About an adaptively weighted Kaplan-Meier estimate.
Plante, Jean-François
2009-09-01
The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.
Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A
2015-11-01
Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and
Understanding survival analysis: Kaplan-Meier estimate.
Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal
2010-10-01
Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.
The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method
Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia
2011-01-01
Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the
Gerds, Thomas A.
2016-01-01
Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A
2018-01-01
Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.
The Kaplan-Meier Integral in the Presence of Covariates
DEFF Research Database (Denmark)
Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis
2017-01-01
In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...
van Walraven, Carl; McAlister, Finlay A
2016-01-01
Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.
Modified Weighted Kaplan-Meier Estimator
Directory of Open Access Journals (Sweden)
Mohammad Shafiq
2007-01-01
Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.
J. Szymszal; A. Gierek; J. Kliś
2010-01-01
The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Directory of Open Access Journals (Sweden)
Arnd Gross
Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912
DEFF Research Database (Denmark)
Gerds, Thomas Alexander
2016-01-01
Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...
Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J
2012-02-01
The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Directory of Open Access Journals (Sweden)
Guyot Patricia
2012-02-01
Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
International Nuclear Information System (INIS)
Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.
1996-01-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs
Energy Technology Data Exchange (ETDEWEB)
Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)
1996-12-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.
International Nuclear Information System (INIS)
Mould, Richard F.
1995-01-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method
Energy Technology Data Exchange (ETDEWEB)
Mould, Richard F
1995-07-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.
[Survival analysis with competing risks: estimating failure probability].
Llorca, Javier; Delgado-Rodríguez, Miguel
2004-01-01
To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J
2015-12-10
With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Javier Llorca
2004-10-01
Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Directory of Open Access Journals (Sweden)
Béranger Lueza
2016-03-01
Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect
Kaplan turbine tip vortex cavitation - analysis and prevention
Motycak, L.; Skotak, A.; Kupcik, R.
2012-11-01
The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Directory of Open Access Journals (Sweden)
Jie Zhao
2015-01-01
Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu
2015-01-01
Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...
Kaplan turbine tip vortex cavitation – analysis and prevention
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Kupcik, R
2012-01-01
The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System
Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola
2011-01-01
Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…
Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel
2009-01-01
To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
2017-10-01
of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Applying Kaplan-Meier to Item Response Data
McNeish, Daniel
2018-01-01
Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…
Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine
Directory of Open Access Journals (Sweden)
Doina Frunzaverde
2011-01-01
Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.
Perturbative analysis for Kaplan's lattice chiral fermions
International Nuclear Information System (INIS)
Aoki, S.; Hirose, H.
1994-01-01
Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls
A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines
Pennacchi, P.; Borghesani, P.; Chatterton, S.
2015-08-01
Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.
Survival Analysis of Patients with End Stage Renal Disease
Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.
2015-06-01
This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.
Water hammer 2 phase analysis hydraulic system with a Kaplan turbine
Dudlik, A.; Koutnik, J.
2009-01-01
This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...
Analysis of the Kaplan turbine draft tube effect
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Obrovsky, J
2010-01-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Energy Technology Data Exchange (ETDEWEB)
Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)
2010-08-15
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Motycak, L.; Skotak, A.; Obrovsky, J.
2010-08-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Deciphering the Adaptive Immune Response to Ovarian Cancer
2013-10-01
positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
Competing approaches to analysis of failure times with competing risks.
Farley, T M; Ali, M M; Slaymaker, E
2001-12-15
For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...
Directory of Open Access Journals (Sweden)
Pablo Martínez-Camblor
2009-12-01
sobrestimación tanto de la probabilidad de recidiva como de la mortalidad debida a la enfermedad.Objective: To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. Methods: All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival were also studied. Results: Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Conclusions: Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
Blade profile optimization of kaplan turbine using cfd analysis
International Nuclear Information System (INIS)
Janjua, A.B.; Khalil, M.S.
2013-01-01
Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)
Blade Profile Optimization of Kaplan Turbine Using CFD Analysis
Directory of Open Access Journals (Sweden)
Aijaz Bashir Janjua
2013-10-01
Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
International Nuclear Information System (INIS)
Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H
2012-01-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.
2012-11-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
International Nuclear Information System (INIS)
Badwe, R.A.
1999-01-01
The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
International Nuclear Information System (INIS)
Weili, L; Jinling, L; Xingqi, L; Yuan, L
2010-01-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Energy Technology Data Exchange (ETDEWEB)
Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)
2010-08-15
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.
2010-08-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Genetics Home Reference: Meier-Gorlin syndrome
... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...
Multi-objective shape optimization of runner blade for Kaplan turbine
International Nuclear Information System (INIS)
Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V
2014-01-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads
Multi-objective shape optimization of runner blade for Kaplan turbine
Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.
2014-03-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.
Censoring approach to the detection limits in X-ray fluorescence analysis
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.
2004-01-01
We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples
MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY
Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar
2016-01-01
Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...
DEFF Research Database (Denmark)
Mickley, H; Nielsen, J R; Berning, J
1995-01-01
infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...
Directory of Open Access Journals (Sweden)
Min-jie Mao
2017-01-01
Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.
Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.
Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak
Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
Meier-Gorlin syndrome Clinical genetics and genomics
S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia
Meier-Gorlin syndrome Clinical genetics and genomics
De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Kaplan SpellRead. What Works Clearinghouse Intervention Report
What Works Clearinghouse, 2007
2007-01-01
"Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…
Energy Technology Data Exchange (ETDEWEB)
Sevcik, Petr
2009-07-01
The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.
Rossman, Allan; Kaplan, Danny
2017-01-01
Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…
Numerical investigation of hub clearance flow in a Kaplan turbine
Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.
2012-11-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Numerical investigation of hub clearance flow in a Kaplan turbine
International Nuclear Information System (INIS)
Wu, H; Feng, J J; Wu, G K; Luo, X Q
2012-01-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Survival analysis II: Cox regression
Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.
2011-01-01
In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the
Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P
2018-01-01
The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.
Meier-Gorlin syndrome Clinical genetics and genomics
Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...
Directory of Open Access Journals (Sweden)
Vasile Cojocaru
2011-09-01
Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.
Computer Aided Design of Kaplan Turbine Piston with SolidWorks
Camelia Jianu
2010-01-01
The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
DEFF Research Database (Denmark)
Sidenius, N; Sier, C.F.M.; Ullum, H
2000-01-01
levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...
Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.
Pion, J; Lenoir, M; Vandorpe, B; Segers, V
2015-11-01
This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.
Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón
2016-01-01
The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...
Markov chains and semi-Markov models in time-to-event analysis.
Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J
2013-10-25
A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.
2017-08-01
28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival
International Nuclear Information System (INIS)
Bergant, A; Gregorc, B; Gale, J
2012-01-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Bergant, A.; Gregorc, B.; Gale, J.
2012-11-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing
2017-04-01
Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.
DEFF Research Database (Denmark)
Wells, J Connor; Stukalin, Igor; Norton, Craig
2017-01-01
and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...
International Nuclear Information System (INIS)
Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan
2009-01-01
This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)
Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
DEFF Research Database (Denmark)
Heeran, Mel C; Rask, Lene; Høgdall, Claus K
2015-01-01
of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...
Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids
Gustafsson, Martin
2013-01-01
To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...
Survival analysis in hematologic malignancies: recommendations for clinicians
Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril
2014-01-01
The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982
Kaplan og Norton bør læses af hele ledelsen
DEFF Research Database (Denmark)
Bukh, Per Nikolaj
2009-01-01
Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Javadi, Ardalan; Nilsson, Håkan
2014-01-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
Javadi, Ardalan; Nilsson, Håkan
2014-03-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.
Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam
2011-03-28
The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test
International Nuclear Information System (INIS)
Aoki, S.; Levien, R.B.
1995-01-01
We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories
International Nuclear Information System (INIS)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.
2017-01-01
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
Case Report: Meier-Gorlin syndrome: Report of an additional patient ...
African Journals Online (AJOL)
We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.
Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin
Fjærvold, Lars
2012-01-01
The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...
Energy Technology Data Exchange (ETDEWEB)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)
2017-03-15
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
Directory of Open Access Journals (Sweden)
Bender Ralf
2011-09-01
Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.
Bowden, T J; Bricknell, I R; Preziosi, B M
2018-01-01
Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.
Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky
2017-01-01
The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n = 304) and 11-25 ( n = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.
International Nuclear Information System (INIS)
Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.
2016-01-01
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Energy Technology Data Exchange (ETDEWEB)
Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)
2016-07-15
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-01-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...
Directory of Open Access Journals (Sweden)
P. Wang
2007-07-01
Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-09-17
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.
STAT3 inhibitor enhances chemotherapy drug efficacy by ...
African Journals Online (AJOL)
Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.
[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].
Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing
2016-02-01
To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.
Prita Meier, Swahili Port Cities: The Architecture of Elsewhere
Longair, Sarah
2018-01-01
Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...
Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post
Nikiforov, Raivo
2005-01-01
Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...
Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V
2016-01-01
To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.
DEFF Research Database (Denmark)
Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul
2016-01-01
OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...
Sammour, Tarik; Malakorn, Songphol; Bednarski, Brian K; Kaur, Harmeet; Shin, Ui Sup; Messick, Craig; You, Yi-Qian Nancy; Chang, George J
2018-03-01
The aim of this study is to evaluate the oncological outcomes of robotic total mesorectal excision (TME) at an NCI designated cancer center. The effectiveness of laparoscopic TME could not be established, but the robotic-assisted approach may hold some promise, with improved visualization and ergonomics for pelvic dissection. Oncological outcome data is presently lacking. Patients who underwent total mesorectal excision or tumor-specific mesorectal excision for rectal cancer between April 2009 and April 2016 via a robotic approach were identified from a prospective single-institution database. The circumferential resection margin (CRM), distal resection margin, and TME completeness rates were determined. Kaplan-Meier analysis of disease-free survival and overall survival was performed for all patients treated with curative intent. A total of 276 patients underwent robotic proctectomy during the study period. Robotic surgery was performed initially by 1 surgeon with 3 additional surgeons progressively transitioning from open to robotic during the study period with annual increase in the total number of cases performed robotically. Seven patients had involved circumferential resection margins (2.5%), and there were no positive distal or proximal resection margins. One hundred eighty-six patients had TME quality assessed, and only 1 patient (0.5%) had an incomplete TME. Eighty-three patients were followed up for a minimum of 3 years, with a local recurrence rate of 2.4%, and a distant recurrence rate of 16.9%. Five-year disease-free survival on Kaplan-Meier analysis was 82%, and 5-year overall survival was 87%. Robotic proctectomy for rectal cancer can be performed with good short and medium term oncological outcomes in selected patients.
Survival analysis of heart failure patients: A case study.
Ahmad, Tanvir; Munir, Assia; Bhatti, Sajjad Haider; Aftab, Muhammad; Raza, Muhammad Ali
2017-01-01
This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015). All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.
Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines
Energy Technology Data Exchange (ETDEWEB)
Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)
2015-10-01
Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.
Epilepsy in Rett syndrome--lessons from the Rett networked database
DEFF Research Database (Denmark)
Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori
2015-01-01
collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...
Survival of Root-filled Teeth in the Swedish Adult Population
DEFF Research Database (Denmark)
Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik
2016-01-01
INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...
Directory of Open Access Journals (Sweden)
Dong-dong Cheng
2015-07-01
Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.
Energy Technology Data Exchange (ETDEWEB)
Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)
2012-10-15
Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
International Nuclear Information System (INIS)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao
2017-01-01
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
A 10-year cohort analysis of routine paediatric ART data in a rural South African setting.
Lilian, R R; Mutasa, B; Railton, J; Mongwe, W; McINTYRE, J A; Struthers, H E; Peters, R P H
2017-01-01
South Africa's paediatric antiretroviral therapy (ART) programme is managed using a monitoring and evaluation tool known as TIER.Net. This electronic system has several advantages over paper-based systems, allowing profiling of the paediatric ART programme over time. We analysed anonymized TIER.Net data for HIV-infected children aged ART in a rural district of South Africa between 2005 and 2014. We performed Kaplan-Meier survival analysis to assess outcomes over time. Records of 5461 children were available for analysis; 3593 (66%) children were retained in care. Losses from the programme were higher in children initiated on treatment in more recent years (P ART programme and highlights interventions to improve programme performance.
Verification of Kaplan turbine cam curves realization accuracy at power plant
Directory of Open Access Journals (Sweden)
Džepčeski Dane
2016-01-01
Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.
Ackerman, Ari
2008-01-01
This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…
Energy Technology Data Exchange (ETDEWEB)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik
2002-08-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent
ASURV: Astronomical SURVival Statistics
Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.
2014-06-01
ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.
Influence of antiviral therapy on survival of patients with hepatitis B ...
African Journals Online (AJOL)
The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...
De 'wraak van de geografie' volgens Robert D. Kaplan
Mamadouh, V.
2013-01-01
De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor
Unsteady load on an oscillating Kaplan turbine runner
Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.
2013-02-01
A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.
CASAS: Cancer Survival Analysis Suite, a web based application.
Rupji, Manali; Zhang, Xinyan; Kowalski, Jeanne
2017-01-01
We present CASAS, a shiny R based tool for interactive survival analysis and visualization of results. The tool provides a web-based one stop shop to perform the following types of survival analysis: quantile, landmark and competing risks, in addition to standard survival analysis. The interface makes it easy to perform such survival analyses and obtain results using the interactive Kaplan-Meier and cumulative incidence plots. Univariate analysis can be performed on one or several user specified variable(s) simultaneously, the results of which are displayed in a single table that includes log rank p-values and hazard ratios along with their significance. For several quantile survival analyses from multiple cancer types, a single summary grid is constructed. The CASAS package has been implemented in R and is available via http://shinygispa.winship.emory.edu/CASAS/. The developmental repository is available at https://github.com/manalirupji/CASAS/.
Age at sexual initiation and factors associated with it among youths ...
African Journals Online (AJOL)
Bernt Lindtjorn
Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.
Numerical investigation of tip clearance cavitation in Kaplan runners
Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.
2016-11-01
There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.
Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng
2017-05-23
BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.
Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines
Directory of Open Access Journals (Sweden)
Ana-Maria Budai
2010-10-01
Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.
Metagenes Associated with Survival in Non-Small Cell Lung Cancer
Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres
2011-01-01
NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068
Censoring: a new approach for detection limits in total-reflection X-ray fluorescence
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.
2004-01-01
It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for
Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis
DEFF Research Database (Denmark)
Egeberg, Alexander; Skov, Lone; Zachariae, Claus
2018-01-01
It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....
Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal
2018-06-01
Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.
Floyd, Randy G.; Bergeron, Renee; Hamilton, Gloria; Parra, Gilbert R.
2010-01-01
This study investigated the relations among executive functions and cognitive abilities through a joint exploratory factor analysis and joint confirmatory factor analysis of 25 test scores from the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities. Participants were 100 children and adolescents…
The development of a new algorithm to calculate a survival function in non-parametric ways
International Nuclear Information System (INIS)
Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo
2001-01-01
In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory
International Nuclear Information System (INIS)
Ko, P; Kurosawa, S
2014-01-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine
Ko, P.; Kurosawa, S.
2014-03-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.
International Nuclear Information System (INIS)
Smith, Graham D.; Pickles, Tom; Crook, Juanita; Martin, Andre-Guy; Vigneault, Eric; Cury, Fabio L.; Morris, Jim; Catton, Charles; Lukka, Himu; Warner, Andrew; Yang, Ying; Rodrigues, George
2015-01-01
Purpose: To compare, in a retrospective study, biochemical failure-free survival (bFFS) and overall survival (OS) in low-risk and intermediate-risk prostate cancer patients who received brachytherapy (BT) (either low-dose-rate brachytherapy [LDR-BT] or high-dose-rate brachytherapy with external beam radiation therapy [HDR-BT+EBRT]) versus external beam radiation therapy (EBRT) alone. Methods and Materials: Patient data were obtained from the ProCaRS database, which contains 7974 prostate cancer patients treated with primary radiation therapy at four Canadian cancer institutions from 1994 to 2010. Propensity score matching was used to obtain the following 3 matched cohorts with balanced baseline prognostic factors: (1) low-risk LDR-BT versus EBRT; (2) intermediate-risk LDR-BT versus EBRT; and (3) intermediate-risk HDR-BT+EBRT versus EBRT. Kaplan-Meier survival analysis was performed to compare differences in bFFS (primary endpoint) and OS in the 3 matched groups. Results: Propensity score matching created acceptable balance in the baseline prognostic factors in all matches. Final matches included 2 1:1 matches in the intermediate-risk cohorts, LDR-BT versus EBRT (total n=254) and HDR-BT+EBRT versus EBRT (total n=388), and one 4:1 match in the low-risk cohort (LDR-BT:EBRT, total n=400). Median follow-up ranged from 2.7 to 7.3 years for the 3 matched cohorts. Kaplan-Meier survival analysis showed that all BT treatment options were associated with statistically significant improvements in bFFS when compared with EBRT in all cohorts (intermediate-risk EBRT vs LDR-BT hazard ratio [HR] 4.58, P=.001; intermediate-risk EBRT vs HDR-BT+EBRT HR 2.08, P=.007; low-risk EBRT vs LDR-BT HR 2.90, P=.004). No significant difference in OS was found in all comparisons (intermediate-risk EBRT vs LDR-BT HR 1.27, P=.687; intermediate-risk EBRT vs HDR-BT+EBRT HR 1.55, P=.470; low-risk LDR-BT vs EBRT HR 1.41, P=.500). Conclusions: Propensity score matched analysis showed that BT options led
International Nuclear Information System (INIS)
Liu, X; Luo, Y Y; Wang, Z W
2014-01-01
As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption
Liu, X.; Y Luo, Y.; Wang, Z. W.
2014-03-01
As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption.
Comparison of colorectal and gastric cancer: Survival and prognostic factors
International Nuclear Information System (INIS)
Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R
2009-01-01
Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)
Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming
2015-12-01
Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
Energy Technology Data Exchange (ETDEWEB)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)
2017-03-15
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Schlampp, Ingmar; Rieken, Stefan; Habermehl, Daniel; Foerster, Robert; Debus, Juergen; Rief, Harald [University Hospital of Heidelberg, Department of Radiation Oncology, Heidelberg (Germany); Bruckner, Thomas [University Hospital of Heidelberg, Department of Medical Biometry, Heidelberg (Germany)
2014-09-15
This retrospective analysis was performed to evaluate osteolytic bone lesions of breast cancer in the thoracic and lumbar spine after radiotherapy (RT) in terms of stability using a validated scoring system. The stability of 157 osteolytic metastases, treated from January 2000 to January 2012, in 115 patients with breast cancer was evaluated retrospectively using the Taneichi score. Predictive factors for stability were analyzed and survival rates were calculated. Eighty-five (54 %) lesions were classified as unstable prior to RT. After 3 and 6 months, 109 (70 %) and 124 (79 %) lesions, respectively, were classified as stable. Thirty fractures were detected prior to RT, and after RT seven cases (4.5 %) with pathologic fractures were found within 6 months. None of the examined predictive factors showed significant correlation with stability 6 months after RT. After a median follow-up of 16.7 months, Kaplan-Meier estimates revealed an overall survival of 83 % after 5 years. The majority of patients showed an improved or unchanged stability of the involved vertebral bodies after 6 months. The patients showed only minor cancer-related morbidity during follow-up and reached comparably high survival rates. (orig.) [German] Die retrospektive Analyse untersuchte osteolytische Knochenmetastasen von Patienten mit Mammakarzinom der thorakalen und lumbalen Wirbelsaeule nach Radiotherapie (RT) hinsichtlich Stabilitaet anhand eines validierten Scores. Die Stabilitaet von 157 osteolytischen Metastasen bei 115 Patienten mit Brustkrebs, behandelt von Januar 2000 bis Januar 2012, wurde retrospektiv anhand des Taneichi-Scores evaluiert. Prognostische Faktoren bezueglich Stabilitaet und Ueberlebensraten wurden analysiert. Vor RT wurden 85 Laesionen (54 %) als instabil gewertet. Nach 3 und 6 Monaten wurden 109 (70 %) und 124 (79 %) Laesionen als stabil klassifiziert. Vor RT wurden 30 Frakturen gefunden, nach RT zeigten sich 7 weitere (4,5 %) pathologische Frakturen. Kein prognostischer
Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.
Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.
Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E
2018-02-02
In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.
Survival analysis of heart failure patients: A case study.
Directory of Open Access Journals (Sweden)
Tanvir Ahmad
Full Text Available This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015. All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.
Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F
2018-05-01
The individual kinematic roles of the anterolateral ligament (ALL) and the distal iliotibial band Kaplan fibers in the setting of anterior cruciate ligament (ACL) deficiency require further clarification. This will improve understanding of their potential contribution to residual anterolateral rotational laxity after ACL reconstruction and may influence selection of an anterolateral extra-articular reconstruction technique, which is currently a matter of debate. Hypothesis/Purpose: To compare the role of the ALL and the Kaplan fibers in stabilizing the knee against tibial internal rotation, anterior tibial translation, and the pivot shift in ACL-deficient knees. We hypothesized that the Kaplan fibers would provide greater tibial internal rotation restraint than the ALL in ACL-deficient knees and that both structures would provide restraint against internal rotation during a simulated pivot-shift test. Controlled laboratory study. Ten paired fresh-frozen cadaveric knees (n = 20) were used to investigate the effect of sectioning the ALL and the Kaplan fibers in ACL-deficient knees with a 6 degrees of freedom robotic testing system. After ACL sectioning, sectioning was randomly performed for the ALL and the Kaplan fibers. An established robotic testing protocol was utilized to assess knee kinematics when the specimens were subjected to a 5-N·m internal rotation torque (0°-90° at 15° increments), a simulated pivot shift with 10-N·m valgus and 5-N·m internal rotation torque (15° and 30°), and an 88-N anterior tibial load (30° and 90°). Sectioning of the ACL led to significantly increased tibial internal rotation (from 0° to 90°) and anterior tibial translation (30° and 90°) as compared with the intact state. Significantly increased internal rotation occurred with further sectioning of the ALL (15°-90°) and Kaplan fibers (15°, 60°-90°). At higher flexion angles (60°-90°), sectioning the Kaplan fibers led to significantly greater internal rotation
Risk analysis for autonomous underwater vehicle operations in extreme environments.
Brito, Mario Paulo; Griffiths, Gwyn; Challenor, Peter
2010-12-01
Autonomous underwater vehicles (AUVs) are used increasingly to explore hazardous marine environments. Risk assessment for such complex systems is based on subjective judgment and expert knowledge as much as on hard statistics. Here, we describe the use of a risk management process tailored to AUV operations, the implementation of which requires the elicitation of expert judgment. We conducted a formal judgment elicitation process where eight world experts in AUV design and operation were asked to assign a probability of AUV loss given the emergence of each fault or incident from the vehicle's life history of 63 faults and incidents. After discussing methods of aggregation and analysis, we show how the aggregated risk estimates obtained from the expert judgments were used to create a risk model. To estimate AUV survival with mission distance, we adopted a statistical survival function based on the nonparametric Kaplan-Meier estimator. We present theoretical formulations for the estimator, its variance, and confidence limits. We also present a numerical example where the approach is applied to estimate the probability that the Autosub3 AUV would survive a set of missions under Pine Island Glacier, Antarctica in January-March 2009. © 2010 Society for Risk Analysis.
Can a polynomial interpolation improve on the Kaplan-Yorke dimension?
International Nuclear Information System (INIS)
Richter, Hendrik
2008-01-01
The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems
Arshi, Armin; Sharim, Justin; Park, Don Y; Park, Howard Y; Bernthal, Nicholas M; Yazdanshenas, Hamed; Shamie, Arya N
2017-05-01
Retrospective analysis. To determine the epidemiology and prognostic indicators in patients with chondrosarcoma of the osseous spine. Chondrosarcoma of the spine is rare, with limited data on its epidemiology, clinicopathologic features, and treatment outcomes. Therapy centers on complete en bloc resection with radiotherapy reserved for subtotal resection or advanced disease. The Surveillance, Epidemiology, and End Results Registry was queried for patients with chondrosarcoma of the osseous spine from 1973 to 2012. Study variables included age, sex, race, year of diagnosis, size, grade, extent of disease, and treatment modality. The search identified 973 cases of spinal chondrosarcoma. Mean age at diagnosis was 51.6 years, and 627% of patients were males. Surgical resection and radiotherapy were performed in 75.2% and 21.3% of cases, respectively. Kaplan-Meier analysis demonstrated overall survival (OS) and disease-specific survival (DSS) of 53% and 64%, respectively, at 5 years. Multivariate Cox regression analysis showed that age (OS, P chondrosarcoma of the spine independent of extent of disease. Radiotherapy improves survival in patients with metastatic disease and worsens outcomes in patients with confined and locally invasive disease. 4.
Adding gauge fields to Kaplan's fermions
International Nuclear Information System (INIS)
Blum, T.; Kaerkkaeinen, L.
1994-01-01
We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)
Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao
2017-08-01
The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.
de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.
2012-01-01
MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex
de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.
2012-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This
Zhou, Huaqiang; Zhang, Yuanzhe; Song, Yiyan; Tan, Wulin; Qiu, Zeting; Li, Si; Chen, Qinchang; Gao, Shaowei
2017-09-01
Marital status's prognostic impact on pancreatic neuroendocrine tumors (PNET) has not been rigorously studied. We aimed to explore the relationship between marital status and outcomes of PNET. We retrospectively investigated 2060 PNET cases between 2004 and 2010 from Surveillance, Epidemiology, and End Results (SEER) database. Variables were compared by Chi 2 test, t-test as appropriate. Kaplan-Meier methods and COX proportional hazard models were used to ascertain independent prognostic factors. Married patients had better 5-year overall survival (OS) (53.37% vs. 42.27%, Pvs. 59.82%, P=0.001) comparing with unmarried patients. Multivariate analysis revealed marital status is an independent prognostic factor, with married patients showing better OS (HR=0.74; 95% CI: 0.65-0.84; Punmarried patients may be associated with a delayed diagnosis with advanced tumor stage, psychosocial and socioeconomic factors. Further studies are needed. Copyright © 2017. Published by Elsevier Masson SAS.
Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A
2018-06-01
Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
A. V. Rusanov
2016-12-01
Full Text Available The results of numerical investigation of spatial flow of viscous incompressible fluid in flow part of Kaplan turbine PL20 Kremenchug HPP at optimum setting angle of runner blade φb = 15° and at maximum setting angle φb = 35° are shown. The flow simulation has been carried out on basis of numerical integration of the Reynolds equations with an additional term containing artificial compressibility. The differential two-parameter model of Menter (SST has been applied to take into account turbulent effects. Numerical integration of the equations is carried out using an implicit quasi-monotone Godunov type scheme of second - order accuracy in space and time. The calculations have been conducted with the help of the software system IPMFlow. The analysis of fluid flow in the flow part elements is shown and the values of hydraulic losses and local cavitation coefficient have been obtained. Comparison of calculated and experimental results has been carried out.
XRF and XANES Data for Kaplan U Paper
The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).
Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents
International Nuclear Information System (INIS)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.
2002-01-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de
DEFF Research Database (Denmark)
Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels
2009-01-01
bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...
Energy Technology Data Exchange (ETDEWEB)
Ukonsaari; Jan
2012-08-15
This study concerns environmentally adapted Kaplan runners, which have no oil for lubricating the blade regulation mechanisms and bearings. The runners are water or air filled with self lubricated bearings. Recent design also includes regulation system pressure increase and servo motor placement below runner centre and environmentally adapted synthetic ester as hydraulic fluid. These together with power output increase and efficiency optimization are suspected sources of poor runner function. Of 37 runners 43 % have had some kind of problem and 30 % bearing or mechanism related ones. When the axial blade bearing problems are excluded the problems occurred at 16 %. Deeper look into the design of newer runners shows that only bronze based runner hubs is significantly more problem dense regarding regulation mechanisms (50 %). Hidden figures of increased runner regulation forces are suspected. All problems cannot be explained and the young machines limit the experiences. The working group's opinion and bring ups of historical and present examples during the work show evidence that the old oil filled runners function is far from perfect, nor the life length. The future is not with oil filled runner hubs. Main parts of the discovered problems have been solved and can be resolved by thorough design analysis. One future concern is what effects the recent design changes will cause due to increase demand for power output changes including the number of starts and stops. That is why the working group's recommendation is to put joint effort into material fatigue and in which a first step is to identify the real forces the runners are exposed to.
Chang, Wei-Chin; Lin, Chun-Shu; Yang, Cheng-Yu; Lin, Chih-Kung; Chen, Yuan-Wu
2018-04-01
Lymph node metastasis in oral squamous cell carcinoma (OSCC) is a poor prognostic factor. The histopathologic stage (e.g., pN) is used to evaluate the severity of lymph node metastasis; however, the current staging system insufficiently predicts survival and recurrence. We investigated clinical outcomes and lymph node density (LND) in betel nut-chewing individuals. We retrospectively analyzed 389 betel nut-exposed patients with primary OSCC who underwent surgical resection in 2002-2015. The prognostic significance of LND was evaluated by overall survival (OS) and disease-free survival (DFS) using the Kaplan-Meier method. Kaplan-Meier analyses showed that the 5-year OS and DFS rates in all patients were 60.9 and 48.9%, respectively. Multivariate analysis showed that variables independently prognostic for OS were aged population (hazard ratio [HR] = 1.6, 95% confidence interval [95% CI] = 1.1-2.5; P = .025), and cell differentiation classification (HR = 2.4, 95% CI = 1.4-4.2; P = .002). In pathologic N-positive patients, a receiver operating characteristic (ROC) curve for OS was used and indicated the best cutoff of 0.05, and the multivariate analysis showed that LND was an independent predictor of OS (HR = 2.2, 95% CI = 1.3-3.7; P = .004). Lymph node density, at a cutoff of 0.05, was an independent predictor of OS and DFS. OS and DFS underwent multiple analyses, and LND remained significant. The pathologic N stage had no influence in the OS analysis. LND is a more reliable predictor of survival in betel nut-chewing patients for further post operation adjuvant treatment, such as reoperation or adjuvant radiotherapy.
International Nuclear Information System (INIS)
Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li
2011-01-01
Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)
Grindedal, Eli Marie; Aarset, Harald; Bjørnevoll, Inga; Røyset, Elin; Mæhle, Lovise; Stormorken, Astrid; Heramb, Cecilie; Medvik, Heidi; Møller, Pål; Sjursen, Wenche
2014-01-01
Using immunohistochemistry (IHC) to select cases for mismatch repair (MMR) genetic testing, we failed to identify a large kindred with the deleterious PMS2 mutation c.989-1G > T. The purpose of the study was to examine the sensitivity of IHC and microsatellite instability-analysis (MSI) to identify carriers of the mutation, and to estimate its penetrance and expressions. All carriers and obligate carriers of the mutation were identified. All cancer diagnoses were confirmed. IHC and MSI-analysis were performed on available tumours. Penetrances of cancers included in the Amsterdam and the Bethesda Criteria, for MSI-high tumours and MSI-high and low tumours were calculated by the Kaplan-Meier algorithm. Probability for co-segregation of the mutation and cancers by chance was 0.000004. Fifty-six carriers or obligate carriers were identified. There was normal staining for PMS2 in 15/18 (83.3%) of tumours included in the AMS1/AMS2/Bethesda criteria. MSI-analysis showed that 15/21 (71.4%) of tumours were MSI-high and 4/21 (19.0%) were MSI-low. Penetrance at 70 years was 30.6% for AMS1 cancers (colorectal cancers), 42.8% for AMS2 cancers, 47.2% for Bethesda cancers, 55.6% for MSI-high and MSI-low cancers and 52.2% for MSI-high cancers. The mutation met class 5 criteria for pathogenicity. IHC was insensitive in detecting tumours caused by the mutation. Penetrance of cancers that displayed MSI was 56% at 70 years. Besides colorectal cancers, the most frequent expressions were carcinoma of the endometrium and breast in females and stomach and prostate in males.
Molecular genetics analysis of hereditary breast and ovarian cancer patients in India
Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan
2009-01-01
Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...
High serum uric acid concentration predicts poor survival in patients with breast cancer.
Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min
2017-10-01
Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa
2016-03-01
Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
International Nuclear Information System (INIS)
Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F
2012-01-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.
2012-11-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.
1998-01-01
We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766
Coupled skinny baker's maps and the Kaplan-Yorke conjecture
Gröger, Maik; Hunt, Brian R.
2013-09-01
The Kaplan-Yorke conjecture states that for ‘typical’ dynamical systems with a physical measure, the information dimension and the Lyapunov dimension coincide. We explore this conjecture in a neighborhood of a system for which the two dimensions do not coincide because the system consists of two uncoupled subsystems. We are interested in whether coupling ‘typically’ restores the equality of the dimensions. The particular subsystems we consider are skinny baker's maps, and we consider uni-directional coupling. For coupling in one of the possible directions, we prove that the dimensions coincide for a prevalent set of coupling functions, but for coupling in the other direction we show that the dimensions remain unequal for all coupling functions. We conjecture that the dimensions prevalently coincide for bi-directional coupling. On the other hand, we conjecture that the phenomenon we observe for a particular class of systems with uni-directional coupling, where the information and Lyapunov dimensions differ robustly, occurs more generally for many classes of uni-directionally coupled systems (also called skew-product systems) in higher dimensions.
Large mass limit of the continuum theories in Kaplan's formulation
International Nuclear Information System (INIS)
Kawano, T.; Kikukawa, Y.
1994-01-01
Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense
DEFF Research Database (Denmark)
Cannon, Christopher P; Husted, Steen; Harrington, Robert A
2007-01-01
, or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...
Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease
Directory of Open Access Journals (Sweden)
Rabah M. Shawky
2014-10-01
Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.
Air injection test on a Kaplan turbine: prototype - model comparison
Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.
2016-11-01
Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.
Energy Technology Data Exchange (ETDEWEB)
Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)
2008-07-01
In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)
Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele
2017-07-01
Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.
Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping
2017-10-01
Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.
Vogl, Vanessa; Hiller, Karl-Anton; Buchalla, Wolfgang; Federlin, Marianne; Schmalz, Gottfried
2016-12-01
A new universal adhesive with corresponding luting composite was recently marketed which can be used both, in a self-etch or in an etch-and-rinse mode. In this study, the clinical performance of partial ceramic crowns (PCCs) inserted with this adhesive and the corresponding luting material used in a self-etch or selective etch approach was compared with a self-adhesive universal luting material. Three PCCs were placed in a split-mouth design in 50 patients. Two PCCs were luted with a combination of a universal adhesive/resin cement (Scotchbond Universal/RelyX Ultimate, 3M ESPE) with (SB+E)/without (SB-E) selective enamel etching. Another PCC was luted with a self-adhesive resin cement (RelyX Unicem 2, 3M ESPE). Forty-eight patients were evaluated clinically according to FDI criteria at baseline and 6, 12 and 18 months. For statistical analyses, the chi-square test (α = 0.05) and Kaplan-Meier analysis were applied. Clinically, no statistically significant differences between groups were detected over time. Within groups, clinically significant increase for criterion "marginal staining" was detected for SB-E over 18 months. Kaplan-Meier analysis revealed significantly higher retention rates for SB+E (97.8 %) and SB-E (95.6 %) in comparison to RXU2 (75.6 %). The 18-month clinical performance of a new universal adhesive/composite combination showed no differences with respect to bonding strategy and may be recommended for luting PCCs. Longer-term evaluation is needed to confirm superiority of SB+E over SB-E. At 18 months, the new multi-mode adhesive, Scotchbond Universal, showed clinically reliable results when used for luting PCCs.
Directory of Open Access Journals (Sweden)
Muge Akmansu
2010-12-01
Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.
Primary Squamous Cell Carcinoma of the Thyroid: A Population-Based Analysis.
Au, Joshua K; Alonso, Jose; Kuan, Edward C; Arshi, Armin; St John, Maie A
2017-07-01
Objectives To analyze the epidemiology and describe the prognostic indicators of patients with primary squamous cell carcinoma of the thyroid. Study Design and Setting Retrospective cohort study based on a national database. Methods The US National Cancer Institute's SEER registry (Surveillance, Epidemiology, and End Results) was reviewed for patients with primary squamous cell carcinoma of the thyroid from 1973 to 2012. Study variables included age, sex, race, tumor size, tumor grade, regional and distant metastases, and treatment modality. Survival measures included overall survival (OS) and disease-specific survival (DSS). Results A total of 199 cases of primary squamous cell carcinoma of the thyroid were identified. Mean age at diagnosis was 68.1 years; 58.3% were female; and 79.4% were white. Following diagnosis, 46.3% of patients underwent surgery; 55.7%, radiation therapy; and 45.8%, surgery with radiation therapy. Kaplan-Meier analysis demonstrated OS and DSS of 16% and 21% at 5 years, respectively. Median survival after diagnosis was 9.1 months. Multivariate Cox regression analysis showed that predictors of OS and DSS included age ( P Squamous cell carcinoma of the thyroid is a rare malignancy with a very poor prognosis. Surgical resection confers an overall survival benefit. Age, tumor grade, and tumor size are predictors of OS and DSS.
International Nuclear Information System (INIS)
Tai, Bee-Choo; Grundy, Richard G.; Machin, David
2010-01-01
Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Prognostic and survival analysis of 837 Chinese colorectal cancer patients.
Yuan, Ying; Li, Mo-Dan; Hu, Han-Guang; Dong, Cai-Xia; Chen, Jia-Qi; Li, Xiao-Fen; Li, Jing-Jing; Shen, Hong
2013-05-07
To develop a prognostic model to predict survival of patients with colorectal cancer (CRC). Survival data of 837 CRC patients undergoing surgery between 1996 and 2006 were collected and analyzed by univariate analysis and Cox proportional hazard regression model to reveal the prognostic factors for CRC. All data were recorded using a standard data form and analyzed using SPSS version 18.0 (SPSS, Chicago, IL, United States). Survival curves were calculated by the Kaplan-Meier method. The log rank test was used to assess differences in survival. Univariate hazard ratios and significant and independent predictors of disease-specific survival and were identified by Cox proportional hazard analysis. The stepwise procedure was set to a threshold of 0.05. Statistical significance was defined as P analysis suggested age, preoperative obstruction, serum carcinoembryonic antigen level at diagnosis, status of resection, tumor size, histological grade, pathological type, lymphovascular invasion, invasion of adjacent organs, and tumor node metastasis (TNM) staging were positive prognostic factors (P analysis showed a significant statistical difference in 3-year survival among these groups: LNR1, 73%; LNR2, 55%; and LNR3, 42% (P analysis results showed that histological grade, depth of bowel wall invasion, and number of metastatic lymph nodes were the most important prognostic factors for CRC if we did not consider the interaction of the TNM staging system (P < 0.05). When the TNM staging was taken into account, histological grade lost its statistical significance, while the specific TNM staging system showed a statistically significant difference (P < 0.0001). The overall survival of CRC patients has improved between 1996 and 2006. LNR is a powerful factor for estimating the survival of stage III CRC patients.
Rivetti, A.; Angulo, M.; Lucino, C.; Hene, M.; Capezio, O.; Liscia, S.
2016-11-01
Blade tip cavitation is a well-known phenomenon that affects the performance of large-diameter Kaplan turbines and induces structural vibration. Injection of pressurized air has been found to yield promising results in reducing those damaging effects. In this work, the results of an experimental test of air injection on a 9.5-m-diameter Kaplan turbine are reported. Experiments were performed for several load conditions and for two different net heads. Accelerations, pressure pulsation and noise emission were monitored for every tested condition. Results show that, at the expense of a maximum efficiency drop of 0.2%, air injection induces a decrease on the level of vibration from 57% up to 84%, depending on the load condition. Such decrease is seen to be proportional to the air flow rate, in the range from 0.06 to 0.8‰ (respect to the discharge at the best efficiency point).
Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat
2013-01-01
There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer
Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D
2011-12-01
To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.
SAMSN1 is highly expressed and associated with a poor survival in glioblastoma multiforme.
