WorldWideScience

Sample records for kaplan meier analysis

  1. Understanding survival analysis: Kaplan-Meier estimate.

    Science.gov (United States)

    Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal

    2010-10-01

    Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.

  2. Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A

    2015-11-01

    Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and

  3. The Kaplan-Meier Theatre

    Science.gov (United States)

    Gerds, Thomas A.

    2016-01-01

    Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.

  4. The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method

    NARCIS (Netherlands)

    Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia

    2011-01-01

    Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the

  5. Application of Kaplan-Meier analysis in reliability evaluation of products cast from aluminium alloys

    OpenAIRE

    J. Szymszal; A. Gierek; J. Kliś

    2010-01-01

    The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...

  6. The Kaplan-Meier theatre

    DEFF Research Database (Denmark)

    Gerds, Thomas Alexander

    2016-01-01

    Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...

  7. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves

    Directory of Open Access Journals (Sweden)

    Guyot Patricia

    2012-02-01

    Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  8. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves.

    Science.gov (United States)

    Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J

    2012-02-01

    The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  9. Modified Weighted Kaplan-Meier Estimator

    Directory of Open Access Journals (Sweden)

    Mohammad Shafiq

    2007-01-01

    Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.

  10. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  11. KMWin – A Convenient Tool for Graphical Presentation of Results from Kaplan-Meier Survival Time Analysis

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912

  12. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Directory of Open Access Journals (Sweden)

    Arnd Gross

    Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  13. Kaplan-Meier survival analysis overestimates cumulative incidence of health-related events in competing risk settings: a meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A

    2018-01-01

    Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. About an adaptively weighted Kaplan-Meier estimate.

    Science.gov (United States)

    Plante, Jean-François

    2009-09-01

    The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.

  15. The Kaplan-Meier Integral in the Presence of Covariates

    DEFF Research Database (Denmark)

    Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis

    2017-01-01

    In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...

  16. Competing risk bias was common in Kaplan-Meier risk estimates published in prominent medical journals.

    Science.gov (United States)

    van Walraven, Carl; McAlister, Finlay A

    2016-01-01

    Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    International Nuclear Information System (INIS)

    Mould, Richard F.

    1995-01-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method

  18. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    Energy Technology Data Exchange (ETDEWEB)

    Mould, Richard F

    1995-07-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.

  19. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    International Nuclear Information System (INIS)

    Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.

    1996-01-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs

  20. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    Energy Technology Data Exchange (ETDEWEB)

    Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)

    1996-12-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.

  1. A versatile test for equality of two survival functions based on weighted differences of Kaplan-Meier curves.

    Science.gov (United States)

    Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J

    2015-12-10

    With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.

  2. Perturbative analysis for Kaplan's lattice chiral fermions

    International Nuclear Information System (INIS)

    Aoki, S.; Hirose, H.

    1994-01-01

    Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls

  3. Kaplan turbine tip vortex cavitation – analysis and prevention

    International Nuclear Information System (INIS)

    Motycak, L; Skotak, A; Kupcik, R

    2012-01-01

    The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

  4. Kaplan turbine tip vortex cavitation - analysis and prevention

    Science.gov (United States)

    Motycak, L.; Skotak, A.; Kupcik, R.

    2012-11-01

    The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

  5. Blade Profile Optimization of Kaplan Turbine Using CFD Analysis

    Directory of Open Access Journals (Sweden)

    Aijaz Bashir Janjua

    2013-10-01

    Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.

  6. Blade profile optimization of kaplan turbine using cfd analysis

    International Nuclear Information System (INIS)

    Janjua, A.B.; Khalil, M.S.

    2013-01-01

    Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)

  7. Analysis of the Kaplan turbine draft tube effect

    Energy Technology Data Exchange (ETDEWEB)

    Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)

    2010-08-15

    The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

  8. Analysis of the Kaplan turbine draft tube effect

    Science.gov (United States)

    Motycak, L.; Skotak, A.; Obrovsky, J.

    2010-08-01

    The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

  9. Analysis of the Kaplan turbine draft tube effect

    International Nuclear Information System (INIS)

    Motycak, L; Skotak, A; Obrovsky, J

    2010-01-01

    The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

  10. Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

    OpenAIRE

    Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu

    2015-01-01

    Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...

  11. Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System

    Science.gov (United States)

    Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola

    2011-01-01

    Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…

  12. Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

    Directory of Open Access Journals (Sweden)

    Jie Zhao

    2015-01-01

    Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.

  13. Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine

    Directory of Open Access Journals (Sweden)

    Doina Frunzaverde

    2011-01-01

    Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.

  14. Applying Kaplan-Meier to Item Response Data

    Science.gov (United States)

    McNeish, Daniel

    2018-01-01

    Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…

  15. A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines

    Science.gov (United States)

    Pennacchi, P.; Borghesani, P.; Chatterton, S.

    2015-08-01

    Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.

  16. Meier-Gorlin syndrome

    NARCIS (Netherlands)

    Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

  17. Water hammer 2 phase analysis hydraulic system with a Kaplan turbine

    OpenAIRE

    Dudlik, A.; Koutnik, J.

    2009-01-01

    This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...

  18. Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

    Science.gov (United States)

    Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.

    2012-11-01

    The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

  19. Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

    International Nuclear Information System (INIS)

    Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H

    2012-01-01

    The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

  20. Meier-Gorlin syndrome

    OpenAIRE

    de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...

  1. Meier-Gorlin syndrome.

    Science.gov (United States)

    de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

    2015-09-17

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.

  2. Mathematical simulation of fluid flow and analysis of flow pattern in the flow path of low-head Kaplan turbine

    Directory of Open Access Journals (Sweden)

    A. V. Rusanov

    2016-12-01

    Full Text Available The results of numerical investigation of spatial flow of viscous incompressible fluid in flow part of Kaplan turbine PL20 Kremenchug HPP at optimum setting angle of runner blade φb = 15° and at maximum setting angle φb = 35° are shown. The flow simulation has been carried out on basis of numerical integration of the Reynolds equations with an additional term containing artificial compressibility. The differential two-parameter model of Menter (SST has been applied to take into account turbulent effects. Numerical integration of the equations is carried out using an implicit quasi-monotone Godunov type scheme of second - order accuracy in space and time. The calculations have been conducted with the help of the software system IPMFlow. The analysis of fluid flow in the flow part elements is shown and the values of hydraulic losses and local cavitation coefficient have been obtained. Comparison of calculated and experimental results has been carried out.

  3. Fatigue Analysis of the Piston Rod in a Kaplan Turbine Based on Crack Propagation under Unsteady Hydraulic Loads

    International Nuclear Information System (INIS)

    Liu, X; Luo, Y Y; Wang, Z W

    2014-01-01

    As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption

  4. Fatigue Analysis of the Piston Rod in a Kaplan Turbine Based on Crack Propagation under Unsteady Hydraulic Loads

    Science.gov (United States)

    Liu, X.; Y Luo, Y.; Wang, Z. W.

    2014-03-01

    As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption.

  5. Interview with Danny Kaplan

    Science.gov (United States)

    Rossman, Allan; Kaplan, Danny

    2017-01-01

    Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…

  6. Numerical Analysis of Flow in Kaplan Turbine Runner Blades Anticavitation Lip with Modified Hydro-dynamic Profile

    Directory of Open Access Journals (Sweden)

    Vasile Cojocaru

    2011-09-01

    Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.

  7. Genetics Home Reference: Meier-Gorlin syndrome

    Science.gov (United States)

    ... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...

  8. The comparative analysis of the current-meter method and the pressure-time method used for discharge measurements in the Kaplan turbine penstocks

    Science.gov (United States)

    Adamkowski, A.; Krzemianowski, Z.

    2012-11-01

    The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.

  9. The comparative analysis of the current-meter method and the pressure-time method used for discharge measurements in the Kaplan turbine penstocks

    International Nuclear Information System (INIS)

    Adamkowski, A; Krzemianowski, Z

    2012-01-01

    The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.

  10. [Survival analysis with competing risks: estimating failure probability].

    Science.gov (United States)

    Llorca, Javier; Delgado-Rodríguez, Miguel

    2004-01-01

    To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

  11. How Do Executive Functions Fit with the Cattell-Horn-Carroll Model? Some Evidence from a Joint Factor Analysis of the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities

    Science.gov (United States)

    Floyd, Randy G.; Bergeron, Renee; Hamilton, Gloria; Parra, Gilbert R.

    2010-01-01

    This study investigated the relations among executive functions and cognitive abilities through a joint exploratory factor analysis and joint confirmatory factor analysis of 25 test scores from the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities. Participants were 100 children and adolescents…

  12. Análisis de supervivencia en presencia de riesgos competitivos: estimadores de la probabilidad de suceso Survival analysis with competing risks: estimating failure probability

    Directory of Open Access Journals (Sweden)

    Javier Llorca

    2004-10-01

    Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

  13. Meier-Gorlin syndrome Clinical genetics and genomics

    NARCIS (Netherlands)

    De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

  14. Meier-Gorlin syndrome Clinical genetics and genomics

    NARCIS (Netherlands)

    S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)

    2015-01-01

    textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia

  15. Numerical investigation of hub clearance flow in a Kaplan turbine

    Science.gov (United States)

    Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.

    2012-11-01

    In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.

  16. Numerical investigation of hub clearance flow in a Kaplan turbine

    International Nuclear Information System (INIS)

    Wu, H; Feng, J J; Wu, G K; Luo, X Q

    2012-01-01

    In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.

  17. Meier-Gorlin syndrome Clinical genetics and genomics

    OpenAIRE

    Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie

    2015-01-01

    textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...

  18. Survival analysis

    International Nuclear Information System (INIS)

    Badwe, R.A.

    1999-01-01

    The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model

  19. Adding gauge fields to Kaplan's fermions

    International Nuclear Information System (INIS)

    Blum, T.; Kaerkkaeinen, L.

    1994-01-01

    We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)

  20. Prita Meier, Swahili Port Cities: The Architecture of Elsewhere

    OpenAIRE

    Longair, Sarah

    2018-01-01

    Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...

  1. A review and comparison of methods for recreating individual patient data from published Kaplan-Meier survival curves for economic evaluations: a simulation study.

    Science.gov (United States)

    Wan, Xiaomin; Peng, Liubao; Li, Yuanjian

    2015-01-01

    In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.

  2. MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY

    OpenAIRE

    Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar

    2016-01-01

    Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...

  3. Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin

    OpenAIRE

    Fjærvold, Lars

    2012-01-01

    The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...

  4. Kaplan SpellRead. What Works Clearinghouse Intervention Report

    Science.gov (United States)

    What Works Clearinghouse, 2007

    2007-01-01

    "Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…

  5. Numerical investigation of tip clearance cavitation in Kaplan runners

    Science.gov (United States)

    Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.

    2016-11-01

    There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.

  6. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

  7. Kaplan Extended V2 SST anomaly data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data is processed at Lamont-Doherty using a optimal analysis scheme. This dataset is different than previously archived version from Nov 1981 due to a different NCEP...

  8. Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids

    OpenAIRE

    Gustafsson, Martin

    2013-01-01

    To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...

  9. Bias and precision of methods for estimating the difference in restricted mean survival time from an individual patient data meta-analysis

    Directory of Open Access Journals (Sweden)

    Béranger Lueza

    2016-03-01

    Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect

  10. Comparison of Exposure in the Kaplan Versus the Kocher Approach in the Treatment of Radial Head Fractures.

    Science.gov (United States)

    Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P

    2018-01-01

    The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.

  11. Pressure pulsation in Kaplan turbines: Prototype-CFD comparison

    International Nuclear Information System (INIS)

    Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F

    2012-01-01

    Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.

  12. Pressure pulsation in Kaplan turbines: Prototype-CFD comparison

    Science.gov (United States)

    Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.

    2012-11-01

    Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.

  13. Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test

    International Nuclear Information System (INIS)

    Aoki, S.; Levien, R.B.

    1995-01-01

    We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories

  14. Optimization of Kaplan turbines. A contribution to economic efficiency; Optimierung von Kaplan-Turbinen. Ein Beitrag zur Betriebswirtschaftlichkeit

    Energy Technology Data Exchange (ETDEWEB)

    Sevcik, Petr

    2009-07-01

    The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.

  15. De 'wraak van de geografie' volgens Robert D. Kaplan

    NARCIS (Netherlands)

    Mamadouh, V.

    2013-01-01

    De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor

  16. Experiences with environmentally adapted Kaplan runners; Erfarenheter med miljoeanpassade Kaplanloephjul

    Energy Technology Data Exchange (ETDEWEB)

    Ukonsaari; Jan

    2012-08-15

    This study concerns environmentally adapted Kaplan runners, which have no oil for lubricating the blade regulation mechanisms and bearings. The runners are water or air filled with self lubricated bearings. Recent design also includes regulation system pressure increase and servo motor placement below runner centre and environmentally adapted synthetic ester as hydraulic fluid. These together with power output increase and efficiency optimization are suspected sources of poor runner function. Of 37 runners 43 % have had some kind of problem and 30 % bearing or mechanism related ones. When the axial blade bearing problems are excluded the problems occurred at 16 %. Deeper look into the design of newer runners shows that only bronze based runner hubs is significantly more problem dense regarding regulation mechanisms (50 %). Hidden figures of increased runner regulation forces are suspected. All problems cannot be explained and the young machines limit the experiences. The working group's opinion and bring ups of historical and present examples during the work show evidence that the old oil filled runners function is far from perfect, nor the life length. The future is not with oil filled runner hubs. Main parts of the discovered problems have been solved and can be resolved by thorough design analysis. One future concern is what effects the recent design changes will cause due to increase demand for power output changes including the number of starts and stops. That is why the working group's recommendation is to put joint effort into material fatigue and in which a first step is to identify the real forces the runners are exposed to.

  17. Survival Analysis of Patients with End Stage Renal Disease

    Science.gov (United States)

    Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.

    2015-06-01

    This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.

  18. Large mass limit of the continuum theories in Kaplan's formulation

    International Nuclear Information System (INIS)

    Kawano, T.; Kikukawa, Y.

    1994-01-01

    Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense

  19. Multi-objective shape optimization of runner blade for Kaplan turbine

    International Nuclear Information System (INIS)

    Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V

    2014-01-01

    Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads

  20. Multi-objective shape optimization of runner blade for Kaplan turbine

    Science.gov (United States)

    Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.

    2014-03-01

    Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.

  1. Competing approaches to analysis of failure times with competing risks.

    Science.gov (United States)

    Farley, T M; Ali, M M; Slaymaker, E

    2001-12-15

    For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.

  2. Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

    International Nuclear Information System (INIS)

    Weili, L; Jinling, L; Xingqi, L; Yuan, L

    2010-01-01

    The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

  3. Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

    Energy Technology Data Exchange (ETDEWEB)

    Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)

    2010-08-15

    The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

  4. Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

    Science.gov (United States)

    Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.

    2010-08-01

    The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

  5. XRF and XANES Data for Kaplan U Paper

    Science.gov (United States)

    The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).

  6. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

    DEFF Research Database (Denmark)

    Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

  7. Unsteady load on an oscillating Kaplan turbine runner

    Science.gov (United States)

    Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.

    2013-02-01

    A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.

  8. Air injection test on a Kaplan turbine: prototype - model comparison

    Science.gov (United States)

    Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.

    2016-11-01

    Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.

  9. Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

    NARCIS (Netherlands)

    de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.

    2012-01-01

    MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex

  10. Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

    NARCIS (Netherlands)

    de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.

    2012-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This

  11. Case Report: Meier-Gorlin syndrome: Report of an additional patient ...

    African Journals Online (AJOL)

    We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.

  12. Calculating the dielectric anisotropy of nematic liquid crystals: a reinvestigation of the Maier–Meier theory

    International Nuclear Information System (INIS)

    Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan

    2009-01-01

    This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)

  13. Numerical and in-situ investigations of water hammer effects in Drava river Kaplan turbine hydropower plants

    Science.gov (United States)

    Bergant, A.; Gregorc, B.; Gale, J.

    2012-11-01

    This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.

  14. Numerical and in-situ investigations of water hammer effects in Drava river Kaplan turbine hydropower plants

    International Nuclear Information System (INIS)

    Bergant, A; Gregorc, B; Gale, J

    2012-01-01

    This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.

  15. Coupled skinny baker's maps and the Kaplan-Yorke conjecture

    Science.gov (United States)

    Gröger, Maik; Hunt, Brian R.

    2013-09-01

    The Kaplan-Yorke conjecture states that for ‘typical’ dynamical systems with a physical measure, the information dimension and the Lyapunov dimension coincide. We explore this conjecture in a neighborhood of a system for which the two dimensions do not coincide because the system consists of two uncoupled subsystems. We are interested in whether coupling ‘typically’ restores the equality of the dimensions. The particular subsystems we consider are skinny baker's maps, and we consider uni-directional coupling. For coupling in one of the possible directions, we prove that the dimensions coincide for a prevalent set of coupling functions, but for coupling in the other direction we show that the dimensions remain unequal for all coupling functions. We conjecture that the dimensions prevalently coincide for bi-directional coupling. On the other hand, we conjecture that the phenomenon we observe for a particular class of systems with uni-directional coupling, where the information and Lyapunov dimensions differ robustly, occurs more generally for many classes of uni-directionally coupled systems (also called skew-product systems) in higher dimensions.

  16. Axial U(1) current in Grabowska and Kaplan's formulation

    Science.gov (United States)

    Hamada, Yu; Kawai, Hikaru

    2017-06-01

    Recently, Grabowska and Kaplan [Phys. Rev. Lett. 116, 211602 (2016); Phys. Rev. D 94, 114504 (2016)] suggested a nonperturbative formulation of a chiral gauge theory, which consists of the conventional domain-wall fermion and a gauge field that evolves by gradient flow from one domain wall to the other. We introduce two sets of domain-wall fermions belonging to complex conjugate representations so that the effective theory is a 4D vector-like gauge theory. Then, as a natural definition of the axial-vector current, we consider a current that generates simultaneous phase transformations for the massless modes in 4 dimensions. However, this current is exactly conserved and does not reproduce the correct anomaly. In order to investigate this point precisely, we consider the mechanism of the conservation. We find that this current includes not only the axial current on the domain wall but also a contribution from the bulk, which is nonlocal in the sense of 4D fields. Therefore, the local current is obtained by subtracting the bulk contribution from it.

  17. Unsteady numerical simulation of the flow in the U9 Kaplan turbine model

    Science.gov (United States)

    Javadi, Ardalan; Nilsson, Håkan

    2014-03-01

    The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.

  18. Unsteady numerical simulation of the flow in the U9 Kaplan turbine model

    International Nuclear Information System (INIS)

    Javadi, Ardalan; Nilsson, Håkan

    2014-01-01

    The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation

  19. Runaway transient simulation of a model Kaplan turbine

    Energy Technology Data Exchange (ETDEWEB)

    Liu, S; Liu, D; Wu, Y [State Key Laboratory of Hydroscience and Engineering, Department of Thermal Eng., Tsinghua University, Beijing, 100084 (China); Zhou, D [Water Conservancy and Hydropower Eng., Hohai University, Nanjing. 210098 (China); Nishi, M, E-mail: liushuhong@tsinghua.edu.c [Kyushu Inst. Tech. Senior Academy, Kitakyushu, 804-8550 (Japan)

    2010-08-15

    The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-{epsilon} turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

  20. Runaway transient simulation of a model Kaplan turbine

    Science.gov (United States)

    Liu, S.; Zhou, D.; Liu, D.; Wu, Y.; Nishi, M.

    2010-08-01

    The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-epsilon turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

  1. Runaway transient simulation of a model Kaplan turbine

    International Nuclear Information System (INIS)

    Liu, S; Liu, D; Wu, Y; Zhou, D; Nishi, M

    2010-01-01

    The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-ε turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

  2. Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease

    Directory of Open Access Journals (Sweden)

    Rabah M. Shawky

    2014-10-01

    Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.

  3. TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier

    Index Scriptorium Estoniae

    Tursk, Eda

    2004-01-01

    Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan

  4. Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response : Patrick Meier, 2015, CRC Press (Boca Raton, FL, 978-1-4822-4839-5, 259 pp.).

    Science.gov (United States)

    Dave, Anushree

    2017-12-01

    This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.

  5. Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks

    Directory of Open Access Journals (Sweden)

    Camelia Jianu

    2010-10-01

    Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

  6. Computer Aided Design of Kaplan Turbine Piston with SolidWorks

    OpenAIRE

    Camelia Jianu

    2010-01-01

    The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

  7. Kaplan og Norton bør læses af hele ledelsen

    DEFF Research Database (Denmark)

    Bukh, Per Nikolaj

    2009-01-01

    Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...

  8. Individualism, Nationalism, and Universalism: The Educational Ideals of Mordecai M. Kaplan's Philosophy of Jewish Education

    Science.gov (United States)

    Ackerman, Ari

    2008-01-01

    This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…

  9. Markov chains and semi-Markov models in time-to-event analysis.

    Science.gov (United States)

    Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J

    2013-10-25

    A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.

  10. Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post

    Index Scriptorium Estoniae

    Nikiforov, Raivo

    2005-01-01

    Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest

  11. Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.

    Science.gov (United States)

    Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E

    2018-02-02

    In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.

  12. De Novo GMNN Mutations Cause Autosomal-Dominant Primordial Dwarfism Associated with Meier-Gorlin Syndrome.

    Science.gov (United States)

    Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping

    2015-12-03

    Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  13. Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines

    Directory of Open Access Journals (Sweden)

    Ana-Maria Budai

    2010-10-01

    Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.

  14. Verification of Kaplan turbine cam curves realization accuracy at power plant

    Directory of Open Access Journals (Sweden)

    Džepčeski Dane

    2016-01-01

    Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.

  15. Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

    Science.gov (United States)

    Ko, P.; Kurosawa, S.

    2014-03-01

    The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.

  16. Can a polynomial interpolation improve on the Kaplan-Yorke dimension?

    International Nuclear Information System (INIS)

    Richter, Hendrik

    2008-01-01

    The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems

  17. The Educational Philosophies of Mordecai Kaplan and Michael Rosenak: Surprising Similarities and Illuminating Differences

    Science.gov (United States)

    Schein, Jeffrey; Caplan, Eric

    2014-01-01

    The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…

  18. Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan

    Science.gov (United States)

    Krikun, Andrew

    2010-01-01

    Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…

  19. Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

    International Nuclear Information System (INIS)

    Ko, P; Kurosawa, S

    2014-01-01

    The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine

  20. Restaging and Survival Analysis of 4036 Ovarian Cancer Patients According to the 2013 FIGO Classification for Ovarian, Fallopian Tube, and Primary Peritoneal Cancer

    DEFF Research Database (Denmark)

    Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul

    2016-01-01

    OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...

  1. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

    International Nuclear Information System (INIS)

    Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

    2008-01-01

    Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

  2. Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks

    Directory of Open Access Journals (Sweden)

    Camelia Jianu

    2010-10-01

    Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.

  3. Statistical evaluation of a project to estimate fish trajectories through the intakes of Kaplan hydropower turbines

    Science.gov (United States)

    Sutton, Virginia Kay

    This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.

  4. Censoring approach to the detection limits in X-ray fluorescence analysis

    International Nuclear Information System (INIS)

    Pajek, M.; Kubala-Kukus, A.

    2004-01-01

    We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples

  5. Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.

    Science.gov (United States)

    Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak

    Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  6. Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.

    Science.gov (United States)

    Pion, J; Lenoir, M; Vandorpe, B; Segers, V

    2015-11-01

    This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.

  7. Survival analysis II: Cox regression

    NARCIS (Netherlands)

    Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.

    2011-01-01

    In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the

  8. CASAS: Cancer Survival Analysis Suite, a web based application.

    Science.gov (United States)

    Rupji, Manali; Zhang, Xinyan; Kowalski, Jeanne

    2017-01-01

    We present CASAS, a shiny R based tool for interactive survival analysis and visualization of results. The tool provides a web-based one stop shop to perform the following types of survival analysis:  quantile, landmark and competing risks, in addition to standard survival analysis.  The interface makes it easy to perform such survival analyses and obtain results using the interactive Kaplan-Meier and cumulative incidence plots.  Univariate analysis can be performed on one or several user specified variable(s) simultaneously, the results of which are displayed in a single table that includes log rank p-values and hazard ratios along with their significance. For several quantile survival analyses from multiple cancer types, a single summary grid is constructed. The CASAS package has been implemented in R and is available via http://shinygispa.winship.emory.edu/CASAS/. The developmental repository is available at https://github.com/manalirupji/CASAS/.

  9. Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

    Science.gov (United States)

    Petit, O.; Mulu, B.; Nilsson, H.; Cervantes, M.

    2010-08-01

    The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

  10. Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

    International Nuclear Information System (INIS)

    Petit, O; Nilsson, H; Mulu, B; Cervantes, M

    2010-01-01

    The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

  11. Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

    Energy Technology Data Exchange (ETDEWEB)

    Petit, O; Nilsson, H [Division of Fluid Mechanics, Chalmers University of Technology, Hoersalsvaegen 7A, SE-41296 Goeteborg (Sweden); Mulu, B; Cervantes, M, E-mail: olivierp@chalmers.s [Division of Fluid Mechanics, Luleaa University of Technology, SE-971 87 Luleaa (Sweden)

    2010-08-15

    The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

  12. Anterolateral Knee Extra-articular Stabilizers: A Robotic Sectioning Study of the Anterolateral Ligament and Distal Iliotibial Band Kaplan Fibers.

    Science.gov (United States)

    Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F

    2018-05-01

    The individual kinematic roles of the anterolateral ligament (ALL) and the distal iliotibial band Kaplan fibers in the setting of anterior cruciate ligament (ACL) deficiency require further clarification. This will improve understanding of their potential contribution to residual anterolateral rotational laxity after ACL reconstruction and may influence selection of an anterolateral extra-articular reconstruction technique, which is currently a matter of debate. Hypothesis/Purpose: To compare the role of the ALL and the Kaplan fibers in stabilizing the knee against tibial internal rotation, anterior tibial translation, and the pivot shift in ACL-deficient knees. We hypothesized that the Kaplan fibers would provide greater tibial internal rotation restraint than the ALL in ACL-deficient knees and that both structures would provide restraint against internal rotation during a simulated pivot-shift test. Controlled laboratory study. Ten paired fresh-frozen cadaveric knees (n = 20) were used to investigate the effect of sectioning the ALL and the Kaplan fibers in ACL-deficient knees with a 6 degrees of freedom robotic testing system. After ACL sectioning, sectioning was randomly performed for the ALL and the Kaplan fibers. An established robotic testing protocol was utilized to assess knee kinematics when the specimens were subjected to a 5-N·m internal rotation torque (0°-90° at 15° increments), a simulated pivot shift with 10-N·m valgus and 5-N·m internal rotation torque (15° and 30°), and an 88-N anterior tibial load (30° and 90°). Sectioning of the ACL led to significantly increased tibial internal rotation (from 0° to 90°) and anterior tibial translation (30° and 90°) as compared with the intact state. Significantly increased internal rotation occurred with further sectioning of the ALL (15°-90°) and Kaplan fibers (15°, 60°-90°). At higher flexion angles (60°-90°), sectioning the Kaplan fibers led to significantly greater internal rotation

  13. Development of low head Kaplan turbine for power station rehabilitation project

    Science.gov (United States)

    Lim, S. M.; Ohtake, N.; Kurosawa, S.; Suzuki, T.; Yamasaki, T.; Nishi, H.

    2012-11-01

    This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.

  14. Development of low head Kaplan turbine for power station rehabilitation project

    International Nuclear Information System (INIS)

    Lim, S M; Ohtake, N; Kurosawa, S; Suzuki, T; Yamasaki, T; Nishi, H

    2012-01-01

    This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.

  15. Numerical Investigation of the Flow Structure in a Kaplan Draft Tube at Part Load

    Science.gov (United States)

    Maddahian, R.; Cervantes, M. J.; Sotoudeh, N.

    2016-11-01

    This research presents numerical simulation of the unsteady flow field inside the draft tube of a Kaplan turbine at part load condition. Due to curvature of streamlines, the ordinary two-equations turbulence models fail to predict the flow features. Therefore, a modification of the Shear Stress Transport (SST-SAS) model is utilized to approximate the turbulent stresses. A guide vane, complete runner and draft tube are considered to insure the real boundary conditions at the draft tube inlet. The outlet boundary is assumed to discharge into the atmosphere. The obtained pressure fluctuations inside the draft tube are in good agreement with available experimental data. In order to further investigate the RVR formation and its movement, the λ2 criterion, relating the position of the vortex core and strength to the second largest Eigen value of the velocity gradient tensor, is employed. The method used for vortex identification shows the flow structure and vortex motion inside the draft tube accurately.

  16. Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines

    Energy Technology Data Exchange (ETDEWEB)

    Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)

    2015-10-01

    Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.

  17. La chiesa di Richard Meier a Tor Tre Teste e il suo contributo al consolidamento identitario dei nuovi quartieri romani oltre il GRA / The church designed by Richard Meier in Tor Tre Teste and the identity consolidation in the new roman neighbourhoods beyond the Great Circular Road

    Directory of Open Access Journals (Sweden)

    Giuseppe Bonaccorso

    2014-06-01

    . The most important aspects of the eastern quadrant of the Roman periphery are described “from the inside”, accentuating the passages, spaces and elements of composition standing in the origin of form and structure of the neighborhoods in the vicinity of Great Circular Road. The article proposes that the key episodes in this process are the new churches by internationally famous architects, created as new focal points for peripheral neighborhoods whilst replacing libraries, squares and malls. Recent realizations are seen as intention to enforce, or, better, to construct, an identity factor for each of the neighborhoods in the dicussed sector of the city. Starting from the general discourse, the article focuses on one church and one neighborhood that might be considered as models to follow in the entire periphery around GCR: the jubilee church of God the Father of Mercy designed by Richard Meier in the neighborhood of Tor Tre Teste. The sequence of events related to the architectural competition for the church, the choice of proposal by Richard Meier, the complexity of construction as well as the technical, stylistic and symbolical analysis of the building are put in relation to the neighborhood, and finally read as an attempt to create centre of attention for the entire periphery.

  18. A method to combine hydrodynamics and constructive design in the optimization of the runner blades of Kaplan turbines

    International Nuclear Information System (INIS)

    Miclosina, C O; Balint, D I; Campian, C V; Frunzaverde, D; Ion, I

    2012-01-01

    This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from 'Eftimie Murgu' University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.

  19. A method to combine hydrodynamics and constructive design in the optimization of the runner blades of Kaplan turbines

    Science.gov (United States)

    Miclosina, C. O.; Balint, D. I.; Campian, C. V.; Frunzaverde, D.; Ion, I.

    2012-11-01

    This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from "Eftimie Murgu" University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.

  20. Survival analysis in hematologic malignancies: recommendations for clinicians

    Science.gov (United States)

    Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril

    2014-01-01

    The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982

  1. Repair of a Kaplan blade sealing surface without dismantling the turbine; Instandsetzung einer Kaplanschaufel-Dichtflaeche ohne Turbinendemontage

    Energy Technology Data Exchange (ETDEWEB)

    Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)

    2008-07-01

    In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)

  2. Deficiency in origin licensing proteins impairs cilia formation: implications for the aetiology of Meier-Gorlin syndrome.

    Directory of Open Access Journals (Sweden)

    Tom Stiff

    Full Text Available Mutations in ORC1, ORC4, ORC6, CDT1, and CDC6, which encode proteins required for DNA replication origin licensing, cause Meier-Gorlin syndrome (MGS, a disorder conferring microcephaly, primordial dwarfism, underdeveloped ears, and skeletal abnormalities. Mutations in ATR, which also functions during replication, can cause Seckel syndrome, a clinically related disorder. These findings suggest that impaired DNA replication could underlie the developmental defects characteristic of these disorders. Here, we show that although origin licensing capacity is impaired in all patient cells with mutations in origin licensing component proteins, this does not correlate with the rate of progression through S phase. Thus, the replicative capacity in MGS patient cells does not correlate with clinical manifestation. However, ORC1-deficient cells from MGS patients and siRNA-mediated depletion of origin licensing proteins also have impaired centrosome and centriole copy number. As a novel and unexpected finding, we show that they also display a striking defect in the rate of formation of primary cilia. We demonstrate that this impacts sonic hedgehog signalling in ORC1-deficient primary fibroblasts. Additionally, reduced growth factor-dependent signaling via primary cilia affects the kinetics of cell cycle progression following cell cycle exit and re-entry, highlighting an unexpected mechanism whereby origin licensing components can influence cell cycle progression. Finally, using a cell-based model, we show that defects in cilia function impair chondroinduction. Our findings raise the possibility that a reduced efficiency in forming cilia could contribute to the clinical features of MGS, particularly the bone development abnormalities, and could provide a new dimension for considering developmental impacts of licensing deficiency.

  3. Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine

    Science.gov (United States)

    Schmidt, H.; Kirschner, O.; Riedelbauch, S.; Necker, J.; Kopf, E.; Rieg, M.; Arantes, G.; Wessiak, M.; Mayrhuber, J.

    2014-03-01

    Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation.

  4. Examining the Latent Structure of the Delis-Kaplan Executive Function System.

    Science.gov (United States)

    Karr, Justin E; Hofer, Scott M; Iverson, Grant L; Garcia-Barrera, Mauricio A

    2018-05-04

    The current study aimed to determine whether the Delis-Kaplan Executive Function System (D-KEFS) taps into three executive function factors (inhibition, shifting, fluency) and to assess the relationship between these factors and tests of executive-related constructs less often measured in latent variable research: reasoning, abstraction, and problem solving. Participants included 425 adults from the D-KEFS standardization sample (20-49 years old; 50.1% female; 70.1% White). Eight alternative measurement models were compared based on model fit, with test scores assigned a priori to three factors: inhibition (Color-Word Interference, Tower), shifting (Trail Making, Sorting, Design Fluency), and fluency (Verbal/Design Fluency). The Twenty Questions, Word Context, and Proverb Tests were predicted in separate structural models. The three-factor model fit the data well (CFI = 0.938; RMSEA = 0.047), although a two-factor model, with shifting and fluency merged, fit similarly well (CFI = 0.929; RMSEA = 0.048). A bifactor model fit best (CFI = 0.977; RMSEA = 0.032) and explained the most variance in shifting indicators, but rarely converged among 5,000 bootstrapped samples. When the three first-order factors simultaneously predicted the criterion variables, only shifting was uniquely predictive (p measuring executive-related constructs and provide a framework through which clinicians can interpret D-KEFS results.

  5. Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine

    International Nuclear Information System (INIS)

    Schmidt, H; Kirschner, O; Riedelbauch, S; Necker, J; Kopf, E; Rieg, M; Arantes, G; Wessiak, M; Mayrhuber, J

    2014-01-01

    Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation

  6. Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model

    International Nuclear Information System (INIS)

    Rivetti, A; Angulo, M; Lucino, C; Liscia, S

    2014-01-01

    Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors

  7. Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner

    International Nuclear Information System (INIS)

    Amiri, K; Cervantes, M J; Mulu, B; Raisee, M

    2014-01-01

    Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR

  8. Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner

    Science.gov (United States)

    Amiri, K.; Mulu, B.; Raisee, M.; Cervantes, M. J.

    2014-03-01

    Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR.

  9. Mitigation of tip vortex cavitation by means of air injection on a Kaplan turbine scale model

    Science.gov (United States)

    Rivetti, A.; Angulo, M.; Lucino, C.; Liscia, S.

    2014-03-01

    Kaplan turbines operating at full-load conditions may undergo excessive vibration, noise and cavitation. In such cases, damage by erosion associated to tip vortex cavitation can be observed at the discharge ring. This phenomenon involves design features such as (1) overhang of guide vanes; (2) blade profile; (3) gap increasing size with blade opening; (4) suction head; (5) operation point; and (6) discharge ring stiffness, among others. Tip vortex cavitation may cause erosion at the discharge ring and draft tube inlet following a wavy pattern, in which the number of vanes can be clearly identified. Injection of pressurized air above the runner blade centerline was tested as a mean to mitigate discharge ring cavitation damage on a scale model. Air entrance was observed by means of a high-speed camera in order to track the air trajectory toward its mergence with the tip vortex cavitation core. Post-processing of acceleration signals shows that the level of vibration and the RSI frequency amplitude decrease proportionally with air flow rate injected. These findings reveal the potential mitigating effect of air injection in preventing cavitation damage and will be useful in further tests to be performed on prototype, aiming at determining the optimum air flow rate, size and distribution of the injectors.

  10. Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions

    International Nuclear Information System (INIS)

    Lakatos, K; Szamosi, Z; Bereczkei, S

    2012-01-01

    This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.

  11. Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions

    Science.gov (United States)

    Lakatos, K.; Szamosi, Z.; Bereczkei, S.

    2012-11-01

    This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.

  12. The Factor Structure and Age-Related Factorial Invariance of the Delis-Kaplan Executive Function System (D-KEFS)

    Science.gov (United States)

    Latzman, Robert D.; Markon, Kristian E.

    2010-01-01

    There has been an increased interest in the structure of and relations among executive functions.The present study examined the factor structure as well as age-related factorial invariance of the Delis-Kaplan Executive Function System (D-KEFS), a widely used inventory aimed at assessing executive functions. Analyses were first conducted using data…

  13. Socialization into a Civilization: The Dewey-Kaplan Synthesis in American Jewish Schooling in the Early 20th Century

    Science.gov (United States)

    Jacobs, Benjamin M.

    2009-01-01

    This historical study focuses on how John Dewey's theory of education as socialization and Mordecai Kaplan's theory of Judaism as a civilization together served as an ideological base and pedagogical framework for the creation of "progressive," "reconstructed" American Jewish school programs in the early 20th century…

  14. A 10-year cohort analysis of routine paediatric ART data in a rural South African setting.

    Science.gov (United States)

    Lilian, R R; Mutasa, B; Railton, J; Mongwe, W; McINTYRE, J A; Struthers, H E; Peters, R P H

    2017-01-01

    South Africa's paediatric antiretroviral therapy (ART) programme is managed using a monitoring and evaluation tool known as TIER.Net. This electronic system has several advantages over paper-based systems, allowing profiling of the paediatric ART programme over time. We analysed anonymized TIER.Net data for HIV-infected children aged ART in a rural district of South Africa between 2005 and 2014. We performed Kaplan-Meier survival analysis to assess outcomes over time. Records of 5461 children were available for analysis; 3593 (66%) children were retained in care. Losses from the programme were higher in children initiated on treatment in more recent years (P ART programme and highlights interventions to improve programme performance.

  15. Implementation of pressurized air injection system in a Kaplan prototype for the reduction of vibration caused by tip vortex cavitation

    Science.gov (United States)

    Rivetti, A.; Angulo, M.; Lucino, C.; Hene, M.; Capezio, O.; Liscia, S.

    2016-11-01

    Blade tip cavitation is a well-known phenomenon that affects the performance of large-diameter Kaplan turbines and induces structural vibration. Injection of pressurized air has been found to yield promising results in reducing those damaging effects. In this work, the results of an experimental test of air injection on a 9.5-m-diameter Kaplan turbine are reported. Experiments were performed for several load conditions and for two different net heads. Accelerations, pressure pulsation and noise emission were monitored for every tested condition. Results show that, at the expense of a maximum efficiency drop of 0.2%, air injection induces a decrease on the level of vibration from 57% up to 84%, depending on the load condition. Such decrease is seen to be proportional to the air flow rate, in the range from 0.06 to 0.8‰ (respect to the discharge at the best efficiency point).

  16. A full three dimensional Navier-Stokes numerical simulation of flow field inside a power plant Kaplan turbine using some model test turbine hill chart points

    Science.gov (United States)

    Hosseinalipour, S. M.; Raja, A.; Hajikhani, S.

    2012-06-01

    A full three dimensional Navier - Stokes numerical simulation has been performed for performance analysis of a Kaplan turbine which is installed in one of the Irans south dams. No simplifications have been enforced in the simulation. The numerical results have been evaluated using some integral parameters such as the turbine efficiency via comparing the results with existing experimental data from the prototype Hill chart. In part of this study the numerical simulations were performed in order to calculate the prototype turbine efficiencies in some specific points which comes from the scaling up of the model efficiency that are available in the model experimental Hill chart. The results are very promising which shows the good ability of the numerical techniques for resolving the flow characteristics in these kind of complex geometries. A parametric study regarding the evaluation of turbine performance in three different runner angles of the prototype is also performed and the results are cited in this paper.

  17. Multiple factor analysis of metachronous upper urinary tract transitional cell carcinoma after radical cystectomy

    Directory of Open Access Journals (Sweden)

    P. Wang

    2007-07-01

    Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.

  18. Hypofractionated radiation therapy for invasive thyroid carcinoma in dogs: a retrospective analysis of survival

    International Nuclear Information System (INIS)

    Brearley, M.J.; Hayes, A.M.; Murphy, S.

    1999-01-01

    Thirteen dogs with invasive thyroid carcinoma (WHO classification T2b or T3b) seen between January 1991 and October 1997 were treated by external beam Irradiation. Four once-weekly fractions of 9 gray of 4 MeV X-rays were administered. Four of the dogs died of progression of the primary disease and four from metastatic spread. Of the remaining dogs, three died of unrelated problems, although two were still alive at the time of the censor. Kaplan-Meier analysis of the survival time from first dose to death from either primary or metastatic disease gave a median survival time of 96 weeks (mean 85 weeks, range six to 247 weeks). Radiographic evidence of pulmonary metastatic disease at presentation had no prognostic value whereas crude growth rate was a highly significant factor. The present series Indicates that radiation therapy should be considered an important modality for the control of invasive thyroid carcinoma in the dog

  19. CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

    International Nuclear Information System (INIS)

    Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.

    2017-01-01

    The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

  20. The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

    International Nuclear Information System (INIS)

    Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.

    2016-01-01

    Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

  1. The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)

    2016-07-15

    Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

  2. Oncological Outcomes After Robotic Proctectomy for Rectal Cancer: Analysis of a Prospective Database.

    Science.gov (United States)

    Sammour, Tarik; Malakorn, Songphol; Bednarski, Brian K; Kaur, Harmeet; Shin, Ui Sup; Messick, Craig; You, Yi-Qian Nancy; Chang, George J

    2018-03-01

    The aim of this study is to evaluate the oncological outcomes of robotic total mesorectal excision (TME) at an NCI designated cancer center. The effectiveness of laparoscopic TME could not be established, but the robotic-assisted approach may hold some promise, with improved visualization and ergonomics for pelvic dissection. Oncological outcome data is presently lacking. Patients who underwent total mesorectal excision or tumor-specific mesorectal excision for rectal cancer between April 2009 and April 2016 via a robotic approach were identified from a prospective single-institution database. The circumferential resection margin (CRM), distal resection margin, and TME completeness rates were determined. Kaplan-Meier analysis of disease-free survival and overall survival was performed for all patients treated with curative intent. A total of 276 patients underwent robotic proctectomy during the study period. Robotic surgery was performed initially by 1 surgeon with 3 additional surgeons progressively transitioning from open to robotic during the study period with annual increase in the total number of cases performed robotically. Seven patients had involved circumferential resection margins (2.5%), and there were no positive distal or proximal resection margins. One hundred eighty-six patients had TME quality assessed, and only 1 patient (0.5%) had an incomplete TME. Eighty-three patients were followed up for a minimum of 3 years, with a local recurrence rate of 2.4%, and a distant recurrence rate of 16.9%. Five-year disease-free survival on Kaplan-Meier analysis was 82%, and 5-year overall survival was 87%. Robotic proctectomy for rectal cancer can be performed with good short and medium term oncological outcomes in selected patients.

  3. ["That flesh, pink and perishable": analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain) in the presence of competing risks].

    Science.gov (United States)

    Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel

    2009-01-01

    To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

  4. CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

    Energy Technology Data Exchange (ETDEWEB)

    Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)

    2017-03-15

    The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

  5. Evaluation of Hydraulic Loads on the Runner Blades of a Kaplan Turbine using CFD Simulation and Model Test

    Directory of Open Access Journals (Sweden)

    Zoltan-Iosif Korka

    2016-10-01

    Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.

  6. Analytical Method to Estimate Fatigue Life Time Duration in Service for Runner Blade Mechanism of Kaplan Turbines

    Directory of Open Access Journals (Sweden)

    Ana – Maria Budai

    2010-10-01

    Full Text Available The paper present an analytical method that can be used to determianted fatigue life time duration in service for runner blade mechanism of Kaplan turbines. The study was made for lever button of runer blade mechanism using two analytical relation to calculate the maximum number of stress cycles whereupon the mechanism work without any damage. To estimate fatigue life time duration will be used a formula obtained from one of most comon cumulative damage methodology taking in consideration the real exploatation conditions of a specified Kapaln turbine.

  7. Going Large or Going Small in Plant Design: Comparison between a P.P. with three small Kaplan turbines and a P.P. with just one Large Kaplan turbine

    Science.gov (United States)

    Castro-Otero, C.

    2017-04-01

    Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.

  8. LenoxKaplan_Role of natural gas in meeting electric sector emissions reduction strategy_dataset

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset is for an analysis that used the MARKAL linear optimization model to compare the carbon emissions profiles and system-wide global warming potential of...

  9. The BCR-ABLT315I mutation compromises survival in chronic phase chronic myelogenous leukemia patients resistant to tyrosine kinase inhibitors, in a matched pair analysis

    DEFF Research Database (Denmark)

    Nicolini, Franck E; Ibrahim, Amr R; Soverini, Simona

    2013-01-01

    The BCR-ABL T315I mutation confers resistance to currently licensed tyrosine kinase inhibitors in chronic myelogenous leukemia. However, the impact of this mutation on survival in early stages of disease, in chronic phase, has never been detailed. Using matched pair analysis, a cohort of 64...... patients with chronic phase chronic myelogenous leukemia harboring a T315I mutation and resistant to imatinib mesylate was compared to a similar cohort of 53 chronic phase patients resistant to imatinib, but with no detectable T315I mutation, in the pre-ponatinib era. These patients were matched according...... to age at diagnosis, interval between disease diagnosis and start of imatinib treatment, and duration of imatinib therapy. Kaplan-Meier survival analyses demonstrated the significant negative impact of the presence of the T315I mutation on overall survival (since imatinib-resistance: 48.4 months for T315...

  10. Marital status is an independent prognostic factor for pancreatic neuroendocrine tumors patients: An analysis of the Surveillance, Epidemiology, and End Results (SEER) database.

    Science.gov (United States)

    Zhou, Huaqiang; Zhang, Yuanzhe; Song, Yiyan; Tan, Wulin; Qiu, Zeting; Li, Si; Chen, Qinchang; Gao, Shaowei

    2017-09-01

    Marital status's prognostic impact on pancreatic neuroendocrine tumors (PNET) has not been rigorously studied. We aimed to explore the relationship between marital status and outcomes of PNET. We retrospectively investigated 2060 PNET cases between 2004 and 2010 from Surveillance, Epidemiology, and End Results (SEER) database. Variables were compared by Chi 2 test, t-test as appropriate. Kaplan-Meier methods and COX proportional hazard models were used to ascertain independent prognostic factors. Married patients had better 5-year overall survival (OS) (53.37% vs. 42.27%, Pvs. 59.82%, P=0.001) comparing with unmarried patients. Multivariate analysis revealed marital status is an independent prognostic factor, with married patients showing better OS (HR=0.74; 95% CI: 0.65-0.84; Punmarried patients may be associated with a delayed diagnosis with advanced tumor stage, psychosocial and socioeconomic factors. Further studies are needed. Copyright © 2017. Published by Elsevier Masson SAS.

  11. RBPJ and EphrinB2 as Molecular Targets to Treat Brain Arteriovenous Malformation in Notch4 Induced Mouse Model

    Science.gov (United States)

    2017-10-01

    of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to

  12. Carbonic anhydrase IX and response to postmastectomy radiotherapy in high-risk breast cancer: a subgroup analysis of the DBCG82 b and c trials

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...

  13. C-reactive protein-to-albumin ratio is a predictor of hepatitis B virus related decompensated cirrhosis: time-dependent receiver operating characteristics and decision curve analysis.

    Science.gov (United States)

    Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing

    2017-04-01

    Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.

  14. Indigolapsed muudavad maailma / Moon Meier

    Index Scriptorium Estoniae

    Meier, Moon

    2004-01-01

    Kasvatusteadlased avastasid, et alates u 1980. a-st sündinud lapsed on hoopis teistsugused kui eelmised põlvkonnad. Senine haridussüsteem neile ei sobi, hariduses peaks rohkem pöörama tähelepanu emotsioonidele

  15. Two-year survival analysis of twisted wire fixed retainer versus spiral wire and fiber-reinforced composite retainers: a preliminary explorative single-blind randomized clinical trial.

    Science.gov (United States)

    Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa

    2016-03-01

    Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.

  16. Genetic architecture of the Delis-Kaplan Executive Function System Trail Making Test: evidence for distinct genetic influences on executive function.

    Science.gov (United States)

    Vasilopoulos, Terrie; Franz, Carol E; Panizzon, Matthew S; Xian, Hong; Grant, Michael D; Lyons, Michael J; Toomey, Rosemary; Jacobson, Kristen C; Kremen, William S

    2012-03-01

    To examine how genes and environments contribute to relationships among Trail Making Test (TMT) conditions and the extent to which these conditions have unique genetic and environmental influences. Participants included 1,237 middle-aged male twins from the Vietnam Era Twin Study of Aging. The Delis-Kaplan Executive Function System TMT included visual searching, number and letter sequencing, and set-shifting components. Phenotypic correlations among TMT conditions ranged from 0.29 to 0.60, and genes accounted for the majority (58-84%) of each correlation. Overall heritability ranged from 0.34 to 0.62 across conditions. Phenotypic factor analysis suggested a single factor. In contrast, genetic models revealed a single common genetic factor but also unique genetic influences separate from the common factor. Genetic variance (i.e., heritability) of number and letter sequencing was completely explained by the common genetic factor while unique genetic influences separate from the common factor accounted for 57% and 21% of the heritabilities of visual search and set shifting, respectively. After accounting for general cognitive ability, unique genetic influences accounted for 64% and 31% of those heritabilities. A common genetic factor, most likely representing a combination of speed and sequencing, accounted for most of the correlation among TMT 1-4. Distinct genetic factors, however, accounted for a portion of variance in visual scanning and set shifting. Thus, although traditional phenotypic shared variance analysis techniques suggest only one general factor underlying different neuropsychological functions in nonpatient populations, examining the genetic underpinnings of cognitive processes with twin analysis can uncover more complex etiological processes.

  17. Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome.

    Science.gov (United States)

    Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A

    2011-02-27

    Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.

  18. Left ventricular dyssynchrony assessed by gated SPECT phase analysis is an independent predictor of death in patients with advanced coronary artery disease and reduced left ventricular function not undergoing cardiac resynchronization therapy

    Energy Technology Data Exchange (ETDEWEB)

    Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)

    2012-10-15

    Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)

  19. Inability of Kaplan radiation leukemia virus to replicate on mouse fibroblasts is conferred by its long terminal repeat

    International Nuclear Information System (INIS)

    Rassart, E.; Paquette, Y.; Jolicoeur, P.

    1988-01-01

    The molecularly cloned infectious Kaplan radiation leukemia virus has previously been shown to be unable to replicate on mouse fibroblasts. To map the viral sequences responsible for this, we constructed chimeric viral DNA genomes in vitro with parental cloned infectious viral DNAs from the nonfibrotropic (F-) BL/VL3 V-13 radiation leukemia virus and the fibrotropic (F+) endogenous BALB/c or Moloney murine leukemia viruses (MuLV). Infectious chimeric MuLVs, recovered after transfection of Ti-6 lymphocytes with these recombinant DNAs, were tested for capacity to replicate on mouse fibroblasts in vitro. We found that chimeric MuLVs harboring the long terminal repeat (LTR) of a fibrotropic MuLV replicated well on mouse fibroblasts. Conversely, chimeric MuLVs harboring the LTR of a nonfibrotropic MuLV were restricted on mouse fibroblasts. These results indicate that the LTR of BL/VL3 radiation leukemia virus harbors the primary determinant responsible for its inability to replicate on mouse fibroblasts in vitro. Our results also show that the primary determinant allowing F+ MuLVs (endogenous BALB/c and Moloney MuLVs) to replicate on mouse fibroblasts in vitro resides within the LTR

  20. How Do We Defend Democratic Education? Lois Weiner and Andy Kaplan Respond to Diane Ravitch's "The Reign of Error"

    Science.gov (United States)

    Weiner, Lois; Kaplan, Andy

    2014-01-01

    In this commentary, Andy Kaplan discusses with Lois Weiner, Diane Ravitch's latest book "The Reign of Error," which combines scholarly argument and scrupulous research in defense of democratic education. Weiner notes, the book will prove an important resource in the ongoing struggle for the survival of public schooling. Weiner adds,…

  1. Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.

    Directory of Open Access Journals (Sweden)

    Jeban Ganesalingam

    2009-09-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes.Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method.The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001.The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.

  2. Design of a Kaplan turbine for a wide range of operating head -Curved draft tube design and model test verification-

    Science.gov (United States)

    KO, Pohan; MATSUMOTO, Kiyoshi; OHTAKE, Norio; DING, Hua

    2016-11-01

    As for turbomachine off-design performance improvement is challenging but critical for maximising the performing area. In this paper, a curved draft tube for a medium head Kaplan type hydro turbine is introduced and discussed for its significant effect on expanding operating head range. Without adding any extra structure and working fluid for swirl destruction and damping, a carefully designed outline shape of draft tube with the selected placement of center-piers successfully supresses the growth of turbulence eddy and the transport of the swirl to the outlet. Also, more kinetic energy is recovered and the head lost is improved. Finally, the model test results are also presented. The obvious performance improvement was found in the lower net head area, where the maximum efficiency improvement was measured up to 20% without compromising the best efficiency point. Additionally, this design results in a new draft tube more compact in size and so leads to better construction and manufacturing cost performance for prototype. The draft tube geometry parameter designing process was concerning the best efficiency point together with the off-design points covering various water net heads and discharges. The hydraulic performance and flow behavior was numerically previewed and visualized by solving Reynolds-Averaged Navier-Stokes equations with Shear Stress Transport turbulence model. The simulation was under the assumption of steady-state incompressible turbulence flow inside the flow passage, and the inlet boundary condition was the carefully simulated flow pattern from the runner outlet. For confirmation, the corresponding turbine efficiency performance of the entire operating area was verified by model test.

  3. Neyman, Markov processes and survival analysis.

    Science.gov (United States)

    Yang, Grace

    2013-07-01

    J. Neyman used stochastic processes extensively in his applied work. One example is the Fix and Neyman (F-N) competing risks model (1951) that uses finite homogeneous Markov processes to analyse clinical trials with breast cancer patients. We revisit the F-N model, and compare it with the Kaplan-Meier (K-M) formulation for right censored data. The comparison offers a way to generalize the K-M formulation to include risks of recovery and relapses in the calculation of a patient's survival probability. The generalization is to extend the F-N model to a nonhomogeneous Markov process. Closed-form solutions of the survival probability are available in special cases of the nonhomogeneous processes, like the popular multiple decrement model (including the K-M model) and Chiang's staging model, but these models do not consider recovery and relapses while the F-N model does. An analysis of sero-epidemiology current status data with recurrent events is illustrated. Fix and Neyman used Neyman's RBAN (regular best asymptotic normal) estimates for the risks, and provided a numerical example showing the importance of considering both the survival probability and the length of time of a patient living a normal life in the evaluation of clinical trials. The said extension would result in a complicated model and it is unlikely to find analytical closed-form solutions for survival analysis. With ever increasing computing power, numerical methods offer a viable way of investigating the problem.

  4. The BAH domain of ORC1 links H4K20me2 to DNA replication licensing and Meier-Gorlin syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Alex J; Song, Jikui; Cheung, Peggie; Ishibe-Murakami, Satoko; Yamazoe, Sayumi; Chen, James K; Patel, Dinshaw J; Gozani, Or [Stanford; (MSKCC); (Stanford-MED)

    2012-07-11

    The recognition of distinctly modified histones by specialized 'effector' proteins constitutes a key mechanism for transducing molecular events at chromatin to biological outcomes. Effector proteins influence DNA-templated processes, including transcription, DNA recombination and DNA repair; however, no effector functions have yet been identified within the mammalian machinery that regulate DNA replication. Here we show that ORC1 - a component of ORC (origin of replication complex), which mediates pre-DNA replication licensing - contains a bromo adjacent homology (BAH) domain that specifically recognizes histone H4 dimethylated at lysine 20 (H4K20me2). Recognition of H4K20me2 is a property common to BAH domains present within diverse metazoan ORC1 proteins. Structural studies reveal that the specificity of the BAH domain for H4K20me2 is mediated by a dynamic aromatic dimethyl-lysine-binding cage and multiple intermolecular contacts involving the bound peptide. H4K20me2 is enriched at replication origins, and abrogating ORC1 recognition of H4K20me2 in cells impairs ORC1 occupancy at replication origins, ORC chromatin loading and cell-cycle progression. Mutation of the ORC1 BAH domain has been implicated in the aetiology of Meier-Gorlin syndrome (MGS), a form of primordial dwarfism, and ORC1 depletion in zebrafish results in an MGS-like phenotype. We find that wild-type human ORC1, but not ORC1-H4K20me2-binding mutants, rescues the growth retardation of orc1 morphants. Moreover, zebrafish depleted of H4K20me2 have diminished body size, mirroring the phenotype of orc1 morphants. Together, our results identify the BAH domain as a novel methyl-lysine-binding module, thereby establishing the first direct link between histone methylation and the metazoan DNA replication machinery, and defining a pivotal aetiological role for the canonical H4K20me2 mark, via ORC1, in primordial dwarfism.

  5. À LA RECHERCHE DES FONDEMENTS CONCEPTUELS ET METHODOLOGIQUES DU BALANCED SCORECARD : LE MODELE DE KAPLAN ET NORTON REVISITÉ À TRAVERS LE CADRE CONCEPTUEL DES LEVIERS DE CONTROLE.

    OpenAIRE

    Gérald Naro; Denis Travaillé

    2009-01-01

    International audience; The aim of this paper is to confront the Balanced Scorecard (BSC) with Simons' (1995) levers of control framework and to discuss its role in the various stages of the strategic process. Whereas Kaplan and Norton present the BSC above all as a system of diagnostic control, Simons' (1995) levers of control model leads us to privilege a representation of the BSC in the form of an interactive process. Such an approach presents several theoretical and methodological implica...

  6. A conversation with Drs. Kaplan and Moser about conflicting data, confusing results, and some recent treatment recommendations for the management of hypertension.

    Science.gov (United States)

    Post, Wendy; Moser, Marvin; Kaplan, Norman

    2005-10-01

    Following a hypertension symposium in Baltimore, MD, on June 1, 2005, Dr. Wendy Post from the Johns Hopkins University School of Medicine, Baltimore, MD, had the opportunity to interview two of the outstanding hypertension experts in the United States on several controversial issues in hypertension management. Dr. Norman Kaplan is Clinical Professor of Medicine at the Southwestern Health Science Center in Dallas, TX, and Dr. Marvin Moser is Clinical Professor of Medicine at the Yale University School of Medicine, New Haven, CT. Both have been leaders in the field of hypertension treatment and education for more than 40 years. Dr. Kaplan's book Clinical Hypertension has been a standard textbook since 1973 and is now in its ninth edition. Dr. Marvin Moser was the Senior Medical Consultant to the National High Blood Pressure Education Program from 1974 to 2002 and was Chairman of the first Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure and a member of the six subsequent committees. His book Clinical Management of Hypertension is in its seventh edition. Drs. Moser and Kaplan were corecipients of the 2004 International Society of Hypertension Award for Outstanding Contributions to Hypertension Treatment and Education and have lectured extensively throughout the United States and overseas.

  7. Gastric cancer: texture analysis from multidetector computed tomography as a potential preoperative prognostic biomarker

    Energy Technology Data Exchange (ETDEWEB)

    Giganti, Francesco; Salerno, Annalaura; Marra, Paolo; Esposito, Antonio; Del Maschio, Alessandro; De Cobelli, Francesco [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); San Raffaele Vita-Salute University, Milan (Italy); Antunes, Sofia [San Raffaele Scientific Institute, Centre for Experimental Imaging, Milan (Italy); Ambrosi, Alessandro [San Raffaele Vita-Salute University, Milan (Italy); Nicoletti, Roberto [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); Orsenigo, Elena [San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Chiari, Damiano; Staudacher, Carlo [San Raffaele Vita-Salute University, Milan (Italy); San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Albarello, Luca [San Raffaele Scientific Institute, Pathology Unit, Milan (Italy)

    2017-05-15

    To investigate the association between preoperative texture analysis from multidetector computed tomography (MDCT) and overall survival in patients with gastric cancer. Institutional review board approval and informed consent were obtained. Fifty-six patients with biopsy-proved gastric cancer were examined by MDCT and treated with surgery. Image features from texture analysis were quantified, with and without filters for fine to coarse textures. The association with survival time was assessed using Kaplan-Meier and Cox analysis. The following parameters were significantly associated with a negative prognosis, according to different thresholds: energy [no filter] - Logarithm of relative risk (Log RR): 3.25; p = 0.046; entropy [no filter] (Log RR: 5.96; p = 0.002); entropy [filter 1.5] (Log RR: 3.54; p = 0.027); maximum Hounsfield unit value [filter 1.5] (Log RR: 3.44; p = 0.027); skewness [filter 2] (Log RR: 5.83; p = 0.004); root mean square [filter 1] (Log RR: - 2.66; p = 0.024) and mean absolute deviation [filter 2] (Log RR: - 4.22; p = 0.007). Texture analysis could increase the performance of a multivariate prognostic model for risk stratification in gastric cancer. Further evaluations are warranted to clarify the clinical role of texture analysis from MDCT. (orig.)

