A versatile test for equality of two survival functions based on weighted differences of Kaplan-Meier curves.

Science.gov (United States)

Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J

2015-12-10

With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.

[Survival analysis with competing risks: estimating failure probability].

Science.gov (United States)

Llorca, Javier; Delgado-Rodríguez, Miguel

2004-01-01

To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

Kaplan turbine tip vortex cavitation - analysis and prevention

Science.gov (United States)

Motycak, L.; Skotak, A.; Kupcik, R.

2012-11-01

The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

Análisis de supervivencia en presencia de riesgos competitivos: estimadores de la probabilidad de suceso Survival analysis with competing risks: estimating failure probability

Directory of Open Access Journals (Sweden)

Javier Llorca

2004-10-01

Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

Directory of Open Access Journals (Sweden)

Jie Zhao

2015-01-01

Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.

Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

OpenAIRE

Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu

2015-01-01

Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...

Kaplan turbine tip vortex cavitation – analysis and prevention

International Nuclear Information System (INIS)

Motycak, L; Skotak, A; Kupcik, R

2012-01-01

The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System

Science.gov (United States)

Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola

2011-01-01

Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…

Bias and precision of methods for estimating the difference in restricted mean survival time from an individual patient data meta-analysis

Directory of Open Access Journals (Sweden)

Béranger Lueza

2016-03-01

Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect

Applying Kaplan-Meier to Item Response Data

Science.gov (United States)

McNeish, Daniel

2018-01-01

Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…

Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine

Directory of Open Access Journals (Sweden)

Doina Frunzaverde

2011-01-01

Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.

A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines

Science.gov (United States)

Pennacchi, P.; Borghesani, P.; Chatterton, S.

2015-08-01

Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.

Water hammer 2 phase analysis hydraulic system with a Kaplan turbine

OpenAIRE

Dudlik, A.; Koutnik, J.

2009-01-01

This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...

Analysis of the Kaplan turbine draft tube effect

International Nuclear Information System (INIS)

Motycak, L; Skotak, A; Obrovsky, J

2010-01-01

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Analysis of the Kaplan turbine draft tube effect

Energy Technology Data Exchange (ETDEWEB)

Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)

2010-08-15

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Analysis of the Kaplan turbine draft tube effect

Science.gov (United States)

Motycak, L.; Skotak, A.; Obrovsky, J.

2010-08-01

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Meier-Gorlin syndrome

NARCIS (Netherlands)

Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

DEFF Research Database (Denmark)

Kyndi, M.; Sorensen, F.B.; Alsner, J.

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

Serum level of soluble urokinase-type plasminogen activator receptor is a strong and independent predictor of survival in human immunodeficiency virus infection

DEFF Research Database (Denmark)

Sidenius, N; Sier, C.F.M.; Ullum, H

2000-01-01

levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...

["That flesh, pink and perishable": analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain) in the presence of competing risks].

Science.gov (United States)

Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel

2009-01-01

To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

Competing approaches to analysis of failure times with competing risks.

Science.gov (United States)

Farley, T M; Ali, M M; Slaymaker, E

2001-12-15

For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.

Meier-Gorlin syndrome

OpenAIRE

de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...

RBPJ and EphrinB2 as Molecular Targets to Treat Brain Arteriovenous Malformation in Notch4 Induced Mouse Model

Science.gov (United States)

2017-10-01

of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to

Censoring approach to the detection limits in X-ray fluorescence analysis

International Nuclear Information System (INIS)

Pajek, M.; Kubala-Kukus, A.

2004-01-01

We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples

Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

International Nuclear Information System (INIS)

Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H

2012-01-01

The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

Science.gov (United States)

Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.

2012-11-01

The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

DEFF Research Database (Denmark)

Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

Survival analysis

International Nuclear Information System (INIS)

Badwe, R.A.

1999-01-01

The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model

Survival Analysis of Patients with End Stage Renal Disease

Science.gov (United States)

Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.

2015-06-01

This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.

Clinical Significance of Preoperative Albumin and Globulin Ratio in Patients with Gastric Cancer Undergoing Treatment

Directory of Open Access Journals (Sweden)

Min-jie Mao

2017-01-01

Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.

Genetics Home Reference: Meier-Gorlin syndrome

Science.gov (United States)

... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...

Perturbative analysis for Kaplan's lattice chiral fermions

International Nuclear Information System (INIS)

Aoki, S.; Hirose, H.

1994-01-01

Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls

Multi-objective shape optimization of runner blade for Kaplan turbine

International Nuclear Information System (INIS)

Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V

2014-01-01

Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads

Multi-objective shape optimization of runner blade for Kaplan turbine

Science.gov (United States)

Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.

2014-03-01

Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.

MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY

OpenAIRE

Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar

2016-01-01

Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...

Prognostic significance of transient myocardial ischaemia after first acute myocardial infarction: five year follow up study

DEFF Research Database (Denmark)

Mickley, H; Nielsen, J R; Berning, J

1995-01-01

infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...

Meier-Gorlin syndrome Clinical genetics and genomics

NARCIS (Netherlands)

S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)

2015-01-01

textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia

«Esa corporeidad mortal y rosa»: análisis del tiempo libre de enfermedad del cáncer de mama en Gipuzkoa en presencia de riesgos competitivos "That deadly and pink corporeity": Analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain in the presence of competing risks

Directory of Open Access Journals (Sweden)

Pablo Martínez-Camblor

2009-12-01

Full Text Available Objetivo: Analizar el tiempo de supervivencia libre de enfermedad y la supervivencia relativa en mujeres diagnosticadas de cáncer de mama en la provincia de Gipuzkoa en un contexto de riesgos competitivos, valorando las diferencias encontradas entre el uso directo del estimador de Kaplan-Meier y el método de decrementos múltiples por un lado y la supervivencia relativa por otro. Métodos: Se consideraron todos los casos de cáncer de mama registrados en la provincia de Gipuzkoa durante los años 1995 y 1996 en estadio distinto del IV, y se hizo un seguimiento de 8 años para la recidiva y de 10 años para la supervivencia. Se analizó el tiempo de supervivencia libre de enfermedad mediante el método de decrementos múltiples. Asimismo, también se analizó el tiempo de supervivencia observado y corregido por la mortalidad esperada de la población, conocido como supervivencia relativa. Resultados: La estimación de la probabilidad de recidiva a los 8 años por el método de decrementos múltiples es un 8,8% inferior a la obtenida por el método de Kaplan-Meier. La diferencia entre la supervivencia observada y la relativa a los 10 años es del 10,8%. Ambos resultados indican que, en este caso, el método de Kaplan-Meier sobrestima tanto la probabilidad de recaída como la de muerte por la enfermedad. Conclusiones: Dos cuestiones que muchas veces se obvian al realizar un análisis de supervivencia son, por un lado, que la no independencia entre el tiempo de supervivencia y el tiempo de censura hacen no interpretables los resultados obtenidos por el estimador de Kaplan-Meier, y por otro el hecho, hasta hora incuestionable, de que de una manera u otra todos causamos fallo y, desde este planteamiento, en el estudio del tiempo de supervivencia hay que tener presente la probabilidad de fallo en la población general de referencia. En los resultados obtenidos se observa que utilizar de manera superficial el estimador de Kaplan-Meier comporta una

Meier-Gorlin syndrome Clinical genetics and genomics

NARCIS (Netherlands)

De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

Multiple factor analysis of metachronous upper urinary tract transitional cell carcinoma after radical cystectomy

Directory of Open Access Journals (Sweden)

P. Wang

2007-07-01

Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.

Kaplan SpellRead. What Works Clearinghouse Intervention Report

Science.gov (United States)

What Works Clearinghouse, 2007

2007-01-01

"Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…

Optimization of Kaplan turbines. A contribution to economic efficiency; Optimierung von Kaplan-Turbinen. Ein Beitrag zur Betriebswirtschaftlichkeit

Energy Technology Data Exchange (ETDEWEB)

Sevcik, Petr

2009-07-01

The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.

Deciphering the Adaptive Immune Response to Ovarian Cancer

Science.gov (United States)

2013-10-01

positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor

Blade profile optimization of kaplan turbine using cfd analysis

International Nuclear Information System (INIS)

Janjua, A.B.; Khalil, M.S.

2013-01-01

Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)

Blade Profile Optimization of Kaplan Turbine Using CFD Analysis

Directory of Open Access Journals (Sweden)

Aijaz Bashir Janjua

2013-10-01

Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.

Challenges in risk estimation using routinely collected clinical data: The example of estimating cervical cancer risks from electronic health-records.

Science.gov (United States)

Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A

2018-06-01

Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Interview with Danny Kaplan

Science.gov (United States)

Rossman, Allan; Kaplan, Danny

2017-01-01

Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

International Nuclear Information System (INIS)

Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

2008-01-01

Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

Numerical investigation of hub clearance flow in a Kaplan turbine

Science.gov (United States)

Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.

2012-11-01

In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.

Numerical investigation of hub clearance flow in a Kaplan turbine

International Nuclear Information System (INIS)

Wu, H; Feng, J J; Wu, G K; Luo, X Q

2012-01-01

In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.

Survival analysis II: Cox regression

NARCIS (Netherlands)

Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.

2011-01-01

In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the

Comparison of Exposure in the Kaplan Versus the Kocher Approach in the Treatment of Radial Head Fractures.

Science.gov (United States)

Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P

2018-01-01

The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.

Meier-Gorlin syndrome Clinical genetics and genomics

OpenAIRE

Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie

2015-01-01

textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...

Computer Aided Design of Kaplan Turbine Piston with SolidWorks

OpenAIRE

Camelia Jianu

2010-01-01

The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.

Science.gov (United States)

Pion, J; Lenoir, M; Vandorpe, B; Segers, V

2015-11-01

This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.

Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

International Nuclear Information System (INIS)

Weili, L; Jinling, L; Xingqi, L; Yuan, L

2010-01-01

The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

Energy Technology Data Exchange (ETDEWEB)

Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)

2010-08-15

The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

Science.gov (United States)

Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.

2010-08-01

The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

Volume-Based F-18 FDG PET/CT Imaging Markers Provide Supplemental Prognostic Information to Histologic Grading in Patients With High-Grade Bone or Soft Tissue Sarcoma

DEFF Research Database (Denmark)

Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid

2015-01-01

analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...

Markov chains and semi-Markov models in time-to-event analysis.

Science.gov (United States)

Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J

2013-10-25

A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.

Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

Science.gov (United States)

2017-08-01

28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival

Numerical and in-situ investigations of water hammer effects in Drava river Kaplan turbine hydropower plants

International Nuclear Information System (INIS)

Bergant, A; Gregorc, B; Gale, J

2012-01-01

This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.

Numerical and in-situ investigations of water hammer effects in Drava river Kaplan turbine hydropower plants

Science.gov (United States)

Bergant, A.; Gregorc, B.; Gale, J.

2012-11-01

This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.

Third-line Targeted Therapy in Metastatic Renal Cell Carcinoma: Results from the International Metastatic Renal Cell Carcinoma Database Consortium

DEFF Research Database (Denmark)

Wells, J Connor; Stukalin, Igor; Norton, Craig

2017-01-01

and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...

Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.

Science.gov (United States)

Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E

2018-02-02

In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.

Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks

Directory of Open Access Journals (Sweden)

Camelia Jianu

2010-10-01

Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.

Science.gov (United States)

Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak

Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids

OpenAIRE

Gustafsson, Martin

2013-01-01

To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...

Survival analysis in hematologic malignancies: recommendations for clinicians

Science.gov (United States)

Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril

2014-01-01

The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982

Kaplan og Norton bør læses af hele ledelsen

DEFF Research Database (Denmark)

Bukh, Per Nikolaj

2009-01-01

Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...

Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

Science.gov (United States)

Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

2011-03-28

The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test

International Nuclear Information System (INIS)

Aoki, S.; Levien, R.B.

1995-01-01

We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories

CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

International Nuclear Information System (INIS)

Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.

2017-01-01

The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

Case Report: Meier-Gorlin syndrome: Report of an additional patient ...

African Journals Online (AJOL)

We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.

Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin

OpenAIRE

Fjærvold, Lars

2012-01-01

The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...

Anterolateral Knee Extra-articular Stabilizers: A Robotic Sectioning Study of the Anterolateral Ligament and Distal Iliotibial Band Kaplan Fibers.

Science.gov (United States)

Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F

2018-05-01

when compared with ALL sectioning. On simulated pivot-shift testing, ALL sectioning led to significantly increased internal rotation and anterior translation at 15° and 30°; sectioning of the Kaplan fibers led to significantly increased tibial internal rotation at 15° and 30° and anterior translation at 15°. No significant difference was found when anterior tibial translation was compared between the ACL/ALL- and ACL/Kaplan fiber-deficient states on simulated pivot-shift testing or isolated anterior tibial load. The ALL and Kaplan fibers restrain internal rotation in the ACL-deficient knee. Sectioning the Kaplan fibers led to greater tibial internal rotation at higher flexion angles (60°-90°) as compared with ALL sectioning. Additionally, the ALL and Kaplan fibers contribute to restraint of the pivot shift and anterior tibial translation in the ACL-deficient knee. This study reports that the ALL and distal iliotibial band Kaplan fibers restrain anterior tibial translation, internal rotation, and pivot shift in the ACL-deficient knee. Furthermore, sectioning the Kaplan fibers led to significantly greater tibial internal rotation when compared with ALL sectioning at high flexion angles. These results demonstrate increased rotational knee laxity with combined ACL and anterolateral extra-articular knee injuries and may allow surgeons to optimize the care of patients with this injury pattern.

Prognostic value of MLH1 promoter methylation in male patients with esophageal squamous cell carcinoma.

Science.gov (United States)

Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei

2017-04-01

The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.

CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

Energy Technology Data Exchange (ETDEWEB)

Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)

2017-03-15

The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

Reporting of loss to follow-up information in randomised controlled trials with time-to-event outcomes: a literature survey

Directory of Open Access Journals (Sweden)

Bender Ralf

2011-09-01

Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.

Comparative pathogenicity of Vibrio spp., Photobacterium damselae ssp. damselae and five isolates of Aeromonas salmonicida ssp. achromogenes in juvenile Atlantic halibut (Hippoglossus hippoglossus).

Science.gov (United States)

Bowden, T J; Bricknell, I R; Preziosi, B M

2018-01-01

Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.

Clinical outcomes in patients with node-negative breast cancer treated based on the recurrence score results: evidence from a large prospectively designed registry.

Science.gov (United States)

Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky

2017-01-01

The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n  = 304) and 11-25 ( n  = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.

The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

International Nuclear Information System (INIS)

Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.

2016-01-01

Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

Energy Technology Data Exchange (ETDEWEB)

Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)

2016-07-15

Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

Meier-Gorlin syndrome.

Science.gov (United States)

de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

2015-09-17

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.

STAT3 inhibitor enhances chemotherapy drug efficacy by ...

African Journals Online (AJOL)

Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.

Censoring: a new approach for detection limits in total-reflection X-ray fluorescence

International Nuclear Information System (INIS)

Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.

2004-01-01

It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for

Prita Meier, Swahili Port Cities: The Architecture of Elsewhere

OpenAIRE

Longair, Sarah

2018-01-01

Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...

Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post

Index Scriptorium Estoniae

Nikiforov, Raivo

2005-01-01

Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest

Carbonic anhydrase IX and response to postmastectomy radiotherapy in high-risk breast cancer: a subgroup analysis of the DBCG82 b and c trials

DEFF Research Database (Denmark)

Kyndi, M.; Sorensen, F.B.; Alsner, J.

2008-01-01

-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...

The Prognostic Impact of NK/NKT Cell Density in Periampullary Adenocarcinoma Differs by Morphological Type and Adjuvant Treatment.

Science.gov (United States)

Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin

2016-01-01

Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.

Restaging and Survival Analysis of 4036 Ovarian Cancer Patients According to the 2013 FIGO Classification for Ovarian, Fallopian Tube, and Primary Peritoneal Cancer

DEFF Research Database (Denmark)

Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul

2016-01-01

OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...

Oncological Outcomes After Robotic Proctectomy for Rectal Cancer: Analysis of a Prospective Database.

Science.gov (United States)

Sammour, Tarik; Malakorn, Songphol; Bednarski, Brian K; Kaur, Harmeet; Shin, Ui Sup; Messick, Craig; You, Yi-Qian Nancy; Chang, George J

2018-03-01

The aim of this study is to evaluate the oncological outcomes of robotic total mesorectal excision (TME) at an NCI designated cancer center. The effectiveness of laparoscopic TME could not be established, but the robotic-assisted approach may hold some promise, with improved visualization and ergonomics for pelvic dissection. Oncological outcome data is presently lacking. Patients who underwent total mesorectal excision or tumor-specific mesorectal excision for rectal cancer between April 2009 and April 2016 via a robotic approach were identified from a prospective single-institution database. The circumferential resection margin (CRM), distal resection margin, and TME completeness rates were determined. Kaplan-Meier analysis of disease-free survival and overall survival was performed for all patients treated with curative intent. A total of 276 patients underwent robotic proctectomy during the study period. Robotic surgery was performed initially by 1 surgeon with 3 additional surgeons progressively transitioning from open to robotic during the study period with annual increase in the total number of cases performed robotically. Seven patients had involved circumferential resection margins (2.5%), and there were no positive distal or proximal resection margins. One hundred eighty-six patients had TME quality assessed, and only 1 patient (0.5%) had an incomplete TME. Eighty-three patients were followed up for a minimum of 3 years, with a local recurrence rate of 2.4%, and a distant recurrence rate of 16.9%. Five-year disease-free survival on Kaplan-Meier analysis was 82%, and 5-year overall survival was 87%. Robotic proctectomy for rectal cancer can be performed with good short and medium term oncological outcomes in selected patients.

Epilepsy in Rett syndrome--lessons from the Rett networked database

DEFF Research Database (Denmark)

Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori

2015-01-01

collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...

Survival of Root-filled Teeth in the Swedish Adult Population

DEFF Research Database (Denmark)

Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik

2016-01-01

INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...

Carotid flow velocity/diameter ratio is a predictor of cardiovascular events in hypertensive patients

DEFF Research Database (Denmark)

Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V

2015-01-01

AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...

Chondrosarcoma of the Osseous Spine: An Analysis of Epidemiology, Patient Outcomes, and Prognostic Factors Using the SEER Registry From 1973 to 2012.

Science.gov (United States)

Arshi, Armin; Sharim, Justin; Park, Don Y; Park, Howard Y; Bernthal, Nicholas M; Yazdanshenas, Hamed; Shamie, Arya N

2017-05-01

Retrospective analysis. To determine the epidemiology and prognostic indicators in patients with chondrosarcoma of the osseous spine. Chondrosarcoma of the spine is rare, with limited data on its epidemiology, clinicopathologic features, and treatment outcomes. Therapy centers on complete en bloc resection with radiotherapy reserved for subtotal resection or advanced disease. The Surveillance, Epidemiology, and End Results Registry was queried for patients with chondrosarcoma of the osseous spine from 1973 to 2012. Study variables included age, sex, race, year of diagnosis, size, grade, extent of disease, and treatment modality. The search identified 973 cases of spinal chondrosarcoma. Mean age at diagnosis was 51.6 years, and 627% of patients were males. Surgical resection and radiotherapy were performed in 75.2% and 21.3% of cases, respectively. Kaplan-Meier analysis demonstrated overall survival (OS) and disease-specific survival (DSS) of 53% and 64%, respectively, at 5 years. Multivariate Cox regression analysis showed that age (OS, P chondrosarcoma of the spine independent of extent of disease. Radiotherapy improves survival in patients with metastatic disease and worsens outcomes in patients with confined and locally invasive disease. 4.

A 10-year cohort analysis of routine paediatric ART data in a rural South African setting.

Science.gov (United States)

Lilian, R R; Mutasa, B; Railton, J; Mongwe, W; McINTYRE, J A; Struthers, H E; Peters, R P H

2017-01-01

South Africa's paediatric antiretroviral therapy (ART) programme is managed using a monitoring and evaluation tool known as TIER.Net. This electronic system has several advantages over paper-based systems, allowing profiling of the paediatric ART programme over time. We analysed anonymized TIER.Net data for HIV-infected children aged ART in a rural district of South Africa between 2005 and 2014. We performed Kaplan-Meier survival analysis to assess outcomes over time. Records of 5461 children were available for analysis; 3593 (66%) children were retained in care. Losses from the programme were higher in children initiated on treatment in more recent years (P ART programme and highlights interventions to improve programme performance.

Verification of Kaplan turbine cam curves realization accuracy at power plant

Directory of Open Access Journals (Sweden)

Džepčeski Dane

2016-01-01

Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.

Individualism, Nationalism, and Universalism: The Educational Ideals of Mordecai M. Kaplan's Philosophy of Jewish Education

Science.gov (United States)

Ackerman, Ari

2008-01-01

This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…

Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents; Interdisziplinaere interventionelle Therapie tracheobronchialer Stenosen mit modernen Metallmaschenstents

Energy Technology Data Exchange (ETDEWEB)

Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik

2002-08-01

Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent

ASURV: Astronomical SURVival Statistics

Science.gov (United States)

Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.

2014-06-01

ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.

Influence of antiviral therapy on survival of patients with hepatitis B ...

African Journals Online (AJOL)

The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...

Neoadjuvant treatment and adjuvant radiotherapy for patients with high risk prostate cancer and radical prostatectomy

International Nuclear Information System (INIS)

Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo

2009-01-01

Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es

The BCR-ABLT315I mutation compromises survival in chronic phase chronic myelogenous leukemia patients resistant to tyrosine kinase inhibitors, in a matched pair analysis

DEFF Research Database (Denmark)

Nicolini, Franck E; Ibrahim, Amr R; Soverini, Simona

2013-01-01

The BCR-ABL T315I mutation confers resistance to currently licensed tyrosine kinase inhibitors in chronic myelogenous leukemia. However, the impact of this mutation on survival in early stages of disease, in chronic phase, has never been detailed. Using matched pair analysis, a cohort of 64...... patients with chronic phase chronic myelogenous leukemia harboring a T315I mutation and resistant to imatinib mesylate was compared to a similar cohort of 53 chronic phase patients resistant to imatinib, but with no detectable T315I mutation, in the pre-ponatinib era. These patients were matched according...... to age at diagnosis, interval between disease diagnosis and start of imatinib treatment, and duration of imatinib therapy. Kaplan-Meier survival analyses demonstrated the significant negative impact of the presence of the T315I mutation on overall survival (since imatinib-resistance: 48.4 months for T315...

De 'wraak van de geografie' volgens Robert D. Kaplan

NARCIS (Netherlands)

Mamadouh, V.

2013-01-01

De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor

Unsteady load on an oscillating Kaplan turbine runner

Science.gov (United States)

Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.

2013-02-01

A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.

CASAS: Cancer Survival Analysis Suite, a web based application.

Science.gov (United States)

Rupji, Manali; Zhang, Xinyan; Kowalski, Jeanne

2017-01-01

We present CASAS, a shiny R based tool for interactive survival analysis and visualization of results. The tool provides a web-based one stop shop to perform the following types of survival analysis:  quantile, landmark and competing risks, in addition to standard survival analysis.  The interface makes it easy to perform such survival analyses and obtain results using the interactive Kaplan-Meier and cumulative incidence plots.  Univariate analysis can be performed on one or several user specified variable(s) simultaneously, the results of which are displayed in a single table that includes log rank p-values and hazard ratios along with their significance. For several quantile survival analyses from multiple cancer types, a single summary grid is constructed. The CASAS package has been implemented in R and is available via http://shinygispa.winship.emory.edu/CASAS/. The developmental repository is available at https://github.com/manalirupji/CASAS/.

Numerical investigation of tip clearance cavitation in Kaplan runners

Science.gov (United States)

Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.

2016-11-01

There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.

Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines

Directory of Open Access Journals (Sweden)

Ana-Maria Budai

2010-10-01

Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.

C-reactive protein-to-albumin ratio is a predictor of hepatitis B virus related decompensated cirrhosis: time-dependent receiver operating characteristics and decision curve analysis.

Science.gov (United States)

Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing

2017-04-01

Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.

Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis

DEFF Research Database (Denmark)

Egeberg, Alexander; Skov, Lone; Zachariae, Claus

2018-01-01

It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....

Maternal smoking during pregnancy and the risk of pediatric cardiovascular diseases of the offspring: A population-based cohort study with up to 18-years of follow up.

Science.gov (United States)

Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal

2018-06-01

Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.

How Do Executive Functions Fit with the Cattell-Horn-Carroll Model? Some Evidence from a Joint Factor Analysis of the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities

Science.gov (United States)

Floyd, Randy G.; Bergeron, Renee; Hamilton, Gloria; Parra, Gilbert R.

2010-01-01

This study investigated the relations among executive functions and cognitive abilities through a joint exploratory factor analysis and joint confirmatory factor analysis of 25 test scores from the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities. Participants were 100 children and adolescents…

The development of a new algorithm to calculate a survival function in non-parametric ways

International Nuclear Information System (INIS)

Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo

2001-01-01

In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory

Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

International Nuclear Information System (INIS)

Ko, P; Kurosawa, S

2014-01-01

The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine

Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

Science.gov (United States)

Ko, P.; Kurosawa, S.

2014-03-01

The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.

Numerical Analysis of Flow in Kaplan Turbine Runner Blades Anticavitation Lip with Modified Hydro-dynamic Profile

Directory of Open Access Journals (Sweden)

Vasile Cojocaru

2011-09-01

Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.

Prognostic value of preoperative dynamic contrast-enhanced MRI perfusion parameters for high-grade glioma patients

Energy Technology Data Exchange (ETDEWEB)

Ulyte, Agne [Vilnius University, Faculty of Medicine, Vilnius (Lithuania); Katsaros, Vasileios K. [General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Advanced Imaging Modalities - CT and MRI, Athens (Greece); University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Liouta, Evangelia; Stranjalis, Georgios [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Boskos, Christos [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Radiation Oncology, Athens (Greece); Papanikolaou, Nickolas [Champalimaud Foundation, Department of Radiology, Centre for the Unknown, Lisbon (Portugal); Usinskiene, Jurgita [National Cancer Institute, Vilnius (Lithuania); Affidea Lietuva, Vilnius (Lithuania); Bisdas, Sotirios [University College London Hospitals, Department of Neuroradiology, The National Hospital for Neurology and Neurosurgery, London (United Kingdom)

2016-12-15

The prognostic value of the dynamic contrast-enhanced (DCE) MRI perfusion and its histogram analysis-derived metrics is not well established for high-grade glioma (HGG) patients. The aim of this prospective study was to investigate DCE perfusion transfer coefficient (K{sup trans}), vascular plasma volume fraction (v{sub p}), extracellular volume fraction (v{sub e}), reverse transfer constant (k{sub ep}), and initial area under gadolinium concentration time curve (IAUGC) as predictors of progression-free (PFS) and overall survival (OS) in HGG patients. Sixty-nine patients with suspected anaplastic astrocytoma or glioblastoma underwent preoperative DCE-MRI scans. DCE perfusion whole tumor region histogram parameters, clinical details, and PFS and OS data were obtained. Univariate, multivariate, and Kaplan-Meier survival analyses were conducted. Receiver operating characteristic (ROC) curve analysis was employed to identify perfusion parameters with the best differentiation performance. On univariate analysis, v{sub e} and skewness of v{sub p} had significant negative impacts, while k{sub ep} had significant positive impact on OS (P < 0.05). v{sub e} was also a negative predictor of PFS (P < 0.05). Patients with lower v{sub e} and IAUGC had longer median PFS and OS on Kaplan-Meier analysis (P < 0.05). K{sup trans} and v{sub e} could also differentiate grade III from IV gliomas (area under the curve 0.819 and 0.791, respectively). High v{sub e} is a consistent predictor of worse PFS and OS in HGG glioma patients. v{sub p} skewness and k{sub ep} are also predictive for OS. K{sup trans} and v{sub e} demonstrated the best diagnostic performance for differentiating grade III from IV gliomas. (orig.)

Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks

Directory of Open Access Journals (Sweden)

Camelia Jianu

2010-10-01

Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.

Primary Squamous Cell Carcinoma of the Thyroid: A Population-Based Analysis.

Science.gov (United States)

Au, Joshua K; Alonso, Jose; Kuan, Edward C; Arshi, Armin; St John, Maie A

2017-07-01

Objectives To analyze the epidemiology and describe the prognostic indicators of patients with primary squamous cell carcinoma of the thyroid. Study Design and Setting Retrospective cohort study based on a national database. Methods The US National Cancer Institute's SEER registry (Surveillance, Epidemiology, and End Results) was reviewed for patients with primary squamous cell carcinoma of the thyroid from 1973 to 2012. Study variables included age, sex, race, tumor size, tumor grade, regional and distant metastases, and treatment modality. Survival measures included overall survival (OS) and disease-specific survival (DSS). Results A total of 199 cases of primary squamous cell carcinoma of the thyroid were identified. Mean age at diagnosis was 68.1 years; 58.3% were female; and 79.4% were white. Following diagnosis, 46.3% of patients underwent surgery; 55.7%, radiation therapy; and 45.8%, surgery with radiation therapy. Kaplan-Meier analysis demonstrated OS and DSS of 16% and 21% at 5 years, respectively. Median survival after diagnosis was 9.1 months. Multivariate Cox regression analysis showed that predictors of OS and DSS included age ( P Squamous cell carcinoma of the thyroid is a rare malignancy with a very poor prognosis. Surgical resection confers an overall survival benefit. Age, tumor grade, and tumor size are predictors of OS and DSS.

Can a polynomial interpolation improve on the Kaplan-Yorke dimension?

International Nuclear Information System (INIS)

Richter, Hendrik

2008-01-01

The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems

Unsteady numerical simulation of the flow in the U9 Kaplan turbine model

International Nuclear Information System (INIS)

Javadi, Ardalan; Nilsson, Håkan

2014-01-01

The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation

Unsteady numerical simulation of the flow in the U9 Kaplan turbine model

Science.gov (United States)

Javadi, Ardalan; Nilsson, Håkan

2014-03-01

The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.

Adding gauge fields to Kaplan's fermions

International Nuclear Information System (INIS)

Blum, T.; Kaerkkaeinen, L.

1994-01-01

We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)

Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

NARCIS (Netherlands)

de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.

2012-01-01

MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex

Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

NARCIS (Netherlands)

de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.

2012-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This

Mathematical simulation of fluid flow and analysis of flow pattern in the flow path of low-head Kaplan turbine

Directory of Open Access Journals (Sweden)

A. V. Rusanov

2016-12-01

Full Text Available The results of numerical investigation of spatial flow of viscous incompressible fluid in flow part of Kaplan turbine PL20 Kremenchug HPP at optimum setting angle of runner blade φb = 15° and at maximum setting angle φb = 35° are shown. The flow simulation has been carried out on basis of numerical integration of the Reynolds equations with an additional term containing artificial compressibility. The differential two-parameter model of Menter (SST has been applied to take into account turbulent effects. Numerical integration of the equations is carried out using an implicit quasi-monotone Godunov type scheme of second - order accuracy in space and time. The calculations have been conducted with the help of the software system IPMFlow. The analysis of fluid flow in the flow part elements is shown and the values of hydraulic losses and local cavitation coefficient have been obtained. Comparison of calculated and experimental results has been carried out.

XRF and XANES Data for Kaplan U Paper

Science.gov (United States)

The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).

Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents

International Nuclear Information System (INIS)

Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.

2002-01-01

Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de

Calculating the dielectric anisotropy of nematic liquid crystals: a reinvestigation of the Maier–Meier theory

International Nuclear Information System (INIS)

Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan

2009-01-01

This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)

High Expression of PHGDH Predicts Poor Prognosis in Non–Small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Jinhong Zhu

2016-12-01

Full Text Available Tumors have exceptionally high demands for energy and anabolism because of their rapid growth. The de novo serine synthesis pathway initiated by phosphoglycerate dehydrogenase (PHGDH has been recognized as a hallmark of metabolic adaption in carcinogenesis. The oncogenic role and prognostic value of PHGDH have been investigated in multiple cancer types, including breast cancer, melanoma, cervical cancer, and colon cancer. Due to the importance of PHGDH in cancer, we attempted to determine the clinical significance of PHGDH in 319 patients with non–small cell lung cancer (NSCLC. We evaluated the mRNA and protein expression levels of PHGDH gene, using quantitative reverse transcriptase polymerase chain reaction and tissue array–based immunohistochemistry, respectively. Significantly increased PHGDH expression in mRNA and protein levels was identified in tumor tissues versus matched adjacent nontumor tissues. More interestingly, immunohistochemical expression of PHGDH was significantly associated with lymph node metastasis (P = .021 and TNM stage (P = .016. Kaplan-Meier survival analysis indicated that NSCLC patients with low levels of PHGDH outperformed patients with high levels of PHGDH regarding 5-year overall survival. Significantly longer survival in the former suggested the prognostic implication of PHGDH in NSCLC. Multivariate survival analysis using Cox regression model demonstrated that high PHGDH levels and advanced TNM stage (III + IV were independent predictors of prognosis in NSCLC. Moreover, bioinformatics analysis confirmed the increase in PHGDH transcripts (data from The Cancer Genome Atlas and its prognostic value (Kaplan-Meier plotter in NSCLC. In conclusion, this study suggested the clinical implication of PHGDH in NSCLC. PHGDH may be a promising therapeutic target in NSCLC.

Chemokine-like factor-like MARVEL transmembrane domain-containing 3 expression is associated with a favorable prognosis in esophageal squamous cell carcinoma.

Science.gov (United States)

Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin

2017-05-01

Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic

Lenalidomide-induced myelosuppression is associated with renal dysfunction: adverse events evaluation of treatment-naïve patients undergoing front-line lenalidomide and dexamethasone therapy.

Science.gov (United States)

Niesvizky, Ruben; Naib, Tara; Christos, Paul J; Jayabalan, David; Furst, Jessica R; Jalbrzikowski, Jessica; Zafar, Faiza; Mark, Tomer; Lent, Richard; Pearse, Roger N; Ely, Scott; Leonard, John P; Mazumdar, Madhu; Chen-Kiang, Selina; Coleman, Morton

2007-09-01

Data on 72 patients receiving lenalidomide/dexamethasone for multiple myeloma (MM) was used to determine the factors that are associated with lenalidomide-induced myelosuppression. Eight of 14 patients with grade > or =3 myelosuppression had baseline creatinine clearance (CrCl) < or =0.67 ml/s. Kaplan-Meier analysis by log-rank test demonstrated a significant association (P < 0.0001) between renal insufficiency and time to myelosuppression (hazard ratio = 8.4; 95% confidence interval 2.9-24.7, P = 0.0001). Therefore, CrCl is inversely associated with significant myelosuppression. Caution should be exercised when lenalidomide therapy is commenced and CrCl should be incorporated as a determinant of the initial dosing of lenalidomide in MM patients.

Natural history definition and a suggested clinical approach to Buerger's disease: a case-control study with survival analysis.

Science.gov (United States)

Fazeli, Bahare; Ravari, Hassan; Assadi, Reza

2012-08-01

The aim of this study was first to describe the natural history of Buerger's disease (BD) and then to discuss a clinical approach to this disease based on multivariate analysis. One hundred eight patients who corresponded with Shionoya's criteria were selected from 2000 to 2007 for this study. Major amputation was considered the ultimate adverse event. Survival analyses were performed by Kaplan-Meier curves. Independent variables including gender, duration of smoking, number of cigarettes smoked per day, minor amputation events and type of treatments, were determined by multivariate Cox regression analysis. The recorded data demonstrated that BD may present in four forms, including relapsing-remitting (75%), secondary progressive (4.6%), primary progressive (14.2%) and benign BD (6.2%). Most of the amputations occurred due to relapses within the six years after diagnosis of BD. In multivariate analysis, duration of smoking of more than 20 years had a significant relationship with further major amputation among patients with BD. Smoking cessation programs with experienced psychotherapists are strongly recommended for those areas in which Buerger's disease is common. Patients who have smoked for more than 20 years should be encouraged to quit smoking, but should also be recommended for more advanced treatment for limb salvage.

Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

OpenAIRE

Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

2009-01-01

Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...

Mixture models for undiagnosed prevalent disease and interval-censored incident disease: applications to a cohort assembled from electronic health records.

Science.gov (United States)

Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A

2017-09-30

For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

Modelos estimados de análisis de supervivencia para el tiempo de permanencia de los estudiantes de la Universidad Francisco de Paula Santander

OpenAIRE

Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón

2016-01-01

The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...

High serum uric acid concentration predicts poor survival in patients with breast cancer.

Science.gov (United States)

Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min

2017-10-01

Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Two-year survival analysis of twisted wire fixed retainer versus spiral wire and fiber-reinforced composite retainers: a preliminary explorative single-blind randomized clinical trial.

Science.gov (United States)

Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa

2016-03-01

Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.

Pressure pulsation in Kaplan turbines: Prototype-CFD comparison

International Nuclear Information System (INIS)

Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F

2012-01-01

Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.

Pressure pulsation in Kaplan turbines: Prototype-CFD comparison

Science.gov (United States)

Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.

2012-11-01

Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.

Initial high anti-emetic efficacy of granisetron with dexamethasone is not maintained over repeated cycles.

Science.gov (United States)

de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.

1998-01-01

We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766

Large mass limit of the continuum theories in Kaplan's formulation

International Nuclear Information System (INIS)

Kawano, T.; Kikukawa, Y.

1994-01-01

Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense

Safety, tolerability, and initial efficacy of AZD6140, the first reversible oral adenosine diphosphate receptor antagonist, compared with clopidogrel, in patients with non-ST-segment elevation acute coronary syndrome: primary results of the DISPERSE-2 trial

DEFF Research Database (Denmark)

Cannon, Christopher P; Husted, Steen; Harrington, Robert A

2007-01-01

, or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...

Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease

Directory of Open Access Journals (Sweden)

Rabah M. Shawky

2014-10-01

Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.

Air injection test on a Kaplan turbine: prototype - model comparison

Science.gov (United States)

Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.

2016-11-01

Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.

Repair of a Kaplan blade sealing surface without dismantling the turbine; Instandsetzung einer Kaplanschaufel-Dichtflaeche ohne Turbinendemontage

Energy Technology Data Exchange (ETDEWEB)

Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)

2008-07-01

In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)

Prospective Randomized Trial Comparing Efficacy of Topical Loteprednol Etabonate 0.5% Versus Cyclosporine-A 0.05% for Treatment of Dry Eye Syndrome Following Hematopoietic Stem Cell Transplantation.

Science.gov (United States)

Boynton, Grace E; Raoof, Duna; Niziol, Leslie M; Hussain, Munira; Mian, Shahzad I

2015-07-01

To evaluate the safety and efficacy of topical loteprednol etabonate (LE) 0.5% compared with cyclosporine A (CsA) 0.05% for the prophylaxis and treatment of dry eye syndrome (DES) after hematopoietic stem cell transplantation (HSCT). Seventy-five patients were randomized to LE (n = 76 eyes of 38 patients) or CsA (n = 74 eyes of 37 patients) pre-HSCT. Lissamine green and fluorescein staining, tear break-up time, tear osmolarity (Osm), Schirmer score (Sch), intraocular pressure, visual acuity, and Ocular Surface Disease Index were assessed pre-HSCT, 3, 6, 9, and 12 months post-HSCT. There were no differences in DES incidence (P = 0.22; log-rank test) or progression (P = 0.41; log-rank test) between the 2 treatment arms during the course of the study. Among eyes with no DES at enrollment, the Kaplan-Meier analysis yielded a 90% rate of DES development in cyclosporine-treated eyes and a 79% rate of DES development in LE-treated eyes by 12 months post-HSCT. The Kaplan-Meier analysis of eyes with DES at enrollment demonstrated a 38% rate of disease progression among cyclosporine-treated eyes and a 26% rate of disease progression among loteprednol-treated eyes by 12 months. No patient in either group had an elevation of 10 mm Hg or greater from baseline at any study visit, and no patients had their treatment discontinued for elevation in intraocular pressure. Pre-HSCT initiation of LE 0.5% appears to be safe and may be as effective as CsA 0.5% for the treatment and prophylaxis of DES following HSCT.

Cost-utility analysis of adjuvant goserelin (Zoladex and adjuvant chemotherapy in premenopausal women with breast cancer

Directory of Open Access Journals (Sweden)

Cheng Tsui

2012-01-01

Full Text Available Abstract Background Increased health care costs have made it incumbent on health-care facilities and physicians to demonstrate both clinical and cost efficacy when recommending treatments. Though studies have examined the cost-effectiveness of adjuvant goserelin with radiotherapy for locally advanced prostate cancer, few have compared the cost-effectiveness of adjuvant goserelin to adjuvant chemotherapy alone in premenopausal breast cancer. Methods In this retrospective study at one hospital, the records of 152 patients with stage Ia to IIIa ER + breast cancer who received goserelin or chemotherapy were reviewed. Survival analysis was assessed by the Kaplan-Meier method. Patients were interviewed to evaluate their quality of life using the European Organization for Research and Treatment Quality of Life questionnaire (EORTC-QLQ-C30, version 4.0, and to obtain the utility value by the standard gamble (SG and visual scale (VS methods. Total medical cost was assessed from the (National Health Insurance NHI payer's perspective. Results Survival at 11 years was significantly better in the groserelin group (P Conclusions Goserelin therapy results in better survival and higher utility-weighted life-years, and is more cost-effective than TC or TEC chemotherapy.

Preclinical demonstration of synergistic Active Nutrients/Drug (AND combination as a potential treatment for malignant pleural mesothelioma.

Directory of Open Access Journals (Sweden)

Viviana Volta

Full Text Available Malignant pleural mesothelioma (MPM is a poor prognosis disease lacking adequate therapy. We have previously shown that ascorbic acid administration is toxic to MPM cells. Here we evaluated a new combined therapy consisting of ascorbate/epigallocatechin-3-gallate/gemcitabine mixture (called AND, for Active Nutrients/Drug. In vitro effects of AND therapy on various MPM cell lines revealed a synergistic cytotoxic mechanism. In vivo experiments on a xenograft mouse model for MPM, obtained by REN cells injection in immunocompromised mice, showed that AND strongly reduced the size of primary tumor as well as the number and size of metastases, and prevented abdominal hemorrhage. Kaplan Meier curves and the log-rank test indicated a marked increase in the survival of AND-treated animals. Histochemical analysis of dissected tumors showed that AND induced a shift from cell proliferation to apoptosis in cancer cells. Lysates of tumors from AND-treated mice, analyzed with an antibody array, revealed decreased TIMP-1 and -2 expressions and no effects on angiogenesis regulating factors. Multiplex analysis for signaling protein phosphorylation exhibited inactivation of cell proliferation pathways. The complex of data showed that the AND treatment is synergistic in vitro on MPM cells, and blocks in vivo tumor progression and metastasization in REN-based xenografts. Hence, the AND combination is proposed as a new treatment for MPM.

Tetranectin positive expression in tumour tissue leads to longer survival in Danish women with ovarian cancer. Results from the 'Malova' ovarian cancer study

DEFF Research Database (Denmark)

Heeran, Mel C; Rask, Lene; Høgdall, Claus K

2015-01-01

of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...

Cetuximab Concomitant with Second-Line Radiation Therapy in Patients with Locally Advanced Recurrent Squamous Cell Head and Neck Cancer

Directory of Open Access Journals (Sweden)

Muge Akmansu

2010-12-01

Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.

Outcomes analysis in 100 liver transplantation patients.