Directory of Open Access Journals (Sweden)
Yong Yan
Full Text Available OBJECTIVES: To study the expression pattern and prognostic significance of SAMSN1 in glioma. METHODS: Affymetrix and Arrystar gene microarray data in the setting of glioma was analyzed to preliminarily study the expression pattern of SAMSN1 in glioma tissues, and Hieratical clustering of gene microarray data was performed to filter out genes that have prognostic value in malignant glioma. Survival analysis by Kaplan-Meier estimates stratified by SAMSN1 expression was then made based on the data of more than 500 GBM cases provided by The Cancer Genome Atlas (TCGA project. At last, we detected the expression of SAMSN1 in large numbers of glioma and normal brain tissue samples using Tissue Microarray (TMA. Survival analysis by Kaplan-Meier estimates in each grade of glioma was stratified by SAMSN1 expression. Multivariate survival analysis was made by Cox proportional hazards regression models in corresponding groups of glioma. RESULTS: With the expression data of SAMSN1 and 68 other genes, high-grade glioma could be classified into two groups with clearly different prognoses. Gene and large sample tissue microarrays showed high expression of SAMSN1 in glioma particularly in GBM. Survival analysis based on the TCGA GBM data matrix and TMA multi-grade glioma dataset found that SAMSN1 expression was closely related to the prognosis of GBM, either PFS or OS (P<0.05. Multivariate survival analysis with Cox proportional hazards regression models confirmed that high expression of SAMSN1 was a strong risk factor for PFS and OS of GBM patients. CONCLUSION: SAMSN1 is over-expressed in glioma as compared with that found in normal brains, especially in GBM. High expression of SAMSN1 is a significant risk factor for the progression free and overall survival of GBM.
Directory of Open Access Journals (Sweden)
Asaho Nishizawa
Full Text Available To evaluate the influence of phacoemulsification after trabeculectomy on the postoperative intraocular pressure (IOP in eyes with uveitic glaucoma (UG.Kumamoto University Hospital, Kumamoto, Japan.A retrospective cohort study.The medical records of patients with UG who had trabeculectomy with mitomycin-C (MMC were reviewed. Complete and qualified surgical failures were defined by an IOP of ≥21 mmHg (condition A, ≥18 mmHg (condition B, or ≥15 mmHg (condition C without and with glaucoma eye drops, respectively. Kaplan-Meier survival analysis, generalized by the Wilcoxon test, and the Cox proportional hazards model analysis were conducted. Post-trabeculectomy phacoemulsification was treated as a time-dependent variable. In 24 (30% of the included 80 eyes, phacoemulsification was included, and they were divided into two groups: groups I (8 eyes with phacoemulsification within 1 year after trabeculectomy and group II (16 eyes after 1 year following trabeculectomy.Multivariable Cox proportional hazards model analysis showed post-trabeculectomy phacoemulsification was a significant factor in both complete success and qualified success based upon condition C (P = 0.0432 and P = 0.0488, respectively, but not for the other conditions. Kaplan-Meier survival analyses indicated significant differences in success probabilities between groups I and group II for complete success and qualified success based upon condition C (P = 0.020 and P = 0.013, respectively. There was also a significant difference for qualified success based upon condition B (P = 0.034, while there was no significant difference for the other conditions.Post-trabeculectomy phacoemulsification, especially within 1 year, can cause poor prognosis of IOP control of UG eyes after trabeculectomy with MMC.
TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier
Tursk, Eda
2004-01-01
Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan
Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies
International Nuclear Information System (INIS)
Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.
2007-01-01
Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients
Castro-Otero, C.
2017-04-01
Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.
Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei
2017-04-01
The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.
Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.
Directory of Open Access Journals (Sweden)
Jeban Ganesalingam
2009-09-01
Full Text Available Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes.Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method.The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001.The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.
Directory of Open Access Journals (Sweden)
Marisa Aparecida Amaro Malvestio
2008-08-01
Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized
Directory of Open Access Journals (Sweden)
Jung Kwon Kim
Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.
Rutten, I J G; Ubachs, J; Kruitwagen, R F P M; van Dijk, D P J; Beets-Tan, R G H; Massuger, L F A G; Olde Damink, S W M; Van Gorp, T
2017-04-01
Sarcopenia, severe skeletal muscle loss, has been identified as a prognostic factor in various malignancies. This study aims to investigate whether sarcopenia is associated with overall survival (OS) and surgical complications in patients with advanced ovarian cancer undergoing primary debulking surgery (PDS). Ovarian cancer patients (n = 216) treated with PDS were enrolled retrospectively. Total skeletal muscle surface area was measured on axial computed tomography at the level of the third lumbar vertebra. Optimum stratification was used to find the optimal skeletal muscle index cut-off to define sarcopenia (≤38.73 cm 2 /m 2 ). Cox-regression and Kaplan-Meier analysis were used to analyse the relationship between sarcopenia and OS. The effect of sarcopenia on the development of major surgical complications was studied with logistic regression. Kaplan-Meier analysis showed a significant survival disadvantage for patients with sarcopenia compared to patients without sarcopenia (p = 0.010). Sarcopenia univariably predicted OS (HR 1.536 (95% CI 1.105-2.134), p = 0.011) but was not significant in multivariable Cox-regression analysis (HR 1.362 (95% CI 0.968-1.916), p = 0.076). Significant predictors for OS in multivariable Cox-regression analysis were complete PDS, treatment in a specialised centre and the development of major complications. Sarcopenia was not predictive of major complications. Sarcopenia was not predictive of OS or major complications in ovarian cancer patients undergoing primary debulking surgery. However a strong trend towards a survival disadvantage for patients with sarcopenia was seen. Future prospective studies should focus on interventions to prevent or reverse sarcopenia and possibly increase ovarian cancer survival. Complete cytoreduction remains the strongest predictor of ovarian cancer survival. Copyright © 2017 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights
Adamkowski, A.; Krzemianowski, Z.
2012-11-01
The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.
International Nuclear Information System (INIS)
Adamkowski, A; Krzemianowski, Z
2012-01-01
The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.
Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.
2017-08-01
We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P < 0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P < 0.0001) and the triple-negative subtype tumors (P = 0.0039), but not for tumors of the HER2 subtype (P = 0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.
Wu, Jitao; Suk-Ouichai, Chalairat; Dong, Wen; Antonio, Elvis Caraballo; Derweesh, Ithaar H; Lane, Brian R; Demirjian, Sevag; Li, Jianbo; Campbell, Steven C
2018-01-01
To evaluate predictors of long-term survival for patients with chronic kidney disease primarily due to surgery (CKD-S). Patients with CKD-S have generally good survival that approximates patients who do not have CKD even after renal cancer surgery (RCS), yet there may be heterogeneity within this cohort. From 1997 to 2008, 4 246 patients underwent RCS at our centre. The median (interquartile range [IQR]) follow-up was 9.4 (7.3-11.0) years. New baseline glomerular filtration rate (GFR) was defined as highest GFR between nadir and 6 weeks after RCS. We retrospectively evaluated three cohorts: no-CKD (new baseline GFR of ≥60 mL/min/1.73 m 2 ); CKD-S (new baseline GFR of cancer-related survival (NRCRS) for the CKD-S cohort. Kaplan-Meier analysis assessed the longitudinal impact of new baseline GFR (45-60 mL/min/1.73 m 2 vs <45 mL/min/1.73 m 2 ) and Cox regression evaluated relative impact of preoperative GFR, new baseline GFR, and relevant demographics/comorbidities. Of the 4 246 patients who underwent RCS, 931 had CKD-S and 1 113 had CKD-M/S, whilst 2 202 had no-CKD even after RCS. Partial/radical nephrectomy (PN/RN) was performed in 54%/46% of the patients, respectively. For CKD-S, 641 patients had a new baseline GFR of 45-60 mL/min/1.73 m 2 and 290 had a new baseline GFR of <45 mL/min/1.73 m 2 . Kaplan-Meier analysis showed significantly reduced NRCRS for patients with CKD-S with a GFR of <45 mL/min/1.73 m 2 compared to those with no-CKD or CKD-S with a GFR of 45-60 mL/min/1.73 m 2 (both P ≤ 0.004), and competing risk analysis confirmed this (P < 0.001). Age, gender, heart disease, and new baseline GFR were all associated independently with NRCRS for patients with CKD-S (all P ≤ 0.02). Our data suggest that CKD-S is heterogeneous, and patients with a reduced new baseline GFR have compromised survival, particularly if <45 mL/min/1.73 m 2 . Our findings may have implications regarding choice of PN/RN in patients at risk of developing
Onisko, Agnieszka; Druzdzel, Marek J; Austin, R Marshall
2016-01-01
Classical statistics is a well-established approach in the analysis of medical data. While the medical community seems to be familiar with the concept of a statistical analysis and its interpretation, the Bayesian approach, argued by many of its proponents to be superior to the classical frequentist approach, is still not well-recognized in the analysis of medical data. The goal of this study is to encourage data analysts to use the Bayesian approach, such as modeling with graphical probabilistic networks, as an insightful alternative to classical statistical analysis of medical data. This paper offers a comparison of two approaches to analysis of medical time series data: (1) classical statistical approach, such as the Kaplan-Meier estimator and the Cox proportional hazards regression model, and (2) dynamic Bayesian network modeling. Our comparison is based on time series cervical cancer screening data collected at Magee-Womens Hospital, University of Pittsburgh Medical Center over 10 years. The main outcomes of our comparison are cervical cancer risk assessments produced by the three approaches. However, our analysis discusses also several aspects of the comparison, such as modeling assumptions, model building, dealing with incomplete data, individualized risk assessment, results interpretation, and model validation. Our study shows that the Bayesian approach is (1) much more flexible in terms of modeling effort, and (2) it offers an individualized risk assessment, which is more cumbersome for classical statistical approaches.
Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Neyman, Markov processes and survival analysis.
Yang, Grace
2013-07-01
J. Neyman used stochastic processes extensively in his applied work. One example is the Fix and Neyman (F-N) competing risks model (1951) that uses finite homogeneous Markov processes to analyse clinical trials with breast cancer patients. We revisit the F-N model, and compare it with the Kaplan-Meier (K-M) formulation for right censored data. The comparison offers a way to generalize the K-M formulation to include risks of recovery and relapses in the calculation of a patient's survival probability. The generalization is to extend the F-N model to a nonhomogeneous Markov process. Closed-form solutions of the survival probability are available in special cases of the nonhomogeneous processes, like the popular multiple decrement model (including the K-M model) and Chiang's staging model, but these models do not consider recovery and relapses while the F-N model does. An analysis of sero-epidemiology current status data with recurrent events is illustrated. Fix and Neyman used Neyman's RBAN (regular best asymptotic normal) estimates for the risks, and provided a numerical example showing the importance of considering both the survival probability and the length of time of a patient living a normal life in the evaluation of clinical trials. The said extension would result in a complicated model and it is unlikely to find analytical closed-form solutions for survival analysis. With ever increasing computing power, numerical methods offer a viable way of investigating the problem.
Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis
Directory of Open Access Journals (Sweden)
Amal Saki Malehi
2016-01-01
Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.
Wang, Yinqing; Cai, Ranze; Wang, Rui; Wang, Chunhua; Chen, Chunmei
2018-06-01
This is a retrospective study.The aim of this study was to illustrate the survival outcomes of patients with classic ependymoma (CE) and identify potential prognostic factors.CE is the most common category of spinal ependymomas, but few published studies have discussed predictors of the survival outcome.A Boolean search of the PubMed, Embase, and OVID databases was conducted by 2 investigators independently. The objects were intramedullary grade II ependymoma according to 2007 WHO classification. Univariate Kaplan-Meier analysis and Log-Rank tests were performed to identify variables associated with progression-free survival (PFS) or overall survival (OS). Multivariate Cox regression was performed to assess hazard ratios (HRs) with 95% confidence intervals (95% CIs). Statistical analysis was performed by SPSS version 23.0 (IBM Corp.) with statistical significance defined as P analysis showed that patients who had undergone total resection (TR) had better PFS and OS than those with subtotal resection (STR) and biopsy (P = .002, P = .004, respectively). Within either univariate or multivariate analysis (P = .000, P = .07, respectively), histological type was an independent prognostic factor for PFS of CE [papillary type: HR 0.002, 95% CI (0.000-0.073), P = .001, tanycytic type: HR 0.010, 95% CI (0.000-0.218), P = .003].It was the first integrative analysis of CE to elucidate the correlation between kinds of factors and prognostic outcomes. Definite histological type and safely TR were foundation of CE's management. 4.
Nested Cohort - R software package
NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.
DEFF Research Database (Denmark)
Lange, Jeppe; Troelsen, Anders; Solgaard, Søren
2018-01-01
was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...
DEFF Research Database (Denmark)
Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela
2011-01-01
In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...
DEFF Research Database (Denmark)
Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid
2015-01-01
analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...
Dave, Anushree
2017-12-01
This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.
Schein, Jeffrey; Caplan, Eric
2014-01-01
The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…
Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele
2018-04-17
In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.
ORIGINAL ARTICLES Antiretroviral treatment for children
African Journals Online (AJOL)
Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.
Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G
2006-10-01
Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.
Exposure-response relationship of regorafenib efficacy in patients with hepatocellular carcinoma.
Solms, Alexander; Reinecke, Isabel; Fiala-Buskies, Sabine; Keunecke, Anne; Drenth, Henk-Jan; Bruix, Jordi; Meinhardt, Gerold; Cleton, Adriaan; Ploeger, Bart
2017-11-15
To explore the relationship between regorafenib exposure and efficacy in patients with hepatocellular carcinoma (HCC) who had disease progression during sorafenib treatment (RESORCE). Exposure-response (ER) analyses for regorafenib were performed using data from a phase 3, randomized, placebo-controlled trial (RESORCE). Patients received 160mg regorafenib or placebo once daily (3weeks on/1week off in a 4-week cycle) with best supportive care until disease progression, death, or unacceptable toxicity. Kaplan-Meier analyses for overall survival (OS) and time-to-progression (TTP) were performed in which regorafenib-treated patients were grouped into four categories according to their estimated average exposure over 4weeks in cycle 1. While this analysis primarily focused on efficacy, a potential correlation between exposure and treatment-emergent adverse events (TEAEs) was also evaluated. If any differences were observed between Kaplan-Meier plots, the ER analysis continued with a multivariate Cox regression analysis to evaluate the correlation between exposure quartile categories and the efficacy and safety parameters while taking into consideration the effect of the predefined clinically relevant demographic and baseline covariates. The functional form of the ER relationship within the regorafenib treatment group was subsequently evaluated. Based on visual assessment of the Kaplan-Meier plots, no meaningful relationship between the exposure categories and TEAEs were observed, although median OS and TTP tended to be longer in the higher exposure categories. Further ER analyses, which considered the effects of predefined covariates and the different shapes of the ER relationship, focused on efficacy. The baseline risk factors Eastern Cooperative Oncology Group (ECOG) performance status ≥1, alpha-fetoprotein levels ≥400ng/ml, and aspartate transaminase or alanine transaminase levels >3×upper limit of normal were significantly associated with OS (Pregorafenib
International Nuclear Information System (INIS)
Mizumachi, Takatsugu; Hatakeyama, Hiromitsu; Kano, Satoshi; Sakashita, Tomohiro; Suzuki, Seigo; Homma, Akihiro; Oridate, Nobuhiko; Fukuda, Satoshi
2011-01-01
We performed a retrospective analysis of the association between tumor HPV status and the demographic and clinicopathological parameters of 83 patients with oropharyngeal squamous cell carcinoma at Hokkaido University Hospital, Japan, between 1998 and 2010. The parameters included age, gender, tumor subsite, Tumor-Node-Metastasis (TNM) stage, and overall survival. HPV status was established by multiplex polymerase chain reaction analysis. Of the 83 oropharyngeal cancers, 22 were positive for HPV-16, two for HPV-18, and one for HPV-35 and HPV-58. Kaplan-Meier survival analysis showed improved overall survival rates in patients with HPV-positive tumors (p=0.0024) compared with HPV-negative tumors. Of the 51 patients who received chemoradiotherapy, HPV-positive patients experienced better overall survival than HPV-negative patients (p=0.0024). HPV status is a significantly favorable prognostic factor in oropharyngeal cancer in Japan. (author)
Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin
2016-01-01
Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.
Song, Kyung-Jin; Choi, Byung-Wan; Kim, Jong-Kil
2014-12-01
Retrospective study. To analyze the incidence and prevalence of clinical adjacent segment pathology (CASP) following anterior decompression and fusion with cage and plate augmentation for degenerative cervical diseases. No long-term data on the use of cage and plate augmentation have been reported. The study population consisted of 231 patients who underwent anterior cervical discectomy and fusion (ACDF) with cage and plate for degenerative cervical spinal disease. The incidence and prevalence of CASP was determined by using the Kaplan-Meier survival analysis. To analyze the factors that influence CASP, data on preoperative and postoperative sagittal alignment, spinal canal diameter, the distance between the plate and adjacent disc, extent of fusion level, and the presence or absence of adjacent segment degenerative changes by imaging studies were evaluated. CASP occurred in 15 of the cases, of which 9 required additional surgery. At 8-year follow-up, the average yearly incidence was 1.1%. The rate of disease-free survival based on Kaplan-Meier survival analysis was 93.6% at 5 years and 90.2% at 8 years. No statistically significant differences in CASP incidence based on radiological analysis were observed. Significantly high incidence of CASP was observed in the presence of increased adjacent segment degenerative changes (pdegenerative cervical disease is associated with a lower incidence in CSAP by 1.1% per year, and the extent of preoperative adjacent segment degenerative changes has been shown as a risk factor for CASP.
High Rab27A expression indicates favorable prognosis in CRC.
Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng
2015-06-13
Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.
Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment
2010-08-01
overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10
Retrospective analysis of dental implants placed and restored by advanced prosthodontic residents.
Barias, Pamela A; Lee, Damian J; Yuan, Judy Chia-Chun; Sukotjo, Cortino; Campbell, Stephen D; Knoernschild, Kent L
2013-02-01
The purposes of this retrospective clinical review were to: (1) describe the demographics of implant patients, types of implant treatment and implant-supported prostheses in an Advanced Education in Prosthodontic Program, (2) evaluate the survival rate of dental implants placed by prosthodontic residents from 2006 to 2008, and (3) analyze the relationship between resident year of training and implant survival rate. All patients who received dental implants placed by prosthodontic residents from January 2006 to October of 2008 in the Advanced Prosthodontic Program at the University of Illinois at Chicago College of Dentistry were selected for this study. Age, gender, implant diameter, length, implant locations, surgical and restorative detail, and year of prosthodontic residency training were collected and analyzed. Life-table and Kaplan-Meier survival analyses were performed based on implants overall, locations, year of training, and use of a computer-generated surgical guide. A Logrank statistic was performed between implant survival and year of prosthodontic residency training, location, and use of computer-generated surgical guide (α= 0.05). Three hundred and six implants were placed, and of these, seven failed. Life-table and Kaplan-Meier analyses computed a cumulative survival rate (CSR) of 97% for overall implants and implants placed with a computer-generated surgical guide. No statistical difference was found in implant survival rates as a function of year of training (P= 0.85). Dental implants placed by prosthodontic residents had a CSR comparable to previously published studies by other specialties. The year of prosthodontic residency training and implant failure rate did not have any significant relationship. © 2012 by the American College of Prosthodontists.
Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit
2017-01-01
Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.
Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.
Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang
The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.
Wang, Qin; Hu, Ke-Jie; Ren, Ye-Ping; Dong, Jie; Han, Qing-Feng; Zhu, Tong-Ying; Chen, Jiang-Hua; Zhao, Hui-Ping; Chen, Meng-Hua; Xu, Rong; Wang, Yue; Hao, Chuan-Ming; Zhang, Xiao-Hui; Wang, Mei; Tian, Na; Wang, Hai-Yan
2016-01-01
♦ Research indicates that the socioeconomic status (SES) of individuals and the area where they live are related to initial peritonitis and outcomes in peritoneal dialysis (PD). We conducted a retrospective, multi-center cohort study in China to examine these associations. ♦ Data on 2,171 PD patients were collected from 7 centers, including baseline demographic, socioeconomic, and laboratory data. We explored the potential risk factors for initial peritonitis and outcomes using univariate Cox regression and unadjusted binary logistic regression. Then, we used propensity score matching to balance statistically significant risk factors for initial peritonitis and outcomes, and Kaplan-Meier survival analysis to compare differences in peritonitis-free rates between different groups of participants after matching. ♦ A total of 563 (25.9%) initial episodes of peritonitis occurred during the study period. The Kaplan-Meier peritonitis-free rate curve showed high-income patients had a significantly lower risk than low-income patients (p = 0.007) after matching for age, hemoglobin, albumin, and regional SES and PD center. The risk of treatment failure was significantly lower in the high-income than the low-income group after matching for the organism causing peritonitis and PD center: odds ratio (OR) = 0.27 (0.09 - 0.80, p = 0.018). Regional SES and education were not associated with initial peritonitis and outcomes. ♦ Our study demonstrates low individual income is a risk factor for the initial onset of peritonitis and treatment failure after initial peritonitis. Copyright © 2016 International Society for Peritoneal Dialysis.
Application of the standard lymphadenectomy in gastric adenocarcinoma
International Nuclear Information System (INIS)
Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro
2011-01-01
The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
International Nuclear Information System (INIS)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho
2010-01-01
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
Energy Technology Data Exchange (ETDEWEB)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)
2010-08-15
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.
Uterine Carcinosarcoma Confined to the Pelvis: A Retrospective Review and Outcome Analysis
International Nuclear Information System (INIS)
Li, H.; TenNapel, M.J.; Bhatia, S.K.; Ahmed, A.; Lin, L.; Jacobson, G.
2014-01-01
Objective. We compared the treatments of uterine carcinosarcoma at our institution and evaluated their impact on survival. Methods. A retrospective analysis was performed on 60 eligible patients with carcinosarcoma limited to the pelvis. Subjects were divided into four categories: surgery, surgery plus chemotherapy, surgery plus radiation therapy, and a combination of surgery, chemotherapy, and RT. The most commonly used chemotherapy was cisplatin and/or carboplatin and taxol. Radiotherapy included external beam radiation therapy (EBRT) alone or with high dose rate (HDR) brachytherapy or HDR brachytherapy alone. Survival probability data were computed using the Kaplan-Meier method. The differences between groups were compared using the log-rank test. Results. The combination of surgery and radiation therapy with or without chemotherapy is seen to improve overall survival (OS) compared to surgery alone (Ρ =0.044 and Ρ =0.028 resp.). Brachytherapy involving three HDR vaginal cylinder fractions shows an equally effective reduction in local recurrence compared to EBRT. Conclusion. Our study of a relatively large number of carcinosarcoma patients suggests that adjuvant radiation therapy improves OS compared to surgery alone. Brachytherapy with 3 HDR vaginal cylinder fractions is preferred because of its time-saving, better tolerance, low toxicity and equivalent OS, and local control compared to EBRT.
Zhou, K; Yan, Y; Zhao, S; Li, B
2014-01-01
To explore the correlation between serum levels of Tumor Associated Materials (TAM) and clinicopathological parameters and prognosis in patients with esophageal cancer (EC). The levels of TAM were determined by chemical colorimetry in 100 EC patients and 100 healthy controls. Serum TAM levels were significantly higher in patients with esophageal carcinoma than in the control group (p TAM were associated with tumor size (p = 0.004), tumor depth (p TAM (p = 0.001). Kaplan-Meier analysis showed patients with increased levels of TAM after operation had an lower overall survival (p TAM may be an independent factor affecting the overall survival and disease-free survival (p TAM could be used to screen for tumor and assess unfavorable prognosis in patients with EC.
International Nuclear Information System (INIS)
Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo
2009-01-01
Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es
Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study
DEFF Research Database (Denmark)
Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars
2015-01-01
patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...
Association of versican turnover with all-cause mortality in patients on haemodialysis
DEFF Research Database (Denmark)
Genovese, Federica; Karsdal, Morten A; Leeming, Diana J
2014-01-01
with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...
Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.
2000-01-01
Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de
DEFF Research Database (Denmark)
Schneider, Uffe; Nielsen, Rikke; Pedersen, Court
2007-01-01
. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...
International Nuclear Information System (INIS)
Brearley, M.J.; Hayes, A.M.; Murphy, S.
1999-01-01
Thirteen dogs with invasive thyroid carcinoma (WHO classification T2b or T3b) seen between January 1991 and October 1997 were treated by external beam Irradiation. Four once-weekly fractions of 9 gray of 4 MeV X-rays were administered. Four of the dogs died of progression of the primary disease and four from metastatic spread. Of the remaining dogs, three died of unrelated problems, although two were still alive at the time of the censor. Kaplan-Meier analysis of the survival time from first dose to death from either primary or metastatic disease gave a median survival time of 96 weeks (mean 85 weeks, range six to 247 weeks). Radiographic evidence of pulmonary metastatic disease at presentation had no prognostic value whereas crude growth rate was a highly significant factor. The present series Indicates that radiation therapy should be considered an important modality for the control of invasive thyroid carcinoma in the dog
Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola
2009-01-01
We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092
Modelling the survivorship of Nigeria children in their first 10 years of ...
African Journals Online (AJOL)
Fagbamigbe
Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...
Directory of Open Access Journals (Sweden)
Køber Lars
2010-01-01
Full Text Available Abstract Background The optimal duration of clopidogrel treatment after percutaneous coronary intervention (PCI is unclear. We studied the risk of death or recurrent myocardial infarction (MI in relation to 6- and 12-months clopidogrel treatment among MI patients treated with PCI. Methods Using nationwide registers of hospitalizations and drug dispensing from pharmacies we identified 11 680 patients admitted with MI, treated with PCI and clopidogrel. Clopidogrel treatment was categorized in a 6-months and a 12-months regimen. Rates of death, recurrent MI or a combination of both were analyzed by the Kaplan Meier method and Cox proportional hazards models. Bleedings were compared between treatment regimens. Results The Kaplan Meier analysis indicated no benefit of the 12-months regimen compared with the 6-months in all endpoints. The Cox proportional hazards analysis confirmed these findings with hazard ratios for the 12-months regimen (the 6-months regimen used as reference for the composite endpoint of 1.01 (confidence intervals 0.81-1.26 and 1.24 (confidence intervals 0.95-1.62 for Day 0-179 and Day 180-540 after discharge. Bleedings occurred in 3.5% and 4.1% of the patients in the 6-months and 12-months regimen (p = 0.06. Conclusions We found comparable rates of death and recurrent MI in patients treated with 6- and 12-months' clopidogrel. The potential benefit of prolonged clopidogrel treatment in a real-life setting remains uncertain.
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Runaway transient simulation of a model Kaplan turbine
Energy Technology Data Exchange (ETDEWEB)
Liu, S; Liu, D; Wu, Y [State Key Laboratory of Hydroscience and Engineering, Department of Thermal Eng., Tsinghua University, Beijing, 100084 (China); Zhou, D [Water Conservancy and Hydropower Eng., Hohai University, Nanjing. 210098 (China); Nishi, M, E-mail: liushuhong@tsinghua.edu.c [Kyushu Inst. Tech. Senior Academy, Kitakyushu, 804-8550 (Japan)
2010-08-15
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-{epsilon} turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
Liu, S.; Zhou, D.; Liu, D.; Wu, Y.; Nishi, M.
2010-08-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-epsilon turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
International Nuclear Information System (INIS)
Liu, S; Liu, D; Wu, Y; Zhou, D; Nishi, M
2010-01-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-ε turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
de Maio Carrillho, Claudia M D; Gaudereto, Juliana J; Martins, Roberta Cristina Ruedas; de Castro Lima, Victor Augusto Camarinha; de Oliveira, Larissa M; Urbano, Mariana R; Perozin, Jamile S; Levin, Anna Sara; Costa, Silvia F
2017-03-01
We described 27 polyclonal colistin-resistant Enterobacteriaceae (MIC 4-16 μg/mL) infections (12 pneumonia, 12 urinary tract infection (UTI), two Bacteremia, and one skin/soft tissue infection) in which 74% harbored KPC. The isolates were polyclonal, 6 STs were identified and the colistin resistance was due to chromosome mutations. Eight patients with UTI received monotherapy, and combination therapy was given to 19 patients. Overall mortality was 37%. In vitro synergy using time-kill assay was observed in 14 of 19 (74%) isolates tested; the synergistic effect was observed for almost all isolates for the combination of three drugs: colistin, amikacin, and tigecycline. The Kaplan-Meier survival curve showed no significant difference comparing combination therapy with 2, 3, or more drugs and risk factors associated with death were dialysis and shock. These findings reinforce the fact that colistin in combination with other classes of drugs can be useful in treating infections caused by colistin-resistant CRE. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Charlot, Mette; Grove, Erik; Hansen, Peter Riis
2011-01-01
: All aspirin treated patients surviving 30 days after a first myocardial infarction from 1997 to 2006, with follow-up for one year. Patients treated with clopidogrel were excluded. MAIN OUTCOME MEASURES: The risk of the combined end point of cardiovascular death, myocardial infarction, or stroke...... associated with use of proton pump inhibitors was analysed using Kaplan-Meier analysis, Cox proportional hazard models, and propensity score matched Cox proportional hazard models. Results 3366 of 19 925 (16.9%) aspirin treated patients experienced recurrent myocardial infarction, stroke, or cardiovascular...
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper
1999-01-01
for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...
DEFF Research Database (Denmark)
Badawy, Mona; Fenstad, Anne M.; Bartz-Johannessen, Christoffer A.
2017-01-01
Background: High procedure volume and dedication to unicompartmental knee arthroplasty (UKA) has been suggested to improve revision rates. This study aimed to quantify the annual hospital volume effect on revision risk in Oxfordu? nicompartmental knee arthroplasty in the Nordic countries. Methods......). The outcome was revision risk after 2 and 10 years calculated using Kaplan Meier method. Multivariate Cox regression analysis was used to assess the Hazard Ratio (HR) of any revision due to specific reasons with 95% confidence intervals (CI). Results: The implant survival was 80% at 10 years in the volume...
DEFF Research Database (Denmark)
van Keimpema, Loes; Nevens, Frederik; Adam, René
2011-01-01
Patients with end-stage isolated polycystic liver disease (PCLD) suffer from incapacitating symptoms because of very large liver volumes. Liver transplantation (LT) is the only curative option. This study assesses the feasibility of LT in PCLD. We used the European Liver Transplant Registry (ELTR......) database to extract demographics and outcomes of 58 PCLD patients. We used Kaplan-Meier survival analysis for survival rates. Severe abdominal pain (75%) was the most prominent symptom, while portal hypertension (35%) was the most common complication in PCLD. The explantation of the polycystic liver...
Clinical Features in a Danish Population-Based Cohort of Probable Multiple System Atrophy Patients
DEFF Research Database (Denmark)
Starhof, Charlotte; Korbo, Lise; Lassen, Christina Funch
2016-01-01
Background: Multiple system atrophy (MSA) is a rare, sporadic and progressive neurodegenerative disorder. We aimed to describe the clinical features of Danish probable MSA patients, evaluate their initial response to dopaminergic therapy and examine mortality. Methods: From the Danish National...... the criteria for probable MSA. We recorded clinical features, examined differences by MSA subtype and used Kaplan-Meier survival analysis to examine mortality. Results: The mean age at onset of patients with probable MSA was 60.2 years (range 36-75 years) and mean time to wheelchair dependency was 4.7 years...
The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis
DEFF Research Database (Denmark)
Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik
2016-01-01
OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...
Is there racial/ethnic variance in cervical cancer- specific survival of ...
African Journals Online (AJOL)
incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...
Energy Technology Data Exchange (ETDEWEB)
Giganti, Francesco; Salerno, Annalaura; Marra, Paolo; Esposito, Antonio; Del Maschio, Alessandro; De Cobelli, Francesco [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); San Raffaele Vita-Salute University, Milan (Italy); Antunes, Sofia [San Raffaele Scientific Institute, Centre for Experimental Imaging, Milan (Italy); Ambrosi, Alessandro [San Raffaele Vita-Salute University, Milan (Italy); Nicoletti, Roberto [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); Orsenigo, Elena [San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Chiari, Damiano; Staudacher, Carlo [San Raffaele Vita-Salute University, Milan (Italy); San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Albarello, Luca [San Raffaele Scientific Institute, Pathology Unit, Milan (Italy)
2017-05-15
To investigate the association between preoperative texture analysis from multidetector computed tomography (MDCT) and overall survival in patients with gastric cancer. Institutional review board approval and informed consent were obtained. Fifty-six patients with biopsy-proved gastric cancer were examined by MDCT and treated with surgery. Image features from texture analysis were quantified, with and without filters for fine to coarse textures. The association with survival time was assessed using Kaplan-Meier and Cox analysis. The following parameters were significantly associated with a negative prognosis, according to different thresholds: energy [no filter] - Logarithm of relative risk (Log RR): 3.25; p = 0.046; entropy [no filter] (Log RR: 5.96; p = 0.002); entropy [filter 1.5] (Log RR: 3.54; p = 0.027); maximum Hounsfield unit value [filter 1.5] (Log RR: 3.44; p = 0.027); skewness [filter 2] (Log RR: 5.83; p = 0.004); root mean square [filter 1] (Log RR: - 2.66; p = 0.024) and mean absolute deviation [filter 2] (Log RR: - 4.22; p = 0.007). Texture analysis could increase the performance of a multivariate prognostic model for risk stratification in gastric cancer. Further evaluations are warranted to clarify the clinical role of texture analysis from MDCT. (orig.)
Estimation of Unemployment Duration in Botoşani County Using Survival Analysis
Directory of Open Access Journals (Sweden)
Darabă Gabriel
2017-01-01
Full Text Available In this paper we aim at estimating the unemployment duration in Botosani County in order tostudy the impact of individual characteristics (gender, age, place of residence, unemploymentbenefit, etc. on the length of unemployment spells. We use Cox regression model to measure theeffects of gender, age, residential environment, etc. on the hazard rate of leaving unemploymentandKaplan-Meier estimator to compare survival probabilities among different categories ofunemployed persons. The study is carried out on a sample of 200 unemployment spellsregisteredwith the Employment Agency of Botoşani County from January 2012 to December 2015. Theresults reveal that place of residence, unemployment benefit and unemployed category have asignificant impact on unemployment spells.
Numerical Investigation of the Flow Structure in a Kaplan Draft Tube at Part Load
Maddahian, R.; Cervantes, M. J.; Sotoudeh, N.
2016-11-01
This research presents numerical simulation of the unsteady flow field inside the draft tube of a Kaplan turbine at part load condition. Due to curvature of streamlines, the ordinary two-equations turbulence models fail to predict the flow features. Therefore, a modification of the Shear Stress Transport (SST-SAS) model is utilized to approximate the turbulent stresses. A guide vane, complete runner and draft tube are considered to insure the real boundary conditions at the draft tube inlet. The outlet boundary is assumed to discharge into the atmosphere. The obtained pressure fluctuations inside the draft tube are in good agreement with available experimental data. In order to further investigate the RVR formation and its movement, the λ2 criterion, relating the position of the vortex core and strength to the second largest Eigen value of the velocity gradient tensor, is employed. The method used for vortex identification shows the flow structure and vortex motion inside the draft tube accurately.
Directory of Open Access Journals (Sweden)
Giuseppe Bonaccorso
2014-06-01
. The most important aspects of the eastern quadrant of the Roman periphery are described “from the inside”, accentuating the passages, spaces and elements of composition standing in the origin of form and structure of the neighborhoods in the vicinity of Great Circular Road. The article proposes that the key episodes in this process are the new churches by internationally famous architects, created as new focal points for peripheral neighborhoods whilst replacing libraries, squares and malls. Recent realizations are seen as intention to enforce, or, better, to construct, an identity factor for each of the neighborhoods in the dicussed sector of the city. Starting from the general discourse, the article focuses on one church and one neighborhood that might be considered as models to follow in the entire periphery around GCR: the jubilee church of God the Father of Mercy designed by Richard Meier in the neighborhood of Tor Tre Teste. The sequence of events related to the architectural competition for the church, the choice of proposal by Richard Meier, the complexity of construction as well as the technical, stylistic and symbolical analysis of the building are put in relation to the neighborhood, and finally read as an attempt to create centre of attention for the entire periphery.
Survival Analysis of Factors Influencing Cyclic Fatigue of Nickel-Titanium Endodontic Instruments
Directory of Open Access Journals (Sweden)
Eva Fišerová
2015-01-01
Full Text Available Objective. The aim of this study was to validate a survival analysis assessing the effect of type of rotary system, canal curvature, and instrument size on cyclic resistance. Materials and Methods. Cyclic fatigue testing was carried out in stainless steel artificial canals with radii of curvature of 3 or 5 mm and the angle of curvature of 60 degrees. All the instruments were new and 25 mm in working length, and ISO colour coding indicated the instrument size (yellow for size 20; red for size 25. Wizard Navigator instruments, Mtwo instruments, ProTaper instruments, and Revo-S instruments were passively rotated at 250 rotations per minute, and the time fracture was being recorded. Subsequently, fractographic analysis of broken tips was performed by scanning electron microscope. The data were then analysed by the Kaplan-Meier estimator of the survival function, the Cox proportional hazards model, the Wald test for regression covariates, and the Wald test for significance of regression model. Conclusion. The lifespan registered for the tested instruments was Mtwo > Wizard Navigator > Revo-S > ProTaper; 5 mm radius > 3 mm radius; and yellow > red in ISO colour coding system.
Rao, Zilong; Zheng, Huaguang; Wang, Fei; Wang, Anxin; Liu, Liping; Dong, Kehui; Zhao, Xingquan; Wang, Yilong; Cao, Yibin
2017-08-01
To evaluate the role of HTPR in predicting early recurrence of ischemic events in patients with minor ischemic stroke or high-risk TIA. From January 2014 to September 2014, a single center continuously enrolled patients with minor ischemic stroke or high-risk TIA and gave them antiplatelet therapy consisting of aspirin with clopidogrel. HTPR was assessed by TEG after 7 days of antiplatelet therapy and detected CYP2C19 genotype. The incidence of recurrent ischemic events was assessed 3 months after onset. The incidence of recurrent ischemic events was compared between the HTPR and NTPR groups with the Kaplan-Meier method, and multivariate Cox proportional hazards models were used to determine the risk factors associated with recurrent ischemic events. We enrolled 278 eligible patients with minor ischemic stroke or high-risk TIA. Through TEG testing, patients with HTPR were 22.7%, and carriers were not associated with HTPR to ADP by TEG-ADP(%) (p = 0.193). A total of 265 patients completed 3 months of follow-up, and Kaplan-Meier analysis showed that patients with HTPR had a higher percentage of recurrent ischemic events compared with patients with NTPR (p = 0.002). In multivariate Cox proportional hazards models, history of ischemic stroke or TIA (HR 4.45, 95% CI 1.77-11.16, p = 0.001) and HTPR (HR 3.34, 95% CI 1.41-7.91, p = 0.006) was independently associated with recurrent ischemic events. In patients with minor stroke or TIA, the prevalence of HTPR was 22.7%, and HTPR was independently associated with recurrent ischemic events.
Physical activity increases survival after heart valve surgery
DEFF Research Database (Denmark)
Lund, K.; Sibilitz, Kirstine Lærum; Kikkenborg Berg, Selina
2016-01-01
physical activity levels 6-12 months after heart valve surgery and (1) survival, (2) hospital readmission 18-24 months after surgery and (3) participation in exercise-based cardiac rehabilitation. METHODS: Prospective cohort study with registry data from The CopenHeart survey, The Danish National Patient......OBJECTIVES: Increased physical activity predicts survival and reduces risk of readmission in patients with coronary heart disease. However, few data show how physical activity is associated with survival and readmission after heart valve surgery. Objective were to assess the association between...... Register and The Danish Civil Registration System of 742 eligible patients. Physical activity was quantified with the International Physical Activity Questionnaire and analysed using Kaplan-Meier analysis and Cox regression and logistic regression methods. RESULTS: Patients with a moderate to high physical...