  8. Risk analysis for autonomous underwater vehicle operations in extreme environments.

    Science.gov (United States)

    Brito, Mario Paulo; Griffiths, Gwyn; Challenor, Peter

    2010-12-01

    Autonomous underwater vehicles (AUVs) are used increasingly to explore hazardous marine environments. Risk assessment for such complex systems is based on subjective judgment and expert knowledge as much as on hard statistics. Here, we describe the use of a risk management process tailored to AUV operations, the implementation of which requires the elicitation of expert judgment. We conducted a formal judgment elicitation process where eight world experts in AUV design and operation were asked to assign a probability of AUV loss given the emergence of each fault or incident from the vehicle's life history of 63 faults and incidents. After discussing methods of aggregation and analysis, we show how the aggregated risk estimates obtained from the expert judgments were used to create a risk model. To estimate AUV survival with mission distance, we adopted a statistical survival function based on the nonparametric Kaplan-Meier estimator. We present theoretical formulations for the estimator, its variance, and confidence limits. We also present a numerical example where the approach is applied to estimate the probability that the Autosub3 AUV would survive a set of missions under Pine Island Glacier, Antarctica in January-March 2009. © 2010 Society for Risk Analysis.

  9. How to interpret the results of medical time series data analysis: Classical statistical approaches versus dynamic Bayesian network modeling.

    Science.gov (United States)

    Onisko, Agnieszka; Druzdzel, Marek J; Austin, R Marshall

    2016-01-01

    Classical statistics is a well-established approach in the analysis of medical data. While the medical community seems to be familiar with the concept of a statistical analysis and its interpretation, the Bayesian approach, argued by many of its proponents to be superior to the classical frequentist approach, is still not well-recognized in the analysis of medical data. The goal of this study is to encourage data analysts to use the Bayesian approach, such as modeling with graphical probabilistic networks, as an insightful alternative to classical statistical analysis of medical data. This paper offers a comparison of two approaches to analysis of medical time series data: (1) classical statistical approach, such as the Kaplan-Meier estimator and the Cox proportional hazards regression model, and (2) dynamic Bayesian network modeling. Our comparison is based on time series cervical cancer screening data collected at Magee-Womens Hospital, University of Pittsburgh Medical Center over 10 years. The main outcomes of our comparison are cervical cancer risk assessments produced by the three approaches. However, our analysis discusses also several aspects of the comparison, such as modeling assumptions, model building, dealing with incomplete data, individualized risk assessment, results interpretation, and model validation. Our study shows that the Bayesian approach is (1) much more flexible in terms of modeling effort, and (2) it offers an individualized risk assessment, which is more cumbersome for classical statistical approaches.

  10. The prognostic value of time parameters in adjuvant radiotherapy of head and neck cancer. A retrospective analysis of 138 patients

    International Nuclear Information System (INIS)

    Dietl, B.; Schaefer, C.; Koelbl, O.

    2005-01-01

    Purpose: to answer the question, how the parameters waiting time, radiation treatment time and overall treatment time (OTT) influenced the endpoints overall (OS), event-free (EFS) and local recurrence-free survival (LRFS) in patients with locally advanced head-and-neck cancer, who had received postoperative radiotherapy. Patients and methods: 138 patients were included into a retrospective analysis from 10/1993 to 05/2000. Besides the time parameters waiting time, radiation treatment time and OTT, tumor- and therapy-related parameters (T-, N-, R-status, grading, tumor site, surgical technique, and postoperative hemoglobin < 12 g/dl) with potential impact on the endpoints were investigated in the univariate analysis (Kaplan-Meier log-rank test). Individual parameters with a significant impact (p = 0.05) were subjected to a multivariate Cox regression analysis. Results: besides a postoperative hemoglobin value < 12 g/dl, in the univariate analysis an OTT ≥ 105 days negatively influenced all endpoints, as well as a radiation treatment time ≥ 60 days. On multivariate Cox regression analysis, postoperative hemoglobin < 12 g/dl and an OTT ≥ 105 days were identified as independent negative prognostic factors for all endpoints. Conclusion: the waiting time should be managed according to the ASARA (as short as reasonably achievable) recommendation, radiation treatment should not be protracted exceeding an overall treatment of 105 days. Generally, time parameters should be routinely included in the standard tumor documentation, thus facilitating further evaluation of these prognostically relevant factors. (orig.)

  11. Age-Related Trends in Hip Arthroscopy: A Large Cross-Sectional Analysis.

    Science.gov (United States)

    Sing, David C; Feeley, Brian T; Tay, Bobby; Vail, Thomas P; Zhang, Alan L

    2015-12-01

    To analyze a large national private payer population in the United States for trends over time in hip arthroscopy by age groups and to determine the rate of conversion to total hip arthroplasty (THA) after hip arthroscopy. We performed a retrospective analysis using the PearlDiver private insurance patient record database from 2007 through 2011. Hip arthroscopy procedures including newly introduced codes such as osteochondroplasty of cam and pincer lesions and labral repair were queried. Hip arthroscopy incidence and conversion rates to THA were stratified by age. Chi-squared analysis was used for statistical comparison. Conversion to THA was evaluated using Kaplan-Meier analysis. From 2007 through 2011, 20,484,172 orthopaedic patients were analyzed. Hip arthroscopy was performed in 8,227 cases (mean annual incidence, 2.7 cases per 10,000 orthopaedic patients). The incidence of hip arthroscopies increased over 250% from 1.6 cases per 10,000 in 2007 to 4.0 cases per 10,000 in 2011 (P arthroscopy, 17% of patients older than 50 required conversion to THA, compared with arthroscopy procedures are increasing in popularity across all age groups, with patients ages 40 to 49 having the highest incidence in this large cross-sectional population, despite a high rate of early conversion to THA within 2 years in patients over 50. IV, cross-sectional study. Copyright © 2015 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  12. Pressure relieving support surfaces (PRESSURE) trial: cost effectiveness analysis.

    Science.gov (United States)

    Iglesias, Cynthia; Nixon, Jane; Cranny, Gillian; Nelson, E Andrea; Hawkins, Kim; Phillips, Angela; Torgerson, David; Mason, Su; Cullum, Nicky

    2006-06-17

    To assess the cost effectiveness of alternating pressure mattresses compared with alternating pressure overlays for the prevention of pressure ulcers in patients admitted to hospital. Cost effectiveness analysis carried out alongside the pressure relieving support surfaces (PRESSURE) trial; a multicentre UK based pragmatic randomised controlled trial. 11 hospitals in six UK NHS trusts. Intention to treat population comprising 1971 participants. Kaplan Meier estimates of restricted mean time to development of pressure ulcers and total costs for treatment in hospital. Alternating pressure mattresses were associated with lower overall costs (283.6 pounds sterling per patient on average, 95% confidence interval--377.59 pounds sterling to 976.79 pounds sterling) mainly due to reduced length of stay in hospital, and greater benefits (a delay in time to ulceration of 10.64 days on average,--24.40 to 3.09). The differences in health benefits and total costs for hospital stay between alternating pressure mattresses and alternating pressure overlays were not statistically significant; however, a cost effectiveness acceptability curve indicated that on average alternating pressure mattresses compared with alternating pressure overlays were associated with an 80% probability of being cost saving. Alternating pressure mattresses for the prevention of pressure ulcers are more likely to be cost effective and are more acceptable to patients than alternating pressure overlays.

  13. Survival analysis of heart failure patients: A case study.

    Directory of Open Access Journals (Sweden)

    Tanvir Ahmad

    Full Text Available This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015. All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.

  14. Survival analysis of heart failure patients: A case study.

    Science.gov (United States)

    Ahmad, Tanvir; Munir, Assia; Bhatti, Sajjad Haider; Aftab, Muhammad; Raza, Muhammad Ali

    2017-01-01

    This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015). All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.

  15. Multivariate analysis of factors influencing the effect of radiosynovectomy

    International Nuclear Information System (INIS)

    Farahati, J.; Schulz, G.; Koerber, C.; Geling, M.; Schmeider, P.; Reiners, Chr.; Wendler, J.; Kenn, W.; Reidemeister, C.

    2002-01-01

    Objective: In this prospective study, the time to remission after radiosynovectomy (RSV) was analyzed and the influence of age, sex, underlying disease, type of joint, and duration of illness on the success rate of RSV was determined. Methods: A total number of 57 patients with rheumatoid arthritis (n = 33) and arthrosis (n = 21) with a total number of 130 treated joints (36 knee, 66 small and 28 medium-size joints) were monitored using visual analogue scales (VAS) from one week before RSV up to four to six months after RSV. The patients had to answer 3 times daily for pain intensity of the treated joint. The time until remission was determined according to the Kaplan-Meier survivorship function. The influence of the prognosis parameters on outcome of RSV was determined by multivariate discriminant analysis. Results: After six months, the probability of pain relief of more than 20% amounted to 78% and was significantly dependent on the age of the patient (p = 0.02) and the duration of illness (p = 0.05), however not on sex (p = 0.17), underlying disease (p = 0.23), and type of joint (p = 0.69). Conclusion: Irrespective of sex, type of joint and underlying disease, a measurable pain relief can be achieved with RSV in 78% of the patients with synovitis, whereby effectiveness is decreasing with increasing age and progress of illness. (orig.) [de

  16. Prognostic and survival analysis of presbyopia: The healthy twin study

    Science.gov (United States)

    Lira, Adiyani; Sung, Joohon

    2015-12-01

    Presbyopia, a vision condition in which the eye loses its flexibility to focus on near objects, is part of ageing process which mostly perceptible in the early or mid 40s. It is well known that age is its major risk factor, while sex, alcohol, poor nutrition, ocular and systemic diseases are known as common risk factors. However, many other variables might influence the prognosis. Therefore in this paper we developed a prognostic model to estimate survival from presbyopia. 1645 participants which part of the Healthy Twin Study, a prospective cohort study that has recruited Korean adult twins and their family members based on a nation-wide registry at public health agencies since 2005, were collected and analyzed by univariate analysis as well as Cox proportional hazard model to reveal the prognostic factors for presbyopia while survival curves were calculated by Kaplan-Meier method. Besides age, sex, diabetes, and myopia; the proposed model shows that education level (especially engineering program) also contribute to the occurrence of presbyopia as well. Generally, at 47 years old, the chance of getting presbyopia becomes higher with the survival probability is less than 50%. Furthermore, our study shows that by stratifying the survival curve, MZ has shorter survival with average onset time about 45.8 compare to DZ and siblings with 47.5 years old. By providing factors that have more effects and mainly associate with presbyopia, we expect that we could help to design an intervention to control or delay its onset time.

  17. Stability of spinal bone metastases in breast cancer after radiotherapy. A retrospective analysis of 157 cases

    Energy Technology Data Exchange (ETDEWEB)

    Schlampp, Ingmar; Rieken, Stefan; Habermehl, Daniel; Foerster, Robert; Debus, Juergen; Rief, Harald [University Hospital of Heidelberg, Department of Radiation Oncology, Heidelberg (Germany); Bruckner, Thomas [University Hospital of Heidelberg, Department of Medical Biometry, Heidelberg (Germany)

    2014-09-15

    This retrospective analysis was performed to evaluate osteolytic bone lesions of breast cancer in the thoracic and lumbar spine after radiotherapy (RT) in terms of stability using a validated scoring system. The stability of 157 osteolytic metastases, treated from January 2000 to January 2012, in 115 patients with breast cancer was evaluated retrospectively using the Taneichi score. Predictive factors for stability were analyzed and survival rates were calculated. Eighty-five (54 %) lesions were classified as unstable prior to RT. After 3 and 6 months, 109 (70 %) and 124 (79 %) lesions, respectively, were classified as stable. Thirty fractures were detected prior to RT, and after RT seven cases (4.5 %) with pathologic fractures were found within 6 months. None of the examined predictive factors showed significant correlation with stability 6 months after RT. After a median follow-up of 16.7 months, Kaplan-Meier estimates revealed an overall survival of 83 % after 5 years. The majority of patients showed an improved or unchanged stability of the involved vertebral bodies after 6 months. The patients showed only minor cancer-related morbidity during follow-up and reached comparably high survival rates. (orig.) [German] Die retrospektive Analyse untersuchte osteolytische Knochenmetastasen von Patienten mit Mammakarzinom der thorakalen und lumbalen Wirbelsaeule nach Radiotherapie (RT) hinsichtlich Stabilitaet anhand eines validierten Scores. Die Stabilitaet von 157 osteolytischen Metastasen bei 115 Patienten mit Brustkrebs, behandelt von Januar 2000 bis Januar 2012, wurde retrospektiv anhand des Taneichi-Scores evaluiert. Prognostische Faktoren bezueglich Stabilitaet und Ueberlebensraten wurden analysiert. Vor RT wurden 85 Laesionen (54 %) als instabil gewertet. Nach 3 und 6 Monaten wurden 109 (70 %) und 124 (79 %) Laesionen als stabil klassifiziert. Vor RT wurden 30 Frakturen gefunden, nach RT zeigten sich 7 weitere (4,5 %) pathologische Frakturen. Kein prognostischer

  18. Restenosis after carotid artery stenting and endarterectomy: a secondary analysis of CREST, a randomised controlled trial.

    Science.gov (United States)

    Lal, Brajesh K; Beach, Kirk W; Roubin, Gary S; Lutsep, Helmi L; Moore, Wesley S; Malas, Mahmoud B; Chiu, David; Gonzales, Nicole R; Burke, J Lee; Rinaldi, Michael; Elmore, James R; Weaver, Fred A; Narins, Craig R; Foster, Malcolm; Hodgson, Kim J; Shepard, Alexander D; Meschia, James F; Bergelin, Robert O; Voeks, Jenifer H; Howard, George; Brott, Thomas G

    2012-09-01

    In the Carotid Revascularization Endarterectomy versus Stenting Trial (CREST), the composite primary endpoint of stroke, myocardial infarction, or death during the periprocedural period or ipsilateral stroke thereafter did not differ between carotid artery stenting and carotid endarterectomy for symptomatic or asymptomatic carotid stenosis. A secondary aim of this randomised trial was to compare the composite endpoint of restenosis or occlusion. Patients with stenosis of the carotid artery who were asymptomatic or had had a transient ischaemic attack, amaurosis fugax, or a minor stroke were eligible for CREST and were enrolled at 117 clinical centres in the USA and Canada between Dec 21, 2000, and July 18, 2008. In this secondary analysis, the main endpoint was a composite of restenosis or occlusion at 2 years. Restenosis and occlusion were assessed by duplex ultrasonography at 1, 6, 12, 24, and 48 months and were defined as a reduction in diameter of the target artery of at least 70%, diagnosed by a peak systolic velocity of at least 3·0 m/s. Studies were done in CREST-certified laboratories and interpreted at the Ultrasound Core Laboratory (University of Washington). The frequency of restenosis was calculated by Kaplan-Meier survival estimates and was compared during a 2-year follow-up period. We used proportional hazards models to assess the association between baseline characteristics and risk of restenosis. Analyses were per protocol. CREST is registered with ClinicalTrials.gov, number NCT00004732. 2191 patients received their assigned treatment within 30 days of randomisation and had eligible ultrasonography (1086 who had carotid artery stenting, 1105 who had carotid endarterectomy). In 2 years, 58 patients who underwent carotid artery stenting (Kaplan-Meier rate 6·0%) and 62 who had carotid endarterectomy (6·3%) had restenosis or occlusion (hazard ratio [HR] 0·90, 95% CI 0·63-1·29; p=0·58). Female sex (1·79, 1·25-2·56), diabetes (2·31, 1·61-3·31

  19. Meritev izkoristka in nastavitev krmilnih parametrov kaplanove turbine z dolgim cevnim sistemom s primerjalno metodo: Measurement of relative turbine efficiency and adjustment of governing parameters on long penstock Kaplan turbine with comparative method:

    OpenAIRE

    Trebše, Andrej J.

    2004-01-01

    The paper deals with efficiency measurement of Kaplan turbine with relative method (index test) and adjustment of operating of runner and guide vane governing system. At certain longer penstocks the looses in conduit at turbineload operation change the net head. On basis of model test on Kaplan turbine and relative turbine efficiency measurement on prototype the turbine governing system was optimized in accordance with comparative method. Prispevek obravnava meritev izkoristka kaplanove tu...

  20. Brachytherapy Improves Biochemical Failure–Free Survival in Low- and Intermediate-Risk Prostate Cancer Compared With Conventionally Fractionated External Beam Radiation Therapy: A Propensity Score Matched Analysis

    International Nuclear Information System (INIS)

    Smith, Graham D.; Pickles, Tom; Crook, Juanita; Martin, Andre-Guy; Vigneault, Eric; Cury, Fabio L.; Morris, Jim; Catton, Charles; Lukka, Himu; Warner, Andrew; Yang, Ying; Rodrigues, George

    2015-01-01

    Purpose: To compare, in a retrospective study, biochemical failure-free survival (bFFS) and overall survival (OS) in low-risk and intermediate-risk prostate cancer patients who received brachytherapy (BT) (either low-dose-rate brachytherapy [LDR-BT] or high-dose-rate brachytherapy with external beam radiation therapy [HDR-BT+EBRT]) versus external beam radiation therapy (EBRT) alone. Methods and Materials: Patient data were obtained from the ProCaRS database, which contains 7974 prostate cancer patients treated with primary radiation therapy at four Canadian cancer institutions from 1994 to 2010. Propensity score matching was used to obtain the following 3 matched cohorts with balanced baseline prognostic factors: (1) low-risk LDR-BT versus EBRT; (2) intermediate-risk LDR-BT versus EBRT; and (3) intermediate-risk HDR-BT+EBRT versus EBRT. Kaplan-Meier survival analysis was performed to compare differences in bFFS (primary endpoint) and OS in the 3 matched groups. Results: Propensity score matching created acceptable balance in the baseline prognostic factors in all matches. Final matches included 2 1:1 matches in the intermediate-risk cohorts, LDR-BT versus EBRT (total n=254) and HDR-BT+EBRT versus EBRT (total n=388), and one 4:1 match in the low-risk cohort (LDR-BT:EBRT, total n=400). Median follow-up ranged from 2.7 to 7.3 years for the 3 matched cohorts. Kaplan-Meier survival analysis showed that all BT treatment options were associated with statistically significant improvements in bFFS when compared with EBRT in all cohorts (intermediate-risk EBRT vs LDR-BT hazard ratio [HR] 4.58, P=.001; intermediate-risk EBRT vs HDR-BT+EBRT HR 2.08, P=.007; low-risk EBRT vs LDR-BT HR 2.90, P=.004). No significant difference in OS was found in all comparisons (intermediate-risk EBRT vs LDR-BT HR 1.27, P=.687; intermediate-risk EBRT vs HDR-BT+EBRT HR 1.55, P=.470; low-risk LDR-BT vs EBRT HR 1.41, P=.500). Conclusions: Propensity score matched analysis showed that BT options led

  1. Primary Squamous Cell Carcinoma of the Thyroid: A Population-Based Analysis.

    Science.gov (United States)

    Au, Joshua K; Alonso, Jose; Kuan, Edward C; Arshi, Armin; St John, Maie A

    2017-07-01

    Objectives To analyze the epidemiology and describe the prognostic indicators of patients with primary squamous cell carcinoma of the thyroid. Study Design and Setting Retrospective cohort study based on a national database. Methods The US National Cancer Institute's SEER registry (Surveillance, Epidemiology, and End Results) was reviewed for patients with primary squamous cell carcinoma of the thyroid from 1973 to 2012. Study variables included age, sex, race, tumor size, tumor grade, regional and distant metastases, and treatment modality. Survival measures included overall survival (OS) and disease-specific survival (DSS). Results A total of 199 cases of primary squamous cell carcinoma of the thyroid were identified. Mean age at diagnosis was 68.1 years; 58.3% were female; and 79.4% were white. Following diagnosis, 46.3% of patients underwent surgery; 55.7%, radiation therapy; and 45.8%, surgery with radiation therapy. Kaplan-Meier analysis demonstrated OS and DSS of 16% and 21% at 5 years, respectively. Median survival after diagnosis was 9.1 months. Multivariate Cox regression analysis showed that predictors of OS and DSS included age ( P Squamous cell carcinoma of the thyroid is a rare malignancy with a very poor prognosis. Surgical resection confers an overall survival benefit. Age, tumor grade, and tumor size are predictors of OS and DSS.

  2. Survival Analysis of Factors Influencing Cyclic Fatigue of Nickel-Titanium Endodontic Instruments

    Directory of Open Access Journals (Sweden)

    Eva Fišerová

    2015-01-01

    Full Text Available Objective. The aim of this study was to validate a survival analysis assessing the effect of type of rotary system, canal curvature, and instrument size on cyclic resistance. Materials and Methods. Cyclic fatigue testing was carried out in stainless steel artificial canals with radii of curvature of 3 or 5 mm and the angle of curvature of 60 degrees. All the instruments were new and 25 mm in working length, and ISO colour coding indicated the instrument size (yellow for size 20; red for size 25. Wizard Navigator instruments, Mtwo instruments, ProTaper instruments, and Revo-S instruments were passively rotated at 250 rotations per minute, and the time fracture was being recorded. Subsequently, fractographic analysis of broken tips was performed by scanning electron microscope. The data were then analysed by the Kaplan-Meier estimator of the survival function, the Cox proportional hazards model, the Wald test for regression covariates, and the Wald test for significance of regression model. Conclusion. The lifespan registered for the tested instruments was Mtwo > Wizard Navigator > Revo-S > ProTaper; 5 mm radius > 3 mm radius; and yellow > red in ISO colour coding system.

  3. Factors Affecting Adjuvant Therapy in Stage III Pancreatic Cancer—Analysis of the National Cancer Database

    Directory of Open Access Journals (Sweden)

    Mridula Krishnan

    2017-08-01

    Full Text Available Background: Adjuvant therapy after curative resection is associated with survival benefit in stage III pancreatic cancer. We analyzed the factors affecting the outcome of adjuvant therapy in stage III pancreatic cancer and compared overall survival with different modalities of adjuvant treatment. Methods: This is a retrospective study of patients with stage III pancreatic cancer listed in the National Cancer Database (NCDB who were diagnosed between 2004 and 2012. Patients were stratified based on adjuvant therapy they received. Unadjusted Kaplan-Meier and multivariable Cox regression analysis were performed. Results: We analyzed a cohort included 1731 patients who were recipients of adjuvant therapy for stage III pancreatic cancer within the limits of our database. Patients who received adjuvant chemoradiation had the longest postdiagnosis survival time, followed by patients who received adjuvant chemotherapy, and finally patients who received no adjuvant therapy. On multivariate analysis, advancing age and patients with Medicaid had worse survival, whereas Spanish origin and lower Charlson comorbidity score had better survival. Conclusions: Our study is the largest trial using the NCDB addressing the effects of adjuvant therapy specifically in stage III pancreatic cancer. Within the limits of our study, survival benefit with adjuvant therapy was more apparent with longer duration from date of diagnosis.

  4. Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis

    Directory of Open Access Journals (Sweden)

    Amal Saki Malehi

    2016-01-01

    Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.

  5. Treatment of primary parotid non-Hodgkin's lymphoma: an analysis of 29 patients

    International Nuclear Information System (INIS)

    Gu Wendong; Feng Yan

    2003-01-01

    Objective: To analyze the clinical characteristics, treatment and prognosis of primary parotid non-Hodgkin's lymphoma. Methods: From March 1988 to February 2001, twenty-nine patients with primary parotid non-Hodgkin's lymphoma treated in our hospital were retrospectively analyzed. The data were analyzed according to the following factors: sex, age, stage, pathologic classification, chemotherapy given or not, cycles of chemotherapy, radiotherapy given or not, and the dose at the parotid. Kaplan-Meier method and Log-rank method were used in the statistic analysis. Results: The overall 5-year and 10-year survival rates were 73.3% and 51.0%. Stage and pathologic classification were prognostic factors in our statistic analysis. The 5-year survival rates were 81.6% and 25.0% for early stage (I E + II E) and advanced stage (III E + IV E) patients, with the difference significant (P<0.01). The 5-year survival rate for patients with the pathologic classification of mucosa associated lymphoid tissue (MALT) was 100% as compared to 42.2% for patients with diffused large B cell lymphoma, with the difference also significant (P<0.05). Conclusions: The prognosis of primary parotid non-Hodgkin's lymphoma is satisfactory. Surgery should only be used as a diagnostic method. Radiotherapy should be the first choice for patients with MALT lymphoma and stage I E and II E follicular lymphoma, but comprehensive treatment including chemotherapy is necessary to the diffuse large B cell lymphoma

  6. Natural history definition and a suggested clinical approach to Buerger's disease: a case-control study with survival analysis.

    Science.gov (United States)

    Fazeli, Bahare; Ravari, Hassan; Assadi, Reza

    2012-08-01

    The aim of this study was first to describe the natural history of Buerger's disease (BD) and then to discuss a clinical approach to this disease based on multivariate analysis. One hundred eight patients who corresponded with Shionoya's criteria were selected from 2000 to 2007 for this study. Major amputation was considered the ultimate adverse event. Survival analyses were performed by Kaplan-Meier curves. Independent variables including gender, duration of smoking, number of cigarettes smoked per day, minor amputation events and type of treatments, were determined by multivariate Cox regression analysis. The recorded data demonstrated that BD may present in four forms, including relapsing-remitting (75%), secondary progressive (4.6%), primary progressive (14.2%) and benign BD (6.2%). Most of the amputations occurred due to relapses within the six years after diagnosis of BD. In multivariate analysis, duration of smoking of more than 20 years had a significant relationship with further major amputation among patients with BD. Smoking cessation programs with experienced psychotherapists are strongly recommended for those areas in which Buerger's disease is common. Patients who have smoked for more than 20 years should be encouraged to quit smoking, but should also be recommended for more advanced treatment for limb salvage.

  7. A New Treatment Paradigm: Neoadjuvant Radiosurgery Before Surgical Resection of Brain Metastases With Analysis of Local Tumor Recurrence

    International Nuclear Information System (INIS)

    Asher, Anthony L.; Burri, Stuart H.; Wiggins, Walter F.; Kelly, Renee P.; Boltes, Margaret O.; Mehrlich, Melissa; Norton, H. James; Fraser, Robert W.

    2014-01-01

    Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong

  8. A new treatment paradigm: neoadjuvant radiosurgery before surgical resection of brain metastases with analysis of local tumor recurrence.

    Science.gov (United States)

    Asher, Anthony L; Burri, Stuart H; Wiggins, Walter F; Kelly, Renee P; Boltes, Margaret O; Mehrlich, Melissa; Norton, H James; Fraser, Robert W

    2014-03-15

    Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong majority of patients were able to avoid WBRT. NaSRS merits

  9. A New Treatment Paradigm: Neoadjuvant Radiosurgery Before Surgical Resection of Brain Metastases With Analysis of Local Tumor Recurrence

    Energy Technology Data Exchange (ETDEWEB)

    Asher, Anthony L., E-mail: asher@cnsa.com [Department of Neurosurgery, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Burri, Stuart H. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Wiggins, Walter F. [Wake Forest School of Medicine MD/PhD Program, Winston-Salem, North Carolina (United States); Kelly, Renee P. [Brain Tumor Fund for the Carolinas, Charlotte, North Carolina (United States); Boltes, Margaret O.; Mehrlich, Melissa [Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Norton, H. James [Department of Biostatistics, Carolinas Medical Center, Charlotte, North Carolina (United States); Fraser, Robert W. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States)

    2014-03-15

    Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong

  10. THE EMISSION, LIFETIMES, AND FORMATION THRESHOLD OF THE VEGARD–KAPLAN TRANSITION OF SOLID NITROGEN EXPOSED TO FAR-ULTRAVIOLET RADIATION

    International Nuclear Information System (INIS)

    Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming

    2016-01-01

    Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.

  11. THE EMISSION, LIFETIMES, AND FORMATION THRESHOLD OF THE VEGARD–KAPLAN TRANSITION OF SOLID NITROGEN EXPOSED TO FAR-ULTRAVIOLET RADIATION

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming, E-mail: bmcheng@nsrrc.org.tw [National Synchrotron Radiation Research Center, No. 101, Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China)

    2016-11-20

    Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.

  12. The Emission, Lifetimes, and Formation Threshold of the Vegard-Kaplan Transition of Solid Nitrogen Exposed to Far-ultraviolet Radiation

    Science.gov (United States)

    Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming

    2016-11-01

    Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard-Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200-440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ˜ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.

  13. Outcomes analysis in 100 liver transplantation patients.

    Science.gov (United States)

    Geevarghese, S K; Bradley, A E; Wright, J K; Chapman, W C; Feurer, I; Payne, J L; Hunter, E B; Pinson, C W

    1998-05-01

    There is an increasing demand for outcomes analysis, including quality of life and financial analysis, following medical interventions and surgical procedures. We analyzed outcomes for 100 consecutive patients undergoing liver transplantation during a period of case management revision. Patient survival was calculated by Kaplan-Meier actuarial methods. The Karnofsky performance status was objectively assessed for surviving patients up to 6 years after transplantation and was evaluated by repeated measures analysis of variance and covariance. Subjective evaluation of quality of life over time was obtained using the Psychosocial Adjustment to Illness Scale. The correlations between time and scale were calculated. Financial data were accumulated from billing records. Six-month, 1-year, 2-year, and 3- through 5-year survival was 86%, 84%, 83%, and 78%, respectively. Karnofsky performance status confirmed poor functional status preoperatively with a mean of 53 +/- 2, but significantly improving to 72 +/- 2 at 3 months, 80 +/- 2 at 6 months, 90 +/- 1 at 1 year, 92 +/- 1 at 2 years, 94 +/- 1 at 3 years, 96 +/- 1 at 4 years, and 97 +/- 1 at 5 years (P <0.001). Psychosocial Adjustment to Illness Scale scores demonstrated significant improvement following transplantation overall (r = -0.33), improving most in sexual relationships (r = -0.41), and domestic environment (r = -0.35; P <0.001). Median length of stay for the first half of the patients was 19 days declining to 11 days for the second half. Median hospital charges declined from $105,000 to $90,000. Quality of life parameters assessed both by care givers (Karnofsky) and by patients (Psychosocial Adjustment to Illness Scale) improved dramatically following transplantation and over time, demonstrating that liver transplantation effectively restores a good quality of life. Outcomes can be improved while reducing length of stay and charges through modifications in case management.

  14. Impact of posterior rhabdosphincter reconstruction during robot-assisted radical prostatectomy: retrospective analysis of time to continence.

    Science.gov (United States)

    Woo, Jason R; Shikanov, Sergey; Zorn, Kevin C; Shalhav, Arieh L; Zagaja, Gregory P

    2009-12-01

    Posterior rhabdosphincter (PR) reconstruction during robot-assisted radical prostatectomy (RARP) was introduced in an attempt to improve postoperative continence. In the present study, we evaluate time to achieve continence in patients who are undergoing RARP with and without PR reconstruction. A prospective RARP database was searched for most recent cases that were accomplished with PR reconstruction (group 1, n = 69) or with standard technique (group 2, n = 63). We performed the analysis applying two definitions of continence: 0 pads per day or 0-1 security pad per day. Patients were evaluated by telephone interview. Statistical analysis was carried out using the Kaplan-Meier method and log-rank test. With PR reconstruction, continence was improved when defined as 0-1 security pad per day (median time of 90 vs 150 days; P = 0.01). This difference did not achieve statistical significance when continence was defined as 0 pads per day (P = 0.12). A statistically significant improvement in continence rate and time to achieve continence is seen in patients who are undergoing PR reconstruction during RARP, with continence defined as 0-1 security/safety pad per day. A larger, prospective and randomized study is needed to better understand the impact of this technique on postoperative continence.

  15. Association of phase angle on bioelectrical impedance analysis and dialysis frequency with survival of chronic hemodialysis patients

    Science.gov (United States)

    Muzasti, R. A.; Lubis, H. R.

    2018-03-01

    Phase angle, a parameter by Bioelectrical Impedance Analysis, can detect body composition changes, so it can be used as a prognostic indicator in some chronic conditions. This study was for determining the relationship between PhA and hemodiálisis frequency with the survival of chronic hemodiálisis patients. This longitudinal retrospective study involved 173 chronic hemodiálisis patients at Rasyida Renal Hospital. The Kaplan-Meier method is used to determine the survival. Cox proportional hazard analysis is used to determine which variables significantly increase mortality. During the study period, 89 patients underwent hemodiálysis 3x a week (4 hours/session), and 84 patients underwent HD 2x a week (5 hours/session). Demographic and clinical characteristics in both groups were similar. There was no difference in PhA value in groups of 3x a week and group 2x a week (4.02 ± 1.13 vs 4.25 ± 1.12). Patients with twice a week hemodiálisis had a shorter survival than the 3x week group (35.14 ± 2.76 vs 38.62 ± 3.03) although it was not statistically significant (p = 0.126).

  16. The surgical treatment of failure in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma: an analysis of 83 patients

    International Nuclear Information System (INIS)

    Gu Wendong; Ji Qinghai; Lu Xueguan; Feng Yan

    2003-01-01

    Objective: To analyze the results of neck dissection in patients who failed in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma. Methods: Eighty-three patients who received neck dissection due to lymph node persistence or recurrence after definitive radiotherapy were analyzed retrospectively according to the following relevant factors: age, sex, the interval between completion of radiotherapy and surgery, rN stage, postoperative radiotherapy given or not, the adjacent tissues involved or not and the number of positive nodes. Kaplan-Meier method, Log-rank method and Cox method were used in the statistical analysis. Results: The 1-, 3- and 5-year overall survival rates were 80.7%, 47.1% and 34.9%. The interval between completion of radiotherapy and surgery, postoperative radiotherapy given or not, the adjacent tissues involved or not were significantly prognostic factors in statistic analysis. Conclusions: Neck dissection can be applied in the management of cervical lymph node failure in nasopharyngeal carcinoma after radiotherapy. Postoperative radiotherapy should be considered in patients with capsular invasion and/or adjacent tissue involvement

  17. Tumour heterogeneity in non-small cell lung carcinoma assessed by CT texture analysis: a potential marker of survival

    International Nuclear Information System (INIS)

    Ganeshan, Balaji; Miles, Ken; Panayiotou, Elleny; Burnand, Kate; Dizdarevic, Sabina

    2012-01-01

    To establish the potential for tumour heterogeneity in non-small cell lung cancer (NSCLC) as assessed by CT texture analysis (CTTA) to provide an independent marker of survival for patients with NSCLC. Tumour heterogeneity was assessed by CTTA of unenhanced images of primary pulmonary lesions from 54 patients undergoing 18 F-fluorodeoxyglucose (FDG) PET-CT for staging of NSCLC. CTTA comprised image filtration to extract fine, medium and coarse features with quantification of the distribution of pixel values (uniformity) within the filtered images. Receiver operating characteristics identified thresholds for PET and CTTA parameters that were related to patient survival using Kaplan-Meier analysis. The median (range) survival was 29.5 (1-38) months. 24, 10, 14 and 6 patients had tumour stages I, II, III and IV respectively. PET stage and tumour heterogeneity assessed by CTTA were significant independent predictors of survival (PET stage: Odds ratio 3.85, 95% confidence limits 0.9-8.09, P = 0.002; CTTA: Odds ratio 56.4, 95% confidence limits 4.79-666, p = 0.001). SUV was not a significantly associated with survival. Assessment of tumour heterogeneity by CTTA of non-contrast enhanced images has the potential for to provide a novel, independent predictor of survival for patients with NSCLC. (orig.)

  18. Chondrosarcoma of the Osseous Spine: An Analysis of Epidemiology, Patient Outcomes, and Prognostic Factors Using the SEER Registry From 1973 to 2012.

    Science.gov (United States)

    Arshi, Armin; Sharim, Justin; Park, Don Y; Park, Howard Y; Bernthal, Nicholas M; Yazdanshenas, Hamed; Shamie, Arya N

    2017-05-01

    Retrospective analysis. To determine the epidemiology and prognostic indicators in patients with chondrosarcoma of the osseous spine. Chondrosarcoma of the spine is rare, with limited data on its epidemiology, clinicopathologic features, and treatment outcomes. Therapy centers on complete en bloc resection with radiotherapy reserved for subtotal resection or advanced disease. The Surveillance, Epidemiology, and End Results Registry was queried for patients with chondrosarcoma of the osseous spine from 1973 to 2012. Study variables included age, sex, race, year of diagnosis, size, grade, extent of disease, and treatment modality. The search identified 973 cases of spinal chondrosarcoma. Mean age at diagnosis was 51.6 years, and 627% of patients were males. Surgical resection and radiotherapy were performed in 75.2% and 21.3% of cases, respectively. Kaplan-Meier analysis demonstrated overall survival (OS) and disease-specific survival (DSS) of 53% and 64%, respectively, at 5 years. Multivariate Cox regression analysis showed that age (OS, P chondrosarcoma of the spine independent of extent of disease. Radiotherapy improves survival in patients with metastatic disease and worsens outcomes in patients with confined and locally invasive disease. 4.

  19. Clinical outcome after pulmonary metastasectomy from primary hepatocellular carcinoma: Analysis of prognostic factors

    Science.gov (United States)

    Kwon, Jong-Bum; Park, Khun; Kim, Young-Du; Seo, Jong-Hee; Moon, Seok-Whan; Cho, Deog-Gon; Kim, Yong-Whan; Kim, Dong-Goo; Yoon, Seung-Kew; Lim, Hyeon-Woo

    2008-01-01

    AIM: To review the surgical outcomes in terms of the surgical indications and relevant prognostic factors. METHODS: Sixteen patients underwent therapeutic lung surgery between March 1999 and May 2006. The observation period was terminated on May 31, 2007. The surgical outcomes and the clinicopathological factors were compared. RESULTS: There was no mortality or major morbidity encountered in this study. The mean follow-up period after metastasectomy was 26.7 ± 28.2 (range: 1-99 mo), and the median survival time was 20 mo. The 1- and 5-year survival rates were 56% and 26%, respectively. At the end of the follow-up, 1 patient died from hepatic failure without recurrence, 6 died from hepatic failure with a recurrent hepatocellular carcinoma (HCC), and 4 died from recurrent HCC with cachexia. Among several clinical factors, Kaplan-Meier analysis revealed that liver transplantation as a treatment for the primary lesion, grade of cell differentiation, and negative evidence HBV infection were independent predictive factors. On Cox’s proportional hazard model, there were no significant factors affecting survival after pulmonary metastasectomy in patients with HCC. CONCLUSION: A metastasectomy should be performed before other treatments in selected patients. Although not significant, patients with liver transplantation of a primary HCC survived longer. Liver transplantation might be the most beneficial modality that can offer patients better survival. A multi-institutional and collaborative study would be needed for identifying clinical prognostic factors predicting survival in patients with HCC and lung metastasis. PMID:18837090

  20. Total knee arthroplasty with an oxidised zirconium femoral component: ten-year survivorship analysis.

    Science.gov (United States)

    Ahmed, I; Salmon, L J; Waller, A; Watanabe, H; Roe, J P; Pinczewski, L A

    2016-01-01

    Oxidised zirconium was introduced as a material for femoral components in total knee arthroplasty (TKA) as an attempt to reduce polyethylene wear. However, the long-term survival of this component is not known. We performed a retrospective review of a prospectively collected database to assess the ten year survival and clinical and radiological outcomes of an oxidised zirconium total knee arthroplasty with the Genesis II prosthesis. The Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), Knee Injury and Osteoarthritis Outcome Score (KOOS) and a patient satisfaction scale were used to assess outcome. A total of 303 consecutive TKAs were performed in 278 patients with a mean age of 68 years (45 to 89). The rate of survival ten years post-operatively as assessed using Kaplan-Meier analysis was 97% (95% confidence interval 94 to 99) with revision for any reason as the endpoint. There were no revisions for loosening, osteolysis or failure of the implant. There was a significant improvement in all components of the WOMAC score at final follow-up (p zirconium TKA gives comparable rates of survival with other implants and excellent functional outcomes ten years post-operatively. Total knee arthroplasty with an oxidised zirconium femoral component gives comparable long-term rates of survival and functional outcomes with conventional implants. ©2016 The British Editorial Society of Bone & Joint Surgery.

  1. Uterine Carcinosarcoma Confined to the Pelvis: A Retrospective Review and Outcome Analysis

    International Nuclear Information System (INIS)

    Li, H.; TenNapel, M.J.; Bhatia, S.K.; Ahmed, A.; Lin, L.; Jacobson, G.

    2014-01-01

    Objective. We compared the treatments of uterine carcinosarcoma at our institution and evaluated their impact on survival. Methods. A retrospective analysis was performed on 60 eligible patients with carcinosarcoma limited to the pelvis. Subjects were divided into four categories: surgery, surgery plus chemotherapy, surgery plus radiation therapy, and a combination of surgery, chemotherapy, and RT. The most commonly used chemotherapy was cisplatin and/or carboplatin and taxol. Radiotherapy included external beam radiation therapy (EBRT) alone or with high dose rate (HDR) brachytherapy or HDR brachytherapy alone. Survival probability data were computed using the Kaplan-Meier method. The differences between groups were compared using the log-rank test. Results. The combination of surgery and radiation therapy with or without chemotherapy is seen to improve overall survival (OS) compared to surgery alone (Ρ =0.044 and Ρ =0.028 resp.). Brachytherapy involving three HDR vaginal cylinder fractions shows an equally effective reduction in local recurrence compared to EBRT. Conclusion. Our study of a relatively large number of carcinosarcoma patients suggests that adjuvant radiation therapy improves OS compared to surgery alone. Brachytherapy with 3 HDR vaginal cylinder fractions is preferred because of its time-saving, better tolerance, low toxicity and equivalent OS, and local control compared to EBRT.

  2. Patterns of Occurrence and Outcomes of Contralateral Breast Cancer: Analysis of SEER Data

    Directory of Open Access Journals (Sweden)

    Zhenchong Xiong

    2018-05-01

    Full Text Available Population-based estimates are lacking for the temporal trends in the contralateral breast cancer (CBC risk for patients with breast cancer (BC. Data for BC patients diagnosed with CBC were collected from the Surveillance, Epidemiology, and End Results database. CBC incidence was calculated using the Kaplan-Meier method and the temporal trend in CBC incidence was assessed using joinpoint regression. Survival analysis was calculated using propensity scoring (PS and multivariate Cox regression with a competing risk model. We found that 10,944 of 212,630 patients with early-stage BC were subsequently diagnosed with secondary BC in the contralateral breast. The 5-, 10-, 15-, and 20-year cumulative CBC incidences were 1.9, 4.6, 7.6, and 10.5%, respectively. Being younger (<40 years, black, hormone receptor-negative, and having undergone radiotherapy were correlated with a high risk of CBC occurrence. CBC incidence increased continuously in the first 11 years after the initial cancer diagnosis, and the upward trend slowed from years 11 to 21, and tended to decline from years 21 to 24. CBC diagnosis was significantly and negatively associated with survival. We reported population-based estimates of the CBC occurrence pattern and risk factors. Patients are at high risk of developing CBC in the first 21 years after the initial BC diagnosis.

  3. Analysis of a novel protocol of combined induction chemotherapy and concurrent chemoradiation in unresected non-small-cell lung cancer: a ten-year experience with vinblastine, Cisplatin, and radiation therapy.

    Science.gov (United States)

    Waters, Eugenie; Dingle, Brian; Rodrigues, George; Vincent, Mark; Ash, Robert; Dar, Rashid; Inculet, Richard; Kocha, Walter; Malthaner, Richard; Sanatani, Michael; Stitt, Larry; Yaremko, Brian; Younus, Jawaid; Yu, Edward

    2010-07-01

    The London Regional Cancer Program (LRCP) uses a unique schedule of induction plus concurrent chemoradiation, termed VCRT (vinblastine, cisplatin, and radiation therapy), for the treatment of a subset of unresectable stage IIIA and IIIB non-small-cell lung cancer (NSCLC). This analysis was conducted to better understand the outcomes in VCRT-treated patients. We report a retrospective analysis of a large cohort of patients who underwent VCRT at the LRCP over a 10-year period, from 1996 to 2006. The analysis focused on OS, toxicities, and the outcomes from completion surgery in a small subset of patients. A total of 294 patients were included and 5-year OS, determined using Kaplan-Meier methodology, was 19.8% with a MST of 18.2 months. Reported grade 3-4 toxicities included neutropenia (39%), anemia (10%), pneumonitis (1%), and esophagitis (3%). Significant differences in survival between groups of patients were demonstrated with log-rank tests for completion surgery, use of radiation therapy, and cisplatin dose. Similarly, Univariate Cox regression showed that completion surgery, use of radiation therapy, cisplatin dose, and vinblastine dose were associated with increased survival. This retrospective analysis of a large cohort of patients reveals an OS for VCRT comparable to that reported in the literature for other current combined chemoradiation protocols. The success of this protocol seems to be dose dependent and the outcomes in those who underwent completion surgery suggests that pathologic complete remission is possible for IIIA and IIIB NSCLC.

  4. Multivariate analysis of factors influencing the effect of radiosynovectomy; Multivariate Analyse der Einflussfaktoren auf die Wirkung der Radiosynoviorthese bei entzuendlichen Gelenkerkrankungen

    Energy Technology Data Exchange (ETDEWEB)

    Farahati, J.; Schulz, G.; Koerber, C.; Geling, M.; Schmeider, P.; Reiners, Chr. [Wuerzburg Univ. (Germany). Klinik fuer Nuklearmedizin; Wendler, J. [Erlangen-Nuernberg Univ. (Germany). Klinik fuer Innere Medizin III; Kenn, W. [Wuerzburg Univ. (Germany). Inst. fuer Roentgendiagnostik; Reidemeister, C. [Wuerzburg Univ. (Germany). Klinik fuer Innere Medizin

    2002-04-01

    Objective: In this prospective study, the time to remission after radiosynovectomy (RSV) was analyzed and the influence of age, sex, underlying disease, type of joint, and duration of illness on the success rate of RSV was determined. Methods: A total number of 57 patients with rheumatoid arthritis (n = 33) and arthrosis (n = 21) with a total number of 130 treated joints (36 knee, 66 small and 28 medium-size joints) were monitored using visual analogue scales (VAS) from one week before RSV up to four to six months after RSV. The patients had to answer 3 times daily for pain intensity of the treated joint. The time until remission was determined according to the Kaplan-Meier survivorship function. The influence of the prognosis parameters on outcome of RSV was determined by multivariate discriminant analysis. Results: After six months, the probability of pain relief of more than 20% amounted to 78% and was significantly dependent on the age of the patient (p = 0.02) and the duration of illness (p = 0.05), however not on sex (p = 0.17), underlying disease (p = 0.23), and type of joint (p = 0.69). Conclusion: Irrespective of sex, type of joint and underlying disease, a measurable pain relief can be achieved with RSV in 78% of the patients with synovitis, whereby effectiveness is decreasing with increasing age and progress of illness. (orig.) [German] Ziel: In dieser prospektiven Studie wurde die Zeit bis zur Remission nach einer Radiosynoviorthese (RSO) untersucht. Ebenso wurde der Einfluss von Alter, Geschlecht, Grunderkrankung, Gelenktyp und Erkrankungsdauer auf die Erfolgsrate der RSO ermittelt. Methodik: Bei insgesamt 57 Patienten mit rheumatoider Arthritis (n = 33) und Arthritis bei aktivierter Arthrose (n = 24) wurden 130 Gelenke (36 Kniegelenke, 66 kleine und 28 mittelgrosse Gelenke) behandelt. Die Patienten wurden unter Verwendung so genannter visueller Analogskalen eine Woche vor RSO und vier bis sechs Monate danach 3-mal taeglich zur Schmerzintensitaet des

  5. Prognostic and survival analysis of 837 Chinese colorectal cancer patients.

    Science.gov (United States)

    Yuan, Ying; Li, Mo-Dan; Hu, Han-Guang; Dong, Cai-Xia; Chen, Jia-Qi; Li, Xiao-Fen; Li, Jing-Jing; Shen, Hong

    2013-05-07

    To develop a prognostic model to predict survival of patients with colorectal cancer (CRC). Survival data of 837 CRC patients undergoing surgery between 1996 and 2006 were collected and analyzed by univariate analysis and Cox proportional hazard regression model to reveal the prognostic factors for CRC. All data were recorded using a standard data form and analyzed using SPSS version 18.0 (SPSS, Chicago, IL, United States). Survival curves were calculated by the Kaplan-Meier method. The log rank test was used to assess differences in survival. Univariate hazard ratios and significant and independent predictors of disease-specific survival and were identified by Cox proportional hazard analysis. The stepwise procedure was set to a threshold of 0.05. Statistical significance was defined as P analysis suggested age, preoperative obstruction, serum carcinoembryonic antigen level at diagnosis, status of resection, tumor size, histological grade, pathological type, lymphovascular invasion, invasion of adjacent organs, and tumor node metastasis (TNM) staging were positive prognostic factors (P analysis showed a significant statistical difference in 3-year survival among these groups: LNR1, 73%; LNR2, 55%; and LNR3, 42% (P analysis results showed that histological grade, depth of bowel wall invasion, and number of metastatic lymph nodes were the most important prognostic factors for CRC if we did not consider the interaction of the TNM staging system (P < 0.05). When the TNM staging was taken into account, histological grade lost its statistical significance, while the specific TNM staging system showed a statistically significant difference (P < 0.0001). The overall survival of CRC patients has improved between 1996 and 2006. LNR is a powerful factor for estimating the survival of stage III CRC patients.

  6. Noh, Kaplan, and Sievers reply

    International Nuclear Information System (INIS)

    Noh, T.W.; Kaplan, S.G.; Sievers, A.J.

    1989-01-01

    A reply to the comment for infrared resonance in superconducting LaSrCuO is given. The authors provide direct experimental evidence that the particles studied for the most part single crystals have anisotropic optical properties, the hypothesis and comment do not apply

  7. 2018-09 - Kaplan Companies

    Science.gov (United States)

    EPA is providing notice of a proceeding to assess a Class II civil penalty for alleged violations of the Clean Water Act (Act). EPA is also providing notice of opportunity to comment on the proposed penalty assessment.

  8. Relationship between angina pectoris and outcomes in patients with heart failure and reduced ejection fraction: an analysis of the Controlled Rosuvastatin Multinational Trial in Heart Failure (CORONA).

    Science.gov (United States)

    Badar, Athar A; Perez-Moreno, Ana Cristina; Jhund, Pardeep S; Wong, Chih M; Hawkins, Nathaniel M; Cleland, John G F; van Veldhuisen, Dirk J; Wikstrand, John; Kjekshus, John; Wedel, Hans; Watkins, Stuart; Gardner, Roy S; Petrie, Mark C; McMurray, John J V

    2014-12-21

    Angina pectoris is common in patients with heart failure and reduced ejection fraction (HF-REF) but its relationship with outcomes has not been well defined. This relationship was investigated further in a retrospective analysis of the Controlled Rosuvastatin Multinational Trial in Heart Failure (CORONA). Four thousand, eight hundred and seventy-eight patients were divided into three categories: no history of angina and no chest pain at baseline (Group A; n = 1240), past history of angina but no chest pain at baseline (Group B; n = 1353) and both a history of angina and chest pain at baseline (Group C; n = 2285). Outcomes were examined using Kaplan-Meier and Cox regression survival analysis. Compared with Group A, Group C had a higher risk of non-fatal myocardial infarction or unstable angina (HR: 2.36, 1.54-3.61; P angina are at an increased risk of acute coronary syndrome and HF hospitalization. Whether these patients would benefit from more aggressive medical therapy or percutaneous revascularization is not known and merits further investigation. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

  9. Beyond reliability, multi-state failure analysis of satellite subsystems: A statistical approach

    International Nuclear Information System (INIS)

    Castet, Jean-Francois; Saleh, Joseph H.

    2010-01-01

    Reliability is widely recognized as a critical design attribute for space systems. In recent articles, we conducted nonparametric analyses and Weibull fits of satellite and satellite subsystems reliability for 1584 Earth-orbiting satellites launched between January 1990 and October 2008. In this paper, we extend our investigation of failures of satellites and satellite subsystems beyond the binary concept of reliability to the analysis of their anomalies and multi-state failures. In reliability analysis, the system or subsystem under study is considered to be either in an operational or failed state; multi-state failure analysis introduces 'degraded states' or partial failures, and thus provides more insights through finer resolution into the degradation behavior of an item and its progression towards complete failure. The database used for the statistical analysis in the present work identifies five states for each satellite subsystem: three degraded states, one fully operational state, and one failed state (complete failure). Because our dataset is right-censored, we calculate the nonparametric probability of transitioning between states for each satellite subsystem with the Kaplan-Meier estimator, and we derive confidence intervals for each probability of transitioning between states. We then conduct parametric Weibull fits of these probabilities using the Maximum Likelihood Estimation (MLE) approach. After validating the results, we compare the reliability versus multi-state failure analyses of three satellite subsystems: the thruster/fuel; the telemetry, tracking, and control (TTC); and the gyro/sensor/reaction wheel subsystems. The results are particularly revealing of the insights that can be gleaned from multi-state failure analysis and the deficiencies, or blind spots, of the traditional reliability analysis. In addition to the specific results provided here, which should prove particularly useful to the space industry, this work highlights the importance

  10. New-Onset Diabetes Mellitus in Liver Transplant Recipients With Hepatitis C: Analysis of the National Database.

    Science.gov (United States)

    Li, Z; Sun, F; Hu, Z; Xiang, J; Zhou, J; Yan, S; Wu, J; Zhou, L; Zheng, S

    2016-01-01

    New-onset diabetes mellitus (NODM) after liver transplantation (LT) occurs with increased frequency in recipients with hepatitis C virus (HCV). We compared the incidence and risk factors for NODM in HCV vs non-HCV recipients. Among 24,956 liver recipients, 18,741 without pretransplantation diabetes were identified. NODM-free survival was analyzed using Kaplan-Meier and log-rank tests, and risk factors for NODM were examined using multivariate Cox regression analysis. The overall incidence of NODM was 13.0% at 1 year after LT. At 1, 2, 3, and 5 years after LT, incidence of NODM in HCV recipients was 14.4%, 4.3%, 3.1%, and 3.5%, respectively, compared with 11.9%, 3.5%, 3.2%, and 6.4%, respectively, in non-HCV recipients. HCV recipients had a higher risk of NODM than non-HCV recipients (hazard ratio 1.17 [1.09-1.27], P diabetes mellitus. Risk factors in non-HCV recipients were male recipient, BMI, and recipients with nonalcoholic steatohepatitis diagnosis. HCV recipients have a higher incidence and more risk factors for NODM than non-HCV recipients. Early identification of modifiable risk factors will assist clinical interventions to prevent NODM complications after LT. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Comparative analysis of whole mount processing and systematic sampling of radical prostatectomy specimens: pathological outcomes and risk of biochemical recurrence.

    Science.gov (United States)

    Salem, Shady; Chang, Sam S; Clark, Peter E; Davis, Rodney; Herrell, S Duke; Kordan, Yakup; Wills, Marcia L; Shappell, Scott B; Baumgartner, Roxelyn; Phillips, Sharon; Smith, Joseph A; Cookson, Michael S; Barocas, Daniel A

    2010-10-01

    Whole mount processing is more resource intensive than routine systematic sampling of radical retropubic prostatectomy specimens. We compared whole mount and systematic sampling for detecting pathological outcomes, and compared the prognostic value of pathological findings across pathological methods. We included men (608 whole mount and 525 systematic sampling samples) with no prior treatment who underwent radical retropubic prostatectomy at Vanderbilt University Medical Center between January 2000 and June 2008. We used univariate and multivariate analysis to compare the pathological outcome detection rate between pathological methods. Kaplan-Meier curves and the log rank test were used to compare the prognostic value of pathological findings across pathological methods. There were no significant differences between the whole mount and the systematic sampling groups in detecting extraprostatic extension (25% vs 30%), positive surgical margins (31% vs 31%), pathological Gleason score less than 7 (49% vs 43%), 7 (39% vs 43%) or greater than 7 (12% vs 13%), seminal vesicle invasion (8% vs 10%) or lymph node involvement (3% vs 5%). Tumor volume was higher in the systematic sampling group and whole mount detected more multiple surgical margins (each p systematic sampling yield similar pathological information. Each method stratifies patients into comparable risk groups for biochemical recurrence. Thus, while whole mount is more resource intensive, it does not appear to result in improved detection of clinically important pathological outcomes or prognostication. Copyright © 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  12. Perioperative and long-term outcome of thymectomy for myasthenia gravis: comparison of surgical approaches and prognostic analysis.

    Science.gov (United States)

    Liu, Cheng-wu; Luo, Meng; Mei, Jian-dong; Zhu, Yun-ke; Pu, Qiang; Ma, Lin; Che, Guo-wei; Lin, Yi-dan; Wu, Zhu; Wang, Yun; Kou, Ying-li; Liu, Lun-xu

    2013-01-01

    Thymectomy is an established treatment for myasthenia gravis (MG), and video-assisted thoracoscopic surgery (VATS) thymectomy has become an acceptable surgical procedure. This study aimed to compare the results of VATS thymectomy and open thymectomy and to identify the prognostic factors after thymectomy. The clinical data of 187 consecutive thymectomies performed between July 2000 and December 2009 were retrospectively reviewed; 75 open thymectomies and 112 VATS thymectomies. Clinical efficacy and variables influencing outcome were assessed by Kaplan-Meier survival curves and Cox proportional hazards regression analysis. The operative blood loss in the VATS group was significantly less than that in the open group ((62.14 ± 55.43) ml vs. (137.87 ± 165.25) ml, P CSR) was the end point for evaluation of the treatment results. The overall five-year CSR rate was 57.5%. Two good prognostic factors were identified; preoperative prescription of anticholinesterase alone (P = 0.035) and non-thymomatous MG (P = 0.003). The five-year CSR rate of the ocular type of MG reached a high level of 67.4%. Thymectomy can achieve good long-term CSR in MG, and VATS is an ideal alternative method. High-dose prescription of anticholinesterase and the advanced stage by Myasthenia Gravis Foundation of America (MGFA) classification have higher risks of postoperative crisis. Preoperative prescription of anticholinesterase alone and non-thymomatous MG are good prognostic factors. Thymectomy should also be considered for the ocular type of MG.

  13. Cost-utility analysis of adjuvant goserelin (Zoladex and adjuvant chemotherapy in premenopausal women with breast cancer

    Directory of Open Access Journals (Sweden)

    Cheng Tsui

    2012-01-01

    Full Text Available Abstract Background Increased health care costs have made it incumbent on health-care facilities and physicians to demonstrate both clinical and cost efficacy when recommending treatments. Though studies have examined the cost-effectiveness of adjuvant goserelin with radiotherapy for locally advanced prostate cancer, few have compared the cost-effectiveness of adjuvant goserelin to adjuvant chemotherapy alone in premenopausal breast cancer. Methods In this retrospective study at one hospital, the records of 152 patients with stage Ia to IIIa ER + breast cancer who received goserelin or chemotherapy were reviewed. Survival analysis was assessed by the Kaplan-Meier method. Patients were interviewed to evaluate their quality of life using the European Organization for Research and Treatment Quality of Life questionnaire (EORTC-QLQ-C30, version 4.0, and to obtain the utility value by the standard gamble (SG and visual scale (VS methods. Total medical cost was assessed from the (National Health Insurance NHI payer's perspective. Results Survival at 11 years was significantly better in the groserelin group (P Conclusions Goserelin therapy results in better survival and higher utility-weighted life-years, and is more cost-effective than TC or TEC chemotherapy.

  14. [Analysis of clinicopathologic and survival characteristics in patients with right-or left-sided colon cancer].