Science.gov (United States)

Geevarghese, S K; Bradley, A E; Wright, J K; Chapman, W C; Feurer, I; Payne, J L; Hunter, E B; Pinson, C W

1998-05-01

There is an increasing demand for outcomes analysis, including quality of life and financial analysis, following medical interventions and surgical procedures. We analyzed outcomes for 100 consecutive patients undergoing liver transplantation during a period of case management revision. Patient survival was calculated by Kaplan-Meier actuarial methods. The Karnofsky performance status was objectively assessed for surviving patients up to 6 years after transplantation and was evaluated by repeated measures analysis of variance and covariance. Subjective evaluation of quality of life over time was obtained using the Psychosocial Adjustment to Illness Scale. The correlations between time and scale were calculated. Financial data were accumulated from billing records. Six-month, 1-year, 2-year, and 3- through 5-year survival was 86%, 84%, 83%, and 78%, respectively. Karnofsky performance status confirmed poor functional status preoperatively with a mean of 53 +/- 2, but significantly improving to 72 +/- 2 at 3 months, 80 +/- 2 at 6 months, 90 +/- 1 at 1 year, 92 +/- 1 at 2 years, 94 +/- 1 at 3 years, 96 +/- 1 at 4 years, and 97 +/- 1 at 5 years (P <0.001). Psychosocial Adjustment to Illness Scale scores demonstrated significant improvement following transplantation overall (r = -0.33), improving most in sexual relationships (r = -0.41), and domestic environment (r = -0.35; P <0.001). Median length of stay for the first half of the patients was 19 days declining to 11 days for the second half. Median hospital charges declined from $105,000 to $90,000. Quality of life parameters assessed both by care givers (Karnofsky) and by patients (Psychosocial Adjustment to Illness Scale) improved dramatically following transplantation and over time, demonstrating that liver transplantation effectively restores a good quality of life. Outcomes can be improved while reducing length of stay and charges through modifications in case management.

The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

Science.gov (United States)

2014-03-01

8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

Left ventricular dyssynchrony assessed by gated SPECT phase analysis is an independent predictor of death in patients with advanced coronary artery disease and reduced left ventricular function not undergoing cardiac resynchronization therapy

Energy Technology Data Exchange (ETDEWEB)

Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)

2012-10-15

Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)

Assessing the effect of quantitative and qualitative predictors on gastric cancer individuals survival using hierarchical artificial neural network models.

Science.gov (United States)

Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat

2013-01-01

There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer

Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

Science.gov (United States)

Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

2011-12-01

To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].

Science.gov (United States)

Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing

2016-02-01

To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.

Factors Affecting the Recurrence of Giant Cell Tumor of Bone After Surgery: A Clinicopathological Study of 80 Cases from a Single Center

Directory of Open Access Journals (Sweden)

Dong-dong Cheng

2015-07-01

Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.

TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier

Index Scriptorium Estoniae

Tursk, Eda

2004-01-01

Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan

Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies

International Nuclear Information System (INIS)

Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.

2007-01-01

Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients

The Association of Individual and Regional Socioeconomic Status on Initial Peritonitis and Outcomes in Peritoneal Dialysis Patients: A Propensity Score-Matched Cohort Study.

Science.gov (United States)

Wang, Qin; Hu, Ke-Jie; Ren, Ye-Ping; Dong, Jie; Han, Qing-Feng; Zhu, Tong-Ying; Chen, Jiang-Hua; Zhao, Hui-Ping; Chen, Meng-Hua; Xu, Rong; Wang, Yue; Hao, Chuan-Ming; Zhang, Xiao-Hui; Wang, Mei; Tian, Na; Wang, Hai-Yan

2016-01-01

♦ Research indicates that the socioeconomic status (SES) of individuals and the area where they live are related to initial peritonitis and outcomes in peritoneal dialysis (PD). We conducted a retrospective, multi-center cohort study in China to examine these associations. ♦ Data on 2,171 PD patients were collected from 7 centers, including baseline demographic, socioeconomic, and laboratory data. We explored the potential risk factors for initial peritonitis and outcomes using univariate Cox regression and unadjusted binary logistic regression. Then, we used propensity score matching to balance statistically significant risk factors for initial peritonitis and outcomes, and Kaplan-Meier survival analysis to compare differences in peritonitis-free rates between different groups of participants after matching. ♦ A total of 563 (25.9%) initial episodes of peritonitis occurred during the study period. The Kaplan-Meier peritonitis-free rate curve showed high-income patients had a significantly lower risk than low-income patients (p = 0.007) after matching for age, hemoglobin, albumin, and regional SES and PD center. The risk of treatment failure was significantly lower in the high-income than the low-income group after matching for the organism causing peritonitis and PD center: odds ratio (OR) = 0.27 (0.09 - 0.80, p = 0.018). Regional SES and education were not associated with initial peritonitis and outcomes. ♦ Our study demonstrates low individual income is a risk factor for the initial onset of peritonitis and treatment failure after initial peritonitis. Copyright © 2016 International Society for Peritoneal Dialysis.

Satisfactory Results of the Exeter Revision Femoral Stem Used for Primary Total Hip Arthroplasty.

Science.gov (United States)

Desy, Nicholas M; Johnson, Joshua D; Sierra, Rafael J

2017-02-01

The Exeter cemented femoral stem has demonstrated excellent clinical and radiographic outcomes as well as long-term survivorship free from aseptic loosening. A shorter revision stem (125 mm) with a 44 offset became available for the purpose of cement-in-cement revision situations. In certain cases, this shorter revision stem may be used for various primary total hip arthroplasties (THAs) where the standard length stem would require distally reaming the femoral canal. We sought to report on the early to midterm results of this specific stem when used for primary THA regarding (1) clinical and radiographic outcomes, (2) complications, and (3) survivorship. Twenty-nine patients (33 hips) underwent a hybrid THA using the smaller revision Exeter cemented femoral stem. Twenty-five patients (28 hips) had at least 2 years of follow-up and were assessed for clinical and radiographic outcomes. All 33 hips were included in the analysis of complications and survivorship. The Kaplan-Meier survivorship was performed using revision for all causes and for aseptic loosening as the end points. The average clinical follow-up was 4 years (range, 2-7). Harris Hip Scores improved from a mean preoperative value of 56 (range, 23-96) to 90 (range, 51-100) at the latest follow-up. All patients demonstrated superior cement mantles with no signs of loosening. One patient suffered a B2 periprosthetic fracture and 1 patient experienced 2 episodes of instability. The 5-year Kaplan-Meier survivorship was 96.7% for all causes of revision and was 100% using aseptic loosening as the end point. The shorter Exeter revision cemented femoral stem has favorable early to midterm clinical and radiographic outcomes when used for primary THA with a low complication rate and is a viable option in patients with narrow femoral canals where uncemented stem fixation is not desired. Copyright © 2016 Elsevier Inc. All rights reserved.

Going Large or Going Small in Plant Design: Comparison between a P.P. with three small Kaplan turbines and a P.P. with just one Large Kaplan turbine

Science.gov (United States)

Castro-Otero, C.

2017-04-01

Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.

Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

International Nuclear Information System (INIS)

Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao

2017-01-01

The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.

Directory of Open Access Journals (Sweden)

Jeban Ganesalingam

2009-09-01

Full Text Available Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes.Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method.The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001.The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.

The comparative analysis of the current-meter method and the pressure-time method used for discharge measurements in the Kaplan turbine penstocks

Science.gov (United States)

Adamkowski, A.; Krzemianowski, Z.

2012-11-01

The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.

The comparative analysis of the current-meter method and the pressure-time method used for discharge measurements in the Kaplan turbine penstocks

International Nuclear Information System (INIS)

Adamkowski, A; Krzemianowski, Z

2012-01-01

The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.

Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study

DEFF Research Database (Denmark)

Kammersgaard, Lars Peter; Olsen, Tom Skyhøj

2005-01-01

population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...

Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study

DEFF Research Database (Denmark)

Kammersgaard, Lars Peter; Olsen, Tom Skyhøj

2005-01-01

population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...

Survival analysis of heart failure patients: A case study.

Science.gov (United States)

Ahmad, Tanvir; Munir, Assia; Bhatti, Sajjad Haider; Aftab, Muhammad; Raza, Muhammad Ali

2017-01-01

This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015). All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.

Correlations of Hemoglobin Level and Perioperative Blood Transfusion with the Prognosis of Gastric Cancer: A Retrospective Study.

Science.gov (United States)

Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng

2017-05-23

BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.

Protective effect of Asparagus racemosus root extract against lethal total - body electron beam radiation induced damage in Swiss albino mice

International Nuclear Information System (INIS)

Sharmila, K.P.; Bhandary, B. Satheesh Kumar; Suchetha Kumari, N.; Bhat, Vadish S.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.; Fernandes, Ronald

2016-01-01

To investigate the protective effect of Asparagus Racemosus Root ethanolic extract (ARE) in Swiss albino mice against acute lethal total - body Electron beam irradiation. Swiss Albino mice were used for the assessment of radiation induced sickness and 30 day survival analysis. Survival studies were determined using the Kaplan-Meier survival curves. The maximum survival was observed in the experimental mice pretreated with 200 mg/kg.b.wt. of ARE which also reduced the radiation sickness characteristics. This dose was considered as an optimal dose for radioprotection. Treatment of mice with ARE before irradiation delayed the onset of mortality as compared with the untreated irradiated controls. Present findings demonstrate the potential of ARE in mitigating radiation-induced mortality, which may be attributed to its free radical scavenging and increased antioxidant potential

Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage

OpenAIRE

Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung

2014-01-01

In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...

Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer

DEFF Research Database (Denmark)

Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim

2017-01-01

OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...

Nested Cohort - R software package

Science.gov (United States)

NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.

Cementless One-Stage Revision in Chronic Periprosthetic Hip Joint Infection. Ninety-One Percent Infection Free Survival in 56 Patients at Minimum 2-Year Follow-Up

DEFF Research Database (Denmark)

Lange, Jeppe; Troelsen, Anders; Solgaard, Søren

2018-01-01

was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...

Sequential alternating deferiprone and deferoxamine treatment compared to deferiprone monotherapy: main findings and clinical follow-up of a large multicenter randomized clinical trial in -thalassemia major patients

DEFF Research Database (Denmark)

Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela

2011-01-01

In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...

Efficacy of qualitative response assessment interpretation criteria at 18F-FDG PET-CT for predicting outcome in locally advanced cervical carcinoma treated with chemoradiotherapy

International Nuclear Information System (INIS)

Scarsbrook, Andrew; Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag; Swift, Sarah; Cooper, Rachel

2017-01-01

To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced

Efficacy of qualitative response assessment interpretation criteria at 18F-FDG PET-CT for predicting outcome in locally advanced cervical carcinoma treated with chemoradiotherapy

Energy Technology Data Exchange (ETDEWEB)

Scarsbrook, Andrew [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); University of Leeds, Leeds Institute of Cancer and Pathology, Leeds (United Kingdom); Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); Swift, Sarah [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Cooper, Rachel [Leeds Teaching Hospitals NHS Trust, Department of Clinical Oncology, Leeds (United Kingdom)

2017-04-15

To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced

Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response : Patrick Meier, 2015, CRC Press (Boca Raton, FL, 978-1-4822-4839-5, 259 pp.).

Science.gov (United States)

Dave, Anushree

2017-12-01

This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.

IMP3 expression in human ovarian cancer is associated with improved survival

DEFF Research Database (Denmark)

Noske, Aurelia; Faggad, Areeg; Wirtz, Ralph

2009-01-01

The insulin-like growth factor-II mRNA-binding protein IMP3 plays an important role in embryogenesis and recent reports suggest an involvement in tumorigenesis. Although IMP3 expression has been well studied in mouse and human fetal and adult gonads, its role in ovarian cancer is unknown. We...... investigated the expression of IMP3 at protein and mRNA levels in a cohort of primary ovarian carcinomas and in 11 ovarian cancer cell lines. Western blot analysis revealed an expression of IMP3 in all ovarian cancer cell lines and immunohistochemistry demonstrated a positive cytoplasmic staining in 32 of 68...... carcinomas (47%). In contrast, epithelium of borderline tumors, as well as, benign ovarian lesions and normal ovaries exhibited only weak or no IMP3 expression. In univariate Kaplan-Meier analysis, IMP3 protein expression was significantly associated with better overall survival (P=0.048). To confirm...

The Educational Philosophies of Mordecai Kaplan and Michael Rosenak: Surprising Similarities and Illuminating Differences

Science.gov (United States)

Schein, Jeffrey; Caplan, Eric

2014-01-01

The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…

ORIGINAL ARTICLES Antiretroviral treatment for children

African Journals Online (AJOL)

Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.

Phosphorylation of ETS-1 is a critical event in DNA polymerase iota-induced invasion and metastasis of esophageal squamous cell carcinoma.

Science.gov (United States)

He, Chao; Wu, Shuhua; Gao, Aidi; Su, Ye; Min, Han; Shang, Zeng-Fu; Wu, Jinchang; Yang, Li; Ding, Wei-Qun; Zhou, Jundong

2017-12-01

An aberrantly elevated expression of DNA polymerase ι (Pol ι) is significantly associated with poor prognosis of patients with esophageal squamous cell carcinoma (ESCC), yet the mechanisms behind this phenomenon remain obscure. Based on the RNA-Seq transcriptome and real-time PCR analysis, we identified ETS-1 as a candidate gene involved in Pol ι-mediated progression of ESCC. Wound-healing and transwell assay indicated that downregulation of ETS-1 attenuates Pol ι-mediated invasiveness of ESCC. Signaling pathway analysis showed that Pol ι enhances ETS-1 phosphorylation at threonine-38 through the Erk signaling pathway in ESCC cells. Kaplan-Meier analysis, based on 93 clinical tissue samples, revealed that ETS-1 phosphorylation at threonine-38 is associated with poor prognosis of ESCC patients. The present study thus demonstrates that phosphorylation of ETS-1 is a critical event in the Pol ι-induced invasion and metastasis of ESCC. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Prognostic significance of hemoglobin level in patients with congestive heart failure and normal ejection fraction.

Science.gov (United States)

Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G

2006-10-01

Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.

Fatigue Analysis of the Piston Rod in a Kaplan Turbine Based on Crack Propagation under Unsteady Hydraulic Loads

International Nuclear Information System (INIS)

Liu, X; Luo, Y Y; Wang, Z W

2014-01-01

As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption

Fatigue Analysis of the Piston Rod in a Kaplan Turbine Based on Crack Propagation under Unsteady Hydraulic Loads

Science.gov (United States)

Liu, X.; Y Luo, Y.; Wang, Z. W.

2014-03-01

As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption.

Comparison of colorectal and gastric cancer: Survival and prognostic factors

International Nuclear Information System (INIS)

Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R

2009-01-01

Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)

Glycolytic activity in breast cancer using 18F-FDG PET/CT as prognostic predictor: A molecular phenotype approach.

Science.gov (United States)

Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V

2016-01-01

To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.

Adjacent segment pathology following anterior decompression and fusion using cage and plate for the treatment of degenerative cervical spinal diseases.

Science.gov (United States)

Song, Kyung-Jin; Choi, Byung-Wan; Kim, Jong-Kil

2014-12-01

Retrospective study. To analyze the incidence and prevalence of clinical adjacent segment pathology (CASP) following anterior decompression and fusion with cage and plate augmentation for degenerative cervical diseases. No long-term data on the use of cage and plate augmentation have been reported. The study population consisted of 231 patients who underwent anterior cervical discectomy and fusion (ACDF) with cage and plate for degenerative cervical spinal disease. The incidence and prevalence of CASP was determined by using the Kaplan-Meier survival analysis. To analyze the factors that influence CASP, data on preoperative and postoperative sagittal alignment, spinal canal diameter, the distance between the plate and adjacent disc, extent of fusion level, and the presence or absence of adjacent segment degenerative changes by imaging studies were evaluated. CASP occurred in 15 of the cases, of which 9 required additional surgery. At 8-year follow-up, the average yearly incidence was 1.1%. The rate of disease-free survival based on Kaplan-Meier survival analysis was 93.6% at 5 years and 90.2% at 8 years. No statistically significant differences in CASP incidence based on radiological analysis were observed. Significantly high incidence of CASP was observed in the presence of increased adjacent segment degenerative changes (pdegenerative cervical disease is associated with a lower incidence in CSAP by 1.1% per year, and the extent of preoperative adjacent segment degenerative changes has been shown as a risk factor for CASP.

The preoperative plasma fibrinogen level is an independent prognostic factor for overall survival of breast cancer patients who underwent surgical treatment.

Science.gov (United States)

Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming

2015-12-01

Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

Energy Technology Data Exchange (ETDEWEB)

Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)

2017-03-15

The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

High Rab27A expression indicates favorable prognosis in CRC.

Science.gov (United States)

Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng

2015-06-13

Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.

Retrospective analysis of dental implants placed and restored by advanced prosthodontic residents.

Science.gov (United States)

Barias, Pamela A; Lee, Damian J; Yuan, Judy Chia-Chun; Sukotjo, Cortino; Campbell, Stephen D; Knoernschild, Kent L

2013-02-01

The purposes of this retrospective clinical review were to: (1) describe the demographics of implant patients, types of implant treatment and implant-supported prostheses in an Advanced Education in Prosthodontic Program, (2) evaluate the survival rate of dental implants placed by prosthodontic residents from 2006 to 2008, and (3) analyze the relationship between resident year of training and implant survival rate. All patients who received dental implants placed by prosthodontic residents from January 2006 to October of 2008 in the Advanced Prosthodontic Program at the University of Illinois at Chicago College of Dentistry were selected for this study. Age, gender, implant diameter, length, implant locations, surgical and restorative detail, and year of prosthodontic residency training were collected and analyzed. Life-table and Kaplan-Meier survival analyses were performed based on implants overall, locations, year of training, and use of a computer-generated surgical guide. A Logrank statistic was performed between implant survival and year of prosthodontic residency training, location, and use of computer-generated surgical guide (α= 0.05). Three hundred and six implants were placed, and of these, seven failed. Life-table and Kaplan-Meier analyses computed a cumulative survival rate (CSR) of 97% for overall implants and implants placed with a computer-generated surgical guide. No statistical difference was found in implant survival rates as a function of year of training (P= 0.85). Dental implants placed by prosthodontic residents had a CSR comparable to previously published studies by other specialties. The year of prosthodontic residency training and implant failure rate did not have any significant relationship. © 2012 by the American College of Prosthodontists.

Application of the standard lymphadenectomy in gastric adenocarcinoma

International Nuclear Information System (INIS)

Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro

2011-01-01

The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined

Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

International Nuclear Information System (INIS)

Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho

2010-01-01

We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate

Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

Energy Technology Data Exchange (ETDEWEB)

Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)

2010-08-15

We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.

Increased Transfusion of Fresh Frozen Plasma is Associated with Mortality or Worse Functional Outcomes After Severe Traumatic Brain Injury: A Retrospective Study.

Science.gov (United States)

Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao

2017-08-01

The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.

Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study

DEFF Research Database (Denmark)

Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars

2015-01-01

patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...

Association of versican turnover with all-cause mortality in patients on haemodialysis

DEFF Research Database (Denmark)

Genovese, Federica; Karsdal, Morten A; Leeming, Diana J

2014-01-01

with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...

Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy

International Nuclear Information System (INIS)

Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.

2000-01-01

Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de

The prognostic value of the suPARnosticTM ELISA assay in HIV-1 infected individuals is not affected by uPAR promoter polymorphisms

DEFF Research Database (Denmark)

Schneider, Uffe; Nielsen, Rikke; Pedersen, Court

2007-01-01

. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...

Hypofractionated radiation therapy for invasive thyroid carcinoma in dogs: a retrospective analysis of survival

International Nuclear Information System (INIS)

Brearley, M.J.; Hayes, A.M.; Murphy, S.

1999-01-01

Thirteen dogs with invasive thyroid carcinoma (WHO classification T2b or T3b) seen between January 1991 and October 1997 were treated by external beam Irradiation. Four once-weekly fractions of 9 gray of 4 MeV X-rays were administered. Four of the dogs died of progression of the primary disease and four from metastatic spread. Of the remaining dogs, three died of unrelated problems, although two were still alive at the time of the censor. Kaplan-Meier analysis of the survival time from first dose to death from either primary or metastatic disease gave a median survival time of 96 weeks (mean 85 weeks, range six to 247 weeks). Radiographic evidence of pulmonary metastatic disease at presentation had no prognostic value whereas crude growth rate was a highly significant factor. The present series Indicates that radiation therapy should be considered an important modality for the control of invasive thyroid carcinoma in the dog

Brachytherapy Improves Biochemical Failure–Free Survival in Low- and Intermediate-Risk Prostate Cancer Compared With Conventionally Fractionated External Beam Radiation Therapy: A Propensity Score Matched Analysis

International Nuclear Information System (INIS)

Smith, Graham D.; Pickles, Tom; Crook, Juanita; Martin, Andre-Guy; Vigneault, Eric; Cury, Fabio L.; Morris, Jim; Catton, Charles; Lukka, Himu; Warner, Andrew; Yang, Ying; Rodrigues, George

2015-01-01

Purpose: To compare, in a retrospective study, biochemical failure-free survival (bFFS) and overall survival (OS) in low-risk and intermediate-risk prostate cancer patients who received brachytherapy (BT) (either low-dose-rate brachytherapy [LDR-BT] or high-dose-rate brachytherapy with external beam radiation therapy [HDR-BT+EBRT]) versus external beam radiation therapy (EBRT) alone. Methods and Materials: Patient data were obtained from the ProCaRS database, which contains 7974 prostate cancer patients treated with primary radiation therapy at four Canadian cancer institutions from 1994 to 2010. Propensity score matching was used to obtain the following 3 matched cohorts with balanced baseline prognostic factors: (1) low-risk LDR-BT versus EBRT; (2) intermediate-risk LDR-BT versus EBRT; and (3) intermediate-risk HDR-BT+EBRT versus EBRT. Kaplan-Meier survival analysis was performed to compare differences in bFFS (primary endpoint) and OS in the 3 matched groups. Results: Propensity score matching created acceptable balance in the baseline prognostic factors in all matches. Final matches included 2 1:1 matches in the intermediate-risk cohorts, LDR-BT versus EBRT (total n=254) and HDR-BT+EBRT versus EBRT (total n=388), and one 4:1 match in the low-risk cohort (LDR-BT:EBRT, total n=400). Median follow-up ranged from 2.7 to 7.3 years for the 3 matched cohorts. Kaplan-Meier survival analysis showed that all BT treatment options were associated with statistically significant improvements in bFFS when compared with EBRT in all cohorts (intermediate-risk EBRT vs LDR-BT hazard ratio [HR] 4.58, P=.001; intermediate-risk EBRT vs HDR-BT+EBRT HR 2.08, P=.007; low-risk EBRT vs LDR-BT HR 2.90, P=.004). No significant difference in OS was found in all comparisons (intermediate-risk EBRT vs LDR-BT HR 1.27, P=.687; intermediate-risk EBRT vs HDR-BT+EBRT HR 1.55, P=.470; low-risk LDR-BT vs EBRT HR 1.41, P=.500). Conclusions: Propensity score matched analysis showed that BT options led

Risk analysis for autonomous underwater vehicle operations in extreme environments.

Science.gov (United States)

Brito, Mario Paulo; Griffiths, Gwyn; Challenor, Peter

2010-12-01

Autonomous underwater vehicles (AUVs) are used increasingly to explore hazardous marine environments. Risk assessment for such complex systems is based on subjective judgment and expert knowledge as much as on hard statistics. Here, we describe the use of a risk management process tailored to AUV operations, the implementation of which requires the elicitation of expert judgment. We conducted a formal judgment elicitation process where eight world experts in AUV design and operation were asked to assign a probability of AUV loss given the emergence of each fault or incident from the vehicle's life history of 63 faults and incidents. After discussing methods of aggregation and analysis, we show how the aggregated risk estimates obtained from the expert judgments were used to create a risk model. To estimate AUV survival with mission distance, we adopted a statistical survival function based on the nonparametric Kaplan-Meier estimator. We present theoretical formulations for the estimator, its variance, and confidence limits. We also present a numerical example where the approach is applied to estimate the probability that the Autosub3 AUV would survive a set of missions under Pine Island Glacier, Antarctica in January-March 2009. © 2010 Society for Risk Analysis.

Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines

Energy Technology Data Exchange (ETDEWEB)

Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)

2015-10-01

Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.

Survival analysis of heart failure patients: A case study.

Directory of Open Access Journals (Sweden)

Tanvir Ahmad

Full Text Available This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015. All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.

Modelling the survivorship of Nigeria children in their first 10 years of ...

African Journals Online (AJOL)

Fagbamigbe

Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...

Duration of clopidogrel treatment and risk of mortality and recurrent myocardial infarction among 11 680 patients with myocardial infarction treated with percutaneous coronary intervention: a cohort study

Directory of Open Access Journals (Sweden)

Køber Lars

2010-01-01

Full Text Available Abstract Background The optimal duration of clopidogrel treatment after percutaneous coronary intervention (PCI is unclear. We studied the risk of death or recurrent myocardial infarction (MI in relation to 6- and 12-months clopidogrel treatment among MI patients treated with PCI. Methods Using nationwide registers of hospitalizations and drug dispensing from pharmacies we identified 11 680 patients admitted with MI, treated with PCI and clopidogrel. Clopidogrel treatment was categorized in a 6-months and a 12-months regimen. Rates of death, recurrent MI or a combination of both were analyzed by the Kaplan Meier method and Cox proportional hazards models. Bleedings were compared between treatment regimens. Results The Kaplan Meier analysis indicated no benefit of the 12-months regimen compared with the 6-months in all endpoints. The Cox proportional hazards analysis confirmed these findings with hazard ratios for the 12-months regimen (the 6-months regimen used as reference for the composite endpoint of 1.01 (confidence intervals 0.81-1.26 and 1.24 (confidence intervals 0.95-1.62 for Day 0-179 and Day 180-540 after discharge. Bleedings occurred in 3.5% and 4.1% of the patients in the 6-months and 12-months regimen (p = 0.06. Conclusions We found comparable rates of death and recurrent MI in patients treated with 6- and 12-months' clopidogrel. The potential benefit of prolonged clopidogrel treatment in a real-life setting remains uncertain.

Analysis of a novel protocol of combined induction chemotherapy and concurrent chemoradiation in unresected non-small-cell lung cancer: a ten-year experience with vinblastine, Cisplatin, and radiation therapy.

Science.gov (United States)

Waters, Eugenie; Dingle, Brian; Rodrigues, George; Vincent, Mark; Ash, Robert; Dar, Rashid; Inculet, Richard; Kocha, Walter; Malthaner, Richard; Sanatani, Michael; Stitt, Larry; Yaremko, Brian; Younus, Jawaid; Yu, Edward

2010-07-01

The London Regional Cancer Program (LRCP) uses a unique schedule of induction plus concurrent chemoradiation, termed VCRT (vinblastine, cisplatin, and radiation therapy), for the treatment of a subset of unresectable stage IIIA and IIIB non-small-cell lung cancer (NSCLC). This analysis was conducted to better understand the outcomes in VCRT-treated patients. We report a retrospective analysis of a large cohort of patients who underwent VCRT at the LRCP over a 10-year period, from 1996 to 2006. The analysis focused on OS, toxicities, and the outcomes from completion surgery in a small subset of patients. A total of 294 patients were included and 5-year OS, determined using Kaplan-Meier methodology, was 19.8% with a MST of 18.2 months. Reported grade 3-4 toxicities included neutropenia (39%), anemia (10%), pneumonitis (1%), and esophagitis (3%). Significant differences in survival between groups of patients were demonstrated with log-rank tests for completion surgery, use of radiation therapy, and cisplatin dose. Similarly, Univariate Cox regression showed that completion surgery, use of radiation therapy, cisplatin dose, and vinblastine dose were associated with increased survival. This retrospective analysis of a large cohort of patients reveals an OS for VCRT comparable to that reported in the literature for other current combined chemoradiation protocols. The success of this protocol seems to be dose dependent and the outcomes in those who underwent completion surgery suggests that pathologic complete remission is possible for IIIA and IIIB NSCLC.

The prognostic value of metabolic tumor volume in FDG PET/CT evaluation of post-operative survival in patients with esophageal squamous cell cancer

International Nuclear Information System (INIS)

Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li

2011-01-01

Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)

Metagenes Associated with Survival in Non-Small Cell Lung Cancer

Science.gov (United States)

Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres

2011-01-01

NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068

Proton pump inhibitor use and risk of adverse cardiovascular events in aspirin treated patients with first time myocardial infarction: nationwide propensity score matched study

DEFF Research Database (Denmark)

Charlot, Mette; Grove, Erik; Hansen, Peter Riis

2011-01-01

: All aspirin treated patients surviving 30 days after a first myocardial infarction from 1997 to 2006, with follow-up for one year. Patients treated with clopidogrel were excluded. MAIN OUTCOME MEASURES: The risk of the combined end point of cardiovascular death, myocardial infarction, or stroke...... associated with use of proton pump inhibitors was analysed using Kaplan-Meier analysis, Cox proportional hazard models, and propensity score matched Cox proportional hazard models. Results 3366 of 19 925 (16.9%) aspirin treated patients experienced recurrent myocardial infarction, stroke, or cardiovascular...

Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

DEFF Research Database (Denmark)

Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper

1999-01-01

for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...

Hospital volume and the risk of revision in Oxford unicompartmental knee arthroplasty in the Nordic countries -an observational study of 14,496 cases

DEFF Research Database (Denmark)

Badawy, Mona; Fenstad, Anne M.; Bartz-Johannessen, Christoffer A.

2017-01-01

Background: High procedure volume and dedication to unicompartmental knee arthroplasty (UKA) has been suggested to improve revision rates. This study aimed to quantify the annual hospital volume effect on revision risk in Oxfordu? nicompartmental knee arthroplasty in the Nordic countries. Methods......). The outcome was revision risk after 2 and 10 years calculated using Kaplan Meier method. Multivariate Cox regression analysis was used to assess the Hazard Ratio (HR) of any revision due to specific reasons with 95% confidence intervals (CI). Results: The implant survival was 80% at 10 years in the volume...

Excellent survival after liver transplantation for isolated polycystic liver disease: an European Liver Transplant Registry study

DEFF Research Database (Denmark)

van Keimpema, Loes; Nevens, Frederik; Adam, René

2011-01-01

Patients with end-stage isolated polycystic liver disease (PCLD) suffer from incapacitating symptoms because of very large liver volumes. Liver transplantation (LT) is the only curative option. This study assesses the feasibility of LT in PCLD. We used the European Liver Transplant Registry (ELTR......) database to extract demographics and outcomes of 58 PCLD patients. We used Kaplan-Meier survival analysis for survival rates. Severe abdominal pain (75%) was the most prominent symptom, while portal hypertension (35%) was the most common complication in PCLD. The explantation of the polycystic liver...

Clinical Features in a Danish Population-Based Cohort of Probable Multiple System Atrophy Patients

DEFF Research Database (Denmark)

Starhof, Charlotte; Korbo, Lise; Lassen, Christina Funch

2016-01-01

Background: Multiple system atrophy (MSA) is a rare, sporadic and progressive neurodegenerative disorder. We aimed to describe the clinical features of Danish probable MSA patients, evaluate their initial response to dopaminergic therapy and examine mortality. Methods: From the Danish National...... the criteria for probable MSA. We recorded clinical features, examined differences by MSA subtype and used Kaplan-Meier survival analysis to examine mortality. Results: The mean age at onset of patients with probable MSA was 60.2 years (range 36-75 years) and mean time to wheelchair dependency was 4.7 years...

The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis

DEFF Research Database (Denmark)

Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik

2016-01-01

OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...

Is there racial/ethnic variance in cervical cancer- specific survival of ...

African Journals Online (AJOL)

incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...

Gastric cancer: texture analysis from multidetector computed tomography as a potential preoperative prognostic biomarker

Energy Technology Data Exchange (ETDEWEB)

Giganti, Francesco; Salerno, Annalaura; Marra, Paolo; Esposito, Antonio; Del Maschio, Alessandro; De Cobelli, Francesco [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); San Raffaele Vita-Salute University, Milan (Italy); Antunes, Sofia [San Raffaele Scientific Institute, Centre for Experimental Imaging, Milan (Italy); Ambrosi, Alessandro [San Raffaele Vita-Salute University, Milan (Italy); Nicoletti, Roberto [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); Orsenigo, Elena [San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Chiari, Damiano; Staudacher, Carlo [San Raffaele Vita-Salute University, Milan (Italy); San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Albarello, Luca [San Raffaele Scientific Institute, Pathology Unit, Milan (Italy)

2017-05-15

To investigate the association between preoperative texture analysis from multidetector computed tomography (MDCT) and overall survival in patients with gastric cancer. Institutional review board approval and informed consent were obtained. Fifty-six patients with biopsy-proved gastric cancer were examined by MDCT and treated with surgery. Image features from texture analysis were quantified, with and without filters for fine to coarse textures. The association with survival time was assessed using Kaplan-Meier and Cox analysis. The following parameters were significantly associated with a negative prognosis, according to different thresholds: energy [no filter] - Logarithm of relative risk (Log RR): 3.25; p = 0.046; entropy [no filter] (Log RR: 5.96; p = 0.002); entropy [filter 1.5] (Log RR: 3.54; p = 0.027); maximum Hounsfield unit value [filter 1.5] (Log RR: 3.44; p = 0.027); skewness [filter 2] (Log RR: 5.83; p = 0.004); root mean square [filter 1] (Log RR: - 2.66; p = 0.024) and mean absolute deviation [filter 2] (Log RR: - 4.22; p = 0.007). Texture analysis could increase the performance of a multivariate prognostic model for risk stratification in gastric cancer. Further evaluations are warranted to clarify the clinical role of texture analysis from MDCT. (orig.)

Estimation of Unemployment Duration in Botoşani County Using Survival Analysis

Directory of Open Access Journals (Sweden)

Darabă Gabriel

2017-01-01

Full Text Available In this paper we aim at estimating the unemployment duration in Botosani County in order tostudy the impact of individual characteristics (gender, age, place of residence, unemploymentbenefit, etc. on the length of unemployment spells. We use Cox regression model to measure theeffects of gender, age, residential environment, etc. on the hazard rate of leaving unemploymentandKaplan-Meier estimator to compare survival probabilities among different categories ofunemployed persons. The study is carried out on a sample of 200 unemployment spellsregisteredwith the Employment Agency of Botoşani County from January 2012 to December 2015. Theresults reveal that place of residence, unemployment benefit and unemployed category have asignificant impact on unemployment spells.

La chiesa di Richard Meier a Tor Tre Teste e il suo contributo al consolidamento identitario dei nuovi quartieri romani oltre il GRA / The church designed by Richard Meier in Tor Tre Teste and the identity consolidation in the new roman neighbourhoods beyond the Great Circular Road

Directory of Open Access Journals (Sweden)

Giuseppe Bonaccorso

2014-06-01

. The most important aspects of the eastern quadrant of the Roman periphery are described “from the inside”, accentuating the passages, spaces and elements of composition standing in the origin of form and structure of the neighborhoods in the vicinity of Great Circular Road. The article proposes that the key episodes in this process are the new churches by internationally famous architects, created as new focal points for peripheral neighborhoods whilst replacing libraries, squares and malls. Recent realizations are seen as intention to enforce, or, better, to construct, an identity factor for each of the neighborhoods in the dicussed sector of the city. Starting from the general discourse, the article focuses on one church and one neighborhood that might be considered as models to follow in the entire periphery around GCR: the jubilee church of God the Father of Mercy designed by Richard Meier in the neighborhood of Tor Tre Teste. The sequence of events related to the architectural competition for the church, the choice of proposal by Richard Meier, the complexity of construction as well as the technical, stylistic and symbolical analysis of the building are put in relation to the neighborhood, and finally read as an attempt to create centre of attention for the entire periphery.

Survival Analysis of Factors Influencing Cyclic Fatigue of Nickel-Titanium Endodontic Instruments

Directory of Open Access Journals (Sweden)

Eva Fišerová

2015-01-01

Full Text Available Objective. The aim of this study was to validate a survival analysis assessing the effect of type of rotary system, canal curvature, and instrument size on cyclic resistance. Materials and Methods. Cyclic fatigue testing was carried out in stainless steel artificial canals with radii of curvature of 3 or 5 mm and the angle of curvature of 60 degrees. All the instruments were new and 25 mm in working length, and ISO colour coding indicated the instrument size (yellow for size 20; red for size 25. Wizard Navigator instruments, Mtwo instruments, ProTaper instruments, and Revo-S instruments were passively rotated at 250 rotations per minute, and the time fracture was being recorded. Subsequently, fractographic analysis of broken tips was performed by scanning electron microscope. The data were then analysed by the Kaplan-Meier estimator of the survival function, the Cox proportional hazards model, the Wald test for regression covariates, and the Wald test for significance of regression model. Conclusion. The lifespan registered for the tested instruments was Mtwo > Wizard Navigator > Revo-S > ProTaper; 5 mm radius > 3 mm radius; and yellow > red in ISO colour coding system.

The long-term outcomes of epilepsy surgery

Science.gov (United States)

Keller, Simon; Nicolson, Andrew; Biswas, Shubhabrata; Smith, David; Osman Farah, Jibril; Eldridge, Paul; Wieshmann, Udo

2018-01-01

Objective Despite modern anti-epileptic drug treatment, approximately 30% of epilepsies remain medically refractory and for these patients, epilepsy surgery may be a treatment option. There have been numerous studies demonstrating good outcome of epilepsy surgery in the short to median term however, there are a limited number of studies looking at the long-term outcomes. The aim of this study was to ascertain the long-term outcome of resective epilepsy surgery in a large neurosurgery hospital in the U.K. Methods This a retrospective analysis of prospectively collected data. We used the 2001 International League Against Epilepsy (ILAE) classification system to classify seizure freedom and Kaplan-Meier survival analysis to estimate the probability of seizure freedom. Results We included 284 patients who underwent epilepsy surgery (178 anterior temporal lobe resections, 37 selective amygdalohippocampectomies, 33 temporal lesionectomies, 36 extratemporal lesionectomies), and had a prospective median follow-up of 5 years (range 1–27). Kaplan-Meier estimates showed that 47% (95% CI 40–58) remained seizure free (apart from simple partial seizures) at 5 years and 38% (95% CI 31–45) at 10 years after surgery. 74% (95% CI 69–80) had a greater than 50% seizure reduction at 5 years and 70% (95% CI 64–77) at 10 years. Patients who had an amygdalohippocampectomy were more likely to have seizure recurrence than patients who had an anterior temporal lobe resection (p = 0.006) and temporal lesionectomy (p = 0.029). There was no significant difference between extra temporal and temporal lesionectomies. Hippocampal sclerosis was associated with a good outcome but declined in relative frequency over the years. Conclusion The vast majority of patients who were not seizure free experienced at least a substantial and long-lasting reduction in seizure frequency. A positive long-term outcome after epilepsy surgery is possible for many patients and especially those with

The surgical treatment of failure in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma: an analysis of 83 patients

International Nuclear Information System (INIS)

Gu Wendong; Ji Qinghai; Lu Xueguan; Feng Yan

2003-01-01

Objective: To analyze the results of neck dissection in patients who failed in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma. Methods: Eighty-three patients who received neck dissection due to lymph node persistence or recurrence after definitive radiotherapy were analyzed retrospectively according to the following relevant factors: age, sex, the interval between completion of radiotherapy and surgery, rN stage, postoperative radiotherapy given or not, the adjacent tissues involved or not and the number of positive nodes. Kaplan-Meier method, Log-rank method and Cox method were used in the statistical analysis. Results: The 1-, 3- and 5-year overall survival rates were 80.7%, 47.1% and 34.9%. The interval between completion of radiotherapy and surgery, postoperative radiotherapy given or not, the adjacent tissues involved or not were significantly prognostic factors in statistic analysis. Conclusions: Neck dissection can be applied in the management of cervical lymph node failure in nasopharyngeal carcinoma after radiotherapy. Postoperative radiotherapy should be considered in patients with capsular invasion and/or adjacent tissue involvement

Longterm Hydroxychloroquine Therapy and Low-dose Aspirin May Have an Additive Effectiveness in the Primary Prevention of Cardiovascular Events in Patients with Systemic Lupus Erythematosus.

Science.gov (United States)

Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele

2017-07-01

Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.

Endolymphatic sac surgery versus tenotomy of the stapedius and tensor tympani muscles in the management of patients with unilateral definite Meniere's disease.

Science.gov (United States)

Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco

2015-12-01

This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.

Marital status is an independent prognostic factor for pancreatic neuroendocrine tumors patients: An analysis of the Surveillance, Epidemiology, and End Results (SEER) database.

Science.gov (United States)

Zhou, Huaqiang; Zhang, Yuanzhe; Song, Yiyan; Tan, Wulin; Qiu, Zeting; Li, Si; Chen, Qinchang; Gao, Shaowei

2017-09-01

Marital status's prognostic impact on pancreatic neuroendocrine tumors (PNET) has not been rigorously studied. We aimed to explore the relationship between marital status and outcomes of PNET. We retrospectively investigated 2060 PNET cases between 2004 and 2010 from Surveillance, Epidemiology, and End Results (SEER) database. Variables were compared by Chi 2 test, t-test as appropriate. Kaplan-Meier methods and COX proportional hazard models were used to ascertain independent prognostic factors. Married patients had better 5-year overall survival (OS) (53.37% vs. 42.27%, Pvs. 59.82%, P=0.001) comparing with unmarried patients. Multivariate analysis revealed marital status is an independent prognostic factor, with married patients showing better OS (HR=0.74; 95% CI: 0.65-0.84; Punmarried patients may be associated with a delayed diagnosis with advanced tumor stage, psychosocial and socioeconomic factors. Further studies are needed. Copyright © 2017. Published by Elsevier Masson SAS.

Age at sexual initiation and factors associated with it among youths ...

African Journals Online (AJOL)

Bernt Lindtjorn

Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.

Differential Expression and Clinical Significance of Transforming Growth Factor-Beta Isoforms in GBM Tumors.

Science.gov (United States)

Roy, Laurent-Olivier; Poirier, Marie-Belle; Fortin, David

2018-04-08

Glioblastoma (GBM) represents the most common and aggressive malignant primary brain tumors in adults. Response to standard treatment is transitory and the survival of clinical trial cohorts are little more than 14 months. GBM are characterized by excessive proliferation, invasiveness, and radio-/chemoresistance features; which are strongly upregulated by transforming growth factor-beta (TGF-β). We hypothesized that TGF-β gene expression could correlate with overall survival (OS) and serve as a prognostic biomarker. TGF-β₁ and -β₂ expression were analyzed by qPCR in 159 GBM tumor specimens. Kaplan-Meier and multivariate analyses were used to correlate expression with OS and progression-free survival (PFS). In GBM, TGF-β₁ and -β₂ levels were 33- and 11-fold higher respectively than in non-tumoral samples. Kaplan-Meier and multivariate analyses revealed that high to moderate expressions of TGF-β₁ significantly conferred a strikingly poorer OS and PFS in newly diagnosed patients. Interestingly, at relapse, neither isoforms had meaningful impact on clinical evolution. We demonstrate that TGF-β₁ is the dominant isoform in newly diagnosed GBM rather than the previously acknowledged TGF-β₂. We believe our study is the first to unveil a significant relationship between TGF-β₁ expression and OS or PFS in newly diagnosed GBM. TGF-β₁ could serve as a prognostic biomarker or target affecting treatment planning and patient follow-up.

Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan

Science.gov (United States)

Krikun, Andrew

2010-01-01

Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…

Decreased graft survival in liver transplant recipients of donors with positive blood cultures: a review of the United Network for Organ Sharing dataset.

Science.gov (United States)

Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto

2017-06-01

Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.