International Nuclear Information System (INIS)
Gu Wendong; Ji Qinghai; Lu Xueguan; Feng Yan
2003-01-01
Objective: To analyze the results of neck dissection in patients who failed in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma. Methods: Eighty-three patients who received neck dissection due to lymph node persistence or recurrence after definitive radiotherapy were analyzed retrospectively according to the following relevant factors: age, sex, the interval between completion of radiotherapy and surgery, rN stage, postoperative radiotherapy given or not, the adjacent tissues involved or not and the number of positive nodes. Kaplan-Meier method, Log-rank method and Cox method were used in the statistical analysis. Results: The 1-, 3- and 5-year overall survival rates were 80.7%, 47.1% and 34.9%. The interval between completion of radiotherapy and surgery, postoperative radiotherapy given or not, the adjacent tissues involved or not were significantly prognostic factors in statistic analysis. Conclusions: Neck dissection can be applied in the management of cervical lymph node failure in nasopharyngeal carcinoma after radiotherapy. Postoperative radiotherapy should be considered in patients with capsular invasion and/or adjacent tissue involvement
Energy Technology Data Exchange (ETDEWEB)
Ulyte, Agne [Vilnius University, Faculty of Medicine, Vilnius (Lithuania); Katsaros, Vasileios K. [General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Advanced Imaging Modalities - CT and MRI, Athens (Greece); University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Liouta, Evangelia; Stranjalis, Georgios [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Boskos, Christos [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Radiation Oncology, Athens (Greece); Papanikolaou, Nickolas [Champalimaud Foundation, Department of Radiology, Centre for the Unknown, Lisbon (Portugal); Usinskiene, Jurgita [National Cancer Institute, Vilnius (Lithuania); Affidea Lietuva, Vilnius (Lithuania); Bisdas, Sotirios [University College London Hospitals, Department of Neuroradiology, The National Hospital for Neurology and Neurosurgery, London (United Kingdom)
2016-12-15
The prognostic value of the dynamic contrast-enhanced (DCE) MRI perfusion and its histogram analysis-derived metrics is not well established for high-grade glioma (HGG) patients. The aim of this prospective study was to investigate DCE perfusion transfer coefficient (K{sup trans}), vascular plasma volume fraction (v{sub p}), extracellular volume fraction (v{sub e}), reverse transfer constant (k{sub ep}), and initial area under gadolinium concentration time curve (IAUGC) as predictors of progression-free (PFS) and overall survival (OS) in HGG patients. Sixty-nine patients with suspected anaplastic astrocytoma or glioblastoma underwent preoperative DCE-MRI scans. DCE perfusion whole tumor region histogram parameters, clinical details, and PFS and OS data were obtained. Univariate, multivariate, and Kaplan-Meier survival analyses were conducted. Receiver operating characteristic (ROC) curve analysis was employed to identify perfusion parameters with the best differentiation performance. On univariate analysis, v{sub e} and skewness of v{sub p} had significant negative impacts, while k{sub ep} had significant positive impact on OS (P < 0.05). v{sub e} was also a negative predictor of PFS (P < 0.05). Patients with lower v{sub e} and IAUGC had longer median PFS and OS on Kaplan-Meier analysis (P < 0.05). K{sup trans} and v{sub e} could also differentiate grade III from IV gliomas (area under the curve 0.819 and 0.791, respectively). High v{sub e} is a consistent predictor of worse PFS and OS in HGG glioma patients. v{sub p} skewness and k{sub ep} are also predictive for OS. K{sup trans} and v{sub e} demonstrated the best diagnostic performance for differentiating grade III from IV gliomas. (orig.)
Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan
Krikun, Andrew
2010-01-01
Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…
Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto
2017-06-01
Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.
S100A14 is a novel independent prognostic biomarker in the triple-negative breast cancer subtype
DEFF Research Database (Denmark)
Ehmsen, Sidse; Hansen, Lea Tykgaard; Bak, Martin
2015-01-01
Triple-negative breast cancer (TNBC) represents a heterogeneous subgroup with generally poor outcome and lack of an effective targeted therapy. Prognostic or predictive biomarkers to guide treatment decisions for this group of patients are needed. To evaluate the potential of S100A14 protein...... as a novel biomarker in TNBC, the protein expression of S100A14 was correlated with clinical outcomes in a Pilot Sample set and a Danish cohort of predominantly TNBC patients. Kaplan-Meier analysis identified a prognostic impact of S100A14 on disease-free survival and overall survival, showing that tumors......-), had equally poor outcomes as those with tumor-positive axillary lymph nodes (N+), while TNBC/N- patients with low S100A14 expression had a significantly better disease free survival (p = 0.013). Multivariate analysis revealed that S100A14 is an independent prognostic factor for TNBC patients (p = 0...
He, Chao; Wu, Shuhua; Gao, Aidi; Su, Ye; Min, Han; Shang, Zeng-Fu; Wu, Jinchang; Yang, Li; Ding, Wei-Qun; Zhou, Jundong
2017-12-01
An aberrantly elevated expression of DNA polymerase ι (Pol ι) is significantly associated with poor prognosis of patients with esophageal squamous cell carcinoma (ESCC), yet the mechanisms behind this phenomenon remain obscure. Based on the RNA-Seq transcriptome and real-time PCR analysis, we identified ETS-1 as a candidate gene involved in Pol ι-mediated progression of ESCC. Wound-healing and transwell assay indicated that downregulation of ETS-1 attenuates Pol ι-mediated invasiveness of ESCC. Signaling pathway analysis showed that Pol ι enhances ETS-1 phosphorylation at threonine-38 through the Erk signaling pathway in ESCC cells. Kaplan-Meier analysis, based on 93 clinical tissue samples, revealed that ETS-1 phosphorylation at threonine-38 is associated with poor prognosis of ESCC patients. The present study thus demonstrates that phosphorylation of ETS-1 is a critical event in the Pol ι-induced invasion and metastasis of ESCC. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center
Directory of Open Access Journals (Sweden)
Claudio Calazan do Carmo
2011-08-01
Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (p<0.001. There was seen a dose-response relationship between mortality and clinical staging, ranging from 27.8 to 749.6 per 1,000 cases-year in women stage I and IV, respectively. CONCLUSIONS: The study showed that early detection through prevention programs is crucial to increase cervical cancer survival.
Directory of Open Access Journals (Sweden)
YE Peiyan
2013-04-01
Full Text Available ObjectiveTo identify the risk factors associated with progression of acute-on-chronic liver failure (ACLF occurring in patients with chronic hepatitis B virus (HBV infection (CHB. MethodsThe clinical, demographic, treatment and outcome data of 180 ACLF patients with concomitant CHB managed in our hospital between June 2009 and September 2012 were retrospectively reviewed. Clinical data, taken at baseline, included markers of inflammation/infection (white blood cell (WBC count, coagulation (prothrombin time (PT and prothrombin activity (PTA, and liver function (alanine aminotransferase (ALT, aspartate aminotransferase (AST, total bilirubin (TBil, direct bilirubin (DBil, choninesterase (CHE, albumin (Alb, globulin (Glb, total cholesterol (TC, and ammonia. In-hospital treatments included supplementation with traditional Chinese medicine-based therapies, such as Tuihuang decoction and detoxification enema. The primary outcome was survival during hospitalization. The patients were grouped for analysis according to ACLF stage (early, n=93; mid, n=61; late, n=26 and the risk factors associated with each stage were identified by using univariate (log-rank test and multivariate (Cox’s test regression analyses. The association of risk factors with patient survival was assessed by Kaplan-Meier curve analysis. ResultsThe three ACLF groups showed significantly different amounts of leukocytes, with the late ACLF group showing the highest WBC. The late ACLF group also showed significantly lower Glb and TC. There was a trend in reduced cumulative survival rate and shorter time to death that significantly corresponded to progressive stages of ACLF (early ACLF>mid ACLF>late ACLF; all P<0.001. One-hundred-and-twenty-six (70.0% of the patients died during their hospitalization, and multivariate regression analysis of this entire patient population identified absence of colonic enema, presence of hepatic encephalopathy, presence of hepatorenal syndrome, PTA
DEFF Research Database (Denmark)
Nicolini, Franck E; Ibrahim, Amr R; Soverini, Simona
2013-01-01
The BCR-ABL T315I mutation confers resistance to currently licensed tyrosine kinase inhibitors in chronic myelogenous leukemia. However, the impact of this mutation on survival in early stages of disease, in chronic phase, has never been detailed. Using matched pair analysis, a cohort of 64...... patients with chronic phase chronic myelogenous leukemia harboring a T315I mutation and resistant to imatinib mesylate was compared to a similar cohort of 53 chronic phase patients resistant to imatinib, but with no detectable T315I mutation, in the pre-ponatinib era. These patients were matched according...... to age at diagnosis, interval between disease diagnosis and start of imatinib treatment, and duration of imatinib therapy. Kaplan-Meier survival analyses demonstrated the significant negative impact of the presence of the T315I mutation on overall survival (since imatinib-resistance: 48.4 months for T315...
First line chemotherapy plus trastuzumab in metastatic breast cancer ...
African Journals Online (AJOL)
First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...
DEFF Research Database (Denmark)
Kirk, O; Mocroft, A; Pradier, C
2001-01-01
-up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...
Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A
2011-02-27
Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.
Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin
2017-05-01
Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic
Axial U(1) current in Grabowska and Kaplan's formulation
Hamada, Yu; Kawai, Hikaru
2017-06-01
Recently, Grabowska and Kaplan [Phys. Rev. Lett. 116, 211602 (2016); Phys. Rev. D 94, 114504 (2016)] suggested a nonperturbative formulation of a chiral gauge theory, which consists of the conventional domain-wall fermion and a gauge field that evolves by gradient flow from one domain wall to the other. We introduce two sets of domain-wall fermions belonging to complex conjugate representations so that the effective theory is a 4D vector-like gauge theory. Then, as a natural definition of the axial-vector current, we consider a current that generates simultaneous phase transformations for the massless modes in 4 dimensions. However, this current is exactly conserved and does not reproduce the correct anomaly. In order to investigate this point precisely, we consider the mechanism of the conservation. We find that this current includes not only the axial current on the domain wall but also a contribution from the bulk, which is nonlocal in the sense of 4D fields. Therefore, the local current is obtained by subtracting the bulk contribution from it.
Latzman, Robert D.; Markon, Kristian E.
2010-01-01
There has been an increased interest in the structure of and relations among executive functions.The present study examined the factor structure as well as age-related factorial invariance of the Delis-Kaplan Executive Function System (D-KEFS), a widely used inventory aimed at assessing executive functions. Analyses were first conducted using data…
Iverson, Shawn M; Spierer, Oriel; Papachristou, George C; Feuer, William J; Shi, Wei; Greenfield, David S; O'Brien, Terrence P
2018-02-01
To compare corneal graft survival rates after penetrating keratoplasty (PK) and Descemet's stripping endothelial keratoplasty (DSEK) in patients with a glaucoma drainage device (GDD) or medically managed glaucoma. A retrospective chart review was conducted on consecutive patients who underwent primary PK or primary DSEK. Inclusion criteria consisted of eyes with a diagnosis of glaucoma prior to corneal transplantation and a minimum of 6 months of follow-up. Graft failure was defined as an edematous cornea with failure to maintain deturgescence lasting beyond a period of 1 month of intense steroid therapy or vascularization and scarring resulting in irreversible loss of central graft clarity. Corneal graft survival was calculated using Kaplan-Meier survival analysis. Patients were divided into four groups: GDD-PK, GDD-DSEK, medical-PK and medical-DSEK. Fifty-six eyes of 56 patients were identified as meeting inclusion criteria. Among eyes with a GDD, there was no difference in the proportion of failures between PK grafts (48%) and DSEK grafts (50%) (p = 0.90). Failure occurred earlier in DSEK recipients compared to PK recipients, 5.82 ± 6.77 months versus 14.40 ± 7.70 months, respectively (p = 0.04). A Kaplan-Meier analysis did not identify a difference between the four groups with respect to graft failure (p = 0.52). There is no significant difference in graft survival rates between medically and surgically treated glaucoma patients for either PK or DSEK grafts. In patients with GDD, graft failure occurs earlier in DSEK compared to PK.
International Nuclear Information System (INIS)
Rieger, Johannes; Hautmann, Hubert; Linsenmaier, Ulrich; Weber, Cristoph; Treitl, Markus; Huber, R.M.; Pfeifer, Klaus-Juergen
2004-01-01
Over the last few years various types of metal wire stents have been increasingly employed in the treatment of both malignant and benign tracheobronchial obstruction. To date, however, few studies have investigated the in vivo properties of different stent types. We implanted 26 balloon-expandable tantalum Strecker stents (18 patients) and 18 self-expandable Wallstents (16 patients) into the tracheobronchial system of 30 patients with combined stenting in 4 patients. Mean age was 51 years (range: 0.5-79 years). Malignant disease was present in 23 patients, benign disease in seven patients. Both patients and individual stents were monitored clinically and radiographically. The probability of stents remaining within the tracheobronchial system, and of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for both stent types. Average stent follow-up time was 112 days until explantation and 115 days until patients' death or discharge. Kaplan-Meier analysis revealed a higher probability for the Wallstent to remain within the tracheobronchial system. Dislocation and compression occurred more rarely. Explantation, however, if desired, was more difficult compared to the Strecker stent. The Wallstent also led to the formation of granulation tissue, especially at the proximal stent end, frequently requiring reintervention. Both stent types proved to be effective therapeutic options in the management of obstructive tracheobronchial disease. The mechanical properties of the Strecker stent seem to be less favorable compared to the Wallstent but removal is easy. For benign disease, however, the Wallstent reveals limitations due to significant side effects
Directory of Open Access Journals (Sweden)
Orlei Ribeiro de Araujo
Full Text Available Antibiotic restriction can be useful in maintaining bacterial susceptibility. The objective of this study was verify if restriction of cefepime, the most frequently used cephalosporin in our neonatal intensive care unit (NICU, would ameliorate broad-spectrum susceptibility of Gram-negative isolates. Nine hundred and ninety-five premature and term newborns were divided into 3 cohorts, according to the prevalence of cefepime use in the unit: Group 1 (n=396 comprised patients admitted from January 2002 to December 2003, period in which cefepime was the most used broad-spectrum antibiotic. Patients in Group 2 (n=349 were admitted when piperacillin/tazobactam replaced cefepime (January to December 2004 and in Group 3 (n=250 when cefepime was reintroduced (January to September 2005. Meropenem was the alternative third-line antibiotic for all groups. Multiresistance was defined as resistance to 2 or more unrelated antibiotics, including necessarily a third or fourth generation cephalosporin, piperacillin/tazobactam or meropenem. Statistics involved Kruskal-Wallis, Mann-Whitney and logrank tests, Kaplan-Meier analysis. Groups were comparable in length of stay, time of mechanical ventilation, gestational age and birth weight. Ninety-eight Gram-negative isolates were analyzed. Patients were more likely to remain free of multiresistant isolates by Kaplan-Meier analysis in Group 2 when compared to Group 1 (p=0.017 and Group 3 (p=0.003. There was also a significant difference in meropenem resistance rates. Cefepime has a greater propensity to select multiresistant Gram-negative pathogens than piperacillin/tazobactam and should not be used extensively in neonatal intensive care.
Post, Carl M; Lin, Chi; Adeberg, Sebastian; Gupta, Mrigank; Zhen, Weining; Verma, Vivek
2018-03-01
The standard of care for T1N0 nasopharyngeal cancer (NPC) is definitive radiation therapy (RT). However, practice patterns in the elderly may not necessarily follow national guidelines. Herein, we investigated national practice patterns for T1N0 NPC. The National Cancer Data Base (NCDB) was queried for clinical T1N0 primary NPC cases (2004-2013) in patients ≥70 years old. Patient, tumor, and treatment parameters were extracted. Kaplan-Meier analysis was used to compare overall survival (OS) between patients receiving RT versus those under observation. Logistic regression was used to examine variables associated with receipt of RT. Cox proportional hazards modeling determined variables associated with OS. Landmark analysis of patients surviving 1 year or more was performed to assess survival differences between groups. In total, data of 147 patients were analyzed. RT was delivered to 89 patients (61%), whereas 58 (39%) patients underwent observation. On multivariable analysis, older patients were less likely to receive RT (p=0.003), but there were no differences between groups in terms of Charlson-Deyo comorbidity index. Median and 5-year OS in patients receiving RT versus those under observation were 71 and 33 months, and 59% and 48% (p=0.011), respectively. For patients surviving 1 year or more (n=96), there was a strong trend showing that receipt of RT was associated with better median and 5-year OS. This National Data Base analysis shows that observation is relatively common for T1N0 NPC in the elderly, but is associated with poorer survival. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
High Expression of PHGDH Predicts Poor Prognosis in Non–Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Jinhong Zhu
2016-12-01
Full Text Available Tumors have exceptionally high demands for energy and anabolism because of their rapid growth. The de novo serine synthesis pathway initiated by phosphoglycerate dehydrogenase (PHGDH has been recognized as a hallmark of metabolic adaption in carcinogenesis. The oncogenic role and prognostic value of PHGDH have been investigated in multiple cancer types, including breast cancer, melanoma, cervical cancer, and colon cancer. Due to the importance of PHGDH in cancer, we attempted to determine the clinical significance of PHGDH in 319 patients with non–small cell lung cancer (NSCLC. We evaluated the mRNA and protein expression levels of PHGDH gene, using quantitative reverse transcriptase polymerase chain reaction and tissue array–based immunohistochemistry, respectively. Significantly increased PHGDH expression in mRNA and protein levels was identified in tumor tissues versus matched adjacent nontumor tissues. More interestingly, immunohistochemical expression of PHGDH was significantly associated with lymph node metastasis (P = .021 and TNM stage (P = .016. Kaplan-Meier survival analysis indicated that NSCLC patients with low levels of PHGDH outperformed patients with high levels of PHGDH regarding 5-year overall survival. Significantly longer survival in the former suggested the prognostic implication of PHGDH in NSCLC. Multivariate survival analysis using Cox regression model demonstrated that high PHGDH levels and advanced TNM stage (III + IV were independent predictors of prognosis in NSCLC. Moreover, bioinformatics analysis confirmed the increase in PHGDH transcripts (data from The Cancer Genome Atlas and its prognostic value (Kaplan-Meier plotter in NSCLC. In conclusion, this study suggested the clinical implication of PHGDH in NSCLC. PHGDH may be a promising therapeutic target in NSCLC.
Prognostic and survival analysis of presbyopia: The healthy twin study
Lira, Adiyani; Sung, Joohon
2015-12-01
Presbyopia, a vision condition in which the eye loses its flexibility to focus on near objects, is part of ageing process which mostly perceptible in the early or mid 40s. It is well known that age is its major risk factor, while sex, alcohol, poor nutrition, ocular and systemic diseases are known as common risk factors. However, many other variables might influence the prognosis. Therefore in this paper we developed a prognostic model to estimate survival from presbyopia. 1645 participants which part of the Healthy Twin Study, a prospective cohort study that has recruited Korean adult twins and their family members based on a nation-wide registry at public health agencies since 2005, were collected and analyzed by univariate analysis as well as Cox proportional hazard model to reveal the prognostic factors for presbyopia while survival curves were calculated by Kaplan-Meier method. Besides age, sex, diabetes, and myopia; the proposed model shows that education level (especially engineering program) also contribute to the occurrence of presbyopia as well. Generally, at 47 years old, the chance of getting presbyopia becomes higher with the survival probability is less than 50%. Furthermore, our study shows that by stratifying the survival curve, MZ has shorter survival with average onset time about 45.8 compare to DZ and siblings with 47.5 years old. By providing factors that have more effects and mainly associate with presbyopia, we expect that we could help to design an intervention to control or delay its onset time.
DEFF Research Database (Denmark)
Andersson, U.; Osterman, P.; Sjostrom, S.
2009-01-01
was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...
Birth interval and its predictors among married women in Dabat ...
African Journals Online (AJOL)
2008-12-30
Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...
Jacobs, Benjamin M.
2009-01-01
This historical study focuses on how John Dewey's theory of education as socialization and Mordecai Kaplan's theory of Judaism as a civilization together served as an ideological base and pedagogical framework for the creation of "progressive," "reconstructed" American Jewish school programs in the early 20th century…
International Nuclear Information System (INIS)
Asher, Anthony L.; Burri, Stuart H.; Wiggins, Walter F.; Kelly, Renee P.; Boltes, Margaret O.; Mehrlich, Melissa; Norton, H. James; Fraser, Robert W.
2014-01-01
Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong
Asher, Anthony L; Burri, Stuart H; Wiggins, Walter F; Kelly, Renee P; Boltes, Margaret O; Mehrlich, Melissa; Norton, H James; Fraser, Robert W
2014-03-15
Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong majority of patients were able to avoid WBRT. NaSRS merits
Energy Technology Data Exchange (ETDEWEB)
Asher, Anthony L., E-mail: asher@cnsa.com [Department of Neurosurgery, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Burri, Stuart H. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Wiggins, Walter F. [Wake Forest School of Medicine MD/PhD Program, Winston-Salem, North Carolina (United States); Kelly, Renee P. [Brain Tumor Fund for the Carolinas, Charlotte, North Carolina (United States); Boltes, Margaret O.; Mehrlich, Melissa [Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Norton, H. James [Department of Biostatistics, Carolinas Medical Center, Charlotte, North Carolina (United States); Fraser, Robert W. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States)
2014-03-15
Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong
DEFF Research Database (Denmark)
Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V
2015-01-01
AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...
Growth pattern of colorectal liver metastasis as a marker of recurrence risk
DEFF Research Database (Denmark)
Eefsen, R L; Vermeulen, P B; Christensen, I J
2015-01-01
from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...
Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe
DEFF Research Database (Denmark)
Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther
2014-01-01
on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...
DEFF Research Database (Denmark)
Kronborg, Mads Brix; Johansen, Jens Brock; Haarbo, Jens
2017-01-01
/mid-ventricular/apical for the LV-LP, and as apical/non-apical for the RV-LP. Appropriate and inappropriate therapies were registered during follow-up via remote monitoring or at device interrogations. Time to event was summarized with Kaplan-Meier plots, and competed risk regression analysis was used to calculate adjusted hazard...... with an apical. We observed no significant association between appropriate therapy and LV-LP in left anterior oblique or right anterior oblique views or inappropriate therapy between any lead positions. Conclusion: An apical RV-LP is associated with an increased risk of appropriate therapy for ventricular...
International Nuclear Information System (INIS)
Fleckenstein, Florian N.; Schernthaner, Ruediger E.; Duran, Rafael; Sohn, Jae Ho; Sahu, Sonia; Zhao, Yan; Hamm, Bernd; Gebauer, Bernhard; Lin, MingDe; Geschwind, Jean-Francois; Chapiro, Julius
2016-01-01
To compare the ability of single- vs. multi-lesion assessment on baseline MRI using 1D- and 3D-based measurements to predict overall survival (OS) in patients with hepatocellular carcinoma (HCC) before transarterial chemoembolization (TACE). This retrospective analysis included 122 patients. A quantitative 3D analysis was performed on baseline MRI to calculate enhancing tumour volume (ETV [cm 3 ]) and enhancing tumour burden (ETB [%]) (ratio between ETV [cm 3 ] and liver volume). Furthermore, enhancing and overall tumour diameters were measured. Patients were stratified into two groups using thresholds derived from the BCLC staging system. Statistical analysis included Kaplan-Meier plots, uni- and multivariate cox proportional hazard ratios (HR) and concordances. All methods achieved good separation of the survival curves (p < 0.05). Multivariate analysis showed an HR of 5.2 (95 % CI 3.1-8.8, p < 0.001) for ETV [cm 3 ] and HR 6.6 (95 % CI 3.7-11.5, p < 0.001) for ETB [%] vs. HR 2.6 (95 % CI 1.2-5.6, p = 0.012) for overall diameter and HR 3.0 (95 % CI 1.5-6.3, p = 0.003) for enhancing diameter. Concordances were highest for ETB [%], with no added predictive power for multi-lesion assessment (difference between concordances not significant). 3D quantitative assessment is a stronger predictor of survival as compared to diameter-based measurements. Assessing multiple lesions provides no substantial improvement in predicting OS than evaluating the dominant lesion alone. (orig.)
Tang, Q; Hu, Q Y; Piao, Y F; Hua, Y H; Chen, X Z
2016-03-23
The aim of the present study was to evaluate the efficacy of three different modalities in treatment of lung oligometastases from nasopharyngeal carcinoma (NPC) after radiotherapy and to identify a more appropriate treatment modality. The clinical data of 87 cases of lung oligometastases from NPC were analyzed retrospectively. Among them, 33 patients underwent local small-field irradiation+ /- chemotherapy, 28 underwent whole-lung irradiation+ chemotherapy, and 26 underwent simple chemotherapy. The survival rates were calculated using Kaplan-Meier analysis. The differences among the modalities were evaluated using the log-rank test. Cox univariate and multivariate analyses were performed to determine the influencing factors. The 3-year lung metastasis survival (LMS) rates of patients with lung metastasis undergoing the three treatment modalities (local small-field irradiation+ /-chemotherapy, whole-lung irradiation+ chemotherapy and chemotherapy alone) were 89.3%, 72.7%, and 72.4%, respectively, showing a significant difference between the groups (P=0.003). Further subgroup analysis showed that the 5-year LMS rate was significantly higher in the local small-field irradiation+ /-chemotherapy group than that in the whole-lung irradiation+ chemotherapy group and chemotherapy alone group (P=0.001). The 2-year progression-free survival (PFS) rates of the three groups were 57.1%, 25.8% and 3.8%, respectively, showing significant intergroup differences (P=0.002 and P<0.001). Multivariate analysis indicated that compared with the whole lung irradiation group and the chemotherapy alone group, the local irradiation+ /- chemotherapy is an independent favorable prognostic factor for LMS and PFS (P<0.05). Local radiotherapy combined with systemic chemotherapy is the best therapeutic modality for lung oligometastases derived from NPC after radiotherapy, improving the LMS and prolonging the PFS.
Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim
2012-01-01
Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Directory of Open Access Journals (Sweden)
Yibeltal Assefa
Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A
2017-09-30
For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Fractionated afterloading therapy in inoperable malignant tumours of the brain
International Nuclear Information System (INIS)
Sparenberg, A.
1987-01-01
With the advent of the method of afterloading the range of uses for fractionated interstitial brady-therapy could be broadened to include malignant cerebral tumours. The mean survival time of 33 female patients was calculated to be 8.3 months for the entire group and 11.3 months for cases not otherwise pretreated. Even though the age, tumour volume, target dose and Karnofsky index obviously tended to influence the survival time, such relationships could not be confirmed statistically. Using the method by Kaplan-Meier it was determined that 65% of the total study group were likely to survive beyond six months and 32% to survive for one year. A separate analysis of patients receiving no previous treatment showed these chances to be 75% and 44%, respectively. The advantages of this therapy are discussed on a comparative basis. (VHE) [de
Role of IKK-alpha in the EGFR Signaling Regulation
2014-09-01
expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100
Ficheur, Grégoire; Ferreira Careira, Lionel; Beuscart, Régis; Chazard, Emmanuel
2015-01-01
Administrative data can be used for the surveillance of the outcomes of implantable medical devices (IMDs). The objective of this work is to build a web-based tool allowing for an exploratory analysis of time-dependent events that may occur after the implementation of an IMD. This tool should enable a pharmacoepidemiologist to explore on the fly the relationship between a given IMD and a potential outcome. This tool mine the French nationwide database of inpatient stays from 2008 to 2013. The data are preprocessed in order to optimize the queries. A web tool is developed in PHP, MySQL and Javascript. The user selects one or a group of IMD from a tree, and can filter the results using years and hospital names. Four result pages describe the selected inpatient stays: (1) temporal and demographic description, (2) a description of the geographical location of the hospital, (3) a description of the geographical place of residence of the patient and (4) a table showing the rehospitalization reasons by decreasing order of frequency. Then, the user can select one readmission reason and display dynamically the probability of readmission by mean of a Kaplan-Meier curve with confidence intervals. This tool enables to dynamically monitor the occurrence of time-dependent complications of IMD.
The prognostic value of family history among patients with urinary bladder cancer.
Egbers, Lieke; Grotenhuis, Anne J; Aben, Katja K; Alfred Witjes, J; Kiemeney, Lambertus A; Vermeulen, Sita H
2015-03-01
A history of urinary bladder cancer (UBC) in first-degree relatives increases UBC risk by twofold. The influence of positive family history on UBC prognosis is unknown. Here, we investigated association of first-degree UBC family history with clinicopathological characteristics and prognosis of UBC patients. Detailed clinical data of 1,465 non-muscle-invasive bladder cancer (NMIBC) and 250 muscle-invasive or metastatic bladder cancer (MIBC) patients, diagnosed from 1995 to 2010, were collected through medical file review. Competing risk analyses were used to compare recurrence-free survival (RFS) and progression-free survival (PFS) of NMIBC patients according to self-reported UBC family history. Overall survival in MIBC patients was estimated using Kaplan-Meier analysis. The added value of family history in prediction of NMIBC prognosis was quantified with Harrell's concordance-index. Hundred (6.8%) NMIBC and 14 (5.6%) MIBC patients reported UBC in first-degree relatives. Positive family history was statistically significantly associated with smaller tumor size and non-significantly with more favorable distribution of other tumor characteristics. In univariable analyses, positive family history correlated with longer RFS (p = 0.11) and PFS (p = 0.04). Hazard ratios for positive vs. negative family history after adjustment for clinicopathological characteristics were 0.75 (95% CI = 0.53-1.07) and 0.45 (95% CI = 0.18-1.12) for RFS and PFS, respectively. Five familial and 48 sporadic MIBC patients (Kaplan-Meier 10-year risk: 41% and 25%) died within 10 years. Family history did not improve the c-index of prediction models. This study shows that a first-degree family history of UBC is not clearly associated with NMIBC prognosis. Family history does not aid in prediction of NMIBC recurrence or progression. © 2014 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.
Directory of Open Access Journals (Sweden)
Vogt A
2011-11-01
Full Text Available Alexander Vogt1, Anke Schoelmerich1, Franziska Pollner1, Manuela Schlitt1, Uwe Raaz1, Lars Maegdefessel2, Iris Reindl1, Michael Buerke1, Karl Werdan1, Axel Schlitt11Department of Medicine III, Martin Luther-University, Halle, Germany; 2Division of Cardiovascular Medicine, Stanford University School of Medicine, Stanford, CA, USAPurpose: The aim of this study was to determine the long-term safety of drug-eluting stent (DES versus bare metal stent (BMS implantation in a “real-world” setting.Patients and methods: A total of 1809 patients who were treated with implantation of either BMS or DES were assessed. Kaplan-Meier and multivariate Cox regression analyses concerning primary endpoint of cardiac mortality were performed.Results: A total of 609 patients received DES. Mean age was 66.2 ± 11.3 years, 69.4% were male, and 1517 (83.8% were treated for acute coronary syndrome (unstable angina 510 [28.2%], non-ST-elevation myocardial infarction [NSTEMI] 506 [28.0%], and ST-elevation myocardial infarction [STEMI] 501 [27.7%]. Mean follow-up was 34 ± 15 months. During follow-up, 268 patients died of cardiac causes (DES 42 [7.3%]; BMS 226 [19.6%]; P < 0.001. Univariate Kaplan-Meier analysis showed an advantage of DES over BMS concerning the primary endpoint (P < 0.001. When adjusting for classic risk factors and additional factors that affect the progression of coronary heart disease (CHD, DES was not found to be superior to BMS (hazard ratio 0.996, 95% confidence interval 0.455–2.182, P = 0.993. Severely impaired renal function was an independent predictor for cardiac mortality after stent implantation.Conclusion: Treatment with DES is safe in the long term, also in patients presenting with STEMI. However, in multivariate analyses it is not superior to BMS treatment.Keywords: coronary stent, outcome, renal insufficiency, myocardial infarction, STEMI
Muzasti, R. A.; Lubis, H. R.
2018-03-01
Phase angle, a parameter by Bioelectrical Impedance Analysis, can detect body composition changes, so it can be used as a prognostic indicator in some chronic conditions. This study was for determining the relationship between PhA and hemodiálisis frequency with the survival of chronic hemodiálisis patients. This longitudinal retrospective study involved 173 chronic hemodiálisis patients at Rasyida Renal Hospital. The Kaplan-Meier method is used to determine the survival. Cox proportional hazard analysis is used to determine which variables significantly increase mortality. During the study period, 89 patients underwent hemodiálysis 3x a week (4 hours/session), and 84 patients underwent HD 2x a week (5 hours/session). Demographic and clinical characteristics in both groups were similar. There was no difference in PhA value in groups of 3x a week and group 2x a week (4.02 ± 1.13 vs 4.25 ± 1.12). Patients with twice a week hemodiálisis had a shorter survival than the 3x week group (35.14 ± 2.76 vs 38.62 ± 3.03) although it was not statistically significant (p = 0.126).
[Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].
Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong
2017-07-01
To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.
Hosseinalipour, S. M.; Raja, A.; Hajikhani, S.
2012-06-01
A full three dimensional Navier - Stokes numerical simulation has been performed for performance analysis of a Kaplan turbine which is installed in one of the Irans south dams. No simplifications have been enforced in the simulation. The numerical results have been evaluated using some integral parameters such as the turbine efficiency via comparing the results with existing experimental data from the prototype Hill chart. In part of this study the numerical simulations were performed in order to calculate the prototype turbine efficiencies in some specific points which comes from the scaling up of the model efficiency that are available in the model experimental Hill chart. The results are very promising which shows the good ability of the numerical techniques for resolving the flow characteristics in these kind of complex geometries. A parametric study regarding the evaluation of turbine performance in three different runner angles of the prototype is also performed and the results are cited in this paper.
Directory of Open Access Journals (Sweden)
Tom Stiff
Full Text Available Mutations in ORC1, ORC4, ORC6, CDT1, and CDC6, which encode proteins required for DNA replication origin licensing, cause Meier-Gorlin syndrome (MGS, a disorder conferring microcephaly, primordial dwarfism, underdeveloped ears, and skeletal abnormalities. Mutations in ATR, which also functions during replication, can cause Seckel syndrome, a clinically related disorder. These findings suggest that impaired DNA replication could underlie the developmental defects characteristic of these disorders. Here, we show that although origin licensing capacity is impaired in all patient cells with mutations in origin licensing component proteins, this does not correlate with the rate of progression through S phase. Thus, the replicative capacity in MGS patient cells does not correlate with clinical manifestation. However, ORC1-deficient cells from MGS patients and siRNA-mediated depletion of origin licensing proteins also have impaired centrosome and centriole copy number. As a novel and unexpected finding, we show that they also display a striking defect in the rate of formation of primary cilia. We demonstrate that this impacts sonic hedgehog signalling in ORC1-deficient primary fibroblasts. Additionally, reduced growth factor-dependent signaling via primary cilia affects the kinetics of cell cycle progression following cell cycle exit and re-entry, highlighting an unexpected mechanism whereby origin licensing components can influence cell cycle progression. Finally, using a cell-based model, we show that defects in cilia function impair chondroinduction. Our findings raise the possibility that a reduced efficiency in forming cilia could contribute to the clinical features of MGS, particularly the bone development abnormalities, and could provide a new dimension for considering developmental impacts of licensing deficiency.
Disciplinary action against physicians: who is likely to get disciplined?
Khaliq, Amir A; Dimassi, Hani; Huang, Chiung-Yu; Narine, Lutchmie; Smego, Raymond A
2005-07-01
We sought to determine the characteristics of disciplined physicians at-large and the risk of disciplinary action over time and to report the type and frequency of complaints and the nature of disciplinary actions against allopathic physicians in Oklahoma. Descriptive statistics, Kaplan-Meier analysis, and Cox proportional hazards modeling of publicly available data on physicians licensed by the Oklahoma Board of Medical Licensure and Supervision. Among 14,314 currently or previously licensed physicians, 396 (2.8%) had been disciplined. Using univariate proportional hazards analysis, men (P disciplinary action compared to US medical graduates (P disciplinary action, medical schools and residency training programs must continue to emphasize both patient care and medical professionalism as critical core competencies.
Freeman, Randall J; Li, Yuanzhang; Niebuhr, David W
2011-05-01
The estimated incidence of idiopathic venous thromboembolism (IVTE) cases in the United States ranges from 24,000 to 282,000/year. This analysis explores the incidence and prevalence of IVTE in the military and if cases experience increased attrition. The Defense Medical Surveillance System was searched for incident IVTE cases from 1998 through 2007. Enlisted cases were each matched to 3 controls. Kaplan-Meier survival analysis and Cox proportional hazard modeling were performed. We matched 463 cases to 1,389 controls. Outpatient IVTE rates have increased markedly from 1998 through 2007. Cases of all-cause attrition risk (0.56 [95% CI = 0.44, 0.72]) and rates were significantly less than controls (p readiness, and medical costs.
Waters, Eugenie; Dingle, Brian; Rodrigues, George; Vincent, Mark; Ash, Robert; Dar, Rashid; Inculet, Richard; Kocha, Walter; Malthaner, Richard; Sanatani, Michael; Stitt, Larry; Yaremko, Brian; Younus, Jawaid; Yu, Edward
2010-07-01
The London Regional Cancer Program (LRCP) uses a unique schedule of induction plus concurrent chemoradiation, termed VCRT (vinblastine, cisplatin, and radiation therapy), for the treatment of a subset of unresectable stage IIIA and IIIB non-small-cell lung cancer (NSCLC). This analysis was conducted to better understand the outcomes in VCRT-treated patients. We report a retrospective analysis of a large cohort of patients who underwent VCRT at the LRCP over a 10-year period, from 1996 to 2006. The analysis focused on OS, toxicities, and the outcomes from completion surgery in a small subset of patients. A total of 294 patients were included and 5-year OS, determined using Kaplan-Meier methodology, was 19.8% with a MST of 18.2 months. Reported grade 3-4 toxicities included neutropenia (39%), anemia (10%), pneumonitis (1%), and esophagitis (3%). Significant differences in survival between groups of patients were demonstrated with log-rank tests for completion surgery, use of radiation therapy, and cisplatin dose. Similarly, Univariate Cox regression showed that completion surgery, use of radiation therapy, cisplatin dose, and vinblastine dose were associated with increased survival. This retrospective analysis of a large cohort of patients reveals an OS for VCRT comparable to that reported in the literature for other current combined chemoradiation protocols. The success of this protocol seems to be dose dependent and the outcomes in those who underwent completion surgery suggests that pathologic complete remission is possible for IIIA and IIIB NSCLC.
Zhang, Linlin; Guo, Shang; Schwab, Joseph H; Nielsen, G Petur; Choy, Edwin; Ye, Shunan; Zhang, Zhan; Mankin, Henry; Hornicek, Francis J; Duan, Zhenfeng
2013-01-01
Brachyury is a marker for notochord-derived tissues and neoplasms, such as chordoma. However, the prognostic relevance of brachyury expression in chordoma is still unknown. The improvement of tissue microarray technology has provided the opportunity to perform analyses of tumor tissues on a large scale in a uniform and consistent manner. This study was designed with the use of tissue microarray to determine the expression of brachyury. Brachyury expression in chordoma tissues from 78 chordoma patients was analyzed by immunohistochemical staining of tissue microarray. The clinicopathologic parameters, including gender, age, location of tumor and metastatic status were evaluated. Fifty-nine of 78 (75.64%) tumors showed nuclear staining for brachyury, and among them, 29 tumors (49.15%) showed 1+ (mobile spine. However, there was no significant relationship between brachyury expression and other clinical variables. By Kaplan-Meier analysis, brachyury expression failed to produce any significant relationship with the overall survival rate. In conclusion, brachyury expression is not a prognostic indicator in chordoma.