    Science.gov (United States)

    Hu, Junjie; Zhou, Zhixiang; Liang, Jianwei; Zhou, Haitao; Wang, Zheng; Zhang, Xingmao; Zeng, Weigen

    2015-07-28

    This study aimed to clarify the clinical and histological parameters, and survival difference between right- and left-sided colon cancer. We retrospectively analyzed the medical records (2006.1-2009.12) of 1 088 consecutive colon cancer patients who received surgery at our hospital. Right- and left-sided colon cancers were compared regarding the clinical and histological parameters. The survival analysis was performed by the Kaplan-Meier method, and the log-rank test was used to determine the statistical significance of differences. Right-sided colon cancer was associated with older age, a more advanced state, and poorly differentiated and undifferentiated adenocarcinoma (25.2% vs 13.2%), mucinous adenocarcinoma (33.5% vs 17.3%) and vascular invasion (9.9% vs 3.9%) were more commonly seen in right-sided colon cancer compared with right-sided colon cancer, and all these differences were statistically significant. Median overall survival was right, 67 months; and left, 68 months. The five-years overall survival of right- and left-sided colon cancer was I/II stage, 91.4% vs 88.6% (P = 0.819); III stage, 66.1% vs 75.4% (P = 0.010); and IV stage, 27.8% vs 38.5% (P = 0.020) respectively. Right- and left-sided colon cancers are significantly different regarding clinical and histological parameters. Right-sided colon cancers in stage III and IV have a worse prognosis.

  15. Experimental Analysis of Residual Stresses in Samples of Austenitic Stainless Steel Welded on Martensitic Stainless Steel Used for Kaplan Blades Repairs

    Directory of Open Access Journals (Sweden)

    Vasile Cojocaru

    2011-01-01

    Full Text Available Residual stresses occur in materials as a result of mechanical processes: welding, machining, grinding etc. If residual stresses reach high values they can accelerate the occurrence of cracks and erosion of material. An experimental research was made in order to study the occurrence of residual stresses in the repaired areas of hydraulic turbine components damaged by cavitation erosion. An austenitic stainless steel was welded in various layer thicknesses on a martensitic stainless steel base. The residual stresses were determined using the hole drilling strain gage method.

  16. Adjuvant treatment for resected rectal cancer: impact of standard and intensified postoperative chemotherapy on disease-free survival in patients undergoing preoperative chemoradiation-a propensity score-matched analysis of an observational database.

    Science.gov (United States)

    Garlipp, Benjamin; Ptok, Henry; Benedix, Frank; Otto, Ronny; Popp, Felix; Ridwelski, Karsten; Gastinger, Ingo; Benckert, Christoph; Lippert, Hans; Bruns, Christiane

    2016-12-01

    Adjuvant chemotherapy for resected rectal cancer is widely used. However, studies on adjuvant treatment following neoadjuvant chemoradiotherapy (CRT) and total mesorectal excision (TME) have yielded conflicting results. Recent studies have focused on adding oxaliplatin to both preoperative and postoperative therapy, making it difficult to assess the impact of adjuvant oxaliplatin alone. This study was aimed at determining the impact of (i) any adjuvant treatment and (ii) oxaliplatin-containing adjuvant treatment on disease-free survival in CRT-pretreated, R0-resected rectal cancer patients. Patients undergoing R0 TME following 5-fluorouracil (5FU)-only-based CRT between January 1, 2008, and December 31, 2010, were selected from a nationwide registry. After propensity score matching (PSM), comparison of disease-free survival (DFS) using Kaplan-Meier analysis and log-rank test was performed in (i) patients receiving no vs. any adjuvant treatment and (ii) patients treated with adjuvant 5FU/capecitabine without vs. with oxaliplatin. Out of 1497 patients, 520 matched pairs were generated for analysis of no vs. any adjuvant treatment. Mean DFS was significantly prolonged with adjuvant treatment (81.8 ± 2.06 vs. 70.1 ± 3.02 months, p rectal cancer patients treated with neoadjuvant CRT and TME surgery under routine conditions, adjuvant chemotherapy significantly improved DFS. No benefit was observed for the addition of oxaliplatin to adjuvant chemotherapy in this setting.

  17. Atypical performance patterns on Delis-Kaplan Executive Functioning System Color-Word Interference Test: Cognitive switching and learning ability in older adults.

    Science.gov (United States)

    Berg, Jody-Lynn; Swan, Natasha M; Banks, Sarah J; Miller, Justin B

    2016-09-01

    Cognitive set shifting requires flexible application of lower level processes. The Delis-Kaplan Executive Functioning System (DKEFS) Color-Word Interference Test (CWIT) is commonly used to clinically assess cognitive set shifting. An atypical pattern of performance has been observed on the CWIT; a subset of individuals perform faster, with equal or fewer errors, on the more difficult inhibition/switching than the inhibition trial. This study seeks to explore the cognitive underpinnings of this atypical pattern. It is hypothesized that atypical patterns on CWIT will be associated with better performance on underlying cognitive measures of attention, working memory, and learning when compared to typical CWIT patterns. Records from 239 clinical referrals (age: M = 68.09 years, SD = 10.62; education: M = 14.87 years, SD = 2.73) seen for a neuropsychological evaluation as part of diagnostic work up in an outpatient dementia and movement disorders clinic were sampled. The standard battery of tests included measures of attention, learning, fluency, executive functioning, and working memory. Analyses of variance (ANOVAs) were conducted to compare the cognitive performance of those with typical versus atypical CWIT patterns. An atypical pattern of performance was confirmed in 23% of our sample. Analyses revealed a significant group difference in acquisition of information on both nonverbal (Brief Visuospatial Memory Test-Revised, BVMT-R total recall), F(1, 213) = 16.61, p < .001, and verbal (Hopkins Verbal Learning Test-Revised, HVLT-R total recall) learning tasks, F(1, 181) = 6.43, p < .01, and semantic fluency (Animal Naming), F(1, 232) = 7.57, p = .006, with the atypical group performing better on each task. Effect sizes were larger for nonverbal (Cohen's d = 0.66) than verbal learning (Cohen's d = 0.47) and semantic fluency (Cohen's d = 0.43). Individuals demonstrating an atypical pattern of performance on the CWIT inhibition/switching trial also demonstrated relative

  18. The impact of caudate lobe resection on margin status and outcomes in patients with hilar cholangiocarcinoma: a multi-institutional analysis from the US Extrahepatic Biliary Malignancy Consortium.

    Science.gov (United States)

    Bhutiani, Neal; Scoggins, Charles R; McMasters, Kelly M; Ethun, Cecilia G; Poultsides, George A; Pawlik, Timothy M; Weber, Sharon M; Schmidt, Carl R; Fields, Ryan C; Idrees, Kamran; Hatzaras, Ioannis; Shen, Perry; Maithel, Shishir K; Martin, Robert C G

    2018-04-01

    The objective of this study was to determine the impact of caudate resection on margin status and outcomes during resection of extrahepatic hilar cholangiocarcinoma. A database of 1,092 patients treated for biliary malignancies at institutions of the Extrahepatic Biliary Malignancy Consortium was queried for individuals undergoing curative-intent resection for extrahepatic hilar cholangiocarcinoma. Patients who did versus did not undergo concomitant caudate resection were compared with regard to demographic, baseline, and tumor characteristics as well as perioperative outcomes. A total of 241 patients underwent resection for a hilar cholangiocarcinoma, of whom 85 underwent caudate resection. Patients undergoing caudate resection were less likely to have a final positive margin (P = .01). Kaplan-Meier curve of overall survival for patients undergoing caudate resection indicated no improvement over patients not undergoing caudate resection (P = .16). On multivariable analysis, caudate resection was not associated with improved overall survival or recurrence-free survival, although lymph node positivity was associated with worse overall survival and recurrence-free survival, and adjuvant chemoradiotherapy was associated with improved overall survival and recurrence-free survival. Caudate resection is associated with a greater likelihood of margin-negative resection in patients with extrahepatic hilar cholangiocarcinoma. Precise preoperative imaging is critical to assess the extent of biliary involvement, so that all degrees of hepatic resections are possible at the time of the initial operation. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Progression of HPV infection to detectable cervical lesions or clearance in adult women: Analysis of the control arm of the VIVIANE study.

    Science.gov (United States)

    Skinner, S Rachel; Wheeler, Cosette M; Romanowski, Barbara; Castellsagué, Xavier; Lazcano-Ponce, Eduardo; Del Rosario-Raymundo, M Rowena; Vallejos, Carlos; Minkina, Galina; Pereira Da Silva, Daniel; McNeil, Shelly; Prilepskaya, Vera; Gogotadze, Irina; Money, Deborah; Garland, Suzanne M; Romanenko, Viktor; Harper, Diane M; Levin, Myron J; Chatterjee, Archana; Geeraerts, Brecht; Struyf, Frank; Dubin, Gary; Bozonnat, Marie-Cécile; Rosillon, Dominique; Baril, Laurence

    2016-05-15

    The control arm of the phase III VIVIANE (Human PapillomaVIrus: Vaccine Immunogenicity ANd Efficacy; NCT00294047) study in women >25 years was studied to assess risk of progression from cervical HPV infection to detectable cervical intraepithelial neoplasia (CIN). The risk of detecting CIN associated with the same HPV type as the reference infection was analysed using Kaplan-Meier and multivariable Cox models. Infections were categorised depending upon persistence as 6-month persistent infection (6MPI) or infection of any duration. The 4-year interim analysis included 2,838 women, of whom 1,073 (37.8%) experienced 2,615 infections of any duration and 708 (24.9%) experienced 1,130 6MPIs. Infection with oncogenic HPV types significantly increased the risk of detecting CIN grade 2 or greater (CIN2+) versus non-oncogenic types. For 6MPI, the highest risk was associated with HPV-33 (hazard ratio [HR]: 31.9 [8.3-122.2, p 25 years in this study was similar to that in women 15-25 years in PATRICIA. © 2015 The Authors and GlaxoSmithKline. International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  20. Can we eliminate neoadjuvant chemoradiotherapy in favor of neoadjuvant multiagent chemotherapy for select stage II/III rectal adenocarcinomas: Analysis of the National Cancer Data base.

    Science.gov (United States)

    Cassidy, Richard J; Liu, Yuan; Patel, Kirtesh; Zhong, Jim; Steuer, Conor E; Kooby, David A; Russell, Maria C; Gillespie, Theresa W; Landry, Jerome C

    2017-03-01

    Stage II and III rectal cancers have been effectively treated with neoadjuvant chemoradiotherapy (NCRT) followed by definitive resection. Advancements in surgical technique and systemic therapy have prompted investigation of neoadjuvant multiagent chemotherapy (NMAC) regimens with the elimination of radiation (RT). The objective of the current study was to investigate factors that predict for the use of NCRT versus NMAC and compare outcomes using the National Cancer Data Base (NCDB) for select stage II and III rectal cancers. In the NCDB, 21,707 patients from 2004 through 2012 with clinical T2N1 (cT2N1), cT3N0, or cT3N1 rectal cancers were identified who had received NCRT or NMAC followed by low anterior resection. Kaplan-Meier analyses, log-rank tests, and Cox-proportional hazards regression analyses were conducted along with propensity score matching analysis to reduce treatment selection bias. The 5-year actuarial overall survival (OS) rate was 75% for patients who received NCRT versus 67.2% for those who received NMAC (P elimination of neoadjuvant RT for select patients with stage II and III rectal adenocarcinoma was associated with worse OS and should not be recommended outside of a clinical trial. Cancer 2017;123:783-93. © 2016 American Cancer Society. © 2016 American Cancer Society.

  1. EpiHosp: A web-based visualization tool enabling the exploratory analysis of complications of implantable medical devices from a nationwide hospital database.

    Science.gov (United States)

    Ficheur, Grégoire; Ferreira Careira, Lionel; Beuscart, Régis; Chazard, Emmanuel

    2015-01-01

    Administrative data can be used for the surveillance of the outcomes of implantable medical devices (IMDs). The objective of this work is to build a web-based tool allowing for an exploratory analysis of time-dependent events that may occur after the implementation of an IMD. This tool should enable a pharmacoepidemiologist to explore on the fly the relationship between a given IMD and a potential outcome. This tool mine the French nationwide database of inpatient stays from 2008 to 2013. The data are preprocessed in order to optimize the queries. A web tool is developed in PHP, MySQL and Javascript. The user selects one or a group of IMD from a tree, and can filter the results using years and hospital names. Four result pages describe the selected inpatient stays: (1) temporal and demographic description, (2) a description of the geographical location of the hospital, (3) a description of the geographical place of residence of the patient and (4) a table showing the rehospitalization reasons by decreasing order of frequency. Then, the user can select one readmission reason and display dynamically the probability of readmission by mean of a Kaplan-Meier curve with confidence intervals. This tool enables to dynamically monitor the occurrence of time-dependent complications of IMD.

  2. Outcome predictors in the management of intramedullary classic ependymoma: An integrative survival analysis.

    Science.gov (United States)

    Wang, Yinqing; Cai, Ranze; Wang, Rui; Wang, Chunhua; Chen, Chunmei

    2018-06-01

    This is a retrospective study.The aim of this study was to illustrate the survival outcomes of patients with classic ependymoma (CE) and identify potential prognostic factors.CE is the most common category of spinal ependymomas, but few published studies have discussed predictors of the survival outcome.A Boolean search of the PubMed, Embase, and OVID databases was conducted by 2 investigators independently. The objects were intramedullary grade II ependymoma according to 2007 WHO classification. Univariate Kaplan-Meier analysis and Log-Rank tests were performed to identify variables associated with progression-free survival (PFS) or overall survival (OS). Multivariate Cox regression was performed to assess hazard ratios (HRs) with 95% confidence intervals (95% CIs). Statistical analysis was performed by SPSS version 23.0 (IBM Corp.) with statistical significance defined as P analysis showed that patients who had undergone total resection (TR) had better PFS and OS than those with subtotal resection (STR) and biopsy (P = .002, P = .004, respectively). Within either univariate or multivariate analysis (P = .000, P = .07, respectively), histological type was an independent prognostic factor for PFS of CE [papillary type: HR 0.002, 95% CI (0.000-0.073), P = .001, tanycytic type: HR 0.010, 95% CI (0.000-0.218), P = .003].It was the first integrative analysis of CE to elucidate the correlation between kinds of factors and prognostic outcomes. Definite histological type and safely TR were foundation of CE's management. 4.

  3. Causes of death in long-term lung cancer survivors: a SEER database analysis.

    Science.gov (United States)

    Abdel-Rahman, Omar

    2017-07-01

    Long-term (>5 years) lung cancer survivors represent a small but distinct subgroup of lung cancer patients and information about the causes of death of this subgroup is scarce. The Surveillance, Epidemiology and End Results (SEER) database (1988-2008) was utilized to determine the causes of death of long-term survivors of lung cancer. Survival analysis was conducted using Kaplan-Meier analysis and multivariate analysis was conducted using a Cox proportional hazard model. Clinicopathological characteristics and survival outcomes were assessed for the whole cohort. A total of 78,701 lung cancer patients with >5 years survival were identified. This cohort included 54,488 patients surviving 5-10 years and 24,213 patients surviving >10 years. Among patients surviving 5-10 years, 21.8% were dead because of primary lung cancer, 10.2% were dead because of other cancers, 6.8% were dead because of cardiac disease and 5.3% were dead because of non-malignant pulmonary disease. Among patients surviving >10 years, 12% were dead because of primary lung cancer, 6% were dead because of other cancers, 6.9% were dead because of cardiac disease and 5.6% were dead because of non-malignant pulmonary disease. On multivariate analysis, factors associated with longer cardiac-disease-specific survival in multivariate analysis include younger age at diagnosis (p death from primary lung cancer is still significant among other causes of death even 20 years after diagnosis of lung cancer. Moreover, cardiac as well as non-malignant pulmonary causes contribute a considerable proportion of deaths in long-term lung cancer survivors.

  4. Skull base chordomas: analysis of dose-response characteristics

    International Nuclear Information System (INIS)

    Niemierko, Andrzej; Terahara, Atsuro; Goitein, Michael

    1997-01-01

    Objective: To extract dose-response characteristics from dose-volume histograms and corresponding actuarial survival statistics for 115 patients with skull base chordomas. Materials and Methods: We analyzed data for 115 patients with skull base chordoma treated with combined photon and proton conformal radiotherapy to doses in the range 66.6Gy - 79.2Gy. Data set for each patient included gender, histology, age, tumor volume, prescribed dose, overall treatment time, time to recurrence or time to last observation, target dose-volume histogram, and several dosimetric parameters (minimum/mean/median/maximum target dose, percent of the target volume receiving the prescribed dose, dose to 90% of the target volume, and the Equivalent Uniform Dose (EUD). Data were analyzed using the Kaplan-Meier survivor function estimate, the proportional hazards (Cox) model, and parametric modeling of the actuarial probability of recurrence. Parameters of dose-response characteristics were obtained using the maximum likelihood method. Results: Local failure developed in 42 (36%) of patients, with actuarial local control rates at 5 years of 59.2%. The proportional hazards model revealed significant dependence of gender on the probability of recurrence, with female patients having significantly poorer prognosis (hazard ratio of 2.3 with the p value of 0.008). The Wilcoxon and the log-rank tests of the corresponding Kaplan-Meier recurrence-free survival curves confirmed statistical significance of this effect. The Cox model with stratification by gender showed significance of tumor volume (p=0.01), the minimum target dose (p=0.02), and the EUD (p=0.02). Other parameters were not significant at the α level of significance of 0.05, including the prescribed dose (p=0.21). Parametric analysis using a combined model of tumor control probability (to account for non-uniformity of target dose distribution) and the Weibull failure time model (to account for censoring) allowed us to estimate

  5. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    OpenAIRE

    Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

    2009-01-01

    Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...

  6. «Esa corporeidad mortal y rosa»: análisis del tiempo libre de enfermedad del cáncer de mama en Gipuzkoa en presencia de riesgos competitivos "That deadly and pink corporeity": Analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain in the presence of competing risks

    Directory of Open Access Journals (Sweden)

    Pablo Martínez-Camblor

    2009-12-01

    Full Text Available Objetivo: Analizar el tiempo de supervivencia libre de enfermedad y la supervivencia relativa en mujeres diagnosticadas de cáncer de mama en la provincia de Gipuzkoa en un contexto de riesgos competitivos, valorando las diferencias encontradas entre el uso directo del estimador de Kaplan-Meier y el método de decrementos múltiples por un lado y la supervivencia relativa por otro. Métodos: Se consideraron todos los casos de cáncer de mama registrados en la provincia de Gipuzkoa durante los años 1995 y 1996 en estadio distinto del IV, y se hizo un seguimiento de 8 años para la recidiva y de 10 años para la supervivencia. Se analizó el tiempo de supervivencia libre de enfermedad mediante el método de decrementos múltiples. Asimismo, también se analizó el tiempo de supervivencia observado y corregido por la mortalidad esperada de la población, conocido como supervivencia relativa. Resultados: La estimación de la probabilidad de recidiva a los 8 años por el método de decrementos múltiples es un 8,8% inferior a la obtenida por el método de Kaplan-Meier. La diferencia entre la supervivencia observada y la relativa a los 10 años es del 10,8%. Ambos resultados indican que, en este caso, el método de Kaplan-Meier sobrestima tanto la probabilidad de recaída como la de muerte por la enfermedad. Conclusiones: Dos cuestiones que muchas veces se obvian al realizar un análisis de supervivencia son, por un lado, que la no independencia entre el tiempo de supervivencia y el tiempo de censura hacen no interpretables los resultados obtenidos por el estimador de Kaplan-Meier, y por otro el hecho, hasta hora incuestionable, de que de una manera u otra todos causamos fallo y, desde este planteamiento, en el estudio del tiempo de supervivencia hay que tener presente la probabilidad de fallo en la población general de referencia. En los resultados obtenidos se observa que utilizar de manera superficial el estimador de Kaplan-Meier comporta una

  7. Feasibility of Economic Analysis of Radiation Therapy Oncology Group (RTOG) 91-11 Using Medicare Data

    International Nuclear Information System (INIS)

    Konski, Andre; Bhargavan, Mythreyi; Owen, Jean; Paulus, Rebecca; Cooper, Jay; Forastiere, Arlene; Ang, K. Kian; Watkins-Bruner, Deborah

    2011-01-01

    Purpose: The specific aim of this analysis was to evaluate the feasibility of performing a cost-effectiveness analysis using Medicare data from patients treated on a randomized Phase III clinical trial. Methods and Materials: Cost data included Medicare Part A and Part B costs from all providers-inpatient, outpatient, skilled nursing facility, home health, hospice, and physicians-and were obtained from the Centers for Medicare and Medicaid Services for patients eligible for Medicare, treated on Radiation Therapy Oncology Group (RTOG) 9111 between 1992 and 1996. The 47-month expected discounted (annual discount rate of 3%) cost for each arm of the trial was calculated in 1996 dollars, with Kaplan-Meier sampling average estimates of survival probabilities for each month and mean monthly costs. Overall and disease-free survival was also discounted 3%/year. The analysis was performed from a payer's perspective. Incremental cost-effectiveness ratios were calculated comparing the chemotherapy arms to the radiation alone arm. Results: Of the 547 patients entered, Medicare cost data and clinical outcomes were available for 66 patients. Reasons for exclusion included no RTOG follow-up, Medicare HMO enrollment, no Medicare claims since trial entry, and trial entry after 1996. Differences existed between groups in tumor characteristics, toxicity, and survival, all which could affect resource utilization. Conclusions: Although we were able to test the methodology of economic analysis alongside a clinical trial using Medicare data, the results may be difficult to translate to the entire trial population because of non-random missing data. Methods to improve Medicare data capture and matching to clinical trial samples are required.

  8. Analysis of Mel-18 expression in prostate cancer tissues and correlation with clinicopathologic features.

    Science.gov (United States)

    Wang, Wei; Lin, Tianxin; Huang, Jian; Hu, Weilie; Xu, Kewei; Liu, Jun

    2011-01-01

    Mel-18 is a member of the polycomb group (PcG) of proteins, which are chromatin regulatory factors that play an important role in development and oncogenesis. This study was designed to investigate the clinical and prognostic significance of Mel-18 in the patients with prostate cancer. Immunostaining with Mel-18 specific antibodies was performed on paraffin sections from 202 patients. Correlations between Mel-18 and the Gleason grading system, clinical stage, serum prostate-specific antigen (PSA) levels, and age were evaluated. PSA recurrence in 76 patients who underwent radical prostatectomy and survival in 59 patients with metastases at diagnosis were analyzed to evaluate the influence of Mel-18 expression in cancer progression using Kaplan-Meier analysis and multivariate Cox regression analysis. Staining was seen in all prostatic tissues. Mel-18 expression was significantly reduced in the prostate cancer patients with PSA levels over 100 ng/ml (P=0.009), advanced clinical stage (>T4, N1, or M1 disease, P=0.029), higher Gleason grade or with a higher Gleason score (P=0.018) than in those with other clinicopathologic features. Negative expression of Mel-18 was associated with significantly higher rates of PSA recurrence after radical prostatectomy than with positive expression of Mel-18 (P = 0.029), and was an independent predictor of PSA recurrence (P=0.034, HR=2.143) in multivariate analysis. Similarly, metastatic prostate cancer patients with negative expression of Mel-18 showed significantly worse survival compared with the positive expression of Mel-18 (P=0.025). In multivariate analysis, negative expression of Mel-18 was an independent predictor of cancer-specific survival (P=0.024, HR=2.365). Our study provides important evidence for the recognition of Mel-18 as a tumor suppressor. The expression of Mel-18 showed potential as a prognostic marker for human prostate cancer. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Marital status independently predicts testis cancer survival--an analysis of the SEER database.

    Science.gov (United States)

    Abern, Michael R; Dude, Annie M; Coogan, Christopher L

    2012-01-01

    Previous reports have shown that married men with malignancies have improved 10-year survival over unmarried men. We sought to investigate the effect of marital status on 10-year survival in a U.S. population-based cohort of men with testis cancer. We examined 30,789 cases of testis cancer reported to the Surveillance, Epidemiology, and End Results (SEER 17) database between 1973 and 2005. All staging were converted to the 1997 AJCC TNM system. Patients less than 18 years of age at time of diagnosis were excluded. A subgroup analysis of patients with stages I or II non-seminomatous germ cell tumors (NSGCT) was performed. Univariate analysis using t-tests and χ(2) tests compared characteristics of patients separated by marital status. Multivariate analysis was performed using a Cox proportional hazard model to generate Kaplan-Meier survival curves, with all-cause and cancer-specific mortality as the primary endpoints. 20,245 cases met the inclusion criteria. Married men were more likely to be older (38.9 vs. 31.4 years), Caucasian (94.4% vs. 92.1%), stage I (73.1% vs. 61.4%), and have seminoma as the tumor histology (57.3% vs. 43.4%). On multivariate analysis, married status (HR 0.58, P married status (HR 0.60, P married and unmarried men (44.8% vs. 43.4%, P = 0.33). Marital status is an independent predictor of improved overall and cancer-specific survival in men with testis cancer. In men with stages I or II NSGCT, RPLND is an additional predictor of improved overall survival. Marital status does not appear to influence whether men undergo RPLND. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers

    Directory of Open Access Journals (Sweden)

    Wickramarachchi RE

    2010-09-01

    Full Text Available Abstract Objectives This study compares clinico-pathological features in young (50 years with colorectal cancer, survival in the young and the influence of pre-operative clinical and histological factors on survival. Materials and methods A twelve year prospective database of colorectal cancer was analysed. Fifty-three young patients were compared with forty seven consecutive older patients over fifty years old. An analysis of survival was undertaken in young patients using Kaplan Meier graphs, non parametric methods, Cox's Proportional Hazard Ratios and Weibull Hazard models. Results Young patients comprised 13.4 percent of 397 with colorectal cancer. Duration of symptoms and presentation in the young was similar to older patients (median, range; young patients; 6 months, 2 weeks to 2 years, older patients; 4 months, 4 weeks to 3 years, p > 0.05. In both groups, the majority presented without bowel obstruction (young - 81%, older - 94%. Cancer proximal to the splenic flexure was present more in young than in older patients. Synchronous cancers were found exclusively in the young. Mucinous tumours were seen in 16% of young and 4% of older patients (p Conclusion If patients, who are less than 40 years old with colorectal cancer, survive twenty months after operation, the prognosis improves and their survival becomes predictable.

  11. Urbanization factors associated with childhood asthma and prematurity: a population-based analysis aged from 0 to 5 years in Taiwan by using Cox regression within a hospital cluster model.

    Science.gov (United States)

    Lin, Sheng-Chieh; Lin, Hui-Wen

    2015-04-01

    Childhood asthma and premature birth are both common; however, no studies have reported urbanization association between asthma and prematurity and the duration of prematurity affect asthma development. We use Taiwan Longitudinal Health Insurance Database (LHID) to explore association between asthma and prematurity among children by using a population-based analysis. This is a retrospective cohort study with registration data derived from Taiwan LHID. We evaluated prematurely born infants and children aged prematurely and 13 851 (40.27 per 1000 person-years) controls. The hazard ratio for asthma during 5-year follow-up period was 1.95 (95% confidence interval = 1.67-2.28) among children born prematurely. Boys born prematurely aged 0-2 years were associated with higher asthma rates compared with girls in non-premature and premature groups. Living in urban areas, those born prematurely were associated with higher rates of asthma compared with non-prematurity. Those born prematurely lived in northern region had higher asthma hazard ratio than other regions. Our analyses indicated that sex, age, urbanization level, and geographic region are significantly associated with prematurity and asthma. Based on cumulative asthma-free survival curve generated using the Kaplan-Meier method, infants born prematurely should be closely monitored to see if they would develop asthma until the age of 6 years.

  12. Multimodality therapy and prognostic analysis of thymoma

    International Nuclear Information System (INIS)

    Chen Jie; Wang Ping; Song Yongchun

    2007-01-01

    Objective: The aim of this study is to draft the judicious treatment methods by analyzing the Long-term survival result of thymoma and evaluating the effect that prognosis analysis has on thymoma. Methods: Retrospective analysis of the clinical material of 142 patients with thymoma in the Tianjin Medical University Cancer Hospital from January 1954 to January 2001. Statistical analysis was performed using the SPSS software package. The Kaplan-Meier method was used single variable analysis, The Log-rank test was used to compare survival between groups, The Cox' s proportional hazards model was used to multi-factor analysis. Results: The 5- and 10-year survival rate of the 142 patients was 59.9% and 45.8%, respectively. Staging was adopted on the Masaoka's way, 5- and 10-year survival rates was: 93.8%, 79.2% in stage I; 79.3%, 55.2% in stage II; 53.1%, 34.4% in stage III; and 0 and 0 in stage IV. Among 30 patients associated with myasthenia gravis, 19 patients suffered from generalized myasthenia gravis and 11 patients of ocular myasthenia gravis, with 5- and 10-year survival rate of 83.3% and 60.0%, respectively. Three patients finally died of myasthenia gravis. The 5- and 10-year survival rate of 112 patients without myasthenia gravis was 53.6% and 42.0%, respectively. Among 116 patients, treated with surgery-, resection was carried out in 84 patients, palliative resection in 9 patients, and biopsy only in 23 patients. Eighty-nine patients were given radiotherapy and 55 patients had postoperative radiotherapy. Single variable analysis showed that Masaoka clinical staging, association with myasthenia gravis, histopathologic subtype and the method of treatment were prognostic factor's. Finally, drawing the conclusion through muhivariable analysis; Masaoka clinical staging, association with myasthenia gravis and the treatment method were prognostic factors. Conclusions: The diagnosis of thymoma is made clinically and pathologically. The treatment principle should be

  13. Late rectal toxicity after conformal radiotherapy of prostate cancer (I): multivariate analysis and dose-response

    International Nuclear Information System (INIS)

    Skwarchuk, Mark W.; Jackson, Andrew; Zelefsky, Michael J.; Venkatraman, Ennapadam S.; Cowen, Didier M.; Levegruen, Sabine; Burman, Chandra M.; Fuks, Zvi; Leibel, Steven A.; Ling, C. Clifton

    2000-01-01

    Purpose: The purpose of this paper is to use the outcome of a dose escalation protocol for three-dimensional conformal radiation therapy (3D-CRT) of prostate cancer to study the dose-response for late rectal toxicity and to identify anatomic, dosimetric, and clinical factors that correlate with late rectal bleeding in multivariate analysis. Methods and Materials: Seven hundred forty-three patients with T1c-T3 prostate cancer were treated with 3D-CRT with prescribed doses of 64.8 to 81.0 Gy. The 5-year actuarial rate of late rectal toxicity was assessed using Kaplan-Meier statistics. A retrospective dosimetric analysis was performed for patients treated to 70.2 Gy (52 patients) or 75.6 Gy (119 patients) who either exhibited late rectal bleeding (RTOG Grade 2/3) within 30 months after treatment (i.e., 70.2 Gy--13 patients, 75.6 Gy--36 patients) or were nonbleeding for at least 30 months (i.e., 70.2 Gy--39 patients, 75.6 Gy--83 patients). Univariate and multivariate logistic regression was performed to correlate late rectal bleeding with several anatomic, dosimetric, and clinical variables. Results: A dose response for ≥ Grade 2 late rectal toxicity was observed. By multivariate analysis, the following factors were significantly correlated with ≥ Grade 2 late rectal bleeding for patients prescribed 70.2 Gy: 1) enclosure of the outer rectal contour by the 50% isodose on the isocenter slice (i.e., Iso50) (p max (p max

  14. Cluster analysis of autoantibodies in 852 patients with systemic lupus erythematosus from a single center.

    Science.gov (United States)

    Artim-Esen, Bahar; Çene, Erhan; Şahinkaya, Yasemin; Ertan, Semra; Pehlivan, Özlem; Kamali, Sevil; Gül, Ahmet; Öcal, Lale; Aral, Orhan; Inanç, Murat

    2014-07-01

    Associations between autoantibodies and clinical features have been described in systemic lupus erythematosus (SLE). Herein, we aimed to define autoantibody clusters and their clinical correlations in a large cohort of patients with SLE. We analyzed 852 patients with SLE who attended our clinic. Seven autoantibodies were selected for cluster analysis: anti-DNA, anti-Sm, anti-RNP, anticardiolipin (aCL) immunoglobulin (Ig)G or IgM, lupus anticoagulant (LAC), anti-Ro, and anti-La. Two-step clustering and Kaplan-Meier survival analyses were used. Five clusters were identified. A cluster consisted of patients with only anti-dsDNA antibodies, a cluster of anti-Sm and anti-RNP, a cluster of aCL IgG/M and LAC, and a cluster of anti-Ro and anti-La antibodies. Analysis revealed 1 more cluster that consisted of patients who did not belong to any of the clusters formed by antibodies chosen for cluster analysis. Sm/RNP cluster had significantly higher incidence of pulmonary hypertension and Raynaud phenomenon. DsDNA cluster had the highest incidence of renal involvement. In the aCL/LAC cluster, there were significantly more patients with neuropsychiatric involvement, antiphospholipid syndrome, autoimmune hemolytic anemia, and thrombocytopenia. According to the Systemic Lupus International Collaborating Clinics damage index, the highest frequency of damage was in the aCL/LAC cluster. Comparison of 10 and 20 years survival showed reduced survival in the aCL/LAC cluster. This study supports the existence of autoantibody clusters with distinct clinical features in SLE and shows that forming clinical subsets according to autoantibody clusters may be useful in predicting the outcome of the disease. Autoantibody clusters in SLE may exhibit differences according to the clinical setting or population.

  15. Identification and validation of asthma phenotypes in Chinese population using cluster analysis.

    Science.gov (United States)

    Wang, Lei; Liang, Rui; Zhou, Ting; Zheng, Jing; Liang, Bing Miao; Zhang, Hong Ping; Luo, Feng Ming; Gibson, Peter G; Wang, Gang

    2017-10-01

    Asthma is a heterogeneous airway disease, so it is crucial to clearly identify clinical phenotypes to achieve better asthma management. To identify and prospectively validate asthma clusters in a Chinese population. Two hundred eighty-four patients were consecutively recruited and 18 sociodemographic and clinical variables were collected. Hierarchical cluster analysis was performed by the Ward method followed by k-means cluster analysis. Then, a prospective 12-month cohort study was used to validate the identified clusters. Five clusters were successfully identified. Clusters 1 (n = 71) and 3 (n = 81) were mild asthma phenotypes with slight airway obstruction and low exacerbation risk, but with a sex differential. Cluster 2 (n = 65) described an "allergic" phenotype, cluster 4 (n = 33) featured a "fixed airflow limitation" phenotype with smoking, and cluster 5 (n = 34) was a "low socioeconomic status" phenotype. Patients in clusters 2, 4, and 5 had distinctly lower socioeconomic status and more psychological symptoms. Cluster 2 had a significantly increased risk of exacerbations (risk ratio [RR] 1.13, 95% confidence interval [CI] 1.03-1.25), unplanned visits for asthma (RR 1.98, 95% CI 1.07-3.66), and emergency visits for asthma (RR 7.17, 95% CI 1.26-40.80). Cluster 4 had an increased risk of unplanned visits (RR 2.22, 95% CI 1.02-4.81), and cluster 5 had increased emergency visits (RR 12.72, 95% CI 1.95-69.78). Kaplan-Meier analysis confirmed that cluster grouping was predictive of time to the first asthma exacerbation, unplanned visit, emergency visit, and hospital admission (P clusters as "allergic asthma," "fixed airflow limitation," and "low socioeconomic status" phenotypes that are at high risk of severe asthma exacerbations and that have management implications for clinical practice in developing countries. Copyright © 2017 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  16. National Practice Patterns for Clinical T1N0 Nasopharyngeal Cancer in the Elderly: A National Cancer Data Base Analysis.

    Science.gov (United States)

    Post, Carl M; Lin, Chi; Adeberg, Sebastian; Gupta, Mrigank; Zhen, Weining; Verma, Vivek

    2018-03-01

    The standard of care for T1N0 nasopharyngeal cancer (NPC) is definitive radiation therapy (RT). However, practice patterns in the elderly may not necessarily follow national guidelines. Herein, we investigated national practice patterns for T1N0 NPC. The National Cancer Data Base (NCDB) was queried for clinical T1N0 primary NPC cases (2004-2013) in patients ≥70 years old. Patient, tumor, and treatment parameters were extracted. Kaplan-Meier analysis was used to compare overall survival (OS) between patients receiving RT versus those under observation. Logistic regression was used to examine variables associated with receipt of RT. Cox proportional hazards modeling determined variables associated with OS. Landmark analysis of patients surviving 1 year or more was performed to assess survival differences between groups. In total, data of 147 patients were analyzed. RT was delivered to 89 patients (61%), whereas 58 (39%) patients underwent observation. On multivariable analysis, older patients were less likely to receive RT (p=0.003), but there were no differences between groups in terms of Charlson-Deyo comorbidity index. Median and 5-year OS in patients receiving RT versus those under observation were 71 and 33 months, and 59% and 48% (p=0.011), respectively. For patients surviving 1 year or more (n=96), there was a strong trend showing that receipt of RT was associated with better median and 5-year OS. This National Data Base analysis shows that observation is relatively common for T1N0 NPC in the elderly, but is associated with poorer survival. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  17. Breastfeeding practices in a public health field practice area in Sri Lanka: a survival analysis

    Directory of Open Access Journals (Sweden)

    Agampodi Thilini C

    2007-10-01

    Full Text Available Abstract Background Exclusive breastfeeding up to the completion of the sixth month of age is the national infant feeding recommendation for Sri Lanka. The objective of the present study was to collect data on exclusive breastfeeding up to six months and to describe the association between exclusive breastfeeding and selected socio-demographic factors. Methods A clinic based cross-sectional study was conducted in the Medical Officer of Health area, Beruwala, Sri Lanka in June 2006. Mothers with infants aged 4 to 12 months, attending the 19 child welfare clinics in the area were included in the study. Infants with specific feeding problems (cleft lip and palate and primary lactose intolerance were excluded. Cluster sampling technique was used and consecutive infants fulfilling the inclusion criteria were enrolled. A total of 219 mothers participated in the study. The statistical tests used were survival analysis (Kaplan-Meier survival curves and Cox proportional Hazard model. Results All 219 mothers had initiated breastfeeding. The median duration of exclusive breastfeeding was four months (95% CI 3.75, 4.25. The rates of exclusive breastfeeding at 4 and 6 months were 61.6% (135/219 and 15.5% (24/155 respectively. Bivariate analysis showed that the Muslim ethnicity (p = 0.004, lower levels of parental education (p Conclusion The rate of breastfeeding initiation and exclusive breastfeeding up to the fourth month is very high in Medical Officer of Health area, Beruwala, Sri Lanka. However exclusive breastfeeding up to six months is still low and the prevalence of inappropriate feeding practices is high.

  18. Integrated analysis of HPV-mediated immune alterations in cervical cancer.

    Science.gov (United States)

    Chen, Long; Luan, Shaohong; Xia, Baoguo; Liu, Yansheng; Gao, Yuan; Yu, Hongyan; Mu, Qingling; Zhang, Ping; Zhang, Weina; Zhang, Shengmiao; Wei, Guopeng; Yang, Min; Li, Ke

    2018-05-01

    Human papillomavirus (HPV) infection is the primary cause of cervical cancer. HPV-mediated immune alterations are known to play crucial roles in determining viral persistence and host cell transformation. We sought to thoroughly understand HPV-directed immune alterations in cervical cancer by exploring publically available datasets. 130 HPV positive and 7 HPV negative cervical cancer cases from The Cancer Genome Atlas were compared for differences in gene expression levels and functional enrichment. Analyses for copy number variation (CNV) and genetic mutation were conducted for differentially expressed immune genes. Kaplan-Meier analysis was performed to assess survival and relapse differences across cases with or without alterations of the identified immune signature genes. Genes up-regulated in HPV positive cervical cancer were enriched for various gene ontology terms of immune processes (P=1.05E-14~1.00E-05). Integrated analysis of the differentially expressed immune genes identified 9 genes that displayed either CNV, genetic mutation and/or gene expression changes in at least 10% of the cases of HPV positive cervical cancer. Genomic amplification may cause elevated levels of these genes in some HPV positive cases. Finally, patients with alterations in at least one of the nine signature genes overall had earlier relapse compared to those without any alterations. The altered expression of either TFRC or MMP13 may indicate poor survival for a subset of cervical cancer patients (P=1.07E-07). We identified a novel immune gene signature for HPV positive cervical cancer that is potentially associated with early relapse of cervical cancer. Copyright © 2018. Published by Elsevier Inc.

  19. Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province

    Directory of Open Access Journals (Sweden)

    Reza Zamani

    2015-05-01

    Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.

  20. The value and economic analysis of routine postoperative carotid duplex ultrasound surveillance after carotid endarterectomy.

    Science.gov (United States)

    AbuRahma, Ali F; Srivastava, Mohit; AbuRahma, Zachary; Jackson, Will; Mousa, Albeir; Stone, Patrick A; Dean, L Scott; Green, Jason

    2015-08-01

    Several studies have reported on the role of postoperative duplex ultrasound surveillance after carotid endarterectomy (CEA) with varying results. Most of these studies had a small sample size or did not analyze cost-effectiveness. We analyzed 489 of 501 CEA patients with patch closure. All patients had immediate postoperative duplex ultrasound examination and were routinely followed up both clinically and with duplex ultrasound at regular intervals of 1 month, 6 months, 12 months, and every 12 months thereafter. A Kaplan-Meier analysis was used to estimate the rate of ≥50% and ≥80% post-CEA restenosis over time and the time frame of progression from normal to ≥50% or ≥80% restenosis. The cost of post-CEA duplex surveillance was also estimated. Overall, 489 patients with a mean age of 68.5 years were analyzed. Ten of these had residual postoperative ≥50% stenosis, and 37 did not undergo a second duplex ultrasound examination and therefore were not included in the final analysis. The mean follow-up was 20.4 months (range, 1-63 months), with a mean number of duplex ultrasound examinations of 3.6 (range, 1-7). Eleven of 397 patients (2.8%) with a normal finding on immediate postoperative duplex ultrasound vs 4 of 45 (8.9%) with mild stenosis on immediate postoperative duplex ultrasound progressed to ≥50% restenosis (P = .055). Overall, 15 patients (3.1%) had ≥50% restenosis, 9 with 50% to duplex ultrasound), which equals $1,408,320, to detect only four patients with ≥80% to 99% restenosis who may have been potential candidates for reintervention. This study shows that the value of routine postoperative duplex ultrasound surveillance after CEA with patch closure may be limited, particularly if the finding on immediate postoperative duplex ultrasound is normal or shows minimal disease. Copyright © 2015 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

  1. Analysis of survival for patients with chronic kidney disease primarily related to renal cancer surgery.

    Science.gov (United States)

    Wu, Jitao; Suk-Ouichai, Chalairat; Dong, Wen; Antonio, Elvis Caraballo; Derweesh, Ithaar H; Lane, Brian R; Demirjian, Sevag; Li, Jianbo; Campbell, Steven C

    2018-01-01

    To evaluate predictors of long-term survival for patients with chronic kidney disease primarily due to surgery (CKD-S). Patients with CKD-S have generally good survival that approximates patients who do not have CKD even after renal cancer surgery (RCS), yet there may be heterogeneity within this cohort. From 1997 to 2008, 4 246 patients underwent RCS at our centre. The median (interquartile range [IQR]) follow-up was 9.4 (7.3-11.0) years. New baseline glomerular filtration rate (GFR) was defined as highest GFR between nadir and 6 weeks after RCS. We retrospectively evaluated three cohorts: no-CKD (new baseline GFR of ≥60 mL/min/1.73 m 2 ); CKD-S (new baseline GFR of cancer-related survival (NRCRS) for the CKD-S cohort. Kaplan-Meier analysis assessed the longitudinal impact of new baseline GFR (45-60 mL/min/1.73 m 2 vs <45 mL/min/1.73 m 2 ) and Cox regression evaluated relative impact of preoperative GFR, new baseline GFR, and relevant demographics/comorbidities. Of the 4 246 patients who underwent RCS, 931 had CKD-S and 1 113 had CKD-M/S, whilst 2 202 had no-CKD even after RCS. Partial/radical nephrectomy (PN/RN) was performed in 54%/46% of the patients, respectively. For CKD-S, 641 patients had a new baseline GFR of 45-60 mL/min/1.73 m 2 and 290 had a new baseline GFR of <45 mL/min/1.73 m 2 . Kaplan-Meier analysis showed significantly reduced NRCRS for patients with CKD-S with a GFR of <45 mL/min/1.73 m 2 compared to those with no-CKD or CKD-S with a GFR of 45-60 mL/min/1.73 m 2 (both P ≤ 0.004), and competing risk analysis confirmed this (P < 0.001). Age, gender, heart disease, and new baseline GFR were all associated independently with NRCRS for patients with CKD-S (all P ≤ 0.02). Our data suggest that CKD-S is heterogeneous, and patients with a reduced new baseline GFR have compromised survival, particularly if <45 mL/min/1.73 m 2 . Our findings may have implications regarding choice of PN/RN in patients at risk of developing

  2. Mitigación de la cavitación de extremo de alabe mediante la implementación de inyección de aire en un modelo a escala reducida de turbina Kaplan

    OpenAIRE

    Rivetti, Arturo; Angulo, Mauricio Abel; Lucino, Cecilia Verónica; Liscia, Sergio Oscar

    2015-01-01

    Las Turbinas Kaplan que operan en condiciones de alta carga pueden estar sometidas a vibraciones excesivas, ruido y cavitación. En estos casos puede presentarse erosión por cavitación sobre el anillo de descarga asociada al desarrollo de cavitación de extremo de alabe. Este fenómeno involucra características de diseño tales como sobreapertura de los alabes del distribuidor; perfil de los alabes del rodete; el incremento del huelgo debido a la apertura del alabe; la altura neta de aspiración; ...

  3. Texture analysis of {sup 18}F-FDG PET/CT to predict tumour response and prognosis of patients with esophageal cancer treated by chemoradiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Nakajo, Masatoyo; Jinguji, Megumi; Nakabeppu, Yoshiaki; Higashi, Ryutarou; Fukukura, Yoshihiko; Yoshiura, Takashi [Kagoshima University, Department of Radiology, Graduate School of Medical and Dental Sciences, Kagoshima (Japan); Nakajo, Masayuki [Nanpuh Hospital, Department of Radiology, Kagoshima (Japan); Sasaki, Ken; Uchikado, Yasuto; Natsugoe, Shoji [Kagoshima University, Department of Digestive Surgery, Breast and Thyroid Surgery, Graduate School of Medical and Dental Sciences, Kagoshima (Japan)

    2017-02-15

    This retrospective study was done to examine whether the heterogeneity in primary tumour F-18-fluorodeoxyglucose ({sup 18}F-FDG) distribution can predict tumour response and prognosis of patients with esophageal cancer treated by chemoradiotherapy (CRT). The enrolled 52 patients with esophageal cancer underwent {sup 18}F-FDG-PET/CT studies before CRT. SUVmax, SUVmean, metabolic tumour volume (MTV, SUV ≥ 2.5), total lesion glycolysis (TLG) and six heterogeneity parameters assessed by texture analysis were obtained. Patients were classified as responders or non-responders according to Response Evaluation Criteria in Solid Tumors. Progression-free survival (PFS) and overall survival (OS) were calculated by the Kaplan-Meier method. Prognostic significance was assessed by Cox proportional hazards analysis. Thirty four non-responders showed significantly higher MTV (p = 0.006), TLG (p = 0.007), intensity variability (IV; p = 0.003) and size-zone variability (SZV; p = 0.004) than 18 responders. The positive and negative predictive values for non-responders were 77 % and 69 % in MTV, 76 % and 100 % in TLG, 78 % and 67 % in IV and 78 % and 82 % in SZV, respectively. Although PFS and OS were significantly shorter in patients with high MTV (PFS, p = 0.018; OS, p = 0.014), TLG (PFS, p = 0.009; OS, p = 0.025), IV (PFS, p = 0.013; OS, p = 0.007) and SZV (PFS, p = 0.010; OS, p = 0.007) at univariate analysis, none of them was an independent factor, while lymph node status, stage and tumour response status were independent factors at multivariate analysis. Texture features IV and SZV, and volumetric parameters MTV and TLG can predict tumour response, but all of them have limited value in prediction of prognosis of patients with esophageal cancer treated by CRT. (orig.)

  4. Neutrophil-to-lymphocyte ratio as an independent predictor for survival in patients with localized clear cell renal cell carcinoma after radiofrequency ablation: a propensity score matching analysis.

    Science.gov (United States)

    Chang, Xiaofeng; Zhang, Fan; Liu, Tieshi; Wang, Wei; Guo, Hongqian

    2017-06-01

    To investigate the role of neutrophil-to-lymphocyte ratio as a prognostic indicator in patients with localized clear cell renal cell carcinoma treated with radiofrequency ablation. We retrospectively analyzed data from patients with renal cell carcinoma who underwent radiofrequency ablation from 2006 to 2013. The Kaplan-Meier method was used to generate the survival curves according to different categories of neutrophil-to-lymphocyte ratio. Relationships between preoperative neutrophil-to-lymphocyte ratio or the change of neutrophil-to-lymphocyte ratio and survival were evaluated with multivariable Cox proportional hazards regression analysis. A propensity score matching analysis was carried out to avoid confounding bias. A total of 185 patients were included in present study. When stratified by preoperative neutrophil-to-lymphocyte ratio cutoff value of 2.79, 5-year recurrence-free survival, 5-year disease-free survival, and 5-year overall survival rates of neutrophil-to-lymphocyte ratio analysis, 5-year recurrence-free survival, 5-year disease-free survival, and 5-year overall survival rates of neutrophil-to-lymphocyte ratio ratio with the change of neutrophil-to-lymphocyte ratio, patients with both preoperative neutrophil-to-lymphocyte ratio ≥2.79 and the change of neutrophil-to-lymphocyte ratio ≥0.40 had the worst disease-free survival. Results of multivariable analysis showed that preoperative neutrophil-to-lymphocyte ratio and the change of neutrophil-to-lymphocyte ratio correlated with cancer relapse remarkably. High preoperative neutrophil-to-lymphocyte ratio and elevated postoperative neutrophil-to-lymphocyte ratio are associated with significant increase in risk of local recurrence as well as distant metastasis. The combination of neutrophil-to-lymphocyte ratio with the other prognostic indicators can be applied in the evaluation of relapse risk in patients with clear cell renal cell carcinoma after radiofrequency ablation.

  5. 3D Quantitative tumour burden analysis in patients with hepatocellular carcinoma before TACE: comparing single-lesion vs. multi-lesion imaging biomarkers as predictors of patient survival

    International Nuclear Information System (INIS)

    Fleckenstein, Florian N.; Schernthaner, Ruediger E.; Duran, Rafael; Sohn, Jae Ho; Sahu, Sonia; Zhao, Yan; Hamm, Bernd; Gebauer, Bernhard; Lin, MingDe; Geschwind, Jean-Francois; Chapiro, Julius

    2016-01-01

    To compare the ability of single- vs. multi-lesion assessment on baseline MRI using 1D- and 3D-based measurements to predict overall survival (OS) in patients with hepatocellular carcinoma (HCC) before transarterial chemoembolization (TACE). This retrospective analysis included 122 patients. A quantitative 3D analysis was performed on baseline MRI to calculate enhancing tumour volume (ETV [cm 3 ]) and enhancing tumour burden (ETB [%]) (ratio between ETV [cm 3 ] and liver volume). Furthermore, enhancing and overall tumour diameters were measured. Patients were stratified into two groups using thresholds derived from the BCLC staging system. Statistical analysis included Kaplan-Meier plots, uni- and multivariate cox proportional hazard ratios (HR) and concordances. All methods achieved good separation of the survival curves (p < 0.05). Multivariate analysis showed an HR of 5.2 (95 % CI 3.1-8.8, p < 0.001) for ETV [cm 3 ] and HR 6.6 (95 % CI 3.7-11.5, p < 0.001) for ETB [%] vs. HR 2.6 (95 % CI 1.2-5.6, p = 0.012) for overall diameter and HR 3.0 (95 % CI 1.5-6.3, p = 0.003) for enhancing diameter. Concordances were highest for ETB [%], with no added predictive power for multi-lesion assessment (difference between concordances not significant). 3D quantitative assessment is a stronger predictor of survival as compared to diameter-based measurements. Assessing multiple lesions provides no substantial improvement in predicting OS than evaluating the dominant lesion alone. (orig.)

  6. Prognostic analysis of uterine cervical cancer treated with postoperative radiotherapy: importance of positive or close parametrial resection margin

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Yi Jun; Lee, Kyung Ja; Park, Kyung Ran [Dept. of Radiation Oncology, (Korea, Republic of); and others

    2015-06-15

    To analyze prognostic factors for locoregional recurrence (LRR), distant metastasis (DM), and overall survival (OS) in cervical cancer patients who underwent radical hysterectomy followed by postoperative radiotherapy (PORT) in a single institute. Clinicopathologic data of 135 patients with clinical stage IA2 to IIA2 cervical cancer treated with PORT from 2001 to 2012 were reviewed, retrospectively. Postoperative parametrial resection margin (PRM) and vaginal resection margin (VRM) were investigated separately. The median treatment dosage of external beam radiotherapy (EBRT) to the whole pelvis was 50.4 Gy in 1.8 Gy/fraction. High-dose-rate vaginal brachytherapy after EBRT was given to patients with positive or close VRMs. Concurrent platinum-based chemoradiotherapy (CCRT) was administered to 73 patients with positive resection margin, lymph node (LN) metastasis, or direct extension of parametrium. Kaplan-Meier method and log-rank test were used for analyzing LRR, DM, and OS; Cox regression was applied to analyze prognostic factors. The 5-year disease-free survival was 79% and 5-year OS was 91%. In univariate analysis, positive or close PRM, LN metastasis, direct extension of parametrium, lymphovascular invasion, histology of adenocarcinoma, and chemotherapy were related with more DM and poor OS. In multivariate analysis, PRM and LN metastasis remained independent prognostic factors for OS. PORT after radical hysterectomy in uterine cervical cancer showed excellent OS in this study. Positive or close PRM after radical hysterectomy in uterine cervical cancer correlates with poor prognosis even with CCRT. Therefore, additional treatments to improve local control such as radiation boosting need to be considered.

  7. MR Imaging Analysis of Non-Measurable Enhancing Lesions Newly Appearing after Concomitant Chemoradiotherapy in Glioblastoma Patients for Prognosis Prediction.

    Directory of Open Access Journals (Sweden)

    Bo Ram Kim

    Full Text Available To analyze the enhancement patterns and apparent diffusion coefficient (ADC values of non-measurable surgical cavity wall enhancement pattern, newly appearing after completion of standard concurrent chemoradiotherapy (CCRT with temozolomide in glioblastoma patients for the prognosis prediction.From January 2010 to April 2014, among 190 patients with histopathologically confirmed glioblastoma, a total of 33 patients with non-measurable wall enhancement on post-CCRT MR imaging were enrolled and divided into two subgroups: non-progression (n = 18 and progression groups (n = 15. We analyzed the wall enhancement patterns, which were categorized into three patterns: thin, thick and nodular enhancement. ADC values were measured in the enhancing portions of the walls. The progression-free survival (PFS related to the wall enhancement was analyzed by Kaplan-Meier analysis, and survival curves were compared using the log-rank test.Statistically significant differences in the surgical cavity wall enhancement patterns was shown between the progression and non-progression groups (P = 0.0032. Thin wall enhancement was more frequently observed in the non-progression group, and thick or nodular wall enhancement were observed in the progression group (P = 0.0016. There was no statistically significant difference in the mean ADC values between the progression and non-progression groups. The mean PFS was longer in patients with thin wall enhancement than in those with nodular or thick wall enhancement (35.5 months vs. 15.8 months, P = 0.008.Pattern analysis of non-measurable surgical cavity wall enhancement on post-CCRT MR imaging might be useful tool for predicting prognosis of GBM patient before clear progression of non-measurable disease.

  8. Somatic mutation load of estrogen receptor-positive breast tumors predicts overall survival: an analysis of genome sequence data.

    Science.gov (United States)

    Haricharan, Svasti; Bainbridge, Matthew N; Scheet, Paul; Brown, Powel H

    2014-07-01

    Breast cancer is one of the most commonly diagnosed cancers in women. While there are several effective therapies for breast cancer and important single gene prognostic/predictive markers, more than 40,000 women die from this disease every year. The increasing availability of large-scale genomic datasets provides opportunities for identifying factors that influence breast cancer survival in smaller, well-defined subsets. The purpose of this study was to investigate the genomic landscape of various breast cancer subtypes and its potential associations with clinical outcomes. We used statistical analysis of sequence data generated by the Cancer Genome Atlas initiative including somatic mutation load (SML) analysis, Kaplan-Meier survival curves, gene mutational frequency, and mutational enrichment evaluation to study the genomic landscape of breast cancer. We show that ER(+), but not ER(-), tumors with high SML associate with poor overall survival (HR = 2.02). Further, these high mutation load tumors are enriched for coincident mutations in both DNA damage repair and ER signature genes. While it is known that somatic mutations in specific genes affect breast cancer survival, this study is the first to identify that SML may constitute an important global signature for a subset of ER(+) tumors prone to high mortality. Moreover, although somatic mutations in individual DNA damage genes affect clinical outcome, our results indicate that coincident mutations in DNA damage response and signature ER genes may prove more informative for ER(+) breast cancer survival. Next generation sequencing may prove an essential tool for identifying pathways underlying poor outcomes and for tailoring therapeutic strategies.

  9. Treatment and survival outcomes of small cell carcinoma of the esophagus: an analysis of the National Cancer Data Base.

    Science.gov (United States)

    Wong, Andrew T; Shao, Meng; Rineer, Justin; Osborn, Virginia; Schwartz, David; Schreiber, David

    2017-02-01

    Given the paucity of esophageal small cell carcinoma (SCC) cases, there are few large studies evaluating this disease. In this study, the National Cancer Data Base (NCDB) was utilized to analyze the clinical features, treatment, and survival of patients with esophageal SCC in a large, population-based dataset. We selected patients diagnosed with esophageal SCC from 1998 to 2011. Patients were identified as having no treatment, chemotherapy alone, radiation ± sequential chemotherapy, concurrent chemoradiation, and esophagectomy ± chemotherapy and/or radiation. Overall survival (OS) was analyzed using the Kaplan-Meier method and compared using the log-rank test. Multivariate Cox regression analysis was conducted to identify factors associated with OS. A total of 583 patients were identified. Most patients had stage IV disease (41.7%). Regarding treatment selection, chemoradiation was the most commonly utilized for patients with nonmetasatic disease, whereas chemotherapy alone was most common for metastatic patients. Esophagectomy (median survival 44.9 months with 3 year OS 50.5%) was associated with the best OS for patients with localized (node-negative) disease compared with chemotherapy alone (p < 0.001) or chemoradiation (p = 0.01). For locoregional (node-positive) disease, treatment with chemoradiation resulted in a median survival of 17.8 months and a 3 year OS 31.6%. On multivariate analysis, treatment with chemotherapy alone (p = 0.003) was associated with worse OS while esophagectomy (p = 0.04) was associated with improved OS compared to chemoradiation. Esophageal SCC is an aggressive malignancy with most patients presenting with metastatic disease. Either esophagectomy or chemoradiation as part of multimodality treatment appear to improve OS for selected patients with nonmetastatic disease. © 2016 International Society for Diseases of the Esophagus.

  10. Prolonged methylprednisolone therapy after the pulse treatment for patients with moderate-to-severe paraquat poisoning: A retrospective analysis.

    Science.gov (United States)

    Gao, Jie; Feng, ShunYi; Wang, Jian; Yang, SiYuan; Li, Yong

    2017-06-01

    This retrospective study aims to evaluate the effect of prolonged methylprednisolone (MP) therapy on the mortality of patients with moderate-to-severe paraquat (PQ) poisoning after the pulse treatment.We performed a retrospective analysis of patients with acute moderate-to-severe PQ poisoning that were admitted to the emergency department from May 2012 to August 2016. Out of 138 patients, 60 were treated with pulse treatment (15 mg kg day MP for 3 days) and 78 were treated with prolonged MP therapy after pulse treatment (15 mg kg day MP for 3 days; afterward, the dosage was reduced in half every 2 days, and the MP therapy was terminated until 0.47 mg kg day). Kaplan-Meier method was used to compare the mortality between the 2 groups. Cox proportional hazard models were used to estimate the hazard ratios (HR) and 95% confidence intervals (CI).The mortality of the prolonged MP therapy after pulse treatment group was lower than that of the pulse group (47.4% vs 63.3%; log-rank tests, P  =  .003). According to the multivariate Cox analysis, the prolonged MP therapy after pulse treatment was significantly associated with a lower mortality risk (HR: 0.31, 95% CI: 0.19-0.52, P treatment caused more incidences of leucopenia than the pulse treatment alone (25.6% vs 11.7%, P  =  .04).The prolonged MP therapy after pulse treatment can reduce the mortality of moderate-to-severe PQ poisoning patients.