Skull base chordomas: analysis of dose-response characteristics

International Nuclear Information System (INIS)

Niemierko, Andrzej; Terahara, Atsuro; Goitein, Michael

1997-01-01

Objective: To extract dose-response characteristics from dose-volume histograms and corresponding actuarial survival statistics for 115 patients with skull base chordomas. Materials and Methods: We analyzed data for 115 patients with skull base chordoma treated with combined photon and proton conformal radiotherapy to doses in the range 66.6Gy - 79.2Gy. Data set for each patient included gender, histology, age, tumor volume, prescribed dose, overall treatment time, time to recurrence or time to last observation, target dose-volume histogram, and several dosimetric parameters (minimum/mean/median/maximum target dose, percent of the target volume receiving the prescribed dose, dose to 90% of the target volume, and the Equivalent Uniform Dose (EUD). Data were analyzed using the Kaplan-Meier survivor function estimate, the proportional hazards (Cox) model, and parametric modeling of the actuarial probability of recurrence. Parameters of dose-response characteristics were obtained using the maximum likelihood method. Results: Local failure developed in 42 (36%) of patients, with actuarial local control rates at 5 years of 59.2%. The proportional hazards model revealed significant dependence of gender on the probability of recurrence, with female patients having significantly poorer prognosis (hazard ratio of 2.3 with the p value of 0.008). The Wilcoxon and the log-rank tests of the corresponding Kaplan-Meier recurrence-free survival curves confirmed statistical significance of this effect. The Cox model with stratification by gender showed significance of tumor volume (p=0.01), the minimum target dose (p=0.02), and the EUD (p=0.02). Other parameters were not significant at the α level of significance of 0.05, including the prescribed dose (p=0.21). Parametric analysis using a combined model of tumor control probability (to account for non-uniformity of target dose distribution) and the Weibull failure time model (to account for censoring) allowed us to estimate

Optimal FDG PET/CT volumetric parameters for risk stratification in patients with locally advanced non-small cell lung cancer: results from the ACRIN 6668/RTOG 0235 trial

Energy Technology Data Exchange (ETDEWEB)

Salavati, Ali [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); University of Minnesota, Department of Radiology, Minneapolis, MN (United States); Duan, Fenghai [Brown University School of Public Health, Department of Biostatistics and Center for Statistical Sciences, Providence, RI (United States); Snyder, Bradley S. [Brown University School of Public Health, Center for Statistical Sciences, Providence, RI (United States); Wei, Bo [Emory University, Department of Biostatistics, Rollins School of Public Health, Atlanta, GA (United States); Houshmand, Sina; Alavi, Abass [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Khiewvan, Benjapa [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Mahidol University, Division of Nuclear Medicine, Department of Radiology, Faculty of Medicine Siriraj Hospital, Bangkok (Thailand); Opanowski, Adam [ACR Center for Research and Innovation, American College of Radiology, Philadelphia, PA (United States); Simone, Charles B. [University of Maryland Medical Center, Department of Radiation Oncology, Baltimore, MD (United States); Siegel, Barry A. [Washington University School of Medicine, Mallinckrodt Institute of Radiology and the Alvin J. Siteman Cancer Center, St, Louis, MO (United States); Machtay, Mitchell [Case Western Reserve University and University Hospitals Case Medical Center, Department of Radiation Oncology, Cleveland, OH (United States)

2017-11-15

In recent years, multiple studies have demonstrated the value of volumetric FDG-PET/CT parameters as independent prognostic factors in patients with non-small cell lung cancer (NSCLC). We aimed to determine the optimal cut-off points of pretreatment volumetric FDG-PET/CT parameters in predicting overall survival (OS) in patients with locally advanced NSCLC and to recommend imaging biomarkers appropriate for routine clinical applications. Patients with inoperable stage IIB/III NSCLC enrolled in ACRIN 6668/RTOG 0235 were included. Pretreatment FDG-PET scans were quantified using semiautomatic adaptive contrast-oriented thresholding and local-background partial-volume-effect-correction algorithms. For each patient, the following indices were measured: metabolic tumor volume (MTV), total lesion glycolysis (TLG), SUVmax, SUVmean, partial-volume-corrected TLG (pvcTLG), and pvcSUVmean for the whole-body, primary tumor, and regional lymph nodes. The association between each index and patient outcome was assessed using Cox proportional hazards regression. Optimal cut-off points were estimated using recursive binary partitioning in a conditional inference framework and used in Kaplan-Meier curves with log-rank testing. The discriminatory ability of each index was examined using time-dependent receiver operating characteristic (ROC) curves and corresponding area under the curve (AUC(t)). The study included 196 patients. Pretreatment whole-body and primary tumor MTV, TLG, and pvcTLG were independently prognostic of OS. Optimal cut-off points were 175.0, 270.9, and 35.5 cm{sup 3} for whole-body TLG, pvcTLG, and MTV, and were 168.2, 239.8, and 17.4 cm{sup 3} for primary tumor TLG, pvcTLG, and MTV, respectively. In time-dependent ROC analysis, AUC(t) for MTV and TLG were uniformly higher than that of SUV measures over all time points. Primary tumor and whole-body parameters demonstrated similar patterns of separation for those patients above versus below the optimal cut

Stability of spinal bone metastases in breast cancer after radiotherapy. A retrospective analysis of 157 cases

Energy Technology Data Exchange (ETDEWEB)

Schlampp, Ingmar; Rieken, Stefan; Habermehl, Daniel; Foerster, Robert; Debus, Juergen; Rief, Harald [University Hospital of Heidelberg, Department of Radiation Oncology, Heidelberg (Germany); Bruckner, Thomas [University Hospital of Heidelberg, Department of Medical Biometry, Heidelberg (Germany)

2014-09-15

This retrospective analysis was performed to evaluate osteolytic bone lesions of breast cancer in the thoracic and lumbar spine after radiotherapy (RT) in terms of stability using a validated scoring system. The stability of 157 osteolytic metastases, treated from January 2000 to January 2012, in 115 patients with breast cancer was evaluated retrospectively using the Taneichi score. Predictive factors for stability were analyzed and survival rates were calculated. Eighty-five (54 %) lesions were classified as unstable prior to RT. After 3 and 6 months, 109 (70 %) and 124 (79 %) lesions, respectively, were classified as stable. Thirty fractures were detected prior to RT, and after RT seven cases (4.5 %) with pathologic fractures were found within 6 months. None of the examined predictive factors showed significant correlation with stability 6 months after RT. After a median follow-up of 16.7 months, Kaplan-Meier estimates revealed an overall survival of 83 % after 5 years. The majority of patients showed an improved or unchanged stability of the involved vertebral bodies after 6 months. The patients showed only minor cancer-related morbidity during follow-up and reached comparably high survival rates. (orig.) [German] Die retrospektive Analyse untersuchte osteolytische Knochenmetastasen von Patienten mit Mammakarzinom der thorakalen und lumbalen Wirbelsaeule nach Radiotherapie (RT) hinsichtlich Stabilitaet anhand eines validierten Scores. Die Stabilitaet von 157 osteolytischen Metastasen bei 115 Patienten mit Brustkrebs, behandelt von Januar 2000 bis Januar 2012, wurde retrospektiv anhand des Taneichi-Scores evaluiert. Prognostische Faktoren bezueglich Stabilitaet und Ueberlebensraten wurden analysiert. Vor RT wurden 85 Laesionen (54 %) als instabil gewertet. Nach 3 und 6 Monaten wurden 109 (70 %) und 124 (79 %) Laesionen als stabil klassifiziert. Vor RT wurden 30 Frakturen gefunden, nach RT zeigten sich 7 weitere (4,5 %) pathologische Frakturen. Kein prognostischer

First line chemotherapy plus trastuzumab in metastatic breast cancer ...

African Journals Online (AJOL)

First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...

Clinical outcome among HIV-infected patients starting saquinavir hard gel compared to ritonavir or indinavir

DEFF Research Database (Denmark)

Kirk, O; Mocroft, A; Pradier, C

2001-01-01

-up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...

Sobrevivência após acidentes de trânsito: impacto das variáveis clínicas e pré-hospitalares Sobrevida después de accidentes de tránsito: impacto de las variables clínicas y pre hospitalarias Survival after motor vehicle crash: impact of clinical and prehospital variables

Directory of Open Access Journals (Sweden)

Marisa Aparecida Amaro Malvestio

2008-08-01

Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized

Analysis of survival for patients with chronic kidney disease primarily related to renal cancer surgery.

Science.gov (United States)

Wu, Jitao; Suk-Ouichai, Chalairat; Dong, Wen; Antonio, Elvis Caraballo; Derweesh, Ithaar H; Lane, Brian R; Demirjian, Sevag; Li, Jianbo; Campbell, Steven C

2018-01-01

To evaluate predictors of long-term survival for patients with chronic kidney disease primarily due to surgery (CKD-S). Patients with CKD-S have generally good survival that approximates patients who do not have CKD even after renal cancer surgery (RCS), yet there may be heterogeneity within this cohort. From 1997 to 2008, 4 246 patients underwent RCS at our centre. The median (interquartile range [IQR]) follow-up was 9.4 (7.3-11.0) years. New baseline glomerular filtration rate (GFR) was defined as highest GFR between nadir and 6 weeks after RCS. We retrospectively evaluated three cohorts: no-CKD (new baseline GFR of ≥60 mL/min/1.73 m 2 ); CKD-S (new baseline GFR of cancer-related survival (NRCRS) for the CKD-S cohort. Kaplan-Meier analysis assessed the longitudinal impact of new baseline GFR (45-60 mL/min/1.73 m 2 vs <45 mL/min/1.73 m 2 ) and Cox regression evaluated relative impact of preoperative GFR, new baseline GFR, and relevant demographics/comorbidities. Of the 4 246 patients who underwent RCS, 931 had CKD-S and 1 113 had CKD-M/S, whilst 2 202 had no-CKD even after RCS. Partial/radical nephrectomy (PN/RN) was performed in 54%/46% of the patients, respectively. For CKD-S, 641 patients had a new baseline GFR of 45-60 mL/min/1.73 m 2 and 290 had a new baseline GFR of <45 mL/min/1.73 m 2 . Kaplan-Meier analysis showed significantly reduced NRCRS for patients with CKD-S with a GFR of <45 mL/min/1.73 m 2 compared to those with no-CKD or CKD-S with a GFR of 45-60 mL/min/1.73 m 2 (both P ≤ 0.004), and competing risk analysis confirmed this (P < 0.001). Age, gender, heart disease, and new baseline GFR were all associated independently with NRCRS for patients with CKD-S (all P ≤ 0.02). Our data suggest that CKD-S is heterogeneous, and patients with a reduced new baseline GFR have compromised survival, particularly if <45 mL/min/1.73 m 2 . Our findings may have implications regarding choice of PN/RN in patients at risk of developing

SAMSN1 is highly expressed and associated with a poor survival in glioblastoma multiforme.

Directory of Open Access Journals (Sweden)

Yong Yan

Full Text Available OBJECTIVES: To study the expression pattern and prognostic significance of SAMSN1 in glioma. METHODS: Affymetrix and Arrystar gene microarray data in the setting of glioma was analyzed to preliminarily study the expression pattern of SAMSN1 in glioma tissues, and Hieratical clustering of gene microarray data was performed to filter out genes that have prognostic value in malignant glioma. Survival analysis by Kaplan-Meier estimates stratified by SAMSN1 expression was then made based on the data of more than 500 GBM cases provided by The Cancer Genome Atlas (TCGA project. At last, we detected the expression of SAMSN1 in large numbers of glioma and normal brain tissue samples using Tissue Microarray (TMA. Survival analysis by Kaplan-Meier estimates in each grade of glioma was stratified by SAMSN1 expression. Multivariate survival analysis was made by Cox proportional hazards regression models in corresponding groups of glioma. RESULTS: With the expression data of SAMSN1 and 68 other genes, high-grade glioma could be classified into two groups with clearly different prognoses. Gene and large sample tissue microarrays showed high expression of SAMSN1 in glioma particularly in GBM. Survival analysis based on the TCGA GBM data matrix and TMA multi-grade glioma dataset found that SAMSN1 expression was closely related to the prognosis of GBM, either PFS or OS (P<0.05. Multivariate survival analysis with Cox proportional hazards regression models confirmed that high expression of SAMSN1 was a strong risk factor for PFS and OS of GBM patients. CONCLUSION: SAMSN1 is over-expressed in glioma as compared with that found in normal brains, especially in GBM. High expression of SAMSN1 is a significant risk factor for the progression free and overall survival of GBM.

Axial U(1) current in Grabowska and Kaplan's formulation

Science.gov (United States)

Hamada, Yu; Kawai, Hikaru

2017-06-01

Recently, Grabowska and Kaplan [Phys. Rev. Lett. 116, 211602 (2016); Phys. Rev. D 94, 114504 (2016)] suggested a nonperturbative formulation of a chiral gauge theory, which consists of the conventional domain-wall fermion and a gauge field that evolves by gradient flow from one domain wall to the other. We introduce two sets of domain-wall fermions belonging to complex conjugate representations so that the effective theory is a 4D vector-like gauge theory. Then, as a natural definition of the axial-vector current, we consider a current that generates simultaneous phase transformations for the massless modes in 4 dimensions. However, this current is exactly conserved and does not reproduce the correct anomaly. In order to investigate this point precisely, we consider the mechanism of the conservation. We find that this current includes not only the axial current on the domain wall but also a contribution from the bulk, which is nonlocal in the sense of 4D fields. Therefore, the local current is obtained by subtracting the bulk contribution from it.

Coupled skinny baker's maps and the Kaplan-Yorke conjecture

Science.gov (United States)

Gröger, Maik; Hunt, Brian R.

2013-09-01

The Kaplan-Yorke conjecture states that for ‘typical’ dynamical systems with a physical measure, the information dimension and the Lyapunov dimension coincide. We explore this conjecture in a neighborhood of a system for which the two dimensions do not coincide because the system consists of two uncoupled subsystems. We are interested in whether coupling ‘typically’ restores the equality of the dimensions. The particular subsystems we consider are skinny baker's maps, and we consider uni-directional coupling. For coupling in one of the possible directions, we prove that the dimensions coincide for a prevalent set of coupling functions, but for coupling in the other direction we show that the dimensions remain unequal for all coupling functions. We conjecture that the dimensions prevalently coincide for bi-directional coupling. On the other hand, we conjecture that the phenomenon we observe for a particular class of systems with uni-directional coupling, where the information and Lyapunov dimensions differ robustly, occurs more generally for many classes of uni-directionally coupled systems (also called skew-product systems) in higher dimensions.

The Factor Structure and Age-Related Factorial Invariance of the Delis-Kaplan Executive Function System (D-KEFS)

Science.gov (United States)

Latzman, Robert D.; Markon, Kristian E.

2010-01-01

There has been an increased interest in the structure of and relations among executive functions.The present study examined the factor structure as well as age-related factorial invariance of the Delis-Kaplan Executive Function System (D-KEFS), a widely used inventory aimed at assessing executive functions. Analyses were first conducted using data…

On the Importance of Accounting for Competing Risks in Pediatric Cancer Trials Designed to Delay or Avoid Radiotherapy: I. Basic Concepts and First Analyses

International Nuclear Information System (INIS)

Tai, Bee-Choo; Grundy, Richard G.; Machin, David

2010-01-01

Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.

Comparison of graft survival following penetrating keratoplasty and Descemet's stripping endothelial keratoplasty in eyes with a glaucoma drainage device.

Science.gov (United States)

Iverson, Shawn M; Spierer, Oriel; Papachristou, George C; Feuer, William J; Shi, Wei; Greenfield, David S; O'Brien, Terrence P

2018-02-01

To compare corneal graft survival rates after penetrating keratoplasty (PK) and Descemet's stripping endothelial keratoplasty (DSEK) in patients with a glaucoma drainage device (GDD) or medically managed glaucoma. A retrospective chart review was conducted on consecutive patients who underwent primary PK or primary DSEK. Inclusion criteria consisted of eyes with a diagnosis of glaucoma prior to corneal transplantation and a minimum of 6 months of follow-up. Graft failure was defined as an edematous cornea with failure to maintain deturgescence lasting beyond a period of 1 month of intense steroid therapy or vascularization and scarring resulting in irreversible loss of central graft clarity. Corneal graft survival was calculated using Kaplan-Meier survival analysis. Patients were divided into four groups: GDD-PK, GDD-DSEK, medical-PK and medical-DSEK. Fifty-six eyes of 56 patients were identified as meeting inclusion criteria. Among eyes with a GDD, there was no difference in the proportion of failures between PK grafts (48%) and DSEK grafts (50%) (p = 0.90). Failure occurred earlier in DSEK recipients compared to PK recipients, 5.82 ± 6.77 months versus 14.40 ± 7.70 months, respectively (p = 0.04). A Kaplan-Meier analysis did not identify a difference between the four groups with respect to graft failure (p = 0.52). There is no significant difference in graft survival rates between medically and surgically treated glaucoma patients for either PK or DSEK grafts. In patients with GDD, graft failure occurs earlier in DSEK compared to PK.

Treatment of Benign and Malignant Tracheobronchial Obstruction with Metal Wire Stents: Experience with a Balloon-Expandable and a Self-Expandable Stent Type

International Nuclear Information System (INIS)

Rieger, Johannes; Hautmann, Hubert; Linsenmaier, Ulrich; Weber, Cristoph; Treitl, Markus; Huber, R.M.; Pfeifer, Klaus-Juergen

2004-01-01

Over the last few years various types of metal wire stents have been increasingly employed in the treatment of both malignant and benign tracheobronchial obstruction. To date, however, few studies have investigated the in vivo properties of different stent types. We implanted 26 balloon-expandable tantalum Strecker stents (18 patients) and 18 self-expandable Wallstents (16 patients) into the tracheobronchial system of 30 patients with combined stenting in 4 patients. Mean age was 51 years (range: 0.5-79 years). Malignant disease was present in 23 patients, benign disease in seven patients. Both patients and individual stents were monitored clinically and radiographically. The probability of stents remaining within the tracheobronchial system, and of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for both stent types. Average stent follow-up time was 112 days until explantation and 115 days until patients' death or discharge. Kaplan-Meier analysis revealed a higher probability for the Wallstent to remain within the tracheobronchial system. Dislocation and compression occurred more rarely. Explantation, however, if desired, was more difficult compared to the Strecker stent. The Wallstent also led to the formation of granulation tissue, especially at the proximal stent end, frequently requiring reintervention. Both stent types proved to be effective therapeutic options in the management of obstructive tracheobronchial disease. The mechanical properties of the Strecker stent seem to be less favorable compared to the Wallstent but removal is easy. For benign disease, however, the Wallstent reveals limitations due to significant side effects

Cefepime restriction improves gram-negative overall resistance patterns in neonatal intensive care unit

Directory of Open Access Journals (Sweden)

Orlei Ribeiro de Araujo

Full Text Available Antibiotic restriction can be useful in maintaining bacterial susceptibility. The objective of this study was verify if restriction of cefepime, the most frequently used cephalosporin in our neonatal intensive care unit (NICU, would ameliorate broad-spectrum susceptibility of Gram-negative isolates. Nine hundred and ninety-five premature and term newborns were divided into 3 cohorts, according to the prevalence of cefepime use in the unit: Group 1 (n=396 comprised patients admitted from January 2002 to December 2003, period in which cefepime was the most used broad-spectrum antibiotic. Patients in Group 2 (n=349 were admitted when piperacillin/tazobactam replaced cefepime (January to December 2004 and in Group 3 (n=250 when cefepime was reintroduced (January to September 2005. Meropenem was the alternative third-line antibiotic for all groups. Multiresistance was defined as resistance to 2 or more unrelated antibiotics, including necessarily a third or fourth generation cephalosporin, piperacillin/tazobactam or meropenem. Statistics involved Kruskal-Wallis, Mann-Whitney and logrank tests, Kaplan-Meier analysis. Groups were comparable in length of stay, time of mechanical ventilation, gestational age and birth weight. Ninety-eight Gram-negative isolates were analyzed. Patients were more likely to remain free of multiresistant isolates by Kaplan-Meier analysis in Group 2 when compared to Group 1 (p=0.017 and Group 3 (p=0.003. There was also a significant difference in meropenem resistance rates. Cefepime has a greater propensity to select multiresistant Gram-negative pathogens than piperacillin/tazobactam and should not be used extensively in neonatal intensive care.

The Influence of Phacoemulsification on Surgical Outcomes of Trabeculectomy with Mitomycin-C for Uveitic Glaucoma.

Directory of Open Access Journals (Sweden)

Asaho Nishizawa

Full Text Available To evaluate the influence of phacoemulsification after trabeculectomy on the postoperative intraocular pressure (IOP in eyes with uveitic glaucoma (UG.Kumamoto University Hospital, Kumamoto, Japan.A retrospective cohort study.The medical records of patients with UG who had trabeculectomy with mitomycin-C (MMC were reviewed. Complete and qualified surgical failures were defined by an IOP of ≥21 mmHg (condition A, ≥18 mmHg (condition B, or ≥15 mmHg (condition C without and with glaucoma eye drops, respectively. Kaplan-Meier survival analysis, generalized by the Wilcoxon test, and the Cox proportional hazards model analysis were conducted. Post-trabeculectomy phacoemulsification was treated as a time-dependent variable. In 24 (30% of the included 80 eyes, phacoemulsification was included, and they were divided into two groups: groups I (8 eyes with phacoemulsification within 1 year after trabeculectomy and group II (16 eyes after 1 year following trabeculectomy.Multivariable Cox proportional hazards model analysis showed post-trabeculectomy phacoemulsification was a significant factor in both complete success and qualified success based upon condition C (P = 0.0432 and P = 0.0488, respectively, but not for the other conditions. Kaplan-Meier survival analyses indicated significant differences in success probabilities between groups I and group II for complete success and qualified success based upon condition C (P = 0.020 and P = 0.013, respectively. There was also a significant difference for qualified success based upon condition B (P = 0.034, while there was no significant difference for the other conditions.Post-trabeculectomy phacoemulsification, especially within 1 year, can cause poor prognosis of IOP control of UG eyes after trabeculectomy with MMC.

MNS16A minisatellite genotypes in relation to risk of glioma and meningioma and to glioblastoma outcome

DEFF Research Database (Denmark)

Andersson, U.; Osterman, P.; Sjostrom, S.

2009-01-01

was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...

Birth interval and its predictors among married women in Dabat ...

African Journals Online (AJOL)

2008-12-30

Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...

Socialization into a Civilization: The Dewey-Kaplan Synthesis in American Jewish Schooling in the Early 20th Century

Science.gov (United States)

Jacobs, Benjamin M.

2009-01-01

This historical study focuses on how John Dewey's theory of education as socialization and Mordecai Kaplan's theory of Judaism as a civilization together served as an ideological base and pedagogical framework for the creation of "progressive," "reconstructed" American Jewish school programs in the early 20th century…

A New Treatment Paradigm: Neoadjuvant Radiosurgery Before Surgical Resection of Brain Metastases With Analysis of Local Tumor Recurrence

International Nuclear Information System (INIS)

Asher, Anthony L.; Burri, Stuart H.; Wiggins, Walter F.; Kelly, Renee P.; Boltes, Margaret O.; Mehrlich, Melissa; Norton, H. James; Fraser, Robert W.

2014-01-01

Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong

A new treatment paradigm: neoadjuvant radiosurgery before surgical resection of brain metastases with analysis of local tumor recurrence.

Science.gov (United States)

Asher, Anthony L; Burri, Stuart H; Wiggins, Walter F; Kelly, Renee P; Boltes, Margaret O; Mehrlich, Melissa; Norton, H James; Fraser, Robert W

2014-03-15

Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong majority of patients were able to avoid WBRT. NaSRS merits

A New Treatment Paradigm: Neoadjuvant Radiosurgery Before Surgical Resection of Brain Metastases With Analysis of Local Tumor Recurrence

Energy Technology Data Exchange (ETDEWEB)

Asher, Anthony L., E-mail: asher@cnsa.com [Department of Neurosurgery, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Burri, Stuart H. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Wiggins, Walter F. [Wake Forest School of Medicine MD/PhD Program, Winston-Salem, North Carolina (United States); Kelly, Renee P. [Brain Tumor Fund for the Carolinas, Charlotte, North Carolina (United States); Boltes, Margaret O.; Mehrlich, Melissa [Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Norton, H. James [Department of Biostatistics, Carolinas Medical Center, Charlotte, North Carolina (United States); Fraser, Robert W. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States)

2014-03-15

Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong

Experiences with environmentally adapted Kaplan runners; Erfarenheter med miljoeanpassade Kaplanloephjul

Energy Technology Data Exchange (ETDEWEB)

Ukonsaari; Jan

2012-08-15

This study concerns environmentally adapted Kaplan runners, which have no oil for lubricating the blade regulation mechanisms and bearings. The runners are water or air filled with self lubricated bearings. Recent design also includes regulation system pressure increase and servo motor placement below runner centre and environmentally adapted synthetic ester as hydraulic fluid. These together with power output increase and efficiency optimization are suspected sources of poor runner function. Of 37 runners 43 % have had some kind of problem and 30 % bearing or mechanism related ones. When the axial blade bearing problems are excluded the problems occurred at 16 %. Deeper look into the design of newer runners shows that only bronze based runner hubs is significantly more problem dense regarding regulation mechanisms (50 %). Hidden figures of increased runner regulation forces are suspected. All problems cannot be explained and the young machines limit the experiences. The working group's opinion and bring ups of historical and present examples during the work show evidence that the old oil filled runners function is far from perfect, nor the life length. The future is not with oil filled runner hubs. Main parts of the discovered problems have been solved and can be resolved by thorough design analysis. One future concern is what effects the recent design changes will cause due to increase demand for power output changes including the number of starts and stops. That is why the working group's recommendation is to put joint effort into material fatigue and in which a first step is to identify the real forces the runners are exposed to.

Growth pattern of colorectal liver metastasis as a marker of recurrence risk

DEFF Research Database (Denmark)

Eefsen, R L; Vermeulen, P B; Christensen, I J

2015-01-01

from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...

Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe

DEFF Research Database (Denmark)

Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther

2014-01-01

on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...

Association between implantable cardioverter-defibrillator therapy and different lead positions in patients with cardiac resynchronization therapy

DEFF Research Database (Denmark)

Kronborg, Mads Brix; Johansen, Jens Brock; Haarbo, Jens

2017-01-01

/mid-ventricular/apical for the LV-LP, and as apical/non-apical for the RV-LP. Appropriate and inappropriate therapies were registered during follow-up via remote monitoring or at device interrogations. Time to event was summarized with Kaplan-Meier plots, and competed risk regression analysis was used to calculate adjusted hazard...... with an apical. We observed no significant association between appropriate therapy and LV-LP in left anterior oblique or right anterior oblique views or inappropriate therapy between any lead positions. Conclusion: An apical RV-LP is associated with an increased risk of appropriate therapy for ventricular...

High frequency of tumor cells with nuclear Egr-1 protein expression in human bladder cancer is associated with disease progression

DEFF Research Database (Denmark)

Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels

2009-01-01

bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...

Cytogenetic abnormalities and their prognostic significance in idiopathic myelofibrosis: a study of 106 cases.

Science.gov (United States)

Reilly, J T; Snowden, J A; Spearing, R L; Fitzgerald, P M; Jones, N; Watmore, A; Potter, A

1997-07-01

The prognostic significance of cytogenetic abnormalities was determined in 106 patients with well-characterized idiopathic myelofibrosis who were successfully karyotyped at diagnosis. 35% of the cases exhibited a clonal abnormality (37/106), whereas 65% (69/106) had a normal karyotype. Three characteristic defects, namely del(13q) (nine cases), del(20q) (eight cases) and partial trisomy 1q (seven cases), were present in 64.8% (24/37) of patients with clonal abnormalities. Kaplan-Meier plots and log rank analysis demonstrated an abnormal karyotype to be an adverse prognostic variable (P 10.3 x 10(9)/l; P=0.06) were also associated with a shorter survival. In contrast, sex, spleen and liver size, and percentage blast cells were not found to be significant. Multivariate analysis, using Cox's regression, revealed karyotype, haemoglobin concentration, platelet and leucocyte counts to retain their unfavourable prognostic significance. A simple and useful schema for predicting survival in idiopathic myelofibrosis has been produced by combining age, haemoglobin concentration and karyotype with median survival times varying from 180 months (good-risk group) to 16 months (poor-risk group).

The prognostic implications of growth-related gene product β in laryngeal squamous cell carcinoma.

Science.gov (United States)

Tang, Mingming; Xu, Xinjiang; Chen, Juanjuan; Huang, Jiangfei; Jiang, Bin; Han, Liang

2017-09-01

Growth-related gene product β (GROβ) is an angiogenic chemokine that belongs to the CXC chemokine family, and a number of studies have suggested that GROβ is associated with tumor development and progression. However, a number of studies have investigated the association between GROβ expression and the clinical attributes of laryngeal squamous cell carcinoma (LSCC). In the present study, one-step quantitative polymerase chain reaction and immunohistochemistry analysis were used to detect GROβ expression and evaluate the association between its expression and the clinicopathological characteristics of LSCC. The results demonstrated that the GROβ mRNA and protein expression levels were significantly increased in LSCC compared with the corresponding non-cancerous tissues. GROβ protein expression in LSCC was associated with tumor-node-metastasis stage, lymph node metastasis and histopathological grade. The Kaplan-Meier method and Cox multi-factor analysis indicated that high GROβ expression, lymph node metastasis and histopathological grade were significantly associated with poor survival of patients with LSCC. These data indicated that GROβ may be a novel prognostic biomarker of LSCC.

CD147 expression in human gastric cancer is associated with tumor recurrence and prognosis.

Directory of Open Access Journals (Sweden)

Dake Chu

Full Text Available CD147 is correlated with tumor aggressiveness in various human malignancies. Here, we investigated CD147 protein expression in 223 patients with gastric cancer by immunohistochemistry and analyzed its association with disease-free and overall survival. CD147 was increased in gastric cancer compared to normal tissues. Additionally, CD147 expression was associated with gastric cancer invasion, metastasis and TNM stage, whereas it was not related to age, sex, differentiation status, tumor site or Lauren classification. Kaplan-Meier analysis confirmed that CD147 was associated with disease-free and overall survival in patients with gastric cancer; i.e., patients with positive CD147 staining tend to have worse disease-free and overall survival. Moreover, Cox's proportional hazards analysis demonstrated that CD147 was an independent marker of disease-free and overall survival for patients with gastric cancer. These results confirm the association of CD147 with gastric cancer invasion and metastasis and prove that CD147 might be an indicator of tumor recurrence and prognosis in gastric cancer.

Simplified tools for measuring retention in care in antiretroviral treatment program in Ethiopia: cohort and current retention in care.

Science.gov (United States)

Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim

2012-01-01

Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.

Simplified tools for measuring retention in care in antiretroviral treatment program in Ethiopia: cohort and current retention in care.

Directory of Open Access Journals (Sweden)

Yibeltal Assefa

Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.

Role of IKK-alpha in the EGFR Signaling Regulation

Science.gov (United States)

2014-09-01

expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100

Perioperative Blood Transfusion as a Significant Predictor of Biochemical Recurrence and Survival after Radical Prostatectomy in Patients with Prostate Cancer.

Directory of Open Access Journals (Sweden)

Jung Kwon Kim

Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.

The influence of sarcopenia on survival and surgical complications in ovarian cancer patients undergoing primary debulking surgery.

Science.gov (United States)

Rutten, I J G; Ubachs, J; Kruitwagen, R F P M; van Dijk, D P J; Beets-Tan, R G H; Massuger, L F A G; Olde Damink, S W M; Van Gorp, T

2017-04-01

Sarcopenia, severe skeletal muscle loss, has been identified as a prognostic factor in various malignancies. This study aims to investigate whether sarcopenia is associated with overall survival (OS) and surgical complications in patients with advanced ovarian cancer undergoing primary debulking surgery (PDS). Ovarian cancer patients (n = 216) treated with PDS were enrolled retrospectively. Total skeletal muscle surface area was measured on axial computed tomography at the level of the third lumbar vertebra. Optimum stratification was used to find the optimal skeletal muscle index cut-off to define sarcopenia (≤38.73 cm 2 /m 2 ). Cox-regression and Kaplan-Meier analysis were used to analyse the relationship between sarcopenia and OS. The effect of sarcopenia on the development of major surgical complications was studied with logistic regression. Kaplan-Meier analysis showed a significant survival disadvantage for patients with sarcopenia compared to patients without sarcopenia (p = 0.010). Sarcopenia univariably predicted OS (HR 1.536 (95% CI 1.105-2.134), p = 0.011) but was not significant in multivariable Cox-regression analysis (HR 1.362 (95% CI 0.968-1.916), p = 0.076). Significant predictors for OS in multivariable Cox-regression analysis were complete PDS, treatment in a specialised centre and the development of major complications. Sarcopenia was not predictive of major complications. Sarcopenia was not predictive of OS or major complications in ovarian cancer patients undergoing primary debulking surgery. However a strong trend towards a survival disadvantage for patients with sarcopenia was seen. Future prospective studies should focus on interventions to prevent or reverse sarcopenia and possibly increase ovarian cancer survival. Complete cytoreduction remains the strongest predictor of ovarian cancer survival. Copyright © 2017 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights

Exposure-response relationship of regorafenib efficacy in patients with hepatocellular carcinoma.

Science.gov (United States)

Solms, Alexander; Reinecke, Isabel; Fiala-Buskies, Sabine; Keunecke, Anne; Drenth, Henk-Jan; Bruix, Jordi; Meinhardt, Gerold; Cleton, Adriaan; Ploeger, Bart

2017-11-15

To explore the relationship between regorafenib exposure and efficacy in patients with hepatocellular carcinoma (HCC) who had disease progression during sorafenib treatment (RESORCE). Exposure-response (ER) analyses for regorafenib were performed using data from a phase 3, randomized, placebo-controlled trial (RESORCE). Patients received 160mg regorafenib or placebo once daily (3weeks on/1week off in a 4-week cycle) with best supportive care until disease progression, death, or unacceptable toxicity. Kaplan-Meier analyses for overall survival (OS) and time-to-progression (TTP) were performed in which regorafenib-treated patients were grouped into four categories according to their estimated average exposure over 4weeks in cycle 1. While this analysis primarily focused on efficacy, a potential correlation between exposure and treatment-emergent adverse events (TEAEs) was also evaluated. If any differences were observed between Kaplan-Meier plots, the ER analysis continued with a multivariate Cox regression analysis to evaluate the correlation between exposure quartile categories and the efficacy and safety parameters while taking into consideration the effect of the predefined clinically relevant demographic and baseline covariates. The functional form of the ER relationship within the regorafenib treatment group was subsequently evaluated. Based on visual assessment of the Kaplan-Meier plots, no meaningful relationship between the exposure categories and TEAEs were observed, although median OS and TTP tended to be longer in the higher exposure categories. Further ER analyses, which considered the effects of predefined covariates and the different shapes of the ER relationship, focused on efficacy. The baseline risk factors Eastern Cooperative Oncology Group (ECOG) performance status ≥1, alpha-fetoprotein levels ≥400ng/ml, and aspartate transaminase or alanine transaminase levels >3×upper limit of normal were significantly associated with OS (Pregorafenib

Association of phase angle on bioelectrical impedance analysis and dialysis frequency with survival of chronic hemodialysis patients

Science.gov (United States)

Muzasti, R. A.; Lubis, H. R.

2018-03-01

Phase angle, a parameter by Bioelectrical Impedance Analysis, can detect body composition changes, so it can be used as a prognostic indicator in some chronic conditions. This study was for determining the relationship between PhA and hemodiálisis frequency with the survival of chronic hemodiálisis patients. This longitudinal retrospective study involved 173 chronic hemodiálisis patients at Rasyida Renal Hospital. The Kaplan-Meier method is used to determine the survival. Cox proportional hazard analysis is used to determine which variables significantly increase mortality. During the study period, 89 patients underwent hemodiálysis 3x a week (4 hours/session), and 84 patients underwent HD 2x a week (5 hours/session). Demographic and clinical characteristics in both groups were similar. There was no difference in PhA value in groups of 3x a week and group 2x a week (4.02 ± 1.13 vs 4.25 ± 1.12). Patients with twice a week hemodiálisis had a shorter survival than the 3x week group (35.14 ± 2.76 vs 38.62 ± 3.03) although it was not statistically significant (p = 0.126).

[Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].

Science.gov (United States)

Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong

2017-07-01

To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.

Vasodilator-Stimulated Phosphoprotein (VASP) depletion from breast cancer MDA-MB-231 cells inhibits tumor spheroid invasion through downregulation of Migfilin, β-catenin and urokinase-plasminogen activator (uPA)

Energy Technology Data Exchange (ETDEWEB)

Gkretsi, Vasiliki; Stylianou, Andreas; Stylianopoulos, Triantafyllos, E-mail: tstylian@ucy.ac.cy

2017-03-15

A hallmark of cancer cells is their ability to invade surrounding tissues and form metastases. Cell-extracellular matrix (ECM)-adhesion proteins are crucial in metastasis, connecting tumor ECM with actin cytoskeleton thus enabling cells to respond to mechanical cues. Vasodilator-stimulated phosphoprotein (VASP) is an actin-polymerization regulator which interacts with cell-ECM adhesion protein Migfilin, and regulates cell migration. We compared VASP expression in MCF-7 and MDA-MB-231 breast cancer (BC) cells and found that more invasive MDA-MB-231 cells overexpress VASP. We then utilized a 3-dimensional (3D) approach to study metastasis in MDA-MB-231 cells using a system that considers mechanical forces exerted by the ECM. We prepared 3D collagen I gels of increasing concentration, imaged them by atomic force microscopy, and used them to either embed cells or tumor spheroids, in the presence or absence of VASP. We show, for the first time, that VASP silencing downregulated Migfilin, β-catenin and urokinase plasminogen activator both in 2D and 3D, suggesting a matrix-independent mechanism. Tumor spheroids lacking VASP demonstrated impaired invasion, indicating VASP’s involvement in metastasis, which was corroborated by Kaplan-Meier plotter showing high VASP expression to be associated with poor remission-free survival in lymph node-positive BC patients. Hence, VASP may be a novel BC metastasis biomarker. - Highlights: • More invasive MDA-MB-231 overexpress VASP compared to MCF-7 breast cancer cells. • We prepared 3D collagen I gels of increasing concentration and characterized them. • VASP silencing downregulated Migfilin, β-catenin and uPA both in 2D and 3D culture. • Tumor spheroids lacking VASP demonstrated impaired invasion. • Kaplan-Meier plotter shows association of high VASP expression with poor survival.

Disciplinary action against physicians: who is likely to get disciplined?

Science.gov (United States)

Khaliq, Amir A; Dimassi, Hani; Huang, Chiung-Yu; Narine, Lutchmie; Smego, Raymond A

2005-07-01

We sought to determine the characteristics of disciplined physicians at-large and the risk of disciplinary action over time and to report the type and frequency of complaints and the nature of disciplinary actions against allopathic physicians in Oklahoma. Descriptive statistics, Kaplan-Meier analysis, and Cox proportional hazards modeling of publicly available data on physicians licensed by the Oklahoma Board of Medical Licensure and Supervision. Among 14,314 currently or previously licensed physicians, 396 (2.8%) had been disciplined. Using univariate proportional hazards analysis, men (P disciplinary action compared to US medical graduates (P disciplinary action, medical schools and residency training programs must continue to emphasize both patient care and medical professionalism as critical core competencies.

Descriptive epidemiology and natural history of idiopathic venous thromboembolism in U.S. active duty enlisted personnel, 1998-2007.

Science.gov (United States)

Freeman, Randall J; Li, Yuanzhang; Niebuhr, David W

2011-05-01

The estimated incidence of idiopathic venous thromboembolism (IVTE) cases in the United States ranges from 24,000 to 282,000/year. This analysis explores the incidence and prevalence of IVTE in the military and if cases experience increased attrition. The Defense Medical Surveillance System was searched for incident IVTE cases from 1998 through 2007. Enlisted cases were each matched to 3 controls. Kaplan-Meier survival analysis and Cox proportional hazard modeling were performed. We matched 463 cases to 1,389 controls. Outpatient IVTE rates have increased markedly from 1998 through 2007. Cases of all-cause attrition risk (0.56 [95% CI = 0.44, 0.72]) and rates were significantly less than controls (p readiness, and medical costs.

An electronic health record-enabled obesity database

Directory of Open Access Journals (Sweden)

Wood G

2012-05-01

Full Text Available Abstract Background The effectiveness of weight loss therapies is commonly measured using body mass index and other obesity-related variables. Although these data are often stored in electronic health records (EHRs and potentially very accessible, few studies on obesity and weight loss have used data derived from EHRs. We developed processes for obtaining data from the EHR in order to construct a database on patients undergoing Roux-en-Y gastric bypass (RYGB surgery. Methods Clinical data obtained as part of standard of care in a bariatric surgery program at an integrated health delivery system were extracted from the EHR and deposited into a data warehouse. Data files were extracted, cleaned, and stored in research datasets. To illustrate the utility of the data, Kaplan-Meier analysis was used to estimate length of post-operative follow-up. Results Demographic, laboratory, medication, co-morbidity, and survey data were obtained from 2028 patients who had undergone RYGB at the same institution since 2004. Pre-and post-operative diagnostic and prescribing information were available on all patients, while survey laboratory data were available on a majority of patients. The number of patients with post-operative laboratory test results varied by test. Based on Kaplan-Meier estimates, over 74% of patients had post-operative weight data available at 4 years. Conclusion A variety of EHR-derived data related to obesity can be efficiently obtained and used to study important outcomes following RYGB.

Intra-arterial therapy of neuroendocrine tumour liver metastases: comparing conventional TACE, drug-eluting beads TACE and yttrium-90 radioembolisation as treatment options using a propensity score analysis model

Energy Technology Data Exchange (ETDEWEB)

Minh, Duc Do; Gorodetski, Boris; Smolka, Susanne; Savic, Lynn Jeanette; Wainstejn, David [Charite Universitaetsmedizin, Campus Virchow Klinikum, Department of Diagnostic and Interventional Radiology, Berlin (Germany); Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Chapiro, Julius; Schlachter, Todd [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Huang, Qiang [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Capital Medical University, Department of Interventional Radiology, Beijing Chaoyang Hospital, Beijing (China); Liu, Cuihong [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Shandong Provincial Hospital Affiliated to Shandong University, The Ultrasound Department, Jinan (China); Lin, MingDe [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Philips Research North America, U/S Imaging and Interventions (UII), Cambridge, MA (United States); Gebauer, Bernhard [Charite Universitaetsmedizin, Campus Virchow Klinikum, Department of Diagnostic and Interventional Radiology, Berlin (Germany); Geschwind, Jean-Francois [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States)

2017-12-15

To compare efficacy, survival outcome and prognostic factors of conventional transarterial chemoembolisation (cTACE), drug-eluting beads TACE (DEB-TACE) and yttrium-90 radioembolisation (Y90) for the treatment of liver metastases from gastroenteropancreatic (GEP) neuroendocrine tumours (NELM). This retrospective analysis included 192 patients (58.6 years mean age, 56% men) with NELM treated with cTACE (N = 122), DEB-TACE (N = 26) or Y90 (N = 44) between 2000 and 2014. Radiologic response to therapy was assessed according to Response Evaluation Criteria in Solid Tumours (RECIST) and World Health Organization (WHO) criteria using periprocedural MR imaging. Survival analysis included propensity score analysis (PSA), median overall survival (MOS), hepatic progression-free survival, Kaplan-Meier using log-rank test and the uni- and multivariate Cox proportional hazards model (MVA). MOS of the entire study population was 28.8 months. As for cTACE, DEB-TACE and Y90, MOS was 33.8 months, 21.7 months and 23.6 months, respectively. According to the MVA, cTACE demonstrated a significantly longer MOS as compared to DEB-TACE (p <.01) or Y90 (p =.02). The 5-year survival rate after initial cTACE, DEB-TACE and Y90 was 28.2%, 10.3% and 18.5%, respectively. Upon PSA, our study suggests significant survival benefits for patients treated with cTACE as compared to DEB-TACE and Y90. This data supports the therapeutic decision for cTACE as the primary intra-arterial therapy option in patients with unresectable NELM until proven otherwise. (orig.)

