well for broad characterization and classification. We use labeled datasets of periodic variables from CRTS survey and show how this opens doors for a quick classification of diverse classes with several...
Directory of Open Access Journals (Sweden)
Muge Akmansu
2010-12-01
Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.
Measuring Model Rocket Engine Thrust Curves
Penn, Kim; Slaton, William V.
2010-01-01
This paper describes a method and setup to quickly and easily measure a model rocket engine's thrust curve using a computer data logger and force probe. Horst describes using Vernier's LabPro and force probe to measure the rocket engine's thrust curve; however, the method of attaching the rocket to the force probe is not discussed. We show how a…
International Nuclear Information System (INIS)
Shetty, Prashanth; Pooja, S.; Suchetha Kumari, N.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.
2016-01-01
Search for less-toxic radioprotectors has spurred interest in the development of natural products. In Ayurveda, the traditional medicine, Tanacetum species have been used to treat ailments since ancient times throughout the world. Effects of the administration of different concentrations of Tanacetum parthenium leaf aqueous extract (TPLA), Tanacetum parthenium leaf ethanolic extract (TPLE) were investigated in Swiss albino mice. Mice (20-25 g) were randomly divided into 8 groups of ten animals each. The control group and the radiation group were treated daily with oral administration of saline for 15 days. Each subgroups of TPLA and TPLE were treated with doses of 50, 100 and 250 mg/kg daily for 15 days. On the 15th day, all were irradiated with 10 Gy whole body irradiation. Survival was observed daily up to 30th post-irradiation day. Data were analysed using the Kaplan-Meier survival curves. The significance difference in survival between control, radiation and treatment groups were observed (P < 0.001). Current studies revealed the protective effect of Tanacetum parthenium rendering high survivability in lethally irradiated mice. (author)
DEFF Research Database (Denmark)
Høgdall, Claus K; Christensen, Ib J; Stephens, Ross W
2002-01-01
PAR and CEA had a 2.43 increased risk as compared to a patient with median levels of these biochemical markers. Significant correlations were found with Dukes' stages for all the biochemical markers and between the respective biochemical markers. The findings confirm that TN is a strong prognostic factor...... activator (uPAR) and carcinoembryonic antigen (CEA). Significantly shorter survival was found for patients with TN levels below a cut-off point of 7.5 mg/l compared to patients with levels above, as illustrated by Kaplan-Meier curves. By Cox analyses, log TN, log soluble uPAR as well as log CEA were found...... to have an independent prognostic value for survival (log TN: HR = 0.47, 95% CI: 0.29-0.76); log soluble uPAR: HR = 1.65, 95% CI: 1.18-2.31; log CEA: HR = 1.I1, 95% CI: 1.03-1.20). Based on the multivariate model, a patient with a combination of low levels of TN and PAI-1 and elevated levels of soluble u...
Siegal, Steve R; Dolan, James P; Dewey, Elizabeth N; Guimaraes, Alexander R; Tieu, Brandon H; Schipper, Paul H; Hunter, John G
2018-05-01
Sarcopenia is associated with increased morbidity and mortality in hepatic, pancreatic and colorectal cancer. We examined the effect of sarcopenia on morbidity, mortality, and recurrence after resection for esophageal cancer. Retrospective review of consecutive esophagectomies from 2010 to 2015. Computed tomography studies were analyzed for sarcopenia. Morbidity was analyzed using Fischer's test and survival data with Kaplan Meier curves. The sarcopenic group (n = 127) had lower BMI, later stage disease, and higher incidence of neoadjuvant radiation than those without sarcopenia (n = 46). There were no differences in morbidity or mortality between the groups (p = .75 and p = .31, respectively). Mean length of stay was similar (p = .70). Disease free and overall survival were similar (p = .20 and p = .39, respectively). There is no association between sarcopenia and increased morbidity, mortality and disease-free survival in patients undergoing esophagectomy for cancer. Sarcopenia in esophageal cancer may not portend worse outcomes that have been reported in other solid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.
Liu, Yuan; Vela, Monica; Rudakevych, Tanya; Wigfield, Christopher; Garrity, Edward; Saunders, Milda R
2017-03-01
Since 2005, the Lung Allocation Score (LAS) has prioritized patient benefit and post-transplant survival, reducing waitlist to transplant time to fibrosis (CF) and pulmonary fibrosis (PF). We analyzed the times from transplant eligibility to referral, work-up and waitlisting using Kaplan-Meier curves and log-rank tests. Overall, the referral rate for transplant-eligible patients was 64%. Of those referred, approximately 36% reach the lung transplant waitlist. Referred CF patients were significantly more likely to reach the transplant waitlist than PF patients (CF 60% vs PF 22%, p < 0.05). In addition, CF patients had a shorter wait from transplant eligibility to waitlist than PF patients (329 vs 2,369 days, respectively [25th percentile], p < 0.05). Patients with PF and CF both faced delays from eligibility to referral and waitlist. Quality improvement efforts are needed to better identify and refer appropriate patients for lung transplant evaluation. Targeted interventions may facilitate more efficient evaluation completion and waitlist appearance. Copyright © 2017 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.
Hengartner, M P; Heekeren, K; Dvorsky, D; Walitza, S; Rössler, W; Theodoridou, A
2017-09-01
The aim of this study was to critically examine the prognostic validity of various clinical high-risk (CHR) criteria alone and in combination with additional clinical characteristics. A total of 188 CHR positive persons from the region of Zurich, Switzerland (mean age 20.5 years; 60.2% male), meeting ultra high-risk (UHR) and/or basic symptoms (BS) criteria, were followed over three years. The test battery included the Structured Interview for Prodromal Syndromes (SIPS), verbal IQ and many other screening tools. Conversion to psychosis was defined according to ICD-10 criteria for schizophrenia (F20) or brief psychotic disorder (F23). Altogether n=24 persons developed manifest psychosis within three years and according to Kaplan-Meier survival analysis, the projected conversion rate was 17.5%. The predictive accuracy of UHR was statistically significant but poor (area under the curve [AUC]=0.65, Pthinking of binary at-risk criteria is necessary in order to improve the prognosis of psychotic disorders. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Urwin, Helen R; Jones, Peter W; Harden, Paul N; Ramsay, Helen M; Hawley, Carmel M; Nicol, David L; Fryer, Anthony A
2009-06-15
Nonmelanoma skin cancer (NMSC) and associated premalignant lesions represent a major complication after transplantation, particularly in areas with high ultraviolet radiation (UVR) exposure. The American Society of Transplantation has proposed annual NMSC screening for all renal transplant recipients. The aim of this study was to develop a predictive index (PI) that could be used in targeted screening. Data on patient demographics, UVR exposure, and other clinical parameters were collected on 398 adult recipients recruited from the Princess Alexandra Hospital, Brisbane. Structured interview, skin examination, biopsy of lesions, and review of medical/pathologic records were performed. Time to presentation with the first NMSC was assessed using Cox's regression models and Kaplan-Meier estimates used to assess detection of NMSC during screening. Stepwise selection identified age, outdoor UVR exposure, living in a hot climate, pretransplant NMSC, childhood sunburning, and skin type as predictors. The PI generated was used to allocate patients into three screening groups (6 months, 2 years, and 5 years). The survival curves of these groups were significantly different (PPI to enable development of targeted NMSC surveillance strategies.
[Expression and clinical significance of KIAA1199 in primary hepatocellular carcinoma].
Gu, C J; Ni, Q C; Ni, K; Zhang, S; Qian, H X
2018-05-29
Objective: To investigate the expression and clinical significance of KIAA1199 in primary hepatocellular carcinoma. Methods: A total of 136 cases of primary hepatocellular carcinoma tissues and paired adjacent tissues were collected. Immunohistochemistry and Western blot were used to detect the expression of KIAA1199 in primary hepatocellular carcinoma tissues and paired adjacent tissues. The relationship between KIAA1199 and clinicopathological parameter of primary hepatocellular carcinoma was analyzed. Results: The positive rate of KIAA1199 in primary hepatocellular carcinoma was 82.3% (112/136), which was higher than that in paired para-cancerous tissues (14.7%, 20/136). High expression of KIAA1199 was significantly correlated with age, cirrhosis history, tumor size, tumor number, degree of differentiation, TNM staging and microvenous invasion (MVI) ( P 0.05). The Kaplan-Meier survival curves indicated that high KIAA1199 expression was associated with poor survival ( P hepatocellular carcinoma, which is significantly correlated with the clinicopathological features and prognosis, high expression of KIAA1199 increased the risk of death in patients with primary hepatocellular carcinoma.
International Nuclear Information System (INIS)
Koehli, M.; Monbaron, D.; Gaillard, R.C.; Ruiz, J.; Prior, J.O.; Bischof Delaloye, A.; Calcagni, M.L.; Fivaz-Arbane, M.; Stauffer, J.C.
2006-01-01
Aim: To determine the long-term prognostic value of SPECT myocardial perfusion imaging (MPI) for the occurrence of cardiovascular events in diabetic patients. Patients, methods: SPECT MPI of 210 consecutive Caucasian diabetic patients were analysed using Kaplan-Meier event-free survival curve and independent predictors were determined by Cox multivariate analyses. Results: Follow-up was complete in 200 (95%) patients with a median period of 3.0 years (0.8-5.0). The population was composed of 114 (57%) men, age 65 ± 10 years, 181 (90.5%) type 2 diabetes mellitus, 50 (25%) with a history of coronary artery disease (CAD) and 98 (49%) presenting chest pain prior to MPI. The prevalence of abnormal MPI was 58%. Patients with a normal MPI had neither cardiac death, nor myocardial infarction, independently of a history of coronary artery disease or chest pain. Among the independent predictors of cardiac death and myocardial infarction, the strongest was abnormal MPI (p 5-fold increase in cardiovascular events. This emphasizes the value of SPECT MPI in predicting and risk-stratifying cardiovascular events in diabetic patients. (orig.)
Wan, Ke; Sun, Jiayu; Han, Yuchi; Liu, Hong; Yang, Dan; Li, Weihao; Wang, Jie; Cheng, Wei; Zhang, Qing; Zeng, Zhi; Chen, Yucheng
2018-02-23
Late gadolinium enhancement (LGE) pattern is a powerful imaging biomarker for prognosis of cardiac amyloidosis. It is unknown if the query amyloid late enhancement (QALE) score in light-chain (AL) amyloidosis could provide increased prognostic value compared with LGE pattern.Methods and Results:Seventy-eight consecutive patients with AL amyloidosis underwent contrast-enhanced cardiovascular magnetic resonance imaging. Patients with cardiac involvement were grouped by LGE pattern and analyzed using QALE score. Receiver operating characteristic curve was used to identify the optimal cut-off for QALE score in predicting all-cause mortality. Survival of these patients was analyzed with the Kaplan-Meier method and multivariate Cox regression. During a median follow-up of 34 months, 53 of 78 patients died. The optimal cut-off for QALE score to predict mortality at 12-month follow-up was 9.0. On multivariate Cox analysis, QALE score ≥9 (HR, 5.997; 95% CI: 2.665-13.497; Pvalue in AL cardiac amyloidosis. QALE score ≥9 has added value to differentiate prognosis in AL amyloidosis patients with a subendocardial LGE pattern.
Directory of Open Access Journals (Sweden)
Lincoln Douglas
2006-06-01
Full Text Available Abstract Background Increased expression of Eph receptor tyrosine kinases and their ephrin ligands has been implicated in tumor progression in a number of malignancies. This report describes aberrant expression of these genes in ovarian cancer, the commonest cause of death amongst gynaecological malignancies. Methods Eph and ephrin expression was determined using quantitative real time RT-PCR. Correlation of gene expression was measured using Spearman's rho statistic. Survival was analysed using log-rank analysis and (was visualised by Kaplan-Meier survival curves. Results Greater than 10 fold over-expression of EphA1 and a more modest over-expression of EphA2 were observed in partially overlapping subsets of tumors. Over-expression of EphA1 strongly correlated (r = 0.801; p Conclusion These data imply that increased levels of ephrins A1 and A5 in the presence of high expression of Ephs A1 and A2 lead to a more aggressive tumor phenotype. The known functions of Eph/ephrin signalling in cell de-adhesion and movement may explain the observed correlation of ephrin expression with poor prognosis.