  11. Quantitative proteomic analysis for novel biomarkers of buccal squamous cell carcinoma arising in background of oral submucous fibrosis

    International Nuclear Information System (INIS)

    Liu, Wen; Zeng, Lijuan; Li, Ning; Wang, Fei; Jiang, Canhua; Guo, Feng; Chen, Xinqun; Su, Tong; Xu, Chunjiao; Zhang, Shanshan; Fang, Changyun

    2016-01-01

    In South and Southeast Asian, the majority of buccal squamous cell carcinoma (BSCC) can arise from oral submucous fibrosis (OSF). BSCCs develop in OSF that are often not completely resected, causing local relapse. The aim of our study was to find candidate protein biomarkers to detect OSF and predict prognosis in BSCCs by quantitative proteomics approaches. We compared normal oral mucosa (NBM) and paired biopsies of BSCC and OSF by quantitative proteomics using isobaric tags for relative and absolute quantification (iTRAQ) to discover proteins with differential expression. Gene Ontology and KEGG networks were analyzed. The prognostic value of biomarkers was evaluated in 94 BSCCs accompanied with OSF. Significant associations were assessed by Kaplan-Meier survival and Cox-proportional hazards analysis. In total 30 proteins were identified with significantly different expression (false discovery rate < 0.05) among three tissues. Two consistently upregulated proteins, ANXA4 and FLNA, were validated. The disease-free survival was negatively associated with the expression of ANXA4 (hazard ratio, 3.4; P = 0.000), FLNA (hazard ratio, 2.1; P = 0.000) and their combination (hazard ratio, 8.8; P = 0.002) in BSCCs. The present study indicates that iTRAQ quantitative proteomics analysis for tissues of BSCC and OSF is a reliable strategy. A significantly up-regulated ANXA4 and FLNA could be not only candidate biomarkers for BSCC prognosis but also potential targets for its therapy. The online version of this article (doi:10.1186/s12885-016-2650-1) contains supplementary material, which is available to authorized users

  12. Analysis of elemental concentration censored distributions in breast malignant and breast benign neoplasm tissues

    International Nuclear Information System (INIS)

    Kubala-Kukus, A.; Banas, D.; Braziewicz, J.; Gozdz, S.; Majewska, U.; Pajek, M.

    2007-01-01

    The total reflection X-ray fluorescence method was applied to study the trace element concentrations in human breast malignant and breast benign neoplasm tissues taken from the women who were patients of Holycross Cancer Centre in Kielce (Poland). These investigations were mainly focused on the development of new possibilities of cancer diagnosis and therapy monitoring. This systematic comparative study was based on relatively large (∼ 100) population studied, namely 26 samples of breast malignant and 68 samples of breast benign neoplasm tissues. The concentrations, being in the range from a few ppb to 0.1%, were determined for thirteen elements (from P to Pb). The results were carefully analysed to investigate the concentration distribution of trace elements in the studied samples. The measurements of concentration of trace elements by total reflection X-ray fluorescence were limited, however, by the detection limit of the method. It was observed that for more than 50% of elements determined, the concentrations were not measured in all samples. These incomplete measurements were treated within the statistical concept called left-random censoring and for the estimation of the mean value and median of censored concentration distributions, the Kaplan-Meier estimator was used. For comparison of concentrations in two populations, the log-rank test was applied, which allows to compare the censored total reflection X-ray fluorescence data. Found statistically significant differences are discussed in more details. It is noted that described data analysis procedures should be the standard tool to analyze the censored concentrations of trace elements analysed by X-ray fluorescence methods

  13. Analysis of prognostic factors in patients with hepatocellular carcinoma after transcatheter hepatic arterial chemoembolization(TAE)

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Gwon; Byun, Kyung Hwan; Oh, Hyun Han; Ryeom, Hun Kyu; Kim, Yong Joo [Kyungpook National Univ. Hospital, Taegu (Korea, Republic of)

    1996-07-01

    To evaluate long-term survival rates and prognostic factors of patients with hepatocellular carcinoma after TAE. 225 patients with hepatocellular carcinoma treated with TAE between January 1988 and December 1994 were studied. Hepatocellular carcinoma was diagnosed either histologically(n=13) or clinically on the basis of findings characteristic for hepatocellular carcinoma obtained using such as diagnostic imaging methods such as ultrasonography, CT, MRI, and angiography as well as on the basis of high serum alpha-fetoprotein level(n=212). TAE was carried out between one and six times(mean, 1.4 time) using a mixture of lipiodol and Adriamycin, together with Gelfoam. Cumulative survival rates from the day of the first TAE were obtained by the Kaplan-Meier method. Parameters likely to influence the prognosis were subjected to univariate analysis using the log-rank test Cumulative survival rates at the end of the first, second, third, fourth, and fifth year were 55.9%, 32.6%, 21.9%, 17.9%, and 15.0%, respectively. The mean survival time was 727{+-}76 days. Several factors, including Child-Pugh classification, Okuda's stage, tumor size, presence of portal vein invasion by tumor, of arterio-portal shunt, and of extrahepatic metastases, catheter selection level, and number of TAE showed significant correlation with the outcome. Degrees of Lipiodol accumulation in a tumor on follow up CT were also correlated with survival rates. TAE is an effective measure for prolonging the patient's life expectancy and evaluation of prognostic factor is helpful for prognosis and in deciding on the optimal therapeutic modality.

  14. Analysis of time to event outcomes in randomized controlled trials by generalized additive models.

    Directory of Open Access Journals (Sweden)

    Christos Argyropoulos

    Full Text Available Randomized Controlled Trials almost invariably utilize the hazard ratio calculated with a Cox proportional hazard model as a treatment efficacy measure. Despite the widespread adoption of HRs, these provide a limited understanding of the treatment effect and may even provide a biased estimate when the assumption of proportional hazards in the Cox model is not verified by the trial data. Additional treatment effect measures on the survival probability or the time scale may be used to supplement HRs but a framework for the simultaneous generation of these measures is lacking.By splitting follow-up time at the nodes of a Gauss Lobatto numerical quadrature rule, techniques for Poisson Generalized Additive Models (PGAM can be adopted for flexible hazard modeling. Straightforward simulation post-estimation transforms PGAM estimates for the log hazard into estimates of the survival function. These in turn were used to calculate relative and absolute risks or even differences in restricted mean survival time between treatment arms. We illustrate our approach with extensive simulations and in two trials: IPASS (in which the proportionality of hazards was violated and HEMO a long duration study conducted under evolving standards of care on a heterogeneous patient population.PGAM can generate estimates of the survival function and the hazard ratio that are essentially identical to those obtained by Kaplan Meier curve analysis and the Cox model. PGAMs can simultaneously provide multiple measures of treatment efficacy after a single data pass. Furthermore, supported unadjusted (overall treatment effect but also subgroup and adjusted analyses, while incorporating multiple time scales and accounting for non-proportional hazards in survival data.By augmenting the HR conventionally reported, PGAMs have the potential to support the inferential goals of multiple stakeholders involved in the evaluation and appraisal of clinical trial results under proportional and

  15. Survival, causes of death, and prognostic factors in systemic sclerosis: analysis of 947 Brazilian patients.

    Science.gov (United States)

    Sampaio-Barros, Percival D; Bortoluzzo, Adriana B; Marangoni, Roberta G; Rocha, Luiza F; Del Rio, Ana Paula T; Samara, Adil M; Yoshinari, Natalino H; Marques-Neto, João Francisco

    2012-10-01

    To analyze survival, prognostic factors, and causes of death in a large cohort of patients with systemic sclerosis (SSc). From 1991 to 2010, 947 patients with SSc were treated at 2 referral university centers in Brazil. Causes of death were considered SSc-related and non-SSc-related. Multiple logistic regression analysis was used to identify prognostic factors. Survival at 5 and 10 years was estimated using the Kaplan-Meier method. One hundred sixty-eight patients died during the followup. Among the 110 deaths considered related to SSc, there was predominance of lung (48.1%) and heart (24.5%) involvement. Most of the 58 deaths not related to SSc were caused by infection, cardiovascular or cerebrovascular disease, and cancer. Male sex, modified Rodnan skin score (mRSS) > 20, osteoarticular involvement, lung involvement, and renal crisis were the main prognostic factors associated to death. Overall survival rate was 90% for 5 years and 84% for 10 years. Patients presented worse prognosis if they had diffuse SSc (85% vs 92% at 5 yrs, respectively, and 77% vs 87% at 10 yrs, compared to limited SSc), male sex (77% vs 90% at 5 yrs and 64% vs 86% at 10 yrs, compared to female sex), and mRSS > 20 (83% vs 90% at 5 yrs and 66% vs 86% at 10 yrs, compared to mRSS < 20). Survival was worse in male patients with diffuse SSc, and lung and heart involvement represented the main causes of death in this South American series of patients with SSc.

  16. Expression and Functional Pathway Analysis of Nuclear Receptor NR2F2 in Ovarian Cancer

    Science.gov (United States)

    Hawkins, Shannon M.; Loomans, Holli A.; Wan, Ying-Wooi; Ghosh-Choudhury, Triparna; Coffey, Donna; Xiao, Weimin; Liu, Zhandong; Sangi-Haghpeykar, Haleh

    2013-01-01

    Context: Recent evidence implicates the orphan nuclear receptor, nuclear receptor subfamily 2, group F, member 2 (NR2F2; chicken ovalbumin upstream promoter-transcription factor II) as both a master regulator of angiogenesis and an oncogene in prostate and other human cancers. Objective: The objective of the study was to determine whether NR2F2 plays a role in ovarian cancer and dissect its potential mechanisms of action. Design, Setting, and Patients: We examined NR2F2 expression in healthy ovary and ovarian cancers using quantitative PCR and immunohistochemistry. NR2F2 expression was targeted in established ovarian cancer cell lines to assess the impact of dysregulated NR2F2 expression in the epithelial compartment of ovarian cancers. Results: Our results indicate that NR2F2 is robustly expressed in the stroma of healthy ovary with little or no expression in epithelia lining the ovarian surface, clefts, or crypts. This pattern of NR2F2 expression was markedly disrupted in ovarian cancers, in which decreased levels of stromal expression and ectopic epithelial expression were frequently observed. Ovarian cancers with the most disrupted patterns of NR2F2 were associated with significantly shorter disease-free interval by Kaplan-Meier analysis. Targeting NR2F2 expression in established ovarian cancer cell lines enhanced apoptosis and increased proliferation. In addition, we found that NR2F2 regulates the expression of NEK2, RAI14, and multiple other genes involved in the cell cycle, suggesting potential pathways by which dysregulated expression of NR2F2 impacts ovarian cancer. Conclusions: These results uncover novel roles for NR2F2 in ovarian cancer and point to a unique scenario in which a single nuclear receptor plays potentially distinct roles in the stromal and epithelial compartments of the same tissue. PMID:23690307

  17. HIV testing in the maternity ward and the start of breastfeeding: a survival analysis

    Directory of Open Access Journals (Sweden)

    Glaucia T. Possolli

    2015-08-01

    Full Text Available OBJECTIVE: The purpose of this study was to analyze the factors that influence of the time between birth and the beginning of breastfeeding, especially at the moment of the rapid HIV test results at hospital admission for delivery.METHODS: Cohort study of 932 pregnant women who underwent rapid HIV test admitted in the hospital for delivery in Baby-Friendly Hospitals. The survival curves of time from birth to the first feeding were estimated by the Kaplan-Meier method and the joint effect of independent variables by the Cox model with a hierarchical analysis. As the survival curves were not homogeneous among the five hospitals, hindering the principle of proportionality of risks, the data were divided into two groups according to the median time of onset of breastfeeding at birth in women undergoing rapid HIV testing.RESULTS: Hospitals with median time to breastfeeding onset at birth of up to 60 min were considered as early breastfeeding onset and those with higher medians were considered as late breastfeeding onset at birth. Risk factors common to hospitals considered to be with early and late breastfeeding onset at birth were: cesarean section (RR = 1.75 [95% CI: 1.38-2.22]; RR = 3.83 [95% CI: 3.03-4.85] and rapid test result after birth (RR = 1.45 [95% CI: 1.12-1.89]; RR = 1.65 [95% CI: 1.35-2.02], respectively; and hospitals with late onset: starting prenatal care in the third trimester (RR = 1.86 [95% CI: 1.16-2.97].CONCLUSIONS: The onset of breastfeeding is postponed, even in Baby-Friendly Hospitals, when the results of the rapid HIV test requested in the maternity are not available at the time of delivery.

  18. Intensity-modulated Radiosurgery for patients with brain metastases: a mature outcomes analysis.

    Science.gov (United States)

    Wang, Samuel J; Choi, Mehee; Fuller, Clifton D; Salter, Bill J; Fuss, Martin

    2007-06-01

    The purpose of this study was to evaluate the outcomes of patients with brain metastases treated by tomotherapeutic Intensity-modulated Radiosurgery (IMRS). Using retrospective chart review, we analyzed the outcomes of 78 patients (age 33-83 years, median 57 years) who underwent 111 sessions of IMRS (1 to 7 sessions per patient, median 1) for brain metastases (1 to 4 targets per IMRS session, median 1) treated between 2000 and 2005 using a serial tomotherapeutic intensity-modulated radiotherapy treatment (IMRT) planning and delivery system (Peacock, Nomos Corp., Cranberry Township, PA). Treatment planning was performed using an inverse treatment planning optimization algorithm that was optimized for IMRS. A median prescription dose of 15 Gy in combination with WBI, and median 20 Gy for IMRS alone was delivered using 2-4 couch angles over 4-24 rotational arcs. Overall survival was calculated using Kaplan-Meier analysis. To determine the effects of prognostic variables on survival, univariate and multivariate analyses using proportional hazards were performed to assess the effects of age, tumor size, the combination with whole brain irradiation, presence of multiple brain metastases, and presence of extracranial disease. The median overall survival was 6.5 months (95% CI, 5.5-7.9). One- and two-year survival rates were 24% and 10%. In multivariate analyses, age greater than 60 years was the only statistically significant variable that affected survival (hazard rate 1.29, p=0.049). We conclude that tomotherapeutic IMRS is safe and effective to treat patients with brain metastases.

  19. Analysis of BAG3 plasma concentrations in patients with acutely decompensated heart failure.

    Science.gov (United States)

    Gandhi, Parul U; Gaggin, Hanna K; Belcher, Arianna M; Harisiades, Jamie E; Basile, Anna; Falco, Antonia; Rosati, Alessandra; Piscione, Federico; Januzzi, James L; Turco, M Caterina

    2015-05-20

    BCL-2-associated athanogene 3 (BAG3) is a protein implicated in the cardiomyocyte stress response and genesis of cardiomyopathy. Extracellular BAG3 is measurable in patients with heart failure (HF), but the relationship of BAG3 with HF prognosis is unclear. BAG3 plasma concentrations were measured in 39 acutely decompensated HF patients; the primary endpoint was death at 1 year. Baseline characteristics were compared by vital status and median BAG3 concentration. Correlation of BAG3 with left ventricular ejection fraction (LVEF) and other biomarkers was performed. Prognostic value was assessed using Cox proportional hazards regression and Kaplan-Meier analysis. At baseline, median BAG3 was significantly higher in decedents (N=11) than survivors (N=28; 1489 ng/mL versus 50 ng/mL; P=0.04); decedents also had worse renal function and higher median natriuretic peptide (NP) and sST2. BAG3 was not significantly correlated with NPs, mid-regional pro-adrenomedullin, sST2, or eGFR, however. Mortality was increased in patients with supra-median BAG3 (>336 ng/mL; 42.1% versus 15.0%, P=0.06). In age and LVEF-adjusted Cox proportional hazards, BAG3 remained a significant mortality predictor (HR=3.20; 95% CI=1.34-7.65; P=0.02); those with supra-median BAG3 had significantly shorter time-to-death (P=0.04). The stress response protein BAG3 is measurable in patients with ADHF and may be prognostic for death. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. [Analysis of the therapeutic effects of different treatment modalities on the outcomes of 87 patients with lung oligometastasis from nasopharyngeal carcinoma after radiotherapy].

    Science.gov (United States)

    Tang, Q; Hu, Q Y; Piao, Y F; Hua, Y H; Chen, X Z

    2016-03-23

    The aim of the present study was to evaluate the efficacy of three different modalities in treatment of lung oligometastases from nasopharyngeal carcinoma (NPC) after radiotherapy and to identify a more appropriate treatment modality. The clinical data of 87 cases of lung oligometastases from NPC were analyzed retrospectively. Among them, 33 patients underwent local small-field irradiation+ /- chemotherapy, 28 underwent whole-lung irradiation+ chemotherapy, and 26 underwent simple chemotherapy. The survival rates were calculated using Kaplan-Meier analysis. The differences among the modalities were evaluated using the log-rank test. Cox univariate and multivariate analyses were performed to determine the influencing factors. The 3-year lung metastasis survival (LMS) rates of patients with lung metastasis undergoing the three treatment modalities (local small-field irradiation+ /-chemotherapy, whole-lung irradiation+ chemotherapy and chemotherapy alone) were 89.3%, 72.7%, and 72.4%, respectively, showing a significant difference between the groups (P=0.003). Further subgroup analysis showed that the 5-year LMS rate was significantly higher in the local small-field irradiation+ /-chemotherapy group than that in the whole-lung irradiation+ chemotherapy group and chemotherapy alone group (P=0.001). The 2-year progression-free survival (PFS) rates of the three groups were 57.1%, 25.8% and 3.8%, respectively, showing significant intergroup differences (P=0.002 and P<0.001). Multivariate analysis indicated that compared with the whole lung irradiation group and the chemotherapy alone group, the local irradiation+ /- chemotherapy is an independent favorable prognostic factor for LMS and PFS (P<0.05). Local radiotherapy combined with systemic chemotherapy is the best therapeutic modality for lung oligometastases derived from NPC after radiotherapy, improving the LMS and prolonging the PFS.

  1. The impact of body mass index (BMI variation on mortality of incident elderly patients on peritoneal dialysis: a joint model analysis

    Directory of Open Access Journals (Sweden)

    Marcia Regina Gianotti Franco

    Full Text Available Abstract Introduction: Data on impact of high body mass index (BMI on mortality of patients on peritoneal dialysis (PD, especially among elderly, are inconsistent. Objective: To evaluate impact of BMI on cohort of incident elderly PD patients over time. Methods: Prospective multicenter cohort study (December / 2004-October/2007 with 674 patients. Socio-demographic and clinical data evaluated with patients followed until death, transfer to hemodialysis (HD, recovery of renal function, loss of follow-up or transplant. Patients were divided into incident on renal replacement therapy (RRT for PD (PD first: 230 and transferred from hemodialysis (HD first: 444. Analysis was performed comparing these two groups using chi-square or Kruskal Wallis. Similar analysis was used to compare patients on automated peritoneal dialysis (APD vs. continuous ambulatory peritoneal dialysis (CAPD. Data were compared between patients according to BMI by ANOVA, Kruskal Wallis or chi-square. For analysis of survival, Kaplan Meier method was used and to adjust confounding variables, Cox regression proportional hazard. Joint model for longitudinal and time-dependent data was conducted, assessing impact that a longitudinal variable displays on time of survival. Results: Malnourished patients (76.79 ± 7.53 years were older (p < 0.0001 with higher percentage of death (44.6%, p = 0.001; diabetes mellitus showed high prevalence in obese patients (68%, p < 0.0001; higher blood pressure levels (p = 0.002 were present in obese and overweight patients. Conclusions: Increased BMI variation over time proved to be a protective factor, with a decrease of about 1% in risk of death for every BMI unit earned.

  2. Factors affecting survival outcomes of patients with non-metastatic Ewing's sarcoma family tumors in the spine: a retrospective analysis of 63 patients in a single center.

    Science.gov (United States)

    Wan, Wei; Lou, Yan; Hu, Zhiqi; Wang, Ting; Li, Jinsong; Tang, Yu; Wu, Zhipeng; Xu, Leqin; Yang, Xinghai; Song, Dianwen; Xiao, Jianru

    2017-01-01

    Little information has been published in the literature regarding survival outcomes of patients with Ewing's sarcoma family tumors (ESFTs) of the spine. The purpose of this study is to explore factors that may affect the prognosis of patients with non-metastatic spinal ESFTs. A retrospective analysis of survival outcomes was performed in patients with non-metastatic spinal ESFTs. Univariate and multivariate analyses were employed to identify prognostic factors for recurrence and survival. Recurrence-free survival (RFS) and overall survival (OS) were defined as the date of surgery to the date of local relapse and death. Kaplan-Meier methods were applied to estimate RFS and OS. Log-rank test was used to analyze single factors for RFS and OS. Factors with p values ≤0.1 were subjected to multivariate analysis. A total of 63 patients with non-metastatic spinal ESFTs were included in this study. The mean follow-up period was 35.1 months (range 1-155). Postoperative recurrence was detected in 25 patients, and distant metastasis and death occurred in 22 and 36 patients respectively. The result of multivariate analysis suggested that age older than 25 years and neoadjuvant chemotherapy were favorable independent prognostic factors for RFS and OS. In addition, total en-bloc resection, postoperative chemotherapy, radiotherapy and non-distant metastasis were favorable independent prognostic factors for OS. Age older than 25 years and neoadjuvant chemotherapy are favorable prognostic factors for both RFS and OS. In addition, total en-bloc resection, postoperative chemotherapy, radiotherapy and non-distant metastasis are closely associated with favorable survival.

  3. Reporting and methodological quality of survival analysis in articles published in Chinese oncology journals.

    Science.gov (United States)

    Zhu, Xiaoyan; Zhou, Xiaobin; Zhang, Yuan; Sun, Xiao; Liu, Haihua; Zhang, Yingying

    2017-12-01

    Survival analysis methods have gained widespread use in the filed of oncology. For achievement of reliable results, the methodological process and report quality is crucial. This review provides the first examination of methodological characteristics and reporting quality of survival analysis in articles published in leading Chinese oncology journals.To examine methodological and reporting quality of survival analysis, to identify some common deficiencies, to desirable precautions in the analysis, and relate advice for authors, readers, and editors.A total of 242 survival analysis articles were included to be evaluated from 1492 articles published in 4 leading Chinese oncology journals in 2013. Articles were evaluated according to 16 established items for proper use and reporting of survival analysis.The application rates of Kaplan-Meier, life table, log-rank test, Breslow test, and Cox proportional hazards model (Cox model) were 91.74%, 3.72%, 78.51%, 0.41%, and 46.28%, respectively, no article used the parametric method for survival analysis. Multivariate Cox model was conducted in 112 articles (46.28%). Follow-up rates were mentioned in 155 articles (64.05%), of which 4 articles were under 80% and the lowest was 75.25%, 55 articles were100%. The report rates of all types of survival endpoint were lower than 10%. Eleven of 100 articles which reported a loss to follow-up had stated how to treat it in the analysis. One hundred thirty articles (53.72%) did not perform multivariate analysis. One hundred thirty-nine articles (57.44%) did not define the survival time. Violations and omissions of methodological guidelines included no mention of pertinent checks for proportional hazard assumption; no report of testing for interactions and collinearity between independent variables; no report of calculation method of sample size. Thirty-six articles (32.74%) reported the methods of independent variable selection. The above defects could make potentially inaccurate

  4. Deciphering the Adaptive Immune Response to Ovarian Cancer

    Science.gov (United States)

    2013-10-01

    positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By KaplanMeier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, KaplanMeier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor

  5. Predictors of In-Hospital Death After Aneurysmal Subarachnoid Hemorrhage: Analysis of a Nationwide Database (Swiss SOS [Swiss Study on Aneurysmal Subarachnoid Hemorrhage]).

    Science.gov (United States)

    Stienen, Martin Nikolaus; Germans, Menno; Burkhardt, Jan-Karl; Neidert, Marian C; Fung, Christian; Bervini, David; Zumofen, Daniel; Röthlisberger, Michel; Marbacher, Serge; Maduri, Rodolfo; Robert, Thomas; Seule, Martin A; Bijlenga, Philippe; Schaller, Karl; Fandino, Javier; Smoll, Nicolas R; Maldaner, Nicolai; Finkenstädt, Sina; Esposito, Giuseppe; Schatlo, Bawarjan; Keller, Emanuela; Bozinov, Oliver; Regli, Luca

    2018-02-01

    To identify predictors of in-hospital mortality in patients with aneurysmal subarachnoid hemorrhage and to estimate their impact. Retrospective analysis of prospective data from a nationwide multicenter registry on all aneurysmal subarachnoid hemorrhage cases admitted to a tertiary neurosurgical department in Switzerland (Swiss SOS [Swiss Study on Aneurysmal Subarachnoid Hemorrhage]; 2009-2015). Both clinical and radiological independent predictors of in-hospital mortality were identified, and their effect size was determined by calculating adjusted odds ratios (aORs) using multivariate logistic regression. Survival was displayed using Kaplan-Meier curves. Data of n=1866 aneurysmal subarachnoid hemorrhage patients in the Swiss SOS database were available. In-hospital mortality was 20% (n=373). In n=197 patients (10.6%), active treatment was discontinued after hospital admission (no aneurysm occlusion attempted), and this cohort was excluded from analysis of the main statistical model. In the remaining n=1669 patients, the rate of in-hospital mortality was 13.9% (n=232). Strong independent predictors of in-hospital mortality were rebleeding (aOR, 7.69; 95% confidence interval, 3.00-19.71; P <0.001), cerebral infarction attributable to delayed cerebral ischemia (aOR, 3.66; 95% confidence interval, 1.94-6.89; P <0.001), intraventricular hemorrhage (aOR, 2.65; 95% confidence interval, 1.38-5.09; P =0.003), and new infarction post-treatment (aOR, 2.57; 95% confidence interval, 1.43-4.62; P =0.002). Several-and among them modifiable-factors seem to be associated with in-hospital mortality after aneurysmal subarachnoid hemorrhage. Our data suggest that strategies aiming to reduce the risk of rebleeding are most promising in patients where active treatment is initially pursued. URL: http://www.clinicaltrials.gov. Unique identifier: NCT03245866. © 2018 American Heart Association, Inc.

  6. LASER treatment for women with high-grade vaginal intraepithelial neoplasia: A propensity-matched analysis on the efficacy of ablative versus excisional procedures.

    Science.gov (United States)

    Bogani, Giorgio; Ditto, Antonino; Martinelli, Fabio; Mosca, Lavinia; Chiappa, Valentina; Rossetti, Diego; Leone Roberti Maggiore, Umberto; Sabatucci, Ilaria; Lorusso, Domenica; Raspagliesi, Francesco

    2018-05-14

    To investigate the long-term effectiveness of LASER treatment in women affected by high-grade vaginal intra-epithelial neoplasia. Data of consecutive women treated for high-grade vaginal intra-epithelial neoplasia were retrieved. Efficacy and long-term effectiveness of ablative and excisional procedures were tested using a propensity-matched algorithm. Risk of recurrence over the time was assessed using Kaplan-Meier and Cox models. Overall, 204 patients met the inclusion criteria. LASER ablation and exicision were performed in 169 (82.8%) and 35 (17.2%) patients. A total of 41 (20%) patients developed high-grade vaginal intraepithelial neoplasia at a median follow-up of 65 (range, 6-120) months. We observed that only HPV persistence (HR: 2.37 [95%CI:1.03, 5.42]; P = 0.04) was associated with the risk of recurrence at multivariate analysis. Seven (3.4%) invasive cancers of the lower genital tract were observed in our population. Considering the efficacy of type of procedure (after we applied the propensity-matched analysis), we observed that type of procedure did not influence persistence of HPV infection (22.8% after excision and 15.7% after ablation; P = 0.424). Similarly, recurrence (17.1% vs. 18.6%; P = 1.00) and lower genital tract (2.8% vs. 1.4%; P = 1.00) rates were similar between groups. Women affected by high-grade vaginal intra-epithelial neoplasia are at high risk of recurrence. LASER ablation seems to be equivalent to excision in term of long-term effectiveness. Lasers Surg. Med. 9999:1-7, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  7. Prognostic factors and survival in primary malignant astrocytomas of the spinal cord: a population-based analysis from 1973 to 2007.

    Science.gov (United States)

    Adams, Hadie; Avendaño, Javier; Raza, Shaan M; Gokaslan, Ziya L; Jallo, George I; Quiñones-Hinojosa, Alfredo

    2012-05-20

    Observational cross-sectional study. Using data from the population-based cancer registries of the Surveillance, Epidemiology and End Results (SEER) program, we analyzed demographic features, tumor and treatment characteristics, as well as survival rates in patients with primary malignant astrocytomas of the spinal cord (PMASC). PMASC is a rare neoplasm and is considered to carry the same dismal outcome as their cerebral counterparts. Our current knowledge is incomplete, and understanding the epidemiology, diagnosis, and optimal treatment still poses challenges. The SEER data from 1973 to 2007 were reviewed for pathologically confirmed primary anaplastic astrocytomas (AA) and glioblastomas of the spinal cord (C72.0). We compared the clinical features and outcomes of the cohort in uni- and multivariate fashion. Survival was calculated and compared using Kaplan-Meier curves and log-rank analysis. Our search criteria retrieved 135 patients diagnosed with PMASC. The median survival for PMASC was 13 months with 1-, 2-, and 5-year survival rates of 51.8%, 32.2%, and 18.7%. Patient diagnosed with AA had a median survival time of 17 months versus 10 months in patients diagnosed with glioblastomas. Adult patients observed markedly prolonged survival compared with the pediatric group, with a 16-month versus 9-month median survival, respectively. Multivariate analysis revealed age at diagnosis, pediatric and adult age groups, sex, tumor histology, and extent of resection as significant predictors of survival. Interestingly, outcomes did not significantly change throughout the last decades or by receiving radiotherapy. Outcome for patients diagnosed with PMASC remains poor and presents an ongoing challenge for professionals in the field of neurospinal medicine and surgery. In our analyses of AA, adult patients, males, and patients undergoing radical resections were associated with increased survival. However, incidence of these lesions is low; hence, building strong

  8. Results of primary central nervous system lymphoma treated by radiation and chemotherapy. Retrospective analysis of twelve institutions in the Tokai district of Japan, 1995-1999

    International Nuclear Information System (INIS)

    Kawamura, Toshiki; Ishiguchi, Tsuneo; Shibamoto, Yuta

    2006-01-01

    We analyzed the therapeutic results and prognostic factors of 46 primary central nervous system lymphoma (PCNSL) patients who were treated at twelve institutions in the Tokai district of Japan between 1995 and 1999. We compared the results with those of a Japanese nationwide survey performed in the past. We sent each institution a questionnaire about the state of patients' disease, pathological type, method and doses of radiotherapy, regimen and intensity of chemotherapy, and patients' prognoses. The range of patients' ages was 33 to 93 years (median, 61 years). Thirty-one were men and 15 were women. The most prevalent histology was diffuse large B cell type (33 patients). We used the Kaplan-Meier method to calculate the survival rate and Cox's proportional hazards model to analyze the prognostic factors. The five-year cumulative survival rate was 25%, and the median survival time was 22.7 months. The five-year disease-free survival rate was 23%. In monovariate analysis, patients who were both younger than 60 years old and had a World Health Organization (WHO) performance status (PS) score equal to or less than 2 showed a better survival rate. Furthermore, the patients receiving systemic chemotherapy showed a significantly better local control rate. In addition, patients who received systemic chemotherapy achieved a higher complete remission rate than those not receiving it. However, no factors that significantly influenced survival rate were identified in multivariate analysis. We demonstrated that the therapeutic outcome of PCNSL patients has recently improved. In particular, patients with good PS showed better local control than those with poor PS. However, we could not identify any significant prognostic factors in PCNSL patients. (author)

  9. Risk Factors for Neovascular Glaucoma After Proton Beam Therapy of Uveal Melanoma: A Detailed Analysis of Tumor and Dose–Volume Parameters

    International Nuclear Information System (INIS)

    Mishra, Kavita K.; Daftari, Inder K.; Weinberg, Vivian; Cole, Tia; Quivey, Jeanne M.; Castro, Joseph R.; Phillips, Theodore L.; Char, Devron H.

    2013-01-01

    Purpose: To determine neovascular glaucoma (NVG) incidence and identify contributing tumor and dosing factors in uveal melanoma patients treated with proton beam radiation therapy (PBRT). Methods and Materials: A total of 704 PBRT patients treated by a single surgeon (DHC) for uveal melanoma (1996-2010) were reviewed for NVG in our prospectively maintained database. All patients received 56 GyE in 4 fractions. Median follow-up was 58.3 months. Analyses included the Kaplan-Meier method to estimate NVG distributions, univariate log–rank tests, and Cox's proportional hazards multivariate analysis using likelihood ratio tests to identify independent risk factors of NVG among patient, tumor, and dose–volume histogram parameters. Results: The 5-year PBRT NVG rate was 12.7% (95% confidence interval [CI] 10.2%-15.9%). The 5-year rate of enucleation due to NVG was 4.9% (95% CI 3.4%-7.2%). Univariately, the NVG rate increased significantly with larger tumor diameter (P 30% of the lens or ciliary body received ≥50% dose (≥28 GyE), there was a higher probability of NVG (P 0%-30% vs >30%) (P=.01), and optic nerve length treated to ≥90% Dose (≤1 mm vs >1 mm) (P=.02). Conclusions: Our current PBRT patients experience a low rate of NVG and resultant enucleation compared with historical data. The present analysis shows that tumor height, diameter, and anterior as well as posterior critical structure dose–volume parameters may be used to predict NVG risk

  10. Statistical analysis of water-quality data containing multiple detection limits II: S-language software for nonparametric distribution modeling and hypothesis testing

    Science.gov (United States)

    Lee, L.; Helsel, D.

    2007-01-01

    Analysis of low concentrations of trace contaminants in environmental media often results in left-censored data that are below some limit of analytical precision. Interpretation of values becomes complicated when there are multiple detection limits in the data-perhaps as a result of changing analytical precision over time. Parametric and semi-parametric methods, such as maximum likelihood estimation and robust regression on order statistics, can be employed to model distributions of multiply censored data and provide estimates of summary statistics. However, these methods are based on assumptions about the underlying distribution of data. Nonparametric methods provide an alternative that does not require such assumptions. A standard nonparametric method for estimating summary statistics of multiply-censored data is the Kaplan-Meier (K-M) method. This method has seen widespread usage in the medical sciences within a general framework termed "survival analysis" where it is employed with right-censored time-to-failure data. However, K-M methods are equally valid for the left-censored data common in the geosciences. Our S-language software provides an analytical framework based on K-M methods that is tailored to the needs of the earth and environmental sciences community. This includes routines for the generation of empirical cumulative distribution functions, prediction or exceedance probabilities, and related confidence limits computation. Additionally, our software contains K-M-based routines for nonparametric hypothesis testing among an unlimited number of grouping variables. A primary characteristic of K-M methods is that they do not perform extrapolation and interpolation. Thus, these routines cannot be used to model statistics beyond the observed data range or when linear interpolation is desired. For such applications, the aforementioned parametric and semi-parametric methods must be used.

  11. From clinical evidence to everyday practice: implementing findings from a cost-effectiveness analysis for endoscopic injection therapy for upper-gastrointestinal bleeding.

    Science.gov (United States)

    Sitter, Helmut; Lorenz, Wilfried; Nicolay, Uwe; Krack, Walter; Hellenbrandt, Armin; Zielke, Andreas; Gajek, Hartwig; Ledertheil, Gertrud

    2003-03-01

    A previous upper-gastrointestinal bleeding trial showed that patients treated with repeated fibrin glue injection for upper-gastrointestinal bleeding have significantly less rebleeding than those treated with polidocanol. To analyse the cost and effectiveness of repeated fibrin glue injection and to investigate whether these results change physicians' attitudes. A retrospective random sample of five hospitals from the previous study, collection of cost identification, and follow-up data on 320 patients (155 in the polidocanol group, 165 in the fibrin glue group). An incremental cost-effectiveness analysis and comparison of outcomes was performed using chi-squared tests and Kaplan-Meier survival analysis. A survey was carried out using a questionnaire in the five hospitals on local guidelines for management of ulcer bleeding, and its results were analysed qualitatively. The measure of effectiveness is the number of prevented rebleedings. Further variables were length of hospital stay and length of intensive care unit (ICU) stay. The cost for the prevention of one additional rebleeding by repeated fibrin glue treatment amounts to 14,316 +/- 4981 euros (incremental cost-effectiveness ratio). There were no significant differences in length of stays in ICU or in hospital. The physicians did not change their management plans for patients with upper-gastrointestinal bleeding. In a survey, it was seen that other factors, such as local guidelines, attitudes towards new treatment options, and ease of handling of drugs, are more important than a result of a single study for a behavioural change of the doctors. The study was not designed prospectively to address a pharmacoeconomic question. As relevant variables (e.g. length of ICU stay) could not be reliably ascertained retrospectively, this may lead to biased estimates of the incremental cost-effectiveness ratio.

  12. Therapeutic effect and prognostic analysis of intensity-modulated radiotherapy for primary hepatocellular carcinoma with portal vein and/or inferior vena cava tumor thrombus

    Directory of Open Access Journals (Sweden)

    HUANG Long

    2015-06-01

    Full Text Available ObjectiveTo determine the efficacy and prognostic factors of intensity-modulated radiotherapy (IMRT for primary hepatocellular carcinoma (HCC with portal vein and/or inferior vena cava tumor thrombus. MethodsTwenty-three HCC patients with portal vein and/or inferior vena cava tumor thrombus received IMRT with an 8 MV linear accelerator at the Cancer Center of General Hospital of Armed Police Forces, Anhui Medical University, from April 2008 to August 2011. A single dose of 3 to 6 Gy was delivered at five fractions per week, with a total dose of 56 to 96 Gy and a median dose of 60 Gy. Survival time was recorded, and adverse reactions were evaluated. Survival rate calculation and survival analysis were performed using the Kaplan-Meier method. Comparison of categorical between two groups was made by chi-square test. ResultsOne patient did not complete radiotherapy due to upper gastrointestinal bleeding. Of 22 patients who completed IMRT, 4 achieved complete remission and 10 achieved partial remission, with an overall response rate of 63.7%. Our analysis showed that the type of tumor thrombus and tumor size were associated with tumor response rate and were significant prognostic factors (P<0.05. The median survival time was 13.4 months. The 1-, 2-, and 3-year survival rates were 59%, 27%, and 18%, respectively. The 22 patients who completed radiotherapy did not experience acute radiation injury or late adverse outcomes such as radiation-induced liver disease. ConclusionThis study suggests IMRT is a safe and effective treatment option for HCC patients with portal vein and/or inferior vena cava tumor thrombus.

  13. Cost-effectiveness of left ventricular assist devices for patients with end-stage heart failure: analysis of the French hospital discharge database.

    Science.gov (United States)

    Tadmouri, Abir; Blomkvist, Josefin; Landais, Cécile; Seymour, Jerome; Azmoun, Alexandre

    2018-02-01

    Although left ventricular assist devices (LVADs) are currently approved for coverage and reimbursement in France, no French cost-effectiveness (CE) data are available to support this decision. This study aimed at estimating the CE of LVAD compared with medical management in the French health system. Individual patient data from the 'French hospital discharge database' (Medicalization of information systems program) were analysed using Kaplan-Meier method. Outcomes were time to death, time to heart transplantation (HTx), and time to death after HTx. A micro-costing method was used to calculate the monthly costs extracted from the Program for the Medicalization of Information Systems. A multistate Markov monthly cycle model was developed to assess CE. The analysis over a lifetime horizon was performed from the perspective of the French healthcare payer; discount rates were 4%. Probabilistic and deterministic sensitivity analyses were performed. Outcomes were quality-adjusted life years (QALYs) and incremental CE ratio (ICER). Mean QALY for an LVAD patient was 1.5 at a lifetime cost of €190 739, delivering a probabilistic ICER of €125 580/QALY [95% confidence interval: 105 587 to 150 314]. The sensitivity analysis showed that the ICER was mainly sensitive to two factors: (i) the high acquisition cost of the device and (ii) the device performance in terms of patient survival. Our economic evaluation showed that the use of LVAD in patients with end-stage heart failure yields greater benefit in terms of survival than medical management at an extra lifetime cost exceeding the €100 000/QALY. Technological advances and device costs reduction shall hence lead to an improvement in overall CE. © 2017 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of the European Society of Cardiology.

  14. Number of Lymph Nodes Removed and Survival after Gastric Cancer Resection: An Analysis from the US Gastric Cancer Collaborative.

    Science.gov (United States)

    Gholami, Sepideh; Janson, Lucas; Worhunsky, David J; Tran, Thuy B; Squires, Malcolm Hart; Jin, Linda X; Spolverato, Gaya; Votanopoulos, Konstantinos I; Schmidt, Carl; Weber, Sharon M; Bloomston, Mark; Cho, Clifford S; Levine, Edward A; Fields, Ryan C; Pawlik, Timothy M; Maithel, Shishir K; Efron, Bradley; Norton, Jeffrey A; Poultsides, George A

    2015-08-01

    Examination of at least 16 lymph nodes (LNs) has been traditionally recommended during gastric adenocarcinoma resection to optimize staging, but the impact of this strategy on survival is uncertain. Because recent randomized trials have demonstrated a therapeutic benefit from extended lymphadenectomy, we sought to investigate the impact of the number of LNs removed on prognosis after gastric adenocarcinoma resection. We analyzed patients who underwent gastrectomy for gastric adenocarcinoma from 2000 to 2012, at 7 US academic institutions. Patients with M1 disease or R2 resections were excluded. Disease-specific survival (DSS) was calculated using the Kaplan-Meier method and compared using log-rank and Cox regression analyses. Of 742 patients, 257 (35%) had 7 to 15 LNs removed and 485 (65%) had ≥16 LNs removed. Disease-specific survival was not significantly longer after removal of ≥16 vs 7 to 15 LNs (10-year survival, 55% vs 47%, respectively; p = 0.53) for the entire cohort, but was significantly improved in the subset of patients with stage IA to IIIA (10-year survival, 74% vs 57%, respectively; p = 0.018) or N0-2 disease (72% vs 55%, respectively; p = 0.023). Similarly, for patients who were classified to more likely be "true N0-2," based on frequentist analysis incorporating both the number of positive and of total LNs removed, the hazard ratio for disease-related death (adjusted for T stage, R status, grade, receipt of neoadjuvant and adjuvant therapy, and institution) significantly decreased as the number of LNs removed increased. The number of LNs removed during gastrectomy for adenocarcinoma appears itself to have prognostic implications for long-term survival. Copyright © 2015 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  15. Repair or Replacement for Isolated Tricuspid Valve Pathology? Insights from a Surgical Analysis on Long-Term Survival

    Science.gov (United States)

    Farag, Mina; Arif, Rawa; Sabashnikov, Anton; Zeriouh, Mohamed; Popov, Aron-Frederik; Ruhparwar, Arjang; Schmack, Bastian; Dohmen, Pascal M.; Szabó, Gábor; Karck, Matthias; Weymann, Alexander

    2017-01-01

    Background Long-term follow-up data concerning isolated tricuspid valve pathology after replacement or reconstruction is limited. Current American Heart Association guidelines equally recommend repair and replacement when surgical intervention is indicated. Our aim was to investigate and compare operative mortality and long-term survival in patients undergoing isolated tricuspid valve repair surgery versus replacement. Material/Methods Between 1995 and 2011, 109 consecutive patients underwent surgical correction of tricuspid valve pathology at our institution for varying structural pathologies. A total of 41 (37.6%) patients underwent tricuspid annuloplasty/repair (TAP) with or without ring implantation, while 68 (62.3%) patients received tricuspid valve replacement (TVR) of whom 36 (53%) were mechanical and 32 (47%) were biological prostheses. Results Early survival at 30 days after surgery was 97.6% in the TAP group and 91.1% in the TVR group. After 6 months, 89.1% in the TAP group and 87.8% in the TVR group were alive. In terms of long-term survival, there was no further mortality observed after one year post surgery in both groups (Log Rank p=0.919, Breslow p=0.834, Tarone-Ware p=0.880) in the Kaplan-Meier Survival analysis. The 1-, 5-, and 8-year survival rates were 85.8% for TAP and 87.8% for TVR group. Conclusions Surgical repair of the tricuspid valve does not show survival benefit when compared to replacement. Hence valve replacement should be considered generously in patients with reasonable suspicion that regurgitation after repair will reoccur. PMID:28236633

  16. Benign biliary strictures refractory to standard bilioplasty treated using polydoxanone biodegradable biliary stents: retrospective multicentric data analysis on 107 patients.

    Science.gov (United States)

    Mauri, Giovanni; Michelozzi, Caterina; Melchiorre, Fabio; Poretti, Dario; Pedicini, Vittorio; Salvetti, Monica; Criado, Eva; Falcò Fages, Joan; De Gregorio, Miguel Ángel; Laborda, Alicia; Sonfienza, Luca Maria; Cornalba, Gianpaolo; Monfardini, Lorenzo; Panek, Jiri; Andrasina, Tomas; Gimenez, Mariano

    2016-11-01

    To assess mid-term outcome of biodegradable biliary stents (BBSs) to treat benign biliary strictures refractory to standard bilioplasty. Institutional review board approval was obtained and patient consent was waived. 107 patients (61 males, 46 females, mean age 59 ± 16 years), were treated. Technical success and complications were recorded. Ninety-seven patients (55 males, 42 females, aged 57 ± 17 years) were considered for follow-up analysis (mean follow-up 23 ± 12 months). Fisher's exact test and Mann-Whitney U tests were used and a Kaplan-Meier curve was calculated. The procedure was always feasible. In 2/107 cases (2 %), stent migration occurred (technical success 98 %). 4/107 patients (4 %) experienced mild haemobilia. No major complications occurred. In 19/97 patients (18 %), stricture recurrence occurred. In this group, higher rate of subsequent cholangitis (84.2 % vs. 12.8 %, p = 0.001) and biliary stones (26.3 % vs. 2.5 %, p = 0.003) was noted. Estimated mean time to stricture recurrence was 38 months (95 % C.I 34-42 months). Estimated stricture recurrence rate at 1, 2, and 3 years was respectively 7.2 %, 26.4 %, and 29.4 %. Percutaneous placement of a BBS is a feasible and safe strategy to treat benign biliary strictures refractory to standard bilioplasty, with promising results in the mid-term period. • Percutaneous placement of a BBS is 100 % feasible. • The procedure appears free from major complications, with few minor complications. • BBSs offer promising results in the mid-term period. • With a BBS, external catheter/drainage can be removed early. • BBSs represent a new option in treating benign biliary stenosis.

  17. Structure-Function Analysis of Nonarteritic Anterior Ischemic Optic Neuropathy and Age-Related Differences in Outcome.

    Science.gov (United States)

    Sun, Ming-Hui; Liao, Yaping Joyce

    2017-09-01

    The optic nerve head is vulnerable to ischemia leading to anterior ischemic optic neuropathy (AION), the most common acute optic neuropathy in those older than 50 years of age. We performed a cross-sectional study of 55 nonarteritic anterior ischemic optic neuropathy (NAION) eyes in 34 patients to assess clinical outcome and perform structure-function correlations. The peak age of NAION onset was between 50 and 55 years. Sixty-seven percent of patients presented with their first event between the ages of 40 and 60 years, and 32% presented at ≤50 years. Those with NAION onset at age ≤50 years did not have significantly better visual outcome per logMAR visual acuity, automated perimetric mean deviation (PMD) or optical coherence tomography (OCT) measurements. Kaplan-Meier survival curve and multivariate Cox proportional regression analysis showed that age >50 years at NAION onset was associated with greater risk of second eye involvement, with hazard ratio of 20. Older age at onset was significantly correlated with greater thinning of the ganglion cell complex (GCC) (P = 0.022) but not with logMAR visual acuity, PMD, or thinning of retinal nerve fiber layer (RNFL). Using area under receiver operating characteristic curve analyses, we found that thinning of RNFL and GCC was best able to predict visual outcome, and that mean RNFL thickness >65 μm or macular GCC thickness >55 μm significantly correlated with good visual field outcome. We showed that NAION onset at age >50 years had a greater risk of second eye involvement. Patients with OCT mean RNFL thickness >65 μm and mean macular ganglion cell complex thickness >55 μm had better visual outcomes.

  18. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

    Science.gov (United States)

    Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

    2017-01-01

    Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

  19. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

    Directory of Open Access Journals (Sweden)

    Sang Y Lee

    Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

  20. Assessment of Various Risk Factors for Success of Delayed and Immediate Loaded Dental Implants: A Retrospective Analysis.

    Science.gov (United States)

    Prasant, M C; Thukral, Rishi; Kumar, Sachin; Sadrani, Sannishth M; Baxi, Harsh; Shah, Aditi

    2016-10-01

    Ever since its introduction in 1977, a minimum of few months of period is required for osseointegration to take place after dental implant surgery. With the passage of time and advancements in the fields of dental implant, this healing period is getting smaller and smaller. Immediate loading of dental implants is becoming a very popular procedure in the recent time. Hence, we retrospectively analyzed the various risk factors for the failure of delayed and immediate loaded dental implants. In the present study, retrospective analysis of all the patients was done who underwent dental implant surgeries either by immediate loading procedure or by delayed loading procedures. All the patients were divided broadly into two groups with one group containing patients in which delayed loaded dental implants were placed while other consisted of patients in whom immediate loaded dental implants were placed. All the patients in whom follow-up records were missing and who had past medical history of any systemic diseases were excluded from the present study. Evaluation of associated possible risk factors was done by classifying the predictable factors as primary and secondary factors. All the results were analyzed by Statistical Package for the Social Sciences (SPSS) software. Kaplan-Meier survival analyses and chi-square test were used for assessment of level of significance. In delayed and immediate group of dental implants, mean age of the patients was 54.2 and 54.8 years respectively. Statistically significant results were obtained while comparing the clinical parameters of the dental implants in both the groups while demographic parameters showed nonsignificant correlation. Significant higher risk of dental implant failure is associated with immediate loaded dental implants. Tobacco smoking, shorter implant size, and other risk factors play a significant role in predicting the success and failure of dental implants. Delayed loaded dental implant placement should be preferred

  1. Marital status and survival in patients with rectal cancer: An analysis of the Surveillance, Epidemiology and End Results (SEER) database.

    Science.gov (United States)

    Wang, Xiangyang; Cao, Weilan; Zheng, Chenguo; Hu, Wanle; Liu, Changbao

    2018-06-01

    Marital status has been validated as an independent prognostic factor for survival in several cancer types, but is controversial in rectal cancer (RC). The objective of this study was to investigate the impact of marital status on the survival outcomes of patients with RC. We extracted data of 27,498 eligible patients diagnosed with RC between 2004 and 2009 from the Surveillance, Epidemiology and End Results (SEER) database. Patients were categorized into married, never married, divorced/separated and widowed groups.We used Chi-square tests to compare characteristics of patients with different marital status.Rectal cancer specific survival was compared using the Kaplan-Meier method,and multivariate Cox regression analyses was used to analyze the survival outcome risk factors in different marital status. The widowed group had the highest percentage of elderly patients and women,higher proportion of adenocarcinomas, and more stage I/II in tumor stage (P married group (76.7% VS 85.4%). Compared with the married patients, the never married (HR 1.40), widowed (HR 1.61,) and divorced/separated patients (HR 1.16) had an increased overall 5-year mortality. A further analysis showed that widowed patients had an increased overall 5-year cause-specific survival(CSS) compared with married patients at stage I(HR 1.92),stage II (HR 1.65),stage III (HR 1.73),and stage IV (HR 1.38). Our study showed marriage was associated with better outcomes of RC patients, but unmarried RC patients, especially widowed patients,are at greater risk of cancer specific mortality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Invasive micropapillary carcinoma of the breast has a better long-term survival than invasive ductal carcinoma of the breast in spite of its aggressive clinical presentations: a comparison based on large population database and case-control analysis.

    Science.gov (United States)

    Chen, Hongliang; Wu, Kejin; Wang, Maoli; Wang, Fuwen; Zhang, Mingdi; Zhang, Peng

    2017-12-01

    There are controversies in the comparison of overall survival between invasive micropapillary carcinoma of the breast (IMPC) and invasive ductal carcinoma (IDC). The objective of this study was to compare the long-term survival outcome between non-metastatic IMPC and IDC. The Surveillance, Epidemiology, and End Results database was searched to identify women with non-metastatic IMPC and IDC diagnosed between 2001 and 2013. Comparisons of patient and tumor characteristics were performed using Pearson's chi-square. The propensity score matching method was applied with each IMPC matched to one IDC. Breast cancer-specific survival (BCSS) and overall survival (OS) were estimated using the Kaplan-Meier product limit method and compared across groups using the log-rank statistic. Multivariate analysis was performed through Cox models. IMPC was presented with aggressive clinical presentations such as larger tumor, more positive lymph nodes, and more advanced stage compared with IDC. A higher rate of estrogen receptor (ER)/progesterone receptor (PR) positivity was also observed in IMPC. With a median follow-up of 64 months, IMPC had a better BCSS (P = 0.031) and OS (P = 0.012) compared with IDC. In a case-control analysis IMPC was still an independent favorable prognostic factor for BCSS (HR = 0.410, P analysis, IMPC always showed a better survival outcome compared with IDC except in AJCC stage I and histologic grade I disease. IMPC has a better long-term survival outcome compared with IDC in spite of its highly aggressive clinical presentation. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  3. The Influence of Total Nodes Examined, Number of Positive Nodes, and Lymph Node Ratio on Survival After Surgical Resection and Adjuvant Chemoradiation for Pancreatic Cancer: A Secondary Analysis of RTOG 9704

    Energy Technology Data Exchange (ETDEWEB)

    Showalter, Timothy N. [Department of Radiation Oncology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA (United States); Winter, Kathryn A. [Radiation Therapy Oncology Group, RTOG Statistical Center, Philadelphia, PA (United States); Berger, Adam C., E-mail: adam.berger@jefferson.edu [Department of Surgery, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA (United States); Regine, William F. [Department of Radiation Oncology, University of Maryland Medical Center, Baltimore, MD (United States); Abrams, Ross A. [Department of Radiation Oncology, Rush University Medical Center, Chicago, IL (United States); Safran, Howard [Department of Medicine, Miriam Hospital, Brown University Oncology Group, Providence, RI (United States); Hoffman, John P. [Department of Surgical Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Benson, Al B. [Division of Hematology-Oncology, Northwestern University, Chicago, IL (United States); MacDonald, John S. [St. Vincent' s Cancer Care Center, New York, NY (United States); Willett, Christopher G. [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States)

    2011-12-01

    Purpose: Lymph node status is an important predictor of survival in pancreatic cancer. We performed a secondary analysis of Radiation Therapy Oncology Group (RTOG) 9704, an adjuvant chemotherapy and chemoradiation trial, to determine the influence of lymph node factors-number of positive nodes (NPN), total nodes examined (TNE), and lymph node ratio (LNR ratio of NPN to TNE)-on OS and disease-free survival (DFS). Patient and Methods: Eligible patients from RTOG 9704 form the basis of this secondary analysis of lymph node parameters. Actuarial estimates for OS and DFS were calculated using Kaplan-Meier methods. Cox proportional hazards models were performed to evaluate associations of NPN, TNE, and LNR with OS and DFS. Multivariate Cox proportional hazards models were also performed. Results: There were 538 patients enrolled in the RTOG 9704 trial. Of these, 445 patients were eligible with lymph nodes removed. Overall median NPN was 1 (min-max, 0-18). Increased NPN was associated with worse OS (HR = 1.06, p = 0.001) and DFS (HR = 1.05, p = 0.01). In multivariate analyses, both NPN and TNE were associated with OS and DFS. TNE > 12, and >15 were associated with increased OS for all patients, but not for node-negative patients (n = 142). Increased LNR was associated with worse OS (HR = 1.01, p < 0.0001) and DFS (HR = 1.006, p = 0.002). Conclusion: In patients who undergo surgical resection followed by adjuvant chemoradiation, TNE, NPN, and LNR are associated with OS and DFS. This secondary analysis of a prospective, cooperative group trial supports the influence of these lymph node parameters on outcomes after surgery and adjuvant therapy using contemporary techniques.

  4. Intra-arterial therapy of neuroendocrine tumour liver metastases: comparing conventional TACE, drug-eluting beads TACE and yttrium-90 radioembolisation as treatment options using a propensity score analysis model

    Energy Technology Data Exchange (ETDEWEB)

    Minh, Duc Do; Gorodetski, Boris; Smolka, Susanne; Savic, Lynn Jeanette; Wainstejn, David [Charite Universitaetsmedizin, Campus Virchow Klinikum, Department of Diagnostic and Interventional Radiology, Berlin (Germany); Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Chapiro, Julius; Schlachter, Todd [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Huang, Qiang [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Capital Medical University, Department of Interventional Radiology, Beijing Chaoyang Hospital, Beijing (China); Liu, Cuihong [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Shandong Provincial Hospital Affiliated to Shandong University, The Ultrasound Department, Jinan (China); Lin, MingDe [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States); Philips Research North America, U/S Imaging and Interventions (UII), Cambridge, MA (United States); Gebauer, Bernhard [Charite Universitaetsmedizin, Campus Virchow Klinikum, Department of Diagnostic and Interventional Radiology, Berlin (Germany); Geschwind, Jean-Francois [Yale University School of Medicine, Department of Radiology and Biomedical Imaging, New Haven, CT (United States)

    2017-12-15

    To compare efficacy, survival outcome and prognostic factors of conventional transarterial chemoembolisation (cTACE), drug-eluting beads TACE (DEB-TACE) and yttrium-90 radioembolisation (Y90) for the treatment of liver metastases from gastroenteropancreatic (GEP) neuroendocrine tumours (NELM). This retrospective analysis included 192 patients (58.6 years mean age, 56% men) with NELM treated with cTACE (N = 122), DEB-TACE (N = 26) or Y90 (N = 44) between 2000 and 2014. Radiologic response to therapy was assessed according to Response Evaluation Criteria in Solid Tumours (RECIST) and World Health Organization (WHO) criteria using periprocedural MR imaging. Survival analysis included propensity score analysis (PSA), median overall survival (MOS), hepatic progression-free survival, Kaplan-Meier using log-rank test and the uni- and multivariate Cox proportional hazards model (MVA). MOS of the entire study population was 28.8 months. As for cTACE, DEB-TACE and Y90, MOS was 33.8 months, 21.7 months and 23.6 months, respectively. According to the MVA, cTACE demonstrated a significantly longer MOS as compared to DEB-TACE (p <.01) or Y90 (p =.02). The 5-year survival rate after initial cTACE, DEB-TACE and Y90 was 28.2%, 10.3% and 18.5%, respectively. Upon PSA, our study suggests significant survival benefits for patients treated with cTACE as compared to DEB-TACE and Y90. This data supports the therapeutic decision for cTACE as the primary intra-arterial therapy option in patients with unresectable NELM until proven otherwise. (orig.)

  5. Survival analysis according to the receiver tumoral expression profile of the epidermal growth factor - 2 (HER2), the estrogen receptor (ER) and progesterone receptor (RP) in Uruguayan patients with breast cancer

    International Nuclear Information System (INIS)

    Camejo, N.; Gonzalez, V.; Ferrero, L.; Castillo, C.; Delgado, L.; Fresco, R.; Santander, G.; Aguiar, S.; Heinzen, S.; Martinez, A.; Maurizt, S.; Meyer, C.; Sena, G.; Spera, G.; Ubillos, L.; Xavier, F.; Deneo, H.; Aghazarian, M.; Rodriguez, R.; Sabini, G.

    2010-01-01

    Breast cancer (CM), the leading cause of death from cancer in Uruguayan women, is a heterogeneous disease. The study of the expression level of tumor hormone receptor (H R) and Her-2 neu can recognize subtypes with different characteristics. We have previously reported the relationship of these with the clinico pathological features. To analyze the PFS (SVLP) as the biological subtype (patients HR + / HER2 - triple negative (TN) and HER2 +) in Uruguayan patients with breast cancer EI-IIII Methodology: A retrospective study where SVLP 169 cancer patients carrying analyzed breast E I-III, diagnosed between March 2006 and March 2008 from the Clinical Hospital, Military Hospital, INCA and CASMU. SVLP analysis was performed according to different biological subtypes using the Kaplan method Meier and statistical significance of differences was assessed by the log-rank test. Results: The median follow-up was 43 months. At the time of analysis 160 patients (94.7%) are alive and 141 (83.4%) are relapse-free. One hundred twenty-three patients were HR + / HER2 - (72.7%), 32 patients were TN (18.9%) and 14 were HER2 + patients (8.2%). The SVLP to two years for the total of patients was 92.3%, 94% for HR + / HER2 - 91% for TN and 71.4% for HER2 +. Comparing the curves for different subtypes SVLP showed lower for SVLP He r2 + patients compared to patients HR + / HER2 - (p = 0.03) and TN (p 0.11). The median survival was not reached globally or in the subgroup analysis. Conclusions: He r2 + patients have a shorter time to relapse which coincides as reported in the literature. SVLP similar to 2 years and overlapping of curves SVLP Patients HR + / HER2 - and TN not be explained by differences in characteristics clinico pathological

  6. Clinical Outcomes from Androgen Signaling-directed Therapy after Treatment with Abiraterone Acetate and Prednisone in Patients with Metastatic Castration-resistant Prostate Cancer: Post Hoc Analysis of COU-AA-302.