A conversation with Drs. Kaplan and Moser about conflicting data, confusing results, and some recent treatment recommendations for the management of hypertension.

Science.gov (United States)

Post, Wendy; Moser, Marvin; Kaplan, Norman

2005-10-01

Following a hypertension symposium in Baltimore, MD, on June 1, 2005, Dr. Wendy Post from the Johns Hopkins University School of Medicine, Baltimore, MD, had the opportunity to interview two of the outstanding hypertension experts in the United States on several controversial issues in hypertension management. Dr. Norman Kaplan is Clinical Professor of Medicine at the Southwestern Health Science Center in Dallas, TX, and Dr. Marvin Moser is Clinical Professor of Medicine at the Yale University School of Medicine, New Haven, CT. Both have been leaders in the field of hypertension treatment and education for more than 40 years. Dr. Kaplan's book Clinical Hypertension has been a standard textbook since 1973 and is now in its ninth edition. Dr. Marvin Moser was the Senior Medical Consultant to the National High Blood Pressure Education Program from 1974 to 2002 and was Chairman of the first Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure and a member of the six subsequent committees. His book Clinical Management of Hypertension is in its seventh edition. Drs. Moser and Kaplan were corecipients of the 2004 International Society of Hypertension Award for Outstanding Contributions to Hypertension Treatment and Education and have lectured extensively throughout the United States and overseas.

Galleria mellonella infection model demonstrates high lethality of ST69 and ST127 uropathogenic E. coli.

Directory of Open Access Journals (Sweden)

Majed F Alghoribi

Full Text Available Galleria mellonella larvae are an alternative in vivo model for investigating bacterial pathogenicity. Here, we examined the pathogenicity of 71 isolates from five leading uropathogenic E. coli (UPEC lineages using G. mellonella larvae. Larvae were challenged with a range of inoculum doses to determine the 50% lethal dose (LD50 and for analysis of survival outcome using Kaplan-Meier plots. Virulence was correlated with carriage of a panel of 29 virulence factors (VF. Larvae inoculated with ST69 and ST127 isolates (10(4 colony-forming units/larvae showed significantly higher mortality rates than those infected with ST73, ST95 and ST131 isolates, killing 50% of the larvae within 24 hours. Interestingly, ST131 isolates were the least virulent. We observed that ST127 isolates are significantly associated with a higher VF-score than isolates of all other STs tested (P≤0.0001, including ST69 (P<0.02, but one ST127 isolate (strain EC18 was avirulent. Comparative genomic analyses with virulent ST127 strains revealed an IS1 mediated deletion in the O-antigen cluster in strain EC18, which is likely to explain the lack of virulence in the larvae infection model. Virulence in the larvae was not correlated with serotype or phylogenetic group. This study illustrates that G. mellonella are an excellent tool for investigation of the virulence of UPEC strains. The findings also support our suggestion that the incidence of ST127 strains should be monitored, as these isolates have not yet been widely reported, but they clearly have a pathogenic potential greater than that of more widely recognised clones, including ST73, ST95 or ST131.

Development of low head Kaplan turbine for power station rehabilitation project

Science.gov (United States)

Lim, S. M.; Ohtake, N.; Kurosawa, S.; Suzuki, T.; Yamasaki, T.; Nishi, H.

2012-11-01

This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.

Development of low head Kaplan turbine for power station rehabilitation project

International Nuclear Information System (INIS)

Lim, S M; Ohtake, N; Kurosawa, S; Suzuki, T; Yamasaki, T; Nishi, H

2012-01-01

This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.

Aplicación y técnicas del análisis de supervivencia en las investigaciones clínicas Application and techniques of survival analysis in clinical research

Directory of Open Access Journals (Sweden)

Anissa Gramatges Ortiz

2002-08-01

Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated

Concurrent chemoradiotherapy plus adjuvant chemotherapy versus concurrent chemoradiotherapy in locoregionally advanced nasopharyngeal carcinoma. A matched-pair multicenter analysis of outcomes

Energy Technology Data Exchange (ETDEWEB)

Dong, Yi-Yuan [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China); Guilin Medical University Affiliated Hospital, Department of Otorhinolaryngology, Guilin (China); Xiang, Chun [Nan Xishan Hospital, Department of Otorhinolaryngology, Guilin (China); Lu, Jian-Xun [Affiliated Hospital of Youjiang Medical University for Nationalities, Department of Oncology, Baise (China); Su, Yi-Xin [Lingshan People' s Hospital, Department of Radiation Oncology, Lingshan (China); Pan, Yu-Fei [Nan Xishan Hospital, Department of Radiation Oncology, Guilin (China); Cai, Rui; Zhang, Rong-Jun; He, Zhuo-Kai; Liu, Mei-Lian; Huang, Hui; Bai, Xue; Tang, Hua-Ying; Shi, Yun-Hua; Wang, Yan; Jiang, Wei [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China)

2016-06-15

The benefit of adjuvant chemotherapy (AC) in locoregionally advanced nasopharyngeal carcinoma (NPC) is controversial. This study compared concurrent chemoradiotherapy plus AC (CCRT/AC) with CCRT. Pair-matched analysis based on eight clinicopathological features of 244 patients treated with platinum-based CCRT/AC or CCRT alone was performed. Survival outcomes were assessed using the Kaplan-Meier method and log-rank test. Toxicities and response rates were compared using Fisher's exact test. Four-year overall survival, progression-free survival, distant failure-free survival, and locoregional failure-free survival were 72 %, 61 %, 71 %, and 81 %, respectively, for the CCRT arm, compared to 74 % (hazard ratio, HR 0.89; 95 % confidence interval, CI 0.64-1.23; P = 0.474), 62 % (HR 0.91, 95 % CI 0.68-1.20, P = 0.489), 73 % (HR 0.84, 95 % CI 0.59-1.18, P = 0.316), and 84 % (HR 0.84, 95 % CI 0.52-1.24, P = 0.323), respectively, for the CCRT/AC arm. Cox multivariate regression analysis demonstrated AC was not an independent prognostic factor. Overall, there was a higher incidence of grade 3-4 toxicities in the CCRT/AC arm. The most common grade 3-4 adverse events in the CCRT/AC arm were vomiting (27 %), nausea (43 %), leukopenia/neutropenia (23 %), thrombocytopenia (8.8 %), and anemia (6.2 %). Addition of AC to CCRT increased toxicities but did not improve survival in locoregionally advanced NPC. (orig.) [German] Der Nutzen der adjuvanten Chemotherapie (AC) bei lokoregional fortgeschrittenem nasopharyngealem Karzinom (NPC) ist kontrovers. In dieser Studie wurde die simultane Radiochemotherapie (''concurrent chemoradiotherapy'', CCRT) plus adjuvante Chemotherapie (AC) mit einer alleinigen CCRT verglichen. Die Matched-pair-Analyse basiert auf acht klinisch-pathologischen Merkmalen von 244 Patienten, die mit platinbasierter CCRT/AC oder alleiniger CCRT behandelt wurden. Die Ueberlebensendpunkte wurden mit der Kaplan-Meier-Methode und dem Log

Implementation of pressurized air injection system in a Kaplan prototype for the reduction of vibration caused by tip vortex cavitation

Science.gov (United States)

Rivetti, A.; Angulo, M.; Lucino, C.; Hene, M.; Capezio, O.; Liscia, S.

2016-11-01

Blade tip cavitation is a well-known phenomenon that affects the performance of large-diameter Kaplan turbines and induces structural vibration. Injection of pressurized air has been found to yield promising results in reducing those damaging effects. In this work, the results of an experimental test of air injection on a 9.5-m-diameter Kaplan turbine are reported. Experiments were performed for several load conditions and for two different net heads. Accelerations, pressure pulsation and noise emission were monitored for every tested condition. Results show that, at the expense of a maximum efficiency drop of 0.2%, air injection induces a decrease on the level of vibration from 57% up to 84%, depending on the load condition. Such decrease is seen to be proportional to the air flow rate, in the range from 0.06 to 0.8‰ (respect to the discharge at the best efficiency point).

Long non-coding RNA PVT1 as a novel potential biomarker for predicting the prognosis of colorectal cancer.

Science.gov (United States)

Fan, Heng; Zhu, Jian-Hua; Yao, Xue-Qing

2018-05-01

Long non-coding RNA (lncRNA) plays a very important role in the occurrence and development of various tumors, and is a potential biomarker for cancer diagnosis and prognosis. The purpose of this study was to investigate the relationship between the expression of lncRNA plasmacytoma variant translocation 1 (PVT1) and the prognostic significance in patients with colorectal cancer. The expression of PVT1 was measured by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) in cancerous and adjacent tissues of 210 colorectal cancer patients. The disease-free survival and overall survival of colorectal cancer patients were evaluated by Kaplan-Meier analysis, and univariate and multivariate analysis were performed by Cox proportional-hazards model. Our results revealed that PVT1 expression in cancer tissues of colorectal cancer was significantly higher than that of adjacent tissues ( Pcolorectal cancer patients, whether at TNM I/II stage or at TNM III/IV stage. A multivariate Cox regression analysis demonstrated that high PVT1 expression was an independent predictor of poor prognosis in colorectal cancer patients. Our results suggest that high PVT1 expression might be a potential biomarker for assessing tumor recurrence and prognosis in colorectal cancer patients.

Neyman, Markov processes and survival analysis.

Science.gov (United States)

Yang, Grace

2013-07-01

J. Neyman used stochastic processes extensively in his applied work. One example is the Fix and Neyman (F-N) competing risks model (1951) that uses finite homogeneous Markov processes to analyse clinical trials with breast cancer patients. We revisit the F-N model, and compare it with the Kaplan-Meier (K-M) formulation for right censored data. The comparison offers a way to generalize the K-M formulation to include risks of recovery and relapses in the calculation of a patient's survival probability. The generalization is to extend the F-N model to a nonhomogeneous Markov process. Closed-form solutions of the survival probability are available in special cases of the nonhomogeneous processes, like the popular multiple decrement model (including the K-M model) and Chiang's staging model, but these models do not consider recovery and relapses while the F-N model does. An analysis of sero-epidemiology current status data with recurrent events is illustrated. Fix and Neyman used Neyman's RBAN (regular best asymptotic normal) estimates for the risks, and provided a numerical example showing the importance of considering both the survival probability and the length of time of a patient living a normal life in the evaluation of clinical trials. The said extension would result in a complicated model and it is unlikely to find analytical closed-form solutions for survival analysis. With ever increasing computing power, numerical methods offer a viable way of investigating the problem.

Increased expression of hepatocyte nuclear factor 4 alpha transcribed by promoter 2 indicates a poor prognosis in hepatocellular carcinoma.

Science.gov (United States)

Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping

2017-10-01

Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p  = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.

Controlled, prospective, randomized, clinical split-mouth evaluation of partial ceramic crowns luted with a new, universal adhesive system/resin cement: results after 18 months.

Science.gov (United States)

Vogl, Vanessa; Hiller, Karl-Anton; Buchalla, Wolfgang; Federlin, Marianne; Schmalz, Gottfried

2016-12-01

A new universal adhesive with corresponding luting composite was recently marketed which can be used both, in a self-etch or in an etch-and-rinse mode. In this study, the clinical performance of partial ceramic crowns (PCCs) inserted with this adhesive and the corresponding luting material used in a self-etch or selective etch approach was compared with a self-adhesive universal luting material. Three PCCs were placed in a split-mouth design in 50 patients. Two PCCs were luted with a combination of a universal adhesive/resin cement (Scotchbond Universal/RelyX Ultimate, 3M ESPE) with (SB+E)/without (SB-E) selective enamel etching. Another PCC was luted with a self-adhesive resin cement (RelyX Unicem 2, 3M ESPE). Forty-eight patients were evaluated clinically according to FDI criteria at baseline and 6, 12 and 18 months. For statistical analyses, the chi-square test (α = 0.05) and Kaplan-Meier analysis were applied. Clinically, no statistically significant differences between groups were detected over time. Within groups, clinically significant increase for criterion "marginal staining" was detected for SB-E over 18 months. Kaplan-Meier analysis revealed significantly higher retention rates for SB+E (97.8 %) and SB-E (95.6 %) in comparison to RXU2 (75.6 %). The 18-month clinical performance of a new universal adhesive/composite combination showed no differences with respect to bonding strategy and may be recommended for luting PCCs. Longer-term evaluation is needed to confirm superiority of SB+E over SB-E. At 18 months, the new multi-mode adhesive, Scotchbond Universal, showed clinically reliable results when used for luting PCCs.

Evaluation of success after second Ahmed glaucoma valve implantation.

Science.gov (United States)

Nilforushan, Naveed; Yadgari, Maryam; Jazayeri, Anis Alsadat; Karimi, Nasser

2016-03-01

To evaluate the outcome of the second Ahmed glaucoma valve (AGV) surgery in eyes with failed previous AGV surgery. Retrospective case series. Following chart review, 36 eyes of 34 patients with second AGV implantation were enrolled in this study. The primary outcome measure was surgical success defined in terms of intraocular pressure (IOP) control using two criteria: Success was defined as IOP ≤21 mmHg (criterion 1) and IOP ≤16 mmHg (criterion 2), with at least 20% reduction in IOP, either with no medication (complete success) or with no more than two medications (qualified success). Kaplan-Meier survival analysis was used to determine the probability of surgical success. The average age of the patients was 32.7 years (range 4-65), and the mean duration of follow-up was 21.4 months (range 6-96). Preoperatively, the mean IOP was 26.94 mmHg (standard deviation [SD] 7.03), and the patients were using 2.8 glaucoma medications on average (SD 0.9). The mean IOP decreased significantly to 13.28 mmHg (SD 3.59) at the last postoperative visit (P = 0.00) while the patients needed even fewer glaucoma medications on average (1.4 ± 1.1, P = 0.00). Surgical success of second glaucoma drainage devices (Kaplan-Meier analysis), according to criterion 1, at 6, 12, 18, and 42 months was 94%, 85%, 80%, and 53% respectively, and according to criterion 2, was 94%, 85%, 75%, and 45%, respectively. Repeated AGV implantation seems to be a safe modality of treatment with acceptable success rate in cases with failed previous AGV surgery.

Basal 18F-fluoro-2-deoxy-d-glucose positron emission tomography/computed tomography as a prognostic biomarker in patients with locally advanced breast cancer

International Nuclear Information System (INIS)

Garcia Vicente, Ana Maria; Soriano Castrejon, Angel; Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano; Mar Munoz Sanchez, Maria del; Alvarez Cabellos, Ruth; Espinosa Aunion, Ruth

2015-01-01

To explore the relationship between basal 18 F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent 18 F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with 18 F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)

Basal {sup 18}F-fluoro-2-deoxy-d-glucose positron emission tomography/computed tomography as a prognostic biomarker in patients with locally advanced breast cancer

Energy Technology Data Exchange (ETDEWEB)

Garcia Vicente, Ana Maria; Soriano Castrejon, Angel [University General Hospital, Nuclear Medicine Department, Ciudad Real (Spain); Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano [University of Castilla-La Mancha, Department of Mathematics, Ciudad Real (Spain); Mar Munoz Sanchez, Maria del [Virgen de la Luz Hospital, Oncology Department, Cuenca (Spain); Alvarez Cabellos, Ruth [Virgen de la Salud Hospital, Oncology Department, Toledo (Spain); Espinosa Aunion, Ruth [La Mancha Centro Hospital, Oncology Department, Ciudad Real (Spain)

2015-11-15

To explore the relationship between basal {sup 18}F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent {sup 18}F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with {sup 18}F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)

PTFE grafts versus tunneled cuffed catheters for hemodialysis: which is the second choice when arteriovenous fistula is not feasible?

Science.gov (United States)

Donati, Gabriele; Cianciolo, Giuseppe; Mauro, Raffaella; Rucci, Paola; Scrivo, Anna; Marchetti, Antonio; Giampalma, Emanuela; Golfieri, Rita; Panicali, Laura; Iorio, Mario; Stella, Andrea; La Manna, Gaetano; Stefoni, Sergio

2015-02-01

Vascular access-related complications are still one of the leading causes of morbidity in hemodialysis patients. The aim of this study was to compare polytetrafluoroethylene (PTFE) grafts versus tunneled cuffed permanent catheters (TCCs) in terms of vascular access and patients' survival. An observational study was carried out with a 2-year follow-up. Eighty-seven chronic hemodialysis patients were enrolled: 31 with a PTFE graft as vascular access for hemodialysis versus 56 with a TCC. Patients' mean age was 63.8 ± 14.6 (grafts) versus 73.5 ± 11.3 years (TCCs), P = 0.001. Significantly more patients with TCC had atrial fibrillation than patients with grafts (30.3% versus 6.5%, P = 0.01). In an unadjusted Kaplan-Meier analysis, median TCC survival at 24 months was 5.4 months longer than that of PTFE grafts but not significantly (log-rank test = 1.3, P = ns). In a Cox regression analysis adjusted for age, gender, number of previous vascular accesses, diabetes, atrial fibrillation, smoking, and any complication, this lack of significant difference in survival of the vascular access between TCC and PTFE groups was confirmed and diabetes proved to be an independent risk factor for the survival of both vascular accesses considered (P = 0.02). In an unadjusted Kaplan-Meier analysis, a higher mortality was found in the TCC group than in the PTFE group at 24 months (log-rank test = 10.07, P PTFE grafts. When an arteriovenous fistula (AVF) is not possible, PTFE grafts can be considered the vascular access of second choice, whereas TCCs can be used when an AVF or PTFE graft are not feasible or as a bridge to AVF or PTFE graft creation. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Setting the stage for medieval plague: Pre-black death trends in survival and mortality.

Science.gov (United States)

DeWitte, Sharon N

2015-11-01

The 14(th) -century Black Death was one of the most devastating epidemics in human history, killing tens of millions of people in a short period of time. It is not clear why mortality rates during the epidemic were so high. One possibility is that the affected human populations were particularly stressed in the 14(th) century, perhaps as a result of repeated famines in areas such as England. This project examines survival and mortality in two pre-Black Death time periods, 11-12(th) centuries vs 13(th) century CE, to determine if demographic conditions were deteriorating before the epidemic occurred. This study is done using a sample of individuals from several London cemeteries that have been dated, in whole or in part, either to the 11-12(th) centuries (n = 339) or 13(th) century (n = 258). Temporal trends in survivorship and mortality are assessed via Kaplan-Meier survival analysis and by modeling time period as a covariate affecting the Gompertz hazard of adult mortality. The age-at-death distributions from the two pre-Black Death time periods are significantly different, with fewer older adults in 13(th) century. The results of Kaplan-Meier survival analysis indicate reductions in survival before the Black Death, with significantly lower survival in the 13(th) century (Mantel Cox p < 0.001). Last, hazard analysis reveals increases in mortality rates before the Black Death. Together, these results suggest that health in general was declining in the 13(th) century, and this might have led to high mortality during the Black Death. This highlights the importance of considering human context to understand disease in past and living human populations. © 2015 Wiley Periodicals, Inc.

Perioperative and mid-term oncologic outcomes of robotic assisted radical cystectomy with totally intracorporeal neobladder: Results of a propensity score matched comparison with open cohort from a single-centre series.

Science.gov (United States)

Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele

2018-04-17

In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

Lymph node density as a prognostic predictor in patients with betel nut-related oral squamous cell carcinoma.

Science.gov (United States)

Chang, Wei-Chin; Lin, Chun-Shu; Yang, Cheng-Yu; Lin, Chih-Kung; Chen, Yuan-Wu

2018-04-01

Lymph node metastasis in oral squamous cell carcinoma (OSCC) is a poor prognostic factor. The histopathologic stage (e.g., pN) is used to evaluate the severity of lymph node metastasis; however, the current staging system insufficiently predicts survival and recurrence. We investigated clinical outcomes and lymph node density (LND) in betel nut-chewing individuals. We retrospectively analyzed 389 betel nut-exposed patients with primary OSCC who underwent surgical resection in 2002-2015. The prognostic significance of LND was evaluated by overall survival (OS) and disease-free survival (DFS) using the Kaplan-Meier method. Kaplan-Meier analyses showed that the 5-year OS and DFS rates in all patients were 60.9 and 48.9%, respectively. Multivariate analysis showed that variables independently prognostic for OS were aged population (hazard ratio [HR] = 1.6, 95% confidence interval [95% CI] = 1.1-2.5; P = .025), and cell differentiation classification (HR = 2.4, 95% CI = 1.4-4.2; P = .002). In pathologic N-positive patients, a receiver operating characteristic (ROC) curve for OS was used and indicated the best cutoff of 0.05, and the multivariate analysis showed that LND was an independent predictor of OS (HR = 2.2, 95% CI = 1.3-3.7; P = .004). Lymph node density, at a cutoff of 0.05, was an independent predictor of OS and DFS. OS and DFS underwent multiple analyses, and LND remained significant. The pathologic N stage had no influence in the OS analysis. LND is a more reliable predictor of survival in betel nut-chewing patients for further post operation adjuvant treatment, such as reoperation or adjuvant radiotherapy.

Validating a Local Failure Risk Stratification for Use in Prospective Studies of Adjuvant Radiation Therapy for Bladder Cancer

International Nuclear Information System (INIS)

Baumann, Brian C.; He, Jiwei; Hwang, Wei-Ting; Tucker, Kai N.; Bekelman, Justin E.; Herr, Harry W.; Lerner, Seth P.; Guzzo, Thomas J.; Malkowicz, S. Bruce; Christodouleas, John P.

2016-01-01

Purpose: To inform prospective trials of adjuvant radiation therapy (adj-RT) for bladder cancer after radical cystectomy, a locoregional failure (LF) risk stratification was proposed. This stratification was developed and validated using surgical databases that may not reflect the outcomes expected in prospective trials. Our purpose was to assess sources of bias that may affect the stratification model's validity or alter the LF risk estimates for each subgroup: time bias due to evolving surgical techniques; trial accrual bias due to inclusion of patients who would be ineligible for adj-RT trials because of early disease progression, death, or loss to follow-up shortly after cystectomy; bias due to different statistical methods to estimate LF; and subgrouping bias due to different definitions of the LF subgroups. Methods and Materials: The LF risk stratification was developed using a single-institution cohort (n=442, 1990-2008) and the multi-institutional SWOG 8710 cohort (n=264, 1987-1998) treated with radical cystectomy with or without chemotherapy. We evaluated the sensitivity of the stratification to sources of bias using Fine-Gray regression and Kaplan-Meier analyses. Results: Year of radical cystectomy was not associated with LF risk on univariate or multivariate analysis after controlling for risk group. By use of more stringent inclusion criteria, 26 SWOG patients (10%) and 60 patients from the single-institution cohort (14%) were excluded. Analysis of the remaining patients confirmed 3 subgroups with significantly different LF risks with 3-year rates of 7%, 17%, and 36%, respectively (P<.01), nearly identical to the rates without correcting for trial accrual bias. Kaplan-Meier techniques estimated higher subgroup LF rates than competing risk analysis. The subgroup definitions used in the NRG-GU001 adj-RT trial were validated. Conclusions: These sources of bias did not invalidate the LF risk stratification or substantially change the model's LF estimates.

How to interpret the results of medical time series data analysis: Classical statistical approaches versus dynamic Bayesian network modeling.

Science.gov (United States)

Onisko, Agnieszka; Druzdzel, Marek J; Austin, R Marshall

2016-01-01

Classical statistics is a well-established approach in the analysis of medical data. While the medical community seems to be familiar with the concept of a statistical analysis and its interpretation, the Bayesian approach, argued by many of its proponents to be superior to the classical frequentist approach, is still not well-recognized in the analysis of medical data. The goal of this study is to encourage data analysts to use the Bayesian approach, such as modeling with graphical probabilistic networks, as an insightful alternative to classical statistical analysis of medical data. This paper offers a comparison of two approaches to analysis of medical time series data: (1) classical statistical approach, such as the Kaplan-Meier estimator and the Cox proportional hazards regression model, and (2) dynamic Bayesian network modeling. Our comparison is based on time series cervical cancer screening data collected at Magee-Womens Hospital, University of Pittsburgh Medical Center over 10 years. The main outcomes of our comparison are cervical cancer risk assessments produced by the three approaches. However, our analysis discusses also several aspects of the comparison, such as modeling assumptions, model building, dealing with incomplete data, individualized risk assessment, results interpretation, and model validation. Our study shows that the Bayesian approach is (1) much more flexible in terms of modeling effort, and (2) it offers an individualized risk assessment, which is more cumbersome for classical statistical approaches.

Outcome predictors in the management of intramedullary classic ependymoma: An integrative survival analysis.

Science.gov (United States)

Wang, Yinqing; Cai, Ranze; Wang, Rui; Wang, Chunhua; Chen, Chunmei

2018-06-01

This is a retrospective study.The aim of this study was to illustrate the survival outcomes of patients with classic ependymoma (CE) and identify potential prognostic factors.CE is the most common category of spinal ependymomas, but few published studies have discussed predictors of the survival outcome.A Boolean search of the PubMed, Embase, and OVID databases was conducted by 2 investigators independently. The objects were intramedullary grade II ependymoma according to 2007 WHO classification. Univariate Kaplan-Meier analysis and Log-Rank tests were performed to identify variables associated with progression-free survival (PFS) or overall survival (OS). Multivariate Cox regression was performed to assess hazard ratios (HRs) with 95% confidence intervals (95% CIs). Statistical analysis was performed by SPSS version 23.0 (IBM Corp.) with statistical significance defined as P analysis showed that patients who had undergone total resection (TR) had better PFS and OS than those with subtotal resection (STR) and biopsy (P = .002, P = .004, respectively). Within either univariate or multivariate analysis (P = .000, P = .07, respectively), histological type was an independent prognostic factor for PFS of CE [papillary type: HR 0.002, 95% CI (0.000-0.073), P = .001, tanycytic type: HR 0.010, 95% CI (0.000-0.218), P = .003].It was the first integrative analysis of CE to elucidate the correlation between kinds of factors and prognostic outcomes. Definite histological type and safely TR were foundation of CE's management. 4.

Factors Affecting Adjuvant Therapy in Stage III Pancreatic Cancer—Analysis of the National Cancer Database

Directory of Open Access Journals (Sweden)

Mridula Krishnan

2017-08-01

Full Text Available Background: Adjuvant therapy after curative resection is associated with survival benefit in stage III pancreatic cancer. We analyzed the factors affecting the outcome of adjuvant therapy in stage III pancreatic cancer and compared overall survival with different modalities of adjuvant treatment. Methods: This is a retrospective study of patients with stage III pancreatic cancer listed in the National Cancer Database (NCDB who were diagnosed between 2004 and 2012. Patients were stratified based on adjuvant therapy they received. Unadjusted Kaplan-Meier and multivariable Cox regression analysis were performed. Results: We analyzed a cohort included 1731 patients who were recipients of adjuvant therapy for stage III pancreatic cancer within the limits of our database. Patients who received adjuvant chemoradiation had the longest postdiagnosis survival time, followed by patients who received adjuvant chemotherapy, and finally patients who received no adjuvant therapy. On multivariate analysis, advancing age and patients with Medicaid had worse survival, whereas Spanish origin and lower Charlson comorbidity score had better survival. Conclusions: Our study is the largest trial using the NCDB addressing the effects of adjuvant therapy specifically in stage III pancreatic cancer. Within the limits of our study, survival benefit with adjuvant therapy was more apparent with longer duration from date of diagnosis.

Early experience with dual mobility acetabular systems featuring highly cross-linked polyethylene liners for primary hip arthroplasty in patients under fifty five years of age: an international multi-centre preliminary study.

Science.gov (United States)

Epinette, Jean-Alain; Harwin, Steven F; Rowan, Fiachra E; Tracol, Philippe; Mont, Michael A; Chughtai, Morad; Westrich, Geoffrey H

2017-03-01

To evaluate early performance of contemporary dual mobility acetabular systems with second generation annealed highly cross-linked polyethylene for primary hip arthroplasty of patients under 55 years of age. A prospective observational five years study across five centers in Europe and the USA of 321 patients with a mean age of 48.1 years was performed. Patients were assessed for causes of revision, hip instability, intra-prosthetic dissociation, Harris hip score and radiological signs of osteolysis. There were no dislocations and no intra-prosthetic dissociations. Kaplan Meier analysis demonstrated 97.51% survivorship for all cause revision and 99.68% survivorship for acetabular component revision at five years. Mean Harris hip score was 93.6. Two acetabular shells were revised for neck-rim implant impingement without dislocation and ten femoral stems were revised for causes unrelated to dual mobility implants. Contemporary highly cross-linked polyethylene dual mobility systems demonstrate excellent early clinical, radiological, and survivorship results in a cohort of patients that demand high performance from their implants. It is envisaged that DM and second generation annealed HXLPE may reduce THA instability and wear, the two most common causes of THA revision in hip arthroplasty.

Pressure relieving support surfaces (PRESSURE) trial: cost effectiveness analysis.

Science.gov (United States)

Iglesias, Cynthia; Nixon, Jane; Cranny, Gillian; Nelson, E Andrea; Hawkins, Kim; Phillips, Angela; Torgerson, David; Mason, Su; Cullum, Nicky

2006-06-17

To assess the cost effectiveness of alternating pressure mattresses compared with alternating pressure overlays for the prevention of pressure ulcers in patients admitted to hospital. Cost effectiveness analysis carried out alongside the pressure relieving support surfaces (PRESSURE) trial; a multicentre UK based pragmatic randomised controlled trial. 11 hospitals in six UK NHS trusts. Intention to treat population comprising 1971 participants. Kaplan Meier estimates of restricted mean time to development of pressure ulcers and total costs for treatment in hospital. Alternating pressure mattresses were associated with lower overall costs (283.6 pounds sterling per patient on average, 95% confidence interval--377.59 pounds sterling to 976.79 pounds sterling) mainly due to reduced length of stay in hospital, and greater benefits (a delay in time to ulceration of 10.64 days on average,--24.40 to 3.09). The differences in health benefits and total costs for hospital stay between alternating pressure mattresses and alternating pressure overlays were not statistically significant; however, a cost effectiveness acceptability curve indicated that on average alternating pressure mattresses compared with alternating pressure overlays were associated with an 80% probability of being cost saving. Alternating pressure mattresses for the prevention of pressure ulcers are more likely to be cost effective and are more acceptable to patients than alternating pressure overlays.

Improved long-term survival after intra-operative single high-dose ATG-Fresenius induction in renal transplantation: a single centre experience.

Science.gov (United States)

Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus

2009-01-01

In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778

Deficiency in origin licensing proteins impairs cilia formation: implications for the aetiology of Meier-Gorlin syndrome.

Directory of Open Access Journals (Sweden)

Tom Stiff

Full Text Available Mutations in ORC1, ORC4, ORC6, CDT1, and CDC6, which encode proteins required for DNA replication origin licensing, cause Meier-Gorlin syndrome (MGS, a disorder conferring microcephaly, primordial dwarfism, underdeveloped ears, and skeletal abnormalities. Mutations in ATR, which also functions during replication, can cause Seckel syndrome, a clinically related disorder. These findings suggest that impaired DNA replication could underlie the developmental defects characteristic of these disorders. Here, we show that although origin licensing capacity is impaired in all patient cells with mutations in origin licensing component proteins, this does not correlate with the rate of progression through S phase. Thus, the replicative capacity in MGS patient cells does not correlate with clinical manifestation. However, ORC1-deficient cells from MGS patients and siRNA-mediated depletion of origin licensing proteins also have impaired centrosome and centriole copy number. As a novel and unexpected finding, we show that they also display a striking defect in the rate of formation of primary cilia. We demonstrate that this impacts sonic hedgehog signalling in ORC1-deficient primary fibroblasts. Additionally, reduced growth factor-dependent signaling via primary cilia affects the kinetics of cell cycle progression following cell cycle exit and re-entry, highlighting an unexpected mechanism whereby origin licensing components can influence cell cycle progression. Finally, using a cell-based model, we show that defects in cilia function impair chondroinduction. Our findings raise the possibility that a reduced efficiency in forming cilia could contribute to the clinical features of MGS, particularly the bone development abnormalities, and could provide a new dimension for considering developmental impacts of licensing deficiency.

Impact of posterior rhabdosphincter reconstruction during robot-assisted radical prostatectomy: retrospective analysis of time to continence.

Science.gov (United States)

Woo, Jason R; Shikanov, Sergey; Zorn, Kevin C; Shalhav, Arieh L; Zagaja, Gregory P

2009-12-01

Posterior rhabdosphincter (PR) reconstruction during robot-assisted radical prostatectomy (RARP) was introduced in an attempt to improve postoperative continence. In the present study, we evaluate time to achieve continence in patients who are undergoing RARP with and without PR reconstruction. A prospective RARP database was searched for most recent cases that were accomplished with PR reconstruction (group 1, n = 69) or with standard technique (group 2, n = 63). We performed the analysis applying two definitions of continence: 0 pads per day or 0-1 security pad per day. Patients were evaluated by telephone interview. Statistical analysis was carried out using the Kaplan-Meier method and log-rank test. With PR reconstruction, continence was improved when defined as 0-1 security pad per day (median time of 90 vs 150 days; P = 0.01). This difference did not achieve statistical significance when continence was defined as 0 pads per day (P = 0.12). A statistically significant improvement in continence rate and time to achieve continence is seen in patients who are undergoing PR reconstruction during RARP, with continence defined as 0-1 security/safety pad per day. A larger, prospective and randomized study is needed to better understand the impact of this technique on postoperative continence.

Metastatic volume: an old oncologic concept and a new prognostic factor for stage IV melanoma patients.

Science.gov (United States)

Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S

2013-01-01

The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.

Smooth conditional distribution function and quantiles under random censorship.

Science.gov (United States)

Leconte, Eve; Poiraud-Casanova, Sandrine; Thomas-Agnan, Christine

2002-09-01

We consider a nonparametric random design regression model in which the response variable is possibly right censored. The aim of this paper is to estimate the conditional distribution function and the conditional alpha-quantile of the response variable. We restrict attention to the case where the response variable as well as the explanatory variable are unidimensional and continuous. We propose and discuss two classes of estimators which are smooth with respect to the response variable as well as to the covariate. Some simulations demonstrate that the new methods have better mean square error performances than the generalized Kaplan-Meier estimator introduced by Beran (1981) and considered in the literature by Dabrowska (1989, 1992) and Gonzalez-Manteiga and Cadarso-Suarez (1994).

A Point System to Forecast Hepatocellular Carcinoma Risk Before and After Treatment Among Persons with Chronic Hepatitis C.

Science.gov (United States)

Xing, Jian; Spradling, Philip R; Moorman, Anne C; Holmberg, Scott D; Teshale, Eyasu H; Rupp, Loralee B; Gordon, Stuart C; Lu, Mei; Boscarino, Joseph A; Schmidt, Mark A; Trinacty, Connie M; Xu, Fujie

2017-11-01

Risk of hepatocellular carcinoma (HCC) may be difficult to determine in the clinical setting. Develop a scoring system to forecast HCC risk among patients with chronic hepatitis C. Using data from the Chronic Hepatitis Cohort Study collected during 2005-2014, we derived HCC risk scores for males and females using an extended Cox model with aspartate aminotransferase-to-platelet ratio index (APRI) as a time-dependent variables and mean Kaplan-Meier survival functions from patient data at two study sites, and used data collected at two separate sites for external validation. For model calibration, we used the Greenwood-Nam-D'Agostino goodness-of-fit statistic to examine differences between predicted and observed risk. Of 12,469 patients (1628 with a history of sustained viral response [SVR]), 504 developed HCC; median follow-up was 6 years. Final predictors in the model included age, alcohol abuse, interferon-based treatment response, and APRI. Point values, ranging from -3 to 14 (males) and -3 to 12 (females), were established using hazard ratios of the predictors aligned with 1-, 3-, and 5-year Kaplan-Meier survival probabilities of HCC. Discriminatory capacity was high (c-index 0.82 males and 0.84 females) and external calibration demonstrated no differences between predicted and observed HCC risk for 1-, 3-, and 5-year forecasts among males (all p values >0.97) and for 3- and 5-year risk among females (all p values >0.87). This scoring system, based on age, alcohol abuse history, treatment response, and APRI, can be used to forecast up to a 5-year risk of HCC among hepatitis C patients before and after SVR.

Abnormal early cleavage events predict early embryo demise: sperm oxidative stress and early abnormal cleavage.

Science.gov (United States)

Burruel, Victoria; Klooster, Katie; Barker, Christopher M; Pera, Renee Reijo; Meyers, Stuart

2014-10-13

Human embryos resulting from abnormal early cleavage can result in aneuploidy and failure to develop normally to the blastocyst stage. The nature of paternal influence on early embryo development has not been directly demonstrated although many studies have suggested effects from spermatozoal chromatin packaging, DNA damage, centriolar and mitotic spindle integrity, and plasma membrane integrity. The goal of this study was to determine whether early developmental events were affected by oxidative damage to the fertilizing sperm. Survival analysis was used to compare patterns of blastocyst formation based on P2 duration. Kaplan-Meier survival curves demonstrate that relatively few embryos with short (P2 times reached blastocysts, and the two curves diverged beginning on day 4, with nearly all of the embryos with longer P2 times reaching blastocysts by day 6 (p < .01). We determined that duration of the 2nd to 3rd mitoses were sensitive periods in the presence of spermatozoal oxidative stress. Embryos that displayed either too long or too short cytokineses demonstrated an increased failure to reach blastocyst stage and therefore survive for further development. Although paternal-derived gene expression occurs later in development, this study suggests a specific role in early mitosis that is highly influenced by paternal factors.

Age-Related Trends in Hip Arthroscopy: A Large Cross-Sectional Analysis.

Science.gov (United States)

Sing, David C; Feeley, Brian T; Tay, Bobby; Vail, Thomas P; Zhang, Alan L

2015-12-01

To analyze a large national private payer population in the United States for trends over time in hip arthroscopy by age groups and to determine the rate of conversion to total hip arthroplasty (THA) after hip arthroscopy. We performed a retrospective analysis using the PearlDiver private insurance patient record database from 2007 through 2011. Hip arthroscopy procedures including newly introduced codes such as osteochondroplasty of cam and pincer lesions and labral repair were queried. Hip arthroscopy incidence and conversion rates to THA were stratified by age. Chi-squared analysis was used for statistical comparison. Conversion to THA was evaluated using Kaplan-Meier analysis. From 2007 through 2011, 20,484,172 orthopaedic patients were analyzed. Hip arthroscopy was performed in 8,227 cases (mean annual incidence, 2.7 cases per 10,000 orthopaedic patients). The incidence of hip arthroscopies increased over 250% from 1.6 cases per 10,000 in 2007 to 4.0 cases per 10,000 in 2011 (P arthroscopy, 17% of patients older than 50 required conversion to THA, compared with arthroscopy procedures are increasing in popularity across all age groups, with patients ages 40 to 49 having the highest incidence in this large cross-sectional population, despite a high rate of early conversion to THA within 2 years in patients over 50. IV, cross-sectional study. Copyright © 2015 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

pFAK-Y397 overexpression as both a prognostic and a predictive biomarker for patients with metastatic osteosarcoma.

Science.gov (United States)

Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit

2017-01-01

Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.

Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.

Science.gov (United States)

Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang

The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.

MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer

Science.gov (United States)

2012-12-01

hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA

Application of Enlisted Force Retention Levels and Career Field Stability

Science.gov (United States)

2017-03-23

APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial

Resultado do tratamento cirúrgico das neoplasias do seio piriforme

Directory of Open Access Journals (Sweden)

Costa Claudiney C.

2003-01-01

Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.

Pesticide mixtures in the Swedish streams: Environmental risks, contributions of individual compounds and consequences of single-substance oriented risk mitigation.

Science.gov (United States)

Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas

2017-11-15

This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still

Tumour heterogeneity in non-small cell lung carcinoma assessed by CT texture analysis: a potential marker of survival

International Nuclear Information System (INIS)

Ganeshan, Balaji; Miles, Ken; Panayiotou, Elleny; Burnand, Kate; Dizdarevic, Sabina

2012-01-01

To establish the potential for tumour heterogeneity in non-small cell lung cancer (NSCLC) as assessed by CT texture analysis (CTTA) to provide an independent marker of survival for patients with NSCLC. Tumour heterogeneity was assessed by CTTA of unenhanced images of primary pulmonary lesions from 54 patients undergoing 18 F-fluorodeoxyglucose (FDG) PET-CT for staging of NSCLC. CTTA comprised image filtration to extract fine, medium and coarse features with quantification of the distribution of pixel values (uniformity) within the filtered images. Receiver operating characteristics identified thresholds for PET and CTTA parameters that were related to patient survival using Kaplan-Meier analysis. The median (range) survival was 29.5 (1-38) months. 24, 10, 14 and 6 patients had tumour stages I, II, III and IV respectively. PET stage and tumour heterogeneity assessed by CTTA were significant independent predictors of survival (PET stage: Odds ratio 3.85, 95% confidence limits 0.9-8.09, P = 0.002; CTTA: Odds ratio 56.4, 95% confidence limits 4.79-666, p = 0.001). SUV was not a significantly associated with survival. Assessment of tumour heterogeneity by CTTA of non-contrast enhanced images has the potential for to provide a novel, independent predictor of survival for patients with NSCLC. (orig.)

Relationship between angina pectoris and outcomes in patients with heart failure and reduced ejection fraction: an analysis of the Controlled Rosuvastatin Multinational Trial in Heart Failure (CORONA).

Science.gov (United States)

Badar, Athar A; Perez-Moreno, Ana Cristina; Jhund, Pardeep S; Wong, Chih M; Hawkins, Nathaniel M; Cleland, John G F; van Veldhuisen, Dirk J; Wikstrand, John; Kjekshus, John; Wedel, Hans; Watkins, Stuart; Gardner, Roy S; Petrie, Mark C; McMurray, John J V

2014-12-21

Angina pectoris is common in patients with heart failure and reduced ejection fraction (HF-REF) but its relationship with outcomes has not been well defined. This relationship was investigated further in a retrospective analysis of the Controlled Rosuvastatin Multinational Trial in Heart Failure (CORONA). Four thousand, eight hundred and seventy-eight patients were divided into three categories: no history of angina and no chest pain at baseline (Group A; n = 1240), past history of angina but no chest pain at baseline (Group B; n = 1353) and both a history of angina and chest pain at baseline (Group C; n = 2285). Outcomes were examined using Kaplan-Meier and Cox regression survival analysis. Compared with Group A, Group C had a higher risk of non-fatal myocardial infarction or unstable angina (HR: 2.36, 1.54-3.61; P angina are at an increased risk of acute coronary syndrome and HF hospitalization. Whether these patients would benefit from more aggressive medical therapy or percutaneous revascularization is not known and merits further investigation. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

GSK-3α Is a Novel Target of CREB and CREB-GSK-3α Signaling Participates in Cell Viability in Lung Cancer.