Skull base chordomas: analysis of dose-response characteristics
International Nuclear Information System (INIS)
Niemierko, Andrzej; Terahara, Atsuro; Goitein, Michael
1997-01-01
Objective: To extract dose-response characteristics from dose-volume histograms and corresponding actuarial survival statistics for 115 patients with skull base chordomas. Materials and Methods: We analyzed data for 115 patients with skull base chordoma treated with combined photon and proton conformal radiotherapy to doses in the range 66.6Gy - 79.2Gy. Data set for each patient included gender, histology, age, tumor volume, prescribed dose, overall treatment time, time to recurrence or time to last observation, target dose-volume histogram, and several dosimetric parameters (minimum/mean/median/maximum target dose, percent of the target volume receiving the prescribed dose, dose to 90% of the target volume, and the Equivalent Uniform Dose (EUD). Data were analyzed using the Kaplan-Meier survivor function estimate, the proportional hazards (Cox) model, and parametric modeling of the actuarial probability of recurrence. Parameters of dose-response characteristics were obtained using the maximum likelihood method. Results: Local failure developed in 42 (36%) of patients, with actuarial local control rates at 5 years of 59.2%. The proportional hazards model revealed significant dependence of gender on the probability of recurrence, with female patients having significantly poorer prognosis (hazard ratio of 2.3 with the p value of 0.008). The Wilcoxon and the log-rank tests of the corresponding Kaplan-Meier recurrence-free survival curves confirmed statistical significance of this effect. The Cox model with stratification by gender showed significance of tumor volume (p=0.01), the minimum target dose (p=0.02), and the EUD (p=0.02). Other parameters were not significant at the α level of significance of 0.05, including the prescribed dose (p=0.21). Parametric analysis using a combined model of tumor control probability (to account for non-uniformity of target dose distribution) and the Weibull failure time model (to account for censoring) allowed us to estimate
Sublobar resection is equivalent to lobectomy for clinical stage 1A lung cancer in solid nodules.
Altorki, Nasser K; Yip, Rowena; Hanaoka, Takaomi; Bauer, Thomas; Aye, Ralph; Kohman, Leslie; Sheppard, Barry; Thurer, Richard; Andaz, Shahriyour; Smith, Michael; Mayfield, William; Grannis, Fred; Korst, Robert; Pass, Harvey; Straznicka, Michaela; Flores, Raja; Henschke, Claudia I
2014-02-01
A single randomized trial established lobectomy as the standard of care for the surgical treatment of early-stage non-small cell lung cancer. Recent advances in imaging/staging modalities and detection of smaller tumors have once again rekindled interest in sublobar resection for early-stage disease. The objective of this study was to compare lung cancer survival in patients with non-small cell lung cancer with a diameter of 30 mm or less with clinical stage 1 disease who underwent lobectomy or sublobar resection. We identified 347 patients diagnosed with lung cancer who underwent lobectomy (n = 294) or sublobar resection (n = 53) for non-small cell lung cancer manifesting as a solid nodule in the International Early Lung Cancer Action Program from 1993 to 2011. Differences in the distribution of the presurgical covariates between sublobar resection and lobectomy were assessed using unadjusted P values determined by logistic regression analysis. Propensity scoring was performed using the same covariates. Differences in the distribution of the same covariates between sublobar resection and lobectomy were assessed using adjusted P values determined by logistic regression analysis with adjustment for the propensity scores. Lung cancer-specific survival was determined by the Kaplan-Meier method. Cox survival regression analysis was used to compare sublobar resection with lobectomy, adjusted for the propensity scores, surgical, and pathology findings, when adjusted and stratified by propensity quintiles. Among 347 patients, 10-year Kaplan-Meier for 53 patients treated by sublobar resection compared with 294 patients treated by lobectomy was 85% (95% confidence interval, 80-91) versus 86% (confidence interval, 75-96) (P = .86). Cox survival analysis showed no significant difference between sublobar resection and lobectomy when adjusted for propensity scores or when using propensity quintiles (P = .62 and P = .79, respectively). For those with cancers 20 mm or less in
An electronic health record-enabled obesity database
Directory of Open Access Journals (Sweden)
Wood G
2012-05-01
Full Text Available Abstract Background The effectiveness of weight loss therapies is commonly measured using body mass index and other obesity-related variables. Although these data are often stored in electronic health records (EHRs and potentially very accessible, few studies on obesity and weight loss have used data derived from EHRs. We developed processes for obtaining data from the EHR in order to construct a database on patients undergoing Roux-en-Y gastric bypass (RYGB surgery. Methods Clinical data obtained as part of standard of care in a bariatric surgery program at an integrated health delivery system were extracted from the EHR and deposited into a data warehouse. Data files were extracted, cleaned, and stored in research datasets. To illustrate the utility of the data, Kaplan-Meier analysis was used to estimate length of post-operative follow-up. Results Demographic, laboratory, medication, co-morbidity, and survey data were obtained from 2028 patients who had undergone RYGB at the same institution since 2004. Pre-and post-operative diagnostic and prescribing information were available on all patients, while survey laboratory data were available on a majority of patients. The number of patients with post-operative laboratory test results varied by test. Based on Kaplan-Meier estimates, over 74% of patients had post-operative weight data available at 4 years. Conclusion A variety of EHR-derived data related to obesity can be efficiently obtained and used to study important outcomes following RYGB.
Post, Wendy; Moser, Marvin; Kaplan, Norman
2005-10-01
Following a hypertension symposium in Baltimore, MD, on June 1, 2005, Dr. Wendy Post from the Johns Hopkins University School of Medicine, Baltimore, MD, had the opportunity to interview two of the outstanding hypertension experts in the United States on several controversial issues in hypertension management. Dr. Norman Kaplan is Clinical Professor of Medicine at the Southwestern Health Science Center in Dallas, TX, and Dr. Marvin Moser is Clinical Professor of Medicine at the Yale University School of Medicine, New Haven, CT. Both have been leaders in the field of hypertension treatment and education for more than 40 years. Dr. Kaplan's book Clinical Hypertension has been a standard textbook since 1973 and is now in its ninth edition. Dr. Marvin Moser was the Senior Medical Consultant to the National High Blood Pressure Education Program from 1974 to 2002 and was Chairman of the first Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure and a member of the six subsequent committees. His book Clinical Management of Hypertension is in its seventh edition. Drs. Moser and Kaplan were corecipients of the 2004 International Society of Hypertension Award for Outstanding Contributions to Hypertension Treatment and Education and have lectured extensively throughout the United States and overseas.
Jain, Mamta K; Seremba, Emmanuel; Bhore, Rafia; Dao, Doan; Joshi, Reeti; Attar, Nahid; Yuan, He-Jun; Lee, William M
2012-02-01
Noninvasive markers of liver fibrosis, measured at baseline, have been shown to predict liver-related mortality. It remains unknown if a change in the value of the scores over time predicts mortality in patients with HIV and viral hepatitis. In this retrospective study, survival in HIV/hepatitis B virus (HBV; n = 67), HIV/hepatitis C virus (HCV; n = 43), and HIV/HBV/HCV (n = 41) patients was examined using Kaplan-Meier life table analysis. Aspartate aminotransferase (AST)-to-platelet ratio index (APRI) and FIB-4 scores, two noninvasive markers of liver fibrosis, were calculated at baseline and at last available clinical follow-up to determine the change in fibrosis score. Factors associated with mortality were assessed by Cox proportional hazards, including the change in the noninvasive marker score between the two time points. All-cause mortality was determined by Social Security Death Index and chart review. Sixty-seven were coinfected with HIV/HBV, 43 with HIV/HCV, and 41 were triply infected (HIV/HBV/HCV). Kaplan-Meier analysis showed similar survival for the three groups at 7 years of follow-up (p = 0.10). However, median length of follow-up was lower in HIV/HCV (60.5; range 0-102) compared to HIV/HBV (75.7; 12.3-126.5) and HIV/HBV/HCV (80.0; 2.7-123) months, respectively, p = 0.02. Baseline fibrosis score (p = 0.002), an increase in the value for noninvasive measurements for fibrosis (p < 0.001), and the presence of HIV/HCV coinfection (p = 0.041) were each associated with higher risk for mortality. Baseline fibrosis score (p = 0.03) and an increase in FIB-4 score (p = 0.05) were independent predictors of all-cause mortality, but liver-related mortality was not evaluated. In this study, baseline fibrosis score was predictive of 7-year all-cause mortality. Further studies are needed in a prospective cohort to evaluate the predictive value of monitoring changes in fibrosis scores over time to predict mortality in patients with viral hepatitis.
Directory of Open Access Journals (Sweden)
Wan-Chen Yu
Full Text Available We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan.This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI, geriatric syndromes, activities of daily living (ADL using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE. Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk.Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years. Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038 or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002 after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition.Physical disability
Yu, Wan-Chen; Chou, Ming-Yueh; Peng, Li-Ning; Lin, Yu-Te; Liang, Chih-Kuang; Chen, Liang-Kung
2017-01-01
We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan. This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI), geriatric syndromes, activities of daily living (ADL) using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE). Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk. Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years). Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038) or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002) after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition. Physical disability is a major
The long-term outcomes of epilepsy surgery
Keller, Simon; Nicolson, Andrew; Biswas, Shubhabrata; Smith, David; Osman Farah, Jibril; Eldridge, Paul; Wieshmann, Udo
2018-01-01
Objective Despite modern anti-epileptic drug treatment, approximately 30% of epilepsies remain medically refractory and for these patients, epilepsy surgery may be a treatment option. There have been numerous studies demonstrating good outcome of epilepsy surgery in the short to median term however, there are a limited number of studies looking at the long-term outcomes. The aim of this study was to ascertain the long-term outcome of resective epilepsy surgery in a large neurosurgery hospital in the U.K. Methods This a retrospective analysis of prospectively collected data. We used the 2001 International League Against Epilepsy (ILAE) classification system to classify seizure freedom and Kaplan-Meier survival analysis to estimate the probability of seizure freedom. Results We included 284 patients who underwent epilepsy surgery (178 anterior temporal lobe resections, 37 selective amygdalohippocampectomies, 33 temporal lesionectomies, 36 extratemporal lesionectomies), and had a prospective median follow-up of 5 years (range 1–27). Kaplan-Meier estimates showed that 47% (95% CI 40–58) remained seizure free (apart from simple partial seizures) at 5 years and 38% (95% CI 31–45) at 10 years after surgery. 74% (95% CI 69–80) had a greater than 50% seizure reduction at 5 years and 70% (95% CI 64–77) at 10 years. Patients who had an amygdalohippocampectomy were more likely to have seizure recurrence than patients who had an anterior temporal lobe resection (p = 0.006) and temporal lesionectomy (p = 0.029). There was no significant difference between extra temporal and temporal lesionectomies. Hippocampal sclerosis was associated with a good outcome but declined in relative frequency over the years. Conclusion The vast majority of patients who were not seizure free experienced at least a substantial and long-lasting reduction in seizure frequency. A positive long-term outcome after epilepsy surgery is possible for many patients and especially those with
Artim-Esen, Bahar; Çene, Erhan; Şahinkaya, Yasemin; Ertan, Semra; Pehlivan, Özlem; Kamali, Sevil; Gül, Ahmet; Öcal, Lale; Aral, Orhan; Inanç, Murat
2014-07-01
Associations between autoantibodies and clinical features have been described in systemic lupus erythematosus (SLE). Herein, we aimed to define autoantibody clusters and their clinical correlations in a large cohort of patients with SLE. We analyzed 852 patients with SLE who attended our clinic. Seven autoantibodies were selected for cluster analysis: anti-DNA, anti-Sm, anti-RNP, anticardiolipin (aCL) immunoglobulin (Ig)G or IgM, lupus anticoagulant (LAC), anti-Ro, and anti-La. Two-step clustering and Kaplan-Meier survival analyses were used. Five clusters were identified. A cluster consisted of patients with only anti-dsDNA antibodies, a cluster of anti-Sm and anti-RNP, a cluster of aCL IgG/M and LAC, and a cluster of anti-Ro and anti-La antibodies. Analysis revealed 1 more cluster that consisted of patients who did not belong to any of the clusters formed by antibodies chosen for cluster analysis. Sm/RNP cluster had significantly higher incidence of pulmonary hypertension and Raynaud phenomenon. DsDNA cluster had the highest incidence of renal involvement. In the aCL/LAC cluster, there were significantly more patients with neuropsychiatric involvement, antiphospholipid syndrome, autoimmune hemolytic anemia, and thrombocytopenia. According to the Systemic Lupus International Collaborating Clinics damage index, the highest frequency of damage was in the aCL/LAC cluster. Comparison of 10 and 20 years survival showed reduced survival in the aCL/LAC cluster. This study supports the existence of autoantibody clusters with distinct clinical features in SLE and shows that forming clinical subsets according to autoantibody clusters may be useful in predicting the outcome of the disease. Autoantibody clusters in SLE may exhibit differences according to the clinical setting or population.
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
Schmidt, H.; Kirschner, O.; Riedelbauch, S.; Necker, J.; Kopf, E.; Rieg, M.; Arantes, G.; Wessiak, M.; Mayrhuber, J.
2014-03-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation.
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
International Nuclear Information System (INIS)
Schmidt, H; Kirschner, O; Riedelbauch, S; Necker, J; Kopf, E; Rieg, M; Arantes, G; Wessiak, M; Mayrhuber, J
2014-01-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation
Development of low head Kaplan turbine for power station rehabilitation project
Lim, S. M.; Ohtake, N.; Kurosawa, S.; Suzuki, T.; Yamasaki, T.; Nishi, H.
2012-11-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Development of low head Kaplan turbine for power station rehabilitation project
International Nuclear Information System (INIS)
Lim, S M; Ohtake, N; Kurosawa, S; Suzuki, T; Yamasaki, T; Nishi, H
2012-01-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Directory of Open Access Journals (Sweden)
Coco Claudio
2012-09-01
Full Text Available Abstract Background Expression levels of CD133, a cancer stem cell marker, and of the α-subunit of the dystroglycan (α-DG complex, have been previously reported to be altered in colorectal cancers. Methods Expression levels of CD133 and α-DG were assessed by immunohistochemistry in a series of colon cancers and their prognostic significance was evaluated. Results Scattered cells positive for CD133 were rarely detected at the bases of the crypts in normal colonic mucosa while in cancer cells the median percentage of positive cells was 5% (range 0–80. A significant correlation was observed with pT parameter and tumor stage but not with tumor grade and N status. Recurrence and death from disease were significantly more frequent in CD133-high expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor groups for both disease-free (p = 0.002 and overall (p = 0.008 survival. Expression of α-DG was reduced in a significant fraction of tumors but low α-DG staining did not correlate with any of the classical clinical-pathological parameters. Recurrence and death from the disease were significantly more frequent in α-DG-low expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor tumors for both disease-free (p = 0.02 and overall (p = 0.02 survival. Increased expression of CD133, but not loss of α-DG, confirmed to be an independent prognostic parameters at a multivariate analysis associated with an increased risk of recurrence (RR = 2.4; p = 0.002 and death (RR = 2.3; p = 0.003. Conclusions Loss of α-DG and increased CD133 expression are frequent events in human colon cancer and evaluation of CD133 expression could help to identify high-risk colon cancer patients.
International Nuclear Information System (INIS)
Zhu Yueqi; Li Minghua; Fang Chun; Wang Wu; Zhang Peilei; Cheng Yingsheng; Tan Huaqiao; Wang Jianbo
2010-01-01
Objective: Complicated aneurysms located in the cisternal segment of the internal carotid artery(ICA-CSA) present unique therapeutic difficulties. This study is to discuss the feasibility of the Willis stent-graft in treating complicated ICA-CSA by comparing its effect with that of coiling therapy. Methods: Willis covered stents were employed in 19 complicated ICA-CSAs (group A), while coils were used in 17 complicated ICA-CSAs (group B). Follow-up angiography was performed to investigate aneurysm recurrence, endoleak and parent artery (PA) stenosis. Kaplan-Meier curves were constructed to compare the recurrence-free and PA stenosis-free rate in both groups. Results: Total exclusion was immediately achieved in 13 ICA-CSAs and minor endoleaks presented in 5 cases in group A. Total or near-total occlusion was achieved in 7 ICA-CSAs, subtotal occlusion in 8 and partial occlusion in 2 cases in group B after coiling. Acute thrombosis occurred in 1 patient in either group and re-hemorrhage happened in 1 patient after coiling. Follow-up angiography in group A revealed that 16 ICA-CSAs were completely isolated, with two parent arteries showing mild in-stent stenosis. Eighteen months after the procedure, Kaplan-Meier analysis showed that the recurrence-free rate was 93.3% and 50%, while the stenosis-free rate of parent artery was 87.5% and 100% in group A and in Group B, respectively. In group A and group Bthe clinical neurological symptoms were fully recovered in 9 and 9, obviously improved in 3 and 5, unchanged in 2 and 2, and aggravated in one and 0 patients, respectively. Conclusion: The implantation of Willis stent-graft is a feasible endovascular therapy for complicated ICA-CSAs. When the parent artery is very tortuous or when the risk that a main collateral branch may be wrongly covered and occluded is present, the implantation of Willis covered stent can not be taken as the treatment of first choice. (authors)
Energy Technology Data Exchange (ETDEWEB)
Young, M; Craft, D [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States)
2016-06-15
Purpose: To develop an efficient, pathway-based classification system using network biology statistics to assist in patient-specific response predictions to radiation and drug therapies across multiple cancer types. Methods: We developed PICS (Pathway Informed Classification System), a novel two-step cancer classification algorithm. In PICS, a matrix m of mRNA expression values for a patient cohort is collapsed into a matrix p of biological pathways. The entries of p, which we term pathway scores, are obtained from either principal component analysis (PCA), normal tissue centroid (NTC), or gene expression deviation (GED). The pathway score matrix is clustered using both k-means and hierarchical clustering, and a clustering is judged by how well it groups patients into distinct survival classes. The most effective pathway scoring/clustering combination, per clustering p-value, thus generates various ‘signatures’ for conventional and functional cancer classification. Results: PICS successfully regularized large dimension gene data, separated normal and cancerous tissues, and clustered a large patient cohort spanning six cancer types. Furthermore, PICS clustered patient cohorts into distinct, statistically-significant survival groups. For a suboptimally-debulked ovarian cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00127) showed significant improvement over that of a prior gene expression-classified study (p = .0179). For a pancreatic cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00141) showed significant improvement over that of a prior gene expression-classified study (p = .04). Pathway-based classification confirmed biomarkers for the pyrimidine, WNT-signaling, glycerophosphoglycerol, beta-alanine, and panthothenic acid pathways for ovarian cancer. Despite its robust nature, PICS requires significantly less run time than current pathway scoring methods. Conclusion: This work validates the PICS method to improve
Directory of Open Access Journals (Sweden)
Anissa Gramatges Ortiz
2002-08-01
Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated
Fazeli, Bahare; Ravari, Hassan; Assadi, Reza
2012-08-01
The aim of this study was first to describe the natural history of Buerger's disease (BD) and then to discuss a clinical approach to this disease based on multivariate analysis. One hundred eight patients who corresponded with Shionoya's criteria were selected from 2000 to 2007 for this study. Major amputation was considered the ultimate adverse event. Survival analyses were performed by Kaplan-Meier curves. Independent variables including gender, duration of smoking, number of cigarettes smoked per day, minor amputation events and type of treatments, were determined by multivariate Cox regression analysis. The recorded data demonstrated that BD may present in four forms, including relapsing-remitting (75%), secondary progressive (4.6%), primary progressive (14.2%) and benign BD (6.2%). Most of the amputations occurred due to relapses within the six years after diagnosis of BD. In multivariate analysis, duration of smoking of more than 20 years had a significant relationship with further major amputation among patients with BD. Smoking cessation programs with experienced psychotherapists are strongly recommended for those areas in which Buerger's disease is common. Patients who have smoked for more than 20 years should be encouraged to quit smoking, but should also be recommended for more advanced treatment for limb salvage.
Boynton, Grace E; Raoof, Duna; Niziol, Leslie M; Hussain, Munira; Mian, Shahzad I
2015-07-01
To evaluate the safety and efficacy of topical loteprednol etabonate (LE) 0.5% compared with cyclosporine A (CsA) 0.05% for the prophylaxis and treatment of dry eye syndrome (DES) after hematopoietic stem cell transplantation (HSCT). Seventy-five patients were randomized to LE (n = 76 eyes of 38 patients) or CsA (n = 74 eyes of 37 patients) pre-HSCT. Lissamine green and fluorescein staining, tear break-up time, tear osmolarity (Osm), Schirmer score (Sch), intraocular pressure, visual acuity, and Ocular Surface Disease Index were assessed pre-HSCT, 3, 6, 9, and 12 months post-HSCT. There were no differences in DES incidence (P = 0.22; log-rank test) or progression (P = 0.41; log-rank test) between the 2 treatment arms during the course of the study. Among eyes with no DES at enrollment, the Kaplan-Meier analysis yielded a 90% rate of DES development in cyclosporine-treated eyes and a 79% rate of DES development in LE-treated eyes by 12 months post-HSCT. The Kaplan-Meier analysis of eyes with DES at enrollment demonstrated a 38% rate of disease progression among cyclosporine-treated eyes and a 26% rate of disease progression among loteprednol-treated eyes by 12 months. No patient in either group had an elevation of 10 mm Hg or greater from baseline at any study visit, and no patients had their treatment discontinued for elevation in intraocular pressure. Pre-HSCT initiation of LE 0.5% appears to be safe and may be as effective as CsA 0.5% for the treatment and prophylaxis of DES following HSCT.
Evaluation of success after second Ahmed glaucoma valve implantation.
Nilforushan, Naveed; Yadgari, Maryam; Jazayeri, Anis Alsadat; Karimi, Nasser
2016-03-01
To evaluate the outcome of the second Ahmed glaucoma valve (AGV) surgery in eyes with failed previous AGV surgery. Retrospective case series. Following chart review, 36 eyes of 34 patients with second AGV implantation were enrolled in this study. The primary outcome measure was surgical success defined in terms of intraocular pressure (IOP) control using two criteria: Success was defined as IOP ≤21 mmHg (criterion 1) and IOP ≤16 mmHg (criterion 2), with at least 20% reduction in IOP, either with no medication (complete success) or with no more than two medications (qualified success). Kaplan-Meier survival analysis was used to determine the probability of surgical success. The average age of the patients was 32.7 years (range 4-65), and the mean duration of follow-up was 21.4 months (range 6-96). Preoperatively, the mean IOP was 26.94 mmHg (standard deviation [SD] 7.03), and the patients were using 2.8 glaucoma medications on average (SD 0.9). The mean IOP decreased significantly to 13.28 mmHg (SD 3.59) at the last postoperative visit (P = 0.00) while the patients needed even fewer glaucoma medications on average (1.4 ± 1.1, P = 0.00). Surgical success of second glaucoma drainage devices (Kaplan-Meier analysis), according to criterion 1, at 6, 12, 18, and 42 months was 94%, 85%, 80%, and 53% respectively, and according to criterion 2, was 94%, 85%, 75%, and 45%, respectively. Repeated AGV implantation seems to be a safe modality of treatment with acceptable success rate in cases with failed previous AGV surgery.
International Nuclear Information System (INIS)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel; Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano; Mar Munoz Sanchez, Maria del; Alvarez Cabellos, Ruth; Espinosa Aunion, Ruth
2015-01-01
To explore the relationship between basal 18 F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent 18 F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with 18 F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel [University General Hospital, Nuclear Medicine Department, Ciudad Real (Spain); Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano [University of Castilla-La Mancha, Department of Mathematics, Ciudad Real (Spain); Mar Munoz Sanchez, Maria del [Virgen de la Luz Hospital, Oncology Department, Cuenca (Spain); Alvarez Cabellos, Ruth [Virgen de la Salud Hospital, Oncology Department, Toledo (Spain); Espinosa Aunion, Ruth [La Mancha Centro Hospital, Oncology Department, Ciudad Real (Spain)
2015-11-15
To explore the relationship between basal {sup 18}F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent {sup 18}F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with {sup 18}F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Donati, Gabriele; Cianciolo, Giuseppe; Mauro, Raffaella; Rucci, Paola; Scrivo, Anna; Marchetti, Antonio; Giampalma, Emanuela; Golfieri, Rita; Panicali, Laura; Iorio, Mario; Stella, Andrea; La Manna, Gaetano; Stefoni, Sergio
2015-02-01
Vascular access-related complications are still one of the leading causes of morbidity in hemodialysis patients. The aim of this study was to compare polytetrafluoroethylene (PTFE) grafts versus tunneled cuffed permanent catheters (TCCs) in terms of vascular access and patients' survival. An observational study was carried out with a 2-year follow-up. Eighty-seven chronic hemodialysis patients were enrolled: 31 with a PTFE graft as vascular access for hemodialysis versus 56 with a TCC. Patients' mean age was 63.8 ± 14.6 (grafts) versus 73.5 ± 11.3 years (TCCs), P = 0.001. Significantly more patients with TCC had atrial fibrillation than patients with grafts (30.3% versus 6.5%, P = 0.01). In an unadjusted Kaplan-Meier analysis, median TCC survival at 24 months was 5.4 months longer than that of PTFE grafts but not significantly (log-rank test = 1.3, P = ns). In a Cox regression analysis adjusted for age, gender, number of previous vascular accesses, diabetes, atrial fibrillation, smoking, and any complication, this lack of significant difference in survival of the vascular access between TCC and PTFE groups was confirmed and diabetes proved to be an independent risk factor for the survival of both vascular accesses considered (P = 0.02). In an unadjusted Kaplan-Meier analysis, a higher mortality was found in the TCC group than in the PTFE group at 24 months (log-rank test = 10.07, P PTFE grafts. When an arteriovenous fistula (AVF) is not possible, PTFE grafts can be considered the vascular access of second choice, whereas TCCs can be used when an AVF or PTFE graft are not feasible or as a bridge to AVF or PTFE graft creation. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.
Setting the stage for medieval plague: Pre-black death trends in survival and mortality.
DeWitte, Sharon N
2015-11-01
The 14(th) -century Black Death was one of the most devastating epidemics in human history, killing tens of millions of people in a short period of time. It is not clear why mortality rates during the epidemic were so high. One possibility is that the affected human populations were particularly stressed in the 14(th) century, perhaps as a result of repeated famines in areas such as England. This project examines survival and mortality in two pre-Black Death time periods, 11-12(th) centuries vs 13(th) century CE, to determine if demographic conditions were deteriorating before the epidemic occurred. This study is done using a sample of individuals from several London cemeteries that have been dated, in whole or in part, either to the 11-12(th) centuries (n = 339) or 13(th) century (n = 258). Temporal trends in survivorship and mortality are assessed via Kaplan-Meier survival analysis and by modeling time period as a covariate affecting the Gompertz hazard of adult mortality. The age-at-death distributions from the two pre-Black Death time periods are significantly different, with fewer older adults in 13(th) century. The results of Kaplan-Meier survival analysis indicate reductions in survival before the Black Death, with significantly lower survival in the 13(th) century (Mantel Cox p < 0.001). Last, hazard analysis reveals increases in mortality rates before the Black Death. Together, these results suggest that health in general was declining in the 13(th) century, and this might have led to high mortality during the Black Death. This highlights the importance of considering human context to understand disease in past and living human populations. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Baumann, Brian C.; He, Jiwei; Hwang, Wei-Ting; Tucker, Kai N.; Bekelman, Justin E.; Herr, Harry W.; Lerner, Seth P.; Guzzo, Thomas J.; Malkowicz, S. Bruce; Christodouleas, John P.
2016-01-01
Purpose: To inform prospective trials of adjuvant radiation therapy (adj-RT) for bladder cancer after radical cystectomy, a locoregional failure (LF) risk stratification was proposed. This stratification was developed and validated using surgical databases that may not reflect the outcomes expected in prospective trials. Our purpose was to assess sources of bias that may affect the stratification model's validity or alter the LF risk estimates for each subgroup: time bias due to evolving surgical techniques; trial accrual bias due to inclusion of patients who would be ineligible for adj-RT trials because of early disease progression, death, or loss to follow-up shortly after cystectomy; bias due to different statistical methods to estimate LF; and subgrouping bias due to different definitions of the LF subgroups. Methods and Materials: The LF risk stratification was developed using a single-institution cohort (n=442, 1990-2008) and the multi-institutional SWOG 8710 cohort (n=264, 1987-1998) treated with radical cystectomy with or without chemotherapy. We evaluated the sensitivity of the stratification to sources of bias using Fine-Gray regression and Kaplan-Meier analyses. Results: Year of radical cystectomy was not associated with LF risk on univariate or multivariate analysis after controlling for risk group. By use of more stringent inclusion criteria, 26 SWOG patients (10%) and 60 patients from the single-institution cohort (14%) were excluded. Analysis of the remaining patients confirmed 3 subgroups with significantly different LF risks with 3-year rates of 7%, 17%, and 36%, respectively (P<.01), nearly identical to the rates without correcting for trial accrual bias. Kaplan-Meier techniques estimated higher subgroup LF rates than competing risk analysis. The subgroup definitions used in the NRG-GU001 adj-RT trial were validated. Conclusions: These sources of bias did not invalidate the LF risk stratification or substantially change the model's LF estimates.
Factors affecting commencement and cessation of smoking behaviour in Malaysian adults
Directory of Open Access Journals (Sweden)
Ghani Wan
2012-03-01
Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.
International Nuclear Information System (INIS)
Mishra, Kavita K.; Daftari, Inder K.; Weinberg, Vivian; Cole, Tia; Quivey, Jeanne M.; Castro, Joseph R.; Phillips, Theodore L.; Char, Devron H.
2013-01-01
Purpose: To determine neovascular glaucoma (NVG) incidence and identify contributing tumor and dosing factors in uveal melanoma patients treated with proton beam radiation therapy (PBRT). Methods and Materials: A total of 704 PBRT patients treated by a single surgeon (DHC) for uveal melanoma (1996-2010) were reviewed for NVG in our prospectively maintained database. All patients received 56 GyE in 4 fractions. Median follow-up was 58.3 months. Analyses included the Kaplan-Meier method to estimate NVG distributions, univariate log–rank tests, and Cox's proportional hazards multivariate analysis using likelihood ratio tests to identify independent risk factors of NVG among patient, tumor, and dose–volume histogram parameters. Results: The 5-year PBRT NVG rate was 12.7% (95% confidence interval [CI] 10.2%-15.9%). The 5-year rate of enucleation due to NVG was 4.9% (95% CI 3.4%-7.2%). Univariately, the NVG rate increased significantly with larger tumor diameter (P 30% of the lens or ciliary body received ≥50% dose (≥28 GyE), there was a higher probability of NVG (P 0%-30% vs >30%) (P=.01), and optic nerve length treated to ≥90% Dose (≤1 mm vs >1 mm) (P=.02). Conclusions: Our current PBRT patients experience a low rate of NVG and resultant enucleation compared with historical data. The present analysis shows that tumor height, diameter, and anterior as well as posterior critical structure dose–volume parameters may be used to predict NVG risk
Energy Technology Data Exchange (ETDEWEB)
Martin, Katherine J.; Patrick, Denis R.; Bissell, Mina J.; Fournier, Marcia V.
2008-10-20
One of the major tenets in breast cancer research is that early detection is vital for patient survival by increasing treatment options. To that end, we have previously used a novel unsupervised approach to identify a set of genes whose expression predicts prognosis of breast cancer patients. The predictive genes were selected in a well-defined three dimensional (3D) cell culture model of non-malignant human mammary epithelial cell morphogenesis as down-regulated during breast epithelial cell acinar formation and cell cycle arrest. Here we examine the ability of this gene signature (3D-signature) to predict prognosis in three independent breast cancer microarray datasets having 295, 286, and 118 samples, respectively. Our results show that the 3D-signature accurately predicts prognosis in three unrelated patient datasets. At 10 years, the probability of positive outcome was 52, 51, and 47 percent in the group with a poor-prognosis signature and 91, 75, and 71 percent in the group with a good-prognosis signature for the three datasets, respectively (Kaplan-Meier survival analysis, p<0.05). Hazard ratios for poor outcome were 5.5 (95% CI 3.0 to 12.2, p<0.0001), 2.4 (95% CI 1.6 to 3.6, p<0.0001) and 1.9 (95% CI 1.1 to 3.2, p = 0.016) and remained significant for the two larger datasets when corrected for estrogen receptor (ER) status. Hence the 3D-signature accurately predicts breast cancer outcome in both ER-positive and ER-negative tumors, though individual genes differed in their prognostic ability in the two subtypes. Genes that were prognostic in ER+ patients are AURKA, CEP55, RRM2, EPHA2, FGFBP1, and VRK1, while genes prognostic in ER patients include ACTB, FOXM1 and SERPINE2 (Kaplan-Meier p<0.05). Multivariable Cox regression analysis in the largest dataset showed that the 3D-signature was a strong independent factor in predicting breast cancer outcome. The 3D-signature accurately predicts breast cancer outcome across multiple datasets and holds prognostic
International Nuclear Information System (INIS)
Tao, Yan-Fang; Fang, Fang; Hu, Shao-Yan; Lu, Jun; Cao, Lan; Zhao, Wen-Li; Xiao, Pei-Fang; Li, Zhi-Heng; Wang, Na-Na; Xu, Li-Xiao; Du, Xiao-Juan; Sun, Li-Chao; Li, Yan-Hong; Li, Yi-Ping; Xu, Yun-Yun; Ni, Jian; Wang, Jian; Feng, Xing; Pan, Jian
2015-01-01
Acute myeloid leukemia (AML) is the second-most common form of leukemia in children. Aberrant DNA methylation patterns are a characteristic feature of AML. GATA4 has been suggested to be a tumor suppressor gene regulated by promoter hypermethylation in various types of human cancers although the expression and promoter methylation of GATA4 in pediatric AML is still unclear. Transcriptional expression levels of GATA4 were evaluated by semi-quantitative and real-time PCR. Methylation status was investigated by methylation-specific PCR (MSP) and bisulfate genomic sequencing (BGS). The prognostic significance of GATA4 expression and promoter methylation was assessed in 105 cases of Chinese pediatric acute myeloid leukemia patients with clinical follow-up records. MSP and BGS analysis showed that the GATA4 gene promoter is hypermethylated in AML cells, such as the HL-60 and MV4-11 human myeloid leukemia cell lines. 5-Aza treatment significantly upregulated GATA4 expression in HL-60 and MV4-11 cells. Aberrant methylation of GATA4 was observed in 15.0 % (3/20) of the normal bone marrow control samples compared to 56.2 % (59/105) of the pediatric AML samples. GATA4 transcript levels were significantly decreased in AML patients (33.06 ± 70.94; P = 0.011) compared to normal bone marrow/idiopathic thrombocytopenic purpura controls (116.76 ± 105.39). GATA4 promoter methylation was correlated with patient leukocyte counts (WBC, white blood cells) (P = 0.035) and minimal residual disease MRD (P = 0.031). Kaplan-Meier survival analysis revealed significantly shorter overall survival time in patients with GATA4 promoter methylation (P = 0.014). Epigenetic inactivation of GATA4 by promoter hypermethylation was observed in both AML cell lines and pediatric AML samples; our study implicates GATA4 as a putative tumor suppressor gene in pediatric AML. In addition, our findings imply that GATA4 promoter methylation is correlated with WBC and MRD. Kaplan-Meier survival analysis
Breastfeeding practices in a public health field practice area in Sri Lanka: a survival analysis
Directory of Open Access Journals (Sweden)
Agampodi Thilini C
2007-10-01
Full Text Available Abstract Background Exclusive breastfeeding up to the completion of the sixth month of age is the national infant feeding recommendation for Sri Lanka. The objective of the present study was to collect data on exclusive breastfeeding up to six months and to describe the association between exclusive breastfeeding and selected socio-demographic factors. Methods A clinic based cross-sectional study was conducted in the Medical Officer of Health area, Beruwala, Sri Lanka in June 2006. Mothers with infants aged 4 to 12 months, attending the 19 child welfare clinics in the area were included in the study. Infants with specific feeding problems (cleft lip and palate and primary lactose intolerance were excluded. Cluster sampling technique was used and consecutive infants fulfilling the inclusion criteria were enrolled. A total of 219 mothers participated in the study. The statistical tests used were survival analysis (Kaplan-Meier survival curves and Cox proportional Hazard model. Results All 219 mothers had initiated breastfeeding. The median duration of exclusive breastfeeding was four months (95% CI 3.75, 4.25. The rates of exclusive breastfeeding at 4 and 6 months were 61.6% (135/219 and 15.5% (24/155 respectively. Bivariate analysis showed that the Muslim ethnicity (p = 0.004, lower levels of parental education (p Conclusion The rate of breastfeeding initiation and exclusive breastfeeding up to the fourth month is very high in Medical Officer of Health area, Beruwala, Sri Lanka. However exclusive breastfeeding up to six months is still low and the prevalence of inappropriate feeding practices is high.
Estimating a population cumulative incidence under calendar time trends
DEFF Research Database (Denmark)
Hansen, Stefan N; Overgaard, Morten; Andersen, Per K
2017-01-01
BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date...... by calendar time trends, the total sample Kaplan-Meier and Aalen-Johansen estimators do not provide useful estimates of the general risk in the target population. We present some alternatives to this type of analysis. RESULTS: We show how a proportional hazards model may be used to extrapolate disease risk...... estimates if proportionality is a reasonable assumption. If not reasonable, we instead advocate that a more useful description of the disease risk lies in the age-specific cumulative incidence curves across strata given by time of entry or perhaps just the end of follow-up estimates across all strata...
Huang, M-Y; Xuan, F; Liu, W; Cui, H-J
2017-01-19
It is generally known that histone demethylases regulate gene transcription by altering the methylate status on histones, but their roles in cancers and the underlying molecular mechanisms still remain unclear. MYC-induced nuclear antigen (MINA) is reported to be a histone demethylase and highly expressed in many cancers. Here, for the first time, we show that MINA is involved in glioblastoma carcinogenesis and reveal the probable mechanisms of it in cell-cycle control. Kaplan-Meier analysis of progression-free survival showed that high MINA expression was strongly correlated with poor outcome and advancing tumor stage. MINA knockdown significantly repressed the cell proliferation and tumorigenesis abilities of glioblastoma cells in vitro and in vivo that were rescued by overexpressing the full-length MINA afterwards. Microarray analysis after knockdown of MINA revealed that MINA probably regulated glioblastoma carcinogenesis through the predominant cell-cycle pathways. Further investigation showed that MINA deficiency led to a cell-cycle arrest in G1 and G2 phases. And among the downstream genes, we found that cyclins and cyclin-dependent kinases were directly activated by MINA via the demethylation of H3K9me3.
Directory of Open Access Journals (Sweden)
Marcia Regina Gianotti Franco
Full Text Available Abstract Introduction: Data on impact of high body mass index (BMI on mortality of patients on peritoneal dialysis (PD, especially among elderly, are inconsistent. Objective: To evaluate impact of BMI on cohort of incident elderly PD patients over time. Methods: Prospective multicenter cohort study (December / 2004-October/2007 with 674 patients. Socio-demographic and clinical data evaluated with patients followed until death, transfer to hemodialysis (HD, recovery of renal function, loss of follow-up or transplant. Patients were divided into incident on renal replacement therapy (RRT for PD (PD first: 230 and transferred from hemodialysis (HD first: 444. Analysis was performed comparing these two groups using chi-square or Kruskal Wallis. Similar analysis was used to compare patients on automated peritoneal dialysis (APD vs. continuous ambulatory peritoneal dialysis (CAPD. Data were compared between patients according to BMI by ANOVA, Kruskal Wallis or chi-square. For analysis of survival, Kaplan Meier method was used and to adjust confounding variables, Cox regression proportional hazard. Joint model for longitudinal and time-dependent data was conducted, assessing impact that a longitudinal variable displays on time of survival. Results: Malnourished patients (76.79 ± 7.53 years were older (p < 0.0001 with higher percentage of death (44.6%, p = 0.001; diabetes mellitus showed high prevalence in obese patients (68%, p < 0.0001; higher blood pressure levels (p = 0.002 were present in obese and overweight patients. Conclusions: Increased BMI variation over time proved to be a protective factor, with a decrease of about 1% in risk of death for every BMI unit earned.
Directory of Open Access Journals (Sweden)
Mridula Krishnan
2017-08-01
Full Text Available Background: Adjuvant therapy after curative resection is associated with survival benefit in stage III pancreatic cancer. We analyzed the factors affecting the outcome of adjuvant therapy in stage III pancreatic cancer and compared overall survival with different modalities of adjuvant treatment. Methods: This is a retrospective study of patients with stage III pancreatic cancer listed in the National Cancer Database (NCDB who were diagnosed between 2004 and 2012. Patients were stratified based on adjuvant therapy they received. Unadjusted Kaplan-Meier and multivariable Cox regression analysis were performed. Results: We analyzed a cohort included 1731 patients who were recipients of adjuvant therapy for stage III pancreatic cancer within the limits of our database. Patients who received adjuvant chemoradiation had the longest postdiagnosis survival time, followed by patients who received adjuvant chemotherapy, and finally patients who received no adjuvant therapy. On multivariate analysis, advancing age and patients with Medicaid had worse survival, whereas Spanish origin and lower Charlson comorbidity score had better survival. Conclusions: Our study is the largest trial using the NCDB addressing the effects of adjuvant therapy specifically in stage III pancreatic cancer. Within the limits of our study, survival benefit with adjuvant therapy was more apparent with longer duration from date of diagnosis.