    Science.gov (United States)

    Smith, Matthew R; Saad, Fred; Rathkopf, Dana E; Mulders, Peter F A; de Bono, Johann S; Small, Eric J; Shore, Neal D; Fizazi, Karim; Kheoh, Thian; Li, Jinhui; De Porre, Peter; Todd, Mary B; Yu, Margaret K; Ryan, Charles J

    2017-07-01

    In the COU-AA-302 trial, abiraterone acetate plus prednisone significantly increased overall survival for patients with chemotherapy-naïve metastatic castration-resistant prostate cancer (mCRPC). Limited information exists regarding response to subsequent androgen signaling-directed therapies following abiraterone acetate plus prednisone in patients with mCRPC. We investigated clinical outcomes associated with subsequent abiraterone acetate plus prednisone (55 patients) and enzalutamide (33 patients) in a post hoc analysis of COU-AA-302. Prostate-specific antigen (PSA) response was assessed. Median time to PSA progression was estimated using the Kaplan-Meier method. The PSA response rate (≥50% PSA decline, unconfirmed) was 44% and 67%, respectively. The median time to PSA progression was 3.9 mo (range 2.6-not estimable) for subsequent abiraterone acetate plus prednisone and 2.8 mo (range 1.8-not estimable) for subsequent enzalutamide. The majority of patients (68%) received intervening chemotherapy before subsequent abiraterone acetate plus prednisone or enzalutamide. While acknowledging the limitations of post hoc analyses and high censoring (>75%) in both treatment groups, these results suggest that subsequent therapy with abiraterone acetate plus prednisone or enzalutamide for patients who progressed on abiraterone acetate is associated with limited clinical benefit. This analysis showed limited clinical benefit for subsequent abiraterone acetate plus prednisone or enzalutamide in patients with metastatic castration-resistant prostate cancer following initial treatment with abiraterone acetate plus prednisone. This analysis does not support prioritization of subsequent abiraterone acetate plus prednisone or enzalutamide following initial therapy with abiraterone acetate plus prednisone. Copyright © 2017 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  7. Third-line Targeted Therapy in Metastatic Renal Cell Carcinoma: Results from the International Metastatic Renal Cell Carcinoma Database Consortium

    DEFF Research Database (Denmark)

    Wells, J Connor; Stukalin, Igor; Norton, Craig

    2017-01-01

    and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...

  8. Concurrent chemoradiotherapy plus adjuvant chemotherapy versus concurrent chemoradiotherapy in locoregionally advanced nasopharyngeal carcinoma. A matched-pair multicenter analysis of outcomes

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Yi-Yuan [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China); Guilin Medical University Affiliated Hospital, Department of Otorhinolaryngology, Guilin (China); Xiang, Chun [Nan Xishan Hospital, Department of Otorhinolaryngology, Guilin (China); Lu, Jian-Xun [Affiliated Hospital of Youjiang Medical University for Nationalities, Department of Oncology, Baise (China); Su, Yi-Xin [Lingshan People' s Hospital, Department of Radiation Oncology, Lingshan (China); Pan, Yu-Fei [Nan Xishan Hospital, Department of Radiation Oncology, Guilin (China); Cai, Rui; Zhang, Rong-Jun; He, Zhuo-Kai; Liu, Mei-Lian; Huang, Hui; Bai, Xue; Tang, Hua-Ying; Shi, Yun-Hua; Wang, Yan; Jiang, Wei [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China)

    2016-06-15

    The benefit of adjuvant chemotherapy (AC) in locoregionally advanced nasopharyngeal carcinoma (NPC) is controversial. This study compared concurrent chemoradiotherapy plus AC (CCRT/AC) with CCRT. Pair-matched analysis based on eight clinicopathological features of 244 patients treated with platinum-based CCRT/AC or CCRT alone was performed. Survival outcomes were assessed using the Kaplan-Meier method and log-rank test. Toxicities and response rates were compared using Fisher's exact test. Four-year overall survival, progression-free survival, distant failure-free survival, and locoregional failure-free survival were 72 %, 61 %, 71 %, and 81 %, respectively, for the CCRT arm, compared to 74 % (hazard ratio, HR 0.89; 95 % confidence interval, CI 0.64-1.23; P = 0.474), 62 % (HR 0.91, 95 % CI 0.68-1.20, P = 0.489), 73 % (HR 0.84, 95 % CI 0.59-1.18, P = 0.316), and 84 % (HR 0.84, 95 % CI 0.52-1.24, P = 0.323), respectively, for the CCRT/AC arm. Cox multivariate regression analysis demonstrated AC was not an independent prognostic factor. Overall, there was a higher incidence of grade 3-4 toxicities in the CCRT/AC arm. The most common grade 3-4 adverse events in the CCRT/AC arm were vomiting (27 %), nausea (43 %), leukopenia/neutropenia (23 %), thrombocytopenia (8.8 %), and anemia (6.2 %). Addition of AC to CCRT increased toxicities but did not improve survival in locoregionally advanced NPC. (orig.) [German] Der Nutzen der adjuvanten Chemotherapie (AC) bei lokoregional fortgeschrittenem nasopharyngealem Karzinom (NPC) ist kontrovers. In dieser Studie wurde die simultane Radiochemotherapie (''concurrent chemoradiotherapy'', CCRT) plus adjuvante Chemotherapie (AC) mit einer alleinigen CCRT verglichen. Die Matched-pair-Analyse basiert auf acht klinisch-pathologischen Merkmalen von 244 Patienten, die mit platinbasierter CCRT/AC oder alleiniger CCRT behandelt wurden. Die Ueberlebensendpunkte wurden mit der Kaplan-Meier-Methode und dem Log

  9. Analysis of platinum content in biodegradable carboplatin-impregnated beads and retrospective assessment of tolerability for intralesional use of the beads in dogs following excision of subcutaneous sarcomas: 29 cases (2011-2014).

    Science.gov (United States)

    Hess, Theresa A; Drinkhouse, Macy E; Prey, Joshua D; Miller, Jonathan M; Fettig, Arthur A; Carberry, Carol A; Brenn, Stephen H; Bailey, Dennis B

    2018-02-15

    OBJECTIVE To evaluate platinum content in biodegradable carboplatin-impregnated beads and retrospectively assess tolerability and outcome data for dogs treated by intralesional placement of such beads following surgical excision of subcutaneous sarcomas. DESIGN Evaluation study and retrospective case series. SAMPLE 9 carboplatin-impregnated beads and 29 client-owned dogs. PROCEDURES Platinum content in 9 carboplatin-impregnated beads from 3 lots was measured by spectrophotometry, and calculated carboplatin content was compared with the labeled content. Medical records were searched to identify dogs with subcutaneous sarcomas for which treatment included placement of carboplatin-impregnated beads between 2011 and 2014. Signalment, tumor characteristics, surgical and histologic data, adverse events, and local recurrences were recorded. Associations between variables of interest and adverse events or local disease-free interval were analyzed. RESULTS In vitro analysis identified a mean ± SD platinum content of 5.38 ± 0.97 mg/bead. Calculated carboplatin content (10.24 ± 1.84 mg/bead) was significantly greater than the labeled amount (4.6 mg/bead). Bead weight and total platinum content differed significantly among lots, but platinum content per bead weight did not. Mild-to-moderate local adverse events were reported for 11 of 29 tumors; all resolved without additional surgery. No dogs had signs of systemic toxicosis. Overall local disease-free rates 1, 2, and 3 years after surgery were 70%, 70%, and 58%, respectively, as determined by Kaplan-Meier analysis. CONCLUSIONS AND CLINICAL RELEVANCE Carboplatin-impregnated beads were well tolerated; however, results of in vitro tests indicated that caution is needed because of manufacturing inconsistencies.

  10. Prognostic implications of serial risk score assessments in patients with pulmonary arterial hypertension: a Registry to Evaluate Early and Long-Term Pulmonary Arterial Hypertension Disease Management (REVEAL) analysis.

    Science.gov (United States)

    Benza, Raymond L; Miller, Dave P; Foreman, Aimee J; Frost, Adaani E; Badesch, David B; Benton, Wade W; McGoon, Michael D

    2015-03-01

    Data from the Registry to Evaluate Early and Long-Term Pulmonary Arterial Hypertension Disease Management (REVEAL) were used previously to develop a risk score calculator to predict 1-year survival. We evaluated prognostic implications of changes in the risk score and individual risk-score parameters over 12 months. Patients were grouped by decreased, unchanged, or increased risk score from enrollment to 12 months. Kaplan-Meier estimates of subsequent 1-year survival were made based on change in the risk score during the initial 12 months of follow-up. Cox regression was used for multivariable analysis. Of 2,529 patients in the analysis cohort, the risk score was decreased in 800, unchanged in 959, and increased in 770 at 12 months post-enrollment. Six parameters (functional class, systolic blood pressure, heart rate, 6-minute walk distance, brain natriuretic peptide levels, and pericardial effusion) each changed sufficiently over time to improve or worsen risk scores in ≥5% of patients. One-year survival estimates in the subsequent year were 93.7%, 90.3%, and 84.6% in patients with a decreased, unchanged, and increased risk score at 12 months, respectively. Change in risk score significantly predicted future survival, adjusting for risk at enrollment. Considering follow-up risk concurrently with risk at enrollment, follow-up risk was a much stronger predictor, although risk at enrollment maintained a significant effect on future survival. Changes in REVEAL risk scores occur in most patients with pulmonary arterial hypertension over a 12-month period and are predictive of survival. Thus, serial risk score assessments can identify changes in disease trajectory that may warrant treatment modifications. Copyright © 2015 International Society for Heart and Lung Transplantation. All rights reserved.

  11. Prognostic value of myocardial perfusion SPECT images in combination with the maximal heart rate at exercise testing in Japanese patients with suspected ischemic heart disease. A sub-analysis of J-ACCESS

    International Nuclear Information System (INIS)

    Ueshima, Kenji; Usami, Satoru; Yasuno, Shinji; Nakao, Kazuwa; Yamashina, Akira; Nishiyama, Osamu; Yamazaki, Takuya; Nishimura, Tsunehiko

    2009-01-01

    We assessed whether a combination of summed stress scores (SSS) using exercise myocardial perfusion single photon emission computed tomography (SPECT) (Ex-SPECT) and maximal heart rate accurately predicts cardiac events through a sub-analysis of J-ACCESS (Japanese Assessment of Cardiac Events and Survival Study by Quantitative Gated SPECT) which was conducted to evaluate the prognosis of Japanese patients with suspected ischemic heart disease. In J-ACCESS, 2,373 patients with suspected coronary artery disease not receiving beta-blocker treatment underwent Ex-SPECT. These patients were categorized into the following four groups: Group A [achieved target heart rate (THR) and SSS<4: n=631], B (did not achieve THR and SSS<4: n=612), C (achieved THR and SSS≥4: n=570), and D (did not achieve THR and SSS≥4: n=560). We evaluated the incidence rate of cardiac events including cardiac death, myocardial infarction, and heart failure requiring hospital admission during a 3-year period. In Group A, B, C, and D, 9 of 631 (1.4%), 15 of 612 (2.4%), 23 of 570 (4.0%) and 30 of 560 (5.4%) patients experienced cardiac events, respectively. Although the hazard ratio of the SSS≥4 was 2.45 (p<0.001) and that of the attained THR was 0.69 (p=0.10) in the multiple Cox regression analysis, Kaplan-Meier curves showed that the cardiac events rate was lower in the order of A, B, C, and D (p<0.001). The combination of SSS using Ex-SPECT and the maximal heart rate is a useful predictor of cardiac events in patients with suspected coronary artery disease. (author)

  12. Radiogenomics of hepatocellular carcinoma: multiregion analysis-based identification of prognostic imaging biomarkers by integrating gene data—a preliminary study

    Science.gov (United States)

    Xia, Wei; Chen, Ying; Zhang, Rui; Yan, Zhuangzhi; Zhou, Xiaobo; Zhang, Bo; Gao, Xin

    2018-02-01

    Our objective was to identify prognostic imaging biomarkers for hepatocellular carcinoma in contrast-enhanced computed tomography (CECT) with biological interpretations by associating imaging features and gene modules. We retrospectively analyzed 371 patients who had gene expression profiles. For the 38 patients with CECT imaging data, automatic intra-tumor partitioning was performed, resulting in three spatially distinct subregions. We extracted a total of 37 quantitative imaging features describing intensity, geometry, and texture from each subregion. Imaging features were selected after robustness and redundancy analysis. Gene modules acquired from clustering were chosen for their prognostic significance. By constructing an association map between imaging features and gene modules with Spearman rank correlations, the imaging features that significantly correlated with gene modules were obtained. These features were evaluated with Cox’s proportional hazard models and Kaplan-Meier estimates to determine their prognostic capabilities for overall survival (OS). Eight imaging features were significantly correlated with prognostic gene modules, and two of them were associated with OS. Among these, the geometry feature volume fraction of the subregion, which was significantly correlated with all prognostic gene modules representing cancer-related interpretation, was predictive of OS (Cox p  =  0.022, hazard ratio  =  0.24). The texture feature cluster prominence in the subregion, which was correlated with the prognostic gene module representing lipid metabolism and complement activation, also had the ability to predict OS (Cox p  =  0.021, hazard ratio  =  0.17). Imaging features depicting the volume fraction and textural heterogeneity in subregions have the potential to be predictors of OS with interpretable biological meaning.

  13. Worse prognosis in breast cancer patients can be predicted by immunohistochemical analysis of positive MMP-2 and negative estrogen and progesterone receptors

    Directory of Open Access Journals (Sweden)

    Edneia A. S. Ramos

    Full Text Available Summary Introduction: Breast cancer is the most cause of death, and approximately 90% of these deaths are due to metastases. Matrix metalloproteinase-2 (MMP-2 gelatinase activity is able to degrade a major constituent of the tumor microenvironment, type IV collagen. Two well-established proteins used as markers in clinical practice for breast cancer are the receptors for estrogen (ER and progesterone (PR. Although the presence of these receptors has been associated with a better prognosis, loss of these proteins can occur during tumor progression, with subsequent resistance to hormone therapy. Objective: To study the correlation among MMP-2, ER, and PR, as well as the establishment of the metastatic process in primary breast tumors. Method: Breast cancer samples (n=44 were analyzed by immunohistochemistry for MMP-2, ER, and PR. Results: We observed that 90% of patients who had metastases and died showed positive staining for MMP-2 (p=0.0082 for both. Using Kaplan-Meier analysis, we found that negative ER patients who were also positive for MMP-2 had even worse disease-free survival (DFS and overall survival (OS (p= 0.012 and p=0.005, respectively. Similar results were found in PR-negative patients for DFS (a trend p=0.077 and OS (p=0.038. Conclusion: Regardless of our small sample size (n=44, the data obtained strongly suggest that MMP-2 in combination with already well-established markers could help to predict the emergence of metastases and death in patients with breast cancer.

  14. Hepatitis B and C Co-Infection in HIV Patients from the TREAT Asia HIV Observational Database: Analysis of Risk Factors and Survival

    Science.gov (United States)

    Chen, Marcelo; Wong, Wing-Wai; Law, Matthew G.; Kiertiburanakul, Sasisopin; Yunihastuti, Evy; Merati, Tuti Parwati; Lim, Poh Lian; Chaiwarith, Romanee; Phanuphak, Praphan; Lee, Man Po; Kumarasamy, Nagalingeswaran; Saphonn, Vonthanak; Ditangco, Rossana; Sim, Benedict L. H.; Nguyen, Kinh Van; Pujari, Sanjay; Kamarulzaman, Adeeba; Zhang, Fujie; Pham, Thuy Thanh; Choi, Jun Yong; Oka, Shinichi; Kantipong, Pacharee; Mustafa, Mahiran; Ratanasuwan, Winai; Durier, Nicolas; Chen, Yi-Ming Arthur

    2016-01-01

    Background We assessed the effects of hepatitis B (HBV) or hepatitis C (HCV) co-infection on outcomes of antiretroviral therapy (ART) in HIV-infected patients enrolled in the TREAT Asia HIV Observational Database (TAHOD), a multi-center cohort of HIV-infected patients in the Asia-Pacific region. Methods Patients testing HBs antigen (Ag) or HCV antibody (Ab) positive within enrollment into TAHOD were considered HBV or HCV co-infected. Factors associated with HBV and/or HCV co-infection were assessed by logistic regression models. Factors associated with post-ART HIV immunological response (CD4 change after six months) and virological response (HIV RNA <400 copies/ml after 12 months) were also determined. Survival was assessed by the Kaplan-Meier method and log rank test. Results A total of 7,455 subjects were recruited by December 2012. Of patients tested, 591/5656 (10.4%) were HBsAg positive, 794/5215 (15.2%) were HCVAb positive, and 88/4966 (1.8%) were positive for both markers. In multivariate analysis, HCV co-infection, age, route of HIV infection, baseline CD4 count, baseline HIV RNA, and HIV-1 subtype were associated with immunological recovery. Age, route of HIV infection, baseline CD4 count, baseline HIV RNA, ART regimen, prior ART and HIV-1 subtype, but not HBV or HCV co-infection, affected HIV RNA suppression. Risk factors affecting mortality included HCV co-infection, age, CDC stage, baseline CD4 count, baseline HIV RNA and prior mono/dual ART. Shortest survival was seen in subjects who were both HBV- and HCV-positive. Conclusion In this Asian cohort of HIV-infected patients, HCV co-infection, but not HBV co-infection, was associated with lower CD4 cell recovery after ART and increased mortality. PMID:26933963

  15. Impact of Serum Apolipoprotein A-I on Prognosis and Bevacizumab Efficacy in Patients with Metastatic Colorectal Cancer: a Propensity Score-Matched Analysis

    Directory of Open Access Journals (Sweden)

    Qi Quan

    2017-04-01

    Full Text Available PURPOSE: We aimed to investigate the role of apolipoprotein A-I (ApoA-I as a predictor of prognosis and treatment efficacy of bevacizumab in patients with metastatic colorectal cancer (mCRC treated with first-line chemotherapy with or without bevacizumab. METHODS: We conducted a retrospective study on consecutive patients who were diagnosed with mCRC at Sun Yat-sen University Cancer Center. According to their pretreatment ApoA-I level, patients were divided into low– and high–ApoA-I groups. Propensity score-matched method was performed to balance baseline characteristics between two groups. Based on whether they accepted bevacizumab as a first-line therapy, patients were further divided into the chemo + bevacizumab group and the chemo group. Overall survival (OS and progression-free survival (PFS were assessed with Kaplan-Meier method, log-rank test, and Cox regression. RESULTS: The optimal cutoff value for the ApoA-I level was determined to be 1.105 g/l. In the propensity-matched cohort of 508 patients, low ApoA-I was significantly associated with inferior OS (P < .001 and PFS (P < .001 than high ApoA-I. Multivariate analysis showed that ApoA-I level was an independent prognostic maker of OS (P < .001 and PFS (P = .001. PFS (P < .001 in either the high– or low–ApoA-I groups could be extended significantly after the administration of bevacizumab, and patients with a high ApoA-I level also had a better OS in the chemo + bevacizumab group than the chemo group (P = .049. CONCLUSIONS: Patients with a low ApoA-I level have poor prognoses, and they did not display an OS benefit from bevacizumab.

  16. Right mini-parasternotomy may be a good minimally invasive alternative to full sternotomy for cardiac valve operations-a propensity-adjusted analysis.

    Science.gov (United States)

    Chiu, K M; Chen, R J; Lin, T Y; Chen, J S; Huang, J H; Huang, C Y; Chu, S H

    2014-03-26

    Limited realworld data existed for miniparasternotomy approach with good sample size in Asian cohorts and most previous studies were eclipsed by case heterogeneity. The goal of this study was to compare safety and quality outcomes of cardiac noncoronary valve operations by miniparasternotomy and full sternotomy approaches on riskadjusted basis. From our hospital database, we retrieved the cases of non-coronary valve operations from 1 January 2005 to 31 December 2012, including re-do, emergent, and combined procedures. Estimated EuroScore-II and propensity score for choosing mini-parasternotomy were adjusted for in the regression models on hospital mortality, complications (pneumonia, stroke, sepsis, etc.), and quality parameters (length of stay, ICU time, ventilator time, etc.). Non-complicated cases, defined as survival to discharge, ventilator use not over one week, and intensive care unit stay not over two weeks, were used for quality parameters. There were 283 miniparasternotomy and 177 full sternotomy cases. EuroScore-II differed significantly (medians 2.1 vs. 4.7, p<0.001). Propensity scores for choosing miniparasternotomy were higher with lower EuroScore-II (OR=0.91 per 1%, p<0.001), aortic regurgitation (OR=2.3, p=0.005), and aortic non-mitral valve disease (OR=3.9, p<0.001). Adjusted for propensity score and EuroScore-II, mini-parasternotomy group had less pneumonia (OR=0.32, p=0.043), less sepsis (OR=0.31, p=0.045), and shorter non-complicated length of stay (coefficient=7.2 (day), p<0.001) than full sternotomy group, whereas Kaplan-Meier survival, non-complicated ICU time, non-complicated ventilator time, and 30-day mortality did not differ significantly. The propensity-adjusted analysis demonstrated encouraging safety and quality outcomes for mini-parasternotomy valve operation in carefully selected patients.

  17. No Clinically Significant Changes in Pulmonary Function Following Stereotactic Body Radiation Therapy for Early- Stage Peripheral Non-Small Cell Lung Cancer: An Analysis of RTOG 0236

    Energy Technology Data Exchange (ETDEWEB)

    Stanic, Sinisa, E-mail: sinisa.stanic@carle.com [Carle Cancer Center and University of Illinois College of Medicine, Urbana, Illinois (United States); Paulus, Rebecca [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Timmerman, Robert D. [University of Texas Southwestern, Dallas, Texas (United States); Michalski, Jeff M. [Washington University, St. Louis, Missouri (United States); Barriger, Robert B. [Indiana University, Indianapolis, Indiana (United States); Bezjak, Andrea [Princess Margaret Cancer Center, Toronto, Ontario (Canada); Videtic, Gregory M.M. [Cleveland Clinic Foundation, Cleveland, Ohio (United States); Bradley, Jeffrey [Washington University, St. Louis, Missouri (United States)

    2014-04-01

    Purpose: To investigate pulmonary function test (PFT) results and arterial blood gas changes (complete PFT) following stereotactic body radiation therapy (SBRT) and to see whether baseline PFT correlates with lung toxicity and overall survival in medically inoperable patients receiving SBRT for early stage, peripheral, non-small cell lung cancer (NSCLC). Methods and Materials: During the 2-year follow-up, PFT data were collected for patients with T1-T2N0M0 peripheral NSCLC who received effectively 18 Gy × 3 in a phase 2 North American multicenter study (Radiation Therapy Oncology Group [RTOG] protocol 0236). Pulmonary toxicity was graded by using the RTOG SBRT pulmonary toxicity scale. Paired Wilcoxon signed rank test, logistic regression model, and Kaplan-Meier method were used for statistical analysis. Results: At 2 years, mean percentage predicted forced expiratory volume in the first second and diffusing capacity for carbon monoxide declines were 5.8% and 6.3%, respectively, with minimal changes in arterial blood gases and no significant decline in oxygen saturation. Baseline PFT was not predictive of any pulmonary toxicity following SBRT. Whole-lung V5 (the percentage of normal lung tissue receiving 5 Gy), V10, V20, and mean dose to the whole lung were almost identical between patients who developed pneumonitis and patients who were pneumonitis-free. Poor baseline PFT did not predict decreased overall survival. Patients with poor baseline PFT as the reason for medical inoperability had higher median and overall survival rates than patients with normal baseline PFT values but with cardiac morbidity. Conclusions: Poor baseline PFT did not appear to predict pulmonary toxicity or decreased overall survival after SBRT in this medically inoperable population. Poor baseline PFT alone should not be used to exclude patients with early stage lung cancer from treatment with SBRT.

  18. Children who acquire HIV infection perinatally are at higher risk of early death than those acquiring infection through breastmilk: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Renaud Becquet

    Full Text Available Assumptions about survival of HIV-infected children in Africa without antiretroviral therapy need to be updated to inform ongoing UNAIDS modelling of paediatric HIV epidemics among children. Improved estimates of infant survival by timing of HIV-infection (perinatally or postnatally are thus needed.A pooled analysis was conducted of individual data of all available intervention cohorts and randomized trials on prevention of HIV mother-to-child transmission in Africa. Studies were right-censored at the time of infant antiretroviral initiation. Overall mortality rate per 1000 child-years of follow-up was calculated by selected maternal and infant characteristics. The Kaplan-Meier method was used to estimate survival curves by child's HIV infection status and timing of HIV infection. Individual data from 12 studies were pooled, with 12,112 children of HIV-infected women. Mortality rates per 1,000 child-years follow-up were 39.3 and 381.6 for HIV-uninfected and infected children respectively. One year after acquisition of HIV infection, an estimated 26% postnatally and 52% perinatally infected children would have died; and 4% uninfected children by age 1 year. Mortality was independently associated with maternal death (adjusted hazard ratio 2.2, 95%CI 1.6-3.0, maternal CD4<350 cells/ml (1.4, 1.1-1.7, postnatal (3.1, 2.1-4.1 or peri-partum HIV-infection (12.4, 10.1-15.3.These results update previous work and inform future UNAIDS modelling by providing survival estimates for HIV-infected untreated African children by timing of infection. We highlight the urgent need for the prevention of peri-partum and postnatal transmission and timely assessment of HIV infection in infants to initiate antiretroviral care and support for HIV-infected children.

  19. Efficacy analysis of two drugs consisting platinum combined with first-line chemotherapeutics regimens on 117 elderly patients with advanced non-small cell lung carcinoma

    Directory of Open Access Journals (Sweden)

    Li-li ZHANG

    2013-09-01

    Full Text Available Objective To investigate the therapeutic effects of Gemcitabine(GEM, Vinorelbine(NVB,Paclitaxel(TAX and other first-line chemotherapeutics plus platinum containing drugs on the elderly patients with advanced non-small cell lung cancer(NSCLC who had undergone surgery, and analyze the clinicopathological factors influencing the prognosis. Methods One hundred and seventeen advanced NSCLC patients aged 60 or over were treated with GP(GEM+platinum, or NP(NVB+platinum, or TP(TAX+platinum, or other first-line chemotherapeutics plus platinum(OCP after surgery, and their clinical data were then retrospectively studied to look for the relationship of patients' prognosis to clinicopathological factors(gender, operation methods, pathologicaltypes, differentiation, clinical stages.The survival curve was plotted with Kaplan-Meier method, hypothesis test was performed by log-rank, and the independent prognostic factors were screened with Cox proportional hazards regression model. Results Theone-, three- and five-year survival rates of the 117 patients were 47.23%,17.52% and 8.05%, respectively. The progression free survival(PFS of GP, NP, TP and OCP groups were 6.0, 5.2, 6.1 and5.5 months(P>0.05, respectively. The median progression free survival was 5.7 months. Univariate and multivariate analysis showed that the differentiated degrees and clinical stages of elderly NSCLC patients were the independent prognostic factors. Conclusions Clinicopathological factors(differentiated degree andclinical stages are closely related to one-, three- and five-year survival rates of advanced NSCLC in elderly patients who received treatment of first-line chemotherapeutics plus platinum. However, the efficacy ofGP, NP, TP or OCP shows no significant difference.

  20. Higher risk of renal impairment associated with tenofovir use amongst people living with HIV in India: a comparative cohort analysis between Western India and United Kingdom.

    Science.gov (United States)

    Pujari, Sanjay N; Smith, Colette; Makane, Abhimanyu; Youle, Mike; Johnson, Margaret; Bele, Vivek; Joshi, Kedar; Dabhade, Digamber; Bhagani, Sanjay

    2014-03-29

    Data on the renal safety of Tenofovir (TDF) in Low and Middle Income Countries (LMICs) is scarce. We compared development of various forms of renal impairment with use of TDF-containing antiretroviral therapy (ART) between a cohort from the Institute of Infectious Diseases (IID) Pune, Western India and the Royal Free Hospital (RFH) London, UK. This is a retrospective analysis of change in estimated glomerular filtration rates (eGFRs) at 6, 12 and 24 months post TDF initiation using the Modification of Diet in Renal Disease (MDRD) equation. In people living with Human Immunodeficiency virus (PLHIV) with pre-TDF eGFR > 90 ml/min/1.73 m2 time to development of and factors associated with progression to eGFR  90 ml/min/1.73 m2 PLHIV at IID were more likely to develop an eGFR < 60 ml/min/1.73 m2 (aHR = 7.6 [95% CI 3.4, 17.4] p < 0.0001) and had a faster rate of progression estimated using Kaplan Meier methods. Risk factors included age (per 10 years older: aHR = 2.21 [1.6, 3.0] p < 0.0001) and receiving concomitant ritonavir boosted Protease Inhibitor (PI/r) (aHR = 2.4 [1.2, 4.8] p = 0.01). There is higher frequency of treatment limiting renal impairment events amongst PLHIV receiving TDF in Western India. As TDF scale up progresses, programs need to develop capacity for monitoring and treatment of renal impairment associated with TDF.

  1. Survival analysis of increases in care needs associated with dementia and living alone among older long-term care service users in Japan.

    Science.gov (United States)

    Lin, Huei-Ru; Otsubo, Tetsuya; Imanaka, Yuichi

    2017-08-15

    Japan is known for its long life expectancy and rapidly aging society that there are various demands of older adults need to be fulfilled with, and one of them is long-term care needs. Therefore, Japan implemented the Long-Term Care Insurance in year 2000 for citizens who are above 65-year old and citizens who are above 40-year old in needs of long-term care services. This study was undertaken to longitudinally examine the influence of dementia and living alone on care needs increases among older long-term care insurance service users in Japan. Long-term care insurance claims data were used to identify enrollees who applied for long-term care services between October 2010 and September 2011, and subjects were tracked until March 2015. A Kaplan-Meier survival analysis was conducted to examine increases in care needs over time in months. Cox regression models were used to examine the effects of dementia and living alone on care needs increases. The cumulative survival rates before care needs increased over the 4.5-year observation period were 17.6% in the dementia group and 31.9% in the non-dementia group. After adjusting for age, sex, care needs level, and status of living alone, the risk of care needs increases was found to be 1.5 times higher in the dementia group. Living alone was not a significant risk factor of care needs increases, but people with dementia who lived alone had a higher risk of care needs increases than those without dementia. Dementia, older age, the female sex, and lower care needs levels were associated with a higher risk of care needs increases over the study period. Among these variables, dementia had the strongest impact on care needs increases, especially in persons who lived alone.

  2. No Clinically Significant Changes in Pulmonary Function Following Stereotactic Body Radiation Therapy for Early- Stage Peripheral Non-Small Cell Lung Cancer: An Analysis of RTOG 0236

    International Nuclear Information System (INIS)

    Stanic, Sinisa; Paulus, Rebecca; Timmerman, Robert D.; Michalski, Jeff M.; Barriger, Robert B.; Bezjak, Andrea; Videtic, Gregory M.M.; Bradley, Jeffrey

    2014-01-01

    Purpose: To investigate pulmonary function test (PFT) results and arterial blood gas changes (complete PFT) following stereotactic body radiation therapy (SBRT) and to see whether baseline PFT correlates with lung toxicity and overall survival in medically inoperable patients receiving SBRT for early stage, peripheral, non-small cell lung cancer (NSCLC). Methods and Materials: During the 2-year follow-up, PFT data were collected for patients with T1-T2N0M0 peripheral NSCLC who received effectively 18 Gy × 3 in a phase 2 North American multicenter study (Radiation Therapy Oncology Group [RTOG] protocol 0236). Pulmonary toxicity was graded by using the RTOG SBRT pulmonary toxicity scale. Paired Wilcoxon signed rank test, logistic regression model, and Kaplan-Meier method were used for statistical analysis. Results: At 2 years, mean percentage predicted forced expiratory volume in the first second and diffusing capacity for carbon monoxide declines were 5.8% and 6.3%, respectively, with minimal changes in arterial blood gases and no significant decline in oxygen saturation. Baseline PFT was not predictive of any pulmonary toxicity following SBRT. Whole-lung V5 (the percentage of normal lung tissue receiving 5 Gy), V10, V20, and mean dose to the whole lung were almost identical between patients who developed pneumonitis and patients who were pneumonitis-free. Poor baseline PFT did not predict decreased overall survival. Patients with poor baseline PFT as the reason for medical inoperability had higher median and overall survival rates than patients with normal baseline PFT values but with cardiac morbidity. Conclusions: Poor baseline PFT did not appear to predict pulmonary toxicity or decreased overall survival after SBRT in this medically inoperable population. Poor baseline PFT alone should not be used to exclude patients with early stage lung cancer from treatment with SBRT

  3. Public Notice: 2018-09 Kaplan Companies

    Science.gov (United States)

    EPA is providing notice of a proceeding to assess a Class II civil penalty for alleged violations of the Clean Water Act (Act). EPA is also providing notice of opportunity to comment on the proposed penalty assessment.

  4. Concomitant chemoradiotherapy versus induction chemotherapy followed by chemoradiotherapy as definitive, first line treatment of squamous cell carcinoma of the head and neck. A retrospective single center analysis

    Energy Technology Data Exchange (ETDEWEB)

    Balermpas, P.; Bauer, C.; Fraunholz, I.; Ottinger, A.; Fokas, E.; Roedel, C.; Weiss, C. [Goethe University Frankfurt, Department of Radiation Therapy and Oncology, Frankfurt am Main (Germany); Wagenblast, J.; Stoever, T. [Goethe University, Department of Otorhinolaryngology, Frankfurt am Main (Germany); Seitz, O. [Goethe University, Department of Oral Maxillofacial and Plastic Facial Surgery, Frankfurt am Main (Germany)

    2014-03-15

    Despite the lack of evidence to support its implementation in the clinical practice, induction chemotherapy (IC) before chemoradiotherapy (CRT) is often used in patients with locally advanced squamous cell carcinoma of the head and neck (SCCHN). We retrospectively examined the tolerability, feasibility, and clinical outcome of both concepts in a single center analysis. In all, 83 patients were treated between 2007 and 2010 with IC + CRT (n = 42) or CRT alone (n = 41). IC consisted of docetaxel, cisplatin and 5-fluorouracil (TPF), or cisplatin and 5-fluorouracil (PF). All patients were scheduled to receive 2 cycles of PF during concurrent CRT. Adverse events were assessed according to the common toxicity criteria of adverse events (CTCAE v. 3.0). Associations were tested using the χ{sup 2} test, and survival estimates were calculated according to Kaplan-Meier. The median follow-up was 30.35 months (range 2.66-61.25 months). At 2 years, the overall survival rate was significantly higher for primary CRT compared to IC + CRT group (74.8 % vs. 54 %, respectively; p = 0.041). Significantly more treatment-related overall grade 4 toxicities were documented in the IC + CRT group compared to the CRT group (42.9% vs. 9.8%; p = 0.001). Renal toxicity ≥ grade 2 occurred in 52.4 % vs. 7.3 % (p < 0.001), respectively. In all, 93 % of the patients with primary CRT compared to 71 % with IC + CRT received the planned full radiotherapy dose (p = 0.012). This is, to our knowledge, the largest retrospective study to compare IC + CRT with primary CRT. IC showed high acute toxicity, compromised the feasibility of concurrent CRT, and was associated with reduced overall survival rates compared to primary CRT. The lack of clinical benefit in conjunction with the increased toxicity does not support implementation of IC. (orig.) [German] Trotz fehlender Studienergebnisse, die den Einsatz einer Induktionschemotherapie (IC) vor einer simultanen Radiochemotherapie (RCT) in der klinischen

  5. Results of radiotherapy for meningeomas with high risk for local recurrence. A retrospective analysis; Ergebnisse der Strahlentherapie bei Meningeomen mit hohem Rezidivrisiko. Eine retrospektive Analyse

    Energy Technology Data Exchange (ETDEWEB)

    Winkler, C.; Dornfeld, S.; Friedrich, S.; Baumann, M. [Technische Univ. Dresden (Germany). Klinik und Poliklinik fuerStrahlentherapie und Radioonkologie; Schwarz, R. [Universitaetskrankenhaus Hamburg-Eppendorf (Germany). Abt. fuer Strahlentherapie

    1998-12-01

    Aim: Retrospective assessment of the efficacy of radiatiotherapy for meningeomas with high risk for local recurrence. Patients and methods: Records of 67 patients with meningeomas treated from 1974 to 1995 at 2 centres were analyzed. Follow-up time ranged from 0.8 to 213 months (median: 61 months). Radiation therapy was given either after local failure or after biopsy or subtotal resection. The ratio between malignant (n=20) and benign (n=47) meningenoma was 1:2.4. Median age of the patients was 55 years (7 to 77 years). Radiation treatment was given at 1.5 to 2 Gy per fraction to 36 to 79.5 Gy. Survival rates were calculated by the Kaplan-Meier method. Statistical comparisons were performed with the log-rank test and the Cox proportional hazards model. The Bonferroni method was used to correct for multiple comparisons. Results: Five- and 10-year disease-free survival rates were 82%{+-}5% (standard error) and 70%{+-}9%. Local control rates at 5 and 10 years were 78%{+-}5% and 68%{+-}9%. In uni- and multivariate analysis histology, sex, total dose and center showed no significant influence on the results. Patients age was significant for local control (univariate p=0.02; multivariate p=0.03) and disease-free survival (univariate/multivariate p=0.04). The postoperative tumor burden had a significant influence of disease-free survival (multivariate P=0.04). After Bonferroni correction no significant influenc e was observed. We did not observe late side effects, especially brain necrosis. Conclusions: Despite of the negative selection of our patients we observed high survival- and local control rates after radiation therapy. This underscores the role of radiation therapy in the treatment of meningeomas with high risk of local failure. (orig.) [Deutsch] Hintergrund: Retrospektive Auswertung der Behandlungsergebnisse der Bestrahlung von Meningeomen mit hohem Rezidivrisiko. Patienten und Methode: Im Zeitraum zwischen 1974 und 1995 wurden an zwei Zentren insgesamt 67

  6. ASURV: Astronomical SURVival Statistics

    Science.gov (United States)

    Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.

    2014-06-01

    ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.

  7. Survival of Root-filled Teeth in the Swedish Adult Population

    DEFF Research Database (Denmark)

    Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik

    2016-01-01

    INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...

  8. STAT3 inhibitor enhances chemotherapy drug efficacy by ...

    African Journals Online (AJOL)

    Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.

  9. Epilepsy in Rett syndrome--lessons from the Rett networked database

    DEFF Research Database (Denmark)

    Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori

    2015-01-01

    collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...

  10. Influence of antiviral therapy on survival of patients with hepatitis B ...

    African Journals Online (AJOL)

    The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...

  11. A retrospective analysis of survival and prognostic factors after stereotactic radiosurgery for aggressive meningiomas

    International Nuclear Information System (INIS)

    Ferraro, Daniel J; Zoberi, Imran; Simpson, Joseph R; Jaboin, Jerry J; Funk, Ryan K; Blackett, John William; Ju, Michelle R; DeWees, Todd A; Chicoine, Michael R; Dowling, Joshua L; Rich, Keith M; Drzymala, Robert E

    2014-01-01

    While most meningiomas are benign, aggressive meningiomas are associated with high levels of recurrence and mortality. A single institution’s Gamma Knife radiosurgical experience with atypical and malignant meningiomas is presented, stratified by the most recent WHO classification. Thirty-one patients with atypical and 4 patients with malignant meningiomas treated with Gamma Knife radiosurgery between July 2000 and July 2011 were retrospectively reviewed. All patients underwent prior surgical resection. Overall survival was the primary endpoint and rate of disease recurrence in the brain was a secondary endpoint. Patients who had previous radiotherapy or prior surgical resection were included. Kaplan-Meier and Cox proportional hazards models were used to estimate survival and identify factors predictive of recurrence and survival. Post-Gamma Knife recurrence was identified in 11 patients (31.4%) with a median overall survival of 36 months and progression-free survival of 25.8 months. Nine patients (25.7%) had died. Three-year overall survival (OS) and progression-free survival (PFS) rates were 78.0% and 65.0%, respectively. WHO grade II 3-year OS and PFS were 83.4% and 70.1%, while WHO grade III 3-year OS and PFS were 33.3% and 0%. Recurrence rate was significantly higher in patients with a prior history of benign meningioma, nuclear atypia, high mitotic rate, spontaneous necrosis, and WHO grade III diagnosis on univariate analysis; only WHO grade III diagnosis was significant on multivariate analysis. Overall survival was adversely affected in patients with WHO grade III diagnosis, prior history of benign meningioma, prior fractionated radiotherapy, larger tumor volume, and higher isocenter number on univariate analysis; WHO grade III diagnosis and larger treated tumor volume were significant on multivariate analysis. Atypical and anaplastic meningiomas remain difficult tumors to treat. WHO grade III diagnosis and treated tumor volume were significantly

  12. Low dose rate brachytherapy (LDR-BT) as monotherapy for early stage prostate cancer in Italy: practice and outcome analysis in a series of 2237 patients from 11 institutions.

    Science.gov (United States)

    Fellin, Giovanni; Mirri, Maria A; Santoro, Luigi; Jereczek-Fossa, Barbara A; Divan, Claudio; Mussari, Salvatore; Ziglio, Francesco; La Face, Beniamino; Barbera, Fernando; Buglione, Michela; Bandera, Laura; Ghedi, Barbara; Di Muzio, Nadia G; Losa, Andrea; Mangili, Paola; Nava, Luciano; Chiarlone, Renato; Ciscognetti, Nunzia; Gastaldi, Emilio; Cattani, Federica; Spoto, Ruggero; Vavassori, Andrea; Giglioli, Francesca R; Guarneri, Alessia; Cerboneschi, Valentina; Mignogna, Marcello; Paoluzzi, Mauro; Ravaglia, Valentina; Chiumento, Costanza; Clemente, Stefania; Fusco, Vincenzo; Santini, Roberto; Stefanacci, Marco; Mangiacotti, Francesco P; Martini, Marco; Palloni, Tiziana; Schinaia, Giuseppe; Lazzari, Grazia; Silvano, Giovanni; Magrini, Stefano; Ricardi, Umberto; Santoni, Riccardo; Orecchia, Roberto

    2016-09-01

    Low-dose-rate brachytherapy (LDR-BT) in localized prostate cancer is available since 15 years in Italy. We realized the first national multicentre and multidisciplinary data collection to evaluate LDR-BT practice, given as monotherapy, and outcome in terms of biochemical failure. Between May 1998 and December 2011, 2237 patients with early-stage prostate cancer from 11 Italian community and academic hospitals were treated with iodine-125 ((125)I) or palladium-103 LDR-BT as monotherapy and followed up for at least 2 years. (125)I seeds were implanted in 97.7% of the patients: the mean dose received by 90% of target volume was 145 Gy; the mean target volume receiving 100% of prescribed dose (V100) was 91.1%. Biochemical failure-free survival (BFFS), disease-specific survival (DSS) and overall survival (OS) were estimated using Kaplan-Meier method. Log-rank test and multivariable Cox regression were used to evaluate the relationship of covariates with outcomes. Median follow-up time was 65 months. 5- and 7-year DSS, OS and BFFS were 99 and 98%, 94 and 89%, and 92 and 88%, respectively. At multivariate analysis, the National Comprehensive Cancer Network score (p LDR-BT. This first multicentre Italian report confirms LDR-BT as an excellent curative modality for low-/intermediate-risk prostate cancer. Multidisciplinary teams may help to select adequately patients to be treated with brachytherapy, with a direct impact on the implant quality and, possibly, on outcome.

  13. Management of non-traumatic avascular necrosis of the femoral head-a comparative analysis of the outcome of multiple small diameter drilling and core decompression with fibular grafting.

    Science.gov (United States)

    Mohanty, S P; Singh, K A; Kundangar, R; Shankar, V

    2017-04-01

    The purpose of this study was to compare the clinical and radiological outcomes of multiple small diameter drilling and core decompression with fibular strut grafting in the management of non-traumatic avascular necrosis (AVN) of the femoral head. Outcomes of patients with AVN treated by multiple small diameter drilling (group 1) were compared retrospectively with patients treated by core decompression and fibular grafting (group 2). Harris hip score (HHS) was used to assess the clinical status pre- and postoperatively. Modified Ficat and Arlet classification was used to assess the radiological stage pre- and postoperatively. Forty-six patients (68 hips) were included in this study. Group 1 consisted of 33 hips, and group 2 consisted of 35 hips. In stages I and IIB, there was no statistically significant difference in the final HHS between the two groups. However, in stages IIA and III, hips in group 2 had a better final HHS (P < 0.05). In terms of radiographic progression, there was no statistical difference between hips in stages I, IIA and stage IIB. However, in stage III, hips belonging to group 2 had better results (P < 0.05). Kaplan-Meier survivorship analysis showed better outcome in group 2 in stage III (P < 0.05). Hips with AVN in the precollapse stage can be salvaged by core decompression with or without fibular grafting. Multiple small diameter drilling is relatively simple and carries less morbidity and hence preferred in stages I and II. However, in stage III disease, core decompression with fibular strut grafting gives better results.

  14. Treatment of malignant biliary occlusion by means of transhepatic percutaneous biliary drainage with insertion of metal stents - results of an 8-year follow-up and analysis of the prognostic parameters; Behandlung der malignen Gallenwegsstenose mittels perkutaner transhepatischer Metallendoprothesenimplantation: 8 Jahres-Ergebnisse und Analyse prognostischer Faktoren

    Energy Technology Data Exchange (ETDEWEB)

    Alfke, H.; Alfke, B.; Froelich, J.J.; Klose, K.J.; Wagner, H.J. [Klinik fuer Strahlendiagnostik Philipps Univ. Marburg (Germany)

    2003-08-01

    Purpose: To analyze outcome and predictive factors for patient survival and patency rates of unresectable malignant biliary obstruction treated with percutaneous transhepatic insertion of metal stents. Materials and Methods: This is a retroselective analysis of 130 patients treated in one interventional radiological center with data collected from patient records and by telephone interviews. The procedure-related data had been prospectively documented in a computer data base. The Kaplan-Meier analysis was performed for univariate and multivariate comparison of survival and patency rates with the log-rank test used for different tumor types. Predictive factors for survival and 30-day mortality were analyzed by a stepwise logistic regression. Results: Underlying causes of malignant biliary obstructions were cholangiocarcinoma in 50, pancreatic carcinoma in 29, liver metastases in 27, gallbladder carcinoma in 20, and other tumors in 4 patients. The technical success rate was 99%, the complication rate 27% and the 30-day mortality 11%. Primary patency rates (406 days with a median of 207 days) did not differ significantly for different tumor types. The survival rates were significantly (p = 0.03 by log-rank test) better for patients with cholangiocarcinoma than for patients with pancreatic carcinoma and liver metastases. Multiple regression analysis revealed no predictive factor for patient survival and 30-day mortality. Conclusion: Percutaneous transhepatic insertion of metal biliary endoprostheses offers a good initial and long-term relief of jaundice caused by malignant biliary obstruction. Although survival rates for patients with cholangiocarcinoma are better than for other causes of malignant biliary obstruction, a clear predictive factor is lacking for patients undergoing palliative biliary stent insertion. (orig.) [German] Ziel: Ergebnisse der perkutanen transhepatischen Metallendoprothesenimplantation bei malignen Gallenwegsverschluessen zu evaluieren und

  15. Predetermining value analysis of the prehospital phase procedures in trauma victims survival Análisis del valor predeterminante de los procedimientos de la fase prehospitalaria en la sobrevivencia de las víctimas de trauma Análise do valor predeterminante dos procedimentos da fase pré-hospitalar na sobrevivência das vítimas de trauma

    Directory of Open Access Journals (Sweden)

    Marisa Aparecida Amaro Malvestio

    2008-06-01

    Full Text Available The aim of this study was to analyze the determining value of the procedures carried out during prehospital care in the survival time of traffic accident victims. Data of 175 victims with Revised Trauma Score £ 11, cared for and transported by advanced life support to tertiary referral hospitals, were submitted to Kaplan-Meier Survival Analysis and to Cox proportional hazards model. Four procedure groups associated with survival were identified: basic circulatory; advanced respiratory; volume replaced and medication. Until hospital discharge, the victims who underwent orotracheal intubation and chest compressions showed 3.6 and 6.4 times higher death hazards, respectively. The need for definitive airway and cardiopulmonary resuscitation in the prehospital phase was predetermining with higher death hazard. The less than 1000ml intravenous fluid replacement was the only predetermining factor with protective power against death hazard.La propuesta de este estudio fue analizar el valor determinante de los procedimientos realizados durante la atención prehospitalaria en el tiempo de sobrevivencia de víctimas de accidentes de tránsito. Datos de 175 víctimas con Revised Trauma Score A proposta deste estudo foi analisar o valor predeterminante dos procedimentos realizados, durante o atendimento pré-hospitalar no tempo de sobrevivência de vítimas de acidentes de trânsito. Dados de 175 vítimas com Revised Trauma Score < 11, atendidas e transportadas pelo suporte avançado à vida a hospitais terciários, foram submetidas à Análise de Sobrevivência de Kaplan Méier e à Análise de Riscos Proporcionais de Cox. Identificou-se 4 grupos de procedimentos associados à sobrevivência: circulatórios básicos; respiratórios avançados; volume reposto e medicamentos. Até a alta hospitalar, as vítimas, submetidas à entubação orotraqueal e compressões torácicas, apresentaram 3,6 e 6,4 vezes maior risco para o óbito, respectivamente. A

  16. Retrospective Analysis of the Survival Benefit of Induction Chemotherapy in Stage IVa-b Nasopharyngeal Carcinoma.

    Science.gov (United States)

    Lan, Xiao-Wen; Zou, Xue-Bin; Xiao, Yao; Tang, Jie; OuYang, Pu-Yun; Su, Zhen; Xie, Fang-Yun

    2016-01-01

    The value of adding induction chemotherapy to chemoradiotherapy in locoregionally advanced nasopharyngeal carcinoma (LA-NPC) remains controversial, yet high-risk patients with LA-NPC have poor outcomes after chemoradiotherapy. We aimed to assess the survival benefits of induction chemotherapy in stage IVa-b NPC. A total of 602 patients with stage IVa-b NPC treated with intensity-modulated radiation therapy (IMRT) and concurrent chemotherapy with or without induction chemotherapy were retrospectively analyzed. Overall survival (OS), locoregional relapse-free survival (LRFS), distant metastasis-free survival (DMFS) and progression-free survival (PFS) were evaluated using the Kaplan-Meier method, log-rank test and Cox regression analysis. In univariate analysis, 5-year OS was 83.2% for induction chemotherapy plus concurrent chemotherapy and 74.8% for concurrent chemotherapy alone, corresponding to an absolute risk reduction of 8.4% (P = 0.022). Compared to concurrent chemotherapy alone, addition of induction chemotherapy improved 5-year DMFS (83.2% vs. 74.4%, P = 0.018) but not 5-year LRFS (83.7% vs. 83.0%, P = 0.848) or PFS (71.9% vs. 66.0%, P = 0.12). Age, T category, N category, chemotherapy strategy and clinical stage were associated with 5-year OS (P = 0.017, P = 0.031, P = 0.007, P = 0.022, P = 0.001, respectively). In multivariate analysis, induction chemotherapy plus concurrent chemotherapy was an independent favorable prognostic factor for OS (HR, 0.62; 95% CI, 0.43-0.90, P = 0.012) and DMFS (HR, 0.57; 95% CI, 0.38-0.83, P = 0.004). In subgroup analysis, induction chemotherapy significantly improved 5-year DMFS in stage IVa (86.8% vs. 77.3%, P = 0.008), but provided no significant benefit in stage IVb. In patients with stage IVa-b NPC treated with IMRT, addition of induction chemotherapy to concurrent chemotherapy significantly improved 5-year OS and 5-year DMFS. This study provides a basis for selection of high risk patients in future clinical therapeutic

  17. Kuidas Sander Saarmets kosmosest maailma vallutama kipub / Moon Meier

    Index Scriptorium Estoniae

    Meier, Moon

    2007-01-01

    Eesti Muusika- ja Teatriakadeemias elektronmuusika erialal õppivast Sander Saarmetsast kui noorest heliloojast, kes on siiani oma nime teinud ulmemuusika ringkondades. Kommenteerivad sõber, muusik, ulmeplaatide boss Aivar Tõnso ja Muschraumi kitarrist Kaur Garšnek

  18. Meier-Gorlin syndrome: Report of an additional patient with ...

    African Journals Online (AJOL)

    Rabah M. Shawky

    2014-05-16

    May 16, 2014 ... which functions during replication can cause Seckel syndrome, a clinically related ... brain, and growth hormone provocation test were normal. Skeletal survey ... atrial defect with left–right shunt [17]. Also our patient suf-.

  19. Lasteaiaõpetajate palk kerkis tibusammul / Jaanika Meier

    Index Scriptorium Estoniae

    Meier, Jaanika

    2007-01-01

    Aastaga on tõusnud pea kõigi Tartumaa lasteaiaõpetajate palk, kõige suurem on palgatõus olnud Kambja vallas, kus keskeriharidusega õpetajad saavad praegu palka minimaalselt 6600 ja kõrgharidusega õpetajad 7000 krooni kuus. Lisa: Lasteaiaõpetajate palk Tartumaal

  20. Lille mäele tuleb suveks Flauerpauer / Jaanika Meier

    Index Scriptorium Estoniae

    Meier, Jaanika

    2008-01-01

    Tartus Lille Maja hoovis avatakse suvekohvik Flauerpauer. Kohviku väliskujunduse autoriteks on Tartu kõrgema kunstikooli tudengid Tiit Joala ja Oliver Kuusmann, sisekujunduse autoriks Tallinna Ülikooli üliõpilane Kudrun Vunk. Selgitusi jagab Lille Maja direktor Hele Riit-Vällik

  1. Noorteühenduste kogu tutvustab Euroopa Liitu / Jaanika Meier

    Index Scriptorium Estoniae

    Meier, Jaanika

    2007-01-01

    Tartu Noorteühenduste Kogu tutvustab projekti "Kodanikuna Euroopa Liidus. Eile. Täna. Homme" noortele Euroopa Liitu, selle toimemehhanisme, arengusuundi ja liidus noortele pakutavaid võimalusi. Lisa: Kas teate

  2. Hakkaks maja värvima / Piret Meier

    Index Scriptorium Estoniae

    Meier, Piret, 1962-

    2004-01-01

    Ehitushoolde spetsialist Lea Täheväli-Stroh majade välimusest ja värvilahenduse valikutest. Lisaks Mirjam Peili kommentaar küsimusele, miks on Eestis saanud moeks värvida maamajad nn. Rootsi punaseks.

  3. Prognostic significance of transient myocardial ischaemia after first acute myocardial infarction: five year follow up study

    DEFF Research Database (Denmark)

    Mickley, H; Nielsen, J R; Berning, J

    1995-01-01

    infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...

  4. Clinical course of untreated cerebral cavernous malformations: a meta-analysis of individual patient data.

    Science.gov (United States)

    Horne, Margaret A; Flemming, Kelly D; Su, I-Chang; Stapf, Christian; Jeon, Jin Pyeong; Li, Da; Maxwell, Susanne S; White, Philip; Christianson, Teresa J; Agid, Ronit; Cho, Won-Sang; Oh, Chang Wan; Wu, Zhen; Zhang, Jun-Ting; Kim, Jeong Eun; Ter Brugge, Karel; Willinsky, Robert; Brown, Robert D; Murray, Gordon D; Al-Shahi Salman, Rustam

    2016-02-01

    Cerebral cavernous malformations (CCMs) can cause symptomatic intracranial haemorrhage (ICH), but the estimated risks are imprecise and predictors remain uncertain. We aimed to obtain precise estimates and predictors of the risk of ICH during untreated follow-up in an individual patient data meta-analysis. We invited investigators of published cohorts of people aged at least 16 years, identified by a systematic review of Ovid MEDLINE and Embase from inception to April 30, 2015, to provide individual patient data on clinical course from CCM diagnosis until first CCM treatment or last available follow-up. We used survival analysis to estimate the 5-year risk of symptomatic ICH due to CCMs (primary outcome), multivariable Cox regression to identify baseline predictors of outcome, and random-effects models to pool estimates in a meta-analysis. Among 1620 people in seven cohorts from six studies, 204 experienced ICH during 5197 person-years of follow-up (Kaplan-Meier estimated 5-year risk 15·8%, 95% CI 13·7-17·9). The primary outcome of ICH within 5 years of CCM diagnosis was associated with clinical presentation with ICH or new focal neurological deficit (FND) without brain imaging evidence of recent haemorrhage versus other modes of presentation (hazard ratio 5·6, 95% CI 3·2-9·7) and with brainstem CCM location versus other locations (4·4, 2·3-8·6), but age, sex, and CCM multiplicity did not add independent prognostic information. The 5-year estimated risk of ICH during untreated follow-up was 3·8% (95% CI 2·1-5·5) for 718 people with non-brainstem CCM presenting without ICH or FND, 8·0% (0·1-15·9) for 80 people with brainstem CCM presenting without ICH or FND, 18·4% (13·3-23·5) for 327 people with non-brainstem CCM presenting with ICH or FND, and 30·8% (26·3-35·2) for 495 people with brainstem CCM presenting with ICH or FND. Mode of clinical presentation and CCM location are independently associated with ICH within 5 years of CCM diagnosis. These

  5. Classification of the operating conditions of a Kaplan turbine according to its impact in the structural integrity of the runner; Clasificacion de las condiciones de operacion de una turbina Kaplan de acuerdo a su impacto en la integridad estructural del rodete

    Energy Technology Data Exchange (ETDEWEB)

    Palacios, Luis M; Bautista, Eder A; Espitia, J Ernesto [Instituto Tecnologico de Pachuca, Pachuca, Hidalgo (Mexico); Mazur C, Zdzislaw [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2007-11-15

    Each one of the operating conditions of the turbine according to the impact they have in the structural integrity of the runner is evaluated. By means of CFD (Computational Fluid Dynamics) analysis the pressure that the working fluid exerts on the blade for the turbine operating conditions is obtained. The oscillating disturbances induced by the flow, the angular velocity of the runner and the cavitation effect have been considered. The value of maximum stress for each one of the operating conditions is related to its respective values of cavitation. With this information those operating conditions that induce the greater values of stress and represent greater wears away in the runner are determined. This way, it is possible to avoid the more severe operating conditions and if this is not possible, lineaments of redesign are established to obtain more favorable operating conditions for the runner. [Spanish] Se evaluan y clasifican cada una de las condiciones de operacion de la turbina de acuerdo al impacto que tienen en la integridad estructural del rodete. Mediante analisis de CFD (Computacional Fluid Dynamics) se obtiene la presion que el fluido de trabajo ejerce sobre el alabe para las condiciones de operacion de la turbina. Se han considerado las perturbaciones oscilatorias inducidas por el flujo, la velocidad angular del rodete y el efecto de la cavitacion. Se relacionan los valores de esfuerzo maximo para cada una de las condiciones de operacion con sus respectivos valores de cavitacion. Con esta informacion se determinan aquellas condiciones de operacion que inducen los mayores valores de esfuerzo y representan mayor desgaste en el rodete. De esta manera, es posible evitar las condiciones de operacion mas severas, y si esto no es posible, se establecen lineamientos de rediseno para obtener condiciones de operacion mas favorables para el rodete.

  6. Estimation of Unemployment Duration in Botoşani County Using Survival Analysis

    Directory of Open Access Journals (Sweden)

    Darabă Gabriel

    2017-01-01

    Full Text Available In this paper we aim at estimating the unemployment duration in Botosani County in order tostudy the impact of individual characteristics (gender, age, place of residence, unemploymentbenefit, etc. on the length of unemployment spells. We use Cox regression model to measure theeffects of gender, age, residential environment, etc. on the hazard rate of leaving unemploymentandKaplan-Meier estimator to compare survival probabilities among different categories ofunemployed persons. The study is carried out on a sample of 200 unemployment spellsregisteredwith the Employment Agency of Botoşani County from January 2012 to December 2015. Theresults reveal that place of residence, unemployment benefit and unemployed category have asignificant impact on unemployment spells.

  7. Solitary plasmacytoma: population-based analysis of survival trends and effect of various treatment modalities in the USA.