Directory of Open Access Journals (Sweden)

Sin-Aye Park

Full Text Available Overexpression or activation of cyclic AMP-response element-binding protein (CREB has been known to be involved in several human malignancies, including lung cancer. Genes regulated by CREB have been reported to suppress apoptosis, induce cell proliferation, inflammation, and tumor metastasis. However, the critical target genes of CREB in lung cancer have not been well understood. Here, we identified GSK-3α as one of the CREB target genes which is critical for the viability of lung cancer cells. The CREB knockdown significantly reduced the expression of GSK-3α and the direct binding of CREB on the promoter of GSK3A was identified. Kaplan-Meier analysis with a public database showed a prognostic significance of aberrant GSK-3α expression in lung cancer. Inhibition of GSK-3α suppressed cell viability, colony formation, and tumor growth. For the first time, we demonstrated that GSK-3α is regulated by CREB in lung cancer and is required for the cell viability. These findings implicate CREB-GSK-3α axis as a novel therapeutic target for lung cancer treatment.

KRAS polymorphisms are associated with survival of CRC in Chinese population.

Science.gov (United States)

Dai, Qiong; Wei, Hui Lian; Huang, Juan; Zhou, Tie Jun; Chai, Li; Yang, Zhi-Hui

2016-04-01

rs12245, rs12587, rs9266, rs1137282, rs61764370, and rs712 of KRAS oncogene are characterized in the 3'UTR. The study highlights the important role of these polymorphisms playing in the susceptibility, oxaliplatin-based chemotherapy sensitivity, progression, and prognosis of CRC. Improved multiplex ligation detection reaction (iMLDR) technique is used for genotyping. An unconditional logistic regression model was used to estimate the association of certain polymorphism and CRC risk. The Kaplan-Meier method, log-rank test, and Cox regression model were used to evaluate the effects of polymorphisms on survival analysis. Results demonstrated that TT genotype and T allele of rs712 were associated with the increased risk of CRC; the patients with GG genotype and G allele of rs61764370 had a shorter survival and a higher risk of relapse or metastasis of CRC. Our studies supported the conclusions that rs61764370 and rs712 polymorphisms of the KRAS are functional and it may play an important role in the development of CRC and oxaliplatin-based chemotherapy efficiency and prognosis of CRC.

Eigentumors for prediction of treatment failure in patients with early-stage breast cancer using dynamic contrast-enhanced MRI: a feasibility study

Science.gov (United States)

Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.

2017-08-01

We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P  <  0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P  <  0.0001) and the triple-negative subtype tumors (P  =  0.0039), but not for tumors of the HER2 subtype (P  =  0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.

A prospective observational study comparing a physiological scoring system with time-based discharge criteria in pediatric ambulatory surgical patients.

Science.gov (United States)

Armstrong, James; Forrest, Helen; Crawford, Mark W

2015-10-01

Discharge criteria based on physiological scoring systems can be used in the postanesthesia care unit (PACU) to fast-track patients after ambulatory surgery; however, studies comparing physiological scoring systems with traditional time-based discharge criteria are lacking. The purpose of this study was to compare PACU discharge readiness times using physiological vs time-based discharge criteria in pediatric ambulatory surgical patients. We recorded physiological observations from consecutive American Society of Anesthesiologists physical status I-III patients aged 1-18 yr who were admitted to the PACU after undergoing ambulatory surgery in a tertiary academic pediatric hospital. The physiological score was a combination of the Aldrete and Chung systems. Scores were recorded every 15 min starting upon arrival in the PACU. Patients were considered fit for discharge once they attained a score ≥12 (maximum score, 14), provided no score was zero, with the time to achieve a score ≥12 defining the criteria-based discharge (CBD) time. Patients were discharged from the PACU when both the CBD and the existing time-based discharge (TBD) criteria were met. The CBD and TBD data were compared using Kaplan-Meier and log-rank analysis. Observations from 506 children are presented. Median (interquartile range [IQR]) age was 5.5 [2.8-9.9] yr. Median [IQR] CBD and TBD PACU discharge readiness times were 30 [15-45] min and 60 [45-60] min, respectively. Analysis of Kaplan-Meier curves indicated a significant difference in discharge times using the different criteria (hazard ratio, 5.43; 95% confidence interval, 4.51 to 6.53; P < 0.001). All patients were discharged home without incident. This prospective study suggests that discharge decisions based on physiological criteria have the potential for significantly speeding the transit of children through the PACU, thereby enhancing PACU efficiency and resource utilization.

Demonstration sensitivity analysis for RADTRAN III

International Nuclear Information System (INIS)

Neuhauser, K.S.; Reardon, P.C.

1986-10-01

A demonstration sensitivity analysis was performed to: quantify the relative importance of 37 variables to the total incident free dose; assess the elasticity of seven dose subgroups to those same variables; develop density distributions for accident dose to combinations of accident data under wide-ranging variations; show the relationship between accident consequences and probabilities of occurrence; and develop limits for the variability of probability consequence curves

Environmental analysis for pipeline gas demonstration plants

Energy Technology Data Exchange (ETDEWEB)

Stinton, L.H.

1978-09-01

The Department of Energy (DOE) has implemented programs for encouraging the development and commercialization of coal-related technologies, which include coal gasification demonstration-scale activities. In support of commercialization activities the Environmental Analysis for Pipeline Gas Demonstration Plants has been prepared as a reference document to be used in evaluating potential environmental and socioeconomic effects from construction and operation of site- and process-specific projects. Effluents and associated impacts are identified for six coal gasification processes at three contrasting settings. In general, impacts from construction of a high-Btu gas demonstration plant are similar to those caused by the construction of any chemical plant of similar size. The operation of a high-Btu gas demonstration plant, however, has several unique aspects that differentiate it from other chemical plants. Offsite development (surface mining) and disposal of large quantities of waste solids constitute important sources of potential impact. In addition, air emissions require monitoring for trace metals, polycyclic aromatic hydrocarbons, phenols, and other emissions. Potential biological impacts from long-term exposure to these emissions are unknown, and additional research and data analysis may be necessary to determine such effects. Possible effects of pollutants on vegetation and human populations are discussed. The occurrence of chemical contaminants in liquid effluents and the bioaccumulation of these contaminants in aquatic organisms may lead to adverse ecological impact. Socioeconomic impacts are similar to those from a chemical plant of equivalent size and are summarized and contrasted for the three surrogate sites.

Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

Energy Technology Data Exchange (ETDEWEB)

Petit, O; Nilsson, H [Division of Fluid Mechanics, Chalmers University of Technology, Hoersalsvaegen 7A, SE-41296 Goeteborg (Sweden); Mulu, B; Cervantes, M, E-mail: olivierp@chalmers.s [Division of Fluid Mechanics, Luleaa University of Technology, SE-971 87 Luleaa (Sweden)

2010-08-15

The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

Science.gov (United States)

Petit, O.; Mulu, B.; Nilsson, H.; Cervantes, M.

2010-08-01

The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

International Nuclear Information System (INIS)

Petit, O; Nilsson, H; Mulu, B; Cervantes, M

2010-01-01

The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

Directory of Open Access Journals (Sweden)

Strazzullo Viviana

2006-12-01

Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

A method to combine hydrodynamics and constructive design in the optimization of the runner blades of Kaplan turbines

International Nuclear Information System (INIS)

Miclosina, C O; Balint, D I; Campian, C V; Frunzaverde, D; Ion, I

2012-01-01

This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from 'Eftimie Murgu' University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.

A method to combine hydrodynamics and constructive design in the optimization of the runner blades of Kaplan turbines

Science.gov (United States)

Miclosina, C. O.; Balint, D. I.; Campian, C. V.; Frunzaverde, D.; Ion, I.

2012-11-01

This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from "Eftimie Murgu" University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.

Causes of death in long-term lung cancer survivors: a SEER database analysis.

Science.gov (United States)

Abdel-Rahman, Omar

2017-07-01

Long-term (>5 years) lung cancer survivors represent a small but distinct subgroup of lung cancer patients and information about the causes of death of this subgroup is scarce. The Surveillance, Epidemiology and End Results (SEER) database (1988-2008) was utilized to determine the causes of death of long-term survivors of lung cancer. Survival analysis was conducted using Kaplan-Meier analysis and multivariate analysis was conducted using a Cox proportional hazard model. Clinicopathological characteristics and survival outcomes were assessed for the whole cohort. A total of 78,701 lung cancer patients with >5 years survival were identified. This cohort included 54,488 patients surviving 5-10 years and 24,213 patients surviving >10 years. Among patients surviving 5-10 years, 21.8% were dead because of primary lung cancer, 10.2% were dead because of other cancers, 6.8% were dead because of cardiac disease and 5.3% were dead because of non-malignant pulmonary disease. Among patients surviving >10 years, 12% were dead because of primary lung cancer, 6% were dead because of other cancers, 6.9% were dead because of cardiac disease and 5.6% were dead because of non-malignant pulmonary disease. On multivariate analysis, factors associated with longer cardiac-disease-specific survival in multivariate analysis include younger age at diagnosis (p death from primary lung cancer is still significant among other causes of death even 20 years after diagnosis of lung cancer. Moreover, cardiac as well as non-malignant pulmonary causes contribute a considerable proportion of deaths in long-term lung cancer survivors.

How Do We Defend Democratic Education? Lois Weiner and Andy Kaplan Respond to Diane Ravitch's "The Reign of Error"

Science.gov (United States)

Weiner, Lois; Kaplan, Andy

2014-01-01

In this commentary, Andy Kaplan discusses with Lois Weiner, Diane Ravitch's latest book "The Reign of Error," which combines scholarly argument and scrupulous research in defense of democratic education. Weiner notes, the book will prove an important resource in the ongoing struggle for the survival of public schooling. Weiner adds,…

Uterine Carcinosarcoma Confined to the Pelvis: A Retrospective Review and Outcome Analysis

International Nuclear Information System (INIS)

Li, H.; TenNapel, M.J.; Bhatia, S.K.; Ahmed, A.; Lin, L.; Jacobson, G.

2014-01-01

Objective. We compared the treatments of uterine carcinosarcoma at our institution and evaluated their impact on survival. Methods. A retrospective analysis was performed on 60 eligible patients with carcinosarcoma limited to the pelvis. Subjects were divided into four categories: surgery, surgery plus chemotherapy, surgery plus radiation therapy, and a combination of surgery, chemotherapy, and RT. The most commonly used chemotherapy was cisplatin and/or carboplatin and taxol. Radiotherapy included external beam radiation therapy (EBRT) alone or with high dose rate (HDR) brachytherapy or HDR brachytherapy alone. Survival probability data were computed using the Kaplan-Meier method. The differences between groups were compared using the log-rank test. Results. The combination of surgery and radiation therapy with or without chemotherapy is seen to improve overall survival (OS) compared to surgery alone (Ρ =0.044 and Ρ =0.028 resp.). Brachytherapy involving three HDR vaginal cylinder fractions shows an equally effective reduction in local recurrence compared to EBRT. Conclusion. Our study of a relatively large number of carcinosarcoma patients suggests that adjuvant radiation therapy improves OS compared to surgery alone. Brachytherapy with 3 HDR vaginal cylinder fractions is preferred because of its time-saving, better tolerance, low toxicity and equivalent OS, and local control compared to EBRT.

Role of IKK-alpha in EGFR Signaling Regulation

Science.gov (United States)

2013-09-01

heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3

Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2

DEFF Research Database (Denmark)

Sarkisian, Laura; Saaby, L.; Poulsen, T. S.

2015-01-01

-year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...

Prognostic and survival analysis of 837 Chinese colorectal cancer patients.

Science.gov (United States)

Yuan, Ying; Li, Mo-Dan; Hu, Han-Guang; Dong, Cai-Xia; Chen, Jia-Qi; Li, Xiao-Fen; Li, Jing-Jing; Shen, Hong

2013-05-07

To develop a prognostic model to predict survival of patients with colorectal cancer (CRC). Survival data of 837 CRC patients undergoing surgery between 1996 and 2006 were collected and analyzed by univariate analysis and Cox proportional hazard regression model to reveal the prognostic factors for CRC. All data were recorded using a standard data form and analyzed using SPSS version 18.0 (SPSS, Chicago, IL, United States). Survival curves were calculated by the Kaplan-Meier method. The log rank test was used to assess differences in survival. Univariate hazard ratios and significant and independent predictors of disease-specific survival and were identified by Cox proportional hazard analysis. The stepwise procedure was set to a threshold of 0.05. Statistical significance was defined as P analysis suggested age, preoperative obstruction, serum carcinoembryonic antigen level at diagnosis, status of resection, tumor size, histological grade, pathological type, lymphovascular invasion, invasion of adjacent organs, and tumor node metastasis (TNM) staging were positive prognostic factors (P analysis showed a significant statistical difference in 3-year survival among these groups: LNR1, 73%; LNR2, 55%; and LNR3, 42% (P analysis results showed that histological grade, depth of bowel wall invasion, and number of metastatic lymph nodes were the most important prognostic factors for CRC if we did not consider the interaction of the TNM staging system (P < 0.05). When the TNM staging was taken into account, histological grade lost its statistical significance, while the specific TNM staging system showed a statistically significant difference (P < 0.0001). The overall survival of CRC patients has improved between 1996 and 2006. LNR is a powerful factor for estimating the survival of stage III CRC patients.

Runaway transient simulation of a model Kaplan turbine

Energy Technology Data Exchange (ETDEWEB)

Liu, S; Liu, D; Wu, Y [State Key Laboratory of Hydroscience and Engineering, Department of Thermal Eng., Tsinghua University, Beijing, 100084 (China); Zhou, D [Water Conservancy and Hydropower Eng., Hohai University, Nanjing. 210098 (China); Nishi, M, E-mail: liushuhong@tsinghua.edu.c [Kyushu Inst. Tech. Senior Academy, Kitakyushu, 804-8550 (Japan)

2010-08-15

The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-{epsilon} turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

Runaway transient simulation of a model Kaplan turbine

Science.gov (United States)

Liu, S.; Zhou, D.; Liu, D.; Wu, Y.; Nishi, M.

2010-08-01

The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-epsilon turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

Runaway transient simulation of a model Kaplan turbine

International Nuclear Information System (INIS)

Liu, S; Liu, D; Wu, Y; Zhou, D; Nishi, M

2010-01-01

The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-ε turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

Analytical Method to Estimate Fatigue Life Time Duration in Service for Runner Blade Mechanism of Kaplan Turbines

Directory of Open Access Journals (Sweden)

Ana – Maria Budai

2010-10-01

Full Text Available The paper present an analytical method that can be used to determianted fatigue life time duration in service for runner blade mechanism of Kaplan turbines. The study was made for lever button of runer blade mechanism using two analytical relation to calculate the maximum number of stress cycles whereupon the mechanism work without any damage. To estimate fatigue life time duration will be used a formula obtained from one of most comon cumulative damage methodology taking in consideration the real exploatation conditions of a specified Kapaln turbine.

Strategy for personalized treatment of human papillomavirus-positive oropharyngeal squamous cell carcinoma

International Nuclear Information System (INIS)

Mizumachi, Takatsugu; Hatakeyama, Hiromitsu; Kano, Satoshi; Sakashita, Tomohiro; Suzuki, Seigo; Homma, Akihiro; Oridate, Nobuhiko; Fukuda, Satoshi

2011-01-01

We performed a retrospective analysis of the association between tumor HPV status and the demographic and clinicopathological parameters of 83 patients with oropharyngeal squamous cell carcinoma at Hokkaido University Hospital, Japan, between 1998 and 2010. The parameters included age, gender, tumor subsite, Tumor-Node-Metastasis (TNM) stage, and overall survival. HPV status was established by multiplex polymerase chain reaction analysis. Of the 83 oropharyngeal cancers, 22 were positive for HPV-16, two for HPV-18, and one for HPV-35 and HPV-58. Kaplan-Meier survival analysis showed improved overall survival rates in patients with HPV-positive tumors (p=0.0024) compared with HPV-negative tumors. Of the 51 patients who received chemoradiotherapy, HPV-positive patients experienced better overall survival than HPV-negative patients (p=0.0024). HPV status is a significantly favorable prognostic factor in oropharyngeal cancer in Japan. (author)

Results of primary central nervous system lymphoma treated by radiation and chemotherapy. Retrospective analysis of twelve institutions in the Tokai district of Japan, 1995-1999

International Nuclear Information System (INIS)

Kawamura, Toshiki; Ishiguchi, Tsuneo; Shibamoto, Yuta

2006-01-01

We analyzed the therapeutic results and prognostic factors of 46 primary central nervous system lymphoma (PCNSL) patients who were treated at twelve institutions in the Tokai district of Japan between 1995 and 1999. We compared the results with those of a Japanese nationwide survey performed in the past. We sent each institution a questionnaire about the state of patients' disease, pathological type, method and doses of radiotherapy, regimen and intensity of chemotherapy, and patients' prognoses. The range of patients' ages was 33 to 93 years (median, 61 years). Thirty-one were men and 15 were women. The most prevalent histology was diffuse large B cell type (33 patients). We used the Kaplan-Meier method to calculate the survival rate and Cox's proportional hazards model to analyze the prognostic factors. The five-year cumulative survival rate was 25%, and the median survival time was 22.7 months. The five-year disease-free survival rate was 23%. In monovariate analysis, patients who were both younger than 60 years old and had a World Health Organization (WHO) performance status (PS) score equal to or less than 2 showed a better survival rate. Furthermore, the patients receiving systemic chemotherapy showed a significantly better local control rate. In addition, patients who received systemic chemotherapy achieved a higher complete remission rate than those not receiving it. However, no factors that significantly influenced survival rate were identified in multivariate analysis. We demonstrated that the therapeutic outcome of PCNSL patients has recently improved. In particular, patients with good PS showed better local control than those with poor PS. However, we could not identify any significant prognostic factors in PCNSL patients. (author)

Analysis of Skylab IV fluid mechanic science demonstration

Science.gov (United States)

Klett, M. G.; Bourgeois, S. V.

1975-01-01

Several science demonstrations performed on Skylab III and IV were concerned with the behavior of fluid drops free floating in microgravity. These demonstrations, with large liquid drops, included the oscillation, rotation, impact and coalescence, and air injection into the drops. Rayleigh's analysis of the oscillation of spherical drops of a liquid predicts accurately the effect of size and surface tension on the frequency of vibrated water globules in the Skylab demonstration. However, damping occurred much faster than predicted by Lamb's or Scriven's analyses of the damping time for spherical drops. The impact demonstrations indicated that a minimum velocity is necessary to overcome surface forces and effect a coalescence, but a precise criterion for the coalescence of liquids in low g could not be determined.

The prognostic value of time parameters in adjuvant radiotherapy of head and neck cancer. A retrospective analysis of 138 patients

International Nuclear Information System (INIS)

Dietl, B.; Schaefer, C.; Koelbl, O.

2005-01-01

Purpose: to answer the question, how the parameters waiting time, radiation treatment time and overall treatment time (OTT) influenced the endpoints overall (OS), event-free (EFS) and local recurrence-free survival (LRFS) in patients with locally advanced head-and-neck cancer, who had received postoperative radiotherapy. Patients and methods: 138 patients were included into a retrospective analysis from 10/1993 to 05/2000. Besides the time parameters waiting time, radiation treatment time and OTT, tumor- and therapy-related parameters (T-, N-, R-status, grading, tumor site, surgical technique, and postoperative hemoglobin < 12 g/dl) with potential impact on the endpoints were investigated in the univariate analysis (Kaplan-Meier log-rank test). Individual parameters with a significant impact (p = 0.05) were subjected to a multivariate Cox regression analysis. Results: besides a postoperative hemoglobin value < 12 g/dl, in the univariate analysis an OTT ≥ 105 days negatively influenced all endpoints, as well as a radiation treatment time ≥ 60 days. On multivariate Cox regression analysis, postoperative hemoglobin < 12 g/dl and an OTT ≥ 105 days were identified as independent negative prognostic factors for all endpoints. Conclusion: the waiting time should be managed according to the ASARA (as short as reasonably achievable) recommendation, radiation treatment should not be protracted exceeding an overall treatment of 105 days. Generally, time parameters should be routinely included in the standard tumor documentation, thus facilitating further evaluation of these prognostically relevant factors. (orig.)

Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis

Directory of Open Access Journals (Sweden)

Amal Saki Malehi

2016-01-01

Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.

Statistical evaluation of a project to estimate fish trajectories through the intakes of Kaplan hydropower turbines

Science.gov (United States)

Sutton, Virginia Kay

This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.

Multivariate analysis of factors influencing the effect of radiosynovectomy

International Nuclear Information System (INIS)

Farahati, J.; Schulz, G.; Koerber, C.; Geling, M.; Schmeider, P.; Reiners, Chr.; Wendler, J.; Kenn, W.; Reidemeister, C.

2002-01-01

Objective: In this prospective study, the time to remission after radiosynovectomy (RSV) was analyzed and the influence of age, sex, underlying disease, type of joint, and duration of illness on the success rate of RSV was determined. Methods: A total number of 57 patients with rheumatoid arthritis (n = 33) and arthrosis (n = 21) with a total number of 130 treated joints (36 knee, 66 small and 28 medium-size joints) were monitored using visual analogue scales (VAS) from one week before RSV up to four to six months after RSV. The patients had to answer 3 times daily for pain intensity of the treated joint. The time until remission was determined according to the Kaplan-Meier survivorship function. The influence of the prognosis parameters on outcome of RSV was determined by multivariate discriminant analysis. Results: After six months, the probability of pain relief of more than 20% amounted to 78% and was significantly dependent on the age of the patient (p = 0.02) and the duration of illness (p = 0.05), however not on sex (p = 0.17), underlying disease (p = 0.23), and type of joint (p = 0.69). Conclusion: Irrespective of sex, type of joint and underlying disease, a measurable pain relief can be achieved with RSV in 78% of the patients with synovitis, whereby effectiveness is decreasing with increasing age and progress of illness. (orig.) [de

Prior history of non-melanoma skin cancer is associated with increased mortality in patients with chronic lymphocytic leukemia

Science.gov (United States)

Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola

2009-01-01

We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092

Late rectal toxicity after conformal radiotherapy of prostate cancer (I): multivariate analysis and dose-response

International Nuclear Information System (INIS)

Skwarchuk, Mark W.; Jackson, Andrew; Zelefsky, Michael J.; Venkatraman, Ennapadam S.; Cowen, Didier M.; Levegruen, Sabine; Burman, Chandra M.; Fuks, Zvi; Leibel, Steven A.; Ling, C. Clifton

2000-01-01

Purpose: The purpose of this paper is to use the outcome of a dose escalation protocol for three-dimensional conformal radiation therapy (3D-CRT) of prostate cancer to study the dose-response for late rectal toxicity and to identify anatomic, dosimetric, and clinical factors that correlate with late rectal bleeding in multivariate analysis. Methods and Materials: Seven hundred forty-three patients with T1c-T3 prostate cancer were treated with 3D-CRT with prescribed doses of 64.8 to 81.0 Gy. The 5-year actuarial rate of late rectal toxicity was assessed using Kaplan-Meier statistics. A retrospective dosimetric analysis was performed for patients treated to 70.2 Gy (52 patients) or 75.6 Gy (119 patients) who either exhibited late rectal bleeding (RTOG Grade 2/3) within 30 months after treatment (i.e., 70.2 Gy--13 patients, 75.6 Gy--36 patients) or were nonbleeding for at least 30 months (i.e., 70.2 Gy--39 patients, 75.6 Gy--83 patients). Univariate and multivariate logistic regression was performed to correlate late rectal bleeding with several anatomic, dosimetric, and clinical variables. Results: A dose response for ≥ Grade 2 late rectal toxicity was observed. By multivariate analysis, the following factors were significantly correlated with ≥ Grade 2 late rectal bleeding for patients prescribed 70.2 Gy: 1) enclosure of the outer rectal contour by the 50% isodose on the isocenter slice (i.e., Iso50) (p max (p max

Radical prostatectomy for clinically localised prostate cancer at Rigshospitalet 1995-2011 - an analysis of surgical and oncological outcome.

Science.gov (United States)

Røder, Martin Andreas

2013-12-01

RP for localized PCa was introduced at Rigshospitalet in 1995. Since then, the incidence of PCa and number of RPs performed every year has increased enormously. Presently, RP is performed a six different hospitals in Denmark. No previous studies have meticulously described outcomes of RP in Denmark. This PhD-thesis focuses on surgical and oncological outcome after RP at Rigshospitalet. The primary purpose was to describe biochemical outcome, risk factors associated with positive surgical margins, and the impact of margin location on risk of biochemical recurrence. The PhD-thesis is based on results from approximately 1,300 men who underwent RP between 1995 and 2011 at Rigshospitalet. The patients have been followed prospectively in a local database. BR was defined as the first PSA ≥ 0.2 ng/ml and time to BR was calculated from the date of surgery. Analysis of time to BR was done using Kaplan-Meier estimation and Cox regression analysis including both pre- and postoperative parameters. The association between preoperative and surgical parameters, including surgeon and nerve-sparing surgery, and PSM was analysed using logistic regression analysis. The 10-year estimated BRFS was 75%, 60% and 39% for low-, intermediate-, and high-risk patients, respectively. An in-depth analysis of high-risk patients demonstrated a 10-year metastasis-free and cancer-specific survival of 85% and 90%, respectively. A PSM was demonstrated to increase the risk of BR up to 3 fold. The location of PSM was found to be associated with the risk of BR, i.e. non-apical PSM had the highest risk of BR compared to margin negative and apical PSM, especially in pT2 tumours. A number of factors were found to correlate with the risk of PSM, especially preoperative PSA, surgeon and nerve-sparing surgery. This thesis demonstrates that outcome of RP at Rigshospitalet is comparable to international results. Our studies confirm the prognostic importance of PSM, also in pT2 disease, and indicate that

Restenosis after carotid artery stenting and endarterectomy: a secondary analysis of CREST, a randomised controlled trial.

Science.gov (United States)

Lal, Brajesh K; Beach, Kirk W; Roubin, Gary S; Lutsep, Helmi L; Moore, Wesley S; Malas, Mahmoud B; Chiu, David; Gonzales, Nicole R; Burke, J Lee; Rinaldi, Michael; Elmore, James R; Weaver, Fred A; Narins, Craig R; Foster, Malcolm; Hodgson, Kim J; Shepard, Alexander D; Meschia, James F; Bergelin, Robert O; Voeks, Jenifer H; Howard, George; Brott, Thomas G

2012-09-01

In the Carotid Revascularization Endarterectomy versus Stenting Trial (CREST), the composite primary endpoint of stroke, myocardial infarction, or death during the periprocedural period or ipsilateral stroke thereafter did not differ between carotid artery stenting and carotid endarterectomy for symptomatic or asymptomatic carotid stenosis. A secondary aim of this randomised trial was to compare the composite endpoint of restenosis or occlusion. Patients with stenosis of the carotid artery who were asymptomatic or had had a transient ischaemic attack, amaurosis fugax, or a minor stroke were eligible for CREST and were enrolled at 117 clinical centres in the USA and Canada between Dec 21, 2000, and July 18, 2008. In this secondary analysis, the main endpoint was a composite of restenosis or occlusion at 2 years. Restenosis and occlusion were assessed by duplex ultrasonography at 1, 6, 12, 24, and 48 months and were defined as a reduction in diameter of the target artery of at least 70%, diagnosed by a peak systolic velocity of at least 3·0 m/s. Studies were done in CREST-certified laboratories and interpreted at the Ultrasound Core Laboratory (University of Washington). The frequency of restenosis was calculated by Kaplan-Meier survival estimates and was compared during a 2-year follow-up period. We used proportional hazards models to assess the association between baseline characteristics and risk of restenosis. Analyses were per protocol. CREST is registered with ClinicalTrials.gov, number NCT00004732. 2191 patients received their assigned treatment within 30 days of randomisation and had eligible ultrasonography (1086 who had carotid artery stenting, 1105 who had carotid endarterectomy). In 2 years, 58 patients who underwent carotid artery stenting (Kaplan-Meier rate 6·0%) and 62 who had carotid endarterectomy (6·3%) had restenosis or occlusion (hazard ratio [HR] 0·90, 95% CI 0·63-1·29; p=0·58). Female sex (1·79, 1·25-2·56), diabetes (2·31, 1·61-3·31

A novel systemic immune-inflammation index predicts survival and quality of life of patients after curative resection for esophageal squamous cell carcinoma.

Science.gov (United States)

Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng

2017-10-01

A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.

The Role of Vaginal Brachytherapy in the Treatment of Surgical Stage I Papillary Serous or Clear Cell Endometrial Cancer

International Nuclear Information System (INIS)

Barney, Brandon M.; Petersen, Ivy A.; Mariani, Andrea; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.

2013-01-01

Objectives: The optimal adjuvant therapy for International Federation of Gynecology and Obstetrics (FIGO) stage I papillary serous (UPSC) or clear cell (CC) endometrial cancer is unknown. We report on the largest single-institution experience using adjuvant high-dose-rate vaginal brachytherapy (VBT) for surgically staged women with FIGO stage I UPSC or CC endometrial cancer. Methods and Materials: From 1998-2011, 103 women with FIGO 2009 stage I UPSC (n=74), CC (n=21), or mixed UPSC/CC (n=8) endometrial cancer underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy followed by adjuvant high-dose-rate VBT. Nearly all patients (n=98, 95%) also underwent extended lymph node dissection of pelvic and paraortic lymph nodes. All VBT was performed with a vaginal cylinder, treating to a dose of 2100 cGy in 3 fractions. Thirty-five patients (34%) also received adjuvant chemotherapy. Results: At a median follow-up time of 36 months (range, 1-146 months), 2 patients had experienced vaginal recurrence, and the 5-year Kaplan Meier estimate of vaginal recurrence was 3%. The rates of isolated pelvic recurrence, locoregional recurrence (vaginal + pelvic), and extrapelvic recurrence (including intraabdominal) were similarly low, with 5-year Kaplan-Meier estimates of 4%, 7%, and 10%, respectively. The estimated 5-year overall survival was 84%. On univariate analysis, delivery of chemotherapy did not affect recurrence or survival. Conclusions: VBT is effective at preventing vaginal relapse in women with surgical stage I UPSC or CC endometrial cancer. In this cohort of patients who underwent comprehensive surgical staging, the risk of isolated pelvic or extrapelvic relapse was low, implying that more extensive adjuvant radiation therapy is likely unnecessary.

The association between high on-treatment platelet reactivity and early recurrence of ischemic events after minor stroke or TIA.

Science.gov (United States)

Rao, Zilong; Zheng, Huaguang; Wang, Fei; Wang, Anxin; Liu, Liping; Dong, Kehui; Zhao, Xingquan; Wang, Yilong; Cao, Yibin

2017-08-01

To evaluate the role of HTPR in predicting early recurrence of ischemic events in patients with minor ischemic stroke or high-risk TIA. From January 2014 to September 2014, a single center continuously enrolled patients with minor ischemic stroke or high-risk TIA and gave them antiplatelet therapy consisting of aspirin with clopidogrel. HTPR was assessed by TEG after 7 days of antiplatelet therapy and detected CYP2C19 genotype. The incidence of recurrent ischemic events was assessed 3 months after onset. The incidence of recurrent ischemic events was compared between the HTPR and NTPR groups with the Kaplan-Meier method, and multivariate Cox proportional hazards models were used to determine the risk factors associated with recurrent ischemic events. We enrolled 278 eligible patients with minor ischemic stroke or high-risk TIA. Through TEG testing, patients with HTPR were 22.7%, and carriers were not associated with HTPR to ADP by TEG-ADP(%) (p = 0.193). A total of 265 patients completed 3 months of follow-up, and Kaplan-Meier analysis showed that patients with HTPR had a higher percentage of recurrent ischemic events compared with patients with NTPR (p = 0.002). In multivariate Cox proportional hazards models, history of ischemic stroke or TIA (HR 4.45, 95% CI 1.77-11.16, p = 0.001) and HTPR (HR 3.34, 95% CI 1.41-7.91, p = 0.006) was independently associated with recurrent ischemic events. In patients with minor stroke or TIA, the prevalence of HTPR was 22.7%, and HTPR was independently associated with recurrent ischemic events.

Miners’ return to work following injuries in coal mines

Directory of Open Access Journals (Sweden)

Ashis Bhattacherjee

2016-12-01

Full Text Available Background: The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW following a miner’s injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person’s social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners’ injuries. Material and Methods: A study was conducted for 109 injured workers from an underground coal mine in the years 2000–2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. Results: According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners’ return to work included presence of disease, job satisfaction and injury type. Conclusions: The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6:729–742

Concurrent chemoradiation for vaginal cancer.

Directory of Open Access Journals (Sweden)

David T Miyamoto

Full Text Available BACKGROUND: It is not known whether the addition of chemotherapy to radiation therapy improves outcomes in primary vaginal cancer. Here, we review clinical outcomes in patients with primary vaginal cancer treated with radiation therapy (RT or concurrent chemoradiation therapy (CRT. METHODS: Seventy-one patients with primary vaginal cancer treated with definitive RT with or without concurrent chemotherapy at a single institution were identified and their records reviewed. A total of 51 patients were treated with RT alone; 20 patients were treated with CRT. Recurrences were analyzed. Overall survival (OS and disease-free survival (DFS rates were estimated using the Kaplan-Meier method. Cox regression analysis was performed. RESULTS: The median age at diagnosis was 61 years (range, 18-92 years and the median follow-up time among survivors was 3.0 years. Kaplan-Meier estimates for OS and DFS differed significantly between the RT and CRT groups (3-yr OS = 56% vs. 79%, log-rank p = 0.037; 3-yr DFS = 43% vs. 73%, log-rank p = 0.011. Twenty-three patients (45% in the RT group had a relapse at any site compared to 3 (15% in the CRT group (p = 0.027. With regard to the sites of first relapse, 10 patients (14% had local only, 4 (6% had local and regional, 9 (13% had regional only, 1 (1% had regional and distant, and 2 (3% had distant only relapse. On univariate analysis, the use of concurrent chemotherapy, FIGO stage, tumor size, and date of diagnosis were significant predictors of DFS. On multivariate analysis, the use of concurrent chemotherapy remained a significant predictor of DFS (hazard ratio 0.31 (95% CI, 0.10-0.97; p = 0.04. CONCLUSIONS: Vaginal cancer results in poor outcomes. Adequate radiation dose is essential to ensure curative management. Concurrent chemotherapy should be considered for vaginal cancer patients.

Predictors of Individual Tumor Local Control After Stereotactic Radiosurgery for Non-Small Cell Lung Cancer Brain Metastases

International Nuclear Information System (INIS)

Garsa, Adam A.; Badiyan, Shahed N.; DeWees, Todd; Simpson, Joseph R.; Huang, Jiayi; Drzymala, Robert E.; Barani, Igor J.; Dowling, Joshua L.; Rich, Keith M.; Chicoine, Michael R.; Kim, Albert H.; Leuthardt, Eric C.; Robinson, Clifford G.

2014-01-01

Purpose: To evaluate local control rates and predictors of individual tumor local control for brain metastases from non-small cell lung cancer (NSCLC) treated with stereotactic radiosurgery (SRS). Methods and Materials: Between June 1998 and May 2011, 401 brain metastases in 228 patients were treated with Gamma Knife single-fraction SRS. Local failure was defined as an increase in lesion size after SRS. Local control was estimated using the Kaplan-Meier method. The Cox proportional hazards model was used for univariate and multivariate analysis. Receiver operating characteristic analysis was used to identify an optimal cutpoint for conformality index relative to local control. A P value <.05 was considered statistically significant. Results: Median age was 60 years (range, 27-84 years). There were 66 cerebellar metastases (16%) and 335 supratentorial metastases (84%). The median prescription dose was 20 Gy (range, 14-24 Gy). Median overall survival from time of SRS was 12.1 months. The estimated local control at 12 months was 74%. On multivariate analysis, cerebellar location (hazard ratio [HR] 1.94, P=.009), larger tumor volume (HR 1.09, P<.001), and lower conformality (HR 0.700, P=.044) were significant independent predictors of local failure. Conformality index cutpoints of 1.4-1.9 were predictive of local control, whereas a cutpoint of 1.75 was the most predictive (P=.001). The adjusted Kaplan-Meier 1-year local control for conformality index ≥1.75 was 84% versus 69% for conformality index <1.75, controlling for tumor volume and location. The 1-year adjusted local control for cerebellar lesions was 60%, compared with 77% for supratentorial lesions, controlling for tumor volume and conformality index. Conclusions: Cerebellar tumor location, lower conformality index, and larger tumor volume were significant independent predictors of local failure after SRS for brain metastases from NSCLC. These results warrant further investigation in a prospective

Prognostic value of pre-treatment DCE-MRI parameters in predicting disease free and overall survival for breast cancer patients undergoing neoadjuvant chemotherapy

International Nuclear Information System (INIS)

Pickles, Martin D.; Manton, David J.; Lowry, Martin; Turnbull, Lindsay W.

2009-01-01

The purpose of this study was to investigate whether dynamic contrast enhanced MRI (DCE-MRI) data, both pharmacokinetic and empirical, can predict, prior to neoadjuvant chemotherapy, which patients are likely to have a shorter disease free survival (DFS) and overall survival (OS) interval following surgery. Traditional prognostic parameters were also included in the survival analysis. Consequently, a comparison of the prognostic value could be made between all the parameters studied. MR examinations were conducted on a 1.5 T system in 68 patients prior to the initiation of neoadjuvant chemotherapy. DCE-MRI consisted of a fast spoiled gradient echo sequence acquired over 35 phases with a mean temporal resolution of 11.3 s. Both pharmacokinetic and empirical parameters were derived from the DCE-MRI data. Kaplan-Meier survival plots were generated for each parameter and group comparisons were made utilising logrank tests. The results from the 54 patients entered into the univariate survival analysis demonstrated that traditional prognostic parameters (tumour grade, hormonal status and size), empirical parameters (maximum enhancement index, enhancement index at 30 s, area under the curve and initial slope) and adjuvant therapies demonstrated significant differences in survival intervals. Further multivariate Cox regression survival analysis revealed that empirical enhancement parameters contributed the greatest prediction of both DFS and OS in the resulting models. In conclusion, this study has demonstrated that in patients who exhibit high levels of perfusion and vessel permeability pre-treatment, evidenced by elevated empirical DCE-MRI parameters, a significantly lower disease free survival and overall survival can be expected.

Prognostic value of pre-treatment DCE-MRI parameters in predicting disease free and overall survival for breast cancer patients undergoing neoadjuvant chemotherapy

Energy Technology Data Exchange (ETDEWEB)

Pickles, Martin D. [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: m.pickles@hull.ac.uk; Manton, David J. [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: d.j.manton@hull.ac.uk; Lowry, Martin [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: m.lowry@hull.ac.uk; Turnbull, Lindsay W. [Centre for Magnetic Resonance Investigations, Division of Cancer, Postgraduate Medical School, University of Hull, Hull Royal Infirmary, Anlaby Road, Hull, HU3 2JZ (United Kingdom)], E-mail: l.w.turnbull@hull.ac.uk

2009-09-15

The purpose of this study was to investigate whether dynamic contrast enhanced MRI (DCE-MRI) data, both pharmacokinetic and empirical, can predict, prior to neoadjuvant chemotherapy, which patients are likely to have a shorter disease free survival (DFS) and overall survival (OS) interval following surgery. Traditional prognostic parameters were also included in the survival analysis. Consequently, a comparison of the prognostic value could be made between all the parameters studied. MR examinations were conducted on a 1.5 T system in 68 patients prior to the initiation of neoadjuvant chemotherapy. DCE-MRI consisted of a fast spoiled gradient echo sequence acquired over 35 phases with a mean temporal resolution of 11.3 s. Both pharmacokinetic and empirical parameters were derived from the DCE-MRI data. Kaplan-Meier survival plots were generated for each parameter and group comparisons were made utilising logrank tests. The results from the 54 patients entered into the univariate survival analysis demonstrated that traditional prognostic parameters (tumour grade, hormonal status and size), empirical parameters (maximum enhancement index, enhancement index at 30 s, area under the curve and initial slope) and adjuvant therapies demonstrated significant differences in survival intervals. Further multivariate Cox regression survival analysis revealed that empirical enhancement parameters contributed the greatest prediction of both DFS and OS in the resulting models. In conclusion, this study has demonstrated that in patients who exhibit high levels of perfusion and vessel permeability pre-treatment, evidenced by elevated empirical DCE-MRI parameters, a significantly lower disease free survival and overall survival can be expected.

Survival of Patients With Cervical Cancer in Rural India

OpenAIRE

Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy

2015-01-01

Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...

Melanoma Patients with Unknown Primary Site or Nodal Recurrence after Initial Diagnosis Have a Favourable Survival Compared to Those with Synchronous Lymph Node Metastasis and Primary Tumour

OpenAIRE

Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus

2013-01-01

BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...

Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center Sobrevida de mujeres con cáncer de cuello uterino diagnosticadas en un centro brasileño Sobrevida de mulheres com câncer de colo uterino diagnosticadas em um centro brasileiro

Directory of Open Access Journals (Sweden)

Claudio Calazan do Carmo

2011-08-01

Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (pOBJETIVO: Evaluar la sobrevida global de mujeres con cáncer de cuello uterino e identificar factores pronósticos relacionados. MÉTODOS: Todos los 3.341 casos tratados en el Instituto Nacional de Cáncer, Rio de Janeiro, Sureste de Brasil, entre 1999 y 2004 fueron seleccionados y sus datos clínicos, anatomo-patológicos y de seguimiento fueron colectados. Se utilizaron la curva de Kaplan-meier y el modelo de Cox par evaluación de la sobrevida y para análisis logística múltiple, respectivamente. RESULTADOS: De los casos estudiados, 68,3% presentaban enfermedad localmente avanzada. La sobrevida en cinco años fue de 48%. Posterior al análisis múltiple, el estadio clínico al diagnóstico fue la única variable significativamente asociada con el pronóstico (pOBJETIVO: Avaliar a sobrevida global de mulheres com câncer de colo uterino e identificar fatores prognósticos relacionados. MÉTODOS: Todos os 3.341 casos tratados no Instituto Nacional de Câncer, Rio de Janeiro, RJ, entre 1999 e 2004 foram selecionados e seus dados clínicos, anatomo-patológicos e de seguimento foram coletados. Foram utilizados a curva de Kaplan-Meier e o modelo de Cox para avaliação da sobrevida e para análise logística m

Treatment of primary parotid non-Hodgkin's lymphoma: an analysis of 29 patients

International Nuclear Information System (INIS)

Gu Wendong; Feng Yan

2003-01-01

Objective: To analyze the clinical characteristics, treatment and prognosis of primary parotid non-Hodgkin's lymphoma. Methods: From March 1988 to February 2001, twenty-nine patients with primary parotid non-Hodgkin's lymphoma treated in our hospital were retrospectively analyzed. The data were analyzed according to the following factors: sex, age, stage, pathologic classification, chemotherapy given or not, cycles of chemotherapy, radiotherapy given or not, and the dose at the parotid. Kaplan-Meier method and Log-rank method were used in the statistic analysis. Results: The overall 5-year and 10-year survival rates were 73.3% and 51.0%. Stage and pathologic classification were prognostic factors in our statistic analysis. The 5-year survival rates were 81.6% and 25.0% for early stage (I E + II E) and advanced stage (III E + IV E) patients, with the difference significant (P<0.01). The 5-year survival rate for patients with the pathologic classification of mucosa associated lymphoid tissue (MALT) was 100% as compared to 42.2% for patients with diffused large B cell lymphoma, with the difference also significant (P<0.05). Conclusions: The prognosis of primary parotid non-Hodgkin's lymphoma is satisfactory. Surgery should only be used as a diagnostic method. Radiotherapy should be the first choice for patients with MALT lymphoma and stage I E and II E follicular lymphoma, but comprehensive treatment including chemotherapy is necessary to the diffuse large B cell lymphoma

Meritev izkoristka in nastavitev krmilnih parametrov kaplanove turbine z dolgim cevnim sistemom s primerjalno metodo: Measurement of relative turbine efficiency and adjustment of governing parameters on long penstock Kaplan turbine with comparative method:

OpenAIRE

Trebše, Andrej J.