Pressure relieving support surfaces (PRESSURE) trial: cost effectiveness analysis.
Iglesias, Cynthia; Nixon, Jane; Cranny, Gillian; Nelson, E Andrea; Hawkins, Kim; Phillips, Angela; Torgerson, David; Mason, Su; Cullum, Nicky
2006-06-17
To assess the cost effectiveness of alternating pressure mattresses compared with alternating pressure overlays for the prevention of pressure ulcers in patients admitted to hospital. Cost effectiveness analysis carried out alongside the pressure relieving support surfaces (PRESSURE) trial; a multicentre UK based pragmatic randomised controlled trial. 11 hospitals in six UK NHS trusts. Intention to treat population comprising 1971 participants. Kaplan Meier estimates of restricted mean time to development of pressure ulcers and total costs for treatment in hospital. Alternating pressure mattresses were associated with lower overall costs (283.6 pounds sterling per patient on average, 95% confidence interval--377.59 pounds sterling to 976.79 pounds sterling) mainly due to reduced length of stay in hospital, and greater benefits (a delay in time to ulceration of 10.64 days on average,--24.40 to 3.09). The differences in health benefits and total costs for hospital stay between alternating pressure mattresses and alternating pressure overlays were not statistically significant; however, a cost effectiveness acceptability curve indicated that on average alternating pressure mattresses compared with alternating pressure overlays were associated with an 80% probability of being cost saving. Alternating pressure mattresses for the prevention of pressure ulcers are more likely to be cost effective and are more acceptable to patients than alternating pressure overlays.
Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus
2009-01-01
In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778
Woo, Jason R; Shikanov, Sergey; Zorn, Kevin C; Shalhav, Arieh L; Zagaja, Gregory P
2009-12-01
Posterior rhabdosphincter (PR) reconstruction during robot-assisted radical prostatectomy (RARP) was introduced in an attempt to improve postoperative continence. In the present study, we evaluate time to achieve continence in patients who are undergoing RARP with and without PR reconstruction. A prospective RARP database was searched for most recent cases that were accomplished with PR reconstruction (group 1, n = 69) or with standard technique (group 2, n = 63). We performed the analysis applying two definitions of continence: 0 pads per day or 0-1 security pad per day. Patients were evaluated by telephone interview. Statistical analysis was carried out using the Kaplan-Meier method and log-rank test. With PR reconstruction, continence was improved when defined as 0-1 security pad per day (median time of 90 vs 150 days; P = 0.01). This difference did not achieve statistical significance when continence was defined as 0 pads per day (P = 0.12). A statistically significant improvement in continence rate and time to achieve continence is seen in patients who are undergoing PR reconstruction during RARP, with continence defined as 0-1 security/safety pad per day. A larger, prospective and randomized study is needed to better understand the impact of this technique on postoperative continence.
International Nuclear Information System (INIS)
Kawamura, Toshiki; Ishiguchi, Tsuneo; Shibamoto, Yuta
2006-01-01
We analyzed the therapeutic results and prognostic factors of 46 primary central nervous system lymphoma (PCNSL) patients who were treated at twelve institutions in the Tokai district of Japan between 1995 and 1999. We compared the results with those of a Japanese nationwide survey performed in the past. We sent each institution a questionnaire about the state of patients' disease, pathological type, method and doses of radiotherapy, regimen and intensity of chemotherapy, and patients' prognoses. The range of patients' ages was 33 to 93 years (median, 61 years). Thirty-one were men and 15 were women. The most prevalent histology was diffuse large B cell type (33 patients). We used the Kaplan-Meier method to calculate the survival rate and Cox's proportional hazards model to analyze the prognostic factors. The five-year cumulative survival rate was 25%, and the median survival time was 22.7 months. The five-year disease-free survival rate was 23%. In monovariate analysis, patients who were both younger than 60 years old and had a World Health Organization (WHO) performance status (PS) score equal to or less than 2 showed a better survival rate. Furthermore, the patients receiving systemic chemotherapy showed a significantly better local control rate. In addition, patients who received systemic chemotherapy achieved a higher complete remission rate than those not receiving it. However, no factors that significantly influenced survival rate were identified in multivariate analysis. We demonstrated that the therapeutic outcome of PCNSL patients has recently improved. In particular, patients with good PS showed better local control than those with poor PS. However, we could not identify any significant prognostic factors in PCNSL patients. (author)
Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S
2013-01-01
The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.
International Nuclear Information System (INIS)
Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario; Pagani, Marco; De Carli, Fabrizio
2017-01-01
We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal
Energy Technology Data Exchange (ETDEWEB)
Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario [Genoa Univ. (Italy). Dept. of Health Sciences; IRCCS AOU San Martino-IST, Genoa (Italy). Nuclear Medicine Unit; Arnaldi, Dario; Picco, Agnese; Pardini, Matteo; Brugnolo, Andrea; Girtler, Nicola; Nobili, Flavio [Genoa Univ. (Italy). Clinical Neurology, Department of Neuroscience (DINOGMI); IRCCS AOU San Martino-IST, Genoa (Italy); Pagani, Marco [Institute of Cognitive Sciences and Technologies, Rome (Italy); Karolinska Hospital, Stockholm (Sweden). Department of Nuclear Medicine; Chincarini, Andrea [Istituto Nazionale di Fisica Nucleare, Genoa (Italy); De Carli, Fabrizio [National Research Council, Genoa (Italy). Institute of Bioimaging and Molecular Physiology
2017-11-15
We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal
Adjuvant Ab Interno Tumor Treatment After Proton Beam Irradiation.
Seibel, Ira; Riechardt, Aline I; Heufelder, Jens; Cordini, Dino; Joussen, Antonia M
2017-06-01
This study was performed to show long-term outcomes concerning globe preservation in uveal melanoma patients after proton beam therapy with the main focus on outcomes according to different adjuvant ab interno surgical procedures. Retrospective cohort study. All patients treated with primary proton beam therapy for choroidal or ciliary body melanoma between June 1998 and June 2015 were included. A total of 2499 patients underwent primary proton beam therapy, with local tumor control and globe preservation rates of 95.9% and 94.8% after 5 years, respectively. A total of 110 (4.4%) patients required secondary enucleation. Unresponsive neovascular glaucoma was the leading cause of secondary enucleation in 78 of the 2499 patients (3.1%). The 5-year enucleation-free survival rate was 94.8% in the endoresection group, 94.3% in the endodrainage group, and 93.5% in the comparator group. The log-rank test showed P = .014 (comparator group vs endoresection group) and P = .06 (comparator group vs endodrainage-vitrectomy group). Patients treated with endoresection or endodrainage-vitrectomy developed less radiation retinopathy (30.5% and 37.4% after 5 years, P = .001 and P = .048 [Kaplan-Meier], respectively) and less neovascular glaucoma (11.6% and 21.3% after 5 years, P = .001 and P = .01 [Kaplan-Meier], respectively) compared with the comparator group (52.3% radiation retinopathy and 57.8% neovascular glaucoma after 5 years). This study suggests that in larger tumors the enucleation and neovascular glaucoma rates might be reduced by adjuvant surgical procedures. Although endoresection is the most promising adjuvant treatment option, the endodrainage-vitrectomy is recommended in patients who are ineligible for endoresection. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gkretsi, Vasiliki; Stylianou, Andreas; Stylianopoulos, Triantafyllos, E-mail: tstylian@ucy.ac.cy
2017-03-15
A hallmark of cancer cells is their ability to invade surrounding tissues and form metastases. Cell-extracellular matrix (ECM)-adhesion proteins are crucial in metastasis, connecting tumor ECM with actin cytoskeleton thus enabling cells to respond to mechanical cues. Vasodilator-stimulated phosphoprotein (VASP) is an actin-polymerization regulator which interacts with cell-ECM adhesion protein Migfilin, and regulates cell migration. We compared VASP expression in MCF-7 and MDA-MB-231 breast cancer (BC) cells and found that more invasive MDA-MB-231 cells overexpress VASP. We then utilized a 3-dimensional (3D) approach to study metastasis in MDA-MB-231 cells using a system that considers mechanical forces exerted by the ECM. We prepared 3D collagen I gels of increasing concentration, imaged them by atomic force microscopy, and used them to either embed cells or tumor spheroids, in the presence or absence of VASP. We show, for the first time, that VASP silencing downregulated Migfilin, β-catenin and urokinase plasminogen activator both in 2D and 3D, suggesting a matrix-independent mechanism. Tumor spheroids lacking VASP demonstrated impaired invasion, indicating VASP’s involvement in metastasis, which was corroborated by Kaplan-Meier plotter showing high VASP expression to be associated with poor remission-free survival in lymph node-positive BC patients. Hence, VASP may be a novel BC metastasis biomarker. - Highlights: • More invasive MDA-MB-231 overexpress VASP compared to MCF-7 breast cancer cells. • We prepared 3D collagen I gels of increasing concentration and characterized them. • VASP silencing downregulated Migfilin, β-catenin and uPA both in 2D and 3D culture. • Tumor spheroids lacking VASP demonstrated impaired invasion. • Kaplan-Meier plotter shows association of high VASP expression with poor survival.
Age-Related Trends in Hip Arthroscopy: A Large Cross-Sectional Analysis.
Sing, David C; Feeley, Brian T; Tay, Bobby; Vail, Thomas P; Zhang, Alan L
2015-12-01
To analyze a large national private payer population in the United States for trends over time in hip arthroscopy by age groups and to determine the rate of conversion to total hip arthroplasty (THA) after hip arthroscopy. We performed a retrospective analysis using the PearlDiver private insurance patient record database from 2007 through 2011. Hip arthroscopy procedures including newly introduced codes such as osteochondroplasty of cam and pincer lesions and labral repair were queried. Hip arthroscopy incidence and conversion rates to THA were stratified by age. Chi-squared analysis was used for statistical comparison. Conversion to THA was evaluated using Kaplan-Meier analysis. From 2007 through 2011, 20,484,172 orthopaedic patients were analyzed. Hip arthroscopy was performed in 8,227 cases (mean annual incidence, 2.7 cases per 10,000 orthopaedic patients). The incidence of hip arthroscopies increased over 250% from 1.6 cases per 10,000 in 2007 to 4.0 cases per 10,000 in 2011 (P arthroscopy, 17% of patients older than 50 required conversion to THA, compared with arthroscopy procedures are increasing in popularity across all age groups, with patients ages 40 to 49 having the highest incidence in this large cross-sectional population, despite a high rate of early conversion to THA within 2 years in patients over 50. IV, cross-sectional study. Copyright © 2015 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
Haricharan, Svasti; Bainbridge, Matthew N; Scheet, Paul; Brown, Powel H
2014-07-01
Breast cancer is one of the most commonly diagnosed cancers in women. While there are several effective therapies for breast cancer and important single gene prognostic/predictive markers, more than 40,000 women die from this disease every year. The increasing availability of large-scale genomic datasets provides opportunities for identifying factors that influence breast cancer survival in smaller, well-defined subsets. The purpose of this study was to investigate the genomic landscape of various breast cancer subtypes and its potential associations with clinical outcomes. We used statistical analysis of sequence data generated by the Cancer Genome Atlas initiative including somatic mutation load (SML) analysis, Kaplan-Meier survival curves, gene mutational frequency, and mutational enrichment evaluation to study the genomic landscape of breast cancer. We show that ER(+), but not ER(-), tumors with high SML associate with poor overall survival (HR = 2.02). Further, these high mutation load tumors are enriched for coincident mutations in both DNA damage repair and ER signature genes. While it is known that somatic mutations in specific genes affect breast cancer survival, this study is the first to identify that SML may constitute an important global signature for a subset of ER(+) tumors prone to high mortality. Moreover, although somatic mutations in individual DNA damage genes affect clinical outcome, our results indicate that coincident mutations in DNA damage response and signature ER genes may prove more informative for ER(+) breast cancer survival. Next generation sequencing may prove an essential tool for identifying pathways underlying poor outcomes and for tailoring therapeutic strategies.
Energy Technology Data Exchange (ETDEWEB)
Kim, Yi Jun; Lee, Kyung Ja; Park, Kyung Ran [Dept. of Radiation Oncology, (Korea, Republic of); and others
2015-06-15
To analyze prognostic factors for locoregional recurrence (LRR), distant metastasis (DM), and overall survival (OS) in cervical cancer patients who underwent radical hysterectomy followed by postoperative radiotherapy (PORT) in a single institute. Clinicopathologic data of 135 patients with clinical stage IA2 to IIA2 cervical cancer treated with PORT from 2001 to 2012 were reviewed, retrospectively. Postoperative parametrial resection margin (PRM) and vaginal resection margin (VRM) were investigated separately. The median treatment dosage of external beam radiotherapy (EBRT) to the whole pelvis was 50.4 Gy in 1.8 Gy/fraction. High-dose-rate vaginal brachytherapy after EBRT was given to patients with positive or close VRMs. Concurrent platinum-based chemoradiotherapy (CCRT) was administered to 73 patients with positive resection margin, lymph node (LN) metastasis, or direct extension of parametrium. Kaplan-Meier method and log-rank test were used for analyzing LRR, DM, and OS; Cox regression was applied to analyze prognostic factors. The 5-year disease-free survival was 79% and 5-year OS was 91%. In univariate analysis, positive or close PRM, LN metastasis, direct extension of parametrium, lymphovascular invasion, histology of adenocarcinoma, and chemotherapy were related with more DM and poor OS. In multivariate analysis, PRM and LN metastasis remained independent prognostic factors for OS. PORT after radical hysterectomy in uterine cervical cancer showed excellent OS in this study. Positive or close PRM after radical hysterectomy in uterine cervical cancer correlates with poor prognosis even with CCRT. Therefore, additional treatments to improve local control such as radiation boosting need to be considered.
MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer
2012-12-01
hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA
Application of Enlisted Force Retention Levels and Career Field Stability
2017-03-23
APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial
Wang, Wei; Lin, Tianxin; Huang, Jian; Hu, Weilie; Xu, Kewei; Liu, Jun
2011-01-01
Mel-18 is a member of the polycomb group (PcG) of proteins, which are chromatin regulatory factors that play an important role in development and oncogenesis. This study was designed to investigate the clinical and prognostic significance of Mel-18 in the patients with prostate cancer. Immunostaining with Mel-18 specific antibodies was performed on paraffin sections from 202 patients. Correlations between Mel-18 and the Gleason grading system, clinical stage, serum prostate-specific antigen (PSA) levels, and age were evaluated. PSA recurrence in 76 patients who underwent radical prostatectomy and survival in 59 patients with metastases at diagnosis were analyzed to evaluate the influence of Mel-18 expression in cancer progression using Kaplan-Meier analysis and multivariate Cox regression analysis. Staining was seen in all prostatic tissues. Mel-18 expression was significantly reduced in the prostate cancer patients with PSA levels over 100 ng/ml (P=0.009), advanced clinical stage (>T4, N1, or M1 disease, P=0.029), higher Gleason grade or with a higher Gleason score (P=0.018) than in those with other clinicopathologic features. Negative expression of Mel-18 was associated with significantly higher rates of PSA recurrence after radical prostatectomy than with positive expression of Mel-18 (P = 0.029), and was an independent predictor of PSA recurrence (P=0.034, HR=2.143) in multivariate analysis. Similarly, metastatic prostate cancer patients with negative expression of Mel-18 showed significantly worse survival compared with the positive expression of Mel-18 (P=0.025). In multivariate analysis, negative expression of Mel-18 was an independent predictor of cancer-specific survival (P=0.024, HR=2.365). Our study provides important evidence for the recognition of Mel-18 as a tumor suppressor. The expression of Mel-18 showed potential as a prognostic marker for human prostate cancer. Copyright © 2011 Elsevier Inc. All rights reserved.
Multimodality therapy and prognostic analysis of thymoma
International Nuclear Information System (INIS)
Chen Jie; Wang Ping; Song Yongchun
2007-01-01
Objective: The aim of this study is to draft the judicious treatment methods by analyzing the Long-term survival result of thymoma and evaluating the effect that prognosis analysis has on thymoma. Methods: Retrospective analysis of the clinical material of 142 patients with thymoma in the Tianjin Medical University Cancer Hospital from January 1954 to January 2001. Statistical analysis was performed using the SPSS software package. The Kaplan-Meier method was used single variable analysis, The Log-rank test was used to compare survival between groups, The Cox' s proportional hazards model was used to multi-factor analysis. Results: The 5- and 10-year survival rate of the 142 patients was 59.9% and 45.8%, respectively. Staging was adopted on the Masaoka's way, 5- and 10-year survival rates was: 93.8%, 79.2% in stage I; 79.3%, 55.2% in stage II; 53.1%, 34.4% in stage III; and 0 and 0 in stage IV. Among 30 patients associated with myasthenia gravis, 19 patients suffered from generalized myasthenia gravis and 11 patients of ocular myasthenia gravis, with 5- and 10-year survival rate of 83.3% and 60.0%, respectively. Three patients finally died of myasthenia gravis. The 5- and 10-year survival rate of 112 patients without myasthenia gravis was 53.6% and 42.0%, respectively. Among 116 patients, treated with surgery-, resection was carried out in 84 patients, palliative resection in 9 patients, and biopsy only in 23 patients. Eighty-nine patients were given radiotherapy and 55 patients had postoperative radiotherapy. Single variable analysis showed that Masaoka clinical staging, association with myasthenia gravis, histopathologic subtype and the method of treatment were prognostic factor's. Finally, drawing the conclusion through muhivariable analysis; Masaoka clinical staging, association with myasthenia gravis and the treatment method were prognostic factors. Conclusions: The diagnosis of thymoma is made clinically and pathologically. The treatment principle should be
Resultado do tratamento cirúrgico das neoplasias do seio piriforme
Directory of Open Access Journals (Sweden)
Costa Claudiney C.
2003-01-01
Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.
Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas
2017-11-15
This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still
International Nuclear Information System (INIS)
Ganeshan, Balaji; Miles, Ken; Panayiotou, Elleny; Burnand, Kate; Dizdarevic, Sabina
2012-01-01
To establish the potential for tumour heterogeneity in non-small cell lung cancer (NSCLC) as assessed by CT texture analysis (CTTA) to provide an independent marker of survival for patients with NSCLC. Tumour heterogeneity was assessed by CTTA of unenhanced images of primary pulmonary lesions from 54 patients undergoing 18 F-fluorodeoxyglucose (FDG) PET-CT for staging of NSCLC. CTTA comprised image filtration to extract fine, medium and coarse features with quantification of the distribution of pixel values (uniformity) within the filtered images. Receiver operating characteristics identified thresholds for PET and CTTA parameters that were related to patient survival using Kaplan-Meier analysis. The median (range) survival was 29.5 (1-38) months. 24, 10, 14 and 6 patients had tumour stages I, II, III and IV respectively. PET stage and tumour heterogeneity assessed by CTTA were significant independent predictors of survival (PET stage: Odds ratio 3.85, 95% confidence limits 0.9-8.09, P = 0.002; CTTA: Odds ratio 56.4, 95% confidence limits 4.79-666, p = 0.001). SUV was not a significantly associated with survival. Assessment of tumour heterogeneity by CTTA of non-contrast enhanced images has the potential for to provide a novel, independent predictor of survival for patients with NSCLC. (orig.)
Directory of Open Access Journals (Sweden)
Cheng Tsui
2012-01-01
Full Text Available Abstract Background Increased health care costs have made it incumbent on health-care facilities and physicians to demonstrate both clinical and cost efficacy when recommending treatments. Though studies have examined the cost-effectiveness of adjuvant goserelin with radiotherapy for locally advanced prostate cancer, few have compared the cost-effectiveness of adjuvant goserelin to adjuvant chemotherapy alone in premenopausal breast cancer. Methods In this retrospective study at one hospital, the records of 152 patients with stage Ia to IIIa ER + breast cancer who received goserelin or chemotherapy were reviewed. Survival analysis was assessed by the Kaplan-Meier method. Patients were interviewed to evaluate their quality of life using the European Organization for Research and Treatment Quality of Life questionnaire (EORTC-QLQ-C30, version 4.0, and to obtain the utility value by the standard gamble (SG and visual scale (VS methods. Total medical cost was assessed from the (National Health Insurance NHI payer's perspective. Results Survival at 11 years was significantly better in the groserelin group (P Conclusions Goserelin therapy results in better survival and higher utility-weighted life-years, and is more cost-effective than TC or TEC chemotherapy.
Badar, Athar A; Perez-Moreno, Ana Cristina; Jhund, Pardeep S; Wong, Chih M; Hawkins, Nathaniel M; Cleland, John G F; van Veldhuisen, Dirk J; Wikstrand, John; Kjekshus, John; Wedel, Hans; Watkins, Stuart; Gardner, Roy S; Petrie, Mark C; McMurray, John J V
2014-12-21
Angina pectoris is common in patients with heart failure and reduced ejection fraction (HF-REF) but its relationship with outcomes has not been well defined. This relationship was investigated further in a retrospective analysis of the Controlled Rosuvastatin Multinational Trial in Heart Failure (CORONA). Four thousand, eight hundred and seventy-eight patients were divided into three categories: no history of angina and no chest pain at baseline (Group A; n = 1240), past history of angina but no chest pain at baseline (Group B; n = 1353) and both a history of angina and chest pain at baseline (Group C; n = 2285). Outcomes were examined using Kaplan-Meier and Cox regression survival analysis. Compared with Group A, Group C had a higher risk of non-fatal myocardial infarction or unstable angina (HR: 2.36, 1.54-3.61; P angina are at an increased risk of acute coronary syndrome and HF hospitalization. Whether these patients would benefit from more aggressive medical therapy or percutaneous revascularization is not known and merits further investigation. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.
Armstrong, James; Forrest, Helen; Crawford, Mark W
2015-10-01
Discharge criteria based on physiological scoring systems can be used in the postanesthesia care unit (PACU) to fast-track patients after ambulatory surgery; however, studies comparing physiological scoring systems with traditional time-based discharge criteria are lacking. The purpose of this study was to compare PACU discharge readiness times using physiological vs time-based discharge criteria in pediatric ambulatory surgical patients. We recorded physiological observations from consecutive American Society of Anesthesiologists physical status I-III patients aged 1-18 yr who were admitted to the PACU after undergoing ambulatory surgery in a tertiary academic pediatric hospital. The physiological score was a combination of the Aldrete and Chung systems. Scores were recorded every 15 min starting upon arrival in the PACU. Patients were considered fit for discharge once they attained a score ≥12 (maximum score, 14), provided no score was zero, with the time to achieve a score ≥12 defining the criteria-based discharge (CBD) time. Patients were discharged from the PACU when both the CBD and the existing time-based discharge (TBD) criteria were met. The CBD and TBD data were compared using Kaplan-Meier and log-rank analysis. Observations from 506 children are presented. Median (interquartile range [IQR]) age was 5.5 [2.8-9.9] yr. Median [IQR] CBD and TBD PACU discharge readiness times were 30 [15-45] min and 60 [45-60] min, respectively. Analysis of Kaplan-Meier curves indicated a significant difference in discharge times using the different criteria (hazard ratio, 5.43; 95% confidence interval, 4.51 to 6.53; P < 0.001). All patients were discharged home without incident. This prospective study suggests that discharge decisions based on physiological criteria have the potential for significantly speeding the transit of children through the PACU, thereby enhancing PACU efficiency and resource utilization.
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
International Nuclear Information System (INIS)
Amiri, K; Cervantes, M J; Mulu, B; Raisee, M
2014-01-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
Amiri, K.; Mulu, B.; Raisee, M.; Cervantes, M. J.
2014-03-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR.
Ishizuka, Mitsuru; Oyama, Yusuke; Abe, Akihito; Tago, Kazuma; Tanaka, Genki; Kubota, Keiichi
2014-08-01
To investigate the influence of clinical characteristics including nutritional markers on postoperative survival in patients undergoing total gastrectomy (TG) for gastric cancer (GC). One hundred fifty-four patients were enrolled. Uni- and multivariate analyses using the Cox proportional hazard model were performed to explore the most valuable clinical characteristic that was associated with postoperative survival. Multivariate analysis using twelve clinical characteristics selected from univariate analyses revealed that age (≤ 72/>72), carcinoembryonic antigen (≤ 20/>20) (ng/ml), white blood cell count (≤ 9.5/>9.5) (× 10(3)/mm(3)), prognostic nutritional index (PNI) (≤ 45/>45) and lymph node metastasis (negative/positive) were associated with postoperative survival. Kaplan-Meier analysis and log-rank test showed that patients with higher PNI (>45) had a higher postoperative survival rate than those with lower PNI (≤ 45) (p<0.001). PNI is associated with postoperative survival of patients undergoing TG for GC and is able to divide such patients into two independent groups before surgery. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
CT volumetric measurement of colorectal cancer helps predict tumor staging and prognosis.
Directory of Open Access Journals (Sweden)
Jin Young Park
Full Text Available To evaluate feasibility of CT colonography (CTC volumetry of colorectal cancer (CRC and its correlation with disease stage and patients' survival.CTC volumetry was performed for 126 patients who underwent preoperative CTC. Reproducibility of tumor volume (Tvol between two readers was assessed. One-way ANOVA and ROC analysis evaluated correlation between Tvol and pTNM staging. ROC analysis compared diagnostic performance to predict pTNM staging between Tvol and radiologist. Kaplan-Meier test compared overall survival.Reproducibility among readers was excellent (interclass correlation = 0.9829. Mean Tvol showed an incremental trend with T stage and Tvol of pT4b stage was significantly larger than other stages (P0.05. Smaller tumor burden (≤12.85cm3, ≤T3, N0, M0 stages, and curative surgery were significantly associated with patients' longer survival (P<0.05.CT volumetry has a limited value to predict N stage; however, it may outperform the radiologist's performance when predicting pT4b and M1b stage and can be a useful prognostic marker.
Choi, Ji Young; Kim, Miso; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Heo, Dae Seog; Jo, Seong Jin
2018-04-05
Despite the successful use of tyrosine kinase inhibitors (TKIs) in cancer patients, their effect on herpes zoster development has not been studied. The aim of this study was to evaluate and compare the effects of epidermal growth factor receptor (EGFR) TKI and cytotoxic chemotherapy on the risk of herpes zoster development in non-small cell lung cancer (NSCLC) patients. We conducted a medical review of all eligible NSCLC patients in Seoul National University hospital between 2002 and 2015. We classified patients based on whether they previously underwent EGFR TKI therapy into either the TKI group or the cytotoxic group. We compared the incidence rates of herpes zoster during TKI therapy and cytotoxic chemotherapy. Additionally, the longitudinal risk of herpes zoster from TKIs was analyzed using the incidence rate ratio (IRR) of the TKI group to the cytotoxic group and the log-rank test of the Kaplan-Meier method. Of the 2,981 NSCLC patients, 54 patients (1.54%) developed herpes zoster. In the TKI group (2,002 patients), the IRR of herpes zoster during TKI therapy compared to that during cytotoxic chemotherapy was 1.05 (95% confidence interval [CI], 0.53 to 2.09). The IRR of the TKI group compared to the cytotoxic group was 1.33 (95% CI, 0.64 to 2.76). The Kaplan-Meier cumulative risk of both groups was not significantly different. Our results show that the incidence rate of herpes zoster in the TKI group was not statistically different from the incidence in the cytotoxic group during and after chemotherapy in NSCLC patients.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Energy Technology Data Exchange (ETDEWEB)
Petit, O; Nilsson, H [Division of Fluid Mechanics, Chalmers University of Technology, Hoersalsvaegen 7A, SE-41296 Goeteborg (Sweden); Mulu, B; Cervantes, M, E-mail: olivierp@chalmers.s [Division of Fluid Mechanics, Luleaa University of Technology, SE-971 87 Luleaa (Sweden)
2010-08-15
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Petit, O.; Mulu, B.; Nilsson, H.; Cervantes, M.
2010-08-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Petit, O; Nilsson, H; Mulu, B; Cervantes, M
2010-01-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Feng, Huan; Zhang, Wei; Li, Jiajun; Lu, Xiaozhe
2015-01-01
To compare the pathological features and long-term survival of bladder cancer (BCa) in young patients with elderly counterparts. Using the U.S. National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) population-based data, we identified 93115 patients with non-metastatic bladder cancer diagnosed between 1988 and 2003. Patients were categorized into young (50 years and under) and elderly groups (over 50 years of age). The overall and five-year bladder cancer specific survival (BCSS) data were obtained using Kaplan-Meier plots. Multivariable Cox regression models were built for the analysis of long-term survival outcomes and risk factors. There were significant differences between the two groups in primary site, pathologic grading, histologic type, AJCC stage (pstage patients. The study findings show different patterns in the prognostic value of age for determining BCSS, depending on the tumor stages. Compared with elderly patients, young patients with bladder cancer surgery appear to have unique characteristics and a higher overall and cancer specific survival rate.
International Nuclear Information System (INIS)
Bandoh, Nobuyuki; Takahara, Miki; Moriai, Shigetaka; Katayama, Akihiro; Katada, Akihiro; Hayashi, Tatsuya; Harabuchi, Yasuaki; Nagasawa, Kenichi
2008-01-01
Patients with advanced hypopharyngeal carcinoma still have a poor outcome in spite of radical surgery with chemoradiotherapy. We started superselective intra-arterial infusion chemotherapy with concomitant radiotherapy (IA chemoradiation) for advanced hypopharyngeal carcinoma in 2003. The complete response (CR) rate for local and neck lesions was 94.1% and 60%, respectively. After neck dissection the total CR rate was 82.4%. There was no significant difference in survival rates between groups with IA chemoradiation (n=22) and with surgery with preoperative chemoradiotherapy (n=57). However, Kaplan-Meier analysis showed that the cause-specific survival rate in N3 patients and larynx preservation rate was significantly higher in patients treated with IA chemoradiation than in those with surgery with preoperative chemoradiotherapy (p<0.05 and p<0.001). Subjective symptoms are not so severe in patients without the disease after IA chemoradiation. IA chemoradiation is effective for patients with advanced hypopharyngeal carcinoma to maintain quality of life such as voice and swallowing. (author)
Directory of Open Access Journals (Sweden)
Shingo Hatakeyama
2012-01-01
Full Text Available The oral adsorbent AST-120 has the potential to delay dialysis initiation and improve survival of patients on dialysis. We evaluated the effect of AST-120 on dialysis initiation and its potential to improve survival in patients with chronic kidney disease. The present retrospective pair-matched study included 560 patients, grouped according to whether or not they received AST-120 before dialysis (AST-120 and non-AST-120 groups. The cumulative dialysis initiation free rate and survival rate were compared by the Kaplan-Meier method. Multivariate analysis was used to determine the impact of AST-120 on dialysis initiation. Our results showed significant differences in the 12- and 24-month dialysis initiation free rate (P<0.001, although no significant difference was observed in the survival rate between the two groups. In conclusion, AST-120 delays dialysis initiation in chronic kidney disease (CKD patients but has no effect on survival. AST-120 is an effective therapy for delaying the progression of CKD.
Heubner, Martin; Wimberger, Pauline; Otterbach, Friedrich; Kasimir-Bauer, Sabine; Siffert, Winfried; Kimmig, Rainer; Nückel, Holger
2009-01-01
Bcl-2 plays a key role in the regulation of apoptosis. Recently, a novel regulatory single nucleotide polymorphism (-938C>A) in the inhibitory P2 BCL2 promoter was described. In this study we investigated its potential association with survival in epithelial ovarian cancer. Patients (n=110) with primary epithelial ovarian cancer were retrospectively genotyped by pyrosequencing. Genotype distribution was not significantly different between 110 ovarian cancer patients and 120 healthy controls, suggesting that genotypes of this polymorphism do not increase the susceptibility to ovarian cancer. Kaplan-Meier curves showed a significant association of the AA genotype with increased survival (p=0.002). Multivariate analysis revealed that the BCL2-938AC/CC genotype (hazard ratio 4.5; p=0.003) was an independent prognostic factor compared to other prognostic factors such as age, histological grade or tumor stage. The results suggest a role for the BCL2-938C>A polymorphism as a marker for survival in patients with epithelial ovarian cancer.
The effectiveness of arthroscopic stabilisation for failed open shoulder instability surgery.
Millar, N L; Murrell, G A C
2008-06-01
We identified ten patients who underwent arthroscopic revision of anterior shoulder stabilisation between 1999 and 2005. Their results were compared with 15 patients, matched for age and gender, who had a primary arthroscopic stabilisation during the same period. At a mean follow-up of 37 and 36 months, respectively, the scores for pain and shoulder function improved significantly between the pre-operative and follow-up visits in both groups (p = 0.002), with no significant difference between them (p = 0.4). The UCLA and Rowe shoulder scores improved significantly (p = 0.004 and p = 0.002, respectively), with no statistically significant differences between groups (p = 0.6). Kaplan-Meier analysis for time to recurrent instability showed no differences between the groups (p = 0.2). These results suggest that arthroscopic revision anterior shoulder stabilisation is as reliable as primary arthroscopic stabilisation for patients who have had previous open surgery for recurrent anterior instability.
Jin, Haojie; Zhang, Yurong; You, Haiyan; Tao, Xuemei; Wang, Cun; Jin, Guangzhi; Wang, Ning; Ruan, Haoyu; Gu, Dishui; Huo, Xisong; Cong, Wenming; Qin, Wenxin
2015-06-23
Kynurenine 3-monooxygenase (KMO) is a pivotal enzyme in the kynurenine pathway of tryptophan degradation and plays a critical role in Huntington's and Alzheimer's diseases. This study aimed to examine the expression of KMO in human hepatocellular carcinoma (HCC) and investigate the relationship between its expression and prognosis of HCC patients. We first analyzed KMO expression in 120 paired HCC samples (HCC tissues vs matched adjacent non-cancerous liver tissues), and 205 clinical HCC specimens using immunohistochemistry (IHC). Kaplan-Meier survival and Cox regression analyses were executed to evaluate the prognosis of HCC. The results of IHC analysis showed that KMO expression was significantly higher in HCC tissues than that in normal liver tissues (all p KMO was an independent prognostic factor for overall survival (OS) and time to recurrence (TTR) (both pKMO positively regulated proliferation, migration, and invasion of HCC cells. These results suggest that KMO exhibits tumor-promoting effects towards HCC and it may serve as a novel prognostic marker in HCC.
High mortality risk among individuals assumed to be TB-negative can be predicted using a simple test
DEFF Research Database (Denmark)
Rabna, Paulo; Andersen, Andreas; Wejse, Christian
2009-01-01
1007 aTBneg individuals who were enrolled from 2004 to 2006; 4983 age-matched controls were followed for comparison. Plasma suPAR levels were measured using the suPARnostic ELISA. Survival was analysed using Cox regression, ROC curves and Kaplan-Meier analysis. RESULTS: After 3 months of follow......-up, mortality was 21 per 100 person-year-observation (PYO) among aTBneg individuals and three per 100 PYO among the control population [mortality rate ratio (MRR) = 6.92 (95% CI 4.48-10.7)]. SuPAR values ranged between 0.9 and 45 ng/ml in aTBneg individuals. A log-linear relationship was found between su......PAR levels linear range, a 1 ng/ml increase was associated with a 46% increase in the mortality rate: MRR = 1.46 (95% CI 1.34-1.59). The area under the ROC curves was 0.88 for HIV-positive individuals and 0.79 for HIV-negative individuals. CONCLUSIONS: Our study showed...
Clinical performance of IPS-Empress 2 ceramic crowns inserted by general dental practitioners.
Mansour, Yasar F; Al-Omiri, Mahmoud K; Khader, Yousef Saleh; Al-Wahadni, Ahed
2008-05-01
The aim of this study was to evaluate the clinical performance of IPS-Empress 2(R) all-ceramic crowns placed by general dental practitioners. Eighty-two IPS-Empress 2 crowns placed in 64 patients (27 females and 37 males) were evaluated. These crowns had been in place for 15.2 to 57.2 months (mean 25.3 months, SD=9.3). Survival analysis was conducted using the Kaplan-Meier method. Of the 82 crowns 93.9% were rated satisfactory. In terms of the integrity of the restorations, fracture was observed in three crowns and two showed a crack upon transillumination. Five crowns were rated unsatisfactory for color match; one for marginal adaptation; and none for discoloration, secondary caries, or sensitivity. IPS-Empress 2(R) is a suitable material to fabricate all-ceramic crowns; when these all-ceramic crowns were inserted by general dental practitioners, they functioned satisfactorily with low failure rates during an observation period ranging between 15.2 to 57.2 months.
International Nuclear Information System (INIS)
Miclosina, C O; Balint, D I; Campian, C V; Frunzaverde, D; Ion, I
2012-01-01
This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from 'Eftimie Murgu' University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.
Miclosina, C. O.; Balint, D. I.; Campian, C. V.; Frunzaverde, D.; Ion, I.
2012-11-01
This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from "Eftimie Murgu" University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.
Niesvizky, Ruben; Naib, Tara; Christos, Paul J; Jayabalan, David; Furst, Jessica R; Jalbrzikowski, Jessica; Zafar, Faiza; Mark, Tomer; Lent, Richard; Pearse, Roger N; Ely, Scott; Leonard, John P; Mazumdar, Madhu; Chen-Kiang, Selina; Coleman, Morton
2007-09-01
Data on 72 patients receiving lenalidomide/dexamethasone for multiple myeloma (MM) was used to determine the factors that are associated with lenalidomide-induced myelosuppression. Eight of 14 patients with grade > or =3 myelosuppression had baseline creatinine clearance (CrCl) < or =0.67 ml/s. Kaplan-Meier analysis by log-rank test demonstrated a significant association (P < 0.0001) between renal insufficiency and time to myelosuppression (hazard ratio = 8.4; 95% confidence interval 2.9-24.7, P = 0.0001). Therefore, CrCl is inversely associated with significant myelosuppression. Caution should be exercised when lenalidomide therapy is commenced and CrCl should be incorporated as a determinant of the initial dosing of lenalidomide in MM patients.
Causes of death in long-term lung cancer survivors: a SEER database analysis.
Abdel-Rahman, Omar
2017-07-01
Long-term (>5 years) lung cancer survivors represent a small but distinct subgroup of lung cancer patients and information about the causes of death of this subgroup is scarce. The Surveillance, Epidemiology and End Results (SEER) database (1988-2008) was utilized to determine the causes of death of long-term survivors of lung cancer. Survival analysis was conducted using Kaplan-Meier analysis and multivariate analysis was conducted using a Cox proportional hazard model. Clinicopathological characteristics and survival outcomes were assessed for the whole cohort. A total of 78,701 lung cancer patients with >5 years survival were identified. This cohort included 54,488 patients surviving 5-10 years and 24,213 patients surviving >10 years. Among patients surviving 5-10 years, 21.8% were dead because of primary lung cancer, 10.2% were dead because of other cancers, 6.8% were dead because of cardiac disease and 5.3% were dead because of non-malignant pulmonary disease. Among patients surviving >10 years, 12% were dead because of primary lung cancer, 6% were dead because of other cancers, 6.9% were dead because of cardiac disease and 5.6% were dead because of non-malignant pulmonary disease. On multivariate analysis, factors associated with longer cardiac-disease-specific survival in multivariate analysis include younger age at diagnosis (p death from primary lung cancer is still significant among other causes of death even 20 years after diagnosis of lung cancer. Moreover, cardiac as well as non-malignant pulmonary causes contribute a considerable proportion of deaths in long-term lung cancer survivors.