    Science.gov (United States)

    Thumallapally, Nishitha; Meshref, Ahmed; Mousa, Mohammed; Terjanian, Terenig

    2017-01-05

    Solitary plasmacytoma (SP) is a localized neoplastic plasma cell disorder with an annual incidence of less than 450 cases. Given the rarity of this disorder, it is difficult to conduct large-scale population studies. Consequently, very limited information on the disorder is available, making it difficult to estimate the incidence and survival rates. Furthermore, limited information is available on the efficacy of various treatment modalities in relation to primary tumor sites. The data for this retrospective study were drawn from the Surveillance, Epidemiology and End Results (SEER) database, which comprises 18 registries; patient demographics, treatment modalities and survival rates were obtained for those diagnosed with SP from 1998 to 2007. Various prognostic factors were analyzed via Kaplan-Meier analysis and log-rank test, with 5-year relative survival rate defined as the primary outcome of interest. Cox regression analysis was employed in the multivariate analysis. The SEER search from 1998 to 2007 yielded records for 1691 SP patients. The median age at diagnosis was 63 years. The patient cohort was 62.4% male, 37.6% female, 80% Caucasian, 14.6% African American and 5.4% other races. Additionally, 57.8% had osseous plasmacytoma, and 31.9% had extraosseous involvement. Unspecified plasmacytoma was noted in 10.2% of patients. The most common treatment modalities were radiotherapy (RT) (48.8%), followed by combination surgery with RT (21.2%) and surgery alone (11.6%). Univariate analysis of prognostic factors revealed that the survival outcomes were better for younger male patients who received RT with surgery (p multiple myeloma (MM) was noted in 551 patients. Age >60 years was associated with a lower 5-year survival in patients who progressed to MM compared to those who were diagnosed initially with MM (15.1 vs 16.6%). Finally, those who received RT and progressed to MM still had a higher chance of survival than those who were diagnosed with MM initially and

  8. Radical prostatectomy for clinically localised prostate cancer at Rigshospitalet 1995-2011 - an analysis of surgical and oncological outcome.

    Science.gov (United States)

    Røder, Martin Andreas

    2013-12-01

    RP for localized PCa was introduced at Rigshospitalet in 1995. Since then, the incidence of PCa and number of RPs performed every year has increased enormously. Presently, RP is performed a six different hospitals in Denmark. No previous studies have meticulously described outcomes of RP in Denmark. This PhD-thesis focuses on surgical and oncological outcome after RP at Rigshospitalet. The primary purpose was to describe biochemical outcome, risk factors associated with positive surgical margins, and the impact of margin location on risk of biochemical recurrence. The PhD-thesis is based on results from approximately 1,300 men who underwent RP between 1995 and 2011 at Rigshospitalet. The patients have been followed prospectively in a local database. BR was defined as the first PSA ≥ 0.2 ng/ml and time to BR was calculated from the date of surgery. Analysis of time to BR was done using Kaplan-Meier estimation and Cox regression analysis including both pre- and postoperative parameters. The association between preoperative and surgical parameters, including surgeon and nerve-sparing surgery, and PSM was analysed using logistic regression analysis. The 10-year estimated BRFS was 75%, 60% and 39% for low-, intermediate-, and high-risk patients, respectively. An in-depth analysis of high-risk patients demonstrated a 10-year metastasis-free and cancer-specific survival of 85% and 90%, respectively. A PSM was demonstrated to increase the risk of BR up to 3 fold. The location of PSM was found to be associated with the risk of BR, i.e. non-apical PSM had the highest risk of BR compared to margin negative and apical PSM, especially in pT2 tumours. A number of factors were found to correlate with the risk of PSM, especially preoperative PSA, surgeon and nerve-sparing surgery. This thesis demonstrates that outcome of RP at Rigshospitalet is comparable to international results. Our studies confirm the prognostic importance of PSM, also in pT2 disease, and indicate that

  9. Small cell lung cancer with and without superior vena cava syndrome: a multivariate analysis of prognostic factors in 408 cases

    International Nuclear Information System (INIS)

    Wuerschmidt, Florian; Buenemann, Henry; Heilmann, Hans-Peter

    1995-01-01

    Purpose: Patients with small cell lung cancer (SCLC) and superior vena cava syndrome (SVCS) are widely believed to have a grave prognosis. The purpose of this study was to determine the prognosis of patients with SCLC and SVCS as compared to SCLC without SVCS. Methods and Materials: A retrospective analysis of 408 cases of SCLC ± SVCS was performed. Three-hundred and sixty showed no clinical signs of SVCS and 43 (11%) had SVCS; in 5 patients no adequate information was available about clinical signs of SVCS. All patients were classified as limited disease cases. About 98% received chemotherapy usually as the first treatment followed by radiotherapy. A median total dose of 46 Gy (range 30 to 70 Gy) was given at 2.0 Gy per fraction five times weekly. A prophylactic cranial irradiation was applied if a complete remission was achieved after chemotherapy or after 30 Gy of irradiation. Kaplan-Meier survival curves are shown and comparisons were made by the log-rank and the Gehan/Wilcoxon test. To adjust for prognostic factors, a proportional hazards analysis was done. Results: Patients without SVCS had 5-year survival rates (± SE) and a median survival time (MST; 95% confidence intervals) of 11% ± 2% and 13.7 months (12.7-14.5) in UICC Stage I to III; in Stage III the figures were 9% ± 2% and 12.6 months (11.2-13.7). In comparison, SCLC with SVCS had 5-year survival rates of 15% ± 7% and MST of 16.1 months (13.8-20.5). The difference was significant in univariate analysis (Stage III disease: p 0.008 by the log-rank test). In a multivariate analysis of all patients, Stage (Stage I + II > III; p = 0.0003), SVCS (yes > no; p = 0.005), and Karnofsky performance status (≤ 70 < 80-100%; p = 0.008) were of significant importance. Conclusions: SVCS is a favorable prognostic sign in SCLC. The treatment should be curatively intended

  10. Clustering of immunological, metabolic and genetic features in latent autoimmune diabetes in adults: evidence from principal component analysis.

    Science.gov (United States)

    Pes, Giovanni Mario; Delitala, Alessandro Palmerio; Errigo, Alessandra; Delitala, Giuseppe; Dore, Maria Pina

    2016-06-01

    Latent autoimmune diabetes in adults (LADA) which accounts for more than 10 % of all cases of diabetes is characterized by onset after age 30, absence of ketoacidosis, insulin independence for at least 6 months, and presence of circulating islet-cell antibodies. Its marked heterogeneity in clinical features and immunological markers suggests the existence of multiple mechanisms underlying its pathogenesis. The principal component (PC) analysis is a statistical approach used for finding patterns in data of high dimension. In this study the PC analysis was applied to a set of variables from a cohort of Sardinian LADA patients to identify a smaller number of latent patterns. A list of 11 variables including clinical (gender, BMI, lipid profile, systolic and diastolic blood pressure and insulin-free time period), immunological (anti-GAD65, anti-IA-2 and anti-TPO antibody titers) and genetic features (predisposing gene variants previously identified as risk factors for autoimmune diabetes) retrieved from clinical records of 238 LADA patients referred to the Internal Medicine Unit of University of Sassari, Italy, were analyzed by PC analysis. The predictive value of each PC on the further development of insulin dependence was evaluated using Kaplan-Meier curves. Overall 4 clusters were identified by PC analysis. In component PC-1, the dominant variables were: BMI, triglycerides, systolic and diastolic blood pressure and duration of insulin-free time period; in PC-2: genetic variables such as Class II HLA, CTLA-4 as well as anti-GAD65, anti-IA-2 and anti-TPO antibody titers, and the insulin-free time period predominated; in PC-3: gender and triglycerides; and in PC-4: total cholesterol. These components explained 18, 15, 12, and 12 %, respectively, of the total variance in the LADA cohort. The predictive power of insulin dependence of the four components was different. PC-2 (characterized mostly by high antibody titers and presence of predisposing genetic markers

  11. Retrospective analysis of dental implants placed and restored by advanced prosthodontic residents.

    Science.gov (United States)

    Barias, Pamela A; Lee, Damian J; Yuan, Judy Chia-Chun; Sukotjo, Cortino; Campbell, Stephen D; Knoernschild, Kent L

    2013-02-01

    The purposes of this retrospective clinical review were to: (1) describe the demographics of implant patients, types of implant treatment and implant-supported prostheses in an Advanced Education in Prosthodontic Program, (2) evaluate the survival rate of dental implants placed by prosthodontic residents from 2006 to 2008, and (3) analyze the relationship between resident year of training and implant survival rate. All patients who received dental implants placed by prosthodontic residents from January 2006 to October of 2008 in the Advanced Prosthodontic Program at the University of Illinois at Chicago College of Dentistry were selected for this study. Age, gender, implant diameter, length, implant locations, surgical and restorative detail, and year of prosthodontic residency training were collected and analyzed. Life-table and Kaplan-Meier survival analyses were performed based on implants overall, locations, year of training, and use of a computer-generated surgical guide. A Logrank statistic was performed between implant survival and year of prosthodontic residency training, location, and use of computer-generated surgical guide (α= 0.05). Three hundred and six implants were placed, and of these, seven failed. Life-table and Kaplan-Meier analyses computed a cumulative survival rate (CSR) of 97% for overall implants and implants placed with a computer-generated surgical guide. No statistical difference was found in implant survival rates as a function of year of training (P= 0.85). Dental implants placed by prosthodontic residents had a CSR comparable to previously published studies by other specialties. The year of prosthodontic residency training and implant failure rate did not have any significant relationship. © 2012 by the American College of Prosthodontists.

  12. Failure analysis of satellite subsystems to define suitable de-orbit devices

    Science.gov (United States)

    Palla, Chiara; Peroni, Moreno; Kingston, Jennifer

    2016-11-01

    Space missions in Low Earth Orbit (LEO) are severely affected by the build-up of orbital debris. A key practice, to be compliant with IADC (Inter-Agency Space Debris Coordination Committee) mitigation guidelines, is the removal of space systems that interfere with the LEO region not later than 25 years after the End of Mission. It is important to note that the current guidelines are not generally legally binding, even if different Space Agencies are now looking at the compliance for their missions. If the guidelines will change in law, it will be mandatory to have a postmission disposal strategy for all satellites, including micro and smaller classes. A potential increased number of these satellites is confirmed by different projections, in particular in the commercial sector. Micro and smaller spacecraft are, in general, not provided with propulsion capabilities to achieve a controlled re-entry, so they need different de-orbit disposal methods. When considering the utility of different debris mitigation methods, it is useful to understand which spacecraft subsystems are most likely to fail and how this may affect the operation of a de-orbit system. This also helps the consideration of which components are the most relevant or should be redundant depending on the satellite mass class. This work is based on a sample of LEO and MEO satellites launched between January 2000 and December 2014 with mass lower than 1000 kg. Failure analysis of satellite subsystems is performed by means of the Kaplan-Meier survival analysis; the parametric fits are conducted with Weibull distributions. The study is carried out by using the satellite database SpaceTrak™ which provides anomalies, failures, and trends information for spacecraft subsystems and launch vehicles. The database identifies five states for each satellite subsystem: three degraded states, one fully operational state, and one failed state (complete failure). The results obtained can guide the identification of the

  13. Acute lymphoblastic leukemia in children and adolescents: prognostic factors and analysis of survival

    Directory of Open Access Journals (Sweden)

    Daniel Willian Lustosa de Sousa

    2015-08-01

    Full Text Available OBJECTIVE: To describe the clinical and laboratory features of children and adolescents with acute lymphoblastic leukemia treated at three referral centers in Ceará and evaluate prognostic factors for survival, including age, gender, presenting white blood cell count, immunophenotype, DNA index and early response to treatment.METHODS: Seventy-six under 19-year-old patients with newly diagnosed acute lymphoblastic leukemia treated with the Grupo Brasileiro de Tratamento de Leucemia da Infância - acute lymphoblastic leukemia-93 and -99 protocols between September 2007 and December 2009 were analyzed. The diagnosis was based on cytological, immunophenotypic and cytogenetic criteria. Associations between variables, prognostic factors and response to treatment were analyzed using the chi-square test and Fisher's exact test. Overall and event-free survival were estimated by Kaplan-Meier analysis and compared using the log-rank test. A Cox proportional hazards model was used to identify independent prognostic factors.RESULTS: The average age at diagnosis was 6.3 ± 0.5 years and males were predominant (65%. The most frequently observed clinical features were hepatomegaly, splenomegaly and lymphadenopathy. Central nervous system involvement and mediastinal enlargement occurred in 6.6% and 11.8%, respectively. B-acute lymphoblastic leukemia was more common (89.5% than T-acute lymphoblastic leukemia. A DNA index >1.16 was found in 19% of patients and was associated with favorable prognosis. On Day 8 of induction therapy, 95% of the patients had lymphoblast counts <1000/µL and white blood cell counts <5.0 Ã- 109/L. The remission induction rate was 95%, the induction mortality rate was 2.6% and overall survival was 72%.CONCLUSION: The prognostic factors identified are compatible with the literature. The 5-year overall and event-free survival rates were lower than those reported for developed countries. As shown by the multivariate analysis, age

  14. Survival benefit of postoperative radiation in papillary meningioma: Analysis of the National Cancer Data Base.

    Science.gov (United States)

    Sumner, Whitney A; Amini, Arya; Hankinson, Todd C; Foreman, Nicholas K; Gaspar, Laurie E; Kavanagh, Brian D; Karam, Sana D; Rusthoven, Chad G; Liu, Arthur K

    2017-01-01

    Papillary meningioma represents a rare subset of World Health Organization (WHO) Grade III meningioma that portends an overall poor prognosis. There is relatively limited data regarding the benefit of postoperative radiation therapy (PORT). We used the National Cancer Data Base (NCDB) to compare overall survival (OS) outcomes of surgically resected papillary meningioma cases undergoing PORT compared to post-operative observation. The NCDB was queried for patients with papillary meningioma, diagnosed between 2004 and 2013, who underwent upfront surgery with or without PORT. Overall survival (OS) was determined using the Kaplan-Meier method. Univariate (UVA) and multivariate (MVA) analyses were performed. In total, 190 patients were identified; 89 patients underwent PORT, 101 patients were observed. Eleven patients received chemotherapy (6 with PORT, 5 without). 2-Year OS was significantly improved with PORT vs. no PORT (93.0% vs. 74.4%), as was 5-year OS (78.5% vs. 62.5%) (hazard ratio [HR], 0.48; 95% confidence interval [CI], 0.27-0.85; p  = 0.01). On MVA, patients receiving PORT had improved OS compared to observation (HR, 0.41; 95% CI, 0.22-0.76; p  = 0.005). On subset analysis by age group, the benefit of PORT vs. no PORT was significant in patients ≤18 years ( n  = 13), with 2-year OS of 85.7% vs. 50.0% (HR, 0.08; 95% CI, 0.01-0.80; p  = 0.032) and for patients >18 years ( n  = 184), with 2-year OS of 94.7% vs. 76.1% (HR, 0.55; 95% CI, 0.31-1.00; p  = 0.049), respectively. In this large contemporary analysis, PORT was associated with improved survival for both adult and pediatric patients with papillary meningioma. PORT should be considered in those who present with this rare, aggressive tumor.

  15. Analysis of the Role of PET/CT SUVmax in Prognosis and Its Correlation with 
Clinicopathological Characteristics in Resectable Lung Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Hongliang REN

    2016-04-01

    Full Text Available Background and objective Lung cancer is the leading cause of cancer death in men and women in the world, more than one-half of cases are diagnosed at a advanced stage, and the overall 5-year survival rate for lung cancer is 18%. Lung cancer is divided into non-small cell lung carcinoma (NSCLC and small cell lung carcinoma (SCLC. Approximately 80%-85% of cases are NSCLC which includes three main types: adenocarcinoma (40%, squamous cell carcinoma (SCC (20%-30%, and large cell carcinoma (10%. Although therapies that target driver mutations in adenocarcinomas are showing some promise, they are proving ineffective in smoking-related SCC. We need pay more attention to the diagnosis and treatment of SCC. 18F-FDG positron emission tomography (PET/computed tomography (CT has emerged as an accurate staging modality in lung cancer diagnosis. The aim of this study is to investigate the role of maximum standardized uptake value (SUVmax on PET-CT in prognosis and its correlation with clinicopathological characteristics in resectable SCC. Methods One hundred and eighty-two resectable SCC patients who underwent PET/CT imaging between May 2005 and October 2014 were enrolled into this retrospectively study. All the enrolled patients had underwent pulmonary resection with mediastinal lymph node dissection without preoperative chemotherapy or radiotherapy. Survival outcomes were analyzed using the Kaplan-Meier method and multivariate Cox proportional hazards model. Correlation between SUVmax and clinicopathological factors was analysed using Pearson correlation analysis and Spearman rank correlation analysis. Results The patients were divided into two groups on the basis of SUVmax 13.0 as cutoff value, and patients with SUVmax more than 13.0 had shorter median overall survival than patients less than 13.0 in univariate analysis (56 months vs 87 months; P=0.022. There was remarkable correlation between SUVmax and gender, tumor size, tumor-node-metastasis (TNM stage

  16. Phase 3 study of adjuvant radiotherapy versus wait and see in pT3 prostate cancer: impact of pathology review on analysis.

    Science.gov (United States)

    Bottke, Dirk; Golz, Reinhard; Störkel, Stephan; Hinke, Axel; Siegmann, Alessandra; Hertle, Lothar; Miller, Kurt; Hinkelbein, Wolfgang; Wiegel, Thomas

    2013-08-01

    In a randomised trial, radical prostatectomy (RP) followed by adjuvant radiotherapy (aRT) was compared with RP alone in patients with pT3 pN0 prostate cancer with or without positive margin at local pathology (German Cancer Society trial numbers ARO 96-02/AUO AP 09/95). A pathology review was performed on 85% of RP specimens of patients to investigate the influence of pathology review on the analysis. Patients post-RP (n=385) were randomised before achieving an undetectable prostate-specific antigen (PSA) level to either wait and see (n=192) or 60Gy aRT (n=193). Of 307 patients with undetectable PSA after RP, 262 had pathology review. These results were included prospectively into the analysis. Agreement between local and review pathology was measured by the total percentage of agreement and by simple kappa statistics. The prognostic reliability for the different parameters was analysed by Cox regression model. Event-free rates were determined by Kaplan-Meier analysis with a median follow-up of 40 mo for the wait-and-see arm and 38.5 mo for the aRT arm. There was fair concordance between pathology review and local pathologists for seminal vesicle invasion (pT3c: 91%; κ=0.76), surgical margin status (84%; κ=0.65), and for extraprostatic extension (pT3a/b: 75%; κ=0.74). Agreement was much less for Gleason score (47%; κ=0.42), whereby the review pathology resulted in a shift to Gleason score 7. In contrast to the analysis of progression-free survival with local pathology, the multivariate analysis including review pathology revealed PSMs and Gleason score >6 as significant prognostic factors. Phase 3 studies of postoperative treatment of prostate cancer should be accomplished in the future with a pathology review. In daily practice, a second opinion by a pathologist experienced in urogenital pathology would be desirable, in particular, for high-risk patients after RP. Copyright © 2013 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  17. TU-CD-BRB-08: Radiomic Analysis of FDG-PET Identifies Novel Prognostic Imaging Biomarkers in Locally Advanced Pancreatic Cancer Patients Treated with SBRT

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Y; Shirato, H [Hokkaido University, Global Institute for Collaborative Research and Educat, Sapporo, Hokkaido (Japan); Song, J; Pollom, E; Chang, D; Koong, A [Stanford University, Palo Alto, CA (United States); Li, R [Hokkaido University, Global Institute for Collaborative Research and Educat, Sapporo, Hokkaido (Japan); Stanford University, Palo Alto, CA (United States)

    2015-06-15

    Purpose: This study aims to identify novel prognostic imaging biomarkers in locally advanced pancreatic cancer (LAPC) using quantitative, high-throughput image analysis. Methods: 86 patients with LAPC receiving chemotherapy followed by SBRT were retrospectively studied. All patients had a baseline FDG-PET scan prior to SBRT. For each patient, we extracted 435 PET imaging features of five types: statistical, morphological, textural, histogram, and wavelet. These features went through redundancy checks, robustness analysis, as well as a prescreening process based on their concordance indices with respect to the relevant outcomes. We then performed principle component analysis on the remaining features (number ranged from 10 to 16), and fitted a Cox proportional hazard regression model using the first 3 principle components. Kaplan-Meier analysis was used to assess the ability to distinguish high versus low-risk patients separated by median predicted survival. To avoid overfitting, all evaluations were based on leave-one-out cross validation (LOOCV), in which each holdout patient was assigned to a risk group according to the model obtained from a separate training set. Results: For predicting overall survival (OS), the most dominant imaging features were wavelet coefficients. There was a statistically significant difference in OS between patients with predicted high and low-risk based on LOOCV (hazard ratio: 2.26, p<0.001). Similar imaging features were also strongly associated with local progression-free survival (LPFS) (hazard ratio: 1.53, p=0.026) on LOOCV. In comparison, neither SUVmax nor TLG was associated with LPFS (p=0.103, p=0.433) (Table 1). Results for progression-free survival and distant progression-free survival showed similar trends. Conclusion: Radiomic analysis identified novel imaging features that showed improved prognostic value over conventional methods. These features characterize the degree of intra-tumor heterogeneity reflected on FDG

  18. The survival analysis on localized prostate cancer treated with neoadjuvant endocrine therapy followed by intensity modulated radiation therapy

    International Nuclear Information System (INIS)

    Gao Hong; Li Gaofeng; Wu Qinhong; Li Xuenan; Zhong Qiuzi; Xu Yonggang

    2010-01-01

    Objective: To retrospectively investigate clinical outcomes and prognostic factors in localized prostate cancer treated with neoadjuvant endocrine therapy followed by intensity modulated radiotherapy (IMRT). Methods: Between March 2003 and October 2008, 54 localized prostate cancer treated by IMRT were recruited. All patients had received endocrine therapy before IMRT. The endocrine therapy included surgical castration or medical castration in combination with antiandrogens. The target of IMRT was the prostate and seminal vesicles with or without pelvis. The biochemical failure was defined according to the phoenix definition. By using the risk grouping standard proposed by D'Amico, patients were divided into three groups: low-risk group (n = 5), intermediate-risk group (n = 12), and high-risk group (n = 37). Kaplan-Meier method was used to calculate the overall survival rate. Prognostic factors were analyzed by univariate and multiple Cox regression analysis. Results: The follow-up rate was 98%. The number of patients under follow-up was 39 at 3 years and 25 at 5 years. Potential prognostic factors, including risk groups, mode of endocrine therapy, time of endocrine therapy, phoenix grouping before IMRT, the prostate specific antigen doubling time (PSADT) before radiotherapy, PSA value before IMRT, interval of endocrine therapy and IMRT, irradiation region, and irradiation dose were analyzed by survival analysis. In univariate analysis, time of endocrine therapy (75 % vs 95 %, χ 2 = 6. 45, P = 0. 011), phoenix grouping before IMRT (87% vs 96%, χ 2 = 4. 36, P = 0. 037), interval of endocrine therapy and IMRT (80% vs 95%, χ 2 = 11.60, P= 0. 001), irradiation dose (75% vs 91%, χ 2 =5.92, P= 0. 015) were statistically significant prognostic factors for 3 - year overall survival , and risk groups (85 vs 53 vs 29, χ 2 = 6. 40, P =0. 041) and PSADT before IMRT (62 vs 120, U =24. 50, P =0. 003) were significant factors for the median survival time. In the multiple Cox

  19. Head and Neck Non-Melanoma Skin Cancer Treated By Superficial X-Ray Therapy: An Analysis of 1021 Cases.

    Directory of Open Access Journals (Sweden)

    Daniel Grossi Marconi

    Full Text Available To report a single-institutional experience with the use of Superficial X-Ray Therapy (SXRT for head and neck non-melanoma skin cancer (N-MSC and to compare outcomes by prescribed fractionation schedules.The medical records of 597 patients with 1021 lesions (720 BCC, 242 SCC, 59 SCC in situ treated with kilovoltage radiation from 1979-2013 were retrospectively reviewed. The majority of patients were treated according to 1 of 3 institutional protocols based on the discretion of the radiation oncologist: 1 22 x 2.5 Gy; 2 20 x 2.5 Gy; 3 30 x 2.0 Gy. "T" stage at first presentation was as follows: Tis (59; T1 (765; T2 (175; T3 (6, T4 (9; Tx, (7. All patients were clinical N0 and M0 at presentation. Chi-square test was used to evaluate any potential association between variables. The Kaplan-Meier method was used to analyze survival with the Log Rank test used for comparison. A Cox Regression analysis was performed for multivariate analysis.The median follow up was 44 months. No significant difference was observed among the 3 prescribed fractionation schemes (p = 0.78 in terms of RTOG toxicity. There were no failures among SCC in situ, 37 local failures (23 BCC, 14 SCC, 5 regional failures (all SCC and 2 distant failures (both SCC. For BCC, the 5-year LC was 96% and the 10-year LC was 94%. For SCC the corresponding rates of local control were 92% and 87%, respectively (p = 0.03. The use of >2.0 Gy daily was significantly associated with improved LC on multivariate analysis (HR: 0.17; CI 95%: 0.05-0.59.SXRT for N-MSC of the head and neck is well tolerated, achieves excellent local control, and should continue to be recommended in the management of this disease. Fractionation schedules using >2.0 Gy daily appear to be associated with improved LC.

  20. Postmastectomy Radiation Therapy Is Associated With Improved Survival in Node-Positive Male Breast Cancer: A Population Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Abrams, Matthew J., E-mail: mabrams@tuftsmedicalcenter.org [Department of Radiation Oncology, Tufts University School of Medicine, Tufts Medical Center, Boston, Massachusetts (United States); Koffer, Paul P. [Department of Radiation Oncology, Tufts University School of Medicine, Tufts Medical Center, Boston, Massachusetts (United States); Wazer, David E. [Department of Radiation Oncology, Tufts University School of Medicine, Tufts Medical Center, Boston, Massachusetts (United States); Department of Radiation Oncology, The Alpert Medical School of Brown University, Rhode Island Hospital, Providence, Rhode Island (United States); Hepel, Jaroslaw T. [Department of Radiation Oncology, The Alpert Medical School of Brown University, Rhode Island Hospital, Providence, Rhode Island (United States)

    2017-06-01

    Purpose: Because of its rarity, there are no randomized trials investigating postmastectomy radiation therapy (PMRT) in male breast cancer. This study retrospectively examines the impact of PMRT in male breast cancer patients in the National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) database. Methods and Materials: The SEER database 8.3.2 was queried for men ages 20+ with a diagnosis of localized or regional nonmetastatic invasive ductal/lobular carcinoma from 1998 to 2013. Included patients were treated by modified radical mastectomy (MRM), with or without adjuvant external beam radiation. Univariate and multivariate analyses evaluated predictors for PMRT use after MRM. Kaplan-Meier overall survival (OS) curves of the entire cohort and a case-matched cohort were calculated and compared by the log-rank test. Cox regression was used for multivariate survival analyses. Results: A total of 1933 patients were included in the unmatched cohort. There was no difference in 5-year OS between those who received PMRT and those who did not (78% vs 77%, respectively, P=.371); however, in the case-matched analysis, PMRT was associated with improved OS at 5 years (83% vs 54%, P<.001). On subset analysis of the unmatched cohort, PMRT was associated with improved OS in men with 1 to 3 positive nodes (5-year OS 79% vs 72% P=.05) and those with 4+ positive nodes (5-year OS 73% vs 53% P<.001). On multivariate analysis of the unmatched cohort, independent predictors for improved OS were use of PMRT: HR=0.551 (0.412-0.737) and estrogen receptor–positive disease: HR=0.577 (0.339-0.983). Predictors for a survival detriment were higher grade 3/4: HR=1.825 (1.105-3.015), larger tumor T2: HR=1.783 (1.357-2.342), T3/T4: HR=2.683 (1.809-3.978), higher N-stage: N1 HR=1.574 (1.184-2.091), N2/N3: HR=2.328 (1.684-3.218), black race: HR=1.689 (1.222-2.336), and older age 81+: HR=4.164 (1.497-11.582). Conclusions: There may be a survival benefit with the

  1. Risk Factors for Neovascular Glaucoma After Proton Beam Therapy of Uveal Melanoma: A Detailed Analysis of Tumor and Dose–Volume Parameters

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, Kavita K., E-mail: kmishra@radonc.ucsf.edu [Department of Radiation Oncology, University of California, San Francisco, San Francisco, California (United States); Daftari, Inder K.; Weinberg, Vivian [Department of Radiation Oncology, University of California, San Francisco, San Francisco, California (United States); Cole, Tia [The Tumori Foundation, San Francisco, California (United States); Quivey, Jeanne M.; Castro, Joseph R.; Phillips, Theodore L. [Department of Radiation Oncology, University of California, San Francisco, San Francisco, California (United States); Char, Devron H. [The Tumori Foundation, San Francisco, California (United States)

    2013-10-01

    Purpose: To determine neovascular glaucoma (NVG) incidence and identify contributing tumor and dosing factors in uveal melanoma patients treated with proton beam radiation therapy (PBRT). Methods and Materials: A total of 704 PBRT patients treated by a single surgeon (DHC) for uveal melanoma (1996-2010) were reviewed for NVG in our prospectively maintained database. All patients received 56 GyE in 4 fractions. Median follow-up was 58.3 months. Analyses included the Kaplan-Meier method to estimate NVG distributions, univariate log–rank tests, and Cox's proportional hazards multivariate analysis using likelihood ratio tests to identify independent risk factors of NVG among patient, tumor, and dose–volume histogram parameters. Results: The 5-year PBRT NVG rate was 12.7% (95% confidence interval [CI] 10.2%-15.9%). The 5-year rate of enucleation due to NVG was 4.9% (95% CI 3.4%-7.2%). Univariately, the NVG rate increased significantly with larger tumor diameter (P<.0001), greater height (P<.0001), higher T stage (P<.0001), and closer proximity to the disc (P=.002). Dose–volume histogram analysis revealed that if >30% of the lens or ciliary body received ≥50% dose (≥28 GyE), there was a higher probability of NVG (P<.0001 for both). Furthermore, if 100% of the disc or macula received ≥28 GyE, the NVG rate was higher (P<.0001 and P=.03, respectively). If both anterior and posterior doses were above specified cut points, NVG risk was highest (P<.0001). Multivariate analysis confirmed significant independent risk factors to include tumor height (P<.0001), age (P<.0001), %disc treated to ≥50% Dose (<100% vs 100%) (P=.0007), larger tumor diameter (P=.01), %lens treated to ≥90% Dose (0 vs >0%-30% vs >30%) (P=.01), and optic nerve length treated to ≥90% Dose (≤1 mm vs >1 mm) (P=.02). Conclusions: Our current PBRT patients experience a low rate of NVG and resultant enucleation compared with historical data. The present analysis shows that tumor height

  2. Textural analysis of pre-therapeutic [18F]-FET-PET and its correlation with tumor grade and patient survival in high-grade gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Pyka, Thomas; Hiob, Daniela; Wester, Hans-Juergen [Klinikum Rechts der Isar der TU Muenchen, Department of Nuclear Medicine, Munich (Germany); Gempt, Jens; Ringel, Florian; Meyer, Bernhard [Klinikum Rechts der Isar der TU Muenchen, Neurosurgic Department, Munich (Germany); Schlegel, Juergen [Klinikum Rechts der Isar der TU Muenchen, Institute of Pathology and Neuropathology, Munich (Germany); Bette, Stefanie [Klinikum Rechts der Isar der TU Muenchen, Neuroradiologic department, Munich (Germany); Foerster, Stefan [Klinikum Rechts der Isar der TU Muenchen, Department of Nuclear Medicine, Munich (Germany); Klinikum Rechts der Isar der TU Muenchen, TUM Neuroimaging Center (TUM-NIC), Munich (Germany)

    2016-01-15

    Amino acid positron emission tomography (PET) with [18F]-fluoroethyl-L-tyrosine (FET) is well established in the diagnostic work-up of malignant brain tumors. Analysis of FET-PET data using tumor-to-background ratios (TBR) has been shown to be highly valuable for the detection of viable hypermetabolic brain tumor tissue; however, it has not proven equally useful for tumor grading. Recently, textural features in 18-fluorodeoxyglucose-PET have been proposed as a method to quantify the heterogeneity of glucose metabolism in a variety of tumor entities. Herein we evaluate whether textural FET-PET features are of utility for grading and prognostication in patients with high-grade gliomas. One hundred thirteen patients (70 men, 43 women) with histologically proven high-grade gliomas were included in this retrospective study. All patients received static FET-PET scans prior to first-line therapy. TBR (max and mean), volumetric parameters and textural parameters based on gray-level neighborhood difference matrices were derived from static FET-PET images. Receiver operating characteristic (ROC) and discriminant function analyses were used to assess the value for tumor grading. Kaplan-Meier curves and univariate and multivariate Cox regression were employed for analysis of progression-free and overall survival. All FET-PET textural parameters showed the ability to differentiate between World Health Organization (WHO) grade III and IV tumors (p < 0.001; AUC 0.775). Further improvement in discriminatory power was possible through a combination of texture and metabolic tumor volume, classifying 85 % of tumors correctly (AUC 0.830). TBR and volumetric parameters alone were correlated with tumor grade, but showed lower AUC values (0.644 and 0.710, respectively). Furthermore, a correlation of FET-PET texture but not TBR was shown with patient PFS and OS, proving significant in multivariate analysis as well. Volumetric parameters were predictive for OS, but this correlation did not

  3. Role of postoperative radiotherapy for celiac lymph node metastasis from gastric cancer: analysis on 63 patients

    International Nuclear Information System (INIS)

    Sun Jing; Sun Yihong; Qin Xinyu; Zeng Mengsu; Wang Minhua; Zeng Zhaochong

    2007-01-01

    Objective: To evaluate the role of postoperative radiotherapy for celiac lymph node (LN) metastasis from gastric cancer in the past 6 years. Methods: Sixty-three patients with abdominal LN metastasis after curative resection for gastric cancer were retrospectively analyzed. Clinical characteristics was colleeted including age, gender, status of primary tumor of stomach (size, location and grade), and the number of LN dissected and involved. Of the 63 patients, 36 received local external beam radiotherapy (EBRT) as salvage therapy and were classified as the EBRT group. The irradiation target was local-regional LN. The radiation dose ranged from 40 to 60 Gy in daily 1.8-2.0 Gy fractions, 5 times weekly. The other 27 patients who received chemotherapy were classified as the non-EBRT group. The Kaplan-Meier method was used to evaluate the survival rates, and the Cox regression model was used to identify the predictors of prognosis. Results: After EBRT, complete response and partial response were observed in 31% and 58% of patients, respectively. The clinical obstruction symptoms induced by LN pressure in 18 patients were completely relieved after EBRT. The median survival was 339 clays for the EBRT group and 136 days for the non- EBRT group, the survival rate at 1 and 2 years for patients treated with EBRT vs. without EBRT was 40% vs. 17% and 20% vs. 6%, respectively (P=0.004). Multivariate analysis showed that the level of relative risk (RR) in the EBRT group was reduced to 0.299 (P=0.002). The incidence of death resulting from LN-related complications was lower in the EBRT group. The main cause of death in both groups was distant metastasis. The gastro-intestinal toxicities were the most common side effects during and after EBRT. The RTOG grade 0,1,2 and 3 toxicities were found in 7,17,11 and 1 patients, respectively. No hematologic and hepatic toxicities were observed. Conclusions: Postoperative lymph node metastasis from gastric cancer is sensitive to external beam

  4. The Corail stem as a reverse hybrid - survivorship and x-ray analysis at 10 years.

    Science.gov (United States)

    Wangen, Helge; Nordsletten, Lars; Boldt, Jens G; Fenstad, Anne M; Beverland, David E

    2017-07-25

    The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA have been sparsely described.We report our experience of reverse hybrid THA, using the Elite plus polyethylene cemented cup together with the Corail fully hydroxyapatite-coated uncemented stem and a 28-mm alumina ceramic head. 132 consecutive reverse hybrid hip arthroplasties were performed from January 2000 to December 2003 in 126 patients with a mean age of 54.3 years (28-65). All patients were routinely reviewed at 3 months, 1, 5, 7 and 10 years postoperatively. At each follow-up patients were seen either by a consultant orthopaedic surgeon or a senior trainee. Anteroposterior pelvic and lateral x-rays of the hip were taken at each visit. To estimate the survival of the THAs we used the Kaplan-Meier method with 95% confidence interval (CI). Logistic regression analysis was performed to determine which factors affected the presence of radiolucency around the femoral stem. The mean follow-up was 11.1 years (9.0-14.2). 1 patient was lost to follow-up, and 7 patients were deceased at the time of 10-year follow up. At 10 years 7 patients have had further surgery. 5 for infection, 1 periprosthetic femoral fracture and 1 heterotopic bone formation. All stems were classified as well fixed. 2 cups were defined as loose at 10 years. 1 patient is scheduled for revision the other refused revision. The clinical outcome and radiological findings were assessed in 123 hips. The mean Harris Hip Score was 94 (35-100) at 10 years and the mean WOMAC score was 89 (30.2-100). We report good results with respect to clinical outcome and survival of the reverse hybrid concept in patients younger than 65. A successful outcome depends on meticulous preoperative planning, use of modern cementing techniques in the acetabulum and experience in implanting an uncemented stem.

  5. Histologic heterogeneity of triple negative breast cancer: A National Cancer Centre Database analysis.

    Science.gov (United States)

    Mills, Matthew N; Yang, George Q; Oliver, Daniel E; Liveringhouse, Casey L; Ahmed, Kamran A; Orman, Amber G; Laronga, Christine; Hoover, Susan J; Khakpour, Nazanin; Costa, Ricardo L B; Diaz, Roberto

    2018-06-02

    Triple negative breast cancer (TNBC) is an aggressive disease, but recent studies have identified heterogeneity in patient outcomes. However, the utility of histologic subtyping in TNBC has not yet been well-characterised. This study utilises data from the National Cancer Center Database (NCDB) to complete the largest series to date investigating the prognostic importance of histology within TNBC. A total of 729,920 patients (pts) with invasive ductal carcinoma (IDC), metaplastic breast carcinoma (MBC), medullary breast carcinoma (MedBC), adenoid cystic carcinoma (ACC), invasive lobular carcinoma (ILC) or apocrine breast carcinoma (ABC) treated between 2004 and 2012 were identified in the NCDB. Of these, 89,222 pts with TNBC that received surgery were analysed. Kaplan-Meier analysis, log-rank testing and multivariate Cox proportional hazards regression were utilised with overall survival (OS) as the primary outcome. MBC (74.1%), MedBC (60.6%), ACC (75.7%), ABC (50.1%) and ILC (1.8%) had significantly different proportions of triple negativity when compared to IDC (14.0%, p < 0.001). TNBC predicted an inferior OS in IDC (p < 0.001) and ILC (p < 0.001). Lumpectomy and radiation (RT) were more common in MedBC (51.7%) and ACC (51.5%) and less common in MBC (33.1%) and ILC (25.4%), when compared to IDC (42.5%, p < 0.001). TNBC patients with MBC (HR 1.39, p < 0.001), MedBC (HR 0.42, p < 0.001) and ACC (HR 0.32, p = 0.003) differed significantly in OS when compared to IDC. Our results indicate that histologic heterogeneity in TNBC significantly informs patient outcomes and thus, has the potential to aid in the development of optimum personalised treatments. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Chemical and antimicrobial analysis of husk fiber aqueous extract ...

    African Journals Online (AJOL)

    Chemical and antimicrobial analysis of husk fiber aqueous extract from Cocos nucifera L. Davi Oliveira e Silva, Gabriel Rocha Martins, Antônio Jorge Ribeiro da Silva, Daniela Sales Alviano, Rodrigo Pires Nascimento, Maria Auxiliadora Coelho Kaplan, Celuta Sales Alviano ...

  7. Tube Stent-Grafts for Infrarenal Aortic Aneurysm: A Matched-Paired Analysis Based on EUROSTAR Data

    International Nuclear Information System (INIS)

    Ruppert, Volker; Leurs, Lina J.; Hobo, Roel; Buth, Jacob; Rieger, Johannes; Umscheid, Thomas

    2007-01-01

    Objective. Tube stent-grafts for treatment of infrarenal aortic aneurysms (AAAs) are a nearly forgotten concept. For focal aortic pathologies tube stent-grafts may be a treatment option. We have performed a retrospective matched-paired analysis of the EUROSTAR registry regarding the outcome of tube vs. bifurcated stent-grafts for AAA. Tapered aortomonoiliac stent-grafts were not the objective of this study. Materials and methods. From July 1997 to June 2006, 7581 patients who underwent an endovascular AAA repair were entered in the EUROSTAR registry by 164 centers. One hundred fifty-three patients were treated with tube stent-grafts. For each of these 153 patients we selected one patient from a bifurcated stent-graft group (BGG-original, 7428 patients) matched according to gender, ASA, age, AAA diameter, and type of anesthesia. Differences in preoperative details between the two study groups were analyzed using chi-square test for discrete variables and Wilcoxon rank-sum test for continuous variables. Multivariate logistic regression analysis was performed on early complications. Midterm outcomes (>30 days) were analyzed by Kaplan-Meier and multivariate Cox proportional hazard model. Results. The duration of the procedure was shorter in the tube stent-graft group (TGG; 102.3 ± 52.2) than in BGG (128.3 ± 55.0; p 0.0002). Type II endoleak was less frequent in TGG (4.0%; mean follow-up, 23.12 ± 23.9 months) than in BGG (14.3%; mean follow-up, 20.77 ± 20.0 months; p = 0.0394). Type I endoleaks and migration were distributed equally, without significant differences between the groups. Combined 30-day and late mortality was higher for TGG (p = 0.0346) and was obviously not aneurysm related. Conclusions. We conclude that after selection of patients, tube stent-grafts for infrarenal aortic repair can be performed with great safety regarding endoleaks and migration. The combined higher 30-day mortality and non-aneurysm-related mortality during follow-up were mainly

  8. Brachytherapy Is Associated With Improved Survival in Inoperable Stage I Endometrial Adenocarcinoma: A Population-Based Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Acharya, Sahaja; Perkins, Stephanie M.; DeWees, Todd; Fischer-Valuck, Benjamin W. [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Mutch, David G.; Powell, Matthew A. [Department of Obstetrics and Gynecology, Washington University School of Medicine, St. Louis, Missouri (United States); Schwarz, Julie K. [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Grigsby, Perry W., E-mail: pgrigsby@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States)

    2015-11-01

    Purpose: To assess the use of brachytherapy (BT) with or without external beam radiation (EBRT) in inoperable stage I endometrial adenocarcinoma in the United States and to determine the effect of BT on overall survival (OS) and cause-specific survival (CSS). Methods and Materials: Data between 1998 and 2011 from the National Cancer Institute's Surveillance, Epidemiology and End Results database were analyzed. Coarsened exact matching was used to adjust for differences in age and grade between patients who received BT and those who did not. Prognostic factors affecting OS and CSS were evaluated using the Kaplan-Meier product-limit method and a Cox proportional hazards regression model. Results: A total of 460 patients with inoperable stage I endometrial adenocarcinoma treated with radiation therapy were identified. Radiation consisted of either EBRT (n=260) or BT with or without EBRT (n=200). The only factor associated with BT use was younger patient age (median age, 72 vs 76 years, P=.001). Patients who received BT had a higher 3-year OS (60% vs 47%, P<.001) and CSS (82% vs 74%, P=.032) compared with those who did not. On multivariate analysis, BT use was independently associated with an improved OS (hazard ratio [HR] 0.67, 95% confidence interval [CI] 0.52-0.87) and CSS (HR 0.61, 95% CI 0.39-0.93). When patients were matched on age, BT use remained significant on multivariate analysis for OS (HR 0.65, 95% CI 0.48-0.87) and CSS (HR 0.52, 95% CI 0.31-0.84). When matched on age and grade, BT remained independently associated with improved OS and CSS (OS HR 0.62, 95% CI 0.46-0.83; CSS HR 0.57, 95% CI 0.34-0.92). Conclusion: Brachytherapy is independently associated with improved OS and CSS. It should be considered as part of the treatment regimen for stage I inoperable endometrial cancer patients undergoing radiation.

  9. Clinical outcome and prognostic factors of primary gastric mucosa-associated lymphoid tissue lymphoma: a retrospective analysis of 77 cases

    International Nuclear Information System (INIS)

    Wang Shulian; Song Yongwen; Jin Jing; Wang Weihu; Liu Yueping; Liu Xinfan; Yu Zihao; Li Yexiong; Xue Liyan; Lv Ning

    2009-01-01

    Objective: To analyze the clinical results and prognostic factors of patients with early-stage primary gastric mucosa-associated lymphoid tissue (MALT) lymphoma. Methods: Seventy-seven patients with primary gastric MALT lymphoma treated from 1985 to 2006 were retrospectively analyzed. All patients were pathologically confirmed as MALT lymphoma in stage I, II and II E (by modified Blackedge staging system). Thirty-seven patients had stage I disease, 23 stage II and 17 stage II E . Sixty patients underwent surgical resection and 17 received non-surgical treatment. Survival rates were calculated by the Kaplan-Meier analysis with the Logrank test. Results: With a median follow up of 57 months for the surviving patients (ranging from 1 to 198 months for all patients), the 5-year overall survival rate, disease-free survival rate, loco-regional control rate and distant metastasis free survival rate were 74%, 70%, 76% and 87%, respectively. In univariate analysis, clinical stage was significantly associated with overall survival. Patients with stage I or II disease had a better overall survival than those with stage II E (P=0.01). Tumor size and surgical resection were significantly associated with disease-free survival. Patients with primary tumor 8 cm or less in diameter had better disease-free survival than those with primary tumor more than 8 cm in diameter (P =0.03). Patients who underwent complete resection had better disease-free survival than those who underwent incomplete resection or no surgery (P=0.02). Clinical stage, tumor size and surgical resection were significantly associated with loco-regional control. Patients with stage I or II disease had better loco-regional control than those with stage II E (P=0.03). Patients with primary tumor 8 cm or less in diameter had better loco-regional control than those with primary tumor more than 8 cm in diameter (P=0.01). Patients who underwent complete resection had better loco-regional control than those who underwent

  10. Evidence and temporality of the obesity paradox in coronary bypass surgery: an analysis of cause-specific mortality.

    Science.gov (United States)

    Schwann, Thomas A; Ramia, Paul S; Engoren, Milo C; Bonnell, Mark R; Goodwin, Matthew; Monroe, Ian; Habib, Robert H

    2018-06-02

    We evaluated the presence of an 'obesity paradox' in coronary artery bypass grafting (CABG) patients, determined its time course and ascertained whether it is associated with improved cardiovascular (CV) survival versus non-CV survival. A retrospective analysis of 3 prospectively collected databases was conducted. A fifteen-year Kaplan-Meier analysis in 7091 CABG patients was performed and repeated in 5 body mass index [BMI (kg/m2)] cohorts [Normal (18.5-24.99 kg/m2), Overweight (25-29.99 kg/m2), Obese I (30-34.99 kg/m2), Obese II (35-39.99 kg/m2) and Obese III (≥40 kg/m2)]. Mortality hazard ratios {HR [95% confidence interval (CI)]} were derived using comprehensive multivariable competing risk Cox regression, accounting for BMI categories for overall (0-15), Early (0-1), Intermediate (1-8) and Late (8-15) postoperative years, to relax the proportional hazards assumption. The regression was repeated using BMI as a continuous variable. Mortality was classified into any, CV and non-CV. Obese patients were younger with more comorbidities. Fifteen-year survival was improved in the Overweight and Obese I groups (P < 0.001). Adjusted 15-year mortality was reduced in the Overweight [HR (95% CI) = 0.88 (0.79-0.98)] and Obese I [HR = 0.88 (0.78-0.99)] groups driven by improved CV and non-CV survival. This trend was noted in the early (Overweight) and intermediate postoperative periods (Overweight and Obese I) with no significance in the late period. Higher mortality in the Obese III [HR = 1.28 (1.06-1.55)] group was driven by a decreased CV survival. Using BMI as a continuous variable, a BMI of 29 kg/m2 was associated with optimal survival. We identified a protective partial obesity paradox in the early and intermediate postoperative periods among Overweight and mildly obese (Obese I) patients with improved CV and non-CV survival. The morbidly obese (the Obese III group) had higher early and late CV mortality.

  11. Brachytherapy Is Associated With Improved Survival in Inoperable Stage I Endometrial Adenocarcinoma: A Population-Based Analysis

    International Nuclear Information System (INIS)

    Acharya, Sahaja; Perkins, Stephanie M.; DeWees, Todd; Fischer-Valuck, Benjamin W.; Mutch, David G.; Powell, Matthew A.; Schwarz, Julie K.; Grigsby, Perry W.

    2015-01-01

    Purpose: To assess the use of brachytherapy (BT) with or without external beam radiation (EBRT) in inoperable stage I endometrial adenocarcinoma in the United States and to determine the effect of BT on overall survival (OS) and cause-specific survival (CSS). Methods and Materials: Data between 1998 and 2011 from the National Cancer Institute's Surveillance, Epidemiology and End Results database were analyzed. Coarsened exact matching was used to adjust for differences in age and grade between patients who received BT and those who did not. Prognostic factors affecting OS and CSS were evaluated using the Kaplan-Meier product-limit method and a Cox proportional hazards regression model. Results: A total of 460 patients with inoperable stage I endometrial adenocarcinoma treated with radiation therapy were identified. Radiation consisted of either EBRT (n=260) or BT with or without EBRT (n=200). The only factor associated with BT use was younger patient age (median age, 72 vs 76 years, P=.001). Patients who received BT had a higher 3-year OS (60% vs 47%, P<.001) and CSS (82% vs 74%, P=.032) compared with those who did not. On multivariate analysis, BT use was independently associated with an improved OS (hazard ratio [HR] 0.67, 95% confidence interval [CI] 0.52-0.87) and CSS (HR 0.61, 95% CI 0.39-0.93). When patients were matched on age, BT use remained significant on multivariate analysis for OS (HR 0.65, 95% CI 0.48-0.87) and CSS (HR 0.52, 95% CI 0.31-0.84). When matched on age and grade, BT remained independently associated with improved OS and CSS (OS HR 0.62, 95% CI 0.46-0.83; CSS HR 0.57, 95% CI 0.34-0.92). Conclusion: Brachytherapy is independently associated with improved OS and CSS. It should be considered as part of the treatment regimen for stage I inoperable endometrial cancer patients undergoing radiation.

  12. Treatment adherence and persistence with long-acting somatostatin analog therapy for the treatment of acromegaly: a retrospective analysis.

    Science.gov (United States)

    Gurel, Michelle H; Han, Yi; Stevens, Andrea L; Furtado, Aaron; Cox, David

    2017-04-04

    Many patients with acromegaly require medical treatment that includes somatostatin analogs (SSAs). Long-acting SSA formulations are widely used, due in part to increased patient convenience and increased treatment adherence vs daily medications. Although medication compliance can be poor in patients with chronic conditions, adherence and persistence with these SSAs in patients with acromegaly has not been evaluated. This analysis utilized claims data to estimate treatment adherence and persistence for lanreotide depot and long-acting octreotide in this population. This retrospective analysis used the MarketScan® database (~100 payors, 500 million claims in the US), which was searched between January 2007 and June 2012 to identify patients with acromegaly taking either lanreotide depot or long-acting octreotide. Patients switching treatments were excluded. Treatment adherence was assessed using medication possession ratio (MPR; number of doses dispensed in relation to dispensing period; ≥80% is considered adherent), injection count, and treatment time. Persistence was estimated by Kaplan-Meier analyses and Cox proportional hazards modeling. A washout period, defined as no acromegaly-related prescription activity 180 days prior to the index date, was employed to minimize effects of prior therapy and focus on patients more likely to be treatment-naïve. Altogether 1308 patients with acromegaly receiving a single SSA for treatment (1127 octreotide, 181 lanreotide) who had not switched treatments were identified. Mean MPR in patients with a 180-day washout (n = 663) was 89% for those receiving octreotide (n = 545) and 87% for those receiving lanreotide (n = 118). Median number of days on therapy was 169 (95% CI 135-232) for octreotide patients and 400 (95% CI 232-532) for lanreotide patients. The point estimate of the Cox proportional hazard ratio for stopping treatment was 1.385 for octreotide vs lanreotide (95% CI 1.079-1.777), suggesting a 38

  13. [Analysis of the Role of PET/CT SUVmax in Prognosis and Its Correlation with 
Clinicopathological Characteristics in Resectable Lung Squamous Cell Carcinoma].

    Science.gov (United States)

    Ren, Hongliang; Xu, Wengui; You, Jian; Song, Xiuyu; Huang, Hui; Zhao, Ning; Ren, Xiubao; Zhang, Xinwei

    2016-04-20

    Lung cancer is the leading cause of cancer death in men and women in the world, more than one-half of cases are diagnosed at a advanced stage, and the overall 5-year survival rate for lung cancer is 18%. Lung cancer is divided into non-small cell lung carcinoma (NSCLC) and small cell lung carcinoma (SCLC). Approximately 80%-85% of cases are NSCLC which includes three main types: adenocarcinoma (40%), squamous cell carcinoma (SCC) (20%-30%), and large cell carcinoma (10%). Although therapies that target driver mutations in adenocarcinomas are showing some promise, they are proving ineffective in smoking-related SCC. We need pay more attention to the diagnosis and treatment of SCC. 18F-FDG positron emission tomography (PET)/computed tomography (CT) has emerged as an accurate staging modality in lung cancer diagnosis. The aim of this study is to investigate the role of maximum standardized uptake value (SUVmax) on PET-CT in prognosis and its correlation with clinicopathological characteristics in resectable SCC. One hundred and eighty-two resectable SCC patients who underwent PET/CT imaging between May 2005 and October 2014 were enrolled into this retrospectively study. All the enrolled patients had underwent pulmonary resection with mediastinal lymph node dissection without preoperative chemotherapy or radiotherapy. Survival outcomes were analyzed using the Kaplan-Meier method and multivariate Cox proportional hazards model. Correlation between SUVmax and clinicopathological factors was analysed using Pearson correlation analysis and Spearman rank correlation analysis. The patients were divided into two groups on the basis of SUVmax 13.0 as cutoff value, and patients with SUVmax more than 13.0 had shorter median overall survival than patients less than 13.0 in univariate analysis (56 months vs 87 months; P=0.022). There was remarkable correlation between SUVmax and gender, tumor size, tumor-node-metastasis (TNM) stage, neutrophil, NLR, hemoglobin (Pdifference by

  14. Analysis of cause-specific failure endpoints using simple proportions: an example from a randomized controlled clinical trial in early breast cancer

    International Nuclear Information System (INIS)

    Panzarella, Tony; Meakin, J. William

    1998-01-01

    Purpose: To describe a statistically valid method for analyzing cause-specific failure data based on simple proportions, that is easy to understand and apply, and outline under what conditions its implementation is well-suited. Methods and Materials: In the comparison of treatment groups, time to first failure (in any site) was analyzed first, followed by an analysis of the pattern of first failure, preferably at the latest complete follow-up time common to each group. Results: A retrospective analysis of time to contralateral breast cancer in 777 early breast cancer patients was undertaken. Patients previously treated by mastectomy plus radiation therapy to the chest wall and regional nodal areas were randomized to receive further radiation and prednisone (R+P), radiation alone (R), or no further treatment (NT). Those randomized to R+P had a statistically significantly delayed time to first failure compared to the group randomized to NT (p = 0.0008). Patients randomized to R also experienced a delayed time to first failure compared to NT, but the difference was not statistically significant (p 0.14). At 14 years from the date of surgery (the latest common complete follow-up time) the distribution of first failures was statistically significantly different between R+P and NT (p = 0.005), but not between R and NT (p = 0.09). The contralateral breast cancer first failure rate at 14 years from surgery was 7.2% for NT, 4.6% for R, and 3.7% for R+P. The corresponding Kaplan-Meier estimates were 13.2%, 8.2%, and 5.4%, respectively. Conclusion: Analyzing cause-specific failure data using methods developed for survival endpoints is problematic. We encourage the use of the two-step analysis strategy described when, as in the example presented, competing causes of failure are not likely to be statistically independent, and when a treatment comparison at a single time-point is clinically relevant and feasible; that is, all patients have complete follow-up to this point

  15. Exponential Decay Nonlinear Regression Analysis of Patient Survival Curves: Preliminary Assessment in Non-Small Cell Lung Cancer

    Science.gov (United States)

    Stewart, David J.; Behrens, Carmen; Roth, Jack; Wistuba, Ignacio I.

    2010-01-01

    Background For processes that follow first order kinetics, exponential decay nonlinear regression analysis (EDNRA) may delineate curve characteristics and suggest processes affecting curve shape. We conducted a preliminary feasibility assessment of EDNRA of patient survival curves. Methods EDNRA was performed on Kaplan-Meier overall survival (OS) and time-to-relapse (TTR) curves for 323 patients with resected NSCLC and on OS and progression-free survival (PFS) curves from selected publications. Results and Conclusions In our resected patients, TTR curves were triphasic with a “cured” fraction of 60.7% (half-life [t1/2] >100,000 months), a rapidly-relapsing group (7.4%, t1/2=5.9 months) and a slowly-relapsing group (31.9%, t1/2=23.6 months). OS was uniphasic (t1/2=74.3 months), suggesting an impact of co-morbidities; hence, tumor molecular characteristics would more likely predict TTR than OS. Of 172 published curves analyzed, 72 (42%) were uniphasic, 92 (53%) were biphasic, 8 (5%) were triphasic. With first-line chemotherapy in advanced NSCLC, 87.5% of curves from 2-3 drug regimens were uniphasic vs only 20% of those with best supportive care or 1 drug (p<0.001). 54% of curves from 2-3 drug regimens had convex rapid-decay phases vs 0% with fewer agents (p<0.001). Curve convexities suggest that discontinuing chemotherapy after 3-6 cycles “synchronizes” patient progression and death. With postoperative adjuvant chemotherapy, the PFS rapid-decay phase accounted for a smaller proportion of the population than in controls (p=0.02) with no significant difference in rapid-decay t1/2, suggesting adjuvant chemotherapy may move a subpopulation of patients with sensitive tumors from the relapsing group to the cured group, with minimal impact on time to relapse for a larger group of patients with resistant tumors. In untreated patients, the proportion of patients in the rapid-decay phase increased (p=0.04) while rapid-decay t1/2 decreased (p=0.0004) with increasing

  16. Impact of T and N substage on survival and disease relapse in adjuvant rectal cancer: a pooled analysis

    International Nuclear Information System (INIS)

    Gunderson, Leonard L.; Sargent, Daniel J.; Tepper, Joel E.; O'Connell, Michael J.; Allmer, Cristine; Smalley, Steven R.; Martenson, James A.; Haller, Daniel G.; Mayer, Robert J.; Rich, Tyvin A.; Ajani, Jaffer A.; Macdonald, John S.; Goldberg, Richard M.

    2002-01-01

    Purpose: To determine the rates of survival and disease control by TNM and MAC stage in three randomized North American rectal adjuvant studies. Materials and Methods: Data were merged from 2551 eligible patients on NCCTG 79-47-51 (n=200), NCCTG 86-47-51 (n=656), and INT 114 (n=1695). All patients received postoperative radiation, and 96% were randomized to receive concomitant and maintenance chemotherapy. Five-year follow-up was available in 94% of patients and 7-yr follow-up in 84%. Kaplan-Meier curves were used to estimate the distribution of overall survival (OS) and disease-free survival (DFS), and p values were derived using the log-rank test. Time to local and distant relapse was estimated using cumulative incidence methodology. Analyses were adjusted for treatment effect using Cox proportional hazards models. Results: OS and DFS were dependent on both TN stage and NT stage (N substage within T stage and T substage within N stage). Even among N2 patients (4 or more LN+), T stage influenced 5-yr OS (T1-2, 69%; T3, 48%; T4, 38%). Three risk groups of patients were defined: (1) intermediate: T3N0, T1-2N1; (2) moderately high: T4N0, T1-2N2, T3N1; and (3) high: T3N2, T4N1, T4N2. For Group 1, 5-yr OS was 74% and 81%, and 5-yr DFS was 66% and 74%. For Group 2, 5-yr OS ranged from 61% to 69%, and for Group 3, OS ranged from 33% to 48%. Cumulative incidence rates of local relapse and distant metastases revealed similar differences by TN and NT stage, as seen in the survival analyses. Conclusion: Patients with a single high-risk factor of either extension beyond the rectal wall (T3N0) or nodal involvement (T1-2N1) have improved OS, DFS, and disease control when compared to those with both high risk factors. Different treatment strategies may be indicated for intermediate- (T3N0, T1-2N1) vs. moderately high or high-risk patients in view of differential survival and rates of relapse. For future trial design, it may be preferable to perform separate studies, or a planned

  17. Local recurrence after surgery for non-small cell lung cancer: a recursive partitioning analysis of multi-institutional data.

    Science.gov (United States)

    Kelsey, Chris R; Higgins, Kristin A; Peterson, Bercedis L; Chino, Junzo P; Marks, Lawrence B; D'Amico, Thomas A; Varlotto, John M

    2013-10-01

    To define subgroups at high risk of local recurrence (LR) after surgery for non-small cell lung cancer using a recursive partitioning analysis (RPA). This Institutional Review Board-approved study included patients who underwent upfront surgery for I-IIIA non-small cell lung cancer at Duke Cancer Institute (primary set) or at other participating institutions (validation set). The 2 data sets were analyzed separately and identically. Disease recurrence at the surgical margin, ipsilateral hilum, and/or mediastinum was considered an LR. Recursive partitioning was used to build regression trees for the prediction of local recurrence-free survival (LRFS) from standard clinical and pathological factors. LRFS distributions were estimated with the Kaplan-Meier method. The 1411 patients in the primary set had a 5-year LRFS rate of 77% (95% confidence interval [CI], 0.74-0.81), and the 889 patients in the validation set had a 5-year LRFS rate of 76% (95% CI, 0.72-0.80). The RPA of the primary data set identified 3 terminal nodes based on stage and histology. These nodes and their 5-year LRFS rates were as follows: (1) stage I/adenocarcinoma, 87% (95% CI, 0.83-0.90); (2) stage I/squamous or large cell, 72% (95% CI, 0.65-0.79); and (3) stage II-IIIA, 62% (95% CI, 0.55-0.69). The validation RPA identified 3 terminal nodes based on lymphovascular invasion (LVI) and stage: (1) no LVI/stage IA, 82% (95% CI, 0.76-0.88); (2) no LVI/stage IB-IIIA, 73% (95% CI, 0.69-0.80); and (3) LVI, 58% (95% CI, 0.47-0.69). The risk of LR was similar in the primary and validation patient data sets. There was discordance between the 2 data sets regarding the clinical factors that best segregate patients into risk groups. Copyright © 2013 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.

  18. Ceramic-on-ceramic bearing fractures in total hip arthroplasty: an analysis of data from the National Joint Registry.

    Science.gov (United States)

    Howard, D P; Wall, P D H; Fernandez, M A; Parsons, H; Howard, P W

    2017-08-01

    Ceramic-on-ceramic (CoC) bearings in total hip arthroplasty (THA) are commonly used, but concerns exist regarding ceramic fracture. This study aims to report the risk of revision for fracture of modern CoC bearings and identify factors that might influence this risk, using data from the National Joint Registry (NJR) for England, Wales, Northern Ireland and the Isle of Man. We analysed data on 223 362 bearings from 111 681 primary CoC THAs and 182 linked revisions for bearing fracture recorded in the NJR. We used implant codes to identify ceramic bearing composition and generated Kaplan-Meier estimates for implant survivorship. Logistic regression analyses were performed for implant size and patient specific variables to determine any associated risks for revision. A total of 222 852 bearings (99.8%) were CeramTec Biolox products. Revisions for fracture were linked to seven of 79 442 (0.009%) Biolox Delta heads, 38 of 31 982 (0.119%) Biolox Forte heads, 101 of 80 170 (0.126%) Biolox Delta liners and 35 of 31 258 (0.112%) Biolox Forte liners. Regression analysis of implant size revealed smaller heads had significantly higher odds of fracture (chi-squared 68.0, p ceramic type. Liner thickness was not predictive of fracture (p = 0.67). Body mass index (BMI) was independently associated with revision for both head fractures (odds ratio (OR) 1.09 per unit increase, p = 0.031) and liner fractures (OR 1.06 per unit increase, p = 0.006). We report the largest independent study of CoC bearing fractures to date. The risk of revision for CoC bearing fracture is very low but previous studies have underestimated this risk. There is good evidence that the latest generation of ceramic has greatly reduced the odds of head fracture but not of liner fracture. Small head size and high patient BMI are associated with an increased risk of ceramic bearing fracture. Cite this article: Bone Joint J 2017;99-B:1012-19. ©2017 The British Editorial Society of Bone & Joint Surgery.

  19. Survival analysis of women with cervical cancer treated at a referral hospital for oncology in Espírito Santo State, Brazil, 2000-2005 Análisis de la supervivencia de mujeres con cáncer de cuello de útero atendidas en un hospital oncológico de referencia en Espírito Santo, Brasil, desde 2000 a 2005 Análise da sobrevida de mulheres com câncer do colo do útero atendidas em hospital de referência para oncologia no Espírito Santo, Brasil, nos anos de 2000 a 2005

    Directory of Open Access Journals (Sweden)

    Maria Helena Costa Amorim

    2013-04-01

    Full Text Available Uterine cervical cancer is a leading cause of death from cancer in the female population worldwide. The aim of this study was to analyze survival of women with cervical cancer treated at the Santa Rita de Cássia Hospital/Women's Association for Cancer Education and Control (HSRC/AFECC in Espírito Santo State, Brazil, from 2000 to 2005 and to describe associated prognostic factors. This was a cohort study using retrospective secondary data with a sample of 964 cases. The Kaplan-Meier curve and Cox model were used to evaluate survival and for multiple logistic analysis. There were 421 deaths (43.6% during the minimum 5-year follow-up, with an overall 5-year survival of 58.8%. Risk factors were place of residence in the Serrana Region of the State (HR: 1.94; 95%CI: 1.09-3.45 and advanced staging. Women with stages III and IV at diagnosis showed an increased risk of 4.33 (95%CI: 3.00-6.24 and 15.40 (95%CI: 9.72-24.39, respectively, for lower survival when compared to stage I. The results show that early diagnosis and treatment are essential for reducing mortality from cervical cancer.El cáncer de cuello de útero corresponde a una de las principales causas de muerte por neoplasias en la población femenina mundial. El objetivo de este estudio fue analizar la supervivencia de mujeres con cáncer de cuello de útero, atendidas en el Hospital Santa Rita de Cássia/Asociación Femenina de Educación y Combate al Cáncer (HSRC/AFECC, durante el período de 2000 a 2005 y describir los factores pronósticos asociados. Se trata de un estudio de cohorte con utilización de datos secundarios retrospectivos, con una muestra de 964 casos. Se utilizaron la curva de Kaplan-Meier y el modelo de Cox para la evaluación de la supervivencia y para el análisis logístico múltiple. Se produjeron 421 (43,6% óbitos durante un período mínimo de 5 años de seguimiento, con una sobrevida global de 58,8% en 5 años. Se identificó como un riesgo la procedencia de

  20. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  1. Clinical Outcomes for Patients with Gleason Score 9-10 Prostate Adenocarcinoma Treated With Radiotherapy or Radical Prostatectomy: A Multi-institutional Comparative Analysis.

    Science.gov (United States)

    Kishan, Amar U; Shaikh, Talha; Wang, Pin-Chieh; Reiter, Robert E; Said, Jonathan; Raghavan, Govind; Nickols, Nicholas G; Aronson, William J; Sadeghi, Ahmad; Kamrava, Mitchell; Demanes, David Jeffrey; Steinberg, Michael L; Horwitz, Eric M; Kupelian, Patrick A; King, Christopher R

    2017-05-01

    The long natural history of prostate cancer (CaP) limits comparisons of efficacy between radical prostatectomy (RP) and external beam radiotherapy (EBRT), since patients treated years ago received treatments considered suboptimal by modern standards (particularly with regards to androgen deprivation therapy [ADT] and radiotherapy dose-escalation]. Gleason score (GS) 9-10 CaP is particularly aggressive, and clinically-relevant endpoints occur early, facilitating meaningful comparisons. To compare outcomes of patients with GS 9-10 CaP following EBRT, extremely-dose escalated radiotherapy (as exemplified by EBRT+brachytherapy [EBRT+BT]), and RP. Retrospective analysis of 487 patients with biopsy GS 9-10 CaP treated between 2000 and 2013 (230 with EBRT, 87 with EBRT+BT, and 170 with RP). Most radiotherapy patients received ADT and dose-escalated radiotherapy. Kaplan-Meier analysis and multivariate Cox regression estimated and compared 5-yr and 10-yr rates of distant metastasis-free survival, cancer-specific survival (CSS), and overall survival (OS). The median follow-up was 4.6 yr. Local salvage and systemic salvage were performed more frequently in RP patients (49.0% and 30.1%) when compared with either EBRT patients (0.9% and 19.7%) or EBRT+BT patients (1.2% and 16.1%, pRadiotherapy and RP provide equivalent CSS and OS. Extremely dose-escalated radiotherapy with ADT in particular offers improved systemic control when compared with either EBRT or RP. These data suggest that extremely dose-escalated radiotherapy with ADT might be the optimal upfront treatment for patients with biopsy GS 9-10 CaP. While some prostate cancers are slow-growing requiring many years, sometimes decades, of follow-up in order to compare between radiation and surgery, high-risk and very aggressive cancers follow a much shorter time course allowing such comparisons to be made and updated as treatments, especially radiation, rapidly evolve. We showed that radiation-based treatments and surgery

  2. Glucose-regulated protein 78 regulates the expression of mitochondrial genesis proteins in HBV-related hepatocellular carcinoma: a clinical analysis

    Directory of Open Access Journals (Sweden)

    LI Yaping

    2017-10-01

    Full Text Available ObjectiveTo investigate the expression of glucose-regulated protein 78 (GRP78 in HBV-related hepatocellular carcinoma (HBV-HCC and its association with clinicopathological features, as well as its regulatory effect on mitochondrial genesis proteins in hepatoma cells, and to provide a basis for new strategies for the prevention and treatment of HCC. MethodsTissue samples were collected from 54 patients with HBV-HCC, and immunohistochemistry and Western blot were used to measure the expression of GRP78, Lon, TFAM, and cytochrome C oxidase Ⅳ (COXⅣ. The expression of GRP78 in hepatoma cells was interfered by siRNA, and then the expression of GRP78, Lon, mitochondrial transcription factor A (TFAM, and COX Ⅳ was measured. Quantitative real-time PCR was used to measure the level of mitochondrial DNA (mtDNA in clinical specimens and HCC cells after GRP78 expression was interfered with. A statistical analysis was performed for clinical and experimental data. The t-test was used for comparison of continuous data between groups, the Fisher′s exact test was used for comparison of categorical data between groups, and the Kaplan-Meier method was used for survival analysis. Results Compared with the adjacent tissues, HBV-HCC tissues had significantly higher expression of GRP78 and Lon (t=9.135 and 5523, both P<0.0001 and significantly lower expression of the mitochondrial genesis proteins TFAM and COX Ⅳ and mtDNA level (t=2.765, 4260, and 12.280, P=0.011, <0.001, and <0.001. There were significant increases in the expression of the mitochondrial genesis proteins TFAM and COX Ⅳ and mtDNA level after the interference with GRP78 expression in hepatoma cells (all P<0.05. There were significant differences in the expression of GRP78 between patients with different numbers of tumors, patients with and without portal vein tumor thrombus, and patients with different tumor stages (P=0.016, 0.003, and 0.045. The patients with low GRP78

  3. Combined neck dissection and postoperative radiation therapy in the management of the high-risk neck: a matched-pair analysis

    International Nuclear Information System (INIS)

    Lundahl, Robert E.; Foote, Robert L.; Bonner, James A.; Suman, Vera J.; Lewis, Jean E.; Kasperbauer, Jan L.; McCaffrey, Thomas V.; Olsen, Kerry D.

    1998-01-01

    Purpose: The purpose of this study was to determine the efficacy of postoperative adjuvant radiation therapy with regard to reducing the rate of recurrence in the neck, cancer-related death, and death from any cause in patients with squamous cell carcinoma of the head and neck region metastatic to neck nodes. Methods: This was a retrospective review of patients with pathologically confirmed nodal metastases who underwent neck dissection and postoperative adjuvant radiation therapy for squamous cell carcinoma of the head and neck region. Time to recurrence in the dissected area of the neck, any recurrence in the neck, cancer-related death, and death from any cause were estimated with the Kaplan-Meier method. A matched-pair analysis was performed utilizing a cohort of patients who underwent neck dissection without postoperative radiation therapy. The patients from the two cohorts were matched according to previously reported high-risk features for cancer recurrence and death. Cox hazards models for the matched pairs were used to evaluate the relative risk of subsequent recurrence in the dissected side of the neck, any neck recurrence, cancer-related death, and overall survival. Materials: The medical records and pathologic slides of 95 consecutive patients with pathologically confirmed nodal metastases from squamous cell carcinoma of the head and neck region who underwent neck dissection and postoperative adjuvant radiation therapy between January 1974 and December 1990 were reviewed. Previously published data from 284 patients with squamous cell carcinoma of the head and neck region treated with neck dissection alone between January 1970 and December 1980 were used for a matched-pair analysis. Results: The relative risks for recurrence in the dissected side of the neck, any neck recurrence (dissected neck or delayed undissected neck metastasis), cancer-related death, and death from any cause for patients treated with operation alone relative to those treated with

  4. Improved Metastasis- and Disease-Free Survival With Preoperative Sequential Short-Course Radiation Therapy and FOLFOX Chemotherapy for Rectal Cancer Compared With Neoadjuvant Long-Course Chemoradiotherapy: Results of a Matched Pair Analysis.

    Science.gov (United States)

    Markovina, Stephanie; Youssef, Fady; Roy, Amit; Aggarwal, Sonya; Khwaja, Shariq; DeWees, Todd; Tan, Benjamin; Hunt, Steven; Myerson, Robert J; Chang, Daniel T; Parikh, Parag J; Olsen, Jeffrey R

    2017-10-01

    To compare treatment and toxicity outcomes between a phase 2 institutional trial of near total neoadjuvant therapy (nTNT) for locally advanced rectal cancer and a similar historical control cohort treated at Washington University in St. Louis with the current US standard of care, defined as neoadjuvant chemoradiotherapy (NCRT), total mesorectal excision (TME), and adjuvant FOLFOX chemotherapy; to expand the comparison to an additional institution, patients treated with similar NCRT at Stanford University were included. Sixty-nine patients with cT3-4N0-2M0 rectal adenocarcinoma enrolled on the Washington University in St. Louis phase 2 study of nTNT were included for analysis. Patients treated at the same institution with conventional NCRT and adjuvant FOLFOX were matched for exact cTNM stage. Forty-one patients treated with NCRT at Stanford University were included in a second analysis. Kaplan-Meier analysis with log-rank test was used to compare local control, distant metastasis-free survival, disease-free survival, and overall survival. Median follow-up was 49 and 54 months for nTNT and NCRT, respectively. Pathologic complete response and T-downstaging rates were 28% versus 16% (P=.21) and 75% versus 41% (P<.001) in the nTNT and NCRT cohorts, respectively. Three-year disease-free survival (85% vs 68%, P=.032) was significantly better in the nTNT group. Actuarial 3-year local control (92% vs 96%, P=.36) and overall survival (96% vs 88%, P=.67) were similar. The Stanford cohort had significantly lower clinical stage. After controlling for clinical stage, age, tumor location, institution, and number of chemotherapy cycles, nTNT treatment remained significantly associated with lower risk of recurrence (P=.006). Patients treated with nTNT had higher T-downstaging and superior distant metastasis-free survival and disease-free survival compared with conventional NCRT when matched for tumor location and exact cTNM stage. Near total neoadjuvant therapy remained a

  5. Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

    Science.gov (United States)

    Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

    2011-03-28

    The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  6. Impact of postoperative radiotherapy and HER2/new overexpression in salivary duct carcinoma. A monocentric clinicopathologic analysis

    Energy Technology Data Exchange (ETDEWEB)

    Haderlein, Marlen; Semrau, Sabine; Lettmaier, Sebastian; Hecht, Markus; Fietkau, Rainer [University Hospital of Erlangen, Department of Radiation Oncology, Erlangen (Germany); Scherl, Claudia; Iro, Heinrich [University Hospital of Erlangen, Department of Otorhinolaryngology, Erlangen (Germany); Erber, Ramona; Agaimy, Abbas [University Hospital of Erlangen, Institute of Pathology, Erlangen (Germany)

    2017-11-15

    Retrospective Investigation of the prognostic relevance of clinicopathologic parameters in patients with salivary duct carcinoma (SDC). An experienced pathologist reviewed 67 patients with de novo SDC or SDC ex pleomorphic adenoma. Paraffin-embedded tumor samples were examined by immunohistochemistry for expression of HER2/neu, androgen (AR), progesterone (PR), estrogen (ER), epidermal growth factor (EGFR) and programmed death ligand 1 (PD-L1-R) receptor. In 45 patients who had cM0 and follow-up data available, survival rates were calculated (Kaplan-Meier method) and prognostic variables were analyzed (univariate analysis: log-rank test; multivariate analysis: Cox-regression analysis). Overexpression of HER2/neu, AR, ER, PR, EGFR, PD-L1-R was found in 25.4%, 84%, 0%, 0%, 17.9%, 16.4% of patients. Overall (OS), disease-free (DFS), distant-metastases-free survival (DMFS) and locoregional control (LRC) were 92.3/72.4/56.9%, 78.2/58.1/58.1%, 85.4/65.2/65.2% and 89.7/81.9/81.9% after 1/3/5 years (medial follow-up 26 months). In univariate analysis a positive resection margin (p = 0.008) and no postoperative radiotherapy (p = 0.001) predict an increased locoregional recurrence rate. In multivariate analysis only postoperative radiotherapy is statistically significant (p = 0.004). Presence of lymph node metastases, a lymph node density >4 and HER2/neu overexpression predict decreased DFS and DMFS. In multivariate HER2/neu overexpression was the only significant predictor for reduced DFS (p = 0.04) and DMFS (p = 0.02). Postoperative radiotherapy is the only significant predictor for LRC. HER2/neu receptor expression is an independent prognostic factor for decreased DFS and DMFS in patients with SDC. In addition to radio(chemo)therapy, intensified first-line treatment regimens should also be evaluated in the future. (orig.) [German] In dieser retrospektiven Auswertung wurde der Einfluss klinisch-pathologischer Parameter auf die Prognose von Patienten mit

  7. Risk factors and survival outcome for non-elective referral in non-small cell lung cancer patients--analysis based on the National Lung Cancer Audit.

    Science.gov (United States)

    Beckett, P; Tata, L J; Hubbard, R B

    2014-03-01

    Survival after diagnosis of lung cancer is poor and seemingly lower in the UK than other Western countries, due in large part to late presentation with advanced disease precluding curative treatment. Recent research suggests that around one-third of lung cancer patients reach specialist care after emergency presentation and have a worse survival outcome. Confirmation of these data and understanding which patients are affected may allow a targeted approach to improving outcomes. We used data from the UK National Lung Cancer Audit in a multivariate logistic regression model to quantify the association of non-elective referral in non-small cell lung cancer patients with covariates including age, sex, stage, performance status, co-morbidity and socioeconomic status and used the Kaplan-Meier method and Cox proportional hazards model to quantify survival by source of referral. In an analysis of 133,530 cases of NSCLC who presented 2006-2011, 19% of patients were referred non-electively (following an emergency admission to hospital or following an emergency presentation to A&E). This route of referral was strongly associated with more advanced disease stage (e.g. in Stage IV - OR: 2.34, 95% CI: 2.14-2.57, p<0.001) and worse performance status (e.g. in PS 4 - OR: 7.28, 95% CI: 6.75-7.86, p<0.001), but was also independently associated with worse socioeconomic status, and extremes of age. These patients were more likely to have died within 1 year of diagnosis (hazard ratio of 1.51 (95% CI: 1.49-1.54) after adjustment for key clinical variables. Our data confirm and quantify poorer survival in lung cancer patients who are referred non-electively to specialist care, which is more common in patients with poorer performance status, higher disease stage and less advantaged socioeconomic status. Work to tackle this late presentation should be urgently accelerated, since its realisation holds the promise of improved outcomes and better healthcare resource utilisation. Copyright

  8. Contribution of lymph node staging method and prognostic factors in malignant ovarian sex cord-stromal tumors: A world wide database analysis.

    Science.gov (United States)

    Wang, Jieyu; Li, Jun; Chen, Ruifang; Lu, Xin

    2018-07-01

    To investigate the clinicopathologic prognostic factors in patients with malignant sex cord-stromal tumors (SCSTs) with lymph node dissection, and at the same time, to evaluate the influence of the log odds of positive lymph nodes (LODDS) on their survival. Patients diagnosed with malignant SCSTs who underwent lymph node dissection were extracted from the 1988-2013 Surveillance, Epidemiology, and End Results (SEER) database. Overall survival (OS) and cancer-specific survival (CSS) were estimated by Kaplan-Meier curves. The Cox proportional hazards regression model was used to identify independent predictors of survival. 576 patients with malignant SCSTs and with lymphadenectomy were identified, including 468 (81.3%) patients with granulosa cell tumors (GCTs) and 80 (13.9%) patients with Sertoli-Leydig cell tumors (SLCTs). 399 (69.3%) patients and 118 (20.5%) patients were in the LODDS < -1 group and -1 ≤ LODDS < -0.5 group, respectively. The 10-year OS rate was 80.9% and CSS was 87.2% in the LODDS < -0.5 group, whereas the survival rates for other groups were 68.5% and 73.3%. On multivariate analysis, age 50 years or less (p < 0.001), tumor size of 10 cm or less (p < 0.001), early-stage disease (p < 0.001), and GCT histology (p ≤ 0.001) were the significant prognostic factors for improved survival. LODDS < -0.5 was associated with a favorable prognosis (OS: p = 0.051; CSS:P = 0.055). Younger age, smaller tumor size, early stage, and GCT histologic type are independent prognostic factors for improved survival in patients with malignant SCST with lymphadenectomy. Stratified LODDS could be regarded as an effective value to assess the lymph node status, and to predict the survival status of patients. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

  9. A population-based analysis of mortality in patients with Turner syndrome and hypoplastic left heart syndrome using the Texas Birth Defects Registry.

    Science.gov (United States)

    Lara, Diego A; Ethen, Mary K; Canfield, Mark A; Nembhard, Wendy N; Morris, Shaine A

    2017-01-01

    Hypoplastic left heart syndrome (HLHS) is strongly associated with Turner syndrome (TS); outcome data when these conditions coexist is sparse. We aimed to investigate long-term survival and causes of death in this population. The Texas Birth Defects Registry was queried for all live born infants with HLHS during 1999-2007. We used Kaplan-Meier and Cox regression analyses to compare survival among patients with HLHS with TS (HLHS/TS+) to patients who had HLHS without genetic disorders or extracardiac birth defects (HLHS/TS-). Of the 542 patients with HLHS, 11 had TS (2.0%), 71 had other extracardiac birth defects or genetic disorders, and 463 had neither. The median follow-up time was 4.2 y (interquartile range [IQR] 2.1-6.5). Comparing those with HLHS/TS+ to HLHS/TS-, 100% versus 35% were female (P < .001), and median birth weight was 2140 g (IQR 1809-2650) versus 3196 g (IQR 2807-3540, P < .001). Neonatal mortality was 36% in HLHS/TS+ versus 27% in HLHS/TS- (log rank = 0.431). Ten of the 11 TS+ patients died during the study period for cumulative mortality of 91% versus 50% (hazard ratio (HR) for TS+: 2.90, 95% CI 1.53-5.48). Six patients died prior to surgery, 5 underwent Stage 1 palliation (S1P), 3 died after S1P, 2 survived past S2P, and one of these died at age 19 mo. The underlying cause of death was listed as congenital heart disease on all the death certificates of HLHS/TS+ patients. In multivariable analysis controlling for low birth weight (<2500 g), TS remained associated with significantly increased cumulative mortality, although females without TS had higher mortality than males (HR for TS+ versus males: 2.42, 95% CI 1.24-4.73; HR for TS- females versus males: 1.41, 95% CI 1.08-1.83). TS with HLHS is associated with significant mortality. The increased mortality in females without documented TS calls to question if TS is undetected in a portion of females with HLHS. © 2016 Wiley Periodicals, Inc.

  10. Measurement of circulating transcripts and gene cluster analysis predicts and defines therapeutic efficacy of peptide receptor radionuclide therapy (PRRT) in neuroendocrine tumors

    International Nuclear Information System (INIS)

    Bodei, L.; Kidd, M.; Modlin, I.M.; Severi, S.; Nicolini, S.; Paganelli, G.; Drozdov, I.; Kwekkeboom, D.J.; Krenning, E.P.; Baum, R.P.

    2016-01-01

    Peptide receptor radionuclide therapy (PRRT) is an effective method for treating neuroendocrine tumors (NETs). It is limited, however, in the prediction of individual tumor response and the precise and early identification of changes in tumor size. Currently, response prediction is based on somatostatin receptor expression and efficacy by morphological imaging and/or chromogranin A (CgA) measurement. The aim of this study was to assess the accuracy of circulating NET transcripts as a measure of PRRT efficacy, and moreover to identify prognostic gene clusters in pretreatment blood that could be interpolated with relevant clinical features in order to define a biological index for the tumor and a predictive quotient for PRRT efficacy. NET patients (n = 54), M: F 37:17, median age 66, bronchial: n = 13, GEP-NET: n = 35, CUP: n = 6 were treated with 177 Lu-based-PRRT (cumulative activity: 6.5-27.8 GBq, median 18.5). At baseline: 47/54 low-grade (G1/G2; bronchial typical/atypical), 31/49 18 FDG positive and 39/54 progressive. Disease status was assessed by RECIST1.1. Transcripts were measured by real-time quantitative reverse transcription PCR (qRT-PCR) and multianalyte algorithmic analysis (NETest); CgA by enzyme-linked immunosorbent assay (ELISA). Gene cluster (GC) derivations: regulatory network, protein:protein interactome analyses. Statistical analyses: chi-square, non-parametric measurements, multiple regression, receiver operating characteristic and Kaplan-Meier survival. The disease control rate was 72 %. Median PFS was not achieved (follow-up: 1-33 months, median: 16). Only grading was associated with response (p < 0.01). At baseline, 94 % of patients were NETest-positive, while CgA was elevated in 59 %. NETest accurately (89 %, χ 2 = 27.4; p = 1.2 x 10 -7 ) correlated with treatment response, while CgA was 24 % accurate. Gene cluster expression (growth-factor signalome and metabolome) had an AUC of 0.74 ± 0.08 (z-statistic = 2.92, p < 0.004) for predicting

  11. Right miniparasternotomy may be a good minimally invasive alternative to full sternotomy for cardiac valve operations: a propensity-adjusted analysis.

    Science.gov (United States)

    Chiu, Kuan M; Chen, Robert J; Lin, Tzu Y; Chen, Jer S; Huang, Jin H; Huang, Chun Y; Chu, Shu H

    2016-02-01

    Limited real-world data existed for mini-parasternotomy approach with good sample size in Asian cohorts and most previous studies were eclipsed by case heterogeneity. The goal of this study was to compare safety and quality outcomes of cardiac non-coronary valve operations by mini-parasternotomy and full sternotomy approaches on risk-adjusted basis. METHODS From our hospital database, we retrieved the cases of non-coronary valve operations from 1 January 2005 to 31 December 2012, including re-do, emergent, and combined procedures. Estimated EuroScore-II and propensity score for choosing mini-parasternotomy were adjusted for in the regression models on hospital mortality, complications (pneumonia, stroke, sepsis, etc.), and quality parameters (length of stay, ICU time, ventilator time, etc.). Non-complicated cases, defined as survival to discharge, ventilator use not over one week, and intensive care unit stay not over two weeks, were used for quality parameters. There were 283 mini-parasternotomy and 177 full sternotomy cases. EuroScore-II differed significantly (medians 2.1 vs. 4.7, P<0.001). Propensity scores for choosing mini-parasternotomy were higher with lower EuroScore-II (OR=0.91 per 1%, P<0.001), aortic regurgitation (OR=2.3, P=0.005), and aortic non-mitral valve disease (OR=3.9, P<0.001). Adjusted for propensity score and EuroScore-II, mini-parasternotomy group had less pneumonia (OR=0.32, P=0.043), less sepsis (OR=0.31, P=0.045), and shorter non-complicated length of stay (coefficient=-7.2 (day), P<0.001) than full sternotomy group, whereas Kaplan-Meier survival, non-complicated ICU time, non-complicated ventilator time, and 30-day mortality did not differ significantly. The propensity-adjusted analysis demonstrated encouraging safety and quality outcomes for mini-parasternotomy valve operation in carefully selected patients.

  12. Pretreatment 18F-FDG PET Textural Features in Locally Advanced Non-Small Cell Lung Cancer: Secondary Analysis of ACRIN 6668/RTOG 0235.

    Science.gov (United States)

    Ohri, Nitin; Duan, Fenghai; Snyder, Bradley S; Wei, Bo; Machtay, Mitchell; Alavi, Abass; Siegel, Barry A; Johnson, Douglas W; Bradley, Jeffrey D; DeNittis, Albert; Werner-Wasik, Maria; El Naqa, Issam

    2016-06-01

    In a secondary analysis of American College of Radiology Imaging Network (ACRIN) 6668/RTOG 0235, high pretreatment metabolic tumor volume (MTV) on (18)F-FDG PET was found to be a poor prognostic factor for patients treated with chemoradiotherapy for locally advanced non-small cell lung cancer (NSCLC). Here we utilize the same dataset to explore whether heterogeneity metrics based on PET textural features can provide additional prognostic information. Patients with locally advanced NSCLC underwent (18)F-FDG PET prior to treatment. A gradient-based segmentation tool was used to contour each patient's primary tumor. MTV, maximum SUV, and 43 textural features were extracted for each tumor. To address overfitting and high collinearity among PET features, the least absolute shrinkage and selection operator (LASSO) method was applied to identify features that were independent predictors of overall survival (OS) after adjusting for MTV. Recursive binary partitioning in a conditional inference framework was utilized to identify optimal thresholds. Kaplan-Meier curves and log-rank testing were used to compare outcomes among patient groups. Two hundred one patients met inclusion criteria. The LASSO procedure identified 1 textural feature (SumMean) as an independent predictor of OS. The optimal cutpoint for MTV was 93.3 cm(3), and the optimal SumMean cutpoint for tumors above 93.3 cm(3) was 0.018. This grouped patients into three categories: low tumor MTV (n = 155; median OS, 22.6 mo), high tumor MTV and high SumMean (n = 23; median OS, 20.0 mo), and high tumor MTV and low SumMean (n = 23; median OS, 6.2 mo; log-rank P textural PET features in the context of established prognostic factors. We have also identified a promising feature that may have prognostic value in locally advanced NSCLC patients with large tumors who are treated with chemoradiotherapy. Validation studies are warranted. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  13. Peptide receptor radionuclide therapy (PRRT) in European Neuroendocrine Tumour Society (ENETS) grade 3 (G3) neuroendocrine neoplasia (NEN) - a single-institution retrospective analysis

    Energy Technology Data Exchange (ETDEWEB)

    Thang, Sue Ping [Peter MacCallum Cancer Centre, Centre for Cancer Imaging, Melbourne, VIC (Australia); Singapore General Hospital, Department of Nuclear Medicine and PET, Singapore (Singapore); Lung, Mei Sim; Michael, Michael [Peter MacCallum Cancer Centre, Division of Cancer Medicine, Neuroendocrine Tumour Unit, Melbourne, VIC (Australia); Kong, Grace; Hofman, Michael S.; Callahan, Jason; Hicks, Rodney J. [Peter MacCallum Cancer Centre, Centre for Cancer Imaging, Melbourne, VIC (Australia)

    2018-02-15

    Grade 3 NENs are aggressive tumours with poor prognosis. PRRT+/- radiosensitising chemotherapy is a potential treatment for disease with high somatostatin receptor (SSTR) expression without spatially discordant FDG-avid disease. We retrospectively evaluated the efficacy of PRRT in G3 NEN. Kaplan-Meier estimation was used to determine progression-free survival (PFS) and overall survival (OS) defined from start of PRRT. Subgroup analysis was performed for patients with Ki-67 ≤ 55% and >55%. Anatomical response (RECIST 1.1) and toxicity 3 months after PRRT was determined. Disease control rate (DCR) was defined as complete response (CR), partial response (PR) and stable disease (SD) of those with prior progression. 28 patients (M = 17; age 16-78 years; Ki-67 ≤ 55% = 22) were reviewed. 17 patients had pancreatic, 5 small bowel, 3 large bowel, 2 bronchial and 1 unknown primary disease. 25/28 had significant FDG-avid disease prior to treatment. Most had {sup 177}Lu-DOTA-octreotate (median cumulative activity 24.4 GBq, median 4 cycles). Twenty patients had radiosensitising chemotherapy. 89% were treated for disease progression; 79% after prior chemotherapy. Median follow-up was 29 months. The median PFS was 9 months for all patients. 16 patients died (Ki-67 ≤ 55% = 11; Ki-67 > 55% = 5) with median OS of 19 months. For Ki-67 ≤ 55% (N = 22), the median PFS was 12 months and median OS 46 months. For Ki-67 > 55% (N = 6), the median PFS was 4 months and median OS 7 months. On CT imaging, DCR at 3 months post-PRRT was 74%, 35% (8/23) PR and 39% (9/23) SD. Eleven patients received further PRRT due to recrudescent disease after response. Five patients developed progression of discordant FDG-avid disease and were referred for targeted therapy/chemotherapy. Grade 3 and 4 lymphopenia and thrombocytopenia occurred in five and five patients, respectively. No renal or liver toxicity related to treatment was seen. PRRT achieves clinically relevant disease control with acceptable

  14. Hemithoracic Intensity Modulated Radiation Therapy After Pleurectomy/Decortication for Malignant Pleural Mesothelioma: Toxicity, Patterns of Failure, and a Matched Survival Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Chance, William W. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Rice, David C. [Department of Thoracic and Cardiovascular Surgery, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Allen, Pamela K. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Tsao, Anne S. [Department of Thoracic/Head and Neck Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Fontanilla, Hiral P. [Princeton Radiation Oncology, Monroe Township, New Jersey (United States); Liao, Zhongxing; Chang, Joe Y.; Tang, Chad; Pan, Hubert Y.; Welsh, James W. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Mehran, Reza J. [Department of Thoracic and Cardiovascular Surgery, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gomez, Daniel R., E-mail: dgomez@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2015-01-01

    Purpose: To investigate safety, efficacy, and recurrence after hemithoracic intensity modulated radiation therapy after pleurectomy/decortication (PD-IMRT) and after extrapleural pneumonectomy (EPP-IMRT). Methods and Materials: In 2009-2013, 24 patients with mesothelioma underwent PD-IMRT to the involved hemithorax to a dose of 45 Gy, with an optional integrated boost; 22 also received chemotherapy. Toxicity was scored with the Common Terminology Criteria for Adverse Events v4.0. Pulmonary function was compared at baseline, after surgery, and after IMRT. Kaplan-Meier analysis was used to calculate overall survival (OS), progression-free survival (PFS), time to locoregional failure, and time to distant metastasis. Failures were in-field, marginal, or out of field. Outcomes were compared with those of 24 patients, matched for age, nodal status, performance status, and chemotherapy, who had received EPP-IMRT. Results: Median follow-up time was 12.2 months. Grade 3 toxicity rates were 8% skin and 8% pulmonary. Pulmonary function declined from baseline to after surgery (by 21% for forced vital capacity, 16% for forced expiratory volume in 1 second, and 19% for lung diffusion of carbon monoxide [P for all = .01]) and declined still further after IMRT (by 31% for forced vital capacity [P=.02], 25% for forced expiratory volume in 1 second [P=.01], and 30% for lung diffusion of carbon monoxide [P=.01]). The OS and PFS rates were 76% and 67%, respectively, at 1 year and 56% and 34% at 2 years. Median OS (28.4 vs 14.2 months, P=.04) and median PFS (16.4 vs 8.2 months, P=.01) favored PD-IMRT versus EPP-IMRT. No differences were found in grade 4-5 toxicity (0 of 24 vs 3 of 24, P=.23), median time to locoregional failure (18.7 months vs not reached, P not calculable), or median time to distant metastasis (18.8 vs 11.8 months, P=.12). Conclusions: Hemithoracic intensity modulated radiation therapy after pleurectomy/decortication produced little high-grade toxicity but

  15. Measurement of circulating transcripts and gene cluster analysis predicts and defines therapeutic efficacy of peptide receptor radionuclide therapy (PRRT) in neuroendocrine tumors

    Energy Technology Data Exchange (ETDEWEB)

    Bodei, L. [European Institute of Oncology, Division of Nuclear Medicine, Milan (Italy); LuGenIum Consortium, Milan, Rotterdam, Bad Berka, London, Italy, Netherlands, Germany (Country Unknown); Kidd, M. [Wren Laboratories, Branford, CT (United States); Modlin, I.M. [LuGenIum Consortium, Milan, Rotterdam, Bad Berka, London, Italy, Netherlands, Germany (Country Unknown); Yale School of Medicine, New Haven, CT (United States); Severi, S.; Nicolini, S.; Paganelli, G. [Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS, Nuclear Medicine and Radiometabolic Units, Meldola (Italy); Drozdov, I. [Bering Limited, London (United Kingdom); Kwekkeboom, D.J.; Krenning, E.P. [LuGenIum Consortium, Milan, Rotterdam, Bad Berka, London, Italy, Netherlands, Germany (Country Unknown); Erasmus Medical Center, Nuclear Medicine Department, Rotterdam (Netherlands); Baum, R.P. [LuGenIum Consortium, Milan, Rotterdam, Bad Berka, London, Italy, Netherlands, Germany (Country Unknown); Zentralklinik Bad Berka, Theranostics Center for Molecular Radiotherapy and Imaging, Bad Berka (Germany)

    2016-05-15

    Peptide receptor radionuclide therapy (PRRT) is an effective method for treating neuroendocrine tumors (NETs). It is limited, however, in the prediction of individual tumor response and the precise and early identification of changes in tumor size. Currently, response prediction is based on somatostatin receptor expression and efficacy by morphological imaging and/or chromogranin A (CgA) measurement. The aim of this study was to assess the accuracy of circulating NET transcripts as a measure of PRRT efficacy, and moreover to identify prognostic gene clusters in pretreatment blood that could be interpolated with relevant clinical features in order to define a biological index for the tumor and a predictive quotient for PRRT efficacy. NET patients (n = 54), M: F 37:17, median age 66, bronchial: n = 13, GEP-NET: n = 35, CUP: n = 6 were treated with {sup 177}Lu-based-PRRT (cumulative activity: 6.5-27.8 GBq, median 18.5). At baseline: 47/54 low-grade (G1/G2; bronchial typical/atypical), 31/49 {sup 18}FDG positive and 39/54 progressive. Disease status was assessed by RECIST1.1. Transcripts were measured by real-time quantitative reverse transcription PCR (qRT-PCR) and multianalyte algorithmic analysis (NETest); CgA by enzyme-linked immunosorbent assay (ELISA). Gene cluster (GC) derivations: regulatory network, protein:protein interactome analyses. Statistical analyses: chi-square, non-parametric measurements, multiple regression, receiver operating characteristic and Kaplan-Meier survival. The disease control rate was 72 %. Median PFS was not achieved (follow-up: 1-33 months, median: 16). Only grading was associated with response (p < 0.01). At baseline, 94 % of patients were NETest-positive, while CgA was elevated in 59 %. NETest accurately (89 %, χ{sup 2} = 27.4; p = 1.2 x 10{sup -7}) correlated with treatment response, while CgA was 24 % accurate. Gene cluster expression (growth-factor signalome and metabolome) had an AUC of 0.74 ± 0.08 (z-statistic = 2.92, p < 0

  16. Improved Survival With Radiation Therapy in Stage I-II Primary Mediastinal B Cell Lymphoma: A Surveillance, Epidemiology, and End Results Database Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Matthew W., E-mail: matthew.jackson@ucdenver.edu [Department of Radiation Oncology, University of Colorado Cancer Center, Aurora, Colorado (United States); Rusthoven, Chad G.; Jones, Bernard L. [Department of Radiation Oncology, University of Colorado Cancer Center, Aurora, Colorado (United States); Kamdar, Manali [Department of Medical Oncology, University of Colorado Cancer Center, Aurora, Colorado (United States); Rabinovitch, Rachel [Department of Radiation Oncology, University of Colorado Cancer Center, Aurora, Colorado (United States)

    2016-01-01

    Background: Primary mediastinal B cell lymphoma (PMBCL) is an uncommon lymphoma for which trials are few with small patient numbers. The role of radiation therapy (RT) after standard immunochemotherapy for early-stage disease has never been studied prospectively. We used the Surveillance, Epidemiology, and End Results (SEER) database to evaluate PMBCL and the impact of RT on outcomes. Methods and Materials: We queried the SEER database for patients with stage I-II PMBCL diagnosed from 2001 to 2011. Retrievable data included age, gender, race (white/nonwhite), stage, extranodal disease, year of diagnosis, and use of RT as a component of definitive therapy. Kaplan-Meier overall survival (OS) estimates, univariate (UVA) log-rank and multivariate (MVA) Cox proportional hazards regression analyses were performed. Results: Two hundred fifty patients with stage I-II disease were identified, with a median follow-up time of 39 months (range, 3-125 months). The median age was 36 years (range, 18-89 years); 61% were female; 76% were white; 45% had stage I disease, 60% had extranodal disease, and 55% were given RT. The 5-year OS for the entire cohort was 86%. On UVA, OS was improved with RT (hazard ratio [HR] 0.446, P=.029) and decreased in association with nonwhite race (HR 2.70, P=.006). The 5-year OS was 79% (no RT) and 90% (RT). On MVA, white race and RT remained significantly associated with improved OS (P=.007 and .018, respectively). The use of RT decreased over time: 61% for the 67 patients whose disease was diagnosed from 2001 to 2005 and 53% in the 138 patients treated from 2006 to 2010. Conclusion: This retrospective population-based analysis is the largest PMBCL dataset to date and demonstrates a significant survival benefit associated with RT. Nearly half of patients treated in the United States do not receive RT, and its use appears to be declining. In the absence of phase 3 data, the use of RT should be strongly considered for its survival benefit in early

  17. Aplicación y técnicas del análisis de supervivencia en las investigaciones clínicas Application and techniques of survival analysis in clinical research

    Directory of Open Access Journals (Sweden)

    Anissa Gramatges Ortiz

    2002-08-01

    Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated

  18. Risk of first cervical HPV infection and pre-cancerous lesions after onset of sexual activity: analysis of women in the control arm of the randomized, controlled PATRICIA trial.

    Science.gov (United States)

    Castellsagué, Xavier; Paavonen, Jorma; Jaisamrarn, Unnop; Wheeler, Cosette M; Skinner, S Rachel; Lehtinen, Matti; Naud, Paulo; Chow, Song-Nan; Del Rosario-Raymundo, Maria Rowena; Teixeira, Julio C; Palmroth, Johanna; de Carvalho, Newton S; Germar, Maria Julieta V; Peters, Klaus; Garland, Suzanne M; Szarewski, Anne; Poppe, Willy A J; Romanowski, Barbara; Schwarz, Tino F; Tjalma, Wiebren A A; Bosch, F Xavier; Bozonnat, Marie-Cecile; Struyf, Frank; Dubin, Gary; Rosillon, Dominique; Baril, Laurence

    2014-10-30

    More information is needed about time between sexual initiation and human papillomavirus (HPV) infection and development of cervical precancer. The objectives were to investigate the time between first sexual activity and detection of first cervical HPV infection or development of first cervical intraepithelial neoplasia (CIN), and associated factors in women from the double-blind, multinational, 4-year PATRICIA trial. PATRICIA enroled women aged 15-25 years with no more than 6 lifetime sexual partners. Women were randomized 1:1 to the HPV-16/18 AS04-adjuvanted vaccine or to control, but only women from the control arm who began sexual intercourse during the study or within 6 months before enrolment, and had no HPV infection detected before the recorded date of their first sexual intercourse, were included in the present analysis. The time between onset of sexual activity and detection of the first cervical HPV infection or development of the first CIN lesion was analyzed using Kaplan-Meier and univariate and multivariable Cox proportional-hazards models. A total of 9337 women were enroled in the control arm of PATRICIA of whom 982 fulfilled the required inclusion criteria for analysis. A cumulative total of 28%, 44%, and 62% of the subjects had HPV infection within 12, 24, and 48 months, respectively. The overall incidence rate was 27.08 per 100 person-years. The most common oncogenic types associated with 6-month persistent infection were HPV-16 (incidence rate: 2.74 per 100 person-years), HPV-51 (2.70), HPV-52 (1.66), HPV-66 (1.14), and HPV-18 (1.09). Increased infection risk was associated with more lifetime sexual partners, being single, Chlamydia trachomatis history, and duration of hormone use. CIN1+ and CIN2+ lesions were most commonly associated with HPV-16, with an overall incidence rate of 1.87 and 1.07 per 100 person-years, respectively. Previous cervical HPV infection was most strongly associated with CIN development. More than 25% of women were

  19. A pilot study for texture analysis of {sup 18}F-FDG and {sup 18}F-FLT-PET/CT to predict tumor recurrence of patients with colorectal cancer who received surgery

    Energy Technology Data Exchange (ETDEWEB)

    Nakajo, Masatoyo; Tani, Atsushi; Jinguji, Megumi; Yoshiura, Takashi [Kagoshima University, Department of Radiology, Graduate School of Medical and Dental Sciences, Kagoshima (Japan); Kajiya, Yoriko; Nakajo, Masayuki [Nanpuh Hospital, Department of Radiology, Kagoshima (Japan); Kitazono, Masaki [Nanpuh Hospital, Department of Surgery, Kagoshima (Japan)

    2017-12-15

    This retrospective study was done to examine whether the heterogeneity in primary tumor F-18-fluorodeoxyglucose ({sup 18}F-FDG) and {sup 18}F-3'-fluoro-3'-deoxythymidine ({sup 18}F-FLT) distribution can predict prognosis of patients with colorectal cancer who received surgery. The enrolled 32 patients with colorectal cancer underwent both {sup 18}F-FDG- and {sup 18}F-FLT-PET/CT studies before surgery. Clinicopathological factors, stage, SUVmax, SUVmean, metabolic tumor volume (SUV ≥ 2.5), total lesion glycolysis, total lesion proliferation and seven texture heterogeneity parameters (coefficient of variation, local parameters: entropy, homogeneity, and dissimilarity; and regional parameters: intensity variability [IV], size-zone variability [SZV], and zone percentage [ZP]) were obtained. Progression free survival (PFS) was calculated by the Kaplan-Meier method. Prognostic significance was assessed by Cox proportional hazards analysis. Eight patients had eventually come to progression, and 24 patients were alive without progression during clinical follow-up [mean follow-up PFS; 55.9 months (range, 1-72)]. High stage (p = 0.004), high {sup 18}F-FDG-IV (p = 0.015), high {sup 18}F-FDG-SZV (p = 0.013) and high {sup 18}F-FLT-entropy (p = 0.015) were significant in predicting poor 5-year PFS. Other parameters did not predict the disease outcome. At bivariate analysis, disease event hazards ratios for {sup 18}F-FDG-IV and {sup 18}F-FDG-SZV remained significant when adjusted for stage and {sup 18}F-FLT-entropy ({sup 18}F-FDG-IV; p = 0.004 [adjusted for stage], 0.007 [adjusted for {sup 18}F-FLT-entropy]; {sup 18}F-FDG-SZV; p = 0.028 [adjusted for stage], 0.040 [adjusted for {sup 18}F-FLT-entropy]). {sup 18}F-FDG PET heterogeneity parameters, IV and SZV, have a potential to be strong prognostic factors to predict PFS of patients with surgically resected colorectal cancer and are more useful than {sup 18}F-FLT-PET/CT heterogeneity parameters. (orig.)

  20. Comparative pathogenicity of Vibrio spp., Photobacterium damselae ssp. damselae and five isolates of Aeromonas salmonicida ssp. achromogenes in juvenile Atlantic halibut (Hippoglossus hippoglossus).

    Science.gov (United States)

    Bowden, T J; Bricknell, I R; Preziosi, B M

    2018-01-01

    Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.

  1. Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

    Science.gov (United States)

    2017-08-01

    28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival

  2. Stereotactic body radiotherapy for centrally located stage I NSCLC. A multicenter analysis

    Energy Technology Data Exchange (ETDEWEB)

    Schanne, Daniel H.; Nestle, Ursula; Grosu, Anca L. [Universitaetsklinik Freiburg, Klinik fuer Strahlenheilkunde, Freiburg (Germany); Allgaeuer, Michael [Barmherzige Brueder, Klinik fuer Strahlentherapie, Regensburg (Germany); Andratschke, Nicolaus; Molls, Michael [TU Muenchen, Klinik und Poliklinik fuer Strahlentherapie und Radiologische Onkologie, Muenchen (Germany); Appold, Steffen [Universitaetsklinikum Dresden, Klinik und Poliklinik fuer Strahlentherapie und Radioonkologie, Dresden (Germany); Dieckmann, Ute [Allgemeines Krankenhaus Wien, Univ. Klinik fuer Strahlentherapie, Wien (Austria); Ernst, Iris [Universitaetsklinikum Muenster, Klinik fuer Strahlentherapie, Muenster (Germany); Ganswindt, Ute [LMU Muenchen, Klinik und Poliklinik fuer Strahlentherapie und Radioonkologie, Muenchen (Germany); Holy, Richard [Universitaetsklinikum Aachen, Klinik fuer Strahlentherapie, Aachen (Germany); Nevinny-Stickel, Meinhard [Medizinischen Universitaet Innsbruck, Univ. Klinik fuer Strahlentherapie und Radioonkologie, Innsbruck (Austria); Semrau, Sabine [Universitaetsklinikum Erlangen, Strahlenklinik Erlangen, Erlangen (Germany); Sterzing, Florian [Universitaetsklinikum Heidelberg, Klinik fuer Radioonkologie und Strahlentherapie, Heidelberg (Germany); Wittig, Andrea [Philipps-Universitaet Marburg, Klinik fuer Strahlentherapie und Radioonkologie, Marburg (Germany); Guckenberger, Matthias [Universitaet Wuerzburg, Klinik und Poliklinik fuer Strahlentherapie, Wuerzburg (Germany)

    2014-08-27

    The purpose of this work is to analyze patterns of care and outcome after stereotactic body radiotherapy (SBRT) for centrally located, early-stage, non-small cell lung cancer (NSCLC) and to address the question of potential risk for increased toxicity in this entity. A total of 90 patients with centrally located NSCLC were identified among 613 cases in a database of 13 German and Austrian academic radiotherapy centers. The outcome of centrally located NSCLC was compared to that of cases with peripheral tumor location from the same database. Patients with central tumors most commonly presented with UICC stage IB (50 %), while the majority of peripheral lesions were stage IA (56 %). Average tumor diameters were 3.3 cm (central) and 2.8 cm (peripheral). Staging PET/CT was available for 73 and 74 % of peripheral and central tumors, respectively. Biopsy was performed in 84 % (peripheral) and 88 % (central) of cases. Doses varied significantly between central and peripheral lesions with a median BED{sub 10} of 72 Gy and 84 Gy, respectively (p < 0.001). Fractionation differed as well with medians of 5 (central) and 3 (peripheral) fractions (p < 0.001). In the Kaplan-Meier analysis, 3-year actuarial overall survival was 29 % (central) and 51 % (peripheral; p = 0.004) and freedom from local progression was 52 % (central) and 84 % (peripheral; p < 0.001). Toxicity after treatment of central tumors was low with no grade III/IV and one grade V event. Mortality rates were 0 and 1 % after 30 and 60 days, respectively. Local tumor control in patients treated with SBRT for centrally located, early-stage NSCLC was favorable, provided ablative radiation doses were prescribed. This was, however, not the case in the majority of patients, possibly due to concerns about treatment-related toxicity. Reported toxicity was low, but prospective trials are needed to resolve the existing uncertainties and to establish safe high-dose regimens for this cohort of patients. (orig.) [German] Ziel

  3. Vibration analysis of a hydro generator for different operating regimes

    Science.gov (United States)

    Haţiegan, C.; Pădureanu, I.; Jurcu, M.; Nedeloni, M. D.; Hamat, C. O.; Chioncel, C. P.; Trocaru, S.; Vasile, O.; Bădescu, O.; Micliuc, D.; (Filip Nedeloni, L.; Băra, A.; (Barboni Haţiegan, L.

    2017-01-01

    Based on experimental measurements, this paper presents the vibration analysis of a hydro generator that equips a Kaplan hydraulic turbine of a Hydropower plant in Romania. This analysis means vibrations measurement to different operating regimes of the hydro generator respectively before installing it and into operation, namely putting off load mode (unexcited and excited) respectively putting on load mode. By comparing, through the experimental results obtained before and after the operation of hydro aggregates are observed vibrations improvements.

  4. Tetranectin positive expression in tumour tissue leads to longer survival in Danish women with ovarian cancer. Results from the 'Malova' ovarian cancer study

    DEFF Research Database (Denmark)

    Heeran, Mel C; Rask, Lene; Høgdall, Claus K

    2015-01-01

    of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...

  5. Cetuximab Concomitant with Second-Line Radiation Therapy in Patients with Locally Advanced Recurrent Squamous Cell Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    Muge Akmansu

    2010-12-01

    Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.

  6. Modelos estimados de análisis de supervivencia para el tiempo de permanencia de los estudiantes de la Universidad Francisco de Paula Santander

    OpenAIRE

    Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón

    2016-01-01

    The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...

  7. Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage

    OpenAIRE

    Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung

    2014-01-01

    In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...

  8. Clinical Significance of Preoperative Albumin and Globulin Ratio in Patients with Gastric Cancer Undergoing Treatment

    Directory of Open Access Journals (Sweden)

    Min-jie Mao

    2017-01-01

    Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.

  9. Serum level of soluble urokinase-type plasminogen activator receptor is a strong and independent predictor of survival in human immunodeficiency virus infection

    DEFF Research Database (Denmark)

    Sidenius, N; Sier, C.F.M.; Ullum, H

    2000-01-01

    levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...

  10. The Outcome for Patients With Pathologic Node-Positive Prostate Cancer Treated With Intensity Modulated Radiation Therapy and Androgen Deprivation Therapy: A Case-Matched Analysis of pN1 and pN0 Patients

    Energy Technology Data Exchange (ETDEWEB)

    Van Hemelryk, Annelies [Department of Urology, Ghent University Hospital, Ghent (Belgium); De Meerleer, Gert; Ost, Piet [Department of Radiation Oncology, Ghent University Hospital, Ghent (Belgium); Poelaert, Filip [Department of Urology, Ghent University Hospital, Ghent (Belgium); De Gersem, Werner [Department of Radiation Oncology, Ghent University Hospital, Ghent (Belgium); Decaestecker, Karel [Department of Urology, Ghent University Hospital, Ghent (Belgium); De Visschere, Pieter [Department of Radiology, Ghent University Hospital, Ghent (Belgium); Fonteyne, Valérie, E-mail: valerie.fonteyne@uzgent.be [Department of Radiation Oncology, Ghent University Hospital, Ghent (Belgium)

    2016-10-01

    Purpose: Improved outcome is reported after surgery or external beam radiation therapy (EBRT) plus androgen deprivation therapy (ADT) for patients with lymph node (LN) positive (N1) prostate cancer (PC). Surgical series have shown that pathologic (p)N1 PC does not behave the same in all patients. The aim of this study was to perform a matched-case analysis to compare the outcome of pN1 and pN0 PC after high-dose EBRT plus ADT. Methods and Materials: Radiation therapy up to 80 Gy was delivered to the prostate with a minimal dose of 45 Gy to the pelvis for pN1 patients. After matching, Kaplan-Meier statistics were used to compare the 5-year biochemical and clinical relapse-free survival (bRFS and cRFS), prostate cancer–specific survival (PCSS), and overall survival (OS). Acute and late rectal and urinary toxicity was evaluated. Results: Sixty-nine pN1 PC patients were matched 1:1 with pN0 PC patients. The median follow-up time was 60 months. The 5-year bRFS and cRFS for pN1 versus pN0 PC patients were 65% ± 7% versus 79% ± 5% (P=.08) and 70% ± 6% versus 83% ± 5% (P=.04) respectively. No significant difference was found in bRFS or cRFS rates between low volume pN1 (≤2 positive LNs) and pN0 patients. The 5-year PCSS and OS were comparable between pN1 and pN0 PC patients: PCSS: 92% ± 4% versus 93% ± 3% (P=.66); OS: 82% ± 5% versus 80% ± 5% (P=.58). Severe toxicity was rare for both groups, although pN1 patients experienced significantly more acute grade 2 rectal toxicity. Conclusion: Primary EBRT plus 2 to 3 years of ADT is a legitimate treatment option for pN1 PC patients, especially those with ≤2 positive LNs, and this with bRFS and cRFS rates comparable to those in pN0 PC patients. For pN1 PC patients with >2 positive LNs, bRFS and cRFS are worse than in pN0 patients, but even in this subgroup, long-term disease control is obtained.

  11. The Outcome for Patients With Pathologic Node-Positive Prostate Cancer Treated With Intensity Modulated Radiation Therapy and Androgen Deprivation Therapy: A Case-Matched Analysis of pN1 and pN0 Patients

    International Nuclear Information System (INIS)

    Van Hemelryk, Annelies; De Meerleer, Gert; Ost, Piet; Poelaert, Filip; De Gersem, Werner; Decaestecker, Karel; De Visschere, Pieter; Fonteyne, Valérie

    2016-01-01

    Purpose: Improved outcome is reported after surgery or external beam radiation therapy (EBRT) plus androgen deprivation therapy (ADT) for patients with lymph node (LN) positive (N1) prostate cancer (PC). Surgical series have shown that pathologic (p)N1 PC does not behave the same in all patients. The aim of this study was to perform a matched-case analysis to compare the outcome of pN1 and pN0 PC after high-dose EBRT plus ADT. Methods and Materials: Radiation therapy up to 80 Gy was delivered to the prostate with a minimal dose of 45 Gy to the pelvis for pN1 patients. After matching, Kaplan-Meier statistics were used to compare the 5-year biochemical and clinical relapse-free survival (bRFS and cRFS), prostate cancer–specific survival (PCSS), and overall survival (OS). Acute and late rectal and urinary toxicity was evaluated. Results: Sixty-nine pN1 PC patients were matched 1:1 with pN0 PC patients. The median follow-up time was 60 months. The 5-year bRFS and cRFS for pN1 versus pN0 PC patients were 65% ± 7% versus 79% ± 5% (P=.08) and 70% ± 6% versus 83% ± 5% (P=.04) respectively. No significant difference was found in bRFS or cRFS rates between low volume pN1 (≤2 positive LNs) and pN0 patients. The 5-year PCSS and OS were comparable between pN1 and pN0 PC patients: PCSS: 92% ± 4% versus 93% ± 3% (P=.66); OS: 82% ± 5% versus 80% ± 5% (P=.58). Severe toxicity was rare for both groups, although pN1 patients experienced significantly more acute grade 2 rectal toxicity. Conclusion: Primary EBRT plus 2 to 3 years of ADT is a legitimate treatment option for pN1 PC patients, especially those with ≤2 positive LNs, and this with bRFS and cRFS rates comparable to those in pN0 PC patients. For pN1 PC patients with >2 positive LNs, bRFS and cRFS are worse than in pN0 patients, but even in this subgroup, long-term disease control is obtained.

  12. Phase I/II trials of {sup 186}Re-HEDP in metastatic castration-resistant prostate cancer: post-hoc analysis of the impact of administered activity and dosimetry on survival

    Energy Technology Data Exchange (ETDEWEB)

    Denis-Bacelar, Ana M.; Chittenden, Sarah J.; Divoli, Antigoni; Flux, Glenn D. [The Institute of Cancer Research and The Royal Marsden Hospital NHS Foundation Trust, Joint Department of Physics, London (United Kingdom); Dearnaley, David P.; Johnson, Bernadette [The Institute of Cancer Research and The Royal Marsden Hospital NHS Foundation Trust, Division of Radiotherapy and Imaging, London (United Kingdom); O' Sullivan, Joe M. [Queen' s University Belfast, Centre for Cancer Research and Cell Biology, Belfast (United Kingdom); McCready, V.R. [Brighton and Sussex University Hospitals NHS Trust, Department of Nuclear Medicine, Brighton (United Kingdom); Du, Yong [The Royal Marsden Hospital NHS Foundation Trust, Department of Nuclear Medicine and PET/CT, London (United Kingdom)

    2017-04-15

    To investigate the role of patient-specific dosimetry as a predictive marker of survival and as a potential tool for individualised molecular radiotherapy treatment planning of bone metastases from castration-resistant prostate cancer, and to assess whether higher administered levels of activity are associated with a survival benefit. Clinical data from 57 patients who received 2.5-5.1 GBq of {sup 186}Re-HEDP as part of NIH-funded phase I/II clinical trials were analysed. Whole-body and SPECT-based absorbed doses to the whole body and bone lesions were calculated for 22 patients receiving 5 GBq. The patient mean absorbed dose was defined as the mean of all bone lesion-absorbed doses in any given patient. Kaplan-Meier curves, log-rank tests, Cox's proportional hazards model and Pearson's correlation coefficients were used for overall survival (OS) and correlation analyses. A statistically significantly longer OS was associated with administered activities above 3.5 GBq in the 57 patients (20.1 vs 7.1 months, hazard ratio: 0.39, 95 % CI: 0.10-0.58, P = 0.002). A total of 379 bone lesions were identified in 22 patients. The mean of the patient mean absorbed dose was 19 (±6) Gy and the mean of the whole-body absorbed dose was 0.33 (±0.11) Gy for the 22 patients. The patient mean absorbed dose (r = 0.65, P = 0.001) and the whole-body absorbed dose (r = 0.63, P = 0.002) showed a positive correlation with disease volume. Significant differences in OS were observed for the univariate group analyses according to disease volume as measured from SPECT imaging of {sup 186}Re-HEDP (P = 0.03) and patient mean absorbed dose (P = 0.01), whilst only the disease volume remained significant in a multivariable analysis (P = 0.004). This study demonstrated that higher administered activities led to prolonged survival and that for a fixed administered activity, the whole-body and patient mean absorbed doses correlated with the extent of disease, which, in turn, correlated

  13. Androgen Suppression Combined with Elective Nodal and Dose Escalated Radiation Therapy (the ASCENDE-RT Trial): An Analysis of Survival Endpoints for a Randomized Trial Comparing a Low-Dose-Rate Brachytherapy Boost to a Dose-Escalated External Beam Boost for High- and Intermediate-risk Prostate Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Morris, W. James, E-mail: jmorris@bccancer.bc.ca [Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); BC Cancer Agency–Vancouver Centre, Vancouver, British Columbia (Canada); Tyldesley, Scott [Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); BC Cancer Agency–Vancouver Centre, Vancouver, British Columbia (Canada); Rodda, Sree [Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); Halperin, Ross [Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); BC Cancer Agency–Centre for the Southern Interior, Vancouver, British Columbia (Canada); Pai, Howard [Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); BC Cancer Agency–Vancouver Island Centre, Vancouver, British Columbia (Canada); McKenzie, Michael; Duncan, Graeme [Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); BC Cancer Agency–Vancouver Centre, Vancouver, British Columbia (Canada); Morton, Gerard [Department of Radiation Oncology, University of Toronto, Sunnybrook Health Sciences Centre, Toronto, Ontario (Canada); Hamm, Jeremy [Department of Population Oncology, BC Cancer Agency, Vancouver, British Columbia (Canada); Murray, Nevin [BC Cancer Agency–Vancouver Centre, Vancouver, British Columbia (Canada); Department of Medicine, University of British Columbia, Vancouver, British Columbia (Canada)

    2017-06-01

    Purpose: To report the primary endpoint of biochemical progression-free survival (b-PFS) and secondary survival endpoints from ASCENDE-RT, a randomized trial comparing 2 methods of dose escalation for intermediate- and high-risk prostate cancer. Methods and Materials: ASCENDE-RT enrolled 398 men, with a median age of 68 years; 69% (n=276) had high-risk disease. After stratification by risk group, the subjects were randomized to a standard arm with 12 months of androgen deprivation therapy, pelvic irradiation to 46 Gy, followed by a dose-escalated external beam radiation therapy (DE-EBRT) boost to 78 Gy, or an experimental arm that substituted a low-dose-rate prostate brachytherapy (LDR-PB) boost. Of the 398 trial subjects, 200 were assigned to DE-EBRT boost and 198 to LDR-PB boost. The median follow-up was 6.5 years. Results: In an intent-to-treat analysis, men randomized to DE-EBRT were twice as likely to experience biochemical failure (multivariable analysis [MVA] hazard ratio [HR] 2.04; P=.004). The 5-, 7-, and 9-year Kaplan-Meier b-PFS estimates were 89%, 86%, and 83% for the LDR-PB boost versus 84%, 75%, and 62% for the DE-EBRT boost (log-rank P<.001). The LDR-PB boost benefited both intermediate- and high-risk patients. Because the b-PFS curves for the treatment arms diverge sharply after 4 years, the relative advantage of the LDR-PB should increase with longer follow-up. On MVA, the only variables correlated with reduced overall survival were age (MVA HR 1.06/y; P=.004) and biochemical failure (MVA HR 6.30; P<.001). Although biochemical failure was associated with increased mortality and randomization to DE-EBRT doubled the rate of biochemical failure, no significant overall survival difference was observed between the treatment arms (MVA HR 1.13; P=.62). Conclusions: Compared with 78 Gy EBRT, men randomized to the LDR-PB boost were twice as likely to be free of biochemical failure at a median follow-up of 6.5 years.

  14. Breast conserving treatment of breast carcinoma T2 ({<=} 4 cm) and T3 by neoadjuvant chemotherapy, quadrantectomy, high dose rate brachytherapy as a boost, external beam radiotherapy and adjuvant chemotherapy: local control and overall survival analysis; Tratamento conservador do cancer de mama T2 ({<=} 4 cm) e T3 por quimioterapia neoadjuvante, quadrantectomia, braquiterapia com alta taxa de dose como reforco de dose, teleterapia complementar e quimioterapia adjuvante: analise de controle local e sobrevida global

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Celia Regina; Miziara Filho, Miguel Abrao; Fogaroli, Ricardo Cesar; Baraldi, Helena Espindola; Pellizzon, Antonio Cassio Assis; Pelosi, Edilson Lopes [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Radioterapia], e-mail: celiarsoares@terra.com.br; Fristachi, Carlos Elias [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Onco-Ginecologia e Mastologia; Paes, Roberto Pinto [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil)

    2008-12-15

    Objective: to assess the treatment of breast cancer T2 ({<=} 4 cm) and T3 through neoadjuvant chemotherapy, quadrantectomy and high dose rate brachytherapy as a boost, complementary radiotherapy and adjuvant chemotherapy, considering local control and overall survival. Material and method: this clinical prospective descriptive study was based on the evaluation of 88 patients ranging from 30 to 70 years old, with infiltrating ductal carcinoma, clinical stage IIb and IIIa, responsive to the neoadjuvant chemotherapy, treated from June/1995 to December/2006. Median follow-up was 58 months. Using clinical methods the tumor was evaluated before and after three or four cycles of chemotherapy based on anthracyclines. Overall survival and local control were assessed according to Kaplan-Meier methodology. Results: Local control and overall survival in five years were 90% and 73.5%, respectively. Conclusion: local control and overall survival were comparable to other forms of treatment. (author)

  15. Prospective Validation of 18F-FDG Brain PET Discriminant Analysis Methods in the Diagnosis of Amyotrophic Lateral Sclerosis.

    Science.gov (United States)

    Van Weehaeghe, Donatienne; Ceccarini, Jenny; Delva, Aline; Robberecht, Wim; Van Damme, Philip; Van Laere, Koen

    2016-08-01

    nearly identical and not separable on an individual basis. Extensive frontotemporal hypometabolism was predictive for a lower survival using a Kaplan-Meier survival analysis (P < 0.001). On the basis of a previously acquired training set, (18)F-FDG PET with advanced discriminant analysis methods is able to accurately distinguish ALS from controls and aids in assessing individual prognosis. Further validation on multicenter datasets and ALS-mimicking disorders is needed to fully assess the general applicability of this approach. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  16. Bone metastasis: review and critical analysis of random allocation trials of local field treatment

    International Nuclear Information System (INIS)

    Ratanatharathorn, Vaneerat; Powers, William E.; Moss, William T.; Perez, Carlos A.

    1999-01-01

    Purpose: Compare and contrast reports of random allocation clinical trials of local field radiation therapy of metastases to bone to determine the techniques producing the best results (frequency, magnitude, and duration of benefit), and relate these to the goals of complete relief of pain and prevention of disability for the remaining life of the patient. Methods and Materials: Review all published reports of random allocation clinical trials, and perform a systematic analysis of the processes and outcomes of the several trial reports. Results: All trials were performed on selected populations of patients with symptomatic metastases and most studies included widely diverse groups with regard to: (a) site of primary tumor, (b) location, extent, size, and nature of metastases, (c) duration of survival after treatment. All trial reports lack sufficient detail for full and complete analysis. Much collected information is not now available for reanalysis and many important data sets were apparently never collected. Several of the variations in patient and tumor characteristics were found to be much more important than treatment dose in the outcome results. Treatment planning and delivery techniques were unsophisticated and probably resulted in a systematic delivery of less than the assigned dose to some metastases. In general the use and benefit of retreatment was greater in those patients who initially received lower doses but the basis and dose of retreatment was not documented. Follow-up of patients was varied with a large proportion of surviving patients lost to follow-up in several studies. The greatest difference in the reports is the method of calculation of results. The applicability of Kaplan-Meier actuarial analysis, censoring the lost and dead patients, as used in studies with loss to follow-up of a large number of patients is questionable. The censoring involved is 'informative' (the processes of loss relate to the outcome) and not acceptable since it

  17. Esimese käigu kasulikkusest / Robert D. Kaplan

    Index Scriptorium Estoniae

    Kaplan, Robert D.

    2008-01-01

    Ilmunud ka: Postimees : na russkom jazõke 19. aug. 2008, lk. 11. Autor analüüsib USA ja lääneriikide võimalusi Venemaaga hakkamasaamisel pärast Venemaa sõjalist konflikti Gruusiaga ning leiab, et Venemaa esimese käigu eelis avaldus olukorras, kus geopoliitiline tegelikkus erineb tugevalt diplomaatilisest näilisusest

  18. Kaplan võiks olla malevapealiku oluliseks toeks / Peeter Parts

    Index Scriptorium Estoniae

    Parts, Peeter

    2007-01-01

    Kokkuvõte Kaitseliidu Tallinna maleva Toompea malevkonna pealiku kapten Heiki Arikese peetud ettekandest Kaitseliidu maleva juhtide ootuste kohta kaplani suhtes. Kaplanite erialaoskusi peaks rakendama ka malevlaste psühholoogilisel nõustamisel ning sotsiaalse mälu meeldetuletamisel

  19. Psychiatry in Australia | Kaplan | South African Journal of Psychiatry

    African Journals Online (AJOL)

    South African Journal of Psychiatry. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 10, No 2 (2004) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected ...

  20. Caffeine Content of Tea and Coffee | Kaplan | South African Medical ...

    African Journals Online (AJOL)

    South African Medical Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 47, No 3 (1973) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should ...

  1. Analysis of Clinicopathological Features and Prognostic Factors in 39 Cases of Bladder Neuroendocrine Carcinoma.

    Science.gov (United States)

    Zhou, Hui-Hui; Liu, Li-Yan; Yu, Guo-Hua; Qu, Gui-Mei; Gong, Pei-You; Yu, Xiao; Yang, Ping

    2017-08-01

    Through analysis and summarization of clinicopathological features, immunohistochemical expression, pathological diagnostic criteria, prognostic and other factors in patients suffering from bladder neuroendocrine carcinoma (BNEC), a better understanding of BNEC could be achieved to provide solid evidence for clinicopathology and prognosis. The clinicopathological data of 39 cases of BNEC with up to 5-year follow-up data (median follow-up=650 days) were analyzed retrospectively based on immunohistochemical staining. Survival analyses were carried out using the Kaplan-Meier method and tested with the log-rank method. Multivariate Cox regression analysis was adopted to screen independent risk factors affecting patients' survival. In these 39 cases of BNEC, there were 26 cases of male patients, 13 female, with the proportion of male to female being 2:1. The ages of onset ranged from 44 to 86, with the median age being 62 and the average age 61.97 years, respectively. Histologically, referring to the WHO standard of neuroendocrine lung tumor classification, there were 7 cases of typical carcinoid tumors, 8 atypical carcinoid, 12 small-cell carcinomas and 12 large-cell carcinomas. In these cases there were 11 cases of featured urothelium carcinomas and 9 cases of adenocarcinomas. Immunohistochemical staining showed that, in these 39 cases of BNEC, the positive expression for the neuroendocrinic markers, including neural cell adhesion molecule 56 (CD56), synaptophysin (Syn), chromogranin A (CgA), neuron-specific enolase (NSE), thyroid transcription factor-1 (TTF-1), cytokeratin (CK) and cytokeratin 7 (CK7), accounted for 39/39, 27/39, 18/39, 39/39, 19/39, 10/39 and 8/39, respectively. In contrast, cytokeratin 20 (CK20), protein 63 (P63), human melanoma black 45 (HMB45), S-lfln protein 100 (S-100) and leukocyte common antigen (LCA) were all negatively expressed. During the follow-up period, 12 patients died. The 1-, 3- and 5-year overall survival (OS) rates were 76.92%, 74

  2. Oligo dendrogliomas. Analysis of 77 cases treated in the neuro oncology unit from 1970-2004

    International Nuclear Information System (INIS)

    Rodríguez, R; Roldán, G.; Mañana, G.

    2004-01-01

    Introduction: Gliomas are the most frequent primary brain tumors distinguishing: astrocytic tumors, oligodendroglial and ependymal. There has been an increase in he incidence of oligodendrogliomas (OG) reaching 30% of all gliomas in some series. The OG of particular interest because of their particular sensitivity to treatment (tto) oncospecific which confers a better prognosis compared to other gliomas. Identifying alterations makes the target specific chromosomal active investigation. Objective: To analyze the outcome of patients (ptes) carriers treated OG Unit Neuro-Oncology Clinical Hospital of Montevideo. Materials and Methods: A retrospective review of medical records of 77 ptes is done with pathologic diagnosis of OG treated at the Neuro-Oncology Unit between January 1970 and July 2004 were analyzed epidemiological, clinical, therapeutic and evolutionary. Survival analysis was performed according to the Kaplan-Meier method (95%) comparing by logrank test with alpha = 0.05. Results: Thirty-seven (48.1%) were female gender and 40 (51.9%) were men. The median age was 41.2 years (range: 5-74). Ptes Twenty (29.9%) had low OG degree, 32 (41.6%) high-grade and 22 (28.6%) Mixed (oligo-astrocytic). hypertension intracranial and seizures were the most frequent reasons for consultation. survival (SV) median ptes in this series was 57 months and the median disease-free interval of 39 months. The overall 5-year SV reached 46% and 10 years 34%. SV free survival was 44 % And 33% respectively. We found no overall relationship between SV and factors recognized value prognosis such as age, gender, histological grade and initial tto made; although gender analysis results showed borderline statistical significance (p = 0.0579) in favor of women. the SV median was 58, 70, 53 and 21 months to complete ptes with surgery (35 patients), subtotal (16) part (22) and biopsies (4), respectively, with the significant difference from the biopsy (p = 0.04). Ptes of 77, 42 relapsed with a

  3. Eningiomas: outcome, and analysis of prognostic factors of primarily resected tumors

    International Nuclear Information System (INIS)

    Stafford, S.L.; Perry, A.; Suman, V.; Meyer, B.; Scheithauer, B.W.; Shaw, E.G.; Earle, J.D.

    1996-01-01

    Purpose: 582 consecutive cases of primary intracranial meningioma undergoing resection at the Mayo Clinic, (Rochester, MN) were reviewed to determine overall survival (OS), progression free survival(PFS), prognostic factors predicting recurrence, and to determine the importance of radiation therapy in the management of this tumor. Materials and Methods: Between 1978-1988, 582 cases of primarily resected meningiomas were identified based on the tumor and operative registries where diagnosis was between 1978-1988 inclusive. PFS was identified by radiographic progression. Follow-up was accomplished by chart review, and a detailed questionnaire sent to patients and referring physicians. Estimation of OS and PFS distributions were done by the Kaplan-Meier method. The log rank test was used to assess which factors were associated with PFS. Proportional hazard modeling was performed to obtain a subset of independent predictors of PFS. Results: the median age was 57(5-93). 67% were female. CT identified the tumor in 91% of cases. There was associated edema in 21% and 2% were radiographically en plaque. There were 17 patients with multiple tumors, four of whom had a known diagnosis of neurofibromatosis. Gross total resection (GTR) was accomplished in 80%, radical subtotal or subtotal resection(STR) in 20%, and biopsy in 53) cellularity, and four or more mitoses per 10 HPF. Multivariate analysis indicated young age, male sex, en plaque at surgery, were significant for decreased PFS when only patient characteristics were considered. When treatment and pathologic factors were also considered, then young age, male sex, less than GTR, and tumor sheeting were predictors for decreased PFS. 10 patients had RT after initial resection, two of whom recurred. There were 107 first recurrences. 50 were observed(no intervention within 3 months), 35 treated by surgery alone, 11 had S+RT, and 11 were treated with RT alone. Considering those patients treated at recurrence (n=57), PFS was at

  4. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    Science.gov (United States)

    Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

    2009-01-01

    Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16%) pathogenic mutations (12 in BRCA1 and 3 in BRCA2), of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free) and with prognostic molecular markers (ER, PR, c-erbB2 and p53). Conclusion The stage of the disease at diagnosis was the only statistically significant (p < 0.0035) prognostic parameter. The mutation frequency and the polymorphisms were similar to reports on other ethnic populations. The lack of association between the clinico-pathological variables, mutation status and the disease status is likely to be due to the small numbers. PMID:19656415

  5. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    Directory of Open Access Journals (Sweden)

    Soumittra Nagasamy

    2009-08-01

    Full Text Available Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16% pathogenic mutations (12 in BRCA1 and 3 in BRCA2, of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free and with prognostic molecular markers (ER, PR, c-erbB2 and p53. Conclusion The stage of the disease at diagnosis was the only statistically significant (p

  6. Assessment by survival analysis of the radioprotective properties of propolis and its polyphenolic compounds

    International Nuclear Information System (INIS)

    Orsolic, N.; Benkovic, V.; Horvat-Knezevic, A.; Basic, I.; Kopjar, N.; Kosalec, I.; Bakmaz, M.; Mihaljevic, Z.; Bendelja, K.

    2007-01-01

    The radioprotective effects of propolis and polyphenolic compounds from propolis on the radiation-induced mortality of mice exposed to 9 Gy of γ-irradiation were studied. Intraperitoneal (i.p.) treatment of mice at doses of 100 mgkg -1 body weight of propolis (water or ethanolic extract; water-soluble derivative of propolis (WSDP) or ethanolic extract of propolis (EEP)) or its polyphenolic compounds (quercetin, naringin caffeic acid, chrysin) consecutively for 3 d before irradiation, delayed the onset of mortality and reduced the symptoms of radiation sickness. All test compounds provided protection against hematopoietic death (death within 30 d after irradiation). The greatest protection was achieved with quercetin; the number of survivors at the termination of the experiment was 63%. According to statistical analyses by the Kaplan-Meier method and the log-rank test, a significant difference between test components and control was found (p<0.001). Treatment with test components after lethal irradiation was ineffective. These results suggest that propolis and its polyphenolic compounds given to mice before irradiation protect mice from the lethal effects of whole-body irradiation. (author)

  7. Colistin-resistant Enterobacteriaceae infections: clinical and molecular characterization and analysis of in vitro synergy.

    Science.gov (United States)

    de Maio Carrillho, Claudia M D; Gaudereto, Juliana J; Martins, Roberta Cristina Ruedas; de Castro Lima, Victor Augusto Camarinha; de Oliveira, Larissa M; Urbano, Mariana R; Perozin, Jamile S; Levin, Anna Sara; Costa, Silvia F

    2017-03-01

    We described 27 polyclonal colistin-resistant Enterobacteriaceae (MIC 4-16 μg/mL) infections (12 pneumonia, 12 urinary tract infection (UTI), two Bacteremia, and one skin/soft tissue infection) in which 74% harbored KPC. The isolates were polyclonal, 6 STs were identified and the colistin resistance was due to chromosome mutations. Eight patients with UTI received monotherapy, and combination therapy was given to 19 patients. Overall mortality was 37%. In vitro synergy using time-kill assay was observed in 14 of 19 (74%) isolates tested; the synergistic effect was observed for almost all isolates for the combination of three drugs: colistin, amikacin, and tigecycline. The Kaplan-Meier survival curve showed no significant difference comparing combination therapy with 2, 3, or more drugs and risk factors associated with death were dialysis and shock. These findings reinforce the fact that colistin in combination with other classes of drugs can be useful in treating infections caused by colistin-resistant CRE. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. [An analysis of 68 invasive lobular breast cancer cases in clinicopathological characteristics and the prognostic determinants].

    Science.gov (United States)

    Liu, Q; Xiang, H Y; Ye, J M; Xu, L; Zhang, H; Zhang, S; Duan, X N; Liu, Y H

    2018-02-01

    Objective: To study the clinicopathological characteristics and the prognostic determinants of the invasive lobular carcinoma breast cancer. Methods: This was a retrospective single-center study of invasive lobular breast cancer cases diagnosed from January 2008 to December 2014 at Peking University First Hospital Breast Disease Center. The study enrolled 68 invasive lobular breast cancer patients, which represented 3.64% (68/1 870) of total invasive breast cancer. The median age of all selected patients was 46 years ranging from 36 to 83 years. All patients were restaged based on the 8(th) edition of AJCC cancer staging system and follow-up data including disease-free survival (DFS) and overall survival (OS) were analyzed to explore the prognostic determinants. The 5-year OS and DFS were calculated using Kaplan-Meier method; the significance of correlations between clinicopathological features and prognostic factors was estimated using log-rank test. Results: There were significant differences in OS between patients with different anatomic stage, prognostic stage, lymph node metastasis, progesterone receptor (PR) expression, lymphvascular invasion and perineural invasion (χ(2:) 4.318 to 32.394, all P invasion (χ(2:) 4.347 to 27.369, all P invasion are the prognostic factors of invasive lobular breast cancer. Regard to invasive lobular breast cancer patients, clinicians should pay close attention to the differences between prognostic stage and anatomic stage.

  9. Clinical performance of ART restorations in primary teeth: a survival analysis.

    Science.gov (United States)

    Faccin, Elise Sasso; Ferreira, Simone Helena; Kramer, Paulo Floriani; Ardenghi, Thiago Machado; Feldens, Carlos Alberto

    2009-01-01

    To assess the survival of Atraumatic Restorative Treatment (ART) restorations in primary teeth performed in a dental clinical setting. One hundred and five single-surface ART restorations placed in 56 preschool children (mean age 31 months) were included. Final-year dental students performed the restorations using standard ART procedures with hand instruments. A resin-modified glass ionomer cement (Vitremer 3M/ESPE) was used as a restorative material. Performances of the restorations were assessed directly by the ART evaluation criteria. Follow-up period ranged from 6 to 48 months. Survival estimates for restoration longevity were evaluated using the Kaplan-Meier method. Log-rank test (P ART restorations were 89%, 85% and 72% in 6 to 11, 12 to 24 and 25 to 48 months of evaluation respectively. Differences in success rates among demographic and clinical characteristics were not statistically significant. High survivals rates of the ART restorations found in this study seem to indicate the reliability of this approach as an appropriate treatment option for primary teeth in a clinical setting.

  10. Mini dental implants retaining mandibular overdentures: A dental practice-based retrospective analysis.

    Science.gov (United States)

    Schwindling, Franz Sebastian; Schwindling, Franz-Peter

    2016-07-01

    The purpose of this study was to assess the survival of mini dental implants (MDI) and to measure prosthetic maintenance needs in a dental practice-based setting. Patients with mandibular removable dentures were provided with MDI to improve denture retention. Complications and maintenance were analyzed by use of patient records and evaluated with Kaplan-Meier curves and the log rank test at a significance level of 0.05. Ninety-nine MDI were placed in 25 patients (mean age: 72 years). Two MDI fractured during placement and eight implants failed during the first weeks. No more implants were lost for up to seven years, resulting in 92% survival. Implant survival differed significantly depending on whether the maxilla was provided with complete dentures (94.9%) or with partial dentures (81%). All prostheses were in use at the time of data extraction. Denture base fractures were observed in six cases, an incidence of fractures of 24%. Some minor intervention was necessary: one resin tooth fractured, retention rings were changed in five cases, and repeated relining was required for 16% of the dentures. After mid-term observation, survival of MDI was good. However, the incidence of denture base fractures and of minor prosthetic complications should not be under-estimated. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Analysis of prognostic factors for survival in patients with primary spinal chordoma using the SEER Registry from 1973 to 2014.

    Science.gov (United States)

    Pan, Yue; Lu, Lingyun; Chen, Junquan; Zhong, Yong; Dai, Zhehao

    2018-04-06

    Spinal chordomas are rare primary osseous tumors that arise from the remnants of the notochord. They are commonly considered slow-growing, locally invasive neoplasms with little tendency to metastasize, but the high recurrent rate of spinal chordomas may seriously affect the survival rate and quality of life of patients. The aim of the study is to describe the epidemiological data and determine the prognostic factors for decreased survival in patients with primary spinal chordoma. The Surveillance, Epidemiology, and End Results (SEER) Registry database, a US population-based cancer registry database, was used to identify all patients diagnosed with primary spinal chordoma from 1973 to 2014. We utilized Kaplan-Meier method and Cox proportional hazards regression analysis to evaluate the association between patients overall survival and relevant characteristics, including age, gender, race, disease stage, treatment methods, primary tumor site, marital status, and urban county background. In the data set between 1973 and 2014, a total of 808 patients were identified with primary spinal chordoma. The overall rate of distant metastatic cases in our cohort was only 7.7%. Spinal chordoma was more common occurred in men (62.6%) than women (37.3%). Majority of neoplasms were found in the White (87.9%), while the incidence of the Black is relatively infrequent (3.3%). Three hundred fifty-seven spinal chordomas (44.2%) were located in the vertebral column, while 451 patients' tumor (55.8%) was located in the sacrum or pelvis. Age ≥ 60 years (HR = 2.72; 95%CI, 1.71 to 2.89), distant metastasis (HR = 2.16; 95%CI, 1.54 to 3.02), and non-surgical therapy (HR = 2.14; 95%CI, 1.72 to 2.69) were independent risk factors for survival reduction in analysis. Survival did not significantly differ as a factor of tumor site (vertebrae vs sacrum/pelvis) for primary spinal chordoma (HR = 0.93, P = 0.16). Race (P = 0.52), gender (P = 0.11), marital status (P = 0.94), and

  12. The results of definitive radiation therapy and the analysis of prognostic factors for non-small cell lung cancer

    International Nuclear Information System (INIS)

    Chang, Seung Hee; Lee, Kyung Ja; Lee, Soon Nam

    1998-01-01

    This retrospective study was tried to evaluate the clinical characteristics of patients, patterns of failure, survival rates, prognostic factors affecting survival, and treatment related toxicities when non-small cell lung cancer patients was treated by definitive radiotherapy alone or combined with chemotherapy. We evaluated the treatment results of 70 patients who were treated by definitive radiation therapy for non-small cell lung cancer at the Department of Radiation Oncology. Ewha Womans University Hospital, between March 1982 and April 1996. The number of patients of each stage was 2 in stage 1. 6 in stage II, 30 in stage III-A, 29 in stage III-B, 3 in stage IV. Radiation therapy was administered by 6 MV linear accelerator and daily dose was 1.8-2.0 Gy and total radiation dose was ranged from 50.4 Gy to 72.0 Gy with median dose 59.4 Gy. Thirty four patients was treated with combined therapy with neoadjuvant or concurrent chemotherapy and radiotherapy, and most of them were administered with the multi-drug combined chemotherapy including etoposide and cisplatin. The survival rate was calculated with the Kaplan-Meier methods. The overall 1-year, 2-year, and 3-year survival rates were 63%, 29%, and 26%, respectively. The median survival time of all patients was 17 months. The disease-free survival rate for 1-year and 2-year were 23% and 16%, respectively. The overall 1-year survival rates according to the stage was 100% for stage I, 80% for stage II, 61% for stage III, and 50% for stage IV. The overall 1-year, 2-year, and 3-year survival rates for stage III patients only were 61%, 23%, and 20%, respectively. The median survival time of stage III patients only was 15 months. The complete response rates by radiation therapy was 16% and partial response rate was 50%, patients (43%) among 70 patients assessed local control at initial 3 months follow-up duration. Twenty four (80%) of these 30 patients was possible to evaluate the pattern of failure after achievement

  13. Analysis

    DEFF Research Database (Denmark)

    Mathiesen, Brian Vad; Liu, Wen; Zhang, Xiliang

    2014-01-01

    three major technological changes: energy savings on the demand side, efficiency improvements in energy production, and the replacement of fossil fuels by various sources of renewable energy. Consequently, the analysis of these systems must include strategies for integrating renewable sources...

  14. Modular titanium alloy neck adapter failures in hip replacement - failure mode analysis and influence of implant material

    Directory of Open Access Journals (Sweden)

    Bloemer Wilhelm

    2010-01-01

    Full Text Available Abstract Background Modular neck adapters for hip arthroplasty stems allow the surgeon to modify CCD angle, offset and femoral anteversion intraoperatively. Fretting or crevice corrosion may lead to failure of such a modular device due to high loads or surface contamination inside the modular coupling. Unfortunately we have experienced such a failure of implants and now report our clinical experience with the failures in order to advance orthopaedic material research and joint replacement surgery. The failed neck adapters were implanted between August 2004 and November 2006 a total of about 5000 devices. After this period, the titanium neck adapters were replaced by adapters out of cobalt-chromium. Until the end of 2008 in total 1.4% (n = 68 of the implanted titanium alloy neck adapters failed with an average time of 2.0 years (0.7 to 4.0 years postoperatively. All, but one, patients were male, their average age being 57.4 years (36 to 75 years and the average weight 102.3 kg (75 to 130 kg. The failures of neck adapters were divided into 66% with small CCD of 130° and 60% with head lengths of L or larger. Assuming an average time to failure of 2.8 years, the cumulative failure rate was calculated with 2.4%. Methods A series of adapter failures of titanium alloy modular neck adapters in combination with a titanium alloy modular short hip stem was investigated. For patients having received this particular implant combination risk factors were identified which were associated with the occurence of implant failure. A Kaplan-Meier survival-failure-analysis was conducted. The retrieved implants were analysed using microscopic and chemical methods. Modes of failure were simulated in biomechanical tests. Comparative tests included modular neck adapters made of titanium alloy and cobalt chrome alloy material. Results Retrieval examinations and biomechanical simulation revealed that primary micromotions initiated fretting within the modular tapered neck

  15. Analysis of prognostic value of clinical information and myocardial perfusion imaging in diabetic patients on cardiac events occurrence

    International Nuclear Information System (INIS)

    Wu Zhifang; Li Sijin

    2004-01-01

    Objective: To explore the risk factors of cardiac event (CE) occurrence and evaluate the prognostic value of myocardial perfusion imaging (MPI) in diabetic patients. Methods: We conducted a study with 172(16.4%) consecutively registered patients with diabetes (132 males, 40 females; age range 16-90 years, mean age 55.94±12.46 years) and 875(83.6%) patients without diabetes with known or suspected coronary artery disease (CAD) undergoing SPECT MPI. Follow-up information was obtained through telephone interviews. Patients were followed up for at least 18 months. End points were defined as death due to primary cardiac cause, or nonfatal acute myocardial infarction and revascularization. The mean time of follow-up was 33.25±14.95 (1∼56) months. Results: Logistic stepwise regression analysis evaluated history of smoking and drinking, hypertension, hyperlipemia and the family history of CAD as predictors. A multiple regression formula was obtained: Y=-5.593+0.958X1+0.921 X2+0.428X3, (Y=cardiac events, X1=diabetes, X2=the family history of CAD, X3=hypertension). Diabetes, the family history of CAD and hypertension were dangerous factors for cardiac events, but hyperlipemia, history of smoking and drinking were protective factors for cardiac events. Over the follow-up period, there are 42 cardiac events in diabetic group, 86 in non-diabetic group. Patients with diabetes had significantly higher rates of cardiac events (24.4% versus 9.8%; chi-square 28.5, P<0.0001), compared with rates among patients without diabetes (table 1). Kaplan-Meier survival curves analyzing the no-CE rates in the diabetic and non-diabetic groups, diabetic patients were significantly lower than non-diabetic ones (Log-rank statistic, chi-square 28.75, P <0.0001). Of 172 diabetic patients, 32.2% of the patients with abnormal MPI occurred cardiac events, but only 7.4% of the patients with normal ones did(chi-square 12.34, P <0.001) (figure 1). Abnormal SPECT MPI was associated with the higher rate

  16. Percutaneous transluminal angioplasty of malfunctioning Brescia-Cimino arteriovenous fistula: analysis of factors adversely affecting long-term patency

    International Nuclear Information System (INIS)

    Sugimoto, Koji; Hirota, Shozo; Sugimura, Kazuro; Higashino, Takanori; Kuwata, Yoichiro; Imanaka, Kazufumi

    2003-01-01

    Our objective was to identify the factors adversely affecting long-term patency after percutaneous transluminal angioplasty (PTA) for hemodialysis Brescia-Cimino arteriovenous fistulas. Between November 1995 and March 2000, 91 PTA procedures were performed on 50 patients with 57 Brescia-Cimino fistulas. A retrospective study based on the chart review was performed. The initial technical success rate for all procedures and the primary and secondary patency rates for all fistulas were calculated. Regarding fistulas successfully maintained by the primary PTA, the primary and secondary patency rates were compared using the Kaplan-Meier method between two patient groups. They were classified on the basis of several factors, including age (older, over 70 years, and younger group), age of the fistulas (older, over 6 months, and younger group), with or without diabetes mellitus (DM), solitary or multiple lesions, long or short segment lesion, stenosis or occlusion, and with or without arterial and/or anastomotic lesions. Initial technical success rates for all procedures and fistulas were 91.2 and 89.5%, respectively. Cumulative primary and secondary patency rates at 1 year were 47.3 and 67.3%, respectively. In the comparative study, the secondary patency rate for the older group was lower than that of the younger group with statistical significance (p =0.029). The higher age is the only factor that reduces the long-term patency rate after PTA. (orig.)

  17. [D2 lymph node dissection in gastric cancer surgery: long term results--analysis of an experience with 227 patients].

    Science.gov (United States)

    Vasilescu, C; Herlea, V; Tidor, S; Ivanov, B; Stănciulea, Oana; Mănuc, M; Gheorghe, C; Ionescu, M; Diculescu, M; Popescu, I

    2006-01-01

    The main objective of the study was to evaluate the postoperative mortality and 5 year survival in gastric cancer patients undergoing a minimum of D2 lymphadenectomy. A retrospective study was conducted on 1170 patients operated for gastric adenocarcinoma in the Department of General Surgery and Liver Transplantation of Fundeni Clinical Institute, between 1997 and April 2005. Only 443 patients underwent a curative resection, from which 216 patients had D1 resection and in 227 cases a D2 or D3/D4 lymphadenectomy was performed. Information about survival was available for 189 patients of those who had a D1 resection and for 210 of those who underwent a D2 or D3/D4 lymphadenectomy. Postoperative mortality was 6.5% in the group of curative resection, with 9.2% for D1 and 3.9% for D2/D3 D4. Five year survival according to Kaplan Meier curves was 32 % in the D1 group vs. 51,8% in D2/D3-D4 (p <0.0001). Significant differences were noted in the median survival-- D2/D3-D4 group 63 months vs. 28 months in D1 group. Our data support the gastric resection with a minimum of D2 lymphadenectomy in the radical surgery of gastric cancer. However, an accurate interpretation of the statistical interpretation between the different groups of patients is difficult, mainly because of the retrospective character of the study.

  18. Performance Analysis Rim Driven Propeller as a Propulsor using Open Water Test

    Directory of Open Access Journals (Sweden)

    Agoes Santoso

    2017-12-01

    Full Text Available The use of duct in propeller is one of the breakthrough in the development of the propeller. Ducting not only claimed to be increasing efficiency of the propeller, but also capable to protect the propeller from impact therefore propeller lifespan is longer. From that idea then RDP is created. RDP propeller blade are designed to be fix at their housing called Rim, in the other word, the driving force came from it’s rim. On current RDP blade used is non-conventional blade. This thesis will discuss about design analysis of Kaplan Propeller Kaplan Ka-70 that modified on it’s thickness distribution. On this thesis data that is varied is motor load. Simulation using Open Water Test. The result, highest value of KT and KQ occur on 30% motor load and highest efficiency is 18,338% achieved on 260 Rpm.

  19. AKaplan-Meier estimators of distance distributions for spatial point processes

    NARCIS (Netherlands)

    Baddeley, A.J.; Gill, R.D.

    1997-01-01

    When a spatial point process is observed through a bounded window, edge effects hamper the estimation of characteristics such as the empty space function $F$, the nearest neighbour distance distribution $G$, and the reduced second order moment function $K$. Here we propose and study product-limit

  20. A Note on Some Characteristics and Correlates of the Meier Art Test of Aesthetic Perception.

    Science.gov (United States)

    Stallings, William M.; Anderson, Frances E.

    The reliability and the predictive and concurrent validity of the MATAP were investigated with the implicit goal of improving the prediction of course grades in the College of Fine and Applied Arts. It was found that reliability and validity coefficients were low, and it was suggested that the scoring system was a source of error variance. (MS)

  1. Ettevaatusprintsiip keskkonnaõiguses : [bakalaureusetöö] / Kristel Meier ; Akadeemia Nord, õigusteaduskond ; juhendaja: Rita Annus

    Index Scriptorium Estoniae

    Meier, Kristel, 1966-

    2002-01-01

    Keskkonnaõiguse üldiseloomustus, eesmärk, põhiprintsiibid, ettevaatusprintsiibi ajalooline taust ja areng, Saksa õiguses, rahvusvaheline kohtupraktika, ettevaatusprintsiip Euroopa Ühenduse keskkonnaõiguses

  2. Meier–Gorlin syndrome: An additional Egyptian patient with ...

    African Journals Online (AJOL)

    Rabah M. Shawky

    2016-01-23

    Jan 23, 2016 ... 1. Introduction. The Meier–Gorlin syndrome (MGS) is a rare autosomal reces- ... was 81.5 cm, weight for stature (<3rd centile) and her skull circumference was ... Polycystic ovaries also were reported in ... moderate conductive hearing loss [4]. ... et al. Meier–Gorlin syndrome genotype-phenotype studies: 35.

  3. Early results of a prospective quality of life analysis using the lung cancer symptom scale (LCSS) in patients receiving radiation therapy (XRT) for lung cancer in the community hospital setting

    International Nuclear Information System (INIS)

    Lutz, Stephen T.; Norrell, Ruth; Johnson, Christopher R.; Kachnic, Lisa A.; Arthur, Douglas W.; Huang, David T.

    1997-01-01

    Purpose/Objective: To prospectively determine symptom response in patients receiving radiation therapy for primary lung cancer. Materials and Methods: Thirty-three consecutive lung cancer patients were evaluated between March 1996 and February 1997 at the Medical College of Virginia satellite facility which serves a local community hospital. The LCSS, a validated quality of life scale, was used prospectively during the consultation and upon subsequent follow-up. The scale allowed scoring of symptom improvement, worsening, or stability following therapy. One patient declined therapy, while another was not offered XRT. The 31 remaining patients received a median dose of 54 Gy. Eleven patients received radiotherapy with curative intent to doses between 60 and 70 Gy, 5 small cell lung carcinoma (SmCCa) patients received 54 Gy consolidative therapy, and 13 patients received 15 to 30 Gy with palliative intent. Eight patients received chemotherapy as part of their initial treatment course, including all of those diagnosed with SmCCa. Twenty-one patients completed the LCSS at least once in the three month interval after therapy, while 6 died prior to follow-up, 2 were under treatment at the time of this analysis, and 2 were lost to follow-up. Survival analysis was completed using the Kaplan-Meier method. Results: Median follow-up was 4 months (range = 1 to 14), with an estimated median survival of 5 months. Fourteen patients died of lung cancer, 12 are alive with disease, 6 are alive without disease, and 1 died without disease. Patient characteristics were median age of 69 years (range = 43 to 91), male to female ratio of 4.5 to 1, mean weight loss of 12 pounds (range = 0 to 27), and mean duration of symptoms of 3 months (range = 0 to 12). Stage was: I 9%, II = 0%, IIIA = 6%, IIIB = 43%, IV = 27%, and limited stage SmCCa = 15%. Histology was: squamous cell carcinoma = 21%, adenocarcinoma = 23%, large cell carcinoma = 23%, poorly differentiated carcinoma = 15%, mesothelioma

  4. Impaction grafting in the femur in cementless modular revision total hip arthroplasty: a descriptive outcome analysis of 243 cases with the MRP-TITAN revision implant

    Directory of Open Access Journals (Sweden)

    Wimmer Matthias D

    2013-01-01

    Full Text Available Abstract Background We present a descriptive and retrospective analysis of revision total hip arthroplasties (THA using the MRP-TITAN stem (Peter Brehm, Weisendorf, GER with distal diaphyseal fixation and metaphyseal defect augmentation. Our hypothesis was that the metaphyseal defect augmentation (Impaction Bone Grafting improves the stem survival. Methods We retrospectively analyzed the aggregated and anonymized data of 243 femoral stem revisions. 68 patients with 70 implants (28.8% received an allograft augmentation for metaphyseal defects; 165 patients with 173 implants (71.2% did not, and served as controls. The mean follow-up was 4.4 ± 1.8 years (range, 2.1–9.6 years. There were no significant differences (p > 0.05 between the study and control group regarding age, body mass index (BMI, femoral defects (types I-III as described by Paprosky, and preoperative Harris Hip Score (HHS. Postoperative clinical function was evaluated using the HHS. Postoperative radiologic examination evaluated implant stability, axial implant migration, signs of implant loosening, periprosthetic radiolucencies, as well as bone regeneration and resorption. Results There were comparable rates of intraoperative and postoperative complications in the study and control groups (p > 0.05. Clinical function, expressed as the increase in the postoperative HHS over the preoperative score, showed significantly greater improvement in the group with Impaction Bone Grafting (35.6 ± 14.3 vs. 30.8 ± 15.8; p ≤ 0.05. The study group showed better outcome especially for larger defects (types II C and III as described by Paprosky and stem diameters ≥ 17 mm. The two groups did not show significant differences in the rate of aseptic loosening (1.4% vs. 2.9% and the rate of revisions (8.6% vs. 11%. The Kaplan-Meier survival for the MRP-TITAN stem in both groups together was 93.8% after 8.8 years. [Study group 95.7% after 8.54 years ; control group 93

  5. Nested Cohort - R software package

    Science.gov (United States)

    NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.

  6. ORIGINAL ARTICLES Antiretroviral treatment for children

    African Journals Online (AJOL)

    Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.

  7. Análisis de la aparición de discapacidades en personas mayores de Cataluña = Analysis of disability onset of the elderly in Catalonia

    Directory of Open Access Journals (Sweden)

    Bermúdez Morata, Lluís

    2008-01-01

    Full Text Available El presente trabajo se centra en el estudio del tiempo hasta la discapacitación para las actividades de la vida diaria en la población activa de Cataluña mayor de 60 años. El riesgo de sufrir discapacidades es mayor para este grupo de edad que en los más jóvenes y, además, se incrementa con la edad. La aparición de discapacidades resta habilidades a la hora de realizar las distintas actividades de la vida diaria, por ello hemos centrado nuestro interés en la variable tiempo hasta que una persona de 60 años que no muestra discapacidad alguna, se discapacita, identificando factores ligados a los incrementos del riesgo de discapacitación. A partir de los datos que proporciona la Encuesta sobre Discapacidades, Deficiencias y Estado de Salud (EDDES, INE 1999 y, utilizando el estimador de Kaplan-Meier, se estiman las funciones de supervivencia que permiten calcular probabilidades relacionadas con la edad de discapacitación. Asimismo, se ha realizado un análisis del modelo de regresión de Weibull que permite interpretar cómo y en qué medida afectan las características individuales. = In Spain individuals aged 60 years and above are major consumers of the health care system. The risk of becoming unable to perform daily life activities is higher for the elderly than for the younger population, and in addition, it increases with age. As a consequence we focus on the study of the period of life after an abled person who is 60 years old becomes disabled and we also study the factors that are related to the risk of disability. Using data from the Survey of Disabilities, Handicaps and Health Status (EDDES, INE 1999, and using the Kaplan-Meier estimator, we estimate the survival functions to calculate the probability of becoming disabled at different age points. Besides, a Weibull regression model is estimated in order to interpret the effects of individual characteristics on the disability risk.

  8. Models and analysis for multivariate failure time data

    Science.gov (United States)

    Shih, Joanna Huang

    The goal of this research is to develop and investigate models and analytic methods for multivariate failure time data. We compare models in terms of direct modeling of the margins, flexibility of dependency structure, local vs. global measures of association, and ease of implementation. In particular, we study copula models, and models produced by right neutral cumulative hazard functions and right neutral hazard functions. We examine the changes of association over time for families of bivariate distributions induced from these models by displaying their density contour plots, conditional density plots, correlation curves of Doksum et al, and local cross ratios of Oakes. We know that bivariate distributions with same margins might exhibit quite different dependency structures. In addition to modeling, we study estimation procedures. For copula models, we investigate three estimation procedures. the first procedure is full maximum likelihood. The second procedure is two-stage maximum likelihood. At stage 1, we estimate the parameters in the margins by maximizing the marginal likelihood. At stage 2, we estimate the dependency structure by fixing the margins at the estimated ones. The third procedure is two-stage partially parametric maximum likelihood. It is similar to the second procedure, but we estimate the margins by the Kaplan-Meier estimate. We derive asymptotic properties for these three estimation procedures and compare their efficiency by Monte-Carlo simulations and direct computations. For models produced by right neutral cumulative hazards and right neutral hazards, we derive the likelihood and investigate the properties of the maximum likelihood estimates. Finally, we develop goodness of fit tests for the dependency structure in the copula models. We derive a test statistic and its asymptotic properties based on the test of homogeneity of Zelterman and Chen (1988), and a graphical diagnostic procedure based on the empirical Bayes approach. We study the

  9. Adoption of new drugs by physicians: a survival analysis

    Directory of Open Access Journals (Sweden)

    Garjón Francisco

    2012-03-01

    Full Text Available Abstract Background New drugs often substitute others cheaper and with a risk-benefit balance better established. Our aim was to analyse the diffusion of new drugs during the first months of use, examining the differences between family physicians and specialists. Methods Prescription data were obtained of cefditoren, duloxetine, etoricoxib, ezetimibe, levocetirizine, olmesartan, pregabalin and tiotropium 36 months after their launching. We obtained the monthly number of prescriptions per doctor and the number prescribers of each drug by specialty. After discarding those with less than 10 prescriptions during this period, physicians were defined as adopters if the number of prescriptions was over the 25th percentile for each drug and level (primary or secondary care. The diffusion of each drug was studied by determining the number of adopter family physicians throughout the study period. Among the group of adopters, we compared the month of the first prescription by family physicians to that of other specialists using the Kaplan-Meier method. Results The adoption of the drugs in primary care follows an exponential diffusion curve that reaches a plateau at month 6 to 23. Tiotropium was the most rapidly and widely adopted drug. Cefditoren spread at a slower rate and was the least adopted. The diffusion of etoricoxib was initially slowed down due to administrative requirements for its prescription. The median time of adoption in the case of family physicians was 4-6 months. For each of the drugs, physicians of a specialty other than family physicians adopted it first. Conclusions The number of adopters of a new drug increases quickly in the first months and reaches a plateau. The number of adopter family physicians varies considerably for different drugs. The adoption of new drugs is faster in specialists. The time of adoption should be considered to promote rational prescribing by providing timely information about new drugs and independent

  10. Estimating the Duration of Public Concern After the Fukushima Dai-ichi Nuclear Power Station Accident From the Occurrence of Radiation Exposure-Related Terms on Twitter: A Retrospective Data Analysis.

    Science.gov (United States)

    Nishimoto, Naoki; Ota, Mizuki; Yagahara, Ayako; Ogasawara, Katsuhiko

    2016-11-25

    After the Fukushima Dai-ichi Nuclear Power Station accident in Japan on March 11, 2011, a large number of comments, both positive and negative, were posted on social media. The objective of this study was to clarify the characteristics of the trend in the number of tweets posted on Twitter, and to estimate how long public concern regarding the accident continued. We surveyed the attenuation period of the first term occurrence related to radiation exposure as a surrogate endpoint for the duration of concern. We retrieved 18,891,284 tweets from Twitter data between March 11, 2011 and March 10, 2012, containing 143 variables in Japanese. We selected radiation, radioactive, Sievert (Sv), Becquerel (Bq), and gray (Gy) as keywords to estimate the attenuation period of public concern regarding radiation exposure. These data, formatted as comma-separated values, were transferred into a Statistical Analysis System (SAS) dataset for analysis, and survival analysis methodology was followed using the SAS LIFETEST procedure. This study was approved by the institutional review board of Hokkaido University and informed consent was waived. A Kaplan-Meier curve was used to show the rate of Twitter users posting a message after the accident that included one or more of the keywords. The term Sv occurred in tweets up to one year after the first tweet. Among the Twitter users studied, 75.32% (880,108/1,168,542) tweeted the word radioactive and 9.20% (107,522/1,168,542) tweeted the term Sv. The first reduction was observed within the first 7 days after March 11, 2011. The means and standard errors (SEs) of the duration from the first tweet on March 11, 2011 were 31.9 days (SE 0.096) for radioactive and 300.6 days (SE 0.181) for Sv. These keywords were still being used at the end of the study period. The mean attenuation period for radioactive was one month, and approximately one year for radiation and radiation units. The difference in mean duration between the keywords was attributed

  11. The prognostic value of the suPARnosticTM ELISA assay in HIV-1 infected individuals is not affected by uPAR promoter polymorphisms

    DEFF Research Database (Denmark)

    Schneider, Uffe; Nielsen, Rikke; Pedersen, Court

    2007-01-01

    . METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...

  12. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  13. Volume-Based F-18 FDG PET/CT Imaging Markers Provide Supplemental Prognostic Information to Histologic Grading in Patients With High-Grade Bone or Soft Tissue Sarcoma

    DEFF Research Database (Denmark)

    Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid

    2015-01-01

    analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...

  14. Sequential alternating deferiprone and deferoxamine treatment compared to deferiprone monotherapy: main findings and clinical follow-up of a large multicenter randomized clinical trial in -thalassemia major patients

    DEFF Research Database (Denmark)

    Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela

    2011-01-01

    In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...

  15. Cementless One-Stage Revision in Chronic Periprosthetic Hip Joint Infection. Ninety-One Percent Infection Free Survival in 56 Patients at Minimum 2-Year Follow-Up

    DEFF Research Database (Denmark)

    Lange, Jeppe; Troelsen, Anders; Solgaard, Søren

    2018-01-01

    was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...

  16. Is Intermediate Radiation Dose Escalation With Concurrent Chemotherapy for Stage III Non–Small-Cell Lung Cancer Beneficial? A Multi-Institutional Propensity Score Matched Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, George, E-mail: george.rodrigues@lhsc.on.ca [London Health Sciences Centre, London, Ontario (Canada); Oberije, Cary [MAASTRO Clinic, Maastricht (Netherlands); Senan, Suresh [VU University Medical Center, Amsterdam (Netherlands); Tsujino, Kayoko [Hyogo Cancer Center, Akashi (Japan); Wiersma, Terry [MAASTRO Clinic, Maastricht (Netherlands); Moreno-Jimenez, Marta [Universidad de Navarra, Pamplona (Spain); Kim, Tae Hyun [National Cancer Center, Goyang-si, Gy eonggi (Korea, Republic of); Marks, Lawrence B. [University of North Carolina, Chapel Hill, North Carolina (United States); Rengan, Ramesh [University of Washington, Seattle, Washington (United States); De Petris, Luigi [Karolinska University Hospital, Stockholm (Sweden); Ramella, Sara [Campus Bio-Medico University, Rome (Italy); DeRuyck, Kim [Ghent University, Ghent (Belgium); De Dios, Núria Rodriguez [Universidad Pompeu Fabra, Barcelona (Spain); Warner, Andrew [London Health Sciences Centre, London, Ontario (Canada); Bradley, Jeffrey D. [Washington University School of Medicine, St. Louis, Missouri (United States); Palma, David A. [London Health Sciences Centre, London, Ontario (Canada)

    2015-01-01

    Purpose: The clinical benefits and risks of dose escalation (DE) for stage III non–small-cell lung cancer (NSCLC) remain uncertain despite the results from Radiation Therapy Oncology Group (RTOG) protocol 0617. There is significant heterogeneity of practice, with many clinicians prescribing intermediate dose levels between the 0617 study arms of 60 and 74 Gy. This study investigated whether this strategy is associated with any survival benefits/risks by analyzing a large multi-institutional database. Methods and Materials: An individual patient database of stage III NSCLC patients treated with radical intent concurrent chemoradiation therapy was created (13 institutions, n=1274 patients). Patients were divided into 2 groups based on tumor Biological Effective Dose at 10 Gy (BED 10): those receiving standard dose (SD; n=552), consisting of 72Gy ≤ BED 10 ≤ 76.8 Gy (eg 60-64 Gy/30-32 fractions [fr]), and those receiving intermediate dose (ID; n=497), consisting of 76.8Gy < BED 10 < 100.8 Gy (eg >64 Gy/32 fr and <74 Gy/37 fr), with lower-dose patients (n=225) excluded from consideration. Patients were then matched using propensity scores, leading to 2 matched groups of 196 patients. Outcomes were compared using various statistics including interquartile range (IQR), Kaplan-Meier curves, and adjusted Cox regression analysis. Results: Matched groups were found to be balanced except for N stage (more N3 disease in SD), median treatment year (SD in 2003; ID in 2007), platinum and taxane chemotherapy (SD in 28%; ID in 39%), and median follow-up (SD were 89 months; ID were 40 months). Median dose fractionation was 60 Gy/30 fr in SD (BED 10 IQR: 72.0-75.5 Gy) and 66 Gy/33 fr (BED 10 IQR: 78.6-79.2 Gy) in ID. Survival curves for SD and ID matched cohorts were statistically similar (P=.27); however, a nonstatistically significant trend toward better survival for ID was observed after 15 months (median survival SD: 19.3 months; ID: 21.0

  17. High-dose-rate versus low-dose-rate brachytherapy in the treatment of cervical cancer: analysis of tumor recurrence - the University of Wisconsin experience

    International Nuclear Information System (INIS)

    Petereit, Daniel G.; Sarkaria, Jann N.; Potter, David M.; Schink, Julian C.

    1999-01-01

    Purpose: To retrospectively compare the clinical outcome for cervical cancer patients treated with high-dose-rate (HDR) vs. low-dose-rate (LDR) brachytherapy. Methods and Materials: One hundred ninety-one LDR patients were treated from 1977 to 1988 and compared to 173 HDR patients treated from 1989 to 1996. Patients of similar stage and tumor volumes were treated with identical external beam fractionation schedules. Brachytherapy was given in either 1 or 2 LDR implants for the earlier patient cohort, and 5 HDR implants for the latter cohort. For both patient groups, Point A received a minimum total dose of 80 Gy. The linear-quadratic formula was used to calculate the LDR dose-equivalent contribution to Point A for the HDR treatments. The primary endpoints assessed were survival, pelvic control, relapse-free survival, and distant metastases. Endpoints were estimated using the Kaplan-Meier method. Comparisons between treatment groups were performed using the log-rank test and Cox proportional hazards models. Results: The median follow-up was 65 months (2 to 208 months) in the LDR group and 22 months (1 to 85 months) in the HDR group. For all stages combined there was no difference in survival, pelvic control, relapse-free survival, or distant metastases between LDR and HDR patients. For Stage IB and II HDR patients, the pelvic control rates were 85% and 80% with survival rates of 86% and 65% at 3 years, respectively. In the LDR group, Stage IB and II patients had 91% and 78% pelvic control rates, with 82% and 58% survival rates at 3 years, respectively. No difference was seen in survival or pelvic control for bulky Stage I and II patients combined (> 5 cm). Pelvic control at 3 years was 44% (HDR) versus 75% (LDR) for Stage IIIB patients (p = 0.002). This difference in pelvic control was associated with a lower survival rate in the Stage IIIB HDR versus LDR population (33% versus 58%, p = 0.004). The only major difference, with regard to patient characteristics

  18. Progression-free Survival Following Stereotactic Body Radiotherapy for Oligometastatic Prostate Cancer Treatment-naive Recurrence: A Multi-institutional Analysis.

    Science.gov (United States)

    Ost, Piet; Jereczek-Fossa, Barbara Alicja; As, Nicholas Van; Zilli, Thomas; Muacevic, Alexander; Olivier, Kenneth; Henderson, Daniel; Casamassima, Franco; Orecchia, Roberto; Surgo, Alessia; Brown, Lindsay; Tree, Alison; Miralbell, Raymond; De Meerleer, Gert

    2016-01-01

    The literature on metastasis-directed therapy for oligometastatic prostate cancer (PCa) recurrence consists of small heterogeneous studies. This study aimed to reduce the heterogeneity by pooling individual patient data from different institutions treating oligometastatic PCa recurrence with stereotactic body radiotherapy (SBRT). We focussed on patients who were treatment naive, with the aim of determining if SBRT could delay disease progression. We included patients with three or fewer metastases. The Kaplan-Meier method was used to estimate distant progression-free survival (DPFS) and local progression-free survival (LPFS). Toxicity was scored using the Common Terminology Criteria for Adverse Events. In total, 163 metastases were treated in 119 patients. The median DPFS was 21 mo (95% confidence interval, 15-26 mo). A lower radiotherapy dose predicted a higher local recurrence rate with a 3-yr LPFS of 79% for patients treated with a biologically effective dose ≤100Gy versus 99% for patients treated with >100Gy (p=0.01). Seventeen patients (14%) developed toxicity classified as grade 1, and three patients (3%) developed grade 2 toxicity. No grade ≥3 toxicity occurred. These results should serve as a benchmark for future prospective trials. This multi-institutional study pools all of the available data on the use of stereotactic body radiotherapy for limited prostate cancer metastases. We concluded that this approach is safe and associated with a prolonged treatment progression-free survival. Copyright © 2015. Published by Elsevier B.V.

  19. Comparison of clinical outcomes between total knee arthroplasty and unicompartmental knee arthroplasty for osteoarthritis of the knee: a retrospective analysis of preoperative and postoperative results.

    Science.gov (United States)

    Horikawa, Akira; Miyakoshi, Naohisa; Shimada, Yoichi; Kodama, Hiroyuki

    2015-10-28

    Excellent results have recently been reported for both total knee arthroplasty (TKA) and unicompartmental knee arthroplasty (UKA), but there have been few reports about which has a better long-term outcome. The preoperative and postoperative results of TKA and UKA for osteoarthritis of the knee were thus compared. The results of 48 patients who underwent TKA and 25 patients who underwent UKA were evaluated based on clinical scores and survivorship in the middle long-term period. Preoperative, latest postoperative, and changes in the femoro-tibial angle (FTA), range of motion (ROM), Japanese Orthopedic Association score (JOA score), and Japanese Knee Osteoarthritis Measure (JKOM) were compared. The patients' mean age was 73 years. The mean follow-up period was 9 years (TKA: mean, 10.5 years; range, 7-12 years; UKA: mean, 9 years; range, 6-11 years). Preoperative FTA and ROM were significantly higher in the UKA group than in the TKA group. Total changes in all scores were similar among the two groups, as were changes in scores for all JOA and JKOM domains. The cumulative revision rate was higher for UKA than for TKA (7 versus 4%). Kaplan-Meier survivorship at 10 years was 84% for UKA and 92% for TKA. This clinical study found no significant differences between TKA and UKA, except in long-term survivorship.

  20. Adjuvant radiation therapy in uterine carcinosarcoma: A population-based analysis of patient demographic and clinical characteristics, patterns of care and outcomes.

    Science.gov (United States)

    Manzerova, Julia; Sison, Cristina P; Gupta, Divya; Holcomb, Kevin; Caputo, Thomas A; Parashar, Bhupesh; Nori, Dattatreyudu; Wernicke, A Gabriella

    2016-05-01

    To examine clinical and demographic characteristics of a population-based cohort of patients with uterine carcinosarcoma (UCS), to assess access to treatment and survival patterns. Surveillance, Epidemiology and End Results database was queried for patients diagnosed in 1999-2010 and treated with surgery with or without adjuvant radiation therapy (aRT). The Kaplan-Meier method was used to estimate survival functions, and Cox proportional hazards regression - to analyze the effect of covariates on survival. 2342 patients were eligible. African Americans presented with more advanced AJCC stages than other races (35.4% vs. 29.1%; pAfrican Americans vs. others, and women diagnosed in 1999-2004 vs. in 2005-2010, received aRT at a similar rate: 36.5% vs. 39.9% (p=NS), and 39.5% vs. 38.9% (p=NS), respectively. There was a trend towards higher aRT utilization among patients younger than 65 vs. older (41.4% vs. 37.5%; paRT group: 42 vs. 22 (paRT group. African Americans were more likely to present with later stage disease and die of UCS than non-African Americans. Age and stage, but not race, influenced receipt of aRT. Patients treated more recently survived longer. Copyright © 2016 Elsevier Inc. All rights reserved.