2004-01-01

The paper deals with efficiency measurement of Kaplan turbine with relative method (index test) and adjustment of operating of runner and guide vane governing system. At certain longer penstocks the looses in conduit at turbineload operation change the net head. On basis of model test on Kaplan turbine and relative turbine efficiency measurement on prototype the turbine governing system was optimized in accordance with comparative method. Prispevek obravnava meritev izkoristka kaplanove tu...

Progression of HPV infection to detectable cervical lesions or clearance in adult women: Analysis of the control arm of the VIVIANE study.

Science.gov (United States)

Skinner, S Rachel; Wheeler, Cosette M; Romanowski, Barbara; Castellsagué, Xavier; Lazcano-Ponce, Eduardo; Del Rosario-Raymundo, M Rowena; Vallejos, Carlos; Minkina, Galina; Pereira Da Silva, Daniel; McNeil, Shelly; Prilepskaya, Vera; Gogotadze, Irina; Money, Deborah; Garland, Suzanne M; Romanenko, Viktor; Harper, Diane M; Levin, Myron J; Chatterjee, Archana; Geeraerts, Brecht; Struyf, Frank; Dubin, Gary; Bozonnat, Marie-Cécile; Rosillon, Dominique; Baril, Laurence

2016-05-15

The control arm of the phase III VIVIANE (Human PapillomaVIrus: Vaccine Immunogenicity ANd Efficacy; NCT00294047) study in women >25 years was studied to assess risk of progression from cervical HPV infection to detectable cervical intraepithelial neoplasia (CIN). The risk of detecting CIN associated with the same HPV type as the reference infection was analysed using Kaplan-Meier and multivariable Cox models. Infections were categorised depending upon persistence as 6-month persistent infection (6MPI) or infection of any duration. The 4-year interim analysis included 2,838 women, of whom 1,073 (37.8%) experienced 2,615 infections of any duration and 708 (24.9%) experienced 1,130 6MPIs. Infection with oncogenic HPV types significantly increased the risk of detecting CIN grade 2 or greater (CIN2+) versus non-oncogenic types. For 6MPI, the highest risk was associated with HPV-33 (hazard ratio [HR]: 31.9 [8.3-122.2, p 25 years in this study was similar to that in women 15-25 years in PATRICIA. © 2015 The Authors and GlaxoSmithKline. International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

Examining the Latent Structure of the Delis-Kaplan Executive Function System.

Science.gov (United States)

Karr, Justin E; Hofer, Scott M; Iverson, Grant L; Garcia-Barrera, Mauricio A

2018-05-04

The current study aimed to determine whether the Delis-Kaplan Executive Function System (D-KEFS) taps into three executive function factors (inhibition, shifting, fluency) and to assess the relationship between these factors and tests of executive-related constructs less often measured in latent variable research: reasoning, abstraction, and problem solving. Participants included 425 adults from the D-KEFS standardization sample (20-49 years old; 50.1% female; 70.1% White). Eight alternative measurement models were compared based on model fit, with test scores assigned a priori to three factors: inhibition (Color-Word Interference, Tower), shifting (Trail Making, Sorting, Design Fluency), and fluency (Verbal/Design Fluency). The Twenty Questions, Word Context, and Proverb Tests were predicted in separate structural models. The three-factor model fit the data well (CFI = 0.938; RMSEA = 0.047), although a two-factor model, with shifting and fluency merged, fit similarly well (CFI = 0.929; RMSEA = 0.048). A bifactor model fit best (CFI = 0.977; RMSEA = 0.032) and explained the most variance in shifting indicators, but rarely converged among 5,000 bootstrapped samples. When the three first-order factors simultaneously predicted the criterion variables, only shifting was uniquely predictive (p measuring executive-related constructs and provide a framework through which clinicians can interpret D-KEFS results.

Beyond reliability, multi-state failure analysis of satellite subsystems: A statistical approach

International Nuclear Information System (INIS)

Castet, Jean-Francois; Saleh, Joseph H.

2010-01-01

Reliability is widely recognized as a critical design attribute for space systems. In recent articles, we conducted nonparametric analyses and Weibull fits of satellite and satellite subsystems reliability for 1584 Earth-orbiting satellites launched between January 1990 and October 2008. In this paper, we extend our investigation of failures of satellites and satellite subsystems beyond the binary concept of reliability to the analysis of their anomalies and multi-state failures. In reliability analysis, the system or subsystem under study is considered to be either in an operational or failed state; multi-state failure analysis introduces 'degraded states' or partial failures, and thus provides more insights through finer resolution into the degradation behavior of an item and its progression towards complete failure. The database used for the statistical analysis in the present work identifies five states for each satellite subsystem: three degraded states, one fully operational state, and one failed state (complete failure). Because our dataset is right-censored, we calculate the nonparametric probability of transitioning between states for each satellite subsystem with the Kaplan-Meier estimator, and we derive confidence intervals for each probability of transitioning between states. We then conduct parametric Weibull fits of these probabilities using the Maximum Likelihood Estimation (MLE) approach. After validating the results, we compare the reliability versus multi-state failure analyses of three satellite subsystems: the thruster/fuel; the telemetry, tracking, and control (TTC); and the gyro/sensor/reaction wheel subsystems. The results are particularly revealing of the insights that can be gleaned from multi-state failure analysis and the deficiencies, or blind spots, of the traditional reliability analysis. In addition to the specific results provided here, which should prove particularly useful to the space industry, this work highlights the importance

Survival benefits of remote ischemic conditioning in sepsis.

Science.gov (United States)

Joseph, Bellal; Khalil, Mazhar; Hashmi, Ammar; Hecker, Louise; Kulvatunyou, Narong; Tang, Andrew; Friese, Randall S; Rhee, Peter

2017-06-01

Sepsis remains the leading cause of death in the surgical intensive care unit. Prior studies have demonstrated a survival benefit of remote ischemic conditioning (RIC) in many disease states. The aim of this study was to determine the effects of RIC on survival in sepsis in an animal model and to assess alterations in inflammatory biochemical profiles. We hypothesized that RIC alters inflammatory biochemical profiles resulting in decreased mortality in a septic mouse model. Eight to 12 week C57BL/6 mice received intra-peritoneal injection of 12.5-mg/kg lipopolysaccharide (LPS). Septic animals in the experimental group underwent RIC at 0, 2, and 6 h after LPS by surgical exploration and alternate clamping of the femoral artery. Six 4-min cycles of ischemia-reperfusion were performed. Primary outcome was survival at 5-d after LPS injection. Secondary outcome was to assess the following serum cytokine levels: interferon-γ (IFN-γ), interleukin (IL)-10, IL-1β, and tumor necrosis factoralpha (TNFα) at the baseline before LPS injection, 0 hour after LPS injection, and at 2, 4, 24 hours after induction of sepsis (RIC was performed at 2 h after LPS injection). Kaplan-Meier survival analysis and log-rank test were used. ANOVA test was used to compare cytokine measurements. We performed experiments on 44 mice: 14 sham and 30 RIC mice (10 at each time point). Overall survival was higher in the experimental group compared to the sham group (57% versus 21%; P = 0.02), with the highest survival rate observed in the 2-hour post-RIC group (70%). On Kaplan-Meier analysis, 2-h post-RIC group had increased survival at 5 days after LPS (P = 0.04) with hazard ratio of 0.3 (95% confidence interval = 0.09-0.98). In the RIC group, serum concentrations of IFN-γ, IL-10, IL-1β, and TNFα peaked at 2 h after LPS and then decreased significantly over 24 hours (P sepsis and has the potential for implementation in the clinical practice. Early implementation of RIC may play an

Feasibility of Economic Analysis of Radiation Therapy Oncology Group (RTOG) 91-11 Using Medicare Data

International Nuclear Information System (INIS)

Konski, Andre; Bhargavan, Mythreyi; Owen, Jean; Paulus, Rebecca; Cooper, Jay; Forastiere, Arlene; Ang, K. Kian; Watkins-Bruner, Deborah

2011-01-01

Purpose: The specific aim of this analysis was to evaluate the feasibility of performing a cost-effectiveness analysis using Medicare data from patients treated on a randomized Phase III clinical trial. Methods and Materials: Cost data included Medicare Part A and Part B costs from all providers-inpatient, outpatient, skilled nursing facility, home health, hospice, and physicians-and were obtained from the Centers for Medicare and Medicaid Services for patients eligible for Medicare, treated on Radiation Therapy Oncology Group (RTOG) 9111 between 1992 and 1996. The 47-month expected discounted (annual discount rate of 3%) cost for each arm of the trial was calculated in 1996 dollars, with Kaplan-Meier sampling average estimates of survival probabilities for each month and mean monthly costs. Overall and disease-free survival was also discounted 3%/year. The analysis was performed from a payer's perspective. Incremental cost-effectiveness ratios were calculated comparing the chemotherapy arms to the radiation alone arm. Results: Of the 547 patients entered, Medicare cost data and clinical outcomes were available for 66 patients. Reasons for exclusion included no RTOG follow-up, Medicare HMO enrollment, no Medicare claims since trial entry, and trial entry after 1996. Differences existed between groups in tumor characteristics, toxicity, and survival, all which could affect resource utilization. Conclusions: Although we were able to test the methodology of economic analysis alongside a clinical trial using Medicare data, the results may be difficult to translate to the entire trial population because of non-random missing data. Methods to improve Medicare data capture and matching to clinical trial samples are required.

Moderate precision of prognostic scoring systems in a consecutive, prospective cohort of 544 patients with metastatic spinal cord compression

DEFF Research Database (Denmark)

Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck

2014-01-01

and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....

The effect of quitting smoking on the risk of unfavorable events after surgical treatment of oral potentially malignant lesions

DEFF Research Database (Denmark)

Vladimirov, B S; Schiødt, Morten

2009-01-01

smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p

Prognostic value of body mass index before treatment for laryngeal squamous cell carcinoma

International Nuclear Information System (INIS)

Li, Zhao-Qu; Zou, Lan; Liu, Tian-Run; Yang, An-Kui

2015-01-01

Patients with head and neck cancer often suffer from malnutrition. This study aims to investigate the influence of body mass index (BMI) on the prognosis of laryngeal squamous cell carcinoma (LSCC). A total of 473 patients with LSCC initially treated at Sun Yat-sen University Cancer Center between January 2005 and July 2009 were retrospectively reviewed. Survival analysis was performed by the Kaplan-Meier method and Cox regression model. Low BMI before treatment was significantly associated with poor overall survival in patients with LSCC (P<0.001). BMI was an independent prognostic factor for patients with LSCC. Leanness before treatment was associated with poor prognosis in patients with LSCC. Good nutritional status is favorable to improve survival in patients with LSCC

Clinical application and prognostic assessment of serum Tumor Associated Material (TAM) from esophageal cancer patients.

Science.gov (United States)

Zhou, K; Yan, Y; Zhao, S; Li, B

2014-01-01

To explore the correlation between serum levels of Tumor Associated Materials (TAM) and clinicopathological parameters and prognosis in patients with esophageal cancer (EC). The levels of TAM were determined by chemical colorimetry in 100 EC patients and 100 healthy controls. Serum TAM levels were significantly higher in patients with esophageal carcinoma than in the control group (p TAM were associated with tumor size (p = 0.004), tumor depth (p TAM (p = 0.001). Kaplan-Meier analysis showed patients with increased levels of TAM after operation had an lower overall survival (p TAM may be an independent factor affecting the overall survival and disease-free survival (p TAM could be used to screen for tumor and assess unfavorable prognosis in patients with EC.

The prognostic value of lymph node metastases and tumour regression grade in rectal cancer patients treated with long-course preoperative chemoradiotherapy

DEFF Research Database (Denmark)

Lindebjerg, J; Spindler, Karen-Lise Garm; Ploen, J

2009-01-01

to the tumour regression grade system and lymph node status in the surgical specimen was assessed. The prognostic value of clinico-pathological parameters was analysed using univariate analysis and Kaplan-Meier methods for comparison of groups. RESULTS: All patients responded to treatment and 47% had a major......OBJECTIVE: The purpose of the present study was to investigate the impact of tumour regression and the post-treatment lymph node status on the prognosis of rectal cancer treated by preoperative neoadjuvant chemoradiotherapy. METHOD: One hundred and thirty-five patients with locally advanced T3.......01). CONCLUSION: The combined assessment of lymph-node status and tumour response has strong prognostic value in locally advanced rectal cancer patient treated with preoperative long-course chemoradiation....

Geographical variations in the use of cancer treatments are associated with survival of lung cancer patients

DEFF Research Database (Denmark)

Møller, Henrik; Coupland, Victoria H; Tataru, Daniela

2018-01-01

INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... to statistical adjustments for age, sex, socio-economic status, performance status and co-morbidity. CONCLUSION: The extent of use of different treatment modalities varies between geographical areas in England. These variations are not attributable to measurable patient and tumour characteristics, and more...

New-Onset Diabetes Mellitus in Liver Transplant Recipients With Hepatitis C: Analysis of the National Database.

Science.gov (United States)

Li, Z; Sun, F; Hu, Z; Xiang, J; Zhou, J; Yan, S; Wu, J; Zhou, L; Zheng, S

2016-01-01

New-onset diabetes mellitus (NODM) after liver transplantation (LT) occurs with increased frequency in recipients with hepatitis C virus (HCV). We compared the incidence and risk factors for NODM in HCV vs non-HCV recipients. Among 24,956 liver recipients, 18,741 without pretransplantation diabetes were identified. NODM-free survival was analyzed using Kaplan-Meier and log-rank tests, and risk factors for NODM were examined using multivariate Cox regression analysis. The overall incidence of NODM was 13.0% at 1 year after LT. At 1, 2, 3, and 5 years after LT, incidence of NODM in HCV recipients was 14.4%, 4.3%, 3.1%, and 3.5%, respectively, compared with 11.9%, 3.5%, 3.2%, and 6.4%, respectively, in non-HCV recipients. HCV recipients had a higher risk of NODM than non-HCV recipients (hazard ratio 1.17 [1.09-1.27], P diabetes mellitus. Risk factors in non-HCV recipients were male recipient, BMI, and recipients with nonalcoholic steatohepatitis diagnosis. HCV recipients have a higher incidence and more risk factors for NODM than non-HCV recipients. Early identification of modifiable risk factors will assist clinical interventions to prevent NODM complications after LT. Copyright © 2016 Elsevier Inc. All rights reserved.

Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions

International Nuclear Information System (INIS)

Lakatos, K; Szamosi, Z; Bereczkei, S

2012-01-01

This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.

Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions

Science.gov (United States)

Lakatos, K.; Szamosi, Z.; Bereczkei, S.

2012-11-01

This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.

Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.

Directory of Open Access Journals (Sweden)

Raúl Vicente Mantilla Quispe

2008-10-01

Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.

Prostatic irradiation is not associated with any measurable increase in the risk of subsequent rectal cancer

International Nuclear Information System (INIS)

Kendal, Wayne S.; Eapen, Libni; MacRae, Robert; Malone, Shawn; Nicholas, Garth

2006-01-01

Purpose: To investigate a putative increased risk of rectal cancer subsequent to prostatic radiotherapy. Methods and Materials: In an analysis of the Surveillance, Epidemiology, and End Results registry, we compared men who had radiotherapy for prostatic carcinoma with those treated surgically and those treated with neither modality. Kaplan-Meier analyses for the time to failure from rectal cancer were performed between age-matched subgroups of the three cohorts. Cox proportional hazards analyses were performed to ascertain what influences might affect the incidence of subsequent rectal cancer. Results: In all, 33,831 men were irradiated, 167,607 were treated surgically, and 36,335 received neither modality. Rectal cancers developed in 243 (0.7%) of those irradiated (mean age, 70.7 years), 578 (0.3%) of those treated surgically (68.7 years), and 227 (0.8%) of those treated with neither modality (74.2 years). When age effects and the differences between the surgical and untreated cohorts were controlled for, we were unable to demonstrate any significant increased incidence of rectal cancer in men irradiated for prostatic cancer. Conclusions: An increased frequency of rectal cancer after prostatic irradiation, apparent on crude analysis, could be attributed to age confounding and other unmeasured confounders associated with prostate cancer treatment and rectal cancer risk

NCOA5 is correlated with progression and prognosis in luminal breast cancer

International Nuclear Information System (INIS)

Ye, Xiao-He; Huang, Du-Ping; Luo, Rong-Cheng

2017-01-01

Nuclear receptor coactivator 5 (NCOA5) is known to modulate ERα-mediated transcription and has been found to be involved in the progression of several malignancies. However, the potential correlation between NCOA5 and clinical outcome in patients with luminal breast cancer remains unknown. In the present study, we demonstrated that NCOA5 was significantly up-regulated in luminal breast cancer tissues compared with adjacent non-cancerous tissues both in validated cohort and TCGA cohort. Moreover, Kaplan-Meier analysis indicated that patients with high NOCA5 expression had significantly lower overall survival (P = 0.021). Cox regression analysis indicated that the high NOCA5 expression was independent high risk factor as well as old age (>60) and HER-2 expression (P = 0.039; P = 0.003; P = 0.005; respectively). This study provides new insights and evidences that NOCA5 over-expression was significantly correlated with progression and prognosis in luminal breast cancer. However, the precise cellular mechanisms for NOCA5 in luminal breast cancer need to be further explored. - Highlights: • NCOA5 is significantly over-expressed in human luminal breast cancer tissues. • NOCA5 was involved in the progression of luminal breast cancer. • NCOA5 can predict the progression of luminal breast cancer.

RELATIONSHIP BETWEEN THE PROANGIOGENIC ROLE OF EG-VEGF, CLINICOPATHOLOGICAL CHARACTERISTICS AND SURVIVAL IN TUMORAL OVARY.

Science.gov (United States)

Lozneanu, Ludmila; Avădănei, Roxana; Cîmpean, Anca Maria; Giuşcă, Simona Eliza; Amălinei, Cornelia; Căruntu, Irina-Draga

2015-01-01

To prove the presence of EG-VEGF in tumor ovary and to analyze its involvement in the ovarian carcinogenesis, as promoter of angiogenesis, in relationship with the clinicopathological prognostic factors and survival. The study group comprises tumor tissue specimens from 50 cases of surgically treated ovarian cancer that were immunohistochemically investigated. A scoring system based on the percentage of positive cells and the intensity of staining was applied for the semiquantitative assessment of EG-VEGF, as negative or positive. Statistics involved χ2 test, and Kaplan-Meier and log-rank test. EG-VEGF was positive in 35 cases (70%) and negative in 15 cases (30%). Our data confirmed the predominance of EG-VEGF positivity in the serous subiype as compared to endometrioid and clear cell subtypes, and its absence in mucinous subtype. Moreover, we demonstrated that EG-VEGF is overexpressed mainly in high-grade ovarian carcinomas (type II) than in low-grade ones. Significant differences were registered between the EG-VEGF positive or negative expression and tumor stage and histological subtypes, respectively. Survival analysis showed no differences in patient's survival and EG-VEGF positive and negative cases. The analysis of EG-VEGF expression in ovarian tumors points out the relationship between the enhanced potential for tumor angiogenesis and the tumor aggressivity.

Using logistic regression to improve the prognostic value of microarray gene expression data sets: application to early-stage squamous cell carcinoma of the lung and triple negative breast carcinoma.

Science.gov (United States)

Mount, David W; Putnam, Charles W; Centouri, Sara M; Manziello, Ann M; Pandey, Ritu; Garland, Linda L; Martinez, Jesse D

2014-06-10

Numerous microarray-based prognostic gene expression signatures of primary neoplasms have been published but often with little concurrence between studies, thus limiting their clinical utility. We describe a methodology using logistic regression, which circumvents limitations of conventional Kaplan Meier analysis. We applied this approach to a thrice-analyzed and published squamous cell carcinoma (SQCC) of the lung data set, with the objective of identifying gene expressions predictive of early death versus long survival in early-stage disease. A similar analysis was applied to a data set of triple negative breast carcinoma cases, which present similar clinical challenges. Important to our approach is the selection of homogenous patient groups for comparison. In the lung study, we selected two groups (including only stages I and II), equal in size, of earliest deaths and longest survivors. Genes varying at least four-fold were tested by logistic regression for accuracy of prediction (area under a ROC plot). The gene list was refined by applying two sliding-window analyses and by validations using a leave-one-out approach and model building with validation subsets. In the breast study, a similar logistic regression analysis was used after selecting appropriate cases for comparison. A total of 8594 variable genes were tested for accuracy in predicting earliest deaths versus longest survivors in SQCC. After applying the two sliding window and the leave-one-out analyses, 24 prognostic genes were identified; most of them were B-cell related. When the same data set of stage I and II cases was analyzed using a conventional Kaplan Meier (KM) approach, we identified fewer immune-related genes among the most statistically significant hits; when stage III cases were included, most of the prognostic genes were missed. Interestingly, logistic regression analysis of the breast cancer data set identified many immune-related genes predictive of clinical outcome. Stratification of

Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment

Science.gov (United States)

2010-08-01

overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10

Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis

DEFF Research Database (Denmark)

Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene

2017-01-01

characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p

Measuring survival time: a probability-based approach useful in healthcare decision-making.

Science.gov (United States)

2011-01-01

In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.

High income, employment, postgraduate education, and marriage. A suicidal cocktail among psychiatric patients

DEFF Research Database (Denmark)

Agerbo, Esben

2007-01-01

longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....

Improve T Cell Therapy in Neuroblastoma

Science.gov (United States)

2015-09-01

bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and

Integrated analysis of HPV-mediated immune alterations in cervical cancer.

Science.gov (United States)

Chen, Long; Luan, Shaohong; Xia, Baoguo; Liu, Yansheng; Gao, Yuan; Yu, Hongyan; Mu, Qingling; Zhang, Ping; Zhang, Weina; Zhang, Shengmiao; Wei, Guopeng; Yang, Min; Li, Ke

2018-05-01

Human papillomavirus (HPV) infection is the primary cause of cervical cancer. HPV-mediated immune alterations are known to play crucial roles in determining viral persistence and host cell transformation. We sought to thoroughly understand HPV-directed immune alterations in cervical cancer by exploring publically available datasets. 130 HPV positive and 7 HPV negative cervical cancer cases from The Cancer Genome Atlas were compared for differences in gene expression levels and functional enrichment. Analyses for copy number variation (CNV) and genetic mutation were conducted for differentially expressed immune genes. Kaplan-Meier analysis was performed to assess survival and relapse differences across cases with or without alterations of the identified immune signature genes. Genes up-regulated in HPV positive cervical cancer were enriched for various gene ontology terms of immune processes (P=1.05E-14~1.00E-05). Integrated analysis of the differentially expressed immune genes identified 9 genes that displayed either CNV, genetic mutation and/or gene expression changes in at least 10% of the cases of HPV positive cervical cancer. Genomic amplification may cause elevated levels of these genes in some HPV positive cases. Finally, patients with alterations in at least one of the nine signature genes overall had earlier relapse compared to those without any alterations. The altered expression of either TFRC or MMP13 may indicate poor survival for a subset of cervical cancer patients (P=1.07E-07). We identified a novel immune gene signature for HPV positive cervical cancer that is potentially associated with early relapse of cervical cancer. Copyright © 2018. Published by Elsevier Inc.

Whole abdominal irradiation in ovarian carcinoma

International Nuclear Information System (INIS)

Romestaing, P.; Gallo, C.; Gerard, J.F.; Ardiet, J.M.; Carrie, C.

1989-01-01

The prognosis of ovarian cancers, which are frequently diagnosed at a late stage, can probably be improved by whole abdominal radiotherapy. 45 patients in Lyon and 8 patients in Montelimar (7 stage I or C, 10 stage II and 36 stage III) were treated by whole abdominal radiotherapy, generally after 6 courses of chemotherapy (46 cases). The overall 5-year survival of this group of patients was 48% (Kaplan-Meier method). When the patients treated by complete resection at 1st look surgery (19 cases) are compared with those in whom 1st look surgery was incomplete (34 cases), the actuarial survival was 83% versus 27%. This study demonstrates that whole abdominal radiotherapy is feasible without any serious long-term complications after two operations and 6 courses of chemotherapy. These encouraging results need to be confirmed by randomized prospective studies [fr

Outcome after arthroscopic labral surgery in patients previously treated with periacetabular osteotomy

DEFF Research Database (Denmark)

Hartig-Andreasen, Charlotte; Nielsen, Torsten G; Lund, Bent

2017-01-01

To identify factors predicting failure after hip arthroscopy in patients with previous periacetabular osteotomy (PAO) defined as a conversion to total hip replacement (THR) and to evaluate the patient reported outcome scores. Of 55 hips treated with hip arthroscopy after PAO from Aug 2008 to 2012....... Nine hips were converted to a THR. Kaplan-Meier survival rate was 52.8% (95% CI, 10%-83.8%) at 6.5 years follow-up. Statistically significant predictors of failure: joint space width after PAO ...% of the hips. In 42% of the hips cartilage lesions of Becks grade >3 were found. Mean mHHS and HOS were 65.7 and 68.8 respectively at follow-up. A NRS pain score of >3 in rest and during activity were present in respectively, 43% and 62% of the patients. Hip arthroscopy after PAO demonstrated limited clinical...

Feasibility and demonstration of a cloud-based RIID analysis system

Energy Technology Data Exchange (ETDEWEB)

Wright, Michael C., E-mail: wrightmc@ornl.gov [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Hertz, Kristin L.; Johnson, William C. [Sandia National Laboratories, Livermore, CA 94551 (United States); Sword, Eric D.; Younkin, James R. [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Sadler, Lorraine E. [Sandia National Laboratories, Livermore, CA 94551 (United States)

2015-06-01

A significant limitation in the operational utility of handheld and backpack radioisotope identifiers (RIIDs) is the inability of their onboard algorithms to accurately and reliably identify the isotopic sources of the measured gamma-ray energy spectrum. A possible solution is to move the spectral analysis computations to an external device, the cloud, where significantly greater capabilities are available. The implementation and demonstration of a prototype cloud-based RIID analysis system have shown this type of system to be feasible with currently available communication and computational technology. A system study has shown that the potential user community could derive significant benefits from an appropriately implemented cloud-based analysis system and has identified the design and operational characteristics required by the users and stakeholders for such a system. A general description of the hardware and software necessary to implement reliable cloud-based analysis, the value of the cloud expressed by the user community, and the aspects of the cloud implemented in the demonstrations are discussed. - Highlights: • A prototype cloud-based RIID analysis system was implemented and demonstrated. • A cloud-based system was shown to be feasible with currently available technology. • A system study identified the operational characteristics required by the users. • The system study showed that the user community could derive significant benefit. • An architecture was defined for field testing by users in relevant environments.

Feasibility and demonstration of a cloud-based RIID analysis system

International Nuclear Information System (INIS)

Wright, Michael C.; Hertz, Kristin L.; Johnson, William C.; Sword, Eric D.; Younkin, James R.; Sadler, Lorraine E.

2015-01-01

A significant limitation in the operational utility of handheld and backpack radioisotope identifiers (RIIDs) is the inability of their onboard algorithms to accurately and reliably identify the isotopic sources of the measured gamma-ray energy spectrum. A possible solution is to move the spectral analysis computations to an external device, the cloud, where significantly greater capabilities are available. The implementation and demonstration of a prototype cloud-based RIID analysis system have shown this type of system to be feasible with currently available communication and computational technology. A system study has shown that the potential user community could derive significant benefits from an appropriately implemented cloud-based analysis system and has identified the design and operational characteristics required by the users and stakeholders for such a system. A general description of the hardware and software necessary to implement reliable cloud-based analysis, the value of the cloud expressed by the user community, and the aspects of the cloud implemented in the demonstrations are discussed. - Highlights: • A prototype cloud-based RIID analysis system was implemented and demonstrated. • A cloud-based system was shown to be feasible with currently available technology. • A system study identified the operational characteristics required by the users. • The system study showed that the user community could derive significant benefit. • An architecture was defined for field testing by users in relevant environments

Colistin-resistant Enterobacteriaceae infections: clinical and molecular characterization and analysis of in vitro synergy.

Science.gov (United States)

de Maio Carrillho, Claudia M D; Gaudereto, Juliana J; Martins, Roberta Cristina Ruedas; de Castro Lima, Victor Augusto Camarinha; de Oliveira, Larissa M; Urbano, Mariana R; Perozin, Jamile S; Levin, Anna Sara; Costa, Silvia F

2017-03-01

We described 27 polyclonal colistin-resistant Enterobacteriaceae (MIC 4-16 μg/mL) infections (12 pneumonia, 12 urinary tract infection (UTI), two Bacteremia, and one skin/soft tissue infection) in which 74% harbored KPC. The isolates were polyclonal, 6 STs were identified and the colistin resistance was due to chromosome mutations. Eight patients with UTI received monotherapy, and combination therapy was given to 19 patients. Overall mortality was 37%. In vitro synergy using time-kill assay was observed in 14 of 19 (74%) isolates tested; the synergistic effect was observed for almost all isolates for the combination of three drugs: colistin, amikacin, and tigecycline. The Kaplan-Meier survival curve showed no significant difference comparing combination therapy with 2, 3, or more drugs and risk factors associated with death were dialysis and shock. These findings reinforce the fact that colistin in combination with other classes of drugs can be useful in treating infections caused by colistin-resistant CRE. Copyright © 2016 Elsevier Inc. All rights reserved.

Numerical Investigation of the Flow Structure in a Kaplan Draft Tube at Part Load

Science.gov (United States)

Maddahian, R.; Cervantes, M. J.; Sotoudeh, N.

2016-11-01

This research presents numerical simulation of the unsteady flow field inside the draft tube of a Kaplan turbine at part load condition. Due to curvature of streamlines, the ordinary two-equations turbulence models fail to predict the flow features. Therefore, a modification of the Shear Stress Transport (SST-SAS) model is utilized to approximate the turbulent stresses. A guide vane, complete runner and draft tube are considered to insure the real boundary conditions at the draft tube inlet. The outlet boundary is assumed to discharge into the atmosphere. The obtained pressure fluctuations inside the draft tube are in good agreement with available experimental data. In order to further investigate the RVR formation and its movement, the λ2 criterion, relating the position of the vortex core and strength to the second largest Eigen value of the velocity gradient tensor, is employed. The method used for vortex identification shows the flow structure and vortex motion inside the draft tube accurately.

Enhanced radiosensitivity and radiation-induced apoptosis in glioma CD133-positive cells by knockdown of SirT1 expression

International Nuclear Information System (INIS)

Chang, C.-J.; Hsu, C.-C.; Yung, M.-C.; Chen, K.-Y.; Tzao Ching; Wu, W.-F.; Chou, H.-Y.; Lee, Y.-Y.; Lu, K.-H.; Chiou, S.-H.; Ma, H.-I

2009-01-01

CD133-expressing glioma cells play a critical role in tumor recovery after treatment and are resistant to radiotherapy. Herein, we demonstrated that glioblastoma-derived CD133-positive cells (GBM-CD133 + ) are capable of self-renewal and express high levels of embryonic stem cell genes and SirT1 compared to GBM-CD133 - cells. To evaluate the role of SirT1 in GBM-CD133 + , we used a lentiviral vector expressing shRNA to knock-down SirT1 expression (sh-SirT1) in GBM-CD133 + . Silencing of SirT1 significantly enhanced the sensitivity of GBM-CD133 + to radiation and increased the level of radiation-mediated apoptosis. Importantly, knock-down of SirT1 increased the effectiveness of radiotherapy in the inhibition of tumor growth in nude mice transplanted with GBM-CD133 + . Kaplan-Meier survival analysis indicated that the mean survival rate of GBM-CD133 + mice treated with radiotherapy was significantly improved by Sh-SirT1 as well. In sum, these results suggest that SirT1 is a potential target for increasing the sensitivity of GBM and glioblastoma-associated cancer stem cells to radiotherapy.

Marital status independently predicts testis cancer survival--an analysis of the SEER database.

Science.gov (United States)

Abern, Michael R; Dude, Annie M; Coogan, Christopher L

2012-01-01

Previous reports have shown that married men with malignancies have improved 10-year survival over unmarried men. We sought to investigate the effect of marital status on 10-year survival in a U.S. population-based cohort of men with testis cancer. We examined 30,789 cases of testis cancer reported to the Surveillance, Epidemiology, and End Results (SEER 17) database between 1973 and 2005. All staging were converted to the 1997 AJCC TNM system. Patients less than 18 years of age at time of diagnosis were excluded. A subgroup analysis of patients with stages I or II non-seminomatous germ cell tumors (NSGCT) was performed. Univariate analysis using t-tests and χ(2) tests compared characteristics of patients separated by marital status. Multivariate analysis was performed using a Cox proportional hazard model to generate Kaplan-Meier survival curves, with all-cause and cancer-specific mortality as the primary endpoints. 20,245 cases met the inclusion criteria. Married men were more likely to be older (38.9 vs. 31.4 years), Caucasian (94.4% vs. 92.1%), stage I (73.1% vs. 61.4%), and have seminoma as the tumor histology (57.3% vs. 43.4%). On multivariate analysis, married status (HR 0.58, P married status (HR 0.60, P married and unmarried men (44.8% vs. 43.4%, P = 0.33). Marital status is an independent predictor of improved overall and cancer-specific survival in men with testis cancer. In men with stages I or II NSGCT, RPLND is an additional predictor of improved overall survival. Marital status does not appear to influence whether men undergo RPLND. Copyright © 2012 Elsevier Inc. All rights reserved.

Multivariate analysis of factors influencing the effect of radiosynovectomy; Multivariate Analyse der Einflussfaktoren auf die Wirkung der Radiosynoviorthese bei entzuendlichen Gelenkerkrankungen

Energy Technology Data Exchange (ETDEWEB)

Farahati, J.; Schulz, G.; Koerber, C.; Geling, M.; Schmeider, P.; Reiners, Chr. [Wuerzburg Univ. (Germany). Klinik fuer Nuklearmedizin; Wendler, J. [Erlangen-Nuernberg Univ. (Germany). Klinik fuer Innere Medizin III; Kenn, W. [Wuerzburg Univ. (Germany). Inst. fuer Roentgendiagnostik; Reidemeister, C. [Wuerzburg Univ. (Germany). Klinik fuer Innere Medizin

2002-04-01

Objective: In this prospective study, the time to remission after radiosynovectomy (RSV) was analyzed and the influence of age, sex, underlying disease, type of joint, and duration of illness on the success rate of RSV was determined. Methods: A total number of 57 patients with rheumatoid arthritis (n = 33) and arthrosis (n = 21) with a total number of 130 treated joints (36 knee, 66 small and 28 medium-size joints) were monitored using visual analogue scales (VAS) from one week before RSV up to four to six months after RSV. The patients had to answer 3 times daily for pain intensity of the treated joint. The time until remission was determined according to the Kaplan-Meier survivorship function. The influence of the prognosis parameters on outcome of RSV was determined by multivariate discriminant analysis. Results: After six months, the probability of pain relief of more than 20% amounted to 78% and was significantly dependent on the age of the patient (p = 0.02) and the duration of illness (p = 0.05), however not on sex (p = 0.17), underlying disease (p = 0.23), and type of joint (p = 0.69). Conclusion: Irrespective of sex, type of joint and underlying disease, a measurable pain relief can be achieved with RSV in 78% of the patients with synovitis, whereby effectiveness is decreasing with increasing age and progress of illness. (orig.) [German] Ziel: In dieser prospektiven Studie wurde die Zeit bis zur Remission nach einer Radiosynoviorthese (RSO) untersucht. Ebenso wurde der Einfluss von Alter, Geschlecht, Grunderkrankung, Gelenktyp und Erkrankungsdauer auf die Erfolgsrate der RSO ermittelt. Methodik: Bei insgesamt 57 Patienten mit rheumatoider Arthritis (n = 33) und Arthritis bei aktivierter Arthrose (n = 24) wurden 130 Gelenke (36 Kniegelenke, 66 kleine und 28 mittelgrosse Gelenke) behandelt. Die Patienten wurden unter Verwendung so genannter visueller Analogskalen eine Woche vor RSO und vier bis sechs Monate danach 3-mal taeglich zur Schmerzintensitaet des

Persistent fatigue in young athletes: measuring the clinical course and identifying variables affecting clinical recovery.

Science.gov (United States)

Locke, S; Osborne, M; O'Rourke, P

2011-02-01

The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.

Stent placement with the monorail technique for treatment of mesenteric artery stenosis.

Science.gov (United States)

Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan

2006-04-01

To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.

The prognostic value of family history among patients with urinary bladder cancer.

Science.gov (United States)

Egbers, Lieke; Grotenhuis, Anne J; Aben, Katja K; Alfred Witjes, J; Kiemeney, Lambertus A; Vermeulen, Sita H

2015-03-01

A history of urinary bladder cancer (UBC) in first-degree relatives increases UBC risk by twofold. The influence of positive family history on UBC prognosis is unknown. Here, we investigated association of first-degree UBC family history with clinicopathological characteristics and prognosis of UBC patients. Detailed clinical data of 1,465 non-muscle-invasive bladder cancer (NMIBC) and 250 muscle-invasive or metastatic bladder cancer (MIBC) patients, diagnosed from 1995 to 2010, were collected through medical file review. Competing risk analyses were used to compare recurrence-free survival (RFS) and progression-free survival (PFS) of NMIBC patients according to self-reported UBC family history. Overall survival in MIBC patients was estimated using Kaplan-Meier analysis. The added value of family history in prediction of NMIBC prognosis was quantified with Harrell's concordance-index. Hundred (6.8%) NMIBC and 14 (5.6%) MIBC patients reported UBC in first-degree relatives. Positive family history was statistically significantly associated with smaller tumor size and non-significantly with more favorable distribution of other tumor characteristics. In univariable analyses, positive family history correlated with longer RFS (p = 0.11) and PFS (p = 0.04). Hazard ratios for positive vs. negative family history after adjustment for clinicopathological characteristics were 0.75 (95% CI = 0.53-1.07) and 0.45 (95% CI = 0.18-1.12) for RFS and PFS, respectively. Five familial and 48 sporadic MIBC patients (Kaplan-Meier 10-year risk: 41% and 25%) died within 10 years. Family history did not improve the c-index of prediction models. This study shows that a first-degree family history of UBC is not clearly associated with NMIBC prognosis. Family history does not aid in prediction of NMIBC recurrence or progression. © 2014 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.

Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.

Science.gov (United States)

Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J

2016-12-01

A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.

Nonrhabdomyosarcoma soft tissue sarcoma (NRSTS) in pediatric and young adult patients: Results from a prospective study using limited-margin radiotherapy.

Science.gov (United States)

Tinkle, Christopher L; Fernandez-Pineda, Israel; Sykes, April; Lu, Zhaohua; Hua, Chia-Ho; Neel, Michael D; Bahrami, Armita; Shulkin, Barry L; Kaste, Sue C; Pappo, Alberto; Spunt, Sheri L; Krasin, Matthew J

2017-11-15

Indications for and delivery of adjuvant therapies for pediatric nonrhabdomyosarcoma soft tissue sarcoma (NRSTS) have been derived largely from adult studies; therefore, significant concern remains regarding radiation exposure to normal tissue. The authors report long-term treatment outcomes and toxicities for pediatric and young adult patients with high-grade NRSTS who were treated on a prospective trial using limited-margin radiotherapy. Sixty-two patients (ages 3-22 years) with predominantly high-grade NRSTS requiring radiation were treated on a phase 2 institutional study of conformal external-beam radiotherapy and/or brachytherapy using a 1.5-cm to 2-cm anatomically constrained margin. The estimated cumulative incidence of local failure, Gray's method estimated cumulative incidence of local failure, Kaplan-Meier method estimated survival, competing-risk regression model determined predictors of disease outcome, and toxicity was reported according to CTCAE v2.0. At a median follow-up of 5.1 years (range, 0.2-10.9 years), 9 patients had experienced local failure. The 5-year overall cumulative incidence of local failure was 14.8% (95% confidence interval [CI], 7.2%-25%), and all but 1 local failure occurred outside the highest-dose irradiation volume. The 5-year Kaplan-Meier estimates for event-free and overall survival were 49.3% (95% CI, 36.3%-61.1%) and 67.9% (95% CI, 54.2%-78.3%), respectively. Multivariable analysis indicated that younger age was the only independent predictor of local recurrence (P = .004). The 5-year cumulative incidence of grade 3 or 4 late toxicity was 15% (95% CI, 7.2%-25.3%). The delivery of limited-margin radiotherapy using conformal external-beam radiotherapy or brachytherapy provides a high rate of local tumor control without an increase in marginal failures and with acceptable treatment-related morbidity. Cancer 2017;123:4419-29. © 2017 American Cancer Society. © 2017 American Cancer Society.

Intraoperative Radiation Therapy for Locally Advanced and Recurrent Soft-Tissue Sarcomas in Adults

International Nuclear Information System (INIS)

Tran, Phuoc T.; Hara, Wendy; Su Zheng; Lin, H. Jill; Bendapudi, Pavan K.; Norton, Jeffrey; Teng, Nelson; King, Christopher R.; Kapp, Daniel S.

2008-01-01

Purpose: To analyze the outcomes of and identify prognostic factors for patients treated with surgery and intraoperative radiotherapy (IORT) for locally advanced and recurrent soft-tissue sarcoma in adults from a single institution. Methods and Materials: We retrospectively reviewed 50 consecutive patients treated with IORT to 62 sites of disease. Primary sites included retroperitoneum-pelvis (78%), extremity (8%), and other (14%). Seventy percent of patients had recurrent disease failing prior surgery (70%) and/or radiation (32%). Mean disease-free interval (DFI) before IORT was 1.9 years (range, 2 weeks-5.4 years). The IORT was delivered with orthovoltage X-rays using individually sized beveled cone applicators. Clinical characteristics were as follows: mean tumor size, 10 cm (range, 1-25 cm); high-grade histologic subtype (72%); and mean dose, 1,159 cGy (range, 600-1,600 cGy). Postoperative radiation or chemotherapy was administered to 37% of IORT Sites and 32% of patients, respectively. Outcomes measured were infield control (IFC), locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Mean and median follow-up of alive patients were 59 and 35 months, respectively. Results: Kaplan-Meier 5-year IFC, LRC, DMFS, and DSS probabilities for the entire group were 55%, 26%, 51%, and 25%, respectively. Prognostic factors found to be significant (p < 0.05) on multivariate analysis were prior DFI and tumor size for LRC, extremity location and leiomyosarcoma histologic subtype for DMFS, and prior DFI for DSS. Our cohort had five Grade 3/4 complications associated with treatment or a 5-year Kaplan-Meier Grade 3/4 complication-free survival rate of 85%. Conclusions: IORT after tumor reductive surgery is well tolerated and seems to confer IFC in carefully selected patients

Miners' return to work following injuries in coal mines.