Weiner, Lois; Kaplan, Andy
2014-01-01
In this commentary, Andy Kaplan discusses with Lois Weiner, Diane Ravitch's latest book "The Reign of Error," which combines scholarly argument and scrupulous research in defense of democratic education. Weiner notes, the book will prove an important resource in the ongoing struggle for the survival of public schooling. Weiner adds,…
Wang, Xiangyang; Cao, Weilan; Zheng, Chenguo; Hu, Wanle; Liu, Changbao
2018-06-01
Marital status has been validated as an independent prognostic factor for survival in several cancer types, but is controversial in rectal cancer (RC). The objective of this study was to investigate the impact of marital status on the survival outcomes of patients with RC. We extracted data of 27,498 eligible patients diagnosed with RC between 2004 and 2009 from the Surveillance, Epidemiology and End Results (SEER) database. Patients were categorized into married, never married, divorced/separated and widowed groups.We used Chi-square tests to compare characteristics of patients with different marital status.Rectal cancer specific survival was compared using the Kaplan-Meier method,and multivariate Cox regression analyses was used to analyze the survival outcome risk factors in different marital status. The widowed group had the highest percentage of elderly patients and women,higher proportion of adenocarcinomas, and more stage I/II in tumor stage (P married group (76.7% VS 85.4%). Compared with the married patients, the never married (HR 1.40), widowed (HR 1.61,) and divorced/separated patients (HR 1.16) had an increased overall 5-year mortality. A further analysis showed that widowed patients had an increased overall 5-year cause-specific survival(CSS) compared with married patients at stage I(HR 1.92),stage II (HR 1.65),stage III (HR 1.73),and stage IV (HR 1.38). Our study showed marriage was associated with better outcomes of RC patients, but unmarried RC patients, especially widowed patients,are at greater risk of cancer specific mortality. Copyright © 2018 Elsevier Ltd. All rights reserved.
Role of IKK-alpha in EGFR Signaling Regulation
2013-09-01
heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3
Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2
DEFF Research Database (Denmark)
Sarkisian, Laura; Saaby, L.; Poulsen, T. S.
2015-01-01
-year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...
Directory of Open Access Journals (Sweden)
Ana – Maria Budai
2010-10-01
Full Text Available The paper present an analytical method that can be used to determianted fatigue life time duration in service for runner blade mechanism of Kaplan turbines. The study was made for lever button of runer blade mechanism using two analytical relation to calculate the maximum number of stress cycles whereupon the mechanism work without any damage. To estimate fatigue life time duration will be used a formula obtained from one of most comon cumulative damage methodology taking in consideration the real exploatation conditions of a specified Kapaln turbine.
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Masaaki, E-mail: BCD06275@nifty.com [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Department of Neurosurgery, Tokyo Women' s Medical University Medical Center E, Tokyo (Japan); Kawabe, Takuya [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Department of Neurosurgery, Kyoto Prefectural University of Medicine Graduate School of Medical Sciences, Kyoto (Japan); Higuchi, Yoshinori [Department of Neurosurgery, Chiba University Graduate School of Medicine, Chiba (Japan); Sato, Yasunori [Clinical Research Center, Chiba University Graduate School of Medicine, Chiba (Japan); Barfod, Bierta E. [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Kasuya, Hidetoshi [Department of Neurosurgery, Tokyo Women' s Medical University Medical Center E, Tokyo (Japan); Urakawa, Yoichi [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan)
2012-12-01
Purpose: We tested the validity of 3 recently proposed prognostic indexes for breast cancer patients with brain metastases (METs) treated radiosurgically. The 3 indexes are Diagnosis-Specific Graded Prognostic Assessment (DS-GPA), New Breast Cancer (NBC)-Recursive Partitioning Analysis (RPA), and our index, sub-classification of RPA class II patients into 3 sub-classes (RPA class II-a, II-b and II-c) based on Karnofsky performance status, tumor number, original tumor status, and non-brain METs. Methods and Materials: This was an institutional review board-approved, retrospective cohort study using our database of 269 consecutive female breast cancer patients (mean age, 55 years; range, 26-86 years) who underwent Gamma Knife radiosurgery (GKRS) alone, without whole-brain radiation therapy, for brain METs during the 15-year period between 1996 and 2011. The Kaplan-Meier method was used to estimate the absolute risk of each event. Results: Kaplan-Meier plots of our patient series showed statistically significant survival differences among patients stratified into 3, 4, or 5 groups based on the 3 systems (P<.001). However, the mean survival time (MST) differences between some pairs of groups failed to reach statistical significance with all 3 systems. Thus, we attempted to regrade our 269 breast cancer patients into 3 groups by modifying our aforementioned index along with the original RPA class I and III, (ie, RPA I+II-a, II-b, and II-c+III). There were statistically significant MST differences among these 3 groups without overlap of 95% confidence intervals (CIs) between any 2 pairs of groups: 18.4 (95% CI = 14.0-29.5) months in I+II-a, 9.2 in II-b (95% CI = 6.8-12.9, P<.001 vs I+II-a) and 5.0 in II-c+III (95% CI = 4.2-6.8, P<.001 vs II-b). Conclusions: As none of the new grading systems, DS-GPS, BC-RPA and our system, was applicable to our set of radiosurgically treated patients for comparing survivals after GKRS, we slightly modified our system for breast cancer
International Nuclear Information System (INIS)
Hyun, Seung Hyup; Choi, Joon Young; Lee, Kyung-Han; Eo, Jae Seon; Lee, Jeong Won; Na, Sae Jung; Hong, Il Ki; Oh, Jin Kyoung; Chung, Yong An; Song, Bong-Il; Kim, Tae-Sung; Kim, Kyung Sik; Moon, Dae Hyuk; Yun, Mijin
2016-01-01
We evaluated the prognostic value of pretreatment 18 F-fluorodeoxyglucose positron emission tomography with computed tomography (FDG PET/CT) in patients with Barcelona Clinic Liver Cancer (BCLC) stage 0 or A hepatocellular carcinoma (HCC) who had received curative treatment or transarterial chemoembolization (TACE). Between 2009 and 2010, 317 patients diagnosed with HCC at seven hospitals were enrolled. Among these, 195 patients underwent curative treatments including resection, liver transplantation, and radiofrequency ablation. TACE was performed in 122 patients. The tumor-to-normal liver standardized uptake value ratio (TLR) of the primary tumor was measured using pretreatment FDG PET/CT. The prognostic significance of TLR and other clinical variables was assessed using Cox regression models. Differences in the overall survival (OS) associated with TLR or other significant clinical factors were examined using the Kaplan-Meier method. Over a median follow-up period of 46 months, 77 patients died from cancer. In the curative cohort, higher TLR (≥2) was significantly associated with death (hazard ratio [HR] = 2.68; 95 % CI, 1.16-6.15; P = 0.020) in multivariable analysis. Patients with a higher TLR had significantly worse OS than patients with a lower TLR (5-year overall survival, 61 % vs. 79.4 %; P = 0.006). In the TACE cohort, the Model for End-Stage Liver Disease (MELD) score (≥8) was a significant independent prognostic factor for OS (HR = 3.34; 95 % CI, 1.49-7.48; P = 0.003), whereas TLR was not associated with OS. The Kaplan-Meier curves showed significantly poorer OS in patients with higher MELD scores (≥8) than in those with lower MELD scores (5-year survival rate, 33.1 % vs. 79.6 %; P < 0.001). Pretreatment TLR measured using FDG PET/CT was an independent prognostic factor for OS in patients with BCLC stage 0 or A HCC undergoing curative treatment. In contrast, underlying liver function appeared to be important in predicting the prognosis of patients
International Nuclear Information System (INIS)
Xue Bo; Zhang Peilei; Wang Jue; Li Minghua; Zhao Jungong; Zhu Yueqi; Tan Huaqiao; Wang Jianbo
2011-01-01
Objective: To evaluate batroxobin in preventing vascular restenosis in diabetic patients after infrapopliteal arterial angioplasty through comparing the clinical results of the combination use of batroxobin and aspirin with that of simple use of aspirin. Methods: After a successful angioplasty, fifty-two diabetic patients with symptomatic infrapopliteal obstructions were randomly divided into the study group (n=26) and the control group (n=26). Patients in both groups received 100 aspirin everyday, but the patients in study group additionally received 5 IU batroxobin intravenous drip every day for six times. At the end of the follow-up period lasting for 12 months, magnetic resonance angiography (MRA) or Doppler ultrasonic angiography was performed to check the vessels to see if there was any restenosis or reocclusion. The relief degree of clinical symptoms were observed, and both preoperative and postoperative ankle-brachial index (ABI) were regularly determined and compared. Kaplan-Meier curves were constructed to evaluate restenosis/reocclusion-free rate, limb salvage rate and amputation-free rate. Results: During the follow-up period the occurrence of restenosis/reocclusion in study group and control group was 22.0% and 34.5% respectively (P=0.0307). Statistically significant difference in ABI existed between two groups both after the procedure (P<0.05) and at 12 months after the treatment (P=0.0094). Clinical improvement and tissue healing in study group and control group were observed in 23 and 19 patients respectively (P=0.0544). Twelve months after angioplasty, Kaplan-Meier analysis showed that the restenosis/reocclusion-free rate, the limb salvage rate and the amputation-free rate for study group were 74.0%, 96.2% and 84.6% respectively, while they was 54.8%, 92.3% and 84.6% respectively for control group. Conclusion: The results of this study indicate that the use of the clinical therapeutic efficacy and markedly relieve the symptoms, although this
Spiess, Philippe E; Levy, David A; Mouraviev, Vladimir; Pisters, Louis L; Jones, J Stephen
2013-08-01
What's known on the subject? and what does the study add?: Previous studies have identified the most important prognostic factors of the likely outcomes of salvage prostate whole-gland ablation, including initial clinical stage, biopsy Gleason score, and PSA (total and doubling time). There is potential for further optimization of candidate selection for salvage cryoablation with curative intent and nadir PSA achieved after whole-gland cryotherapy may provide additional prognostic value. The study shows that the most important prognostic factors of biochemical progression-free survival for patients who have undergone whole-gland salvage prostate cryotherapy are nadir PSA achieved after therapy and pre-therapy biopsy Gleason score. Based on these two prognostic variables, we have identified risk stratification groups (low, intermediate and high) which help predict the expected outcomes of salvage whole-gland prostate cryotherapy in a given patient. This risk stratification constitutes a useful clinical tool in defining which patients maybe best suited for this local salvage treatment method. To assess the prognostic variables predicting the risk of biochemical progression-free survival (bPFS) after salvage prostate whole-gland cryotherapy using the Phoenix definition of bPFS. A total of 132 patients underwent prostate whole-gland salvage cryotherapy with curative intent. No patient underwent neoadjuvant/adjuvant hormonal ablative therapy, and all had extended post-salvage prostate-specific antigen (PSA) follow-up data. Cox univariate and multivariate logistic regression analyses of potential predictors of bPFS were conducted. Kaplan-Meier analyses of bPFS was also performed. At a mean (range) follow-up of 4.3 (0.9-12.7) years, the median (range) post-cryotherapy nadir PSA achieved was 0.17 (0-33.9) ng/mL. On multivariate analysis, predictors of bPFS were nadir PSA post-cryotherapy and pre-salvage biopsy Gleason score (P 2.5 ng/mL or biopsy Gleason score ≥ 7, with
Hyperfractionation in carcinoma of the cervix: tumor control and late bowel complications
International Nuclear Information System (INIS)
Viswanathan, Faith Rangad; Varghese, Cherian; Peedicayil, Abraham; Lakshmanan, Jeyaseelan; Narayan, Viswanathan Perungulam
1999-01-01
Purpose: Hyperfractionation has been advocated to improve local tumor control by increasing radiation dose without increasing late normal tissue complications. The aim of this study was to determine if hyperfractionation decreased late bowel complications. Methods and Materials: Thirty patients with Stage II and III cervical cancer were randomized to receive either hyperfractionation or conventional fractionation. Patients were followed for 5 years and monitored for tumor control, recurrence, and bowel complications. The relative risks of tumor control and bowel complications were computed at 1 year and 5 years of follow-up. Kaplan-Meier survival curves were plotted to determine probabilities of being tumor-free and bowel complication-free. Results: There were 15 patients in each group. At 1 year of follow-up, 2 patients in the hyperfractionation group (13%) and 7 patients in the conventional treatment group (45%) had tumor (relative risk [RR] 0.3; 95% confidence interval [CI] 0.1, 1.1; p = 0.054). Delayed bowel complications were seen in 8 patients in the hyperfractionation group and 1 patient in the conventional treatment group (RR 7.5; 95% CI 1.1, 52; p = 0.014). At 5 years, 2 patients in the hyperfractionation group and 8 patients in the conventional treatment group had tumor (RR 0.3; 95% CI 0.1, 1.1; p = 0.04). Delayed bowel complications (Grades 2 and 3) occurred in 9 women in the hyperfractionation group and 2 patients in the conventional group (RR 5.4; 95% CI 1.5, 19.5; p 0.0006). Kaplan-Meier analysis showed that the hyperfractionation group had significantly more bowel complications over the 5 years of follow-up (p 0.024). Conclusion: Hyperfractionation may result in better tumor control both at 1 year and at 5 years following treatment of cervical cancer. However, hyperfractionation could lead to increased late bowel complications and must be used judiciously in the treatment of cervical cancer
International Nuclear Information System (INIS)
Scarsbrook, Andrew; Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag; Swift, Sarah; Cooper, Rachel
2017-01-01
To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced
Graft survival rate of renal transplantation during a period of 10 years in Iran
Directory of Open Access Journals (Sweden)
Fatemeh Shahbazi
2015-01-01
Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.
Energy Technology Data Exchange (ETDEWEB)
Scarsbrook, Andrew [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); University of Leeds, Leeds Institute of Cancer and Pathology, Leeds (United Kingdom); Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); Swift, Sarah [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Cooper, Rachel [Leeds Teaching Hospitals NHS Trust, Department of Clinical Oncology, Leeds (United Kingdom)
2017-04-15
To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced
Sun, Ming-Hui; Liao, Yaping Joyce
2017-09-01
The optic nerve head is vulnerable to ischemia leading to anterior ischemic optic neuropathy (AION), the most common acute optic neuropathy in those older than 50 years of age. We performed a cross-sectional study of 55 nonarteritic anterior ischemic optic neuropathy (NAION) eyes in 34 patients to assess clinical outcome and perform structure-function correlations. The peak age of NAION onset was between 50 and 55 years. Sixty-seven percent of patients presented with their first event between the ages of 40 and 60 years, and 32% presented at ≤50 years. Those with NAION onset at age ≤50 years did not have significantly better visual outcome per logMAR visual acuity, automated perimetric mean deviation (PMD) or optical coherence tomography (OCT) measurements. Kaplan-Meier survival curve and multivariate Cox proportional regression analysis showed that age >50 years at NAION onset was associated with greater risk of second eye involvement, with hazard ratio of 20. Older age at onset was significantly correlated with greater thinning of the ganglion cell complex (GCC) (P = 0.022) but not with logMAR visual acuity, PMD, or thinning of retinal nerve fiber layer (RNFL). Using area under receiver operating characteristic curve analyses, we found that thinning of RNFL and GCC was best able to predict visual outcome, and that mean RNFL thickness >65 μm or macular GCC thickness >55 μm significantly correlated with good visual field outcome. We showed that NAION onset at age >50 years had a greater risk of second eye involvement. Patients with OCT mean RNFL thickness >65 μm and mean macular ganglion cell complex thickness >55 μm had better visual outcomes.
Yang, Ya-Hsu; Teng, Hao-Wei; Lai, Yen-Ting; Li, Szu-Yuan; Lin, Chih-Ching; Yang, Albert C; Chan, Hsiang-Lin; Hsieh, Yi-Hsuan; Lin, Chiao-Fan; Hsu, Fu-Ying; Liu, Chih-Kuang; Liu, Wen-Sheng
2015-01-01
Patients with late-onset depression (LOD) have been reported to run a higher risk of subsequent dementia. The present study was conducted to assess whether statins can reduce the risk of dementia in these patients. We used the data from National Health Insurance of Taiwan during 1996-2009. Standardized Incidence Ratios (SIRs) were calculated for LOD and subsequent dementia. The criteria for LOD diagnoses included age ≥65 years, diagnosis of depression after 65 years of age, at least three service claims, and treatment with antidepressants. The time-dependent Cox proportional hazards model was applied for multivariate analyses. Propensity scores with the one-to-one nearest-neighbor matching model were used to select matching patients for validation studies. Kaplan-Meier curve estimate was used to measure the group of patients with dementia living after diagnosis of LOD. Totally 45,973 patients aged ≥65 years were enrolled. The prevalence of LOD was 12.9% (5,952/45,973). Patients with LOD showed to have a higher incidence of subsequent dementia compared with those without LOD (Odds Ratio: 2.785; 95% CI 2.619-2.958). Among patients with LOD, lipid lowering agent (LLA) users (for at least 3 months) had lower incidence of subsequent dementia than non-users (Hazard Ratio = 0.781, 95% CI 0.685-0.891). Nevertheless, only statins users showed to have reduced risk of dementia (Hazard Ratio = 0.674, 95% CI 0.547-0.832) while other LLAs did not, which was further validated by Kaplan-Meier estimates after we used the propensity scores with the one-to-one nearest-neighbor matching model to control the confounding factors. Statins may reduce the risk of subsequent dementia in patients with LOD.
International Nuclear Information System (INIS)
Dietl, B.; Schaefer, C.; Koelbl, O.
2005-01-01
Purpose: to answer the question, how the parameters waiting time, radiation treatment time and overall treatment time (OTT) influenced the endpoints overall (OS), event-free (EFS) and local recurrence-free survival (LRFS) in patients with locally advanced head-and-neck cancer, who had received postoperative radiotherapy. Patients and methods: 138 patients were included into a retrospective analysis from 10/1993 to 05/2000. Besides the time parameters waiting time, radiation treatment time and OTT, tumor- and therapy-related parameters (T-, N-, R-status, grading, tumor site, surgical technique, and postoperative hemoglobin < 12 g/dl) with potential impact on the endpoints were investigated in the univariate analysis (Kaplan-Meier log-rank test). Individual parameters with a significant impact (p = 0.05) were subjected to a multivariate Cox regression analysis. Results: besides a postoperative hemoglobin value < 12 g/dl, in the univariate analysis an OTT ≥ 105 days negatively influenced all endpoints, as well as a radiation treatment time ≥ 60 days. On multivariate Cox regression analysis, postoperative hemoglobin < 12 g/dl and an OTT ≥ 105 days were identified as independent negative prognostic factors for all endpoints. Conclusion: the waiting time should be managed according to the ASARA (as short as reasonably achievable) recommendation, radiation treatment should not be protracted exceeding an overall treatment of 105 days. Generally, time parameters should be routinely included in the standard tumor documentation, thus facilitating further evaluation of these prognostically relevant factors. (orig.)
Sutton, Virginia Kay
This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.
Multivariate analysis of factors influencing the effect of radiosynovectomy
International Nuclear Information System (INIS)
Farahati, J.; Schulz, G.; Koerber, C.; Geling, M.; Schmeider, P.; Reiners, Chr.; Wendler, J.; Kenn, W.; Reidemeister, C.
2002-01-01
Objective: In this prospective study, the time to remission after radiosynovectomy (RSV) was analyzed and the influence of age, sex, underlying disease, type of joint, and duration of illness on the success rate of RSV was determined. Methods: A total number of 57 patients with rheumatoid arthritis (n = 33) and arthrosis (n = 21) with a total number of 130 treated joints (36 knee, 66 small and 28 medium-size joints) were monitored using visual analogue scales (VAS) from one week before RSV up to four to six months after RSV. The patients had to answer 3 times daily for pain intensity of the treated joint. The time until remission was determined according to the Kaplan-Meier survivorship function. The influence of the prognosis parameters on outcome of RSV was determined by multivariate discriminant analysis. Results: After six months, the probability of pain relief of more than 20% amounted to 78% and was significantly dependent on the age of the patient (p = 0.02) and the duration of illness (p = 0.05), however not on sex (p = 0.17), underlying disease (p = 0.23), and type of joint (p = 0.69). Conclusion: Irrespective of sex, type of joint and underlying disease, a measurable pain relief can be achieved with RSV in 78% of the patients with synovitis, whereby effectiveness is decreasing with increasing age and progress of illness. (orig.) [de
International Nuclear Information System (INIS)
Skwarchuk, Mark W.; Jackson, Andrew; Zelefsky, Michael J.; Venkatraman, Ennapadam S.; Cowen, Didier M.; Levegruen, Sabine; Burman, Chandra M.; Fuks, Zvi; Leibel, Steven A.; Ling, C. Clifton
2000-01-01
Purpose: The purpose of this paper is to use the outcome of a dose escalation protocol for three-dimensional conformal radiation therapy (3D-CRT) of prostate cancer to study the dose-response for late rectal toxicity and to identify anatomic, dosimetric, and clinical factors that correlate with late rectal bleeding in multivariate analysis. Methods and Materials: Seven hundred forty-three patients with T1c-T3 prostate cancer were treated with 3D-CRT with prescribed doses of 64.8 to 81.0 Gy. The 5-year actuarial rate of late rectal toxicity was assessed using Kaplan-Meier statistics. A retrospective dosimetric analysis was performed for patients treated to 70.2 Gy (52 patients) or 75.6 Gy (119 patients) who either exhibited late rectal bleeding (RTOG Grade 2/3) within 30 months after treatment (i.e., 70.2 Gy--13 patients, 75.6 Gy--36 patients) or were nonbleeding for at least 30 months (i.e., 70.2 Gy--39 patients, 75.6 Gy--83 patients). Univariate and multivariate logistic regression was performed to correlate late rectal bleeding with several anatomic, dosimetric, and clinical variables. Results: A dose response for ≥ Grade 2 late rectal toxicity was observed. By multivariate analysis, the following factors were significantly correlated with ≥ Grade 2 late rectal bleeding for patients prescribed 70.2 Gy: 1) enclosure of the outer rectal contour by the 50% isodose on the isocenter slice (i.e., Iso50) (p max (p max
Lal, Brajesh K; Beach, Kirk W; Roubin, Gary S; Lutsep, Helmi L; Moore, Wesley S; Malas, Mahmoud B; Chiu, David; Gonzales, Nicole R; Burke, J Lee; Rinaldi, Michael; Elmore, James R; Weaver, Fred A; Narins, Craig R; Foster, Malcolm; Hodgson, Kim J; Shepard, Alexander D; Meschia, James F; Bergelin, Robert O; Voeks, Jenifer H; Howard, George; Brott, Thomas G
2012-09-01
In the Carotid Revascularization Endarterectomy versus Stenting Trial (CREST), the composite primary endpoint of stroke, myocardial infarction, or death during the periprocedural period or ipsilateral stroke thereafter did not differ between carotid artery stenting and carotid endarterectomy for symptomatic or asymptomatic carotid stenosis. A secondary aim of this randomised trial was to compare the composite endpoint of restenosis or occlusion. Patients with stenosis of the carotid artery who were asymptomatic or had had a transient ischaemic attack, amaurosis fugax, or a minor stroke were eligible for CREST and were enrolled at 117 clinical centres in the USA and Canada between Dec 21, 2000, and July 18, 2008. In this secondary analysis, the main endpoint was a composite of restenosis or occlusion at 2 years. Restenosis and occlusion were assessed by duplex ultrasonography at 1, 6, 12, 24, and 48 months and were defined as a reduction in diameter of the target artery of at least 70%, diagnosed by a peak systolic velocity of at least 3·0 m/s. Studies were done in CREST-certified laboratories and interpreted at the Ultrasound Core Laboratory (University of Washington). The frequency of restenosis was calculated by Kaplan-Meier survival estimates and was compared during a 2-year follow-up period. We used proportional hazards models to assess the association between baseline characteristics and risk of restenosis. Analyses were per protocol. CREST is registered with ClinicalTrials.gov, number NCT00004732. 2191 patients received their assigned treatment within 30 days of randomisation and had eligible ultrasonography (1086 who had carotid artery stenting, 1105 who had carotid endarterectomy). In 2 years, 58 patients who underwent carotid artery stenting (Kaplan-Meier rate 6·0%) and 62 who had carotid endarterectomy (6·3%) had restenosis or occlusion (hazard ratio [HR] 0·90, 95% CI 0·63-1·29; p=0·58). Female sex (1·79, 1·25-2·56), diabetes (2·31, 1·61-3·31
SOX4 inhibits GBM cell growth and induces G0/G1 cell cycle arrest through Akt-p53 axis.
Zhang, Jing; Jiang, Huawei; Shao, Jiaofang; Mao, Ruifang; Liu, Jie; Ma, Yingying; Fang, Xuefeng; Zhao, Na; Zheng, Shu; Lin, Biaoyang
2014-11-01
SOX4 is a transcription factor required for tissue development and differentiation in vertebrates. Overexpression of SOX4 has been reported in many cancers including glioblastoma multiforme (GBM), however, the underlying mechanism of actions has not been studied. In this study, we investigated the role of SOX4 in GBM. Kaplan-Meier analysis was performed to assess the association between SOX4 expression levels and survival times in primary GBM samples. Cre/lox P system was used to generate gain or loss of SOX4 in GBM cells, and microarray analysis uncovered the regulation network of SOX4 in GBM cells. High SOX4 expression was significantly associated with good prognosis of primary GBMs. SOX4 inhibited the growth of GBM cell line LN229, A172G and U87MG, partly via the activation of p53-p21 signaling and down-regulation of phosphorylated AKT1. Gene expression profiling and subsequent gene ontology analysis showed that SOX4 influenced several key pathways including the Wnt/ beta-catenin and TGF-beta signaling pathways. Our study found that SOX4 acts as a tumor suppressor in GBM cells by induce cell cycle arrest and inhibiting cell growth.
Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng
2017-10-01
A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.
International Nuclear Information System (INIS)
Barney, Brandon M.; Petersen, Ivy A.; Mariani, Andrea; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.
2013-01-01
Objectives: The optimal adjuvant therapy for International Federation of Gynecology and Obstetrics (FIGO) stage I papillary serous (UPSC) or clear cell (CC) endometrial cancer is unknown. We report on the largest single-institution experience using adjuvant high-dose-rate vaginal brachytherapy (VBT) for surgically staged women with FIGO stage I UPSC or CC endometrial cancer. Methods and Materials: From 1998-2011, 103 women with FIGO 2009 stage I UPSC (n=74), CC (n=21), or mixed UPSC/CC (n=8) endometrial cancer underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy followed by adjuvant high-dose-rate VBT. Nearly all patients (n=98, 95%) also underwent extended lymph node dissection of pelvic and paraortic lymph nodes. All VBT was performed with a vaginal cylinder, treating to a dose of 2100 cGy in 3 fractions. Thirty-five patients (34%) also received adjuvant chemotherapy. Results: At a median follow-up time of 36 months (range, 1-146 months), 2 patients had experienced vaginal recurrence, and the 5-year Kaplan Meier estimate of vaginal recurrence was 3%. The rates of isolated pelvic recurrence, locoregional recurrence (vaginal + pelvic), and extrapelvic recurrence (including intraabdominal) were similarly low, with 5-year Kaplan-Meier estimates of 4%, 7%, and 10%, respectively. The estimated 5-year overall survival was 84%. On univariate analysis, delivery of chemotherapy did not affect recurrence or survival. Conclusions: VBT is effective at preventing vaginal relapse in women with surgical stage I UPSC or CC endometrial cancer. In this cohort of patients who underwent comprehensive surgical staging, the risk of isolated pelvic or extrapelvic relapse was low, implying that more extensive adjuvant radiation therapy is likely unnecessary.
Miners’ return to work following injuries in coal mines
Directory of Open Access Journals (Sweden)
Ashis Bhattacherjee
2016-12-01
Full Text Available Background: The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW following a miner’s injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person’s social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners’ injuries. Material and Methods: A study was conducted for 109 injured workers from an underground coal mine in the years 2000–2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. Results: According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners’ return to work included presence of disease, job satisfaction and injury type. Conclusions: The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6:729–742
Molecular genetics analysis of hereditary breast and ovarian cancer patients in India
Directory of Open Access Journals (Sweden)
Soumittra Nagasamy
2009-08-01
Full Text Available Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16% pathogenic mutations (12 in BRCA1 and 3 in BRCA2, of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free and with prognostic molecular markers (ER, PR, c-erbB2 and p53. Conclusion The stage of the disease at diagnosis was the only statistically significant (p
Uriarte-Duque, Juan; Hernández-Riverab, Gabriela
2006-01-01
Survival in patients with acquired immunodeficiency syndrome (AIDS) related non-Hodgkin's Lymphoma has improved with the use of High Active Antiretroviral Therapy (HAART) and less toxic chemotherapy. Clinical characteristics and outcome among patients treated for AIDS related non-Hodgkin's Lymphoma are described. Nine patients were studied retrospectively. Overall survival (OS) and Free Disease Survival (FDS) using a Kaplan-Meier model were analyzed. Patients received (DA-EPOCH) etoposide, prednisone, vincristine, doxorubicin and cyclophosphamide. The overall Survival was 18 months and 13 month Free Disease Survival with a median follow-up of 16 months showing full response in 8/9 patients was observed. A very satisfactory treatment response in this group of patients expressed as an increased Overall Survival was noted.
Xing, Xiaofang; Du, Hong; Zhou, Chunlian; Zhang, Qingyun; Hao, Chunyi; Wen, Xianzi; Ji, Jiafu
2016-01-01
Background Lysosome-associated transmembrane-4 beta (LAPTM4B) is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients. Method Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort), 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher’s exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model. Results LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts). LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045). Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS) in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively), but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively). Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR) = 0.432; 95% confidence interval (CI) = 0.243–0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638–1.804 and 0.998, HR = 1.000, 95% CI = 0.663–1.530, respectively). Conclusion These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might
Directory of Open Access Journals (Sweden)
Xiaojing Cheng
Full Text Available Lysosome-associated transmembrane-4 beta (LAPTM4B is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients.Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort, 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher's exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model.LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts. LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045. Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively, but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively. Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR = 0.432; 95% confidence interval (CI = 0.243-0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638-1.804 and 0.998, HR = 1.000, 95% CI = 0.663-1.530, respectively.These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might be a useful prognostic indicator for
Tadmouri, Abir; Blomkvist, Josefin; Landais, Cécile; Seymour, Jerome; Azmoun, Alexandre
2018-02-01
Although left ventricular assist devices (LVADs) are currently approved for coverage and reimbursement in France, no French cost-effectiveness (CE) data are available to support this decision. This study aimed at estimating the CE of LVAD compared with medical management in the French health system. Individual patient data from the 'French hospital discharge database' (Medicalization of information systems program) were analysed using Kaplan-Meier method. Outcomes were time to death, time to heart transplantation (HTx), and time to death after HTx. A micro-costing method was used to calculate the monthly costs extracted from the Program for the Medicalization of Information Systems. A multistate Markov monthly cycle model was developed to assess CE. The analysis over a lifetime horizon was performed from the perspective of the French healthcare payer; discount rates were 4%. Probabilistic and deterministic sensitivity analyses were performed. Outcomes were quality-adjusted life years (QALYs) and incremental CE ratio (ICER). Mean QALY for an LVAD patient was 1.5 at a lifetime cost of €190 739, delivering a probabilistic ICER of €125 580/QALY [95% confidence interval: 105 587 to 150 314]. The sensitivity analysis showed that the ICER was mainly sensitive to two factors: (i) the high acquisition cost of the device and (ii) the device performance in terms of patient survival. Our economic evaluation showed that the use of LVAD in patients with end-stage heart failure yields greater benefit in terms of survival than medical management at an extra lifetime cost exceeding the €100 000/QALY. Technological advances and device costs reduction shall hence lead to an improvement in overall CE. © 2017 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of the European Society of Cardiology.
Concurrent chemoradiation for vaginal cancer.
Directory of Open Access Journals (Sweden)
David T Miyamoto
Full Text Available BACKGROUND: It is not known whether the addition of chemotherapy to radiation therapy improves outcomes in primary vaginal cancer. Here, we review clinical outcomes in patients with primary vaginal cancer treated with radiation therapy (RT or concurrent chemoradiation therapy (CRT. METHODS: Seventy-one patients with primary vaginal cancer treated with definitive RT with or without concurrent chemotherapy at a single institution were identified and their records reviewed. A total of 51 patients were treated with RT alone; 20 patients were treated with CRT. Recurrences were analyzed. Overall survival (OS and disease-free survival (DFS rates were estimated using the Kaplan-Meier method. Cox regression analysis was performed. RESULTS: The median age at diagnosis was 61 years (range, 18-92 years and the median follow-up time among survivors was 3.0 years. Kaplan-Meier estimates for OS and DFS differed significantly between the RT and CRT groups (3-yr OS = 56% vs. 79%, log-rank p = 0.037; 3-yr DFS = 43% vs. 73%, log-rank p = 0.011. Twenty-three patients (45% in the RT group had a relapse at any site compared to 3 (15% in the CRT group (p = 0.027. With regard to the sites of first relapse, 10 patients (14% had local only, 4 (6% had local and regional, 9 (13% had regional only, 1 (1% had regional and distant, and 2 (3% had distant only relapse. On univariate analysis, the use of concurrent chemotherapy, FIGO stage, tumor size, and date of diagnosis were significant predictors of DFS. On multivariate analysis, the use of concurrent chemotherapy remained a significant predictor of DFS (hazard ratio 0.31 (95% CI, 0.10-0.97; p = 0.04. CONCLUSIONS: Vaginal cancer results in poor outcomes. Adequate radiation dose is essential to ensure curative management. Concurrent chemotherapy should be considered for vaginal cancer patients.
International Nuclear Information System (INIS)
Garsa, Adam A.; Badiyan, Shahed N.; DeWees, Todd; Simpson, Joseph R.; Huang, Jiayi; Drzymala, Robert E.; Barani, Igor J.; Dowling, Joshua L.; Rich, Keith M.; Chicoine, Michael R.; Kim, Albert H.; Leuthardt, Eric C.; Robinson, Clifford G.
2014-01-01
Purpose: To evaluate local control rates and predictors of individual tumor local control for brain metastases from non-small cell lung cancer (NSCLC) treated with stereotactic radiosurgery (SRS). Methods and Materials: Between June 1998 and May 2011, 401 brain metastases in 228 patients were treated with Gamma Knife single-fraction SRS. Local failure was defined as an increase in lesion size after SRS. Local control was estimated using the Kaplan-Meier method. The Cox proportional hazards model was used for univariate and multivariate analysis. Receiver operating characteristic analysis was used to identify an optimal cutpoint for conformality index relative to local control. A P value <.05 was considered statistically significant. Results: Median age was 60 years (range, 27-84 years). There were 66 cerebellar metastases (16%) and 335 supratentorial metastases (84%). The median prescription dose was 20 Gy (range, 14-24 Gy). Median overall survival from time of SRS was 12.1 months. The estimated local control at 12 months was 74%. On multivariate analysis, cerebellar location (hazard ratio [HR] 1.94, P=.009), larger tumor volume (HR 1.09, P<.001), and lower conformality (HR 0.700, P=.044) were significant independent predictors of local failure. Conformality index cutpoints of 1.4-1.9 were predictive of local control, whereas a cutpoint of 1.75 was the most predictive (P=.001). The adjusted Kaplan-Meier 1-year local control for conformality index ≥1.75 was 84% versus 69% for conformality index <1.75, controlling for tumor volume and location. The 1-year adjusted local control for cerebellar lesions was 60%, compared with 77% for supratentorial lesions, controlling for tumor volume and conformality index. Conclusions: Cerebellar tumor location, lower conformality index, and larger tumor volume were significant independent predictors of local failure after SRS for brain metastases from NSCLC. These results warrant further investigation in a prospective
Energy Technology Data Exchange (ETDEWEB)
Kim, Tae Gwon; Byun, Kyung Hwan; Oh, Hyun Han; Ryeom, Hun Kyu; Kim, Yong Joo [Kyungpook National Univ. Hospital, Taegu (Korea, Republic of)
1996-07-01
To evaluate long-term survival rates and prognostic factors of patients with hepatocellular carcinoma after TAE. 225 patients with hepatocellular carcinoma treated with TAE between January 1988 and December 1994 were studied. Hepatocellular carcinoma was diagnosed either histologically(n=13) or clinically on the basis of findings characteristic for hepatocellular carcinoma obtained using such as diagnostic imaging methods such as ultrasonography, CT, MRI, and angiography as well as on the basis of high serum alpha-fetoprotein level(n=212). TAE was carried out between one and six times(mean, 1.4 time) using a mixture of lipiodol and Adriamycin, together with Gelfoam. Cumulative survival rates from the day of the first TAE were obtained by the Kaplan-Meier method. Parameters likely to influence the prognosis were subjected to univariate analysis using the log-rank test Cumulative survival rates at the end of the first, second, third, fourth, and fifth year were 55.9%, 32.6%, 21.9%, 17.9%, and 15.0%, respectively. The mean survival time was 727{+-}76 days. Several factors, including Child-Pugh classification, Okuda's stage, tumor size, presence of portal vein invasion by tumor, of arterio-portal shunt, and of extrahepatic metastases, catheter selection level, and number of TAE showed significant correlation with the outcome. Degrees of Lipiodol accumulation in a tumor on follow up CT were also correlated with survival rates. TAE is an effective measure for prolonging the patient's life expectancy and evaluation of prognostic factor is helpful for prognosis and in deciding on the optimal therapeutic modality.
Survival of Patients With Cervical Cancer in Rural India
Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy
2015-01-01
Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...
Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus
2013-01-01
BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...
Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model
International Nuclear Information System (INIS)
Rivetti, A; Angulo, M; Lucino, C; Liscia, S
2014-01-01
Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors
Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model
Rivetti, A.; Angulo, M.; Lucino, C.; Liscia, S.
2014-03-01
Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors.
Directory of Open Access Journals (Sweden)
Claudio Calazan do Carmo
2011-08-01
Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (pOBJETIVO: Evaluar la sobrevida global de mujeres con cáncer de cuello uterino e identificar factores pronósticos relacionados. MÉTODOS: Todos los 3.341 casos tratados en el Instituto Nacional de Cáncer, Rio de Janeiro, Sureste de Brasil, entre 1999 y 2004 fueron seleccionados y sus datos clínicos, anatomo-patológicos y de seguimiento fueron colectados. Se utilizaron la curva de Kaplan-meier y el modelo de Cox par evaluación de la sobrevida y para análisis logística múltiple, respectivamente. RESULTADOS: De los casos estudiados, 68,3% presentaban enfermedad localmente avanzada. La sobrevida en cinco años fue de 48%. Posterior al análisis múltiple, el estadio clínico al diagnóstico fue la única variable significativamente asociada con el pronóstico (pOBJETIVO: Avaliar a sobrevida global de mulheres com câncer de colo uterino e identificar fatores prognósticos relacionados. MÉTODOS: Todos os 3.341 casos tratados no Instituto Nacional de Câncer, Rio de Janeiro, RJ, entre 1999 e 2004 foram selecionados e seus dados clínicos, anatomo-patológicos e de seguimento foram coletados. Foram utilizados a curva de Kaplan-Meier e o modelo de Cox para avaliação da sobrevida e para análise logística m
Treatment of primary parotid non-Hodgkin's lymphoma: an analysis of 29 patients
International Nuclear Information System (INIS)
Gu Wendong; Feng Yan
2003-01-01
Objective: To analyze the clinical characteristics, treatment and prognosis of primary parotid non-Hodgkin's lymphoma. Methods: From March 1988 to February 2001, twenty-nine patients with primary parotid non-Hodgkin's lymphoma treated in our hospital were retrospectively analyzed. The data were analyzed according to the following factors: sex, age, stage, pathologic classification, chemotherapy given or not, cycles of chemotherapy, radiotherapy given or not, and the dose at the parotid. Kaplan-Meier method and Log-rank method were used in the statistic analysis. Results: The overall 5-year and 10-year survival rates were 73.3% and 51.0%. Stage and pathologic classification were prognostic factors in our statistic analysis. The 5-year survival rates were 81.6% and 25.0% for early stage (I E + II E) and advanced stage (III E + IV E) patients, with the difference significant (P<0.01). The 5-year survival rate for patients with the pathologic classification of mucosa associated lymphoid tissue (MALT) was 100% as compared to 42.2% for patients with diffused large B cell lymphoma, with the difference also significant (P<0.05). Conclusions: The prognosis of primary parotid non-Hodgkin's lymphoma is satisfactory. Surgery should only be used as a diagnostic method. Radiotherapy should be the first choice for patients with MALT lymphoma and stage I E and II E follicular lymphoma, but comprehensive treatment including chemotherapy is necessary to the diffuse large B cell lymphoma
Energy Technology Data Exchange (ETDEWEB)
Cui, Y; Shirato, H [Hokkaido University, Global Institute for Collaborative Research and Educat, Sapporo, Hokkaido (Japan); Song, J; Pollom, E; Chang, D; Koong, A [Stanford University, Palo Alto, CA (United States); Li, R [Hokkaido University, Global Institute for Collaborative Research and Educat, Sapporo, Hokkaido (Japan); Stanford University, Palo Alto, CA (United States)
2015-06-15
Purpose: This study aims to identify novel prognostic imaging biomarkers in locally advanced pancreatic cancer (LAPC) using quantitative, high-throughput image analysis. Methods: 86 patients with LAPC receiving chemotherapy followed by SBRT were retrospectively studied. All patients had a baseline FDG-PET scan prior to SBRT. For each patient, we extracted 435 PET imaging features of five types: statistical, morphological, textural, histogram, and wavelet. These features went through redundancy checks, robustness analysis, as well as a prescreening process based on their concordance indices with respect to the relevant outcomes. We then performed principle component analysis on the remaining features (number ranged from 10 to 16), and fitted a Cox proportional hazard regression model using the first 3 principle components. Kaplan-Meier analysis was used to assess the ability to distinguish high versus low-risk patients separated by median predicted survival. To avoid overfitting, all evaluations were based on leave-one-out cross validation (LOOCV), in which each holdout patient was assigned to a risk group according to the model obtained from a separate training set. Results: For predicting overall survival (OS), the most dominant imaging features were wavelet coefficients. There was a statistically significant difference in OS between patients with predicted high and low-risk based on LOOCV (hazard ratio: 2.26, p<0.001). Similar imaging features were also strongly associated with local progression-free survival (LPFS) (hazard ratio: 1.53, p=0.026) on LOOCV. In comparison, neither SUVmax nor TLG was associated with LPFS (p=0.103, p=0.433) (Table 1). Results for progression-free survival and distant progression-free survival showed similar trends. Conclusion: Radiomic analysis identified novel imaging features that showed improved prognostic value over conventional methods. These features characterize the degree of intra-tumor heterogeneity reflected on FDG
Trebše, Andrej J.
2004-01-01
The paper deals with efficiency measurement of Kaplan turbine with relative method (index test) and adjustment of operating of runner and guide vane governing system. At certain longer penstocks the looses in conduit at turbineload operation change the net head. On basis of model test on Kaplan turbine and relative turbine efficiency measurement on prototype the turbine governing system was optimized in accordance with comparative method. Prispevek obravnava meritev izkoristka kaplanove tu...
Skinner, S Rachel; Wheeler, Cosette M; Romanowski, Barbara; Castellsagué, Xavier; Lazcano-Ponce, Eduardo; Del Rosario-Raymundo, M Rowena; Vallejos, Carlos; Minkina, Galina; Pereira Da Silva, Daniel; McNeil, Shelly; Prilepskaya, Vera; Gogotadze, Irina; Money, Deborah; Garland, Suzanne M; Romanenko, Viktor; Harper, Diane M; Levin, Myron J; Chatterjee, Archana; Geeraerts, Brecht; Struyf, Frank; Dubin, Gary; Bozonnat, Marie-Cécile; Rosillon, Dominique; Baril, Laurence
2016-05-15
The control arm of the phase III VIVIANE (Human PapillomaVIrus: Vaccine Immunogenicity ANd Efficacy; NCT00294047) study in women >25 years was studied to assess risk of progression from cervical HPV infection to detectable cervical intraepithelial neoplasia (CIN). The risk of detecting CIN associated with the same HPV type as the reference infection was analysed using Kaplan-Meier and multivariable Cox models. Infections were categorised depending upon persistence as 6-month persistent infection (6MPI) or infection of any duration. The 4-year interim analysis included 2,838 women, of whom 1,073 (37.8%) experienced 2,615 infections of any duration and 708 (24.9%) experienced 1,130 6MPIs. Infection with oncogenic HPV types significantly increased the risk of detecting CIN grade 2 or greater (CIN2+) versus non-oncogenic types. For 6MPI, the highest risk was associated with HPV-33 (hazard ratio [HR]: 31.9 [8.3-122.2, p 25 years in this study was similar to that in women 15-25 years in PATRICIA. © 2015 The Authors and GlaxoSmithKline. International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.
Examining the Latent Structure of the Delis-Kaplan Executive Function System.
Karr, Justin E; Hofer, Scott M; Iverson, Grant L; Garcia-Barrera, Mauricio A
2018-05-04
The current study aimed to determine whether the Delis-Kaplan Executive Function System (D-KEFS) taps into three executive function factors (inhibition, shifting, fluency) and to assess the relationship between these factors and tests of executive-related constructs less often measured in latent variable research: reasoning, abstraction, and problem solving. Participants included 425 adults from the D-KEFS standardization sample (20-49 years old; 50.1% female; 70.1% White). Eight alternative measurement models were compared based on model fit, with test scores assigned a priori to three factors: inhibition (Color-Word Interference, Tower), shifting (Trail Making, Sorting, Design Fluency), and fluency (Verbal/Design Fluency). The Twenty Questions, Word Context, and Proverb Tests were predicted in separate structural models. The three-factor model fit the data well (CFI = 0.938; RMSEA = 0.047), although a two-factor model, with shifting and fluency merged, fit similarly well (CFI = 0.929; RMSEA = 0.048). A bifactor model fit best (CFI = 0.977; RMSEA = 0.032) and explained the most variance in shifting indicators, but rarely converged among 5,000 bootstrapped samples. When the three first-order factors simultaneously predicted the criterion variables, only shifting was uniquely predictive (p measuring executive-related constructs and provide a framework through which clinicians can interpret D-KEFS results.
Beyond reliability, multi-state failure analysis of satellite subsystems: A statistical approach
International Nuclear Information System (INIS)
Castet, Jean-Francois; Saleh, Joseph H.
2010-01-01
Reliability is widely recognized as a critical design attribute for space systems. In recent articles, we conducted nonparametric analyses and Weibull fits of satellite and satellite subsystems reliability for 1584 Earth-orbiting satellites launched between January 1990 and October 2008. In this paper, we extend our investigation of failures of satellites and satellite subsystems beyond the binary concept of reliability to the analysis of their anomalies and multi-state failures. In reliability analysis, the system or subsystem under study is considered to be either in an operational or failed state; multi-state failure analysis introduces 'degraded states' or partial failures, and thus provides more insights through finer resolution into the degradation behavior of an item and its progression towards complete failure. The database used for the statistical analysis in the present work identifies five states for each satellite subsystem: three degraded states, one fully operational state, and one failed state (complete failure). Because our dataset is right-censored, we calculate the nonparametric probability of transitioning between states for each satellite subsystem with the Kaplan-Meier estimator, and we derive confidence intervals for each probability of transitioning between states. We then conduct parametric Weibull fits of these probabilities using the Maximum Likelihood Estimation (MLE) approach. After validating the results, we compare the reliability versus multi-state failure analyses of three satellite subsystems: the thruster/fuel; the telemetry, tracking, and control (TTC); and the gyro/sensor/reaction wheel subsystems. The results are particularly revealing of the insights that can be gleaned from multi-state failure analysis and the deficiencies, or blind spots, of the traditional reliability analysis. In addition to the specific results provided here, which should prove particularly useful to the space industry, this work highlights the importance
Outcome and CT differentiation of gallbladder neuroendocrine tumours from adenocarcinomas
Energy Technology Data Exchange (ETDEWEB)
Kim, Tae-Hyung [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Kim, Se Hyung [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Seoul National University Hospital and Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Lee, Kyoung Boon [Seoul National University Hospital, Department of Pathology, Seoul (Korea, Republic of); Han, Joon Koo [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Seoul National University Medical Research Center, Institute of Radiation Medicine, Seoul (Korea, Republic of)
2017-02-15
To retrospectively investigate clinical outcome and differential CT features of gallbladder (GB) neuroendocrine tumours (NETs) from adenocarcinomas (ADCs). Nineteen patients with poorly-differentiated (PD) NETs and 19 patients with PD ADCs were enrolled. Clinical outcome was compared by the Kaplan-Meier method. We assessed qualitative and quantitative CT features to identify significant differential CT features of PD NETs from ADCs using univariate and multivariate analyses. Receiver operating characteristic (ROC) analysis was used for quantitative CT features. PD NETs showed poorer prognosis with significantly shorter median survival days than ADCs (363 vs. 590 days, P = 0.03). On univariate analysis, NETs more frequently manifested as GB-replacing type and showed well-defined margins accompanied with intact overlying mucosa. On multivariate analysis, well-defined margin was the sole significant CT differentiator (odds ratio = 27.817, P = 0.045). Maximum size of hepatic and lymph node (LN) metastases was significantly larger in NETs (11.0 cm and 4.62 cm) than ADCs (2.40 cm and 2.41 cm). Areas under ROC curves for tumour-to-mucosa ratio, maximum size of hepatic and LN metastasis were 0.772, 0.932 and 0.919, respectively (P < 0.05). GB PD NETs show poorer prognosis than ADCs. Well-defined margin, larger hepatic and LN metastases are useful CT differentiators of GB NETs from ADCs. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Nakajo, Masatoyo; Jinguji, Megumi; Nakabeppu, Yoshiaki; Higashi, Ryutarou; Fukukura, Yoshihiko; Yoshiura, Takashi [Kagoshima University, Department of Radiology, Graduate School of Medical and Dental Sciences, Kagoshima (Japan); Nakajo, Masayuki [Nanpuh Hospital, Department of Radiology, Kagoshima (Japan); Sasaki, Ken; Uchikado, Yasuto; Natsugoe, Shoji [Kagoshima University, Department of Digestive Surgery, Breast and Thyroid Surgery, Graduate School of Medical and Dental Sciences, Kagoshima (Japan)
2017-02-15
This retrospective study was done to examine whether the heterogeneity in primary tumour F-18-fluorodeoxyglucose ({sup 18}F-FDG) distribution can predict tumour response and prognosis of patients with esophageal cancer treated by chemoradiotherapy (CRT). The enrolled 52 patients with esophageal cancer underwent {sup 18}F-FDG-PET/CT studies before CRT. SUVmax, SUVmean, metabolic tumour volume (MTV, SUV ≥ 2.5), total lesion glycolysis (TLG) and six heterogeneity parameters assessed by texture analysis were obtained. Patients were classified as responders or non-responders according to Response Evaluation Criteria in Solid Tumors. Progression-free survival (PFS) and overall survival (OS) were calculated by the Kaplan-Meier method. Prognostic significance was assessed by Cox proportional hazards analysis. Thirty four non-responders showed significantly higher MTV (p = 0.006), TLG (p = 0.007), intensity variability (IV; p = 0.003) and size-zone variability (SZV; p = 0.004) than 18 responders. The positive and negative predictive values for non-responders were 77 % and 69 % in MTV, 76 % and 100 % in TLG, 78 % and 67 % in IV and 78 % and 82 % in SZV, respectively. Although PFS and OS were significantly shorter in patients with high MTV (PFS, p = 0.018; OS, p = 0.014), TLG (PFS, p = 0.009; OS, p = 0.025), IV (PFS, p = 0.013; OS, p = 0.007) and SZV (PFS, p = 0.010; OS, p = 0.007) at univariate analysis, none of them was an independent factor, while lymph node status, stage and tumour response status were independent factors at multivariate analysis. Texture features IV and SZV, and volumetric parameters MTV and TLG can predict tumour response, but all of them have limited value in prediction of prognosis of patients with esophageal cancer treated by CRT. (orig.)
International Nuclear Information System (INIS)
Konski, Andre; Bhargavan, Mythreyi; Owen, Jean; Paulus, Rebecca; Cooper, Jay; Forastiere, Arlene; Ang, K. Kian; Watkins-Bruner, Deborah
2011-01-01
Purpose: The specific aim of this analysis was to evaluate the feasibility of performing a cost-effectiveness analysis using Medicare data from patients treated on a randomized Phase III clinical trial. Methods and Materials: Cost data included Medicare Part A and Part B costs from all providers-inpatient, outpatient, skilled nursing facility, home health, hospice, and physicians-and were obtained from the Centers for Medicare and Medicaid Services for patients eligible for Medicare, treated on Radiation Therapy Oncology Group (RTOG) 9111 between 1992 and 1996. The 47-month expected discounted (annual discount rate of 3%) cost for each arm of the trial was calculated in 1996 dollars, with Kaplan-Meier sampling average estimates of survival probabilities for each month and mean monthly costs. Overall and disease-free survival was also discounted 3%/year. The analysis was performed from a payer's perspective. Incremental cost-effectiveness ratios were calculated comparing the chemotherapy arms to the radiation alone arm. Results: Of the 547 patients entered, Medicare cost data and clinical outcomes were available for 66 patients. Reasons for exclusion included no RTOG follow-up, Medicare HMO enrollment, no Medicare claims since trial entry, and trial entry after 1996. Differences existed between groups in tumor characteristics, toxicity, and survival, all which could affect resource utilization. Conclusions: Although we were able to test the methodology of economic analysis alongside a clinical trial using Medicare data, the results may be difficult to translate to the entire trial population because of non-random missing data. Methods to improve Medicare data capture and matching to clinical trial samples are required.
Chen, Hongliang; Wu, Kejin; Wang, Maoli; Wang, Fuwen; Zhang, Mingdi; Zhang, Peng
2017-12-01
There are controversies in the comparison of overall survival between invasive micropapillary carcinoma of the breast (IMPC) and invasive ductal carcinoma (IDC). The objective of this study was to compare the long-term survival outcome between non-metastatic IMPC and IDC. The Surveillance, Epidemiology, and End Results database was searched to identify women with non-metastatic IMPC and IDC diagnosed between 2001 and 2013. Comparisons of patient and tumor characteristics were performed using Pearson's chi-square. The propensity score matching method was applied with each IMPC matched to one IDC. Breast cancer-specific survival (BCSS) and overall survival (OS) were estimated using the Kaplan-Meier product limit method and compared across groups using the log-rank statistic. Multivariate analysis was performed through Cox models. IMPC was presented with aggressive clinical presentations such as larger tumor, more positive lymph nodes, and more advanced stage compared with IDC. A higher rate of estrogen receptor (ER)/progesterone receptor (PR) positivity was also observed in IMPC. With a median follow-up of 64 months, IMPC had a better BCSS (P = 0.031) and OS (P = 0.012) compared with IDC. In a case-control analysis IMPC was still an independent favorable prognostic factor for BCSS (HR = 0.410, P analysis, IMPC always showed a better survival outcome compared with IDC except in AJCC stage I and histologic grade I disease. IMPC has a better long-term survival outcome compared with IDC in spite of its highly aggressive clinical presentation. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Hee Jin Lee
Full Text Available Several methods are used to assess the pathologic response of breast cancer after neoadjuvant chemotherapy (NAC to predict clinical outcome. However, the clinical utility of these systems for each molecular subtype of breast cancer is unclear. Therefore, we applied six pathologic response assessment systems to specific subtypes of breast cancer and compared the results.Five hundred and eighty eight breast cancer patients treated with anthracycline with/without taxane-based NAC were retrospectively analyzed, and the ypTNM stage, residual cancer burden (RCB, residual disease in breast and nodes (RDBN, tumor response ratio, Sataloff's classification, and Miller-Payne grading system were evaluated. The results obtained for each assessment system were analyzed in terms of patient survival.In triple-negative tumors, all systems were significantly associated with disease-free survival and Kaplan-Meier survival curves for disease-free survival were clearly separated by all assessment methods. For HR+/HER2- tumors, systems assessing the residual tumor (ypTNM stage, RCB, and RDBN had prognostic significance. However, for HER2+ tumors, the association between patient survival and the pathologic response assessment results varied according to the system used, and none resulted in distinct Kaplan-Meier curves.Most of the currently available pathologic assessment systems used after anthracycline with/without taxane-based NAC effectively classified triple-negative breast cancers into groups showing different prognoses. The pathologic assessment systems evaluating residual tumors only also had prognostic significance in HR+/HER2- tumors. However, new assessment methods are required to effectively evaluate the pathologic response of HR+/HER2+ and HR-/HER2+ tumors to anthracycline with/without taxane-based NAC.
Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco
2015-12-01
This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.
DEFF Research Database (Denmark)
Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck
2014-01-01
and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....
DEFF Research Database (Denmark)
Vladimirov, B S; Schiødt, Morten
2009-01-01
smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p
Prognostic value of body mass index before treatment for laryngeal squamous cell carcinoma
International Nuclear Information System (INIS)
Li, Zhao-Qu; Zou, Lan; Liu, Tian-Run; Yang, An-Kui
2015-01-01
Patients with head and neck cancer often suffer from malnutrition. This study aims to investigate the influence of body mass index (BMI) on the prognosis of laryngeal squamous cell carcinoma (LSCC). A total of 473 patients with LSCC initially treated at Sun Yat-sen University Cancer Center between January 2005 and July 2009 were retrospectively reviewed. Survival analysis was performed by the Kaplan-Meier method and Cox regression model. Low BMI before treatment was significantly associated with poor overall survival in patients with LSCC (P<0.001). BMI was an independent prognostic factor for patients with LSCC. Leanness before treatment was associated with poor prognosis in patients with LSCC. Good nutritional status is favorable to improve survival in patients with LSCC
DEFF Research Database (Denmark)
Lindebjerg, J; Spindler, Karen-Lise Garm; Ploen, J
2009-01-01
to the tumour regression grade system and lymph node status in the surgical specimen was assessed. The prognostic value of clinico-pathological parameters was analysed using univariate analysis and Kaplan-Meier methods for comparison of groups. RESULTS: All patients responded to treatment and 47% had a major......OBJECTIVE: The purpose of the present study was to investigate the impact of tumour regression and the post-treatment lymph node status on the prognosis of rectal cancer treated by preoperative neoadjuvant chemoradiotherapy. METHOD: One hundred and thirty-five patients with locally advanced T3.......01). CONCLUSION: The combined assessment of lymph-node status and tumour response has strong prognostic value in locally advanced rectal cancer patient treated with preoperative long-course chemoradiation....
DEFF Research Database (Denmark)
Møller, Henrik; Coupland, Victoria H; Tataru, Daniela
2018-01-01
INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... to statistical adjustments for age, sex, socio-economic status, performance status and co-morbidity. CONCLUSION: The extent of use of different treatment modalities varies between geographical areas in England. These variations are not attributable to measurable patient and tumour characteristics, and more...
Li, Z; Sun, F; Hu, Z; Xiang, J; Zhou, J; Yan, S; Wu, J; Zhou, L; Zheng, S
2016-01-01
New-onset diabetes mellitus (NODM) after liver transplantation (LT) occurs with increased frequency in recipients with hepatitis C virus (HCV). We compared the incidence and risk factors for NODM in HCV vs non-HCV recipients. Among 24,956 liver recipients, 18,741 without pretransplantation diabetes were identified. NODM-free survival was analyzed using Kaplan-Meier and log-rank tests, and risk factors for NODM were examined using multivariate Cox regression analysis. The overall incidence of NODM was 13.0% at 1 year after LT. At 1, 2, 3, and 5 years after LT, incidence of NODM in HCV recipients was 14.4%, 4.3%, 3.1%, and 3.5%, respectively, compared with 11.9%, 3.5%, 3.2%, and 6.4%, respectively, in non-HCV recipients. HCV recipients had a higher risk of NODM than non-HCV recipients (hazard ratio 1.17 [1.09-1.27], P diabetes mellitus. Risk factors in non-HCV recipients were male recipient, BMI, and recipients with nonalcoholic steatohepatitis diagnosis. HCV recipients have a higher incidence and more risk factors for NODM than non-HCV recipients. Early identification of modifiable risk factors will assist clinical interventions to prevent NODM complications after LT. Copyright © 2016 Elsevier Inc. All rights reserved.
Farag, Mina; Arif, Rawa; Sabashnikov, Anton; Zeriouh, Mohamed; Popov, Aron-Frederik; Ruhparwar, Arjang; Schmack, Bastian; Dohmen, Pascal M.; Szabó, Gábor; Karck, Matthias; Weymann, Alexander
2017-01-01
Background Long-term follow-up data concerning isolated tricuspid valve pathology after replacement or reconstruction is limited. Current American Heart Association guidelines equally recommend repair and replacement when surgical intervention is indicated. Our aim was to investigate and compare operative mortality and long-term survival in patients undergoing isolated tricuspid valve repair surgery versus replacement. Material/Methods Between 1995 and 2011, 109 consecutive patients underwent surgical correction of tricuspid valve pathology at our institution for varying structural pathologies. A total of 41 (37.6%) patients underwent tricuspid annuloplasty/repair (TAP) with or without ring implantation, while 68 (62.3%) patients received tricuspid valve replacement (TVR) of whom 36 (53%) were mechanical and 32 (47%) were biological prostheses. Results Early survival at 30 days after surgery was 97.6% in the TAP group and 91.1% in the TVR group. After 6 months, 89.1% in the TAP group and 87.8% in the TVR group were alive. In terms of long-term survival, there was no further mortality observed after one year post surgery in both groups (Log Rank p=0.919, Breslow p=0.834, Tarone-Ware p=0.880) in the Kaplan-Meier Survival analysis. The 1-, 5-, and 8-year survival rates were 85.8% for TAP and 87.8% for TVR group. Conclusions Surgical repair of the tricuspid valve does not show survival benefit when compared to replacement. Hence valve replacement should be considered generously in patients with reasonable suspicion that regurgitation after repair will reoccur. PMID:28236633
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
International Nuclear Information System (INIS)
Lakatos, K; Szamosi, Z; Bereczkei, S
2012-01-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
Lakatos, K.; Szamosi, Z.; Bereczkei, S.
2012-11-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.
Directory of Open Access Journals (Sweden)
Raúl Vicente Mantilla Quispe
2008-10-01
Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.
MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1
Directory of Open Access Journals (Sweden)
Olsson Hans
2013-01-01
Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in
Chen, Jian-Wu; Zhou, Chang-Fu; Lin, Zhi-Xiong
2015-09-15
Although age is thought to correlate with the prognosis of glioma patients, the most appropriate age-group classification standard to evaluate prognosis had not been fully studied. This study aimed to investigate the influence of age-group classification standards on the prognosis of patients with high-grade hemispheric glioma (HGG). This retrospective study of 125 HGG patients used three different classification standards of age-groups (≤ 50 and >50 years old, ≤ 60 and >60 years old, ≤ 45 and 45-65 and ≥ 65 years old) to evaluate the impact of age on prognosis. The primary end-point was overall survival (OS). The Kaplan-Meier method was applied for univariate analysis and Cox proportional hazards model for multivariate analysis. Univariate analysis showed a significant correlation between OS and all three classification standards of age-groups as well as between OS and pathological grade, gender, location of glioma, and regular chemotherapy and radiotherapy treatment. Multivariate analysis showed that the only independent predictors of OS were classification standard of age-groups ≤ 50 and > 50 years old, pathological grade and regular chemotherapy. In summary, the most appropriate classification standard of age-groups as an independent prognostic factor was ≤ 50 and > 50 years old. Pathological grade and chemotherapy were also independent predictors of OS in post-operative HGG patients. Copyright © 2015. Published by Elsevier B.V.
Outcomes analysis in 100 liver transplantation patients.
Geevarghese, S K; Bradley, A E; Wright, J K; Chapman, W C; Feurer, I; Payne, J L; Hunter, E B; Pinson, C W
1998-05-01
There is an increasing demand for outcomes analysis, including quality of life and financial analysis, following medical interventions and surgical procedures. We analyzed outcomes for 100 consecutive patients undergoing liver transplantation during a period of case management revision. Patient survival was calculated by Kaplan-Meier actuarial methods. The Karnofsky performance status was objectively assessed for surviving patients up to 6 years after transplantation and was evaluated by repeated measures analysis of variance and covariance. Subjective evaluation of quality of life over time was obtained using the Psychosocial Adjustment to Illness Scale. The correlations between time and scale were calculated. Financial data were accumulated from billing records. Six-month, 1-year, 2-year, and 3- through 5-year survival was 86%, 84%, 83%, and 78%, respectively. Karnofsky performance status confirmed poor functional status preoperatively with a mean of 53 +/- 2, but significantly improving to 72 +/- 2 at 3 months, 80 +/- 2 at 6 months, 90 +/- 1 at 1 year, 92 +/- 1 at 2 years, 94 +/- 1 at 3 years, 96 +/- 1 at 4 years, and 97 +/- 1 at 5 years (P <0.001). Psychosocial Adjustment to Illness Scale scores demonstrated significant improvement following transplantation overall (r = -0.33), improving most in sexual relationships (r = -0.41), and domestic environment (r = -0.35; P <0.001). Median length of stay for the first half of the patients was 19 days declining to 11 days for the second half. Median hospital charges declined from $105,000 to $90,000. Quality of life parameters assessed both by care givers (Karnofsky) and by patients (Psychosocial Adjustment to Illness Scale) improved dramatically following transplantation and over time, demonstrating that liver transplantation effectively restores a good quality of life. Outcomes can be improved while reducing length of stay and charges through modifications in case management.
Mount, David W; Putnam, Charles W; Centouri, Sara M; Manziello, Ann M; Pandey, Ritu; Garland, Linda L; Martinez, Jesse D
2014-06-10
Numerous microarray-based prognostic gene expression signatures of primary neoplasms have been published but often with little concurrence between studies, thus limiting their clinical utility. We describe a methodology using logistic regression, which circumvents limitations of conventional Kaplan Meier analysis. We applied this approach to a thrice-analyzed and published squamous cell carcinoma (SQCC) of the lung data set, with the objective of identifying gene expressions predictive of early death versus long survival in early-stage disease. A similar analysis was applied to a data set of triple negative breast carcinoma cases, which present similar clinical challenges. Important to our approach is the selection of homogenous patient groups for comparison. In the lung study, we selected two groups (including only stages I and II), equal in size, of earliest deaths and longest survivors. Genes varying at least four-fold were tested by logistic regression for accuracy of prediction (area under a ROC plot). The gene list was refined by applying two sliding-window analyses and by validations using a leave-one-out approach and model building with validation subsets. In the breast study, a similar logistic regression analysis was used after selecting appropriate cases for comparison. A total of 8594 variable genes were tested for accuracy in predicting earliest deaths versus longest survivors in SQCC. After applying the two sliding window and the leave-one-out analyses, 24 prognostic genes were identified; most of them were B-cell related. When the same data set of stage I and II cases was analyzed using a conventional Kaplan Meier (KM) approach, we identified fewer immune-related genes among the most statistically significant hits; when stage III cases were included, most of the prognostic genes were missed. Interestingly, logistic regression analysis of the breast cancer data set identified many immune-related genes predictive of clinical outcome. Stratification of
Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis
DEFF Research Database (Denmark)
Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene
2017-01-01
characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p
Measuring survival time: a probability-based approach useful in healthcare decision-making.
2011-01-01
In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.
DEFF Research Database (Denmark)
Agerbo, Esben
2007-01-01
longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....
Improve T Cell Therapy in Neuroblastoma
2015-09-01
bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and
Integrated analysis of HPV-mediated immune alterations in cervical cancer.
Chen, Long; Luan, Shaohong; Xia, Baoguo; Liu, Yansheng; Gao, Yuan; Yu, Hongyan; Mu, Qingling; Zhang, Ping; Zhang, Weina; Zhang, Shengmiao; Wei, Guopeng; Yang, Min; Li, Ke
2018-05-01
Human papillomavirus (HPV) infection is the primary cause of cervical cancer. HPV-mediated immune alterations are known to play crucial roles in determining viral persistence and host cell transformation. We sought to thoroughly understand HPV-directed immune alterations in cervical cancer by exploring publically available datasets. 130 HPV positive and 7 HPV negative cervical cancer cases from The Cancer Genome Atlas were compared for differences in gene expression levels and functional enrichment. Analyses for copy number variation (CNV) and genetic mutation were conducted for differentially expressed immune genes. Kaplan-Meier analysis was performed to assess survival and relapse differences across cases with or without alterations of the identified immune signature genes. Genes up-regulated in HPV positive cervical cancer were enriched for various gene ontology terms of immune processes (P=1.05E-14~1.00E-05). Integrated analysis of the differentially expressed immune genes identified 9 genes that displayed either CNV, genetic mutation and/or gene expression changes in at least 10% of the cases of HPV positive cervical cancer. Genomic amplification may cause elevated levels of these genes in some HPV positive cases. Finally, patients with alterations in at least one of the nine signature genes overall had earlier relapse compared to those without any alterations. The altered expression of either TFRC or MMP13 may indicate poor survival for a subset of cervical cancer patients (P=1.07E-07). We identified a novel immune gene signature for HPV positive cervical cancer that is potentially associated with early relapse of cervical cancer. Copyright © 2018. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Rassart, E.; Paquette, Y.; Jolicoeur, P.
1988-01-01
The molecularly cloned infectious Kaplan radiation leukemia virus has previously been shown to be unable to replicate on mouse fibroblasts. To map the viral sequences responsible for this, we constructed chimeric viral DNA genomes in vitro with parental cloned infectious viral DNAs from the nonfibrotropic (F-) BL/VL3 V-13 radiation leukemia virus and the fibrotropic (F+) endogenous BALB/c or Moloney murine leukemia viruses (MuLV). Infectious chimeric MuLVs, recovered after transfection of Ti-6 lymphocytes with these recombinant DNAs, were tested for capacity to replicate on mouse fibroblasts in vitro. We found that chimeric MuLVs harboring the long terminal repeat (LTR) of a fibrotropic MuLV replicated well on mouse fibroblasts. Conversely, chimeric MuLVs harboring the LTR of a nonfibrotropic MuLV were restricted on mouse fibroblasts. These results indicate that the LTR of BL/VL3 radiation leukemia virus harbors the primary determinant responsible for its inability to replicate on mouse fibroblasts in vitro. Our results also show that the primary determinant allowing F+ MuLVs (endogenous BALB/c and Moloney MuLVs) to replicate on mouse fibroblasts in vitro resides within the LTR
Smith, Matthew R; Saad, Fred; Rathkopf, Dana E; Mulders, Peter F A; de Bono, Johann S; Small, Eric J; Shore, Neal D; Fizazi, Karim; Kheoh, Thian; Li, Jinhui; De Porre, Peter; Todd, Mary B; Yu, Margaret K; Ryan, Charles J
2017-07-01
In the COU-AA-302 trial, abiraterone acetate plus prednisone significantly increased overall survival for patients with chemotherapy-naïve metastatic castration-resistant prostate cancer (mCRPC). Limited information exists regarding response to subsequent androgen signaling-directed therapies following abiraterone acetate plus prednisone in patients with mCRPC. We investigated clinical outcomes associated with subsequent abiraterone acetate plus prednisone (55 patients) and enzalutamide (33 patients) in a post hoc analysis of COU-AA-302. Prostate-specific antigen (PSA) response was assessed. Median time to PSA progression was estimated using the Kaplan-Meier method. The PSA response rate (≥50% PSA decline, unconfirmed) was 44% and 67%, respectively. The median time to PSA progression was 3.9 mo (range 2.6-not estimable) for subsequent abiraterone acetate plus prednisone and 2.8 mo (range 1.8-not estimable) for subsequent enzalutamide. The majority of patients (68%) received intervening chemotherapy before subsequent abiraterone acetate plus prednisone or enzalutamide. While acknowledging the limitations of post hoc analyses and high censoring (>75%) in both treatment groups, these results suggest that subsequent therapy with abiraterone acetate plus prednisone or enzalutamide for patients who progressed on abiraterone acetate is associated with limited clinical benefit. This analysis showed limited clinical benefit for subsequent abiraterone acetate plus prednisone or enzalutamide in patients with metastatic castration-resistant prostate cancer following initial treatment with abiraterone acetate plus prednisone. This analysis does not support prioritization of subsequent abiraterone acetate plus prednisone or enzalutamide following initial therapy with abiraterone acetate plus prednisone. Copyright © 2017 European Association of Urology. Published by Elsevier B.V. All rights reserved.
EpCAM nuclear localization identifies aggressive Thyroid Cancer and is a marker for poor prognosis
Directory of Open Access Journals (Sweden)
MacMillan Christina
2010-06-01
Full Text Available Abstract Background Proteolytic cleavage of the extracellular domain (EpEx of Epithelial cell adhesion molecule (EpCAM and nuclear signaling by its intracellular oncogenic domain Ep-ICD has recently been implicated in increased proliferation of cancer cells. The clinical significance of Ep-ICD in human tumors remains an enigma. Methods EpEx, Ep-ICD and β-catenin immunohistochemistry using specific antibodies was conducted on 58 archived thyroid cancer (TC tissue blocks from 34 patients and correlated with survival analysis of these patients for up to 17 years. Results The anaplastic (ATC and aggressive thyroid cancers showed loss of EpEx and increased nuclear and cytoplasmic accumulation of Ep-ICD. In contrast, the low grade papillary thyroid cancers (PTC showed membranous EpEx and no detectable nuclear Ep-ICD. The ATC also showed concomitant nuclear expression of Ep-ICD and β-catenin. Kaplan-Meier Survival analysis revealed reduced overall survival (OS for TC patients showing nuclear Ep-ICD expression or loss of membranous EpEx (p Conclusion We report reciprocal loss of membrane EpEx but increased nuclear and cytoplasmic accumulation of Ep-ICD in aggressive TC; nuclear Ep-ICD correlated with poor OS of TC patients. Thus nuclear Ep-ICD localization may serve as a useful biomarker for aggressive TC and may represent a novel diagnostic, prognostic and therapeutic target for aggressive TC.
Spies, Benedikt Christopher; Witkowski, Siegbert; Butz, Frank; Vach, Kirstin; Kohal, Ralf-Joachim
2016-10-01
The aim of this study was to determine the success and survival rate of all-ceramic bi-layered implant-supported three-unit fixed dental prostheses (IS-FDPs) 3 years after implant placement. Thirteen patients (seven males, six females; age: 41-78 years) received two one-piece ceramic implants (alumina-toughened zirconia) each in the region of the premolars or the first molar and were finally restored with adhesively cemented bi-layered zirconia-based IS-FDPs (3 in the maxilla, 10 in the mandible) composed of CAD/CAM-fabricated zirconia frameworks pressed-over with fluor-apatite glass-ceramic ingots. At prosthetic delivery and the follow-ups after 1, 2 and 3 years, the restorations were evaluated using modified United States Public Health Service (USPHS) criteria. Restorations with minor veneer chippings, a small-area occlusal roughness, slightly soundable restoration margins, minimal contour deficiencies and tolerable color deviations were regarded as success. In case of more distinct defects that could, however, be repaired to a clinically acceptable level, IS-FDPs were regarded as surviving. Kaplan-Meier plots were used for the success/survival analyses. To verify an impact on subjective patients' perceptions, satisfaction was evaluated by visual analog scales (VAS). All patients were seen 3 years after implant installation. No IS-FDP had to be replaced, resulting in 100% survival after a mean observation period of 29.5 months (median: 30.7). At the 3-year follow-up, 7/13 IS-FDPs showed a veneer chipping, 13/13 an occlusal roughness and 12/13 minimal deficiencies of contour/color. Since six restorations showed a major chipping and/or a major occlusal roughness, the Kaplan-Meier success rate was 53.8%. However, patients' significantly improved perceptions of function, esthetics, sense, and speech at prosthetic delivery remained stable over time. Bi-layered zirconia/fluor-apatite IS-FDPs entirely survived the observation period but showed a high frequency of
Clinical characteristics associated with mortality of patients with anaerobic bacteremia.
Umemura, Takumi; Hamada, Yukihiro; Yamagishi, Yuka; Suematsu, Hiroyuki; Mikamo, Hiroshige
2016-06-01
The presence of anaerobes in the blood stream is known to be associated with a higher rate of mortality. However, few prognostic risk factor analyses examining whether a patient's background characteristics are associated with the prognosis have been reported. We performed a retrospective case-controlled study to assess the prognostic factors associated with death from anaerobic bacteremia. Seventy-four patients with anaerobic bacteremia were treated between January 2005 and December 2014 at Aichi Medical University Hospital. The clinical information included drug susceptibility was used for analysis of prognostic factors for 30-day mortality. Multivariate logistic analyses revealed an association between the 30-day mortality rate and malignancy (OR: 3.64, 95% CI: 1.08-12.31) and clindamycin resistance (OR: 7.93, 95% CI: 2.33-27.94). The result of Kaplan-Meier analysis of mortality showed that the 30-day survival rate was 83% in clindamycin susceptible and 38.1% in clindamycin resistant anaerobes causing bacteremia. The result of log-rank test also showed that susceptibility to clindamycin affected mortality (P anaerobic bacteremia with a higher risk of 30-day mortality. The results of this study are important for the early and appropriate management of patients with anaerobic bacteremia. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yang, D H; Su, Z Q; Chen, Y; Chen, Z B; Ding, Z N; Weng, Y Y; Li, J; Li, X; Tong, Q L; Han, Y X; Zhang, X
2016-03-08
To assess the predictive value of the albumin to globulin ratio (AGR) in evaluation of disease severity and prognosis in myasthenia gravis patients. A total of 135 myasthenia gravis (MG) patients were enrolled between February 2009 and March 2015. The AGR was detected on the first day of hospitalization and ranked from lowest to highest, and the patients were divided into three equal tertiles according to the AGR values, which were T1 (AGR 1.53). The Kaplan-Meier curve was used to evaluate the prognostic value of AGR. Cox model analysis was used to evaluate the relevant factors. Multivariate Logistic regression analysis was used to find the predictors of myasthenia crisis during hospitalization. The median length of hospital stay for each tertile was: for the T1 21 days (15-35.5), T2 18 days (14-27.5), and T3 16 days (12-22.5) (Pmyasthenia gravis. At the multivariate Cox regression analysis, the AGR (Pmyasthenia gravis patients. Respectively, the hazard ratio (HR) were 4.655 (95% CI: 2.355-9.202) and 0.596 (95% CI: 0.492-0.723). Multivariate Logistic regression analysis showed the AGR (Pmyasthenia crisis. The AGR may represent a simple, potentially useful predictive biomarker for evaluating the disease severity and prognosis of patients with myasthenia gravis.
Chang, Xiaofeng; Zhang, Fan; Liu, Tieshi; Wang, Wei; Guo, Hongqian
2017-06-01
To investigate the role of neutrophil-to-lymphocyte ratio as a prognostic indicator in patients with localized clear cell renal cell carcinoma treated with radiofrequency ablation. We retrospectively analyzed data from patients with renal cell carcinoma who underwent radiofrequency ablation from 2006 to 2013. The Kaplan-Meier method was used to generate the survival curves according to different categories of neutrophil-to-lymphocyte ratio. Relationships between preoperative neutrophil-to-lymphocyte ratio or the change of neutrophil-to-lymphocyte ratio and survival were evaluated with multivariable Cox proportional hazards regression analysis. A propensity score matching analysis was carried out to avoid confounding bias. A total of 185 patients were included in present study. When stratified by preoperative neutrophil-to-lymphocyte ratio cutoff value of 2.79, 5-year recurrence-free survival, 5-year disease-free survival, and 5-year overall survival rates of neutrophil-to-lymphocyte ratio analysis, 5-year recurrence-free survival, 5-year disease-free survival, and 5-year overall survival rates of neutrophil-to-lymphocyte ratio ratio with the change of neutrophil-to-lymphocyte ratio, patients with both preoperative neutrophil-to-lymphocyte ratio ≥2.79 and the change of neutrophil-to-lymphocyte ratio ≥0.40 had the worst disease-free survival. Results of multivariable analysis showed that preoperative neutrophil-to-lymphocyte ratio and the change of neutrophil-to-lymphocyte ratio correlated with cancer relapse remarkably. High preoperative neutrophil-to-lymphocyte ratio and elevated postoperative neutrophil-to-lymphocyte ratio are associated with significant increase in risk of local recurrence as well as distant metastasis. The combination of neutrophil-to-lymphocyte ratio with the other prognostic indicators can be applied in the evaluation of relapse risk in patients with clear cell renal cell carcinoma after radiofrequency ablation.
Marital status independently predicts testis cancer survival--an analysis of the SEER database.
Abern, Michael R; Dude, Annie M; Coogan, Christopher L
2012-01-01
Previous reports have shown that married men with malignancies have improved 10-year survival over unmarried men. We sought to investigate the effect of marital status on 10-year survival in a U.S. population-based cohort of men with testis cancer. We examined 30,789 cases of testis cancer reported to the Surveillance, Epidemiology, and End Results (SEER 17) database between 1973 and 2005. All staging were converted to the 1997 AJCC TNM system. Patients less than 18 years of age at time of diagnosis were excluded. A subgroup analysis of patients with stages I or II non-seminomatous germ cell tumors (NSGCT) was performed. Univariate analysis using t-tests and χ(2) tests compared characteristics of patients separated by marital status. Multivariate analysis was performed using a Cox proportional hazard model to generate Kaplan-Meier survival curves, with all-cause and cancer-specific mortality as the primary endpoints. 20,245 cases met the inclusion criteria. Married men were more likely to be older (38.9 vs. 31.4 years), Caucasian (94.4% vs. 92.1%), stage I (73.1% vs. 61.4%), and have seminoma as the tumor histology (57.3% vs. 43.4%). On multivariate analysis, married status (HR 0.58, P married status (HR 0.60, P married and unmarried men (44.8% vs. 43.4%, P = 0.33). Marital status is an independent predictor of improved overall and cancer-specific survival in men with testis cancer. In men with stages I or II NSGCT, RPLND is an additional predictor of improved overall survival. Marital status does not appear to influence whether men undergo RPLND. Copyright © 2012 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Farahati, J.; Schulz, G.; Koerber, C.; Geling, M.; Schmeider, P.; Reiners, Chr. [Wuerzburg Univ. (Germany). Klinik fuer Nuklearmedizin; Wendler, J. [Erlangen-Nuernberg Univ. (Germany). Klinik fuer Innere Medizin III; Kenn, W. [Wuerzburg Univ. (Germany). Inst. fuer Roentgendiagnostik; Reidemeister, C. [Wuerzburg Univ. (Germany). Klinik fuer Innere Medizin
2002-04-01
Objective: In this prospective study, the time to remission after radiosynovectomy (RSV) was analyzed and the influence of age, sex, underlying disease, type of joint, and duration of illness on the success rate of RSV was determined. Methods: A total number of 57 patients with rheumatoid arthritis (n = 33) and arthrosis (n = 21) with a total number of 130 treated joints (36 knee, 66 small and 28 medium-size joints) were monitored using visual analogue scales (VAS) from one week before RSV up to four to six months after RSV. The patients had to answer 3 times daily for pain intensity of the treated joint. The time until remission was determined according to the Kaplan-Meier survivorship function. The influence of the prognosis parameters on outcome of RSV was determined by multivariate discriminant analysis. Results: After six months, the probability of pain relief of more than 20% amounted to 78% and was significantly dependent on the age of the patient (p = 0.02) and the duration of illness (p = 0.05), however not on sex (p = 0.17), underlying disease (p = 0.23), and type of joint (p = 0.69). Conclusion: Irrespective of sex, type of joint and underlying disease, a measurable pain relief can be achieved with RSV in 78% of the patients with synovitis, whereby effectiveness is decreasing with increasing age and progress of illness. (orig.) [German] Ziel: In dieser prospektiven Studie wurde die Zeit bis zur Remission nach einer Radiosynoviorthese (RSO) untersucht. Ebenso wurde der Einfluss von Alter, Geschlecht, Grunderkrankung, Gelenktyp und Erkrankungsdauer auf die Erfolgsrate der RSO ermittelt. Methodik: Bei insgesamt 57 Patienten mit rheumatoider Arthritis (n = 33) und Arthritis bei aktivierter Arthrose (n = 24) wurden 130 Gelenke (36 Kniegelenke, 66 kleine und 28 mittelgrosse Gelenke) behandelt. Die Patienten wurden unter Verwendung so genannter visueller Analogskalen eine Woche vor RSO und vier bis sechs Monate danach 3-mal taeglich zur Schmerzintensitaet des
Directory of Open Access Journals (Sweden)
A Srivastava
2004-01-01
Full Text Available Objective : The study was performed with an aim to determine the incidence of ureteric complications in live related donor renal transplantation, and to study the effect of ureteric complications on long term graft and patient survival. Patients And Methods: Records of 1200 consecutive live related renal transplants done from 1989-2002 were reviewed. Twenty-six ureteric complications were noted to occur and treatment modalities employed were documented. In the non complication group sufficient data for evaluation was available in 867 patients. Survival analysis were performed using Kaplan-Meier techniques. Results: The overall incidence of urological complications is 2.9%. Complications occurred at a mean interval of 31.9 days after renal transplantation. Ureteric complications occurred in 2% patients with stented and 7.7% patients with non stented anastomosis (p=0.001. Mean follow up following renal transplantation was 37.4 months. Survival analysis showed that ureteric complications did not increase the risk of graft fai lu re or patient death. Conclusions: Ureteric complications in live related donor renal transplantation occurred in 2.9 % patients and did not impair graft and patient survival.
Bernal-Morell, Enrique; García-Villalba, Eva; Vera, Maria Del Carmen; Medina, Blanca; Martinez, Monica; Callejo, Victoria; Valero, Salvador; Cinesi, Cesar; Piñera, Pascual; Alcaraz, Antonia; Marin, Irene; Muñoz, Angeles; Cano, Alfredo
2018-03-01
Midregional proadrenomedullin (MR-proADM) is a prognostic biomarker in patients with community-acquired pneumonia (CAP) and sepsis. In this paper, we examined the ability of MR-proADM to predict organ damage and long-term mortality in sepsis patients, compared to that of procalcitonin, C-reactive protein and lactate. This was a prospective observational cohort, enrolling severe sepsis or septic shock patients admitted to internal service department. The association between biomarkers and 90-day mortality was assessed by Cox regression analysis and Kaplan-Meier curves. The accuracy of biomarkers for mortality was determined by area under the receiver operating characteristic curve (AUROC) analysis. A total of 148 patients with severe sepsis, according to the criteria of the campaign to survive sepsis, were enrolled. Eighty-five (57.4%) had sepsis according to the new criteria of Sepsis-3. MR-proADM showed the best AUROC to predict sepsis as defined by the Sepsis-3 criteria (AUROC of 0.771, 95% CI 0.692-0.850, p scale, especially when scores are low. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
[Psychiatric readmissions: individual and organizational factors].
Plancke, Laurent; Amariei, Alina; Flament, Clara; Dumesnil, Chloé
2017-01-01
Psychiatric readmission often constitutes a criterion to assess the effects of various therapies, as well as the impact of organizational changes in the healthcare system. It is used to characterize relapse or decompensation. The purpose of this study was to determine readmission rates and identify individual and organizational factors associated with significant variations in these rates. Adult psychiatric readmissions were identified from the full-time hospital stays registered in psychiatric wards in 2011-2012 in the Nord and Pas-de-Calais departments of France, available in the medical the RimP psychiatric admission database. Readmission rates for various follow-up periods after discharge were measured by Kaplan-Meier survival analysis and multivariate analysis was conducted using the Cox proportional hazards model. Approximately 30,000 adults were hospitalized full-time in psychiatric units of the region during the study period. The 24-month readmission rate was 51.6% (95%CI: 50.8-52.3%). The Cox model showed that a diagnosis of schizophrenia (F2 - HR = 1.72 - 95%CI: 1.61-1.84 - p Psychiatric readmission is a very frequent event and is linked to organizational as well as individual factors.
Impact of tumour volume on prediction of progression-free survival in sinonasal cancer
International Nuclear Information System (INIS)
Hennersdorf, Florian; Mauz, Paul-Stefan; Adam, Patrick; Welz, Stefan; Sievert, Anne; Ernemann, Ulrike; Bisdas, Sotirios
2015-01-01
The present study aimed to analyse potential prognostic factors, with emphasis on tumour volume, in determining progression free survival (PFS) for malignancies of the nasal cavity and the paranasal sinuses. Retrospective analysis of 106 patients with primary sinonasal malignancies treated and followed-up between March 2006 and October 2012. Possible predictive parameters for PFS were entered into univariate and multivariate Cox regression analysis. Kaplan-Meier curve analysis included age, sex, baseline tumour volume (based on MR imaging), histology type, TNM stage and prognostic groups according to the American Joint Committee on Cancer (AJCC) classification. Receiver operating characteristic (ROC) curve analysis concerning the predictive value of tumour volume for recurrence was also conducted. The main histological subgroup consisted of epithelial tumours (77%). The majority of the patients (68%) showed advanced tumour burden (AJCC stage III–IV). Lymph node involvement was present in 18 cases. The mean tumour volume was 26.6 ± 21.2 cm 3 . The median PFS for all patients was 24.9 months (range: 2.5–84.5 months). The ROC curve analysis for the tumour volume showed 58.1% sensitivity and 75.4% specificity for predicting recurrence. Tumour volume, AJCC staging, T- and N- stage were significant predictors in the univariate analysis. Positive lymph node status and tumour volume remained significant and independent predictors in the multivariate analysis. Radiological tumour volume proofed to be a statistically reliable predictor of PFS. In the multivariate analysis, T-, N- and overall AJCC staging did not show significant prognostic value
Directory of Open Access Journals (Sweden)
HUANG Long
2015-06-01
Full Text Available ObjectiveTo determine the efficacy and prognostic factors of intensity-modulated radiotherapy (IMRT for primary hepatocellular carcinoma (HCC with portal vein and/or inferior vena cava tumor thrombus. MethodsTwenty-three HCC patients with portal vein and/or inferior vena cava tumor thrombus received IMRT with an 8 MV linear accelerator at the Cancer Center of General Hospital of Armed Police Forces, Anhui Medical University, from April 2008 to August 2011. A single dose of 3 to 6 Gy was delivered at five fractions per week, with a total dose of 56 to 96 Gy and a median dose of 60 Gy. Survival time was recorded, and adverse reactions were evaluated. Survival rate calculation and survival analysis were performed using the Kaplan-Meier method. Comparison of categorical between two groups was made by chi-square test. ResultsOne patient did not complete radiotherapy due to upper gastrointestinal bleeding. Of 22 patients who completed IMRT, 4 achieved complete remission and 10 achieved partial remission, with an overall response rate of 63.7%. Our analysis showed that the type of tumor thrombus and tumor size were associated with tumor response rate and were significant prognostic factors (P<0.05. The median survival time was 13.4 months. The 1-, 2-, and 3-year survival rates were 59%, 27%, and 18%, respectively. The 22 patients who completed radiotherapy did not experience acute radiation injury or late adverse outcomes such as radiation-induced liver disease. ConclusionThis study suggests IMRT is a safe and effective treatment option for HCC patients with portal vein and/or inferior vena cava tumor thrombus.
Prognostic impact of tumor MET expression among patients with stage IV gastric cancer
DEFF Research Database (Denmark)
Erichsen, Rune; Kelsh, Michael A; Oliner, Kelly S
2016-01-01
PURPOSE: We aimed to investigate the prevalence and prognostic impact of tumor mesenchymal epithelial transition factor (MET) expression in stage IV gastric cancers in a real-world clinical setting because existing evidence is sparse. METHODS: The study included archived cancer specimens from 103...... stage IV gastric cancer patients (2003-2010). We analyzed MET-protein expression by immunohistochemistry (MET-positive if ≥25% of tumor cells showed MET expression). We calculated overall survival using the Kaplan-Meier method and hazard ratios comparing mortality among MET-positive and MET.......6 months), corresponding to an adjusted hazard ratio of 2.2 (95% confidence interval, 1.3-3.7). CONCLUSIONS: Tumor MET expression is prevalent and has substantial prognostic impact in stage IV gastric cancer patients....
AbuRahma, Ali F; Srivastava, Mohit; AbuRahma, Zachary; Jackson, Will; Mousa, Albeir; Stone, Patrick A; Dean, L Scott; Green, Jason
2015-08-01
Several studies have reported on the role of postoperative duplex ultrasound surveillance after carotid endarterectomy (CEA) with varying results. Most of these studies had a small sample size or did not analyze cost-effectiveness. We analyzed 489 of 501 CEA patients with patch closure. All patients had immediate postoperative duplex ultrasound examination and were routinely followed up both clinically and with duplex ultrasound at regular intervals of 1 month, 6 months, 12 months, and every 12 months thereafter. A Kaplan-Meier analysis was used to estimate the rate of ≥50% and ≥80% post-CEA restenosis over time and the time frame of progression from normal to ≥50% or ≥80% restenosis. The cost of post-CEA duplex surveillance was also estimated. Overall, 489 patients with a mean age of 68.5 years were analyzed. Ten of these had residual postoperative ≥50% stenosis, and 37 did not undergo a second duplex ultrasound examination and therefore were not included in the final analysis. The mean follow-up was 20.4 months (range, 1-63 months), with a mean number of duplex ultrasound examinations of 3.6 (range, 1-7). Eleven of 397 patients (2.8%) with a normal finding on immediate postoperative duplex ultrasound vs 4 of 45 (8.9%) with mild stenosis on immediate postoperative duplex ultrasound progressed to ≥50% restenosis (P = .055). Overall, 15 patients (3.1%) had ≥50% restenosis, 9 with 50% to duplex ultrasound), which equals $1,408,320, to detect only four patients with ≥80% to 99% restenosis who may have been potential candidates for reintervention. This study shows that the value of routine postoperative duplex ultrasound surveillance after CEA with patch closure may be limited, particularly if the finding on immediate postoperative duplex ultrasound is normal or shows minimal disease. Copyright © 2015 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.
Locke, S; Osborne, M; O'Rourke, P
2011-02-01
The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.
Stent placement with the monorail technique for treatment of mesenteric artery stenosis.
Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan
2006-04-01
To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.
Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.
Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J
2016-12-01
A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.
Tinkle, Christopher L; Fernandez-Pineda, Israel; Sykes, April; Lu, Zhaohua; Hua, Chia-Ho; Neel, Michael D; Bahrami, Armita; Shulkin, Barry L; Kaste, Sue C; Pappo, Alberto; Spunt, Sheri L; Krasin, Matthew J
2017-11-15
Indications for and delivery of adjuvant therapies for pediatric nonrhabdomyosarcoma soft tissue sarcoma (NRSTS) have been derived largely from adult studies; therefore, significant concern remains regarding radiation exposure to normal tissue. The authors report long-term treatment outcomes and toxicities for pediatric and young adult patients with high-grade NRSTS who were treated on a prospective trial using limited-margin radiotherapy. Sixty-two patients (ages 3-22 years) with predominantly high-grade NRSTS requiring radiation were treated on a phase 2 institutional study of conformal external-beam radiotherapy and/or brachytherapy using a 1.5-cm to 2-cm anatomically constrained margin. The estimated cumulative incidence of local failure, Gray's method estimated cumulative incidence of local failure, Kaplan-Meier method estimated survival, competing-risk regression model determined predictors of disease outcome, and toxicity was reported according to CTCAE v2.0. At a median follow-up of 5.1 years (range, 0.2-10.9 years), 9 patients had experienced local failure. The 5-year overall cumulative incidence of local failure was 14.8% (95% confidence interval [CI], 7.2%-25%), and all but 1 local failure occurred outside the highest-dose irradiation volume. The 5-year Kaplan-Meier estimates for event-free and overall survival were 49.3% (95% CI, 36.3%-61.1%) and 67.9% (95% CI, 54.2%-78.3%), respectively. Multivariable analysis indicated that younger age was the only independent predictor of local recurrence (P = .004). The 5-year cumulative incidence of grade 3 or 4 late toxicity was 15% (95% CI, 7.2%-25.3%). The delivery of limited-margin radiotherapy using conformal external-beam radiotherapy or brachytherapy provides a high rate of local tumor control without an increase in marginal failures and with acceptable treatment-related morbidity. Cancer 2017;123:4419-29. © 2017 American Cancer Society. © 2017 American Cancer Society.
Intraoperative Radiation Therapy for Locally Advanced and Recurrent Soft-Tissue Sarcomas in Adults
International Nuclear Information System (INIS)
Tran, Phuoc T.; Hara, Wendy; Su Zheng; Lin, H. Jill; Bendapudi, Pavan K.; Norton, Jeffrey; Teng, Nelson; King, Christopher R.; Kapp, Daniel S.
2008-01-01
Purpose: To analyze the outcomes of and identify prognostic factors for patients treated with surgery and intraoperative radiotherapy (IORT) for locally advanced and recurrent soft-tissue sarcoma in adults from a single institution. Methods and Materials: We retrospectively reviewed 50 consecutive patients treated with IORT to 62 sites of disease. Primary sites included retroperitoneum-pelvis (78%), extremity (8%), and other (14%). Seventy percent of patients had recurrent disease failing prior surgery (70%) and/or radiation (32%). Mean disease-free interval (DFI) before IORT was 1.9 years (range, 2 weeks-5.4 years). The IORT was delivered with orthovoltage X-rays using individually sized beveled cone applicators. Clinical characteristics were as follows: mean tumor size, 10 cm (range, 1-25 cm); high-grade histologic subtype (72%); and mean dose, 1,159 cGy (range, 600-1,600 cGy). Postoperative radiation or chemotherapy was administered to 37% of IORT Sites and 32% of patients, respectively. Outcomes measured were infield control (IFC), locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Mean and median follow-up of alive patients were 59 and 35 months, respectively. Results: Kaplan-Meier 5-year IFC, LRC, DMFS, and DSS probabilities for the entire group were 55%, 26%, 51%, and 25%, respectively. Prognostic factors found to be significant (p < 0.05) on multivariate analysis were prior DFI and tumor size for LRC, extremity location and leiomyosarcoma histologic subtype for DMFS, and prior DFI for DSS. Our cohort had five Grade 3/4 complications associated with treatment or a 5-year Kaplan-Meier Grade 3/4 complication-free survival rate of 85%. Conclusions: IORT after tumor reductive surgery is well tolerated and seems to confer IFC in carefully selected patients
Miners' return to work following injuries in coal mines.
Bhattacherjee, Ashis; Kunar, Bijay Mihir
2016-12-22
The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW) following a miner's injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person's social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners' injuries. A study was conducted for 109 injured workers from an underground coal mine in the years 2000-2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners' return to work included presence of disease, job satisfaction and injury type. The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6):729-742. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Satisfactory Results of the Exeter Revision Femoral Stem Used for Primary Total Hip Arthroplasty.
Desy, Nicholas M; Johnson, Joshua D; Sierra, Rafael J
2017-02-01
The Exeter cemented femoral stem has demonstrated excellent clinical and radiographic outcomes as well as long-term survivorship free from aseptic loosening. A shorter revision stem (125 mm) with a 44 offset became available for the purpose of cement-in-cement revision situations. In certain cases, this shorter revision stem may be used for various primary total hip arthroplasties (THAs) where the standard length stem would require distally reaming the femoral canal. We sought to report on the early to midterm results of this specific stem when used for primary THA regarding (1) clinical and radiographic outcomes, (2) complications, and (3) survivorship. Twenty-nine patients (33 hips) underwent a hybrid THA using the smaller revision Exeter cemented femoral stem. Twenty-five patients (28 hips) had at least 2 years of follow-up and were assessed for clinical and radiographic outcomes. All 33 hips were included in the analysis of complications and survivorship. The Kaplan-Meier survivorship was performed using revision for all causes and for aseptic loosening as the end points. The average clinical follow-up was 4 years (range, 2-7). Harris Hip Scores improved from a mean preoperative value of 56 (range, 23-96) to 90 (range, 51-100) at the latest follow-up. All patients demonstrated superior cement mantles with no signs of loosening. One patient suffered a B2 periprosthetic fracture and 1 patient experienced 2 episodes of instability. The 5-year Kaplan-Meier survivorship was 96.7% for all causes of revision and was 100% using aseptic loosening as the end point. The shorter Exeter revision cemented femoral stem has favorable early to midterm clinical and radiographic outcomes when used for primary THA with a low complication rate and is a viable option in patients with narrow femoral canals where uncemented stem fixation is not desired. Copyright © 2016 Elsevier Inc. All rights reserved.
Patterns of Occurrence and Outcomes of Contralateral Breast Cancer: Analysis of SEER Data
Directory of Open Access Journals (Sweden)
Zhenchong Xiong
2018-05-01
Full Text Available Population-based estimates are lacking for the temporal trends in the contralateral breast cancer (CBC risk for patients with breast cancer (BC. Data for BC patients diagnosed with CBC were collected from the Surveillance, Epidemiology, and End Results database. CBC incidence was calculated using the Kaplan-Meier method and the temporal trend in CBC incidence was assessed using joinpoint regression. Survival analysis was calculated using propensity scoring (PS and multivariate Cox regression with a competing risk model. We found that 10,944 of 212,630 patients with early-stage BC were subsequently diagnosed with secondary BC in the contralateral breast. The 5-, 10-, 15-, and 20-year cumulative CBC incidences were 1.9, 4.6, 7.6, and 10.5%, respectively. Being younger (<40 years, black, hormone receptor-negative, and having undergone radiotherapy were correlated with a high risk of CBC occurrence. CBC incidence increased continuously in the first 11 years after the initial cancer diagnosis, and the upward trend slowed from years 11 to 21, and tended to decline from years 21 to 24. CBC diagnosis was significantly and negatively associated with survival. We reported population-based estimates of the CBC occurrence pattern and risk factors. Patients are at high risk of developing CBC in the first 21 years after the initial BC diagnosis.
Ahmed, I; Salmon, L J; Waller, A; Watanabe, H; Roe, J P; Pinczewski, L A
2016-01-01
Oxidised zirconium was introduced as a material for femoral components in total knee arthroplasty (TKA) as an attempt to reduce polyethylene wear. However, the long-term survival of this component is not known. We performed a retrospective review of a prospectively collected database to assess the ten year survival and clinical and radiological outcomes of an oxidised zirconium total knee arthroplasty with the Genesis II prosthesis. The Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), Knee Injury and Osteoarthritis Outcome Score (KOOS) and a patient satisfaction scale were used to assess outcome. A total of 303 consecutive TKAs were performed in 278 patients with a mean age of 68 years (45 to 89). The rate of survival ten years post-operatively as assessed using Kaplan-Meier analysis was 97% (95% confidence interval 94 to 99) with revision for any reason as the endpoint. There were no revisions for loosening, osteolysis or failure of the implant. There was a significant improvement in all components of the WOMAC score at final follow-up (p zirconium TKA gives comparable rates of survival with other implants and excellent functional outcomes ten years post-operatively. Total knee arthroplasty with an oxidised zirconium femoral component gives comparable long-term rates of survival and functional outcomes with conventional implants. ©2016 The British Editorial Society of Bone & Joint Surgery.
Ferrer, Pedro E; Bloch, Mark; Roth, Norman; Finlayson, Robert; Baker, David; Koh, Ken; Orth, David; Urbaityte, Rimgaile; Brown, Dannae; Drummond, Fraser
2018-03-01
The most common reasons for switching HIV-1 therapy in patients with virologic suppression are treatment regimen simplification and resolving tolerability issues. Single-pill regimens that include an integrase inhibitor are recommended options. A retrospective clinical audit was performed to determine the motivations for switching to dolutegravir (DTG)/abacavir (ABC)/lamivudine (3TC) at high HIV-caseload general practice clinics in Australia. The most common reasons for switching from a prior suppressive therapy to DTG/ABC/3TC were simplification of regimen, resolving toxicity/intolerance and patient preference (73%, 13% and 12%, respectively). Kaplan-Meier analysis showed that the probability of patients remaining on DTG/ABC/3TC therapy at 12 months was 95.1%. Switching to DTG/ABC/3TC from a range of other regimens was associated with a discontinuation rate of 3.2%, with 2.5% of patients discontinuing due to adverse events and no patients discontinuing due to virologic failure. Switching to DTG/ABC/3TC was a viable treatment strategy in this cohort of Australian patients.
Directory of Open Access Journals (Sweden)
Sin-Aye Park
Full Text Available Overexpression or activation of cyclic AMP-response element-binding protein (CREB has been known to be involved in several human malignancies, including lung cancer. Genes regulated by CREB have been reported to suppress apoptosis, induce cell proliferation, inflammation, and tumor metastasis. However, the critical target genes of CREB in lung cancer have not been well understood. Here, we identified GSK-3α as one of the CREB target genes which is critical for the viability of lung cancer cells. The CREB knockdown significantly reduced the expression of GSK-3α and the direct binding of CREB on the promoter of GSK3A was identified. Kaplan-Meier analysis with a public database showed a prognostic significance of aberrant GSK-3α expression in lung cancer. Inhibition of GSK-3α suppressed cell viability, colony formation, and tumor growth. For the first time, we demonstrated that GSK-3α is regulated by CREB in lung cancer and is required for the cell viability. These findings implicate CREB-GSK-3α axis as a novel therapeutic target for lung cancer treatment.
Ma, Xinlong; Shang, Feng; Zhu, Weidong; Lin, Qingtang
2017-09-01
CXCR4 is an oncogene in glioblastoma multiforme (GBM) but the mechanism of its dysregulation and its prognostic value in GBM have not been fully understood. Bioinformatic analysis was performed by using R2 and the UCSC Xena browser based on data from GSE16011 in GEO datasets and in GBM cohort in TCGA database (TCGA-GBM). Kaplan Meier curves of overall survival (OS) were generated to assess the association between CXCR4 expression/methylation and OS in patients with GBM. GBM patients with high CXCR4 expression had significantly worse 5 and 10 yrs OS (p GBM subtypes, there was an inverse relationship between overall DNA methylation and CXCR4 expression. CXCR4 expression was significantly lower in CpG island methylation phenotype (CIMP) group than in non CIMP group. Log rank test results showed that patients with high CXCR4 methylation (first tertile) had significantly better 5 yrs OS (p = 0.038). CXCR4 expression is regulated by DNA methylation in GBM and its low expression or hypermethylation might indicate favorable OS in GBM patients.
Directory of Open Access Journals (Sweden)
Shingo Hatakeyama
2011-01-01
Full Text Available Vascular access stenosis is a major complication in hemodialysis patients. We prospectively observed 50 patients in whom 50 nitinol shape-memory alloy-recoverable technology (SMART stents were used as salvage therapy for recurrent peripheral venous stenosis. Twenty-five stents each were deployed in native arteriovenous fistula (AVF and synthetic arteriovenous polyurethane graft (AVG cases. Vascular access patency rates were calculated by Kaplan-Meier analysis. The primary patency rates in AVF versus AVG at 3, 6, and 12 months were 80.3% versus 75.6%, 64.9% versus 28.3%, and 32.3% versus 18.9%, respectively. The secondary patency rates in AVF versus AVG at 3, 6, and 12 months were 88.5% versus 75.5%, 82.6% versus 61.8%, and 74.4% versus 61.8%, respectively. Although there were no statistically significant difference in patency between AVF and AVG, AVG showed poor tendency in primary and secondary patency. The usefulness of SMART stents was limited in a short period of time in hemodialysis patients with recurrent vascular access stenosis.
Wei, Xue-Biao; Liu, Yuan-Hui; He, Peng-Cheng; Yu, Dan-Qing; Zhou, Ying-Ling; Tan, Ning; Chen, Ji-Yan
2017-05-01
Background Limited research studies with a large sample size were performed to evaluate the prognostic value of N-terminal pro-B-type natriuretic peptide (NT-proBNP) for in-hospital or long-term poor outcomes in patients with infective endocarditis. Methods A total of 703 patients with infective endocarditis were enrolled and divided into four groups according to admission NT-pro-BNP (pg/mL) quartiles: Q1 (3522). Multivariate regression was used to determine independent risk of NT-proBNP for in-hospital and one-year death. Results In-hospital death occurred in 9.0% of patients. The in-hospital mortality was increased from the lowest to the highest NT-proBNP quartiles (1.1%, 3.4%, 9.1% and 22.3%, P 2260 pg/mL had 76.2% sensitivity and 69.1% specificity for predicting in-hospital death. Kaplan-Meier analysis showed that patients with NT-proBNP > 2260 pg/ml had a worse prognosis than those without (log-rank test 18.84, P endocarditis.
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage.
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-07-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and 2.86 days and were quicker compared with that in the UV only group (4.21 days); (2) zebrafish fins in the UV+comfrey (50 and 100 ppm) groups were 2.05 and 3.25 times more likely to return to normal than those in the UV only group; and (3) comfrey leave extracts had UV-absorbance abilities and significantly reduced ROS production in UV-exposed zebrafish embryos, which may attenuate UV-mediated apoptosis. In conclusion, comfrey leaves extracts may have the potential to be developed as UV-protective agents to protect zebrafish embryos from UV-induced damage.
Yamamoto, Tetsuya; Sawada, Akira; Mayama, Chihiro; Araie, Makoto; Ohkubo, Shinji; Sugiyama, Kazuhisa; Kuwayama, Yasuaki
2014-05-01
To report the 5-year incidence of bleb-related infection after mitomycin C-augmented glaucoma filtering surgery and to investigate the risk factors for infections. Prospective, observational cohort study. A total of 1098 eyes of 1098 glaucoma patients who had undergone mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation performed at 34 clinical centers. Patients were followed up at 6-month intervals for 5 years, with special attention given to bleb-related infections. The follow-up data were analyzed via Kaplan-Meier survival analysis and the Cox proportional hazards model. Incidence of bleb-related infection over 5 years and risk factors for infections. Of the 1098 eyes, a bleb-related infection developed in 21 eyes. Kaplan-Meier survival analysis revealed that the incidence of bleb-related infection was 2.2±0.5% (cumulative incidence ± standard error) at the 5-year follow-up for all cases, whereas it was 7.9±3.1% and 1.7±0.4% for cases with and without a history of bleb leakage, respectively (P = 0.000, log-rank test). When only eyes with a well-functioning bleb were counted, it was 3.9±1.0%. No differences were found between the trabeculectomy cases and the combined surgery cases (P = 0.398, log-rank test) or between cases with a fornix-based flap and those with a limbal-based flap (P = 0.651, log-rank test). The Cox model revealed that a history of bleb leakage and younger age were risk factors for infections. The 5-year cumulative incidence of bleb-related infection was 2.2±0.5% in eyes treated with mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation in our prospective, multicenter study. Bleb leakage and younger age were the main risk factors for infections. Copyright © 2014 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Abhishek A Solanki
Full Text Available PURPOSE: Radiation therapy (RT is commonly used as definitive treatment for early-stage nodular lymphocyte-predominant Hodgkin's lymphoma (NLPHL. We evaluated the cause-specific survival (CSS, overall survival (OS, and second malignancy (SM rates in patients with early-stage NLPHL treated with RT. METHODS AND MATERIALS: Patients with stage I-II NLPHL between 1988 and 2009 who underwent RT were selected from the Surveillance, Epidemiology and End Results database. Univariate analysis (UVA for CSS and Os was performed using the Kaplan-Meier method and included age, gender, involved site, year of diagnosis, presence of B-symptoms, and extranodal involvement (ENI. Multivariable analysis (MVA was performed using Cox Proportional Hazards modeling and included the above clinical variables. SM were classified as RT-related or non-RT-related. Freedom from SM and freedom from RT-related SM were determined using the Kaplan-Meier method. RESULTS: The study cohort included 469 patients. Median age was 37 years. The most common involved sites were the head and neck (36%, axilla/arm (26%, and multiple lymph node regions (18%. Sixty-eight percent had stage I disease, 70% were male, 4% had ENI, and 7% had B-symptoms. Median follow-up was 6 years. Ten-year CSS and Os were 98% and 88%, respectively. On UVA, none of the covariates was associated with CSS. Increasing age (p<0.01 and female gender (p<0.01 were associated with worse Os. On MVA, older age (p<0.01, female gender (p=0.04, multiple regions of involvement (p=0.03, stage I disease (p=0.02, and presence of B-symptoms (p=0.02 were associated with worse Os. Ten-year freedom from SM and freedom from RT-related SM were 89% and 99%, respectively. CONCLUSIONS: This is the largest series to evaluate the outcomes of stage I-II NLPHL patients treated with RT and found that this patient population has an excellent long-term prognosis and a low rate of RT-related second malignancies.
Directory of Open Access Journals (Sweden)
Zoltan-Iosif Korka
2016-10-01
Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.
A population-based study of survival and discharge status for survivors after head injury
DEFF Research Database (Denmark)
Engberg, Aase Worså; Teasdale, T W
2004-01-01
and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score
Syncytin immunoreactivity in colorectal cancer
DEFF Research Database (Denmark)
Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen
2009-01-01
monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....
Lee, Sung Woo; Yu, Mi-Yeon; Baek, Seon Ha; Ahn, Shin-Young; Kim, Sejoong; Na, Ki Young; Chae, Dong-Wan; Chin, Ho Jun
2016-04-01
Few studies have reported on the long-term prognosis of anti-neutrophil cytoplasmic antibody (ANCA)-negative renal vasculitis. Between April 2003 and December 2013, 48 patients were diagnosed with renal vasculitis. Their ANCA status was tested using indirect immunofluorescence and enzyme-linked immunosorbent assays. During a median (interquartile range) follow-up duration of 933.5 (257.5-2,079.0) days, 41.7% of patients progressed to end stage renal disease (ESRD) and 43.8% died from any cause. Of 48 patients, 6 and 42 were ANCA-negative and positive, respectively. The rate of ESRD within 3 months was higher in ANCA-negative patients than in ANCA-positive patients (P = 0.038). In Kaplan-Meier survival analysis, ANCA-negative patients showed shorter renal survival than did ANCA-positive patients (log-rank P = 0.033). In univariate Cox-proportional hazard regression analysis, ANCA-negative patients showed increased risk of ESRD, with a hazard ratio 3.190 (95% confidence interval, 1.028-9.895, P = 0.045). However, the effect of ANCA status on renal survival was not statistically significant in multivariate analysis. Finally, ANCA status did not significantly affect patient survival. In conclusion, long-term patient and renal survival of ANCA-negative renal vasculitis patients did not differ from those of ANCA-positive renal vasculitis patients. Therefore, different treatment strategy depending on ANCA status might be unnecessary.
Choi, Youngmin; Lee, Hyung-Sik; Hur, Won-Joo; Sung, Ki-Han; Kim, Ki-Uk; Choi, Sun-Seob; Kim, Su-Jin; Kim, Dae-Cheol
2013-01-01
Purpose There are conflicting results surrounding the prognostic significance of epidermal growth factor receptor (EGFR) status in glioblastoma (GBM) patients. Accordingly, we attempted to assess the influence of EGFR expression on the survival of GBM patients receiving postoperative radiotherapy. Materials and Methods Thirty three GBM patients who had received surgery and postoperative radiotherapy at our institute, between March 1997 and February 2006, were included. The evaluation of EGFR expression with immunohistochemistry was available for 30 patients. Kaplan-Meier survival analysis and Cox regression were used for statistical analysis. Results EGFR was expressed in 23 patients (76.7%), and not expressed in seven (23.3%). Survival in EGFR expressing GBM patients was significantly less than that in non-expressing patients (median survival: 12.5 versus 17.5 months, p=0.013). Patients who received more than 60 Gy showed improved survival over those who received up to 60 Gy (median survival: 17.0 versus 9.0 months, p=0.000). Negative EGFR expression and a higher radiation dose were significantly correlated with improved survival on multivariate analysis. Survival rates showed no differences according to age, sex, and surgical extent. Conclusion The expression of EGFR demonstrated a significantly deleterious effect on the survival of GBM patients. Therefore, approaches targeting EGFR should be considered in potential treatment methods for GBM patients, in addition to current management strategies. PMID:23225805
Directory of Open Access Journals (Sweden)
Li-li ZHANG
2013-09-01
Full Text Available Objective To investigate the therapeutic effects of Gemcitabine(GEM, Vinorelbine(NVB,Paclitaxel(TAX and other first-line chemotherapeutics plus platinum containing drugs on the elderly patients with advanced non-small cell lung cancer(NSCLC who had undergone surgery, and analyze the clinicopathological factors influencing the prognosis. Methods One hundred and seventeen advanced NSCLC patients aged 60 or over were treated with GP(GEM+platinum, or NP(NVB+platinum, or TP(TAX+platinum, or other first-line chemotherapeutics plus platinum(OCP after surgery, and their clinical data were then retrospectively studied to look for the relationship of patients' prognosis to clinicopathological factors(gender, operation methods, pathologicaltypes, differentiation, clinical stages.The survival curve was plotted with Kaplan-Meier method, hypothesis test was performed by log-rank, and the independent prognostic factors were screened with Cox proportional hazards regression model. Results Theone-, three- and five-year survival rates of the 117 patients were 47.23%,17.52% and 8.05%, respectively. The progression free survival(PFS of GP, NP, TP and OCP groups were 6.0, 5.2, 6.1 and5.5 months(P>0.05, respectively. The median progression free survival was 5.7 months. Univariate and multivariate analysis showed that the differentiated degrees and clinical stages of elderly NSCLC patients were the independent prognostic factors. Conclusions Clinicopathological factors(differentiated degree andclinical stages are closely related to one-, three- and five-year survival rates of advanced NSCLC in elderly patients who received treatment of first-line chemotherapeutics plus platinum. However, the efficacy ofGP, NP, TP or OCP shows no significant difference.
Directory of Open Access Journals (Sweden)
Viviana Volta
Full Text Available Malignant pleural mesothelioma (MPM is a poor prognosis disease lacking adequate therapy. We have previously shown that ascorbic acid administration is toxic to MPM cells. Here we evaluated a new combined therapy consisting of ascorbate/epigallocatechin-3-gallate/gemcitabine mixture (called AND, for Active Nutrients/Drug. In vitro effects of AND therapy on various MPM cell lines revealed a synergistic cytotoxic mechanism. In vivo experiments on a xenograft mouse model for MPM, obtained by REN cells injection in immunocompromised mice, showed that AND strongly reduced the size of primary tumor as well as the number and size of metastases, and prevented abdominal hemorrhage. Kaplan Meier curves and the log-rank test indicated a marked increase in the survival of AND-treated animals. Histochemical analysis of dissected tumors showed that AND induced a shift from cell proliferation to apoptosis in cancer cells. Lysates of tumors from AND-treated mice, analyzed with an antibody array, revealed decreased TIMP-1 and -2 expressions and no effects on angiogenesis regulating factors. Multiplex analysis for signaling protein phosphorylation exhibited inactivation of cell proliferation pathways. The complex of data showed that the AND treatment is synergistic in vitro on MPM cells, and blocks in vivo tumor progression and metastasization in REN-based xenografts. Hence, the AND combination is proposed as a new treatment for MPM.
Vasilopoulos, Terrie; Franz, Carol E; Panizzon, Matthew S; Xian, Hong; Grant, Michael D; Lyons, Michael J; Toomey, Rosemary; Jacobson, Kristen C; Kremen, William S
2012-03-01
To examine how genes and environments contribute to relationships among Trail Making Test (TMT) conditions and the extent to which these conditions have unique genetic and environmental influences. Participants included 1,237 middle-aged male twins from the Vietnam Era Twin Study of Aging. The Delis-Kaplan Executive Function System TMT included visual searching, number and letter sequencing, and set-shifting components. Phenotypic correlations among TMT conditions ranged from 0.29 to 0.60, and genes accounted for the majority (58-84%) of each correlation. Overall heritability ranged from 0.34 to 0.62 across conditions. Phenotypic factor analysis suggested a single factor. In contrast, genetic models revealed a single common genetic factor but also unique genetic influences separate from the common factor. Genetic variance (i.e., heritability) of number and letter sequencing was completely explained by the common genetic factor while unique genetic influences separate from the common factor accounted for 57% and 21% of the heritabilities of visual search and set shifting, respectively. After accounting for general cognitive ability, unique genetic influences accounted for 64% and 31% of those heritabilities. A common genetic factor, most likely representing a combination of speed and sequencing, accounted for most of the correlation among TMT 1-4. Distinct genetic factors, however, accounted for a portion of variance in visual scanning and set shifting. Thus, although traditional phenotypic shared variance analysis techniques suggest only one general factor underlying different neuropsychological functions in nonpatient populations, examining the genetic underpinnings of cognitive processes with twin analysis can uncover more complex etiological processes.