Directory of Open Access Journals (Sweden)
Ana – Maria Budai
2010-10-01
Full Text Available The paper present an analytical method that can be used to determianted fatigue life time duration in service for runner blade mechanism of Kaplan turbines. The study was made for lever button of runer blade mechanism using two analytical relation to calculate the maximum number of stress cycles whereupon the mechanism work without any damage. To estimate fatigue life time duration will be used a formula obtained from one of most comon cumulative damage methodology taking in consideration the real exploatation conditions of a specified Kapaln turbine.
The Koch curve as a smooth manifold
International Nuclear Information System (INIS)
Epstein, Marcelo; Sniatycki, Jedrzej
2008-01-01
We show that there exists a homeomorphism between the closed interval [0,1] is contained in R and the Koch curve endowed with the subset topology of R 2 . We use this homeomorphism to endow the Koch curve with the structure of a smooth manifold with boundary
Remote sensing used for power curves
International Nuclear Information System (INIS)
Wagner, R; Joergensen, H E; Paulsen, U S; Larsen, T J; Antoniou, I; Thesbjerg, L
2008-01-01
Power curve measurement for large wind turbines requires taking into account more parameters than only the wind speed at hub height. Based on results from aerodynamic simulations, an equivalent wind speed taking the wind shear into account was defined and found to reduce the power standard deviation in the power curve significantly. Two LiDARs and a SoDAR are used to measure the wind profile in front of a wind turbine. These profiles are used to calculate the equivalent wind speed. The comparison of the power curves obtained with the three instruments to the traditional power curve, obtained using a cup anemometer measurement, confirms the results obtained from the simulations. Using LiDAR profiles reduces the error in power curve measurement, when these are used as relative instrument together with a cup anemometer. Results from the SoDAR do not show such promising results, probably because of noisy measurements resulting in distorted profiles
Technological Progress and the Future of Kuznets Curve's
Shin, Inyong; Kim, Hyunho; Yamamura, Eiji
2008-01-01
We use OECD members' data to ascertain that new-born technological inventions increase the degree of inequality but that this declines as the technology disperses into the overall economy (e.g., Galor and Tsiddon, 1997; Weil, 2005). Therefore, we show explicitly that Kuznets curve does not converge to a single inverted U-curve but fluctuates through technological progress as a sine curve.
Curve collection, extension of databases
International Nuclear Information System (INIS)
Gillemot, F.
1992-01-01
Full text: Databases: generally calculated data only. The original measurements: diagrams. Information loss between them Expensive research eg. irradiation, aging, creep etc. Original curves should be stored for reanalysing. The format of the stored curves: a. Data in ASCII files, only numbers b. Other information in strings in a second file Same name, but different extension. Extensions shows the type of the test and the type of the file. EXAMPLES. TEN is tensile information, TED is tensile data, CHN is Charpy informations, CHD is Charpy data. Storing techniques: digitalised measurements, digitalising old curves stored on paper. Use: making catalogues, reanalysing, comparison with new data. Tools: mathematical software packages like quattro, genplot, exel, mathcad, qbasic, pascal, fortran, mathlab, grapher etc. (author)
Growth curves for Laron syndrome.
Laron, Z; Lilos, P; Klinger, B
1993-01-01
Growth curves for children with Laron syndrome were constructed on the basis of repeated measurements made throughout infancy, childhood, and puberty in 24 (10 boys, 14 girls) of the 41 patients with this syndrome investigated in our clinic. Growth retardation was already noted at birth, the birth length ranging from 42 to 46 cm in the 12/20 available measurements. The postnatal growth curves deviated sharply from the normal from infancy on. Both sexes showed no clear pubertal spurt. Girls co...
An Alternate Light Curve Solution of AR Lacertae
Directory of Open Access Journals (Sweden)
Hong Suh Park
1984-09-01
Full Text Available Photoelectric UBV light curves of AR Lacertae made in one season during 1981-82 are presented. Although the shape of the light curves in the outside eclipses show a strong distortion, the scatter of observations as well as phase coverage are better than those previously available. Fourier coefficients are derived from the V-light curve and observed curve successfully rectified to the Russell model. Light curve solutions are computed and the geometrical and physical parameters of AR Lac are derived as as = 0.812, ag = 0.341, j = 86°3, Ls = 0.372, Lg = 0.628, k = 0.53, Xs = 0.85, Xg = 0.4.
Geometric invariant theory for polarized curves
Bini, Gilberto; Melo, Margarida; Viviani, Filippo
2014-01-01
We investigate GIT quotients of polarized curves. More specifically, we study the GIT problem for the Hilbert and Chow schemes of curves of degree d and genus g in a projective space of dimension d-g, as d decreases with respect to g. We prove that the first three values of d at which the GIT quotients change are given by d=a(2g-2) where a=2, 3.5, 4. We show that, for a>4, L. Caporaso's results hold true for both Hilbert and Chow semistability. If 3.5curves. If 2curves. We also analyze in detail the critical values a=3.5 and a=4, where the Hilbert semistable locus is strictly smaller than the Chow semistable locus. As an application, we obtain three compactications of the universal Jacobian over the moduli space of stable curves, weakly-pseudo-stable curves and pseu...
Sutton, Virginia Kay
This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.
Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents
International Nuclear Information System (INIS)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.
2002-01-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
International Nuclear Information System (INIS)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho
2010-01-01
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate
High serum uric acid concentration predicts poor survival in patients with breast cancer.
Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min
2017-10-01
Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D
2011-12-01
To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.
Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.
Pion, J; Lenoir, M; Vandorpe, B; Segers, V
2015-11-01
This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
Energy Technology Data Exchange (ETDEWEB)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)
2010-08-15
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.
A Tangent Bundle Theory for Visual Curve Completion.
Ben-Yosef, Guy; Ben-Shahar, Ohad
2012-07-01
Visual curve completion is a fundamental perceptual mechanism that completes the missing parts (e.g., due to occlusion) between observed contour fragments. Previous research into the shape of completed curves has generally followed an "axiomatic" approach, where desired perceptual/geometrical properties are first defined as axioms, followed by mathematical investigation into curves that satisfy them. However, determining psychophysically such desired properties is difficult and researchers still debate what they should be in the first place. Instead, here we exploit the observation that curve completion is an early visual process to formalize the problem in the unit tangent bundle R(2) × S(1), which abstracts the primary visual cortex (V1) and facilitates exploration of basic principles from which perceptual properties are later derived rather than imposed. Exploring here the elementary principle of least action in V1, we show how the problem becomes one of finding minimum-length admissible curves in R(2) × S(1). We formalize the problem in variational terms, we analyze it theoretically, and we formulate practical algorithms for the reconstruction of these completed curves. We then explore their induced visual properties vis-à-vis popular perceptual axioms and show how our theory predicts many perceptual properties reported in the corresponding perceptual literature. Finally, we demonstrate a variety of curve completions and report comparisons to psychophysical data and other completion models.
Optical and IR light curves of VV Puppis
International Nuclear Information System (INIS)
Szkody, P.; Bailey, J.A.; Hough, J.H.
1983-01-01
We present optical (0.36 to 0.6 μm) light curves with time resolutions of seconds and infrared (IR) (1.25 to 2.2 μm) light curves with time resolutions of minutes for VV Puppis during a high state. The optical light curves show a single hump with largest amplitude in the V filter, while the IR light curves show a double hump sinusoidal variation. Flickering is evident in both the optical and IR light curves, with the largest amplitude in optical B light. Through subtraction of the low state fluxes from our high state values, we obtain a flux distribution of the accretion column which peaks at 0.55 μm and becomes #betta# 2 in the IR, consistent with current cyclotron models. Comparison of the observed IR variations throughout the orbit with the expected variations due to an M4 star heated by an accretion column at an inclination of 66 0 suggests that the IR light is a combination of the secondary star plus contributions from two emitting poles. (author)
Uriarte-Duque, Juan; Hernández-Riverab, Gabriela
2006-01-01
Survival in patients with acquired immunodeficiency syndrome (AIDS) related non-Hodgkin's Lymphoma has improved with the use of High Active Antiretroviral Therapy (HAART) and less toxic chemotherapy. Clinical characteristics and outcome among patients treated for AIDS related non-Hodgkin's Lymphoma are described. Nine patients were studied retrospectively. Overall survival (OS) and Free Disease Survival (FDS) using a Kaplan-Meier model were analyzed. Patients received (DA-EPOCH) etoposide, prednisone, vincristine, doxorubicin and cyclophosphamide. The overall Survival was 18 months and 13 month Free Disease Survival with a median follow-up of 16 months showing full response in 8/9 patients was observed. A very satisfactory treatment response in this group of patients expressed as an increased Overall Survival was noted.
Experience Curves: A Tool for Energy Policy Assessment
Energy Technology Data Exchange (ETDEWEB)
Neij, Lena; Helby, Peter [Lund Univ. (Sweden). Environmental and Energy Systems Studies; Dannemand Andersen, Per; Morthorst, Poul Erik [Riso National Laboratory, Roskilde (Denmark); Durstewitz, Michael; Hoppe-Kilpper, Martin [Inst. fuer Solare Energieversorgungstechnik e.V., Kassel (DE); and others
2003-07-01
The objective of the project, Experience curves: a tool for energy policy assessment (EXTOOL), was to analyse the experience curve as a tool for the assessment of energy policy measures. This is of special interest, since the use of experience curves for the assessment of energy policy measures requires the development of the established experience curve methodology. This development raises several questions which have been addressed and analysed in this project. The analysis is based on case studies of wind power, an area with considerable experience in technology development, deployment and policy measures. Therefore, a case study based on wind power provides a good opportunity to study the usefulness of experience curves as a tool for the assessment of energy policy measures. However, the results are discussed in terms of using experience curves for the assessment of any energy technology. The project shows that experience curves can be used to assess the effect of combined policy measures in terms of cost reductions. Moreover, the result of the project show that experience curves could be used to analyse international 'learning systems', i.e. cost reductions brought about by the development of wind power and policy measures used in other countries. Nevertheless, the use of experience curves for the assessment of policy programmes has several limitations. First, the analysis and assessment of policy programmes cannot be achieved unless relevant experience curves based on good data can be developed. The authors are of the opinion that only studies that provide evidence of the validity, reliability and relevance of experience curves should be taken into account in policy making. Second, experience curves provide an aggregated picture of the situation and more detailed analysis of various sources of cost reduction, and cost reductions resulting from individual policy measures, requires additional data and analysis tools. Third, we do not recommend the use of
Neck curve polynomials in neck rupture model
International Nuclear Information System (INIS)
Kurniadi, Rizal; Perkasa, Yudha S.; Waris, Abdul
2012-01-01
The Neck Rupture Model is a model that explains the scission process which has smallest radius in liquid drop at certain position. Old fashion of rupture position is determined randomly so that has been called as Random Neck Rupture Model (RNRM). The neck curve polynomials have been employed in the Neck Rupture Model for calculation the fission yield of neutron induced fission reaction of 280 X 90 with changing of order of polynomials as well as temperature. The neck curve polynomials approximation shows the important effects in shaping of fission yield curve.
Curves of restricted type in euclidean spaces
Directory of Open Access Journals (Sweden)
Bengü Kılıç Bayram
2014-01-01
Full Text Available Submanifolds of restricted type were introduced in [7]. In the present study we consider restricted type of curves in Em. We give some special examples. We also show that spherical curve in S2(r C E3 is of restricted type if and only if either ƒ(s is constant or a linear function of s of the form ƒ(s = ±s + b and every closed W - curve of rank k and of length 2(r in E2k is of restricted type.
Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus
2013-01-01
BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...
International Nuclear Information System (INIS)
Badwe, R.A.
1999-01-01
The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model
Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model
International Nuclear Information System (INIS)
Rivetti, A; Angulo, M; Lucino, C; Liscia, S
2014-01-01
Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors
Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model
Rivetti, A.; Angulo, M.; Lucino, C.; Liscia, S.
2014-03-01
Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors.
Analysis of velocity planning interpolation algorithm based on NURBS curve
Zhang, Wanjun; Gao, Shanping; Cheng, Xiyan; Zhang, Feng
2017-04-01
To reduce interpolation time and Max interpolation error in NURBS (Non-Uniform Rational B-Spline) inter-polation caused by planning Velocity. This paper proposed a velocity planning interpolation algorithm based on NURBS curve. Firstly, the second-order Taylor expansion is applied on the numerator in NURBS curve representation with parameter curve. Then, velocity planning interpolation algorithm can meet with NURBS curve interpolation. Finally, simulation results show that the proposed NURBS curve interpolator meet the high-speed and high-accuracy interpolation requirements of CNC systems. The interpolation of NURBS curve should be finished.
Factors affecting fungus-induced larval mortality in Anopheles gambiae and Anopheles stephensi
Directory of Open Access Journals (Sweden)
Takken Willem
2010-01-01
Full Text Available Abstract Background Entomopathogenic fungi have shown great potential for the control of adult malaria vectors. However, their ability to control aquatic stages of anopheline vectors remains largely unexplored. Therefore, how larval characteristics (Anopheles species, age and larval density, fungus (species and concentration and environmental effects (exposure duration and food availability influence larval mortality caused by fungus, was studied. Methods Laboratory bioassays were performed on the larval stages of Anopheles gambiae and Anopheles stephensi with spores of two fungus species, Metarhizium anisopliae and Beauveria bassiana. For various larval and fungal characteristics and environmental effects the time to death was determined and survival curves established. These curves were compared by Kaplan Meier and Cox regression analyses. Results Beauveria bassiana and Metarhizium anisopliae caused high mortality of An. gambiae and An. stephensi larvae. However, Beauveria bassiana was less effective (Hazard ratio (HR Metarhizium anisopliae. Anopheles stephensi and An. gambiae were equally susceptible to each fungus. Older larvae were less likely to die than young larvae (HR Conclusions This study shows that both fungus species have potential to kill mosquitoes in the larval stage, and that mortality rate depends on fungus species itself, larval stage targeted, larval density and amount of nutrients available to the larvae. Increasing the concentration of fungal spores or reducing the exposure time to spores did not show a proportional increase and decrease in mortality rate, respectively, because the spores clumped together. As a result spores did not provide uniform coverage over space and time. It is, therefore, necessary to develop a formulation that allows the spores to spread over the water surface. Apart from formulation appropriate delivery methods are also necessary to avoid exposing non-target organisms to fungus.
Global experience curves for wind farms
International Nuclear Information System (INIS)
Junginger, M.; Faaij, A.; Turkenburg, W.C.
2005-01-01
In order to forecast the technological development and cost of wind turbines and the production costs of wind electricity, frequent use is made of the so-called experience curve concept. Experience curves of wind turbines are generally based on data describing the development of national markets, which cause a number of problems when applied for global assessments. To analyze global wind energy price development more adequately, we compose a global experience curve. First, underlying factors for past and potential future price reductions of wind turbines are analyzed. Also possible implications and pitfalls when applying the experience curve methodology are assessed. Second, we present and discuss a new approach of establishing a global experience curve and thus a global progress ratio for the investment cost of wind farms. Results show that global progress ratios for wind farms may lie between 77% and 85% (with an average of 81%), which is significantly more optimistic than progress ratios applied in most current scenario studies and integrated assessment models. While the findings are based on a limited amount of data, they may indicate faster price reduction opportunities than so far assumed. With this global experience curve we aim to improve the reliability of describing the speed with which global costs of wind power may decline
Laws governing the energy conversion of ionization curves
International Nuclear Information System (INIS)
Gorgoskii, V.I.
1986-01-01
The author attempts to determine if ionization curves are structured or smooth, the cause of the smoothing of the curves, the possibility of the curves having maxima and why, how many maxima are on the ionization curve, and which of these maxima is the fundamental maxima. The study shows that ionization curves without and additional maximum, i.e., with one fundamental maximum, can be obtained for potassium, rubidium, and cesium. This requires reduction of the density of the electrons in the stream and the density of the atoms of the target gas. It is also shown that in order to obtain ionization curves with additional maxima in the cases of neon, argon, and krypton, the measurements must be carried out at high densities of the electrons in the stream and of the atoms of the target gas
Integrable Flows for Starlike Curves in Centroaffine Space
Directory of Open Access Journals (Sweden)
Annalisa Calini
2013-03-01
Full Text Available We construct integrable hierarchies of flows for curves in centroaffine R^3 through a natural pre-symplectic structure on the space of closed unparametrized starlike curves. We show that the induced evolution equations for the differential invariants are closely connected with the Boussinesq hierarchy, and prove that the restricted hierarchy of flows on curves that project to conics in RP^2 induces the Kaup-Kuperschmidt hierarchy at the curvature level.
Conservative neck dissection in oral cancer patients: A 5 years retrospective study
Directory of Open Access Journals (Sweden)
Wan Mahadzir Wan Mustafa
2016-06-01
Full Text Available The impact of ablative oral cancer surgery was studied, with reference to recurrence and nodal metastasis, survival probability and prognostic indicators and to determine if ethnicity influences the survival of patients. Patients who underwent major ablative surgery of the head and neck region with neck dissection were identified and assessed. Those with stage I-IV oral and oropharyngeal malignancies necessitating resection with or without radiotherapy from 2004 to 2009 were included in this study. All individuals had a pre-operative assessment and post operative assessment. Survival distributions were analyzed using Kaplan-Meier curves. Eighty seven patients (males: 38%; females: 62% were included in this study, with an age range of 21-85 years. Some 78% underwent neck dissections while 63% had surgery and radiotherapy. Nodal and primary site recurrence was 5.7% and 20.5%. The median survival time was 57 months. One year Overall Survival (OS rate was 72.7% and three year overall survival rate 61.5%. The log-rank test showed a significant difference of survival between Malay and Chinese patients (Bonferroni correction p=0.033. Recurrence-Free Survival (RFS analysis revealed that 25% of the patients have reached the event of recurrence at 46 months. The three year survival rate was 76.1%. In the RFS analysis, the log-rank test showed a significant difference in the event of recurrence and nodal metastasis (p<0.001. Conservative neck effectively controls neck metastases. Ethnicity influence survival.
Laffer Curves and Home Production
Directory of Open Access Journals (Sweden)
Kotamäki Mauri
2017-06-01
Full Text Available In the earlier related literature, consumption tax rate Laffer curve is found to be strictly increasing (see Trabandt and Uhlig (2011. In this paper, a general equilibrium macro model is augmented by introducing a substitute for private consumption in the form of home production. The introduction of home production brings about an additional margin of adjustment – an increase in consumption tax rate not only decreases labor supply and reduces the consumption tax base but also allows a substitution of market goods with home-produced goods. The main objective of this paper is to show that, after the introduction of home production, the consumption tax Laffer curve exhibits an inverse U-shape. Also the income tax Laffer curves are significantly altered. The result shown in this paper casts doubt on some of the earlier results in the literature.
Trebše, Andrej J.
2004-01-01
The paper deals with efficiency measurement of Kaplan turbine with relative method (index test) and adjustment of operating of runner and guide vane governing system. At certain longer penstocks the looses in conduit at turbineload operation change the net head. On basis of model test on Kaplan turbine and relative turbine efficiency measurement on prototype the turbine governing system was optimized in accordance with comparative method. Prispevek obravnava meritev izkoristka kaplanove tu...
Examining the Latent Structure of the Delis-Kaplan Executive Function System.
Karr, Justin E; Hofer, Scott M; Iverson, Grant L; Garcia-Barrera, Mauricio A
2018-05-04
The current study aimed to determine whether the Delis-Kaplan Executive Function System (D-KEFS) taps into three executive function factors (inhibition, shifting, fluency) and to assess the relationship between these factors and tests of executive-related constructs less often measured in latent variable research: reasoning, abstraction, and problem solving. Participants included 425 adults from the D-KEFS standardization sample (20-49 years old; 50.1% female; 70.1% White). Eight alternative measurement models were compared based on model fit, with test scores assigned a priori to three factors: inhibition (Color-Word Interference, Tower), shifting (Trail Making, Sorting, Design Fluency), and fluency (Verbal/Design Fluency). The Twenty Questions, Word Context, and Proverb Tests were predicted in separate structural models. The three-factor model fit the data well (CFI = 0.938; RMSEA = 0.047), although a two-factor model, with shifting and fluency merged, fit similarly well (CFI = 0.929; RMSEA = 0.048). A bifactor model fit best (CFI = 0.977; RMSEA = 0.032) and explained the most variance in shifting indicators, but rarely converged among 5,000 bootstrapped samples. When the three first-order factors simultaneously predicted the criterion variables, only shifting was uniquely predictive (p measuring executive-related constructs and provide a framework through which clinicians can interpret D-KEFS results.
Biliary atresia: the Canadian experience.
Schreiber, Richard A; Barker, Collin C; Roberts, Eve A; Martin, Steven R; Alvarez, Fernando; Smith, Lesley; Butzner, J Decker; Wrobel, Iwona; Mack, David; Moroz, Stanley; Rashid, Mohsin; Persad, Rabin; Levesque, Dominique; Brill, Herbert; Bruce, Garth; Critch, Jeff
2007-12-01
To determine the outcomes of Canadian children with biliary atresia. Health records of infants born in Canada between January 1, 1985 and December 31, 1995 (ERA I) and between January 1, 1996 and December 31, 2002 (ERA II) who were diagnosed with biliary atresia at a university center were reviewed. 349 patients were identified. Median patient age at time of the Kasai operation was 55 days. Median age at last follow-up was 70 months. The 4-year patient survival rate was 81% (ERA I = 74%; ERA II = 82%; P = not significant [NS]). Kaplan-Meier survival curves for patients undergoing the Kasai operation at age 90 days showed 49%, 36%, and 23%, respectively, were alive with their native liver at 4 years (P < .0001). This difference continued through 10 years. The 2- and 4-year post-Kasai operation native liver survival rates were 47% and 35% for ERA I and 46% and 39% for ERA II (P = NS). A total of 210 patients (60%) underwent liver transplantation; the 4-year transplantation survival rate was 82% (ERA I = 83%, ERA II = 82%; P = NS). This is the largest outcome series of North American children with biliary atresia at a time when liver transplantation was available. Results in each era were similar. Late referral remains problematic; policies to ensure timely diagnosis are required. Nevertheless, outcomes in Canada are comparable to those reported elsewhere.
International Nuclear Information System (INIS)
Ohno, Akira; Nishimura, Tsunehiko; Uehara, Toshiisa; Shimonagata, Tsuyoshi; Kumita, Shinichiro; Ogawa, Youji; Nagata, Seiki; Miyatake, Kunio
1991-01-01
To assess the prognostic significance of right ventricular function in dilated cardiomyopathy (DCM), we studied consecutive 57 DCM patients. There were 41 men and 16 women, whose mean age was 48 years (range 3-68 years). The mean left ventricular ejection fraction (LVEF) in all patients was 29±11%, and the mean interval from the onset of symptom of cardiac failure (CHF history) was 4 years (range 0-33 years). With follow-up of 3.8 years, five patients had died until the first year, and 14 had died until the third year. By using multivariate regression analysis, there were no prognostic significance in clinical parameters such as age, CHF history, sex, atrial fibrillation, except for NYHA class, and medication at the third year. In survival curves according to Kaplan-Meier method, right ventricular ejection fraction (RVEF) and mean pulmonary artery (PA) had predictive value (p<0.05), while LVEF did not. The patients with RVEF<45% had poor survival rate compared to those with RVEF≥45%. The patients with RVEF<45% showed lower LVEF and left ventricular end-systolic volume index. RVEF may offer prognostic predictive value through the effect of not only mean PA but also left ventricular parameter. In conclusion, radionuclide assessment of right ventricular function should be valuable for the prognostic evaluation of DCM patients. (author)
Different effects of ERβ and TROP2 expression in Chinese patients with early-stage colon cancer.
Fang, Yu-Jing; Wang, Guo-Qiang; Lu, Zhen-Hai; Zhang, Lin; Li, Ji-Bin; Wu, Xiao-Jun; Ding, Pei-Rong; Ou, Qing-Jian; Zhang, Mei-Fang; Jiang, Wu; Pan, Zhi-Zhong; Wan, De-Sen
2012-12-01
Estrogen receptor beta (ERβ) and TROP2 expressed in colon carcinoma and might play an important role there. We explored the relationship of ERβ and TROP2 expression with the prognosis of early-stage colon cancer. ERβ and TROP2 levels were assessed by immunohistochemistry in normal mucosa and tumoral tissues from 220 Chinese patients with T(3)N(0)M(0) (stage IIa) and T(4)N(0)M(0) (stage IIb) colon cancer in the Cancer Center, Sun Yat-sen University, who underwent curative surgical resection between 1995 and 2003. The Cox proportional hazards regression model was applied to analyze the overall survival (OS) data, and the ROC curve, Kaplan-Meier estimate, log rank test, and Jackknife method were used to show the effect of ERβ and TROP2 expression at different stages of cancer. The 5-year survival rates were not significantly different between the patients with stage IIa and stage IIb colon cancer (83 vs. 80 %, respectively). The high expression of ERβ was related to decreasing OS in stage IIa and stage IIb colon cancer, while the high expression of TROP2 was related to decreasing OS in stage IIb colon cancer. The expression of ERβ and TROP2 has tumor-suppressive and tumor-promoting effect in stage IIa and stage IIb colon cancer, respectively.
Directory of Open Access Journals (Sweden)
Chenlu Liu
2018-01-01
Full Text Available Roles of interleukin-31 (IL-31 in the development and progression of human epithelial ovarian cancer are largely unknown. Studies report that the polymorphisms, rs7977932 C>G and rs4758680 C>A in IL-31, affect the expression level of IL-31. In the present study, we examined 412 patients with epithelial ovarian cancer and 428 healthy individuals to explore whether these polymorphisms are associated with the epithelial ovarian cancer in Chinese women. The genotype of the polymorphisms in each individual was identified. The associations of the polymorphisms with patients’ clinical characteristics and outcomes were evaluated. For rs7977932, the frequency of the CG/GG was significantly decreased in patients with epithelial ovarian cancer. However, the frequency of the rs4758680 CA/AA was significantly increased in those patients. Moreover, the frequency of rs7977932 CG/GG genotype was significantly higher in patients with less advanced FIGO stages. Kaplan-Meier curve showed that patients with CG/GG genotypes of rs7977932 had a decreased risk for recurrence compared to those with CC genotype. Our findings suggested that rs7977932 and rs4758680 of IL-31 may be associated with the development and progression of the epithelial ovarian cancer in the Chinese population. IL-31, therefore, may be a potential therapeutic target for the development of drugs to treat the disease.
Klein Nulent, Thomas J W; Van Diest, Paul J; van der Groep, Petra; Leusink, Frank K J; Kruitwagen, Cas L J J; Koole, Ronald; Van Cann, Ellen M
2013-10-01
The prediction of progression of individual tumours, prognosis, and survival in squamous cell carcinoma (SCC) of the head and neck is difficult. Cannabinoid-1 (CB1) and cannabinoid-2 (CB2) receptor expression is related to survival in several types of cancer, and the aim of this study was to find out whether the expression of CB1 and CB2 receptors is associated with survival in primary SCC of the head and neck. We made immunohistochemical analyses of the cannabinoid receptors on tissue arrays from 240 patients with the disease. Receptor immunoreactivity was classified as none, weak, moderate, or strong staining. Overall survival and disease-specific survival were plotted using Kaplan-Meier survival curves. A multivariate Cox proportional hazard model was created with all the relevant clinical and pathological features. Strong immunoreactivity of the CB2 receptor was significantly associated with reduced disease-specific survival (p=0.007). Cox-proportional hazard ratio (HR) showed that CB2 receptor immunoreactivity contributed to the prediction of survival (HR 3.6, 95% CI 1.5-8.7, p=0.004). Depth of invasion (HR 2.2, 95% CI 1.2-4.2, p=0.01) and vascular invasion (HR 2.5, 95% CI 1.4-4.5, p=0.001) were also associated with survival. Copyright © 2013 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Martínez-Ramos, David; Fortea-Sanchis, Carlos; Escrig-Sos, Javier; Prats-de Puig, Miguel; Queralt-Martín, Raquel; Salvador-Sanchis, José Luís
2014-01-01
Conservative surgery can be regarded as the standard treatment for most early stage breast tumors. However, a minority of patients treated with conservative surgery will present local or locoregional recurrence. Therefore, it is of interest to evaluate the possible factors associated with this recurrence. A population-based retrospective study using data from the Tumor Registry of Castellón (Valencia, Spain) of patients operated on for primary nonmetastatic breast cancer between January 2000 and December 2008 was designed. Kaplan-Meier curves and log-rank test to estimate 5-year local recurrence were used. Two groups of patients were defined, one with conservative surgery and another with nonconservative surgery. Cox multivariate analysis was conducted. The total number of patients was 410. Average local recurrence was 6.8%. In univariate analysis, only tumor size and lymph node involvement showed significant differences. On multivariate analysis, independent prognostic factors were conservative surgery (hazard ratio [HR] 4.62; 95% confidence interval [CI]: 1.12-16.82), number of positive lymph nodes (HR 1.07; 95% CI: 1.01-1.17) and tumor size (in mm) (HR 1.02; 95% CI: 1.01-1.06). Local recurrence after breast-conserving surgery is higher in tumors >2 cm. Although tumor size should not be a contraindication for conservative surgery, it should be a risk factor to be considered.
Zhang, Xia; Li, Zhangzhi; Geng, Wei; Song, Bin; Wan, Chucheng
2018-07-01
To investigate the efficacy and safety of umbilical cord blood (UCB) infusion (UCBI) plus immunosuppressive therapy (IST) treatment in comparison to IST treatment, as well as predictive factors for clinical responses, in severe aplastic anemia (SAA) patients. Totally, 93 patients with SAA were enrolled in this cohort study. In the IST group, rabbit antithymocyte globulin (r-ATG) combined with cyclosporine A (CsA) was administered, while in the IST+UBCI group, r-ATG, CsA, and UCB were used. After 6 months of treatment, UCBI+IST achieved a higher complete response (CR) rate (p=0.002) and an elevated overall response rate (ORR) (p=0.004), compared to IST. Regarding hematopoietic recovery at month 6, platelet responses in the UCBI+IST group were better than those in the IST group (p=0.002), and UCBI+IST treatment facilitated increasing trends in absolute neutrophil count (ANC) response (p=0.056). Kaplan-Meier curves illuminated UCBI+IST achieved faster ANC response (paplastic anemia (VSAA) and ANC could predict clinical responses as well. However, Cox proportional hazard regression indicated that VSAA (p=0.003), but not UCBI+IST, affected OS. Safety profiles showed that UCBI+IST therapy did not elevate adverse events, compared with IST treatment. UCBI+IST achieved better clinical responses and hematopoietic recovery than IST, and was well tolerated in SAA patients. © Copyright: Yonsei University College of Medicine 2018.
Energy Technology Data Exchange (ETDEWEB)
Ohno, Akira; Nishimura, Tsunehiko; Uehara, Toshiisa; Shimonagata, Tsuyoshi; Kumita, Shinichiro; Ogawa, Youji; Nagata, Seiki; Miyatake, Kunio [National Cardiovascular Center, Suita, Osaka (Japan)
1991-09-01
To assess the prognostic significance of right ventricular function in dilated cardiomyopathy (DCM), we studied consecutive 57 DCM patients. There were 41 men and 16 women, whose mean age was 48 years (range 3-68 years). The mean left ventricular ejection fraction (LVEF) in all patients was 29{+-}11%, and the mean interval from the onset of symptom of cardiac failure (CHF history) was 4 years (range 0-33 years). With follow-up of 3.8 years, five patients had died until the first year, and 14 had died until the third year. By using multivariate regression analysis, there were no prognostic significance in clinical parameters such as age, CHF history, sex, atrial fibrillation, except for NYHA class, and medication at the third year. In survival curves according to Kaplan-Meier method, right ventricular ejection fraction (RVEF) and mean pulmonary artery (PA) had predictive value (p<0.05), while LVEF did not. The patients with RVEF<45% had poor survival rate compared to those with RVEF{>=}45%. The patients with RVEF<45% showed lower LVEF and left ventricular end-systolic volume index. RVEF may offer prognostic predictive value through the effect of not only mean PA but also left ventricular parameter. In conclusion, radionuclide assessment of right ventricular function should be valuable for the prognostic evaluation of DCM patients. (author).
Zhou, Ling; Zhang, Haihua; Chen, Na; Zhang, Zhongbin; Liu, Ming; Dai, Lifang; Wang, Jingmin; Jiang, Yuwu; Wu, Ye
2018-06-01
Vanishing white matter disease (VWM) is one of the most prevalent inherited leukoencephalopathies in childhood. Infantile VWM is more severe but less understood than the classic early childhood type. We performed a follow-up study on 14 infantile and 26 childhood patients to delineate the natural history and neuroimaging features of VWM. Infantile and childhood patients shared similarities in the incidence of epileptic seizure (35.7 vs. 38.5%) and episodic aggravation (92.9 vs. 84.6%). Developmental delay before disease onset was more common in infantile patients. Motor disability was earlier and more severe in infantile VWM. In survivors with disease durations of 1-3 years, the Gross Motor Function Classification System (GMFCS) was classified as IV-V in 66.7% of infantile and only 29.4% of childhood patients. Kaplan-Meier survival curve analysis indicated that the 5-year survival rates were 21.6 and 91.3% in infantile and childhood VWM, respectively. In terms of MRI, infantile patients showed more extensive involvement and earlier rarefaction, with more common involvement of subcortical white matter, internal capsule, brain stem and dentate nuclei of the cerebellum. Restricted diffusion was more diffuse or extensive in infantile patients. In addition, four novel mutations were identified. In conclusion, we identified some similarities and differences in the natural history and neuroimaging features between infantile and early childhood VWM.
Relapse risk assessment of transplantation for patients with chronic myeloid leukaemia
Institute of Scientific and Technical Information of China (English)
无
2003-01-01
Objective To analyse the risk factors of relapse before bone marrow transplantation (BMT) and to present the prognostic information as good as possible.Methods A total of 3142 patients, who underwent the allogeneic blood or bone marrow tran splantation between 1989 and 1997 and were documented in the European Group for Blood and Marrow transplantation (EBMT), were included. Six possible risk factors including type of donor, stage of disease, age, gender, donor@#-recipient sex co mbination and the waiting time from diagnosis to transplation of relapse were co nsidered. The time to relapse was analysed by Kaplan-Meier curves and Coxregre ssion with stratification on prognostic factors that did not satisfy the Proport ional Hazard Assumption.Results An amount of 447 patients relapsed out of all 3142 patients. The relapse rate was 14.2%. Type of donor and stage of disease showed a clear prognostic effect, but failed the proportional hazard assumption. Therefore, the data were stratified on the combination of type of donor and stage of disease. Within these strata a n additional significant effect of age could be observed. Relative risk of age ≥40 vs age <40 was 1.32 (95% confidence interval 1.09-1.59). The prognostic model is summarized graphically.Conclusions The combination of type of donor, stage of disease and age of recipient at transplantation are important prognostic factors for relapse after BMT.
Development of ipilimumab: contribution to a new paradigm for cancer immunotherapy.
Hoos, Axel; Ibrahim, Ramy; Korman, Alan; Abdallah, Kald; Berman, David; Shahabi, Vafa; Chin, Kevin; Canetta, Renzo; Humphrey, Rachel
2010-10-01
Identification of cytotoxic T-lymphocyte antigen-4 (CTLA-4) as a key negative regulator of T-cell activity led to development of the fully human, monoclonal antibody ipilimumab to block CTLA-4 and potentiate antitumor T-cell responses. Animal studies first provided insight into the ability of an anti-CTLA-4 antibody to cause tumor regression, particularly in combination regimens. Early clinical studies defined ipilimumab pharmacokinetics and possibilities for combinability. Phase II trials of ipilimumab in advanced melanoma showed objective responses, but a greater number of patients had disease stabilization. In a phase III trial, ipilimumab was the first agent to demonstrate an improvement in overall survival in patients with previously treated, advanced melanoma. The adverse event profile associated with ipilimumab was primarily immune-related. Adverse events can be severe and life-threatening, but most were reversible using treatment guidelines. Ipilimumab monotherapy exhibits conventional and new patterns of activity in advanced melanoma, with a delayed separation of Kaplan-Meier survival curves. The observation of some new response patterns with ipilimumab, which are not captured by standard response criteria, led to novel criteria for the evaluation of immunotherapy in solid tumors. Overall, lessons from the development of ipilimumab contributed to a new clinical paradigm for cancer immunotherapy evolved by the Cancer Immunotherapy Consortium. Copyright © 2010 Elsevier Inc. All rights reserved.
Profiling the careers of Thoroughbred horses racing in Hong Kong between 2000 and 2010.
Velie, B D; Stewart, B D; Lam, K; Wade, C M; Hamilton, N A
2013-11-01
Research in Thoroughbred racehorses is often specific to horses from a given racing population or region. In order to investigate trends in racehorse careers across populations accurately, population-specific benchmarks for performance outcomes must be established. To provide summary statistics for performance outcomes for Thoroughbreds racing in Hong Kong between 2000 and 2010 and to document and provide evidence on the current differences in racing careers across sexes and regions of origin for horses racing in Hong Kong. Performance data on the population of Thoroughbreds racing in Hong Kong between 3 September 2000 and 12 March 2011 (n = 4950) were acquired and used to describe and compare the careers of Thoroughbred racehorses in Hong Kong. Career length, number of career starts and number of spells from racing per year were evaluated. Kaplan-Meier survival curves, stratified by sex, age group, country of origin and region of origin were produced for career length. A Cox's proportional hazards model was fitted to assess factors influencing the risk of retirement from racing in Hong Kong. Log-rank tests for equality of career length survivor functions showed significant differences (Phorse originates, with specific effects on each performance outcome also varying between regions. Future research should take into account these potential differences when comparing results across populations. © 2013 EVJ Ltd.
Directory of Open Access Journals (Sweden)
Klaus J. Schmitz
2007-02-01
Full Text Available BACKGROUND/AIMS: The GNAS1 locus encodes the Gas protein, which stimulates the formation of cycloadenosinemonophosphate (cAMP. The cAMP pathway mediates pleiotropic effects, including the regulation of apoptosis and proliferation. We have recently shown that TT genotypes of the single-nucleotide polymorphism T393C in the gene GNAS1 predict the clinical outcome of patients with various carcinomas. METHODS: Eighty-seven patients with intrahepatic cholangiocarcinoma (ICC were retrospectively genotyped to elucidate a potential association between T393C genotypes and clinical outcome. RESULTS: ICCs of patients with homozygous TT genotypes revealed a higher proliferation rate and a lower apoptotic rate. Homozygous TT patients were at highest risk for cancer-related deaths (hazard ratio = 2.74; 95% confidence interval = 1.03-7.28 compared with C-allele carriers. Kaplan-Meier curves for disease-specific overall and local recurrence-free survival in a subgroup with Ro-resected ICC showed a significant association of T393 homozygosity with outcome, which was confirmed in multivariate Cox regression analysis. CONCLUSIONS: GNAS1 T393C is a novel independent host factor for disease progression in patients with ICC. Our finding that TT homozygosity (and not CC homozygosity was associated with unfavorable clinical outcome points to the complex and differing functional effects induced by GNAS1 T393C polymorphism in various human carcinomas.
Diagnostic and prognostic value of peritoneal immunocytology in gastric cancer.
Benevolo, M; Mottolese, M; Cosimelli, M; Tedesco, M; Giannarelli, D; Vasselli, S; Carlini, M; Garofalo, A; Natali, P G
1998-10-01
Among the clinical factors with a pivotal role in the prediction of outcome for patients with gastric cancer, intraperitoneal (i.p.) microscopic dissemination may represent an important cause of recurrences, even in the early stages of the disease. In this context, the cytologic examination of intraoperative peritoneal washings may be essential to identify metastatic free cells, although a number of false-negative cases may be encountered. To determine whether immunocytochemical (ICC) methods that used a panel of three monoclonal antibodies (MoAbs), B72.3, AR3, and BD5, directed to gastric cancer-associated antigens can improve peritoneal cytology by providing more accurate prognostic indications, we immunocytochemically and morphologically evaluated 144 peritoneal washings sampled from patients surgically treated for gastric cancer. The ICC analysis allowed the identification of metastatic free peritoneal cells in 35% of the patients, with a 14% improvement over routine cytopathology (P < .0001). Furthermore, a 54-month survival analysis by Kaplan-Meier curves showed a statistically significant decrease in overall survival (OS) in patients with stages I through III disease with peritoneal microscopic disease detected morphologically and/or by ICC at the time of the primary surgery. Our data indicate that the use of a combination of selected MoAbs may allow the identification of cytologically false-negative cases that provide valuable prognostic information. This may be useful to stratify patients on more adequate therapeutic trials.
Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele
2017-07-01
Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.
Rao, Zilong; Zheng, Huaguang; Wang, Fei; Wang, Anxin; Liu, Liping; Dong, Kehui; Zhao, Xingquan; Wang, Yilong; Cao, Yibin
2017-08-01
To evaluate the role of HTPR in predicting early recurrence of ischemic events in patients with minor ischemic stroke or high-risk TIA. From January 2014 to September 2014, a single center continuously enrolled patients with minor ischemic stroke or high-risk TIA and gave them antiplatelet therapy consisting of aspirin with clopidogrel. HTPR was assessed by TEG after 7 days of antiplatelet therapy and detected CYP2C19 genotype. The incidence of recurrent ischemic events was assessed 3 months after onset. The incidence of recurrent ischemic events was compared between the HTPR and NTPR groups with the Kaplan-Meier method, and multivariate Cox proportional hazards models were used to determine the risk factors associated with recurrent ischemic events. We enrolled 278 eligible patients with minor ischemic stroke or high-risk TIA. Through TEG testing, patients with HTPR were 22.7%, and carriers were not associated with HTPR to ADP by TEG-ADP(%) (p = 0.193). A total of 265 patients completed 3 months of follow-up, and Kaplan-Meier analysis showed that patients with HTPR had a higher percentage of recurrent ischemic events compared with patients with NTPR (p = 0.002). In multivariate Cox proportional hazards models, history of ischemic stroke or TIA (HR 4.45, 95% CI 1.77-11.16, p = 0.001) and HTPR (HR 3.34, 95% CI 1.41-7.91, p = 0.006) was independently associated with recurrent ischemic events. In patients with minor stroke or TIA, the prevalence of HTPR was 22.7%, and HTPR was independently associated with recurrent ischemic events.
Directory of Open Access Journals (Sweden)
Asaho Nishizawa
Full Text Available To evaluate the influence of phacoemulsification after trabeculectomy on the postoperative intraocular pressure (IOP in eyes with uveitic glaucoma (UG.Kumamoto University Hospital, Kumamoto, Japan.A retrospective cohort study.The medical records of patients with UG who had trabeculectomy with mitomycin-C (MMC were reviewed. Complete and qualified surgical failures were defined by an IOP of ≥21 mmHg (condition A, ≥18 mmHg (condition B, or ≥15 mmHg (condition C without and with glaucoma eye drops, respectively. Kaplan-Meier survival analysis, generalized by the Wilcoxon test, and the Cox proportional hazards model analysis were conducted. Post-trabeculectomy phacoemulsification was treated as a time-dependent variable. In 24 (30% of the included 80 eyes, phacoemulsification was included, and they were divided into two groups: groups I (8 eyes with phacoemulsification within 1 year after trabeculectomy and group II (16 eyes after 1 year following trabeculectomy.Multivariable Cox proportional hazards model analysis showed post-trabeculectomy phacoemulsification was a significant factor in both complete success and qualified success based upon condition C (P = 0.0432 and P = 0.0488, respectively, but not for the other conditions. Kaplan-Meier survival analyses indicated significant differences in success probabilities between groups I and group II for complete success and qualified success based upon condition C (P = 0.020 and P = 0.013, respectively. There was also a significant difference for qualified success based upon condition B (P = 0.034, while there was no significant difference for the other conditions.Post-trabeculectomy phacoemulsification, especially within 1 year, can cause poor prognosis of IOP control of UG eyes after trabeculectomy with MMC.
Projection of curves on B-spline surfaces using quadratic reparameterization
Yang, Yijun
2010-09-01
Curves on surfaces play an important role in computer aided geometric design. In this paper, we present a hyperbola approximation method based on the quadratic reparameterization of Bézier surfaces, which generates reasonable low degree curves lying completely on the surfaces by using iso-parameter curves of the reparameterized surfaces. The Hausdorff distance between the projected curve and the original curve is controlled under the user-specified distance tolerance. The projected curve is T-G 1 continuous, where T is the user-specified angle tolerance. Examples are given to show the performance of our algorithm. © 2010 Elsevier Inc. All rights reserved.
Automorphisms of double coverings of curves
International Nuclear Information System (INIS)
Torres, F.
1994-11-01
We study automorphisms of curves that commute with each other. We prove that the order and the number of fixed points of one of them satisfy certain relations involving those of the other. Then, we specialize our results to the case of double coverings of curves. For instance, if the genus of the curve is at least 4γ + 2 and γ >= 1 (γ = the genus of the covered curve) we prove that the order of an automorphism is bounded above by 2γ + 1 (resp. 4γ + 2) provided it is prime (resp. it has at least five fixed points). We also improve Farkas' bound on the number of fixed points namely 4γ + 4 by showing that it involves the order of the automorphism except in the case of even order when such an improvement is obtained provided the automorphism and the γ-involution has at least one common fixed point. (author). 15 refs
Principal Curves on Riemannian Manifolds.
Hauberg, Soren
2016-09-01
Euclidean statistics are often generalized to Riemannian manifolds by replacing straight-line interpolations with geodesic ones. While these Riemannian models are familiar-looking, they are restricted by the inflexibility of geodesics, and they rely on constructions which are optimal only in Euclidean domains. We consider extensions of Principal Component Analysis (PCA) to Riemannian manifolds. Classic Riemannian approaches seek a geodesic curve passing through the mean that optimizes a criteria of interest. The requirements that the solution both is geodesic and must pass through the mean tend to imply that the methods only work well when the manifold is mostly flat within the support of the generating distribution. We argue that instead of generalizing linear Euclidean models, it is more fruitful to generalize non-linear Euclidean models. Specifically, we extend the classic Principal Curves from Hastie & Stuetzle to data residing on a complete Riemannian manifold. We show that for elliptical distributions in the tangent of spaces of constant curvature, the standard principal geodesic is a principal curve. The proposed model is simple to compute and avoids many of the pitfalls of traditional geodesic approaches. We empirically demonstrate the effectiveness of the Riemannian principal curves on several manifolds and datasets.
Utilization of curve offsets in additive manufacturing
Haseltalab, Vahid; Yaman, Ulas; Dolen, Melik
2018-05-01
Curve offsets are utilized in different fields of engineering and science. Additive manufacturing, which lately becomes an explicit requirement in manufacturing industry, utilizes curve offsets widely. One of the necessities of offsetting is for scaling which is required if there is shrinkage after the fabrication or if the surface quality of the resulting part is unacceptable. Therefore, some post-processing is indispensable. But the major application of curve offsets in additive manufacturing processes is for generating head trajectories. In a point-wise AM process, a correct tool-path in each layer can reduce lots of costs and increase the surface quality of the fabricated parts. In this study, different curve offset generation algorithms are analyzed to show their capabilities and disadvantages through some test cases and improvements on their drawbacks are suggested.
Modelling antagonic effect of lactic acid eacteria supernatants on some pathogenic bacteria
Directory of Open Access Journals (Sweden)
Augustus Caeser Franke Portella
2009-11-01
Full Text Available This work presents a statistical model of survival analysis for three pathogenic bacterial strains (Escherichia coli, Listeria monocytogenes and Staphylococcus aureus, when treated with neutralized and non-neutralized filtered supernatants broth from cultures of Lactobacillus acidhophilus, Lactobacillus rhamnosus and Lactobacillus sake. Survival analysis is a method employed to determine the period of time from an initial stage up to the occurrence of a particular event of interest, as death or a particular culture growth failure. In order to evaluate the potential efficacy of the ahead mentioned lactic acid bacteria when used as bioprotective starters in foods, experimental data were statistically treated and expressed by simple representative curves. Following the methodology of Cox and Kaplan-Meier, it was possible to make the selection of the best bioprotective lactic starter, as a predictive tool for evaluation of shelf life and prevention of eventual risks in fresh sausages and other similar food products.Este trabalho apresenta um modelo estatístico de análise de sobrevivência para três bactérias patogénicas (Escherichia coli, Listeria monocytogenes e Staphylococcus aureus, quando tratados com sobrenadantes filtrados neutralizado e não neutralizado provenientes de culturas de Lactobacillus acidhophilus, Lactobacillus rhamnosus e Lactobacillus sake. A Análise de sobrevivência é um método utilizado para determinar o período de tempo a partir de uma fase inicial até a ocorrência de um determinado evento de interesse, como a morte ou a inibição de uma particular cultura, a fim de avaliar a eficácia potencial das referidas bactérias lácticas quando usadas como bioproteção em alimentos. Os dados experimentais foram tratados estatisticamente, seguindo a metodologia de Cox e Kaplan-Meier e foi possível fazer a seleção dos melhores fermentos láticos bioprotectivos, como uma ferramenta para avaliação preditiva, vida de
Leelahapongsathon, Kansuda; Schukken, Ynte Hein; Pinyopummintr, Tanu; Suriyasathaporn, Witaya
2016-02-01
The objectives of study were to determine the transmission parameters (β), durations of infection, and basic reproductive numbers (R0) of both Streptococcus agalactiae and Streptococcus uberis as pathogens causing mastitis outbreaks in dairy herds. A 10-mo longitudinal study was performed using 2 smallholder dairy herds with mastitis outbreaks caused by Strep. agalactiae and Strep. uberis, respectively. Both herds had poor mastitis control management and did not change their milking management during the entire study period. Quarter milk samples were collected at monthly intervals from all lactating animals in each herd for bacteriological identification. The durations of infection for Strep. uberis intramammary infection (IMI) and Strep. agalactiae IMI were examined using Kaplan-Meier survival curves, and the Kaplan-Meier survival functions for Strep. uberis IMI and Strep. agalactiae IMI were compared using log rank survival-test. The spread of Strep. uberis and Strep. agalactiae through the population was determined by transmission parameter, β, the probability per unit of time that one infectious quarter will infect another quarter, assuming that all other quarters are susceptible. For the Strep. uberis outbreak herd (31 cows), 56 new infections and 28 quarters with spontaneous cure were observed. For the Strep. agalactiae outbreak herd (19 cows), 26 new infections and 9 quarters with spontaneous cure were observed. The duration of infection for Strep. agalactiae (mean=270.84 d) was significantly longer than the duration of infection for Strep. uberis (mean=187.88 d). The transmission parameters (β) estimated (including 95% confidence interval) for Strep. uberis IMI and Strep. agalactiae IMI were 0.0155 (0.0035-0.0693) and 0.0068 (0.0008-0.0606), respectively. The R0 (including 95% confidence interval) during the study were 2.91 (0.63-13.47) and 1.86 (0.21-16.61) for Strep. uberis IMI and Strep. agalactiae IMI, respectively. In conclusion, the transmission
Wheelset curving guidance using H∞ control
Qazizadeh, Alireza; Stichel, Sebastian; Feyzmahdavian, Hamid Reza
2018-03-01
This study shows how to design an active suspension system for guidance of a rail vehicle wheelset in curve. The main focus of the study is on designing the controller and afterwards studying its effect on the wheel wear behaviour. The controller is designed based on the closed-loop transfer function shaping method and ? control strategy. The study discusses designing of the controller for both nominal and uncertain plants and considers both stability and performance. The designed controllers in Simulink are then applied to the vehicle model in Simpack to study the wheel wear behaviour in curve. The vehicle type selected for this study is a two-axle rail vehicle. This is because this type of vehicle is known to have very poor curving performance and high wheel wear. On the other hand, the relative simpler structure of this type of vehicle compared to bogie vehicles make it a more economic choice. Hence, equipping this type of vehicle with the active wheelset steering is believed to show high enough benefit to cost ratio to remain attractive to rail vehicle manufacturers and operators.
Design fatigue curve for Hastelloy-X
International Nuclear Information System (INIS)
Nishiguchi, Isoharu; Muto, Yasushi; Tsuji, Hirokazu
1983-12-01
In the design of components intended for elevated temperature service as the experimental Very High-Temperature gas-cooled Reactor (VHTR), it is essential to prevent fatigue failure and creep-fatigue failure. The evaluation method which uses design fatigue curves is adopted in the design rules. This report discussed several aspects of these design fatigue curves for Hastelloy-X (-XR) which is considered for use as a heat-resistant alloy in the VHTR. Examination of fatigue data gathered by a literature search including unpublished data showed that Brinkman's equation is suitable for the design curve of Hastelloy-X (-XR), where total strain range Δ epsilon sub(t) is used as independent variable and fatigue life Nsub(f) is transformed into log(log Nsub(f)). (author)
Granados, I.; Calo, M.; Ramos, V.
2017-12-01
We developed a Matlab suite package (NDCP, Noisy Dispersion Curve Picking) that allows a full control over parameters to identify correctly group velocity dispersion curves in two types of datasets: correlograms between two stations or surface wave records from earthquakes. Using the frequency-time analysis (FTAN), the procedure to obtain the dispersion curves from records with a high noise level becomes difficult, and sometimes, the picked curve result in a misinterpreted character. For correlogram functions, obtained with cross-correlation of noise records or earthquake's coda, a non-homogeneous noise sources distribution yield to a non-symmetric Green's function (GF); to retrieve the complete information contained in there, NDCP allows to pick the dispersion curve in the time domain both in the causal and non-causal part of the GF. Then the picked dispersion curve is displayed on the FTAN diagram to in order to check if it matches with the maximum of the signal energy avoiding confusion with overtones or spike of noise. To illustrate how NDCP performs, we show exemple using: i) local correlograms functions obtained from sensors deployed into a volcanic caldera (Los Humeros, in Puebla, Mexico), ii) regional correlograms functions between two stations of the National Seismological Service (SSN, Servicio Sismológico Nacional in Spanish), and iii) surface wave seismic record for an earthquake located in the Pacific Ocean coast of Mexico and recorded by the SSN. This work is supported by the GEMEX project (Geothermal Europe-Mexico consortium).
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
International Nuclear Information System (INIS)
Lakatos, K; Szamosi, Z; Bereczkei, S
2012-01-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
Lakatos, K.; Szamosi, Z.; Bereczkei, S.
2012-11-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
International Nuclear Information System (INIS)
Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.
2016-01-01
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.
Directory of Open Access Journals (Sweden)
Raúl Vicente Mantilla Quispe
2008-10-01
Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.
Energy Technology Data Exchange (ETDEWEB)
Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)
2016-07-15
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis
DEFF Research Database (Denmark)
Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene
2017-01-01
characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p
Measuring survival time: a probability-based approach useful in healthcare decision-making.
2011-01-01
In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.
DEFF Research Database (Denmark)
Agerbo, Esben
2007-01-01
longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....
Improve T Cell Therapy in Neuroblastoma
2015-09-01
bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and
International Nuclear Information System (INIS)
Rassart, E.; Paquette, Y.; Jolicoeur, P.
1988-01-01
The molecularly cloned infectious Kaplan radiation leukemia virus has previously been shown to be unable to replicate on mouse fibroblasts. To map the viral sequences responsible for this, we constructed chimeric viral DNA genomes in vitro with parental cloned infectious viral DNAs from the nonfibrotropic (F-) BL/VL3 V-13 radiation leukemia virus and the fibrotropic (F+) endogenous BALB/c or Moloney murine leukemia viruses (MuLV). Infectious chimeric MuLVs, recovered after transfection of Ti-6 lymphocytes with these recombinant DNAs, were tested for capacity to replicate on mouse fibroblasts in vitro. We found that chimeric MuLVs harboring the long terminal repeat (LTR) of a fibrotropic MuLV replicated well on mouse fibroblasts. Conversely, chimeric MuLVs harboring the LTR of a nonfibrotropic MuLV were restricted on mouse fibroblasts. These results indicate that the LTR of BL/VL3 radiation leukemia virus harbors the primary determinant responsible for its inability to replicate on mouse fibroblasts in vitro. Our results also show that the primary determinant allowing F+ MuLVs (endogenous BALB/c and Moloney MuLVs) to replicate on mouse fibroblasts in vitro resides within the LTR
Spies, Benedikt Christopher; Witkowski, Siegbert; Butz, Frank; Vach, Kirstin; Kohal, Ralf-Joachim
2016-10-01
The aim of this study was to determine the success and survival rate of all-ceramic bi-layered implant-supported three-unit fixed dental prostheses (IS-FDPs) 3 years after implant placement. Thirteen patients (seven males, six females; age: 41-78 years) received two one-piece ceramic implants (alumina-toughened zirconia) each in the region of the premolars or the first molar and were finally restored with adhesively cemented bi-layered zirconia-based IS-FDPs (3 in the maxilla, 10 in the mandible) composed of CAD/CAM-fabricated zirconia frameworks pressed-over with fluor-apatite glass-ceramic ingots. At prosthetic delivery and the follow-ups after 1, 2 and 3 years, the restorations were evaluated using modified United States Public Health Service (USPHS) criteria. Restorations with minor veneer chippings, a small-area occlusal roughness, slightly soundable restoration margins, minimal contour deficiencies and tolerable color deviations were regarded as success. In case of more distinct defects that could, however, be repaired to a clinically acceptable level, IS-FDPs were regarded as surviving. Kaplan-Meier plots were used for the success/survival analyses. To verify an impact on subjective patients' perceptions, satisfaction was evaluated by visual analog scales (VAS). All patients were seen 3 years after implant installation. No IS-FDP had to be replaced, resulting in 100% survival after a mean observation period of 29.5 months (median: 30.7). At the 3-year follow-up, 7/13 IS-FDPs showed a veneer chipping, 13/13 an occlusal roughness and 12/13 minimal deficiencies of contour/color. Since six restorations showed a major chipping and/or a major occlusal roughness, the Kaplan-Meier success rate was 53.8%. However, patients' significantly improved perceptions of function, esthetics, sense, and speech at prosthetic delivery remained stable over time. Bi-layered zirconia/fluor-apatite IS-FDPs entirely survived the observation period but showed a high frequency of
Walker, Judy L
2000-01-01
When information is transmitted, errors are likely to occur. Coding theory examines efficient ways of packaging data so that these errors can be detected, or even corrected. The traditional tools of coding theory have come from combinatorics and group theory. Lately, however, coding theorists have added techniques from algebraic geometry to their toolboxes. In particular, by re-interpreting the Reed-Solomon codes, one can see how to define new codes based on divisors on algebraic curves. For instance, using modular curves over finite fields, Tsfasman, Vladut, and Zink showed that one can define a sequence of codes with asymptotically better parameters than any previously known codes. This monograph is based on a series of lectures the author gave as part of the IAS/PCMI program on arithmetic algebraic geometry. Here, the reader is introduced to the exciting field of algebraic geometric coding theory. Presenting the material in the same conversational tone of the lectures, the author covers linear codes, inclu...
Methods for predicting isochronous stress-strain curves
International Nuclear Information System (INIS)
Kiyoshige, Masanori; Shimizu, Shigeki; Satoh, Keisuke.
1976-01-01
Isochronous stress-strain curves show the relation between stress and total strain at a certain temperature with time as a parameter, and they are drawn up from the creep test results at various stress levels at a definite temperature. The concept regarding the isochronous stress-strain curves was proposed by McVetty in 1930s, and has been used for the design of aero-engines. Recently the high temperature characteristics of materials are shown as the isochronous stress-strain curves in the design guide for the nuclear energy equipments and structures used in high temperature creep region. It is prescribed that these curves are used as the criteria for determining design stress intensity or the data for analyzing the superposed effects of creep and fatigue. In case of the isochronous stress-strain curves used for the design of nuclear energy equipments with very long service life, it is impractical to determine the curves directly from the results of long time creep test, accordingly the method of predicting long time stress-strain curves from short time creep test results must be established. The method proposed by the authors, for which the creep constitution equations taking the first and second creep stages into account are used, and the method using Larson-Miller parameter were studied, and it was found that both methods were reliable for the prediction. (Kako, I.)
Parametric representation of centrifugal pump homologous curves
International Nuclear Information System (INIS)
Veloso, Marcelo A.; Mattos, Joao R.L. de
2015-01-01
Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic quantities: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. The curves showing the relationships between these four variables are called the pump characteristic curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, this configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the parametric form appears as the simplest way to deal with the homologous curves. In this approach, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a pressurized water reactor (PWR) are transformed to the parametric form. (author)
Stenting for curved lesions using a novel curved balloon: Preliminary experimental study.
Tomita, Hideshi; Higaki, Takashi; Kobayashi, Toshiki; Fujii, Takanari; Fujimoto, Kazuto
2015-08-01
Stenting may be a compelling approach to dilating curved lesions in congenital heart diseases. However, balloon-expandable stents, which are commonly used for congenital heart diseases, are usually deployed in a straight orientation. In this study, we evaluated the effect of stenting with a novel curved balloon considered to provide better conformability to the curved-angled lesion. In vitro experiments: A Palmaz Genesis(®) stent (Johnson & Johnson, Cordis Co, Bridgewater, NJ, USA) mounted on the Goku(®) curve (Tokai Medical Co. Nagoya, Japan) was dilated in vitro to observe directly the behavior of the stent and balloon assembly during expansion. Animal experiment: A short Express(®) Vascular SD (Boston Scientific Co, Marlborough, MA, USA) stent and a long Express(®) Vascular LD stent (Boston Scientific) mounted on the curved balloon were deployed in the curved vessel of a pig to observe the effect of stenting in vivo. In vitro experiments: Although the stent was dilated in a curved fashion, stent and balloon assembly also rotated conjointly during expansion of its curved portion. In the primary stenting of the short stent, the stent was dilated with rotation of the curved portion. The excised stent conformed to the curved vessel. As the long stent could not be negotiated across the mid-portion with the balloon in expansion when it started curving, the mid-portion of the stent failed to expand fully. Furthermore, the balloon, which became entangled with the stent strut, could not be retrieved even after complete deflation. This novel curved balloon catheter might be used for implantation of the short stent in a curved lesion; however, it should not be used for primary stenting of the long stent. Post-dilation to conform the stent to the angled vessel would be safer than primary stenting irrespective of stent length. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
On the solar curve of growth of titanium
International Nuclear Information System (INIS)
Foy, R.
1975-01-01
Our purpose in the present work is to investigate whether or not the splitting of the solar curve of growth found in the case of iron applies to other elements. We show that, contrary to the solar curve of growth for iron, that for titanium is not split in its damping part; this result emphasizes that reference curves of growth have to be used very carefully in detailed analysis of stellar atmospheres. We confirm that the microturbulent velocity is very low in the solar photosphere, namely within the limits: 0.5 [de
PV experience curves for the Netherlands
International Nuclear Information System (INIS)
Gerwig, R.
2005-01-01
Experience curves are one of several tools used by policy makers to take a look at market development. Numerous curves have been constructed for PV but none specific to the Netherlands. The objective of this report is to take a look at the price development of grid-connected PV systems in the Netherlands using the experience curve theory. After a literature and internet search and attempts to acquire information from PV companies information on 51% of the totally installed capacity was found. Curves for the period 1991-2001 were constructed based on system price, BOS (balance-of-system) price and inverter price. The progress ratio of the locally learning BOS was similar to the globally learning module market. This indicates that the pace of development of the Dutch PV market is similar to the globally followed pace. Improvement of the detail of the data might help to get a better idea of which BOS components have declined most. The similar progress ratio also shows the importance of investing both in module and system research as is the case in the Netherlands
Directory of Open Access Journals (Sweden)
René Pellissier
2012-01-01
Full Text Available This paper explores the notion ofjump ing the curve,following from Handy 's S-curve onto a new curve with new rules policies and procedures. . It claims that the curve does not generally lie in wait but has to be invented by leadership. The focus of this paper is the identification (mathematically and inferentially ofthat point in time, known as the cusp in catastrophe theory, when it is time to change - pro-actively, pre-actively or reactively. These three scenarios are addressed separately and discussed in terms ofthe relevance ofeach.
Zhou, K; Yan, Y; Zhao, S; Li, B
2014-01-01
To explore the correlation between serum levels of Tumor Associated Materials (TAM) and clinicopathological parameters and prognosis in patients with esophageal cancer (EC). The levels of TAM were determined by chemical colorimetry in 100 EC patients and 100 healthy controls. Serum TAM levels were significantly higher in patients with esophageal carcinoma than in the control group (p TAM were associated with tumor size (p = 0.004), tumor depth (p TAM (p = 0.001). Kaplan-Meier analysis showed patients with increased levels of TAM after operation had an lower overall survival (p TAM may be an independent factor affecting the overall survival and disease-free survival (p TAM could be used to screen for tumor and assess unfavorable prognosis in patients with EC.
Prognostic impact of tumor MET expression among patients with stage IV gastric cancer
DEFF Research Database (Denmark)
Erichsen, Rune; Kelsh, Michael A; Oliner, Kelly S
2016-01-01
PURPOSE: We aimed to investigate the prevalence and prognostic impact of tumor mesenchymal epithelial transition factor (MET) expression in stage IV gastric cancers in a real-world clinical setting because existing evidence is sparse. METHODS: The study included archived cancer specimens from 103...... stage IV gastric cancer patients (2003-2010). We analyzed MET-protein expression by immunohistochemistry (MET-positive if ≥25% of tumor cells showed MET expression). We calculated overall survival using the Kaplan-Meier method and hazard ratios comparing mortality among MET-positive and MET.......6 months), corresponding to an adjusted hazard ratio of 2.2 (95% confidence interval, 1.3-3.7). CONCLUSIONS: Tumor MET expression is prevalent and has substantial prognostic impact in stage IV gastric cancer patients....
Dual Smarandache Curves of a Timelike Curve lying on Unit dual Lorentzian Sphere
Kahraman, Tanju; Hüseyin Ugurlu, Hasan
2016-01-01
In this paper, we give Darboux approximation for dual Smarandache curves of time like curve on unit dual Lorentzian sphere. Firstly, we define the four types of dual Smarandache curves of a timelike curve lying on dual Lorentzian sphere.
Light Curve Analysis of SAO23229
Directory of Open Access Journals (Sweden)
Ho-Il Kim
1993-06-01
Full Text Available We have made UBV light curves of a newly discovered eclipsing binary, SAO23229 at Sobaeksan Astronomy Observatory. We determined a minimum light time of HJD2448636.1170+/-0.0005 that is 3 minutes later than predicted time, and founda peculiar light variation at phase 0.75 that may not be secondary eclipse. Orbital period of SAO23229 would be 4.2 days rather than 2.1 days. Our analysis of the light curves shows that SAO23229 has a detached configuration consisting of two almost identical F type main sequence stars.
The role of experience curves for setting MEPS for appliances
International Nuclear Information System (INIS)
Siderius, Hans-Paul
2013-01-01
Minimum efficiency performance standards (MEPS) are an important policy instrument to raise the efficiency of products. In most schemes the concept of life cycle costs (LCC) is used to guide setting the MEPS levels. Although a large body of literature shows that product cost is decreasing with increasing cumulative production, the experience curve, this is currently not used for setting MEPS. This article shows how to integrate the concept of the experience curve into LCC calculations for setting MEPS in the European Union and applies this to household laundry driers, refrigerator-freezers and televisions. The results indicate that for driers and refrigerator-freezers at least twice the energy savings compared to the current approach can be achieved. These products also show that energy label classes can successfully be used for setting MEPS. For televisions an experience curve is provided, showing a learning rate of 29%. However, television prices do not show a relation with energy efficiency but are to a large extent determined by the time the product is placed on the market. This suggests to policy makers that for televisions and other products with a short (re)design and market cycle timing is more important than the MEPS levels itself. - Highlights: • We integrate experience curves into life cycle cost calculations for MEPS. • For driers and refrigerators this results in at least twice the energy savings. • For flat panel televisions an experience curve is provided
Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G
2006-10-01
Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.
Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto
2017-06-01
Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.
Stent placement with the monorail technique for treatment of mesenteric artery stenosis.
Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan
2006-04-01
To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.
Polar representation of centrifugal pump homologous curves
International Nuclear Information System (INIS)
Veloso, Marcelo Antonio; Mattos, Joao Roberto Loureiro de
2008-01-01
Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic parameters: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. Any one of these quantities can be expressed as a function of any two others. The curves showing the relationships between these four variables are called the pump characteristic curves, also referred to as four-quadrant curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, the four-quadrant configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the polar form appears as the simplest way to represent the homologous curves. In the polar method, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a
Honglu, Wu; Cucinotta, F.A.; Durante, M.; Lin, Z.; Rusek, A.
2006-01-01
The space environment consists of a varying field of radiation particles including high-energy ions, with spacecraft shielding material providing the major protection to astronauts from harmful exposure. Unlike low-LET gamma or X-rays, the presence of shielding does not always reduce the radiation risks for energetic charged particle exposure. Since the dose delivered by the charged particle increases sharply as the particle approaches the end of its range, a position known as the Bragg peak, the Bragg curve does not necessarily represent the biological damage along the particle traversal since biological effects are influenced by the track structure of both primary and secondary particles. Therefore, the biological Bragg curve is dependent on the energy and the type of the primary particle, and may vary for different biological endpoints. To achieve a Bragg curve distribution, we exposed cells to energetic heavy ions with the beam geometry parallel to a monolayer of fibroblasts. Qualitative analyses of gamma-H2AX fluorescence, a known marker of DSBs, indicated increased clustering of DNA damage before the Bragg peak, enhanced homogenous distribution at the peak, and provided visual evidence of high linear energy transfer (LET) particle traversal of cells beyond the Bragg peak. A quantitative biological response curve generated for micronuclei (MN) induction across the Bragg curve did not reveal an increased yield of MN at the location of the Bragg peak. However, the ratio of mono-to bi-nucleated cells, which indicates inhibition in cell progression, increased at the Bragg peak location. These results, along with other biological concerns, show that space radiation protection with shielding can be a complicated issue.
The genus curve of the Abell clusters
Rhoads, James E.; Gott, J. Richard, III; Postman, Marc
1994-01-01
We study the topology of large-scale structure through a genus curve measurement of the recent Abell catalog redshift survey of Postman, Huchra, and Geller (1992). The structure is found to be spongelike near median density and to exhibit isolated superclusters and voids at high and low densities, respectively. The genus curve shows a slight shift toward 'meatball' topology, but remains consistent with the hypothesis of Gaussian random phase initial conditions. The amplitude of the genus curve corresponds to a power-law spectrum with index n = 0.21-0.47+0.43 on scales of 48/h Mpc or to a cold dark matter power spectrum with omega h = 0.36-0.17+0.46.
The genus curve of the Abell clusters
Rhoads, James E.; Gott, J. Richard, III; Postman, Marc
1994-01-01
We study the topology of large-scale structure through a genus curve measurement of the recent Abell catalog redshift survey of Postman, Huchra, and Geller (1992). The structure is found to be spongelike near median density and to exhibit isolated superclusters and voids at high and low densities, respectively. The genus curve shows a slight shift toward 'meatball' topology, but remains consistent with the hypothesis of Gaussian random phase initial conditions. The amplitude of the genus curve corresponds to a power-law spectrum with index n = 0.21(sub -0.47 sup +0.43) on scales of 48/h Mpc or to a cold dark matter power spectrum with omega h = 0.36(sub -0.17 sup +0.46).
DEFF Research Database (Denmark)
Bernstein, Daniel J.; Birkner, Peter; Lange, Tanja
2013-01-01
-arithmetic level are as follows: (1) use Edwards curves instead of Montgomery curves; (2) use extended Edwards coordinates; (3) use signed-sliding-window addition-subtraction chains; (4) batch primes to increase the window size; (5) choose curves with small parameters and base points; (6) choose curves with large...
Cardona, Samir Julián Calvo; Cadavid, Henry Cardona; Corrales, Juan David; Munilla, Sebastián; Cantet, Rodolfo J C; Rogberg-Muñoz, Andrés
2016-09-01
The κ-casein (CSN-3) and β-lactoglobulin (BLG) genes are extensively polymorphic in ruminants. Several association studies have estimated the effects of polymorphisms in these genes on milk yield, milk composition, and cheese-manufacturing properties. Usually, these results are based on production integrated over the lactation curve or on cross-sectional studies at specific days in milk (DIM). However, as differential expression of milk protein genes occurs over lactation, the effect of the polymorphisms may change over time. In this study, we fitted a mixed-effects regression model to test-day records of milk yield and milk quality traits (fat, protein, and total solids yields) from Colombian tropical dairy goats. We used the well-characterized A/B polymorphisms in the CSN-3 and BLG genes. We argued that this approach provided more efficient estimators than cross-sectional designs, given the same number and pattern of observations, and allowed exclusion of between-subject variation from model error. The BLG genotype AA showed a greater performance than the BB genotype for all traits along the whole lactation curve, whereas the heterozygote showed an intermediate performance. We observed no such constant pattern for the CSN-3 gene between the AA homozygote and the heterozygote (the BB genotype was absent from the sample). The differences among the genotypic effects of the BLG and the CSN-3 polymorphisms were statistically significant during peak and mid lactation (around 40-160 DIM) for the BLG gene and only for mid lactation (80-145 DIM) for the CSN-3 gene. We also estimated the additive and dominant effects of the BLG locus. The locus showed a statistically significant additive behavior along the whole lactation trajectory for all quality traits, whereas for milk yield the effect was not significant at later stages. In turn, we detected a statistically significant dominance effect only for fat yield in the early and peak stages of lactation (at about 1-45 DIM
Dave, Anushree
2017-12-01
This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.
International Nuclear Information System (INIS)
Pan, Haoran; Koehler, Jonathan
2007-01-01
Learning curves have recently been widely adopted in climate-economy models to incorporate endogenous change of energy technologies, replacing the conventional assumption of an autonomous energy efficiency improvement. However, there has been little consideration of the credibility of the learning curve. The current trend that many important energy and climate change policy analyses rely on the learning curve means that it is of great importance to critically examine the basis for learning curves. Here, we analyse the use of learning curves in energy technology, usually implemented as a simple power function. We find that the learning curve cannot separate the effects of price and technological change, cannot reflect continuous and qualitative change of both conventional and emerging energy technologies, cannot help to determine the time paths of technological investment, and misses the central role of R and D activity in driving technological change. We argue that a logistic curve of improving performance modified to include R and D activity as a driving variable can better describe the cost reductions in energy technologies. Furthermore, we demonstrate that the top-down Leontief technology can incorporate the bottom-up technologies that improve along either the learning curve or the logistic curve, through changing input-output coefficients. An application to UK wind power illustrates that the logistic curve fits the observed data better and implies greater potential for cost reduction than the learning curve does. (author)
Directory of Open Access Journals (Sweden)
Zoltan-Iosif Korka
2016-10-01
Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.
A population-based study of survival and discharge status for survivors after head injury
DEFF Research Database (Denmark)
Engberg, Aase Worså; Teasdale, T W
2004-01-01
and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score
Molecular genetics analysis of hereditary breast and ovarian cancer patients in India
Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan
2009-01-01
Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Syncytin immunoreactivity in colorectal cancer
DEFF Research Database (Denmark)
Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen
2009-01-01
monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....
Directory of Open Access Journals (Sweden)
Kyota Fukazawa
2014-01-01
Full Text Available Background. Despite the marked advances in the perioperative management of the liver transplant recipient, an assessment of clinically significant graft injury following preservation and reperfusion remains difficult. In this study, we hypothesized that size-adjusted AST could better approximate real AST values and consequently provide a better reflection of the extent of graft damage, with better sensitivity and specificity than current criteria. Methods. We reviewed data on 930 orthotopic liver transplant recipients. Size-adjusted AST (ASTi was calculated by dividing peak AST by our previously reported index for donor-recipient size mismatch, the BSAi. The predictive value of ASTi of primary nonfunction (PNF and graft survival was assessed by receiver operating characteristic curve, logistic regression, Kaplan-Meier survival, and Cox proportional hazard model. Results. Size-adjusted peak AST (ASTi was significantly associated with subsequent occurrence of PNF and graft failure. In our study cohort, the prediction of PNF by the combination of ASTi and PT-INR had a higher sensitivity and specificity compared to current UNOS criteria. Conclusions. We conclude that size-adjusted AST (ASTi is a simple, reproducible, and sensitive marker of clinically significant graft damage.
Directory of Open Access Journals (Sweden)
Wu Jiang
Full Text Available BACKGROUND: Although numerous prognostic factors have been reported for colorectal cancer liver metastasis (CRLM, few studies have reported intraoperative blood loss (IBL effects on clinical outcome after CRLM resection. METHODS: We retrospectively evaluated the clinical and histopathological characteristics of 139 patients who underwent liver resection for CRLM. The IBL cutoff volume was calculated using receiver operating characteristic curves. Overall survival (OS and recurrence free survival (RFS were assessed using the Kaplan-Meier and Cox regression methods. RESULTS: All patients underwent curative resection. The median follow up period was 25.0 months (range, 2.1-88.8. Body mass index (BMI and CRLM number and tumor size were associated with increased IBL. BMI (P=0.01; 95% CI = 1.3-8.5 and IBL (P500mL were 71%, 33%, and 0%, respectively (P<0.01. RFS of patients within three IBL volumes at the end of the first year were 67%, 38%, and 18%, respectively (P<0.01. CONCLUSIONS: IBL during CRLM resection is an independent predictor of long term survival and tumor recurrence, and its prognostic value was confirmed by a dose-response relationship.
Increasing trends in kidney cancer over the last 2 decades in Saudi Arabia.
Alkhateeb, Sultan S; Alkhateeb, Jawaher M; Alrashidi, Eman A
2015-06-01
To examine the trends of kidney cancer over the last 2 decades in a subset of a Saudi Arabian population. We conducted a retrospective study in a tertiary care center including all adult patients with primary kidney cancer who presented and were managed between 1990 and 2010. The time period was split into 4 quartiles, and variables tested and compared using chi-square, T-test, and Kaplan-Meier curves for survival. The total was 215 patients with a mean age of 57.8 years. There was an increase in the number of kidney cancer cases over the last 2 decades. There was no significant difference in the mode of presentation or stage distribution between quartiles. A significant change was observed in the management towards minimally invasive and nephron-sparing surgeries (p less than 0.001). There was no change in recurrence-free and disease-specific survival over the last 20 years. There have been an increasing number of kidney cancer patients over the last 2 decades with no observed migration towards more incidental and low stage tumors as compared with developed countries.
Directory of Open Access Journals (Sweden)
Ju-Chuan Yen
2015-01-01
Full Text Available We use Taiwanese national health insurance research database (NHIRD to investigate whether thrombolism (carotid artery disease (CAD as a surrogate or embolism (atrial fibrillation (AF as a surrogate plays roles in later retinal artery occlusion (RAO development and examine their relative weights. The relative risks of RAO between AF and CAD patients and controls were compared by estimating the crude hazard ratio with logistic regression. Kaplan-Meier analysis was used to calculate the cumulative incidence rates of developing RAO, and a log-rank test was used to analyze the differences between the survival curves. Separate Cox proportional hazard regressions were done to compute the RAO-free rate after adjusting for possible confounding factors such as age and sex. The crude hazard ratios were 7.98 for the AF group and 5.27 for the CAD group, and the adjusted hazard ratios were 8.32 and 5.34 for the AF and CAD groups, respectively. The observation time with RAO-free was shorter for AF compared with CAD group (1490 versus 1819 days. AF and CAD were both risk factors for RAO with different hazard ratios. To tackle both AF and CAD is crucial for curbing RAO.
The Impact of a Junior Faculty Fellowship Award on Academic Advancement and Retention.
Connelly, Maureen T; Sullivan, Amy M; Chinchilla, Manuel; Dale, Margaret L; Emans, S Jean; Nadelson, Carol Cooperman; Notman, Malkah Tolpin; Tarbell, Nancy J; Zigler, Corwin M; Shore, Eleanor G
2017-08-01
Academic faculty experience barriers to career development and promotion. In 1996, Harvard Medical School (HMS) initiated an intramural junior faculty fellowship to address these obstacles. The authors sought to understand whether receiving a fellowship was associated with more rapid academic promotion and retention. Junior faculty fellowship recipients and all other instructor and assistant professors at HMS between 1996 and 2011 were identified. Using propensity score modeling, the authors created a matched comparison group for the fellowship recipients based on educational background, training, academic rank, department, hospital affiliation, and demographics. Time to promotion and time to leaving were assessed by Kaplan-Meier curves. A total of 622 junior faculty received fellowships. Faculty who received fellowships while instructors (n = 480) had shorter times to promotion to assistant professor (P Women instructors advanced more quickly than matched controls, while male instructors' rates of promotions did not differ. Fellowships to support junior faculty were associated with shorter times to promotion for instructors and more sustained faculty retention for both instructors and assistant professors. This suggests that relatively small amounts of funding early in faculty careers can play a critical role in supporting academic advancement and retention.
Long-term radiographic follow-up of bisphosphonate-associated atypical femur fractures
Energy Technology Data Exchange (ETDEWEB)
Favinger, Jennifer L. [University of Washington, Department of Radiology, 1959 N.E. Pacific Street, Box 357115, Seattle, WA (United States); Hippe, Daniel [University of Washington, Department of Radiology, Seattle, WA (United States); Ha, Alice S. [University of Washington, Department of Radiology, 4245 Roosevelt Way NE, Box 354755, Seattle, WA (United States)
2016-05-15
To evaluate the appearance of bisphosphonate-related femur insufficiency fractures on long-term follow-up radiographic studies and to describe the rate of fracture line obscuration and cortical beak healing over time. In this retrospective study, bisphosphonate-related femur fracture radiographs were reviewed by two radiologists for the presence of a fracture line, callus, and the characteristic cortical beak. Kaplan-Meier curves were used to analyze the time to first indication of healing. Femurs were also subdivided into those who underwent early versus late surgical fixation and those who underwent early versus late discontinuation of bisphosphonate. Clinical data including pain level and medication history were collected. Forty-seven femurs with a bisphosphonate-related femur fracture were identified in 28 women. Eighty-five percent took a bisphosphonate for greater than 5 years and 59 % for greater than 10 years. The median time to beak healing was 265 weeks and the median time to fracture line healing was 56 weeks in the 31 femurs with a baseline fracture. No statistically significant difference was identified between surgical fixation and conservative management. Bisphosphonate-related fractures demonstrate notably prolonged healing time on long-term follow-up. (orig.)
van den Reek, J M P A; Tummers, M; Zweegers, J; Seyger, M M B; van Lümig, P P M; Driessen, R J B; van de Kerkhof, P C M; Kievit, W; de Jong, E M G J
2015-03-01
Drug survival is an indicator for treatment success; insight in predictors associated with drug survival is important. To analyse the long-term drug survival for adalimumab in patients with psoriasis treated in daily practice and (II) to identify predictors of prolonged drug survival for adalimumab split for different reasons of discontinuation. Data were extracted from a prospective psoriasis cohort and analysed using Kaplan-Meier survival curves split for reasons of discontinuation. Baseline predictors associated with longer drug survival were identified using multivariate Cox-regression analysis. One hundred and sixteen patients were included with a total of 208 patient-years. Overall drug survival was 76% after 1 year and 52% after 4.5 years. In patients who stopped due to ineffectiveness, longer drug survival was associated with the absence of specific comorbidities (P = 0.03). In patients who stopped due to side-effects, longer drug survival was associated with male gender (P = 0.02). Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation. Strong, specific predictors can lead to patient-tailored treatment. © 2014 European Academy of Dermatology and Venereology.
The association between gender and pediatric respiratory morbidity.
Ben-Shmuel, Atar; Sheiner, Eyal; Wainstock, Tamar; Landau, Daniella; Vaknin, Flear; Walfisch, Asnat
2018-06-26
To evaluate the association between newborn gender and the risk for later pediatric respiratory morbidity. A population based cohort analysis was performed by comparing the risk of long-term respiratory morbidity (until 18 years of age) according to gender. Respiratory morbidity included hospitalizations involving pneumonia, asthma, bronchitis, bronchiolitis, upper respiratory tract infection (URTI), influenza, and bronchiectasis. Deliveries occurred between the years 1991 and 2014 in a tertiary medical center. Kaplan-Meier survival curves were constructed to compare cumulative respiratory morbidity. A Cox proportional hazards model controlled for confounders. During the study period 240 953 newborns met the inclusion criteria. Among them, 118 113 were females (49.0%) and 122 840 were males (51.0%). During the 18 years of follow-up, 13 719 (5.7%) different newborns were hospitalized with respiratory related morbidity. Males had significantly higher rates of respiratory morbidity as compared with females (6.4% vs 4.9% respectively, P respiratory morbidity (log rank P respiratory morbidity while adjusting for gestational age, birthweight, and other confounders (HR 1.29, 95% CI 1.25-1.34, P respiratory morbidity, independent of obstetrical characteristics such as gestational age and birthweight. © 2018 Wiley Periodicals, Inc.