Science.gov (United States)

Bhattacherjee, Ashis; Kunar, Bijay Mihir

2016-12-22

The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW) following a miner's injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person's social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners' injuries. A study was conducted for 109 injured workers from an underground coal mine in the years 2000-2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners' return to work included presence of disease, job satisfaction and injury type. The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6):729-742. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

Comparison of outcome in 1809 patients treated with drug-eluting stents or bare-metal stents in a real-world setting

Directory of Open Access Journals (Sweden)

Vogt A

2011-11-01

Full Text Available Alexander Vogt1, Anke Schoelmerich1, Franziska Pollner1, Manuela Schlitt1, Uwe Raaz1, Lars Maegdefessel2, Iris Reindl1, Michael Buerke1, Karl Werdan1, Axel Schlitt11Department of Medicine III, Martin Luther-University, Halle, Germany; 2Division of Cardiovascular Medicine, Stanford University School of Medicine, Stanford, CA, USAPurpose: The aim of this study was to determine the long-term safety of drug-eluting stent (DES versus bare metal stent (BMS implantation in a “real-world” setting.Patients and methods: A total of 1809 patients who were treated with implantation of either BMS or DES were assessed. Kaplan-Meier and multivariate Cox regression analyses concerning primary endpoint of cardiac mortality were performed.Results: A total of 609 patients received DES. Mean age was 66.2 ± 11.3 years, 69.4% were male, and 1517 (83.8% were treated for acute coronary syndrome (unstable angina 510 [28.2%], non-ST-elevation myocardial infarction [NSTEMI] 506 [28.0%], and ST-elevation myocardial infarction [STEMI] 501 [27.7%]. Mean follow-up was 34 ± 15 months. During follow-up, 268 patients died of cardiac causes (DES 42 [7.3%]; BMS 226 [19.6%]; P < 0.001. Univariate Kaplan-Meier analysis showed an advantage of DES over BMS concerning the primary endpoint (P < 0.001. When adjusting for classic risk factors and additional factors that affect the progression of coronary heart disease (CHD, DES was not found to be superior to BMS (hazard ratio 0.996, 95% confidence interval 0.455–2.182, P = 0.993. Severely impaired renal function was an independent predictor for cardiac mortality after stent implantation.Conclusion: Treatment with DES is safe in the long term, also in patients presenting with STEMI. However, in multivariate analyses it is not superior to BMS treatment.Keywords: coronary stent, outcome, renal insufficiency, myocardial infarction, STEMI

Performance demonstration program plan for analysis of simulated headspace gases

International Nuclear Information System (INIS)

1995-06-01

The Performance Demonstration Program (PDP) for analysis of headspace gases will consist of regular distribution and analyses of test standards to evaluate the capability for analyzing VOCs, hydrogen, and methane in the headspace of transuranic (TRU) waste throughout the Department of Energy (DOE) complex. Each distribution is termed a PDP cycle. These evaluation cycles will provide an objective measure of the reliability of measurements performed for TRU waste characterization. Laboratory performance will be demonstrated by the successful analysis of blind audit samples of simulated TRU waste drum headspace gases according to the criteria set within the text of this Program Plan. Blind audit samples (hereinafter referred to as PDP samples) will be used as an independent means to assess laboratory performance regarding compliance with the QAPP QAOs. The concentration of analytes in the PDP samples will encompass the range of concentrations anticipated in actual waste characterization gas samples. Analyses which are required by the WIPP to demonstrate compliance with various regulatory requirements and which are included in the PDP must be performed by laboratories which have demonstrated acceptable performance in the PDP

Patterns of Occurrence and Outcomes of Contralateral Breast Cancer: Analysis of SEER Data

Directory of Open Access Journals (Sweden)

Zhenchong Xiong

2018-05-01

Full Text Available Population-based estimates are lacking for the temporal trends in the contralateral breast cancer (CBC risk for patients with breast cancer (BC. Data for BC patients diagnosed with CBC were collected from the Surveillance, Epidemiology, and End Results database. CBC incidence was calculated using the Kaplan-Meier method and the temporal trend in CBC incidence was assessed using joinpoint regression. Survival analysis was calculated using propensity scoring (PS and multivariate Cox regression with a competing risk model. We found that 10,944 of 212,630 patients with early-stage BC were subsequently diagnosed with secondary BC in the contralateral breast. The 5-, 10-, 15-, and 20-year cumulative CBC incidences were 1.9, 4.6, 7.6, and 10.5%, respectively. Being younger (<40 years, black, hormone receptor-negative, and having undergone radiotherapy were correlated with a high risk of CBC occurrence. CBC incidence increased continuously in the first 11 years after the initial cancer diagnosis, and the upward trend slowed from years 11 to 21, and tended to decline from years 21 to 24. CBC diagnosis was significantly and negatively associated with survival. We reported population-based estimates of the CBC occurrence pattern and risk factors. Patients are at high risk of developing CBC in the first 21 years after the initial BC diagnosis.

Total knee arthroplasty with an oxidised zirconium femoral component: ten-year survivorship analysis.

Science.gov (United States)

Ahmed, I; Salmon, L J; Waller, A; Watanabe, H; Roe, J P; Pinczewski, L A

2016-01-01

Oxidised zirconium was introduced as a material for femoral components in total knee arthroplasty (TKA) as an attempt to reduce polyethylene wear. However, the long-term survival of this component is not known. We performed a retrospective review of a prospectively collected database to assess the ten year survival and clinical and radiological outcomes of an oxidised zirconium total knee arthroplasty with the Genesis II prosthesis. The Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), Knee Injury and Osteoarthritis Outcome Score (KOOS) and a patient satisfaction scale were used to assess outcome. A total of 303 consecutive TKAs were performed in 278 patients with a mean age of 68 years (45 to 89). The rate of survival ten years post-operatively as assessed using Kaplan-Meier analysis was 97% (95% confidence interval 94 to 99) with revision for any reason as the endpoint. There were no revisions for loosening, osteolysis or failure of the implant. There was a significant improvement in all components of the WOMAC score at final follow-up (p zirconium TKA gives comparable rates of survival with other implants and excellent functional outcomes ten years post-operatively. Total knee arthroplasty with an oxidised zirconium femoral component gives comparable long-term rates of survival and functional outcomes with conventional implants. ©2016 The British Editorial Society of Bone & Joint Surgery.

Feasibility and demonstration of a cloud-based RIID analysis system

Science.gov (United States)

Wright, Michael C.; Hertz, Kristin L.; Johnson, William C.; Sword, Eric D.; Younkin, James R.; Sadler, Lorraine E.

2015-06-01

A significant limitation in the operational utility of handheld and backpack radioisotope identifiers (RIIDs) is the inability of their onboard algorithms to accurately and reliably identify the isotopic sources of the measured gamma-ray energy spectrum. A possible solution is to move the spectral analysis computations to an external device, the cloud, where significantly greater capabilities are available. The implementation and demonstration of a prototype cloud-based RIID analysis system have shown this type of system to be feasible with currently available communication and computational technology. A system study has shown that the potential user community could derive significant benefits from an appropriately implemented cloud-based analysis system and has identified the design and operational characteristics required by the users and stakeholders for such a system. A general description of the hardware and software necessary to implement reliable cloud-based analysis, the value of the cloud expressed by the user community, and the aspects of the cloud implemented in the demonstrations are discussed.

Association of the Aspartate Aminotransferase to Alanine Aminotransferase Ratio with BNP Level and Cardiovascular Mortality in the General Population: The Yamagata Study 10-Year Follow-Up

Directory of Open Access Journals (Sweden)

Miyuki Yokoyama

2016-01-01

Full Text Available Background. Early identification of high risk subjects for cardiovascular disease in health check-up is still unmet medical need. Cardiovascular disease is characterized by the superior increase in aspartate aminotransferase (AST to alanine aminotransferase (ALT. However, the association of AST/ALT ratio with brain natriuretic peptide (BNP levels and cardiovascular mortality remains unclear in the general population. Methods and Results. This longitudinal cohort study included 3,494 Japanese subjects who participated in a community-based health check-up, with a 10-year follow-up. The AST/ALT ratio increased with increasing BNP levels. And multivariate logistic analysis showed that the AST/ALT ratio was significantly associated with a high BNP (≥100 pg/mL. There were 250 all-cause deaths including 79 cardiovascular deaths. Multivariate Cox proportional hazard regression analysis revealed that a high AST/ALT ratio (>90 percentile was an independent predictor of all-cause and cardiovascular mortality after adjustment for confounding factors. Kaplan-Meier analysis demonstrated that cardiovascular mortality was higher in subjects with a high AST/ALT ratio than in those without. Conclusions. The AST/ALT ratio was associated with an increase in BNP and was predictive of cardiovascular mortality in a general population. Measuring the AST/ALT ratio during routine health check-ups may be a simple and cost-effective marker for cardiovascular mortality.

Epidermal Growth Factor Receptor Is Related to Poor Survival in Glioblastomas: Single-Institution Experience

Science.gov (United States)

Choi, Youngmin; Lee, Hyung-Sik; Hur, Won-Joo; Sung, Ki-Han; Kim, Ki-Uk; Choi, Sun-Seob; Kim, Su-Jin; Kim, Dae-Cheol

2013-01-01

Purpose There are conflicting results surrounding the prognostic significance of epidermal growth factor receptor (EGFR) status in glioblastoma (GBM) patients. Accordingly, we attempted to assess the influence of EGFR expression on the survival of GBM patients receiving postoperative radiotherapy. Materials and Methods Thirty three GBM patients who had received surgery and postoperative radiotherapy at our institute, between March 1997 and February 2006, were included. The evaluation of EGFR expression with immunohistochemistry was available for 30 patients. Kaplan-Meier survival analysis and Cox regression were used for statistical analysis. Results EGFR was expressed in 23 patients (76.7%), and not expressed in seven (23.3%). Survival in EGFR expressing GBM patients was significantly less than that in non-expressing patients (median survival: 12.5 versus 17.5 months, p=0.013). Patients who received more than 60 Gy showed improved survival over those who received up to 60 Gy (median survival: 17.0 versus 9.0 months, p=0.000). Negative EGFR expression and a higher radiation dose were significantly correlated with improved survival on multivariate analysis. Survival rates showed no differences according to age, sex, and surgical extent. Conclusion The expression of EGFR demonstrated a significantly deleterious effect on the survival of GBM patients. Therefore, approaches targeting EGFR should be considered in potential treatment methods for GBM patients, in addition to current management strategies. PMID:23225805

Postoperative radiotherapy improves local control and survival in patients with uterine leiomyosarcoma

International Nuclear Information System (INIS)

Wong, Philip; Han, Kathy; Sykes, Jenna; Catton, Charles; Laframboise, Stephane; Fyles, Anthony; Manchul, Lee; Levin, Wilfred; Milosevic, Michael

2013-01-01

To examine the role of radiotherapy (RT) in uterine leiomyosarcomas (LMS) and to determine the patient population who may benefit from RT. From 1998–2008, 69 patients with primary uterine LMS underwent hysterectomy with or without pelvic radiotherapy to a median dose of 45 Gy. Univariate analysis was performed using the Kaplan-Meier method and cumulative-incidence function, and multivariate analyses using Fine and Gray or Cox proportional hazard models. Following surgery, 32 out of 69 patients received RT. There was no evidence of any correlation between patient, disease and treatment characteristics and the use of RT. Median follow-up was 57 months. RT was associated with reduced local recurrence (3y LR 19% vs. 39%; Gray’s p = 0.019) and improved overall survival (3y OS 69% vs. 35%; log-rank p = 0.025) on univariate analysis. Multivariate analysis demonstrated that RT reduced LR (HR: 0.28, CI: 0.11-0.69, p = 0.006) and increased OS (HR: 0.44, CI: 0.23-0.85, p = 0.014) independent of other clinical and pathologic factors. Positive surgical margins increased the odds of LR (HR: 5.6, CI: 2.3-13.4, p = 0.00012). Large tumor size and advanced stage (II-IV) were associated with the development of distant metastases and inferior OS. Postoperative pelvic RT reduces LR and improves OS of patients with uterine LMS

Detection of semi-volatile organic compounds in permeable ...

Science.gov (United States)

Abstract The Edison Environmental Center (EEC) has a research and demonstration permeable parking lot comprised of three different permeable systems: permeable asphalt, porous concrete and interlocking concrete permeable pavers. Water quality and quantity analysis has been ongoing since January, 2010. This paper describes a subset of the water quality analysis, analysis of semivolatile organic compounds (SVOCs) to determine if hydrocarbons were in water infiltrated through the permeable surfaces. SVOCs were analyzed in samples collected from 11 dates over a 3 year period, from 2/8/2010 to 4/1/2013.Results are broadly divided into three categories: 42 chemicals were never detected; 12 chemicals (11 chemical test) were detected at a rate of less than 10% or less; and 22 chemicals were detected at a frequency of 10% or greater (ranging from 10% to 66.5% detections). Fundamental and exploratory statistical analyses were performed on these latter analyses results by grouping results by surface type. The statistical analyses were limited due to low frequency of detections and dilutions of samples which impacted detection limits. The infiltrate data through three permeable surfaces were analyzed as non-parametric data by the Kaplan-Meier estimation method for fundamental statistics; there were some statistically observable difference in concentration between pavement types when using Tarone-Ware Comparison Hypothesis Test. Additionally Spearman Rank order non-parame

[Clinical study of influential factors on renal scarring after ESWL monotherapy for renal stone disease].

Science.gov (United States)

Ishito, Noritaka; Takamoto, Hitoshi; Kunitomi, Kimito; Satoh, Eiichi; Ishii, Ayano; Shiotuka, Youichi; Sako, Shinichi; Ohta, Naoki; Araki, Tohru

2002-11-01

ESWL is now widely used for the treatment of renal stone disease. Although ESWL has many advantages for patients' quality of life, few reports have demonstrated the long-term outcomes of the alterations of renal morphology after ESWL. We reported renal scarring after ESWL monotherapy in patients with renal calyceal stones. In this study, we evaluated a large series of patients' cohort treated at our institution, and assessed the causal effect of ESWL on the late occurrence of renal scar formation. ESWL was performed with EDAP (LT-01,02) that generates shock wave energy by piezoelectric discharge. We analyzed the records of 285 kidneys treated between Dec. 1986 and Nov. 1998. Renal scarring was noted in 44 kidneys and not in 241 kidneys with periodical ultrasonography. We compared the backgrounds of the two groups using chi-square or non-parametric analysis. The Kaplan-Meier method and Cox regression model determined the analysis of renal scar formation. Univariate and multiple regression analysis revealed that the total amount of ESWL emission and hyperuricemia independently affected the probability of renal scar formation. Over-emission of ESWL (over 10,000 shots) must be care for the prevention of renal scarring in patients with renal calyceal calculi, especially when associated with hyperuricemia. After ESWL, periodical checkups with ultrasonography will provide useful information for the clinical diagnosis of renal scarring.

C-reactive protein in patients with advanced metastatic renal cell carcinoma: Usefulness in identifying patients most likely to benefit from initial nephrectomy

International Nuclear Information System (INIS)

Ito, Hiroki; Kishida, Takeshi; Miura, Takeshi; Kubota, Yoshinobu; Yao, Masahiro; Shioi, Koichi; Murakami, Takayuki; Takizawa, Akitoshi; Sano, Futoshi; Kawahara, Takashi; Mizuno, Nobuhiko; Makiyama, Kazuhide; Nakaigawa, Noboru

2012-01-01

C-reactive protein (CRP) is considered a useful serum marker for patients with RCC. However, its clinical utility in advanced metastatic renal cell carcinoma (AM-RCC), particularly in deciding whether to perform nephrectomy at the onset, is not well studied. We retrospectively evaluated 181 patients with AM-RCC, including 18 patients underwent potentially curative surgery, 111 underwent cytoreductive nephrectomy, and 52 received medical treatment only. CRP cutoff points were determined by receiver operating characteristic (ROC) curve analysis. Kaplan-Meier and Cox regression analyses were used for survival tests. ROC analysis suggested that grouping patients according to 3 CRP ranges was a rational model. Patients with highly elevated CRP (≥67.0 mg/L) presented remarkably poor prognosis despite treatment (nephrectomy or medical treatment only). Cox regression models demonstrated that risk factors of overall survival for patients who underwent nephrectomy were the CRP ranges defined in this study (≤18.0 mg/L, >18.0 and <67.0 mg/L, and ≥67.0 mg/L), ECOG PS (0, 1, and ≥2), and number of metastatic organ sites (0–1 and ≥2). The retrospective design is a limitation of this study. Our study demonstrated that the serum CRP level is a statistically significant prognostic parameter for patients with AM-RCC. The data also indicated that pretreatment serum CRP level provides useful prognostic information that helps in deciding whether to perform initial nephrectomy for patients with AM-RCC

Analysis techniques for background rejection at the Majorana Demonstrator

Energy Technology Data Exchange (ETDEWEB)

Cuestra, Clara [University of Washington; Rielage, Keith Robert [Los Alamos National Laboratory; Elliott, Steven Ray [Los Alamos National Laboratory; Xu, Wenqin [Los Alamos National Laboratory; Goett, John Jerome III [Los Alamos National Laboratory

2015-06-11

The MAJORANA Collaboration is constructing the MAJORANA DEMONSTRATOR, an ultra-low background, 40-kg modular HPGe detector array to search for neutrinoless double beta decay in ⁷⁶Ge. In view of the next generation of tonne-scale Ge-based 0νββ-decay searches that will probe the neutrino mass scale in the inverted-hierarchy region, a major goal of the MAJORANA DEMONSTRATOR is to demonstrate a path forward to achieving a background rate at or below 1 count/tonne/year in the 4 keV region of interest around the Q-value at 2039 keV. The background rejection techniques to be applied to the data include cuts based on data reduction, pulse shape analysis, event coincidences, and time correlations. The Point Contact design of the DEMONSTRATOR's germanium detectors allows for significant reduction of gamma background.

The 5-year incidence of bleb-related infection and its risk factors after filtering surgeries with adjunctive mitomycin C: collaborative bleb-related infection incidence and treatment study 2.

Science.gov (United States)

Yamamoto, Tetsuya; Sawada, Akira; Mayama, Chihiro; Araie, Makoto; Ohkubo, Shinji; Sugiyama, Kazuhisa; Kuwayama, Yasuaki

2014-05-01

To report the 5-year incidence of bleb-related infection after mitomycin C-augmented glaucoma filtering surgery and to investigate the risk factors for infections. Prospective, observational cohort study. A total of 1098 eyes of 1098 glaucoma patients who had undergone mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation performed at 34 clinical centers. Patients were followed up at 6-month intervals for 5 years, with special attention given to bleb-related infections. The follow-up data were analyzed via Kaplan-Meier survival analysis and the Cox proportional hazards model. Incidence of bleb-related infection over 5 years and risk factors for infections. Of the 1098 eyes, a bleb-related infection developed in 21 eyes. Kaplan-Meier survival analysis revealed that the incidence of bleb-related infection was 2.2±0.5% (cumulative incidence ± standard error) at the 5-year follow-up for all cases, whereas it was 7.9±3.1% and 1.7±0.4% for cases with and without a history of bleb leakage, respectively (P = 0.000, log-rank test). When only eyes with a well-functioning bleb were counted, it was 3.9±1.0%. No differences were found between the trabeculectomy cases and the combined surgery cases (P = 0.398, log-rank test) or between cases with a fornix-based flap and those with a limbal-based flap (P = 0.651, log-rank test). The Cox model revealed that a history of bleb leakage and younger age were risk factors for infections. The 5-year cumulative incidence of bleb-related infection was 2.2±0.5% in eyes treated with mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation in our prospective, multicenter study. Bleb leakage and younger age were the main risk factors for infections. Copyright © 2014 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Long-term outcomes in patients with early stage nodular lymphocyte-predominant Hodgkin's lymphoma treated with radiotherapy.

Directory of Open Access Journals (Sweden)

Abhishek A Solanki

Full Text Available PURPOSE: Radiation therapy (RT is commonly used as definitive treatment for early-stage nodular lymphocyte-predominant Hodgkin's lymphoma (NLPHL. We evaluated the cause-specific survival (CSS, overall survival (OS, and second malignancy (SM rates in patients with early-stage NLPHL treated with RT. METHODS AND MATERIALS: Patients with stage I-II NLPHL between 1988 and 2009 who underwent RT were selected from the Surveillance, Epidemiology and End Results database. Univariate analysis (UVA for CSS and Os was performed using the Kaplan-Meier method and included age, gender, involved site, year of diagnosis, presence of B-symptoms, and extranodal involvement (ENI. Multivariable analysis (MVA was performed using Cox Proportional Hazards modeling and included the above clinical variables. SM were classified as RT-related or non-RT-related. Freedom from SM and freedom from RT-related SM were determined using the Kaplan-Meier method. RESULTS: The study cohort included 469 patients. Median age was 37 years. The most common involved sites were the head and neck (36%, axilla/arm (26%, and multiple lymph node regions (18%. Sixty-eight percent had stage I disease, 70% were male, 4% had ENI, and 7% had B-symptoms. Median follow-up was 6 years. Ten-year CSS and Os were 98% and 88%, respectively. On UVA, none of the covariates was associated with CSS. Increasing age (p<0.01 and female gender (p<0.01 were associated with worse Os. On MVA, older age (p<0.01, female gender (p=0.04, multiple regions of involvement (p=0.03, stage I disease (p=0.02, and presence of B-symptoms (p=0.02 were associated with worse Os. Ten-year freedom from SM and freedom from RT-related SM were 89% and 99%, respectively. CONCLUSIONS: This is the largest series to evaluate the outcomes of stage I-II NLPHL patients treated with RT and found that this patient population has an excellent long-term prognosis and a low rate of RT-related second malignancies.

Change in fibrosis score as a predictor of mortality among HIV-infected patients with viral hepatitis.

Science.gov (United States)

Jain, Mamta K; Seremba, Emmanuel; Bhore, Rafia; Dao, Doan; Joshi, Reeti; Attar, Nahid; Yuan, He-Jun; Lee, William M

2012-02-01

Noninvasive markers of liver fibrosis, measured at baseline, have been shown to predict liver-related mortality. It remains unknown if a change in the value of the scores over time predicts mortality in patients with HIV and viral hepatitis. In this retrospective study, survival in HIV/hepatitis B virus (HBV; n = 67), HIV/hepatitis C virus (HCV; n = 43), and HIV/HBV/HCV (n = 41) patients was examined using Kaplan-Meier life table analysis. Aspartate aminotransferase (AST)-to-platelet ratio index (APRI) and FIB-4 scores, two noninvasive markers of liver fibrosis, were calculated at baseline and at last available clinical follow-up to determine the change in fibrosis score. Factors associated with mortality were assessed by Cox proportional hazards, including the change in the noninvasive marker score between the two time points. All-cause mortality was determined by Social Security Death Index and chart review. Sixty-seven were coinfected with HIV/HBV, 43 with HIV/HCV, and 41 were triply infected (HIV/HBV/HCV). Kaplan-Meier analysis showed similar survival for the three groups at 7 years of follow-up (p = 0.10). However, median length of follow-up was lower in HIV/HCV (60.5; range 0-102) compared to HIV/HBV (75.7; 12.3-126.5) and HIV/HBV/HCV (80.0; 2.7-123) months, respectively, p = 0.02. Baseline fibrosis score (p = 0.002), an increase in the value for noninvasive measurements for fibrosis (p < 0.001), and the presence of HIV/HCV coinfection (p = 0.041) were each associated with higher risk for mortality. Baseline fibrosis score (p = 0.03) and an increase in FIB-4 score (p = 0.05) were independent predictors of all-cause mortality, but liver-related mortality was not evaluated. In this study, baseline fibrosis score was predictive of 7-year all-cause mortality. Further studies are needed in a prospective cohort to evaluate the predictive value of monitoring changes in fibrosis scores over time to predict mortality in patients with viral hepatitis.

Synergistic effects of cognitive impairment on physical disability in all-cause mortality among men aged 80 years and over: Results from longitudinal older veterans study.

Directory of Open Access Journals (Sweden)

Wan-Chen Yu

Full Text Available We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan.This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI, geriatric syndromes, activities of daily living (ADL using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE. Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk.Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years. Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038 or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002 after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition.Physical disability

Synergistic effects of cognitive impairment on physical disability in all-cause mortality among men aged 80 years and over: Results from longitudinal older veterans study.

Science.gov (United States)

Yu, Wan-Chen; Chou, Ming-Yueh; Peng, Li-Ning; Lin, Yu-Te; Liang, Chih-Kuang; Chen, Liang-Kung

2017-01-01

We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan. This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI), geriatric syndromes, activities of daily living (ADL) using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE). Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk. Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years). Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038) or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002) after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition. Physical disability is a major

3D Quantitative tumour burden analysis in patients with hepatocellular carcinoma before TACE: comparing single-lesion vs. multi-lesion imaging biomarkers as predictors of patient survival

International Nuclear Information System (INIS)

Fleckenstein, Florian N.; Schernthaner, Ruediger E.; Duran, Rafael; Sohn, Jae Ho; Sahu, Sonia; Zhao, Yan; Hamm, Bernd; Gebauer, Bernhard; Lin, MingDe; Geschwind, Jean-Francois; Chapiro, Julius

2016-01-01

To compare the ability of single- vs. multi-lesion assessment on baseline MRI using 1D- and 3D-based measurements to predict overall survival (OS) in patients with hepatocellular carcinoma (HCC) before transarterial chemoembolization (TACE). This retrospective analysis included 122 patients. A quantitative 3D analysis was performed on baseline MRI to calculate enhancing tumour volume (ETV [cm 3 ]) and enhancing tumour burden (ETB [%]) (ratio between ETV [cm 3 ] and liver volume). Furthermore, enhancing and overall tumour diameters were measured. Patients were stratified into two groups using thresholds derived from the BCLC staging system. Statistical analysis included Kaplan-Meier plots, uni- and multivariate cox proportional hazard ratios (HR) and concordances. All methods achieved good separation of the survival curves (p < 0.05). Multivariate analysis showed an HR of 5.2 (95 % CI 3.1-8.8, p < 0.001) for ETV [cm 3 ] and HR 6.6 (95 % CI 3.7-11.5, p < 0.001) for ETB [%] vs. HR 2.6 (95 % CI 1.2-5.6, p = 0.012) for overall diameter and HR 3.0 (95 % CI 1.5-6.3, p = 0.003) for enhancing diameter. Concordances were highest for ETB [%], with no added predictive power for multi-lesion assessment (difference between concordances not significant). 3D quantitative assessment is a stronger predictor of survival as compared to diameter-based measurements. Assessing multiple lesions provides no substantial improvement in predicting OS than evaluating the dominant lesion alone. (orig.)

Evaluation of Hydraulic Loads on the Runner Blades of a Kaplan Turbine using CFD Simulation and Model Test

Directory of Open Access Journals (Sweden)

Zoltan-Iosif Korka

2016-10-01

Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.

A population-based study of survival and discharge status for survivors after head injury

DEFF Research Database (Denmark)

Engberg, Aase Worså; Teasdale, T W

2004-01-01

and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score

Syncytin immunoreactivity in colorectal cancer

DEFF Research Database (Denmark)

Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen

2009-01-01

monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....

AEP Ohio gridSMART Demonstration Project Real-Time Pricing Demonstration Analysis

Energy Technology Data Exchange (ETDEWEB)

Widergren, Steven E.; Subbarao, Krishnappa; Fuller, Jason C.; Chassin, David P.; Somani, Abhishek; Marinovici, Maria C.; Hammerstrom, Janelle L.

2014-02-01

This report contributes initial findings from an analysis of significant aspects of the gridSMART® Real-Time Pricing (RTP) – Double Auction demonstration project. Over the course of four years, Pacific Northwest National Laboratory (PNNL) worked with American Electric Power (AEP), Ohio and Battelle Memorial Institute to design, build, and operate an innovative system to engage residential consumers and their end-use resources in a participatory approach to electric system operations, an incentive-based approach that has the promise of providing greater efficiency under normal operating conditions and greater flexibility to react under situations of system stress. The material contained in this report supplements the findings documented by AEP Ohio in the main body of the gridSMART report. It delves into three main areas: impacts on system operations, impacts on households, and observations about the sensitivity of load to price changes.

Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center

Directory of Open Access Journals (Sweden)

Claudio Calazan do Carmo

2011-08-01

Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (p<0.001. There was seen a dose-response relationship between mortality and clinical staging, ranging from 27.8 to 749.6 per 1,000 cases-year in women stage I and IV, respectively. CONCLUSIONS: The study showed that early detection through prevention programs is crucial to increase cervical cancer survival.

Genetic architecture of the Delis-Kaplan Executive Function System Trail Making Test: evidence for distinct genetic influences on executive function.

Science.gov (United States)

Vasilopoulos, Terrie; Franz, Carol E; Panizzon, Matthew S; Xian, Hong; Grant, Michael D; Lyons, Michael J; Toomey, Rosemary; Jacobson, Kristen C; Kremen, William S

2012-03-01

To examine how genes and environments contribute to relationships among Trail Making Test (TMT) conditions and the extent to which these conditions have unique genetic and environmental influences. Participants included 1,237 middle-aged male twins from the Vietnam Era Twin Study of Aging. The Delis-Kaplan Executive Function System TMT included visual searching, number and letter sequencing, and set-shifting components. Phenotypic correlations among TMT conditions ranged from 0.29 to 0.60, and genes accounted for the majority (58-84%) of each correlation. Overall heritability ranged from 0.34 to 0.62 across conditions. Phenotypic factor analysis suggested a single factor. In contrast, genetic models revealed a single common genetic factor but also unique genetic influences separate from the common factor. Genetic variance (i.e., heritability) of number and letter sequencing was completely explained by the common genetic factor while unique genetic influences separate from the common factor accounted for 57% and 21% of the heritabilities of visual search and set shifting, respectively. After accounting for general cognitive ability, unique genetic influences accounted for 64% and 31% of those heritabilities. A common genetic factor, most likely representing a combination of speed and sequencing, accounted for most of the correlation among TMT 1-4. Distinct genetic factors, however, accounted for a portion of variance in visual scanning and set shifting. Thus, although traditional phenotypic shared variance analysis techniques suggest only one general factor underlying different neuropsychological functions in nonpatient populations, examining the genetic underpinnings of cognitive processes with twin analysis can uncover more complex etiological processes.

Clinical performance of ART restorations in primary teeth: a survival analysis.

Science.gov (United States)

Faccin, Elise Sasso; Ferreira, Simone Helena; Kramer, Paulo Floriani; Ardenghi, Thiago Machado; Feldens, Carlos Alberto

2009-01-01

To assess the survival of Atraumatic Restorative Treatment (ART) restorations in primary teeth performed in a dental clinical setting. One hundred and five single-surface ART restorations placed in 56 preschool children (mean age 31 months) were included. Final-year dental students performed the restorations using standard ART procedures with hand instruments. A resin-modified glass ionomer cement (Vitremer 3M/ESPE) was used as a restorative material. Performances of the restorations were assessed directly by the ART evaluation criteria. Follow-up period ranged from 6 to 48 months. Survival estimates for restoration longevity were evaluated using the Kaplan-Meier method. Log-rank test (P ART restorations were 89%, 85% and 72% in 6 to 11, 12 to 24 and 25 to 48 months of evaluation respectively. Differences in success rates among demographic and clinical characteristics were not statistically significant. High survivals rates of the ART restorations found in this study seem to indicate the reliability of this approach as an appropriate treatment option for primary teeth in a clinical setting.

Geographical variations in the use of cancer treatments are associated with survival of lung cancer patients

DEFF Research Database (Denmark)

Møller, Henrik; Coupland, Victoria H; Tataru, Daniela

2018-01-01

INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... diagnosis. RESULTS: Survival improved over the period studied. The use of active treatment varied between geographical areas, with inter-quintile ranges of 9%-17% for surgical resection, 4%-13% for radical radiotherapy, and 22%-35% for chemotherapy. At 2 years, there were 188 potentially avoidable deaths...

PAM50 breast cancer intrinsic subtypes and effect of gemcitabine in advanced breast cancer patients

DEFF Research Database (Denmark)

Jørgensen, Charlotte Levin Tykjær; Nielsen, Torsten O; Bjerre, Karsten D

2014-01-01

BACKGROUND: In vitro studies suggest basal breast cancers are more sensitive to gemcitabine relative to other intrinsic subtypes. The main objective of this study was to use specimens from a randomized clinical trial to evaluate whether the basal-like subtype identifies patients with advanced...... breast cancer who benefit from gemcitabine plus docetaxel (GD) compared to single agent docetaxel (D). MATERIAL AND METHODS: From patients randomly assigned to GD or D, RNA was isolated from archival formalin-fixed, paraffin-embedded primary breast tumor tissue and used for PAM50 intrinsic subtyping...... chemotherapy were analyzed by the Kaplan-Meier method, and Cox proportional hazards regression models. Data analysis was performed independently by the Danish Breast Cancer Cooperative Group (DBCG) statistical core and all statistical tests were two-sided. RESULTS: RNA from 270 patients was evaluable; 84...

Analyzing repeated data collected by mobile phones and frequent text messages. An example of Low back pain measured weekly for 18 weeks

DEFF Research Database (Denmark)

Axén, Iben; Bodin, Lennart; Kongsted, Alice

2012-01-01

to recovery? This question was answered using survival analysis, illustrated in Kaplan-Meier curves, Proportional Hazard regression analyses and spline regression analyses. 4: How is the repeatedly measured data associated with baseline (predictor) variables? This question was answered using generalized...... involves some challenges. Vital issues to consider are the within-subject correlation, the between measurement occasion correlation and the presence of missing values. The overall aim of this commentary is to describe different methods of analyzing repeated data. It is meant to give an overview...... for the clinical researcher in order for complex outcome measures to be interpreted in a clinically meaningful way. METHODS: A model data set was formed using data from two clinical studies, where patients with low back pain were followed with weekly text messages for 18 weeks. Different research questions...

Nomogram based overall survival prediction in stereotactic body radiotherapy for oligo-metastatic lung disease

DEFF Research Database (Denmark)

Tanadini-Lang, S; Rieber, J; Filippi, A R

2017-01-01

BACKGROUND: Radical local treatment of pulmonary metastases is practiced with increasing frequency due to acknowledgment and better understanding of oligo-metastatic disease. This study aimed to develop a nomogram predicting overall survival (OS) after stereotactic body radiotherapy (SBRT......) for pulmonary metastases. PATIENTS AND METHODS: A multi-institutional database of 670 patients treated with SBRT for pulmonary metastases was used as training cohort. Cox regression analysis with bidirectional variable elimination was performed to identify factors to be included into the nomogram model...... to predict 2-year OS. The calibration rate of the nomogram was assessed by plotting the actual Kaplan-Meier 2-year OS against the nomogram predicted survival. The nomogram was externally validated using two separate monocentric databases of 145 and 92 patients treated with SBRT for pulmonary metastases...

Radical prostatectomy in clinically localized high-risk prostate cancer

DEFF Research Database (Denmark)

Røder, Martin Andreas; Berg, Kasper Drimer; Christensen, Ib Jarle

2013-01-01

) is regarded as primary therapy by others. This study examined the outcome for high-risk localized PCa patients treated with RP. Material and methods. Of 1300 patients who underwent RP, 231 were identified as high-risk. Patients were followed for biochemical recurrence (BCR) (defined as prostate-specific......Abstract Objective. The optimal therapeutic strategy for high-risk localized prostate cancer (PCa) is controversial. Supported by randomized trials, the combination of external beam radiation therapy (EBRT) and endocrine therapy (ET) is advocated by many, while radical prostatectomy (RP...... antigen ≥ 0.2 ng/ml), metastatic disease and survival. Excluding node-positive patients, none of the patients received adjuvant therapy before BCR was confirmed. Univariate and multivariate analysis was performed with Kaplan-Meier and Cox proportional hazard models. Results. Median follow-up was 4.4 years...

Physical activity increases survival after heart valve surgery

DEFF Research Database (Denmark)

Lund, K.; Sibilitz, Kirstine Lærum; Kikkenborg Berg, Selina

2016-01-01

physical activity levels 6-12 months after heart valve surgery and (1) survival, (2) hospital readmission 18-24 months after surgery and (3) participation in exercise-based cardiac rehabilitation. METHODS: Prospective cohort study with registry data from The CopenHeart survey, The Danish National Patient......OBJECTIVES: Increased physical activity predicts survival and reduces risk of readmission in patients with coronary heart disease. However, few data show how physical activity is associated with survival and readmission after heart valve surgery. Objective were to assess the association between...... Register and The Danish Civil Registration System of 742 eligible patients. Physical activity was quantified with the International Physical Activity Questionnaire and analysed using Kaplan-Meier analysis and Cox regression and logistic regression methods. RESULTS: Patients with a moderate to high physical...

Chest computed tomography scores are predictive of survival in patients with cystic fibrosis awaiting lung transplantation

DEFF Research Database (Denmark)

Loeve, Martine; Hop, Wim C. J.; de Bruijne, Marleen

2012-01-01

Rationale: Up to a third of cystic fibrosis (CF) patients awaiting lung transplantation (LTX) die while waiting. Inclusion of computed tomography (CT) scores may improve survival prediction models such as the lung allocation score (LAS). Objectives: This study investigated the association between...... CT and survival in CF patients screened for LTX. Methods: Clinical data and chest CTs of 411 CF patients screened for LTX between 1990 and 2005 were collected from 17 centers. CTs were scored with the Severe Advanced Lung Disease (SALD) 4-category scoring system, including the components "infection....../inflammation" (INF), air trapping/hypoperfusion (AT), normal/hyperperfusion (NOR) and bulla/cysts (BUL). The volume of each component was computed using semi-automated software. Survival analysis included Kaplan-Meier curves, and Cox-regression models. Measurements and main results: 366 (186 males) out of 411...

S100A14 is a novel independent prognostic biomarker in the triple-negative breast cancer subtype

DEFF Research Database (Denmark)

Ehmsen, Sidse; Hansen, Lea Tykgaard; Bak, Martin

2015-01-01

Triple-negative breast cancer (TNBC) represents a heterogeneous subgroup with generally poor outcome and lack of an effective targeted therapy. Prognostic or predictive biomarkers to guide treatment decisions for this group of patients are needed. To evaluate the potential of S100A14 protein...... as a novel biomarker in TNBC, the protein expression of S100A14 was correlated with clinical outcomes in a Pilot Sample set and a Danish cohort of predominantly TNBC patients. Kaplan-Meier analysis identified a prognostic impact of S100A14 on disease-free survival and overall survival, showing that tumors......-), had equally poor outcomes as those with tumor-positive axillary lymph nodes (N+), while TNBC/N- patients with low S100A14 expression had a significantly better disease free survival (p = 0.013). Multivariate analysis revealed that S100A14 is an independent prognostic factor for TNBC patients (p = 0...

Enzalutamide Antitumour Activity Against Metastatic Castration-resistant Prostate Cancer Previously Treated with Docetaxel and Abiraterone

DEFF Research Database (Denmark)

Brasso, Klaus; Thomsen, Frederik B; Schrader, Andres J

2015-01-01

prostate-specific antigen (PSA) kinetics, patient characteristics, and progression-free survival, respectively. Kaplan-Meier survival analysis and Cox proportional hazard analysis were performed. RESULTS AND LIMITATIONS: We identified 137 patients who prior to enzalutamide had progressed following a median...... of eight cycles of docetaxel and seven courses of abiraterone. The median time on enzalutamide was 3.2 mo; median OS from the time patients started enzalutamide was 8.3 mo (95% confidence interval, 6.8-9.8). Only 45 (38%) and 22 (18%) patients had PSA declines (unconfirmed) >30% and 50%, respectively....... Patients who had more than 30% or 50% falls in PSA had improved survival compared with patients who had no such PSA fall (11.4 mo vs 7.1 mo; p=0.001 and 12.6 vs 7.4 mo; p=0.007, respectively). Poor performance status and low haemoglobin was negatively associated with OS. CONCLUSIONS: Median OS...

Prolonged methylprednisolone therapy after the pulse treatment for patients with moderate-to-severe paraquat poisoning: A retrospective analysis.

Science.gov (United States)

Gao, Jie; Feng, ShunYi; Wang, Jian; Yang, SiYuan; Li, Yong

2017-06-01

This retrospective study aims to evaluate the effect of prolonged methylprednisolone (MP) therapy on the mortality of patients with moderate-to-severe paraquat (PQ) poisoning after the pulse treatment.We performed a retrospective analysis of patients with acute moderate-to-severe PQ poisoning that were admitted to the emergency department from May 2012 to August 2016. Out of 138 patients, 60 were treated with pulse treatment (15 mg kg day MP for 3 days) and 78 were treated with prolonged MP therapy after pulse treatment (15 mg kg day MP for 3 days; afterward, the dosage was reduced in half every 2 days, and the MP therapy was terminated until 0.47 mg kg day). Kaplan-Meier method was used to compare the mortality between the 2 groups. Cox proportional hazard models were used to estimate the hazard ratios (HR) and 95% confidence intervals (CI).The mortality of the prolonged MP therapy after pulse treatment group was lower than that of the pulse group (47.4% vs 63.3%; log-rank tests, P  =  .003). According to the multivariate Cox analysis, the prolonged MP therapy after pulse treatment was significantly associated with a lower mortality risk (HR: 0.31, 95% CI: 0.19-0.52, P treatment caused more incidences of leucopenia than the pulse treatment alone (25.6% vs 11.7%, P  =  .04).The prolonged MP therapy after pulse treatment can reduce the mortality of moderate-to-severe PQ poisoning patients.

[Analysis of clinicopathologic and survival characteristics in patients with right-or left-sided colon cancer].

Science.gov (United States)

Hu, Junjie; Zhou, Zhixiang; Liang, Jianwei; Zhou, Haitao; Wang, Zheng; Zhang, Xingmao; Zeng, Weigen

2015-07-28

This study aimed to clarify the clinical and histological parameters, and survival difference between right- and left-sided colon cancer. We retrospectively analyzed the medical records (2006.1-2009.12) of 1 088 consecutive colon cancer patients who received surgery at our hospital. Right- and left-sided colon cancers were compared regarding the clinical and histological parameters. The survival analysis was performed by the Kaplan-Meier method, and the log-rank test was used to determine the statistical significance of differences. Right-sided colon cancer was associated with older age, a more advanced state, and poorly differentiated and undifferentiated adenocarcinoma (25.2% vs 13.2%), mucinous adenocarcinoma (33.5% vs 17.3%) and vascular invasion (9.9% vs 3.9%) were more commonly seen in right-sided colon cancer compared with right-sided colon cancer, and all these differences were statistically significant. Median overall survival was right, 67 months; and left, 68 months. The five-years overall survival of right- and left-sided colon cancer was I/II stage, 91.4% vs 88.6% (P = 0.819); III stage, 66.1% vs 75.4% (P = 0.010); and IV stage, 27.8% vs 38.5% (P = 0.020) respectively. Right- and left-sided colon cancers are significantly different regarding clinical and histological parameters. Right-sided colon cancers in stage III and IV have a worse prognosis.

Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province

Directory of Open Access Journals (Sweden)

Reza Zamani

2015-05-01

Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.

Tempo de internação e a ocorrência de eventos adversos a medicamentos: uma questão da enfermagem Tiempo de internación y la ocurrencia de eventos adversos por medicamentos: una cuestión de la enfermería The length of stay and the occurrence of adverse drug: a question of nursing

Directory of Open Access Journals (Sweden)

Keroulay Estebanez Roque

2011-09-01

took place at a public and cardiologic hospital, located in the city of Rio de Janeiro. For the analysis of the survival, the method Kaplan-Meier was used. The probability of surviving free from an adverse event to drugs up to 30, 60 and 100 days was respectively of 96%, 93% and 73%. The adverse events to drugs represent marking conditions that describe the performance of the health services. The detection of adverse events in hospitals makes it possible to know the failures that occur in the medication system and also to implement strategies to reduce them.

A review and comparison of methods for recreating individual patient data from published Kaplan-Meier survival curves for economic evaluations: a simulation study.

Science.gov (United States)

Wan, Xiaomin; Peng, Liubao; Li, Yuanjian

2015-01-01

In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.

Impact of forced vital capacity loss on survival after the onset of chronic lung allograft dysfunction.

Science.gov (United States)

Todd, Jamie L; Jain, Rahil; Pavlisko, Elizabeth N; Finlen Copeland, C Ashley; Reynolds, John M; Snyder, Laurie D; Palmer, Scott M

2014-01-15

Emerging evidence suggests a restrictive phenotype of chronic lung allograft dysfunction (CLAD) exists; however, the optimal approach to its diagnosis and clinical significance is uncertain. To evaluate the hypothesis that spirometric indices more suggestive of a restrictive ventilatory defect, such as loss of FVC, identify patients with distinct clinical, radiographic, and pathologic features, including worse survival. Retrospective, single-center analysis of 566 consecutive first bilateral lung recipients transplanted over a 12-year period. A total of 216 patients developed CLAD during follow-up. CLAD was categorized at its onset into discrete physiologic groups based on spirometric criteria. Imaging and histologic studies were reviewed when available. Survival after CLAD diagnosis was assessed using Kaplan-Meier and Cox proportional hazards models. Among patients with CLAD, 30% demonstrated an FVC decrement at its onset. These patients were more likely to be female, have radiographic alveolar or interstitial changes, and histologic findings of interstitial fibrosis. Patients with FVC decline at CLAD onset had significantly worse survival after CLAD when compared with those with preserved FVC (P model including baseline demographic and clinical factors (P < 0.0001; adjusted hazard ratio, 2.73; 95% confidence interval, 1.86-4.04). At CLAD onset, a subset of patients demonstrating physiology more suggestive of restriction experience worse clinical outcomes. Further study of the biologic mechanisms underlying CLAD phenotypes is critical to improving long-term survival after lung transplantation.

EpiHosp: A web-based visualization tool enabling the exploratory analysis of complications of implantable medical devices from a nationwide hospital database.

Science.gov (United States)

Ficheur, Grégoire; Ferreira Careira, Lionel; Beuscart, Régis; Chazard, Emmanuel

2015-01-01

Administrative data can be used for the surveillance of the outcomes of implantable medical devices (IMDs). The objective of this work is to build a web-based tool allowing for an exploratory analysis of time-dependent events that may occur after the implementation of an IMD. This tool should enable a pharmacoepidemiologist to explore on the fly the relationship between a given IMD and a potential outcome. This tool mine the French nationwide database of inpatient stays from 2008 to 2013. The data are preprocessed in order to optimize the queries. A web tool is developed in PHP, MySQL and Javascript. The user selects one or a group of IMD from a tree, and can filter the results using years and hospital names. Four result pages describe the selected inpatient stays: (1) temporal and demographic description, (2) a description of the geographical location of the hospital, (3) a description of the geographical place of residence of the patient and (4) a table showing the rehospitalization reasons by decreasing order of frequency. Then, the user can select one readmission reason and display dynamically the probability of readmission by mean of a Kaplan-Meier curve with confidence intervals. This tool enables to dynamically monitor the occurrence of time-dependent complications of IMD.

Number of Lymph Nodes Removed and Survival after Gastric Cancer Resection: An Analysis from the US Gastric Cancer Collaborative.

Science.gov (United States)

Gholami, Sepideh; Janson, Lucas; Worhunsky, David J; Tran, Thuy B; Squires, Malcolm Hart; Jin, Linda X; Spolverato, Gaya; Votanopoulos, Konstantinos I; Schmidt, Carl; Weber, Sharon M; Bloomston, Mark; Cho, Clifford S; Levine, Edward A; Fields, Ryan C; Pawlik, Timothy M; Maithel, Shishir K; Efron, Bradley; Norton, Jeffrey A; Poultsides, George A

2015-08-01

Examination of at least 16 lymph nodes (LNs) has been traditionally recommended during gastric adenocarcinoma resection to optimize staging, but the impact of this strategy on survival is uncertain. Because recent randomized trials have demonstrated a therapeutic benefit from extended lymphadenectomy, we sought to investigate the impact of the number of LNs removed on prognosis after gastric adenocarcinoma resection. We analyzed patients who underwent gastrectomy for gastric adenocarcinoma from 2000 to 2012, at 7 US academic institutions. Patients with M1 disease or R2 resections were excluded. Disease-specific survival (DSS) was calculated using the Kaplan-Meier method and compared using log-rank and Cox regression analyses. Of 742 patients, 257 (35%) had 7 to 15 LNs removed and 485 (65%) had ≥16 LNs removed. Disease-specific survival was not significantly longer after removal of ≥16 vs 7 to 15 LNs (10-year survival, 55% vs 47%, respectively; p = 0.53) for the entire cohort, but was significantly improved in the subset of patients with stage IA to IIIA (10-year survival, 74% vs 57%, respectively; p = 0.018) or N0-2 disease (72% vs 55%, respectively; p = 0.023). Similarly, for patients who were classified to more likely be "true N0-2," based on frequentist analysis incorporating both the number of positive and of total LNs removed, the hazard ratio for disease-related death (adjusted for T stage, R status, grade, receipt of neoadjuvant and adjuvant therapy, and institution) significantly decreased as the number of LNs removed increased. The number of LNs removed during gastrectomy for adenocarcinoma appears itself to have prognostic implications for long-term survival. Copyright © 2015 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Science.gov (United States)

Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

2017-01-01

Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Directory of Open Access Journals (Sweden)

Sang Y Lee

Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

Solitary plasmacytoma: population-based analysis of survival trends and effect of various treatment modalities in the USA.

Science.gov (United States)

Thumallapally, Nishitha; Meshref, Ahmed; Mousa, Mohammed; Terjanian, Terenig

2017-01-05

Solitary plasmacytoma (SP) is a localized neoplastic plasma cell disorder with an annual incidence of less than 450 cases. Given the rarity of this disorder, it is difficult to conduct large-scale population studies. Consequently, very limited information on the disorder is available, making it difficult to estimate the incidence and survival rates. Furthermore, limited information is available on the efficacy of various treatment modalities in relation to primary tumor sites. The data for this retrospective study were drawn from the Surveillance, Epidemiology and End Results (SEER) database, which comprises 18 registries; patient demographics, treatment modalities and survival rates were obtained for those diagnosed with SP from 1998 to 2007. Various prognostic factors were analyzed via Kaplan-Meier analysis and log-rank test, with 5-year relative survival rate defined as the primary outcome of interest. Cox regression analysis was employed in the multivariate analysis. The SEER search from 1998 to 2007 yielded records for 1691 SP patients. The median age at diagnosis was 63 years. The patient cohort was 62.4% male, 37.6% female, 80% Caucasian, 14.6% African American and 5.4% other races. Additionally, 57.8% had osseous plasmacytoma, and 31.9% had extraosseous involvement. Unspecified plasmacytoma was noted in 10.2% of patients. The most common treatment modalities were radiotherapy (RT) (48.8%), followed by combination surgery with RT (21.2%) and surgery alone (11.6%). Univariate analysis of prognostic factors revealed that the survival outcomes were better for younger male patients who received RT with surgery (p multiple myeloma (MM) was noted in 551 patients. Age >60 years was associated with a lower 5-year survival in patients who progressed to MM compared to those who were diagnosed initially with MM (15.1 vs 16.6%). Finally, those who received RT and progressed to MM still had a higher chance of survival than those who were diagnosed with MM initially and

Prognostic role of syncytin expression in breast cancer

DEFF Research Database (Denmark)

Larsson, Lars-Inge; Holck, Susanne; Christensen, Ib Jarle

2007-01-01

Breast cancer cells were recently found to produce syncytin, an endogenous retroviral protein implicated in cell fusion, immune regulation, and nitric oxide synthase expression. To determine whether syncytin has a prognostic role in breast cancer, we investigated a series of 165 premenopausal lymph...... node-negative women for syncytin expression using an immunocytochemical scoring system. Results were analyzed with the Kaplan-Meier method and with the Cox proportional hazard model. Syncytin expression was observed in 38% of the patients, and the degree of syncytin expression constituted a positive...

Demographic clinical and prognostic characteristics of primary ovarian, peritoneal and tubal adenocarcinomas of serous histology-

DEFF Research Database (Denmark)

Schnack, Tine H; Sørensen, Rie D; Nedergaard, Lotte

2014-01-01

OBJECTIVES: Invasive serous adenocarcinomas may present as primary ovarian (POC), primary fallopian tube (PFC) or primary peritoneal (PPC) carcinomas. Whether they are variants of the same malignancy or develop through different pathways is debated. METHODS: Population-based prospectively collected...... data on POC (n=1443), PPC (n=268) and PFC (n=171) cases was obtained from the Danish Gynecological Cancer Database (2005-2013). Chi-square, Fisher's or Wilcoxon-Mann-Whitney test, multivariate logistic regression, Kaplan-Meier and multivariate Cox-regression were used as appropriate. Statistical tests...

PA activity by using nuclear power plant safety demonstration and analysis

International Nuclear Information System (INIS)

Tsuchiya, Mitsuo; Kamimae, Rie

1999-01-01

INS/NUPEC presents one of Public acceptance (PA) methods for nuclear power in Japan, 'PA activity by using Nuclear Power Plant Safety Demonstration and Analysis', by using one of videos which is explained and analyzed accident events (Loss of Coolant Accident). Safety regulations of The National Government are strictly implemented in licensing at each of basic design and detailed design. To support safety regulation activities conducted by the National Government, INS/NLTPEC continuously implement Safety demonstration and analysis. With safety demonstration and analysis, made by assuming some abnormal conditions, what impacts could be produced by the assumed conditions are forecast based on specific design data on a given nuclear power plants. When analysis results compared with relevant decision criteria, the safety of nuclear power plants is confirmed. The decision criteria are designed to help judge if or not safety design of nuclear power plants is properly made. The decision criteria are set in the safety examination guidelines by taking sufficient safety allowance based on the latest technical knowledge obtained from a wide range of tests and safety studies. Safety demonstration and analysis is made by taking the procedure which are summarized in this presentation. In Japan, various PA (Public Acceptance) pamphlets and videos on nuclear energy have been published. But many of them focused on such topics as necessity or importance of nuclear energy, basic principles of nuclear power generation, etc., and a few described safety evaluation particularly of abnormal and accident events in accordance with the regulatory requirements. In this background, INS/NUPEC has been making efforts to prepare PA pamphlets and videos to explain the safety of nuclear power plants, to be simple and concrete enough, using various analytical computations for abnormal and accident events. In results, PA activity of INS/NUPEC is evaluated highly by the people

The Emission, Lifetimes, and Formation Threshold of the Vegard-Kaplan Transition of Solid Nitrogen Exposed to Far-ultraviolet Radiation

Science.gov (United States)

Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming

2016-11-01

Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard-Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200-440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ˜ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.

THE EMISSION, LIFETIMES, AND FORMATION THRESHOLD OF THE VEGARD–KAPLAN TRANSITION OF SOLID NITROGEN EXPOSED TO FAR-ULTRAVIOLET RADIATION

Energy Technology Data Exchange (ETDEWEB)

Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming, E-mail: bmcheng@nsrrc.org.tw [National Synchrotron Radiation Research Center, No. 101, Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China)

2016-11-20

Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.

THE EMISSION, LIFETIMES, AND FORMATION THRESHOLD OF THE VEGARD–KAPLAN TRANSITION OF SOLID NITROGEN EXPOSED TO FAR-ULTRAVIOLET RADIATION

International Nuclear Information System (INIS)

Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming

2016-01-01

Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.

Right miniparasternotomy may be a good minimally invasive alternative to full sternotomy for cardiac valve operations: a propensity-adjusted analysis.

Science.gov (United States)

Chiu, Kuan M; Chen, Robert J; Lin, Tzu Y; Chen, Jer S; Huang, Jin H; Huang, Chun Y; Chu, Shu H

2016-02-01

Limited real-world data existed for mini-parasternotomy approach with good sample size in Asian cohorts and most previous studies were eclipsed by case heterogeneity. The goal of this study was to compare safety and quality outcomes of cardiac non-coronary valve operations by mini-parasternotomy and full sternotomy approaches on risk-adjusted basis. METHODS From our hospital database, we retrieved the cases of non-coronary valve operations from 1 January 2005 to 31 December 2012, including re-do, emergent, and combined procedures. Estimated EuroScore-II and propensity score for choosing mini-parasternotomy were adjusted for in the regression models on hospital mortality, complications (pneumonia, stroke, sepsis, etc.), and quality parameters (length of stay, ICU time, ventilator time, etc.). Non-complicated cases, defined as survival to discharge, ventilator use not over one week, and intensive care unit stay not over two weeks, were used for quality parameters. There were 283 mini-parasternotomy and 177 full sternotomy cases. EuroScore-II differed significantly (medians 2.1 vs. 4.7, P<0.001). Propensity scores for choosing mini-parasternotomy were higher with lower EuroScore-II (OR=0.91 per 1%, P<0.001), aortic regurgitation (OR=2.3, P=0.005), and aortic non-mitral valve disease (OR=3.9, P<0.001). Adjusted for propensity score and EuroScore-II, mini-parasternotomy group had less pneumonia (OR=0.32, P=0.043), less sepsis (OR=0.31, P=0.045), and shorter non-complicated length of stay (coefficient=-7.2 (day), P<0.001) than full sternotomy group, whereas Kaplan-Meier survival, non-complicated ICU time, non-complicated ventilator time, and 30-day mortality did not differ significantly. The propensity-adjusted analysis demonstrated encouraging safety and quality outcomes for mini-parasternotomy valve operation in carefully selected patients.

Predictive Factors for Visual Field Conversion: Comparison of Scanning Laser Polarimetry and Optical Coherence Tomography.

Science.gov (United States)

Diekmann, Theresa; Schrems-Hoesl, Laura M; Mardin, Christian Y; Laemmer, Robert; Horn, Folkert K; Kruse, Friedrich E; Schrems, Wolfgang A

2018-02-01

The purpose of this study was to compare the ability of scanning laser polarimetry (SLP) and spectral-domain optical coherence tomography (SD-OCT) to predict future visual field conversion of subjects with ocular hypertension and early glaucoma. All patients were recruited from the Erlangen glaucoma registry and examined using standard automated perimetry, 24-hour intraocular pressure profile, and optic disc photography. Peripapillary retinal nerve fiber layer thickness (RNFL) measurements were obtained by SLP (GDx-VCC) and SD-OCT (Spectralis OCT). Positive and negative predictive values (PPV, NPV) were calculated for morphologic parameters of SLP and SD-OCT. Kaplan-Meier survival curves were plotted and log-rank tests were performed to compare the survival distributions. Contingency tables and Venn-diagrams were calculated to compare the predictive ability. The study included 207 patients-75 with ocular hypertension, 85 with early glaucoma, and 47 controls. Median follow-up was 4.5 years. A total of 29 patients (14.0%) developed visual field conversion during follow-up. SLP temporal-inferior RNFL [0.667; 95% confidence interval (CI), 0.281-0.935] and SD-OCT temporal-inferior RNFL (0.571; 95% CI, 0.317-0.802) achieved the highest PPV; nerve fiber indicator (0.923; 95% CI, 0.876-0.957) and SD-OCT mean (0.898; 95% CI, 0.847-0.937) achieved the highest NPV of all investigated parameters. The Kaplan-Meier curves confirmed significantly higher survival for subjects within normal limits of measurements of both devices (P<0.001). Venn diagrams tested with McNemar test statistics showed no significant difference for PPV (P=0.219) or NPV (P=0.678). Both GDx-VCC and SD-OCT demonstrate comparable results in predicting future visual field conversion if taking typical scans for GDx-VCC. In addition, the likelihood ratios suggest that GDx-VCC's nerve fiber indicator<30 may be the most useful parameter to confirm future nonconversion. (http://www.ClinicalTrials.gov number, NTC

Phase II study of paclitaxel given once per week along with trastuzumab and pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer.

Science.gov (United States)

Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

2015-02-10

The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.

Phase II Study of Paclitaxel Given Once per Week Along With Trastuzumab and Pertuzumab in Patients With Human Epidermal Growth Factor Receptor 2–Positive Metastatic Breast Cancer

Science.gov (United States)

Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

2015-01-01

Purpose The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients and Methods Patients with metastatic human epidermal growth factor receptor 2–positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m2 once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. Results From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Conclusion Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. PMID:25547504

Data Analysis for ARRA Early Fuel Cell Market Demonstrations (Presentation)

Energy Technology Data Exchange (ETDEWEB)

Kurtz, J.; Wipke, K.; Sprik, S.; Ramsden, T.

2010-05-01

Presentation about ARRA Early Fuel Cell Market Demonstrations, including an overview of the ARRE Fuel Cell Project, the National Renewable Energy Laboratory's data analysis objectives, deployment composite data products, and planned analyses.

18F-FDG PET diagnostic and prognostic patterns do not overlap in Alzheimer's disease (AD) patients at the mild cognitive impairment (MCI) stage

International Nuclear Information System (INIS)

Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario; Pagani, Marco; De Carli, Fabrizio

2017-01-01

We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal

18F-FDG PET diagnostic and prognostic patterns do not overlap in Alzheimer's disease (AD) patients at the mild cognitive impairment (MCI) stage

Energy Technology Data Exchange (ETDEWEB)

Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario [Genoa Univ. (Italy). Dept. of Health Sciences; IRCCS AOU San Martino-IST, Genoa (Italy). Nuclear Medicine Unit; Arnaldi, Dario; Picco, Agnese; Pardini, Matteo; Brugnolo, Andrea; Girtler, Nicola; Nobili, Flavio [Genoa Univ. (Italy). Clinical Neurology, Department of Neuroscience (DINOGMI); IRCCS AOU San Martino-IST, Genoa (Italy); Pagani, Marco [Institute of Cognitive Sciences and Technologies, Rome (Italy); Karolinska Hospital, Stockholm (Sweden). Department of Nuclear Medicine; Chincarini, Andrea [Istituto Nazionale di Fisica Nucleare, Genoa (Italy); De Carli, Fabrizio [National Research Council, Genoa (Italy). Institute of Bioimaging and Molecular Physiology

2017-11-15

We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal

Right mini-parasternotomy may be a good minimally invasive alternative to full sternotomy for cardiac valve operations-a propensity-adjusted analysis.

Science.gov (United States)

Chiu, K M; Chen, R J; Lin, T Y; Chen, J S; Huang, J H; Huang, C Y; Chu, S H

2014-03-26

Limited realworld data existed for miniparasternotomy approach with good sample size in Asian cohorts and most previous studies were eclipsed by case heterogeneity. The goal of this study was to compare safety and quality outcomes of cardiac noncoronary valve operations by miniparasternotomy and full sternotomy approaches on riskadjusted basis. From our hospital database, we retrieved the cases of non-coronary valve operations from 1 January 2005 to 31 December 2012, including re-do, emergent, and combined procedures. Estimated EuroScore-II and propensity score for choosing mini-parasternotomy were adjusted for in the regression models on hospital mortality, complications (pneumonia, stroke, sepsis, etc.), and quality parameters (length of stay, ICU time, ventilator time, etc.). Non-complicated cases, defined as survival to discharge, ventilator use not over one week, and intensive care unit stay not over two weeks, were used for quality parameters. There were 283 miniparasternotomy and 177 full sternotomy cases. EuroScore-II differed significantly (medians 2.1 vs. 4.7, p<0.001). Propensity scores for choosing miniparasternotomy were higher with lower EuroScore-II (OR=0.91 per 1%, p<0.001), aortic regurgitation (OR=2.3, p=0.005), and aortic non-mitral valve disease (OR=3.9, p<0.001). Adjusted for propensity score and EuroScore-II, mini-parasternotomy group had less pneumonia (OR=0.32, p=0.043), less sepsis (OR=0.31, p=0.045), and shorter non-complicated length of stay (coefficient=7.2 (day), p<0.001) than full sternotomy group, whereas Kaplan-Meier survival, non-complicated ICU time, non-complicated ventilator time, and 30-day mortality did not differ significantly. The propensity-adjusted analysis demonstrated encouraging safety and quality outcomes for mini-parasternotomy valve operation in carefully selected patients.

Análisis de la aparición de discapacidades en personas mayores de Cataluña = Analysis of disability onset of the elderly in Catalonia

Directory of Open Access Journals (Sweden)

Bermúdez Morata, Lluís

2008-01-01

Full Text Available El presente trabajo se centra en el estudio del tiempo hasta la discapacitación para las actividades de la vida diaria en la población activa de Cataluña mayor de 60 años. El riesgo de sufrir discapacidades es mayor para este grupo de edad que en los más jóvenes y, además, se incrementa con la edad. La aparición de discapacidades resta habilidades a la hora de realizar las distintas actividades de la vida diaria, por ello hemos centrado nuestro interés en la variable tiempo hasta que una persona de 60 años que no muestra discapacidad alguna, se discapacita, identificando factores ligados a los incrementos del riesgo de discapacitación. A partir de los datos que proporciona la Encuesta sobre Discapacidades, Deficiencias y Estado de Salud (EDDES, INE 1999 y, utilizando el estimador de Kaplan-Meier, se estiman las funciones de supervivencia que permiten calcular probabilidades relacionadas con la edad de discapacitación. Asimismo, se ha realizado un análisis del modelo de regresión de Weibull que permite interpretar cómo y en qué medida afectan las características individuales. = In Spain individuals aged 60 years and above are major consumers of the health care system. The risk of becoming unable to perform daily life activities is higher for the elderly than for the younger population, and in addition, it increases with age. As a consequence we focus on the study of the period of life after an abled person who is 60 years old becomes disabled and we also study the factors that are related to the risk of disability. Using data from the Survey of Disabilities, Handicaps and Health Status (EDDES, INE 1999, and using the Kaplan-Meier estimator, we estimate the survival functions to calculate the probability of becoming disabled at different age points. Besides, a Weibull regression model is estimated in order to interpret the effects of individual characteristics on the disability risk.

Breastfeeding practices in a public health field practice area in Sri Lanka: a survival analysis

Directory of Open Access Journals (Sweden)

Agampodi Thilini C

2007-10-01

Full Text Available Abstract Background Exclusive breastfeeding up to the completion of the sixth month of age is the national infant feeding recommendation for Sri Lanka. The objective of the present study was to collect data on exclusive breastfeeding up to six months and to describe the association between exclusive breastfeeding and selected socio-demographic factors. Methods A clinic based cross-sectional study was conducted in the Medical Officer of Health area, Beruwala, Sri Lanka in June 2006. Mothers with infants aged 4 to 12 months, attending the 19 child welfare clinics in the area were included in the study. Infants with specific feeding problems (cleft lip and palate and primary lactose intolerance were excluded. Cluster sampling technique was used and consecutive infants fulfilling the inclusion criteria were enrolled. A total of 219 mothers participated in the study. The statistical tests used were survival analysis (Kaplan-Meier survival curves and Cox proportional Hazard model. Results All 219 mothers had initiated breastfeeding. The median duration of exclusive breastfeeding was four months (95% CI 3.75, 4.25. The rates of exclusive breastfeeding at 4 and 6 months were 61.6% (135/219 and 15.5% (24/155 respectively. Bivariate analysis showed that the Muslim ethnicity (p = 0.004, lower levels of parental education (p Conclusion The rate of breastfeeding initiation and exclusive breastfeeding up to the fourth month is very high in Medical Officer of Health area, Beruwala, Sri Lanka. However exclusive breastfeeding up to six months is still low and the prevalence of inappropriate feeding practices is high.

The impact of engagement in street-based income generation activities on stimulant drug use cessation among people who inject drugs.

Science.gov (United States)

Ti, Lianping; Richardson, Lindsey; DeBeck, Kora; Nguyen, Paul; Montaner, Julio; Wood, Evan; Kerr, Thomas

2014-08-01

Despite the growing prevalence of illicit stimulant drug use internationally, and the widespread involvement of people who inject drugs (IDU) within street-based drug markets, little is known about the impact of different types of street-based income generation activities on the cessation of stimulant use among IDU. Data were derived from an open prospective cohort of IDU in Vancouver, Canada. We used Kaplan-Meier methods and Cox proportional hazards regression to examine the effect of different types of street-based income generation activities (e.g., sex work, drug dealing, and scavenging) on time to cessation of stimulant use. Between December, 2005 and November, 2012, 887 IDU who use stimulant drugs (cocaine, crack cocaine, or crystal methamphetamine) were prospectively followed-up for a median duration of 47 months. In Kaplan-Meier analyses, compared to those who did not engage in street-based income generation activities, participants who reported sex work, drug dealing, scavenging, or more than one of these activities were significantly less likely to report stimulant drug use cessation (all pstreet-based income generation activity remained significantly associated with a slower time to stimulant drug cessation (all p<0.005). Our findings highlight the urgent need for strategies to address stimulant dependence, including novel pharmacotherapies. Also important, structural interventions, such as low-threshold employment opportunities, availability of supportive housing, legal reforms regarding drug use, and evidence-based approaches that reduce harm among IDU are urgently required. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Phosphorus-32 therapy for cystic craniopharyngiomas

International Nuclear Information System (INIS)

Barriger, Robert Bryan; Chang, Andrew; Lo, Simon S.; Timmerman, Robert D.; DesRosiers, Colleen; Boaz, Joel C.; Fakiris, Achilles J.

2011-01-01

Background and purpose: To examine control rates for predominantly cystic craniopharyngiomas treated with intracavitary phosphorus-32 (P-32). Material and methods: 22 patients with predominantly cystic craniopharyngiomas were treated at Indiana University between October 1997 and December 2006. Nineteen patients with follow-up of at least 6 months were evaluated. The median patient age was 11 years, median cyst volume was 9 ml, a median dose of 300 Gy was prescribed to the cyst wall, and median follow-up was 62 months. Results: Overall cyst control rate after the initial P-32 treatment was 67%. Complete tumor control after P-32 was 42%. Kaplan-Meier 1-, 3-, and 5-year initial freedom-from-progression rates were 68%, 49%, and 31%, respectively. Following salvage therapy, the Kaplan-Meier 1-, 3-, and 5-year ultimate freedom-from-progression rates were 95%, 95%, and 86%, respectively. All patients were alive at the last follow-up. Visual function was stable or improved in 81% when compared prior to P-32 therapy. Pituitary function remained stable in 74% of patients following P-32 therapy. Conclusions: Intracystic P-32 can be an effective and tolerable treatment for controlling cystic components of craniopharyngiomas as a primary treatment or after prior therapies, but frequently allows for progression of solid tumor components. Disease progression in the form of solid tumor progression, re-accumulation of cystic fluid, or development of new cysts may require further radiotherapy or surgical intervention for optimal long-term disease control.

Factors affecting commencement and cessation of smoking behaviour in Malaysian adults

Directory of Open Access Journals (Sweden)

Ghani Wan

2012-03-01

Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.

Risk Factors for Neovascular Glaucoma After Proton Beam Therapy of Uveal Melanoma: A Detailed Analysis of Tumor and Dose–Volume Parameters

International Nuclear Information System (INIS)

Mishra, Kavita K.; Daftari, Inder K.; Weinberg, Vivian; Cole, Tia; Quivey, Jeanne M.; Castro, Joseph R.; Phillips, Theodore L.; Char, Devron H.

2013-01-01

Purpose: To determine neovascular glaucoma (NVG) incidence and identify contributing tumor and dosing factors in uveal melanoma patients treated with proton beam radiation therapy (PBRT). Methods and Materials: A total of 704 PBRT patients treated by a single surgeon (DHC) for uveal melanoma (1996-2010) were reviewed for NVG in our prospectively maintained database. All patients received 56 GyE in 4 fractions. Median follow-up was 58.3 months. Analyses included the Kaplan-Meier method to estimate NVG distributions, univariate log–rank tests, and Cox's proportional hazards multivariate analysis using likelihood ratio tests to identify independent risk factors of NVG among patient, tumor, and dose–volume histogram parameters. Results: The 5-year PBRT NVG rate was 12.7% (95% confidence interval [CI] 10.2%-15.9%). The 5-year rate of enucleation due to NVG was 4.9% (95% CI 3.4%-7.2%). Univariately, the NVG rate increased significantly with larger tumor diameter (P 30% of the lens or ciliary body received ≥50% dose (≥28 GyE), there was a higher probability of NVG (P 0%-30% vs >30%) (P=.01), and optic nerve length treated to ≥90% Dose (≤1 mm vs >1 mm) (P=.02). Conclusions: Our current PBRT patients experience a low rate of NVG and resultant enucleation compared with historical data. The present analysis shows that tumor height, diameter, and anterior as well as posterior critical structure dose–volume parameters may be used to predict NVG risk

Elevated cardiac troponin I predicts cardiovascular or cerebrovascular events in hypertensive patients

International Nuclear Information System (INIS)

Zhang Li'na; Cao Yanfei; Qiu Yifan

2011-01-01

Objective: Whether elevated cTnI is associated with cardiovascular or cerebrovascular events in patients with hypertension (HT) without left ventricular(LV) systolic dysfunction is not clear. Method: We measured cTnI serum level in 170 patients with essential HT without LV systolic dysfunction (LVEF 55%),renal failure,and prior cardiovascular or cerebrovascular diseases. Besides, control group of 40 normal presons was established and following up (45±38)months. Results: Level of cTnI was elevated (≥0.04 ng/ml) in 15 (8.8%) of the 170 patients and in 0 (0%) of the 40 normal controls. The rate of diabetes mellitus(DM), the cardiothoracic ratio, serum NT-proBNP value, and LV mass index were significantly higher in patients with than without elevated cTnI (DM, 9/15 versus 25/155, P 2 , P=0.0001). Kaplan-Meier analysis demonstrated that significantly fewer (P<0.000001) patients with, than without elevated cTnI remained free of events (hospitalization due to cardiovascular or cerebrovascular disease). Stepwise Cox multivariate analysis revealed that elevated cTnT (hazard ratio, 6.59, P=0.000001) and smoking (hazard ratio, 2.26, P=0.04) were independent predictors of events. Conclusion: The present findings indicate that cTnI is a biomarker and useful predictor of future cardiovascular or cerebrovascular events in hypertensive patients. (authors)

Urine Trefoil Factors as Prognostic Biomarkers in Chronic Kidney Disease.

Science.gov (United States)

Yamanari, Toshio; Sugiyama, Hitoshi; Tanaka, Keiko; Morinaga, Hiroshi; Kitagawa, Masashi; Onishi, Akifumi; Ogawa-Akiyama, Ayu; Kano, Yuzuki; Mise, Koki; Ohmoto, Yasukazu; Shikata, Kenichi; Wada, Jun

2018-01-01

Trefoil factor family (TFF) peptides are increased in serum and urine in patients with chronic kidney disease (CKD). However, whether the levels of TFF predict the progression of CKD remains to be elucidated. We determined the TFF levels using peptide-specific ELISA in spot urine samples and performed a prospective cohort study. The association between the levels of urine TFFs and other urine biomarkers as well as the renal prognosis was analyzed in 216 CKD patients (mean age: 53.7 years, 47.7% female, 56.9% with chronic glomerulonephritis, and mean eGFR: 58.5 ml/min/1.73 m 2 ). The urine TFF1 and TFF3 levels significantly increased with the progression of CKD stages, but not the urine TFF2 levels. The TFF1 and TFF3 peptide levels predicted the progression of CKD ≥ stage 3b by ROC analysis (AUC 0.750 and 0.879, resp.); however, TFF3 alone predicted CKD progression in a multivariate logistic regression analysis (odds ratio 3.854, 95% confidence interval 1.316-11.55). The Kaplan-Meier survival curves demonstrated that patients with a higher TFF1 and TFF3 alone, or in combination with macroalbuminuria, had a significantly worse renal prognosis. The data suggested that urine TFF peptides are associated with renal progression and the outcomes in patients with CKD.

Expression of miR-146a-5p in patients with intracranial aneurysms and its association with prognosis.

Science.gov (United States)

Zhang, H-L; Li, L; Cheng, C-J; Sun, X-C

2018-02-01

The study aims to detect the association of miR-146a-5p with intracranial aneurysms (IAs). The expression of miR-146a-5p was compared from plasma samples between 72 patients with intracranial aneurysms (IAs) and 40 healthy volunteers by quantitative Real-time polymerase chain reaction (qRT-PCR). Statistical analysis was performed to analyze the relationship between miR-146a-5p expression and clinical data and overall survival (OS) time of IAs patients. Univariate and multivariate Cox proportional hazards have also been performed. Notably, higher miR-146a-5p expression was found in plasma samples from 72 patients with intracranial aneurysms (IAs) compared with 40 healthy controls. Higher miR-146a-5p expression was significantly associated with rupture and Hunt-Hess level in IAs patients. Kaplan-Meier survival analysis verified that higher miR-146a-5p expression predicted a shorter overall survival (OS) compared with lower miR-146a-5p expression in IAs patients. Univariate and multivariate Cox proportional hazards demonstrated that higher miR-146a-5p expression, rupture, and Hunt-Hess were independent risk factors of OS in patients with intracranial aneurysms (IAs). MiR-146a-5p expression may serve as a biomarker for predicting prognosis in patients with IAs.

Fluorescent in situ hybridization (FISH) on corneal impression cytology specimens (CICS): study of epithelial cell survival after keratoplasty.

Science.gov (United States)

Catanese, Muriel; Popovici, Cornel; Proust, Hélène; Hoffart, Louis; Matonti, Frédéric; Cochereau, Isabelle; Conrath, John; Gabison, Eric E

2011-02-22

To assess corneal epithelial cell survival after keratoplasty. Corneal impression cytology (CIC) was performed on sex-mismatched corneal transplants. Fluorescent in situ hybridization (FISH) with sex chromosome-specific probes was performed to identify epithelial cell mosaicism and therefore allocate the donor or recipient origin of the cells. Twenty-four samples of corneal epithelial cells derived from 21 transplanted patients were analyzed. All patients received post-operative treatment using dexamethasone eye drops, with progressive tapering over 18 months, and nine patients also received 2% cyclosporine eye drops. Out of the 24 samples reaching quality criteria, sex mosaicism was found in 13, demonstrating the presence of donor-derived cells at the center of the graft for at least 211 days post keratoplasty. Kaplan-Meier analysis established a median survival of donor corneal epithelial cells of 385 days. Although not statistically significant, the disappearance of donor cells seemed to be delayed and the average number of persistent cells appeared to be greater when 2% cyclosporine was used topically as an additional immunosuppressive therapy. The combination of corneal impressions and FISH analysis is a valuable tool with negligible side effects to investigate the presence of epithelial cell mosaicism in sex-mismatched donor transplants. Epithelial cells survived at the center of the graft with a median survival of more than one year, suggesting slower epithelial turnover than previously described.

Post mitigation impact risk analysis for asteroid deflection demonstration missions

Science.gov (United States)

Eggl, Siegfried; Hestroffer, Daniel; Thuillot, William; Bancelin, David; Cano, Juan L.; Cichocki, Filippo

2015-08-01

Even though mankind believes to have the capabilities to avert potentially disastrous asteroid impacts, only the realization of mitigation demonstration missions can validate this claim. Such a deflection demonstration attempt has to be cost effective, easy to validate, and safe in the sense that harmless asteroids must not be turned into potentially hazardous objects. Uncertainties in an asteroid's orbital and physical parameters as well as those additionally introduced during a mitigation attempt necessitate an in depth analysis of deflection mission designs in order to dispel planetary safety concerns. We present a post mitigation impact risk analysis of a list of potential kinetic impactor based deflection demonstration missions proposed in the framework of the NEOShield project. Our results confirm that mitigation induced uncertainties have a significant influence on the deflection outcome. Those cannot be neglected in post deflection impact risk studies. We show, furthermore, that deflection missions have to be assessed on an individual basis in order to ensure that asteroids are not inadvertently transported closer to the Earth at a later date. Finally, we present viable targets and mission designs for a kinetic impactor test to be launched between the years 2025 and 2032.

Assessment by survival analysis of the radioprotective properties of propolis and its polyphenolic compounds

International Nuclear Information System (INIS)

Orsolic, N.; Benkovic, V.; Horvat-Knezevic, A.; Basic, I.; Kopjar, N.; Kosalec, I.; Bakmaz, M.; Mihaljevic, Z.; Bendelja, K.

2007-01-01

The radioprotective effects of propolis and polyphenolic compounds from propolis on the radiation-induced mortality of mice exposed to 9 Gy of γ-irradiation were studied. Intraperitoneal (i.p.) treatment of mice at doses of 100 mgkg -1 body weight of propolis (water or ethanolic extract; water-soluble derivative of propolis (WSDP) or ethanolic extract of propolis (EEP)) or its polyphenolic compounds (quercetin, naringin caffeic acid, chrysin) consecutively for 3 d before irradiation, delayed the onset of mortality and reduced the symptoms of radiation sickness. All test compounds provided protection against hematopoietic death (death within 30 d after irradiation). The greatest protection was achieved with quercetin; the number of survivors at the termination of the experiment was 63%. According to statistical analyses by the Kaplan-Meier method and the log-rank test, a significant difference between test components and control was found (p<0.001). Treatment with test components after lethal irradiation was ineffective. These results suggest that propolis and its polyphenolic compounds given to mice before irradiation protect mice from the lethal effects of whole-body irradiation. (author)

The impact of body mass index (BMI variation on mortality of incident elderly patients on peritoneal dialysis: a joint model analysis

Directory of Open Access Journals (Sweden)

Marcia Regina Gianotti Franco

Full Text Available Abstract Introduction: Data on impact of high body mass index (BMI on mortality of patients on peritoneal dialysis (PD, especially among elderly, are inconsistent. Objective: To evaluate impact of BMI on cohort of incident elderly PD patients over time. Methods: Prospective multicenter cohort study (December / 2004-October/2007 with 674 patients. Socio-demographic and clinical data evaluated with patients followed until death, transfer to hemodialysis (HD, recovery of renal function, loss of follow-up or transplant. Patients were divided into incident on renal replacement therapy (RRT for PD (PD first: 230 and transferred from hemodialysis (HD first: 444. Analysis was performed comparing these two groups using chi-square or Kruskal Wallis. Similar analysis was used to compare patients on automated peritoneal dialysis (APD vs. continuous ambulatory peritoneal dialysis (CAPD. Data were compared between patients according to BMI by ANOVA, Kruskal Wallis or chi-square. For analysis of survival, Kaplan Meier method was used and to adjust confounding variables, Cox regression proportional hazard. Joint model for longitudinal and time-dependent data was conducted, assessing impact that a longitudinal variable displays on time of survival. Results: Malnourished patients (76.79 ± 7.53 years were older (p < 0.0001 with higher percentage of death (44.6%, p = 0.001; diabetes mellitus showed high prevalence in obese patients (68%, p < 0.0001; higher blood pressure levels (p = 0.002 were present in obese and overweight patients. Conclusions: Increased BMI variation over time proved to be a protective factor, with a decrease of about 1% in risk of death for every BMI unit earned.

Longevity of metal-ceramic crowns cemented with self-adhesive resin cement: a prospective clinical study

Science.gov (United States)

Brondani, Lucas Pradebon; Pereira-Cenci, Tatiana; Wandsher, Vinicius Felipe; Pereira, Gabriel Kalil; Valandro, Luis Felipe; Bergoli, César Dalmolin

2017-04-10

Resin cements are often used for single crown cementation due to their physical properties. Self-adhesive resin cements gained widespread due to their simplified technique compared to regular resin cement. However, there is lacking clinical evidence about the long-term behavior of this material. The aim of this prospective clinical trial was to assess the survival rates of metal-ceramic crowns cemented with self-adhesive resin cement up to six years. One hundred and twenty-nine subjects received 152 metal-ceramic crowns. The cementation procedures were standardized and performed by previously trained operators. The crowns were assessed as to primary outcome (debonding) and FDI criteria. Statistical analysis was performed using Kaplan-Meier statistics and descriptive analysis. Three failures occurred (debonding), resulting in a 97.6% survival rate. FDI criteria assessment resulted in scores 1 and 2 (acceptable clinical evaluation) for all surviving crowns. The use of self-adhesive resin cement is a feasible alternative for metal-ceramic crowns cementation, achieving high and adequate survival rates.

Cell cycle-related genes as modifiers of age of onset of colorectal cancer in Lynch syndrome: a large-scale study in non-Hispanic white patients.

Science.gov (United States)

Chen, Jinyun; Pande, Mala; Huang, Yu-Jing; Wei, Chongjuan; Amos, Christopher I; Talseth-Palmer, Bente A; Meldrum, Cliff J; Chen, Wei V; Gorlov, Ivan P; Lynch, Patrick M; Scott, Rodney J; Frazier, Marsha L

2013-02-01

Heterogeneity in age of onset of colorectal cancer in individuals with mutations in DNA mismatch repair genes (Lynch syndrome) suggests the influence of other lifestyle and genetic modifiers. We hypothesized that genes regulating the cell cycle influence the observed heterogeneity as cell cycle-related genes respond to DNA damage by arresting the cell cycle to provide time for repair and induce transcription of genes that facilitate repair. We examined the association of 1456 single nucleotide polymorphisms (SNPs) in 128 cell cycle-related genes and 31 DNA repair-related genes in 485 non-Hispanic white participants with Lynch syndrome to determine whether there are SNPs associated with age of onset of colorectal cancer. Genotyping was performed on an Illumina GoldenGate platform, and data were analyzed using Kaplan-Meier survival analysis, Cox regression analysis and classification and regression tree (CART) methods. Ten SNPs were independently significant in a multivariable Cox proportional hazards regression model after correcting for multiple comparisons (P Lynch syndrome.

PRAME gene expression profile in medulloblastoma

Directory of Open Access Journals (Sweden)

Tânia Maria Vulcani-Freitas

2011-02-01

Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.

Multimodality therapy and prognostic analysis of thymoma

International Nuclear Information System (INIS)

Chen Jie; Wang Ping; Song Yongchun

2007-01-01

Objective: The aim of this study is to draft the judicious treatment methods by analyzing the Long-term survival result of thymoma and evaluating the effect that prognosis analysis has on thymoma. Methods: Retrospective analysis of the clinical material of 142 patients with thymoma in the Tianjin Medical University Cancer Hospital from January 1954 to January 2001. Statistical analysis was performed using the SPSS software package. The Kaplan-Meier method was used single variable analysis, The Log-rank test was used to compare survival between groups, The Cox' s proportional hazards model was used to multi-factor analysis. Results: The 5- and 10-year survival rate of the 142 patients was 59.9% and 45.8%, respectively. Staging was adopted on the Masaoka's way, 5- and 10-year survival rates was: 93.8%, 79.2% in stage I; 79.3%, 55.2% in stage II; 53.1%, 34.4% in stage III; and 0 and 0 in stage IV. Among 30 patients associated with myasthenia gravis, 19 patients suffered from generalized myasthenia gravis and 11 patients of ocular myasthenia gravis, with 5- and 10-year survival rate of 83.3% and 60.0%, respectively. Three patients finally died of myasthenia gravis. The 5- and 10-year survival rate of 112 patients without myasthenia gravis was 53.6% and 42.0%, respectively. Among 116 patients, treated with surgery-, resection was carried out in 84 patients, palliative resection in 9 patients, and biopsy only in 23 patients. Eighty-nine patients were given radiotherapy and 55 patients had postoperative radiotherapy. Single variable analysis showed that Masaoka clinical staging, association with myasthenia gravis, histopathologic subtype and the method of treatment were prognostic factor's. Finally, drawing the conclusion through muhivariable analysis; Masaoka clinical staging, association with myasthenia gravis and the treatment method were prognostic factors. Conclusions: The diagnosis of thymoma is made clinically and pathologically. The treatment principle should be

Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine

Science.gov (United States)

Schmidt, H.; Kirschner, O.; Riedelbauch, S.; Necker, J.; Kopf, E.; Rieg, M.; Arantes, G.; Wessiak, M.; Mayrhuber, J.

2014-03-01

Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation.