K S R Anjaneyulu

Indian Academy of Sciences (India)

90 Research News. Deep Blue Beats Kasparov in a Rematch A Victory for Machine over Man · K S R Anjaneyulu · More Details Fulltext PDF. Volume 3 Issue 3 March 1998 pp 46-58 General Article. Expert Systems : An Introduction.

Resolution of G(s)alpha and G(q)alpha/G(11)alpha proteins in membrane domains by two-dimensional electrophoresis: the effect of long-term agonist stimulation.

Science.gov (United States)

Matousek, P; Novotný, J; Svoboda, P

2004-01-01

Low-density membrane-domain fractions were prepared from S49 lymphoma cells and clone e2m11 of HEK293 cells expressing a large number of thyrotropin-releasing hormone receptor (TRH-R) and G(11)alpha by flotation on sucrose density gradients. The intact cell structure was broken by detergent-extraction, alkaline-treatment or drastic homogenization. Three types of low-density membranes were resolved by two-dimensional electrophoresis and analyzed for G(s)alpha (S49) or G(q)alpha/G11) (e2m11) content. Four individual immunoblot signals of Gsalpha protein were identified in S49 lymphoma cells indicating complete resolution of the long G(s)alpha L+/-ser and short G(s)alpha S+/-ser variants of G(s)alpha. All these were diminished by prolonged agonist (isoprenaline) stimulation. In e2m11-HEK cells, five different immunoblot signals were detected indicating post-translational modification of G proteins of G(q)alpha/G(11)alpha family. The two major spots corresponding to exogenously (over)expressed G(11)alpha and endogenous G(q)alpha were reduced; the minor spots diminished by hormonal stimulation. Parallel analysis by silver staining of the total protein content indicated that no major changes in protein composition occurred under these conditions. Our data thus indicate that agonist-stimulation of target cells results in down-regulation of all different members of G(s) and G(q)/G(11) families. This agonist-specific effect may be demonstrated in crude membrane as well as domain/raft preparations and it is not accompanied by changes in overall protein composition.

Fenntarthatóság a beszerzésben = Sustainable purchasing

OpenAIRE

Vörösmarty, Gyöngyi; Dobos, Imre

2012-01-01

Tanulmányunk a fenntarthatóság beszerzésben való értelmezésével kapcsolatos vizsgálatához szeretne hozzájárulni. A Versenyképesség Kutatás korábbi fázisában a fenntarthatóság beszerzésben való megjelenésével, lehetséges értelmezéseivel, tartalmi elemeivel, azok strukturálásával és azokkal a motivációs tényezőkkel foglalkoztunk, mely a kezdeményezések hátterében állt. Az akkori eredményekre építve szeretnénk a témát folytatni. Áttekintjük a szakirodalom legutóbbi elemzésünk óta született eredm...

[miR-143 inhibits cell proliferation through targeted regulating the expression of K-ras gene in HeLa cells].

Science.gov (United States)

Qin, H X; Cui, H K; Pan, Y; Hu, R L; Zhu, L H; Wang, S J

2016-12-23

Objective: To explore the effect of microRNA miR-143 on the proliferation of cervical cancer HeLa cells through targeted regulating the expression of K-ras gene. Methods: The luciferase report carrier containing wild type 3'-UTR of K-ras gene (K-ras-wt) or mutated 3'-UTR of the K-ras (K-ras-mut) were co-transfected with iR-143 mimic into the HeLa cells respectively, and the targeting effect of miR-143 in the transfectants was verified by the dual luciferase report system. HeLa cells were also transfected with miR-143 mimic (miR-143 mimic group), mimic control (negative control group), and miR-143 mimic plus K-ras gene (miR-143 mimic+ K-ras group), respectively. The expression of miR-143 in the transfected HeLa cells was detected by real-time PCR (RT-PCR), and the expression of K-ras protein was detected by Western blot. The cell proliferation activity of each group was examined by MTT assay. In addition, human cervical cancer tissue samples ( n =5) and cervical intraepithelial neoplasia tissue samples ( n =5) were also examined for the expression of miR-143 and K-ras protein by RT-PCR and Western blot, respectively. Results: The luciferase report assay showed that co-transfection with miR-143 mimic decreased the luciferase activity of the K-ras-wt significantly, but did not inhibit the luciferase activity of the K-ras-mut. The expression of miR-143 in the HeLa cells transfected with miR-143 mimic was significantly higher than that in the HeLa cells transfected with the mimic control (3.31±0.45 vs 0.97±0.22, P cell proliferative activity of the miR-143 mimic group was significantly lower than that of the negative control group ( P cell proliferative activity of the miR-143 mimic+ K-ras group was also significantly lower than the control group ( P HeLa cells through targeted regulating the expression of K-ras gene. In human cervical cancer tissues of a small sample set, the expression of miR-143 is downregulated, and the expression of K-ras is upregulated.

Karakavakta anaçlık yöntemiyle sırık çeliği üretim tekniğinin belirlenmesi

Directory of Open Access Journals (Sweden)

Dr. Selda AKGÜL

2016-12-01

Full Text Available Bu çalışmada, kavak dikim materyali üretiminde, en pratik ve ekonomik metot olarak tespit edilen, anaçlık usulü ile “KOCABEY”, “GAZİ” ve “GEYVE” karakavak klonlarında, ağaçlandırmalarda kullanılmak üzere, bir ve iki yaşlı sırık çeliği standart üretim metodu tespit edilmeye çalışılmıştır. Bir ve iki yaşlı sırık çeliği üretiminde, aralık-mesafenin ve anaçtaki sürgün sayısının etkili olup olmadığını belirlemek amacıyla, rastlantı bloklarında bölünmüş parseller deneme deseni kullanılarak Ankara-Behiçbey Orman Fidanlığında denemeler tesis edilmiştir. Çalışmadan elde edilen sonuçlara göre, bir yaşlı sırık çeliği üretiminde, denenen geniş aralık-mesafe grubu (1,6x0,4 m, üretilen miktar açısından daha iyi sonuç vermiştir. Anaçta bırakılacak sürgün adedi sayısının ise önemli olmadığı görülmüştür. İki yaşlı sırık çeliği üretiminde ise; her üç klonda da, denenen işlemlerin etkisinin çok fazla olmadığı kanaatine ulaşılmıştır.

Mitochondrial 12S rRNA A827G mutation is involved in the genetic susceptibility to aminoglycoside ototoxicity

International Nuclear Information System (INIS)

Xing Guangqian; Chen Zhibin; Wei Qinjun; Tian Huiqin; Li Xiaolu; Zhou Aidong; Bu Xingkuan; Cao Xin

2006-01-01

We have analyzed the clinical and molecular characterization of a Chinese family with aminoglycoside-induced and non-syndromic hearing impairment. Clinical evaluations revealed that only those family members who had a history of exposure to aminoglycoside antibiotics subsequently developed hearing loss, suggesting mitochondrial genome involvement. Sequence analysis of the mitochondrial 12S rRNA and tRNA Ser(UCN) genes led to the identification of a homoplasmic A827G mutation in all maternal relatives, a mutation that was identified previously in a few sporadic patients and in another Chinese family with non-syndromic deafness. The pathogenicity of the A827G mutation is strongly supported by the occurrence of the same mutation in two independent families and several genetically unrelated subjects. The A827G mutation is located at the A-site of the mitochondrial 12S rRNA gene which is highly conserved in mammals. It is possible that the alteration of the tertiary or quaternary structure of this rRNA by the A827G mutation may lead to mitochondrial dysfunction, thereby playing a role in the pathogenesis of hearing loss and aminoglycoside hypersensitivity. However, incomplete penetrance of hearing impairment indicates that the A827G mutation itself is not sufficient to produce clinical phenotype but requires the involvement of modifier factors for the phenotypic expression. Indeed, aminoglycosides may contribute to the phenotypic manifestation of the A827G mutation in this family. In contrast with the congenital or early-onset hearing impairment in another Chinese family carrying the A827G mutation, three patients in this pedigree developed hearing loss only after use of aminoglycosides. This discrepancy likely reflects the difference of genetic backgrounds, either mitochondrial haplotypes or nuclear modifier genes, between two families

G K Ananthasuresh

Indian Academy of Sciences (India)

G K Ananthasuresh · More Details Fulltext PDF. Volume 17 Issue 4 April 2012 pp 317-318 Editorial. Editorial · G K Ananthasuresh · More Details Fulltext PDF. Volume 20 Issue 2 February 2015 pp 98-122 General Article. Buckminster Fuller and his Fabulous Designs · G K Ananthasuresh · More Details Fulltext PDF ...

G-quadruplex recognition activities of E. Coli MutS

Directory of Open Access Journals (Sweden)

Ehrat Edward A

2012-07-01

Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

Identification of two novel mutations, PSEN1 E280K and PRNP G127S, in a Malaysian family

Directory of Open Access Journals (Sweden)

Ch’ng GS

2015-09-01

Full Text Available Gaik-Siew Ch’ng,1,* Seong Soo A An,2,* Sun Oh Bae,2 Eva Bagyinszky,2 SangYun Kim3,41Department of Genetics, Kuala Lumpur Hospital, Malaysia; 2Department of Bionano Technology, Gachon University, 3Department of Neurology, Seoul National University College of Medicine, 4Seoul National University Bundang Hospital, South Korea*These authors contributed equally to this workAbstract: Alzheimer’s disease (AD is the most common form of dementia, which can be categorized into two main forms: early onset AD and late onset AD. The genetic background of early onset AD is well understood, and three genes, the APP, PSEN1, and PSEN2 have been identified as causative genes. In the current study, we tested three siblings from Malaysia who were diagnosed with early onset dementia, as well as their available family members. The family history was positive as their deceased father was similarly affected. Patients were tested for mutations in APP, PSEN1, PSEN2, and PRNP. A novel variant, E280K, was discovered in exon 8 of PSEN1 in the three siblings. In silico analyses with SIFT, SNAP, and PolyPhen2 prediction tools and three-dimensional modeling were performed, and the results suggested that the mutation is probably a pathogenic variant. Two additional pathogenic mutations were previously been described for codon 280, E280A, and E280G, which could support the importance of the E280 residue in the PS1 protein contributing to the pathogenic nature of E280K. Additional ten family members were screened for the E280K mutation, and all of them were negative. Six of them presented with a variety of neuropsychiatric symptoms, including learning disabilities, epilepsy, and schizophrenia, while four family members were asymptomatic. A novel PRNP G127S mutation was found in a step-niece of the three siblings harboring the PSEN1 E280K mutation. In silico predictions for PRNP G127S mutation suggested that this might be possibly a damaging variant. Additional studies to

Peter Singer’ın faydacı etik görüşü çerçevesinde kürtajın değerlendirilmesi

OpenAIRE

KAYA, Funda

2014-01-01

Yaşamın başlangıcına ilişkin biyoetik bir problem olarak kürtaj, gebeliğin sonlandırılmasına dair kararın etik açıdan doğru olup olmadığını tartışma konusuyapmakta olup, uygulamalı etik çalışmalarıyla tanınan Peter Singer’ın görüşlerikürtaj yanlısı görüşlerin en radikali olarak nitelendirilmektedir. Singer etikte faydacılığın çağdaş bir yorumu olarak tercihe dayalı faydacılık görüşlerini savunmaktadır. Tercihe dayalı fayd...

G4S fuajee ruumiinstallatsioon = G4S lobby spatial installation / Ville Lausmäe

Index Scriptorium Estoniae

Lausmäe, Ville, 1981-

2013-01-01

Turvafirma G4S büroohoone (Paldiski mnt 80, Tallinn) fuajee sisekujundusest. Autorid: Ville Lausmäe, Kadi Karmann (sisearhitektuuribüroo VLS). Kultuuriministeeriumi kunstinõuniku Maria-Kristiina Soomre arvamus. Lühidalt sisearhitektuuribüroost VLS

miR-181a promotes G1/S transition and cell proliferation in pediatric acute myeloid leukemia by targeting ATM.

Science.gov (United States)

Liu, Xiaodan; Liao, Wang; Peng, Hongxia; Luo, Xuequn; Luo, Ziyan; Jiang, Hua; Xu, Ling

2016-01-01

Abnormal expression of miRNAs is intimately related to a variety of human cancers. The purpose of this study is to confirm the expression of miR-181a and elucidate its physiological function and mechanism in pediatric acute myeloid leukemia (AML). Pediatric AML patients and healthy controls were enrolled, and the expression of miR-181a and ataxia telangiectasia mutated (ATM) in tissues were examined using quantitative PCR. Moreover, cell proliferation and cell cycle were evaluated in several cell lines (HL60, NB4 and K562) by using flow cytometry after transfected with miR-181a mimics and inhibitors, or ATM siRNA and control siRNA. Finally, ATM as the potential target protein of miR-181a was examined. We found that miR-181a was significantly increased in pediatric AML, which showed an inverse association with ATM expression. Overexpressed miR-181a in cell lines significantly enhanced cell proliferation, as well as increased the ratio of S-phase cells by miR-181a mimics transfection in vitro. Luciferase activity of the reporter construct identified ATM as the direct molecular target of miR-181a. ATM siRNA transfection significantly enhanced cell proliferation and increased the ratio of S-phase cells in vitro. The results revealed novel mechanism through which miR-181a regulates G1/S transition and cell proliferation in pediatric AML by regulating the tumor suppressor ATM, providing insights into the molecular mechanism in pediatric AML.

MiR-7 triggers cell cycle arrest at the G1/S transition by targeting multiple genes including Skp2 and Psme3.

Directory of Open Access Journals (Sweden)

Noelia Sanchez

Full Text Available MiR-7 acts as a tumour suppressor in many cancers and abrogates proliferation of CHO cells in culture. In this study we demonstrate that miR-7 targets key regulators of the G1 to S phase transition, including Skp2 and Psme3, to promote increased levels of p27(KIP and temporary growth arrest of CHO cells in the G1 phase. Simultaneously, the down-regulation of DNA repair-specific proteins via miR-7 including Rad54L, and pro-apoptotic regulators such as p53, combined with the up-regulation of anti-apoptotic factors like p-Akt, promoted cell survival while arrested in G1. Thus miR-7 can co-ordinate the levels of multiple genes and proteins to influence G1 to S phase transition and the apoptotic response in order to maintain cellular homeostasis. This work provides further mechanistic insight into the role of miR-7 as a regulator of cell growth in times of cellular stress.

G K Suryaprakash

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. G K Suryaprakash. Articles written in Resonance – Journal of Science Education. Volume 22 Issue 12 December 2017 pp 1111-1153 General Article. George Andrew Olah: Across Conventional Lines · Ripudaman Malhotra Thomas Mathew G K Suryaprakash.

Purification of polyclonal IgG specific for Camelid’s antibodies and their recombinant nanobodies

Directory of Open Access Journals (Sweden)

Haddad Muhammad

2016-01-01

Full Text Available Camelid’ s heavy-chain antibody (HCAb consists of only two heavy chains and lacks the two light chains together with the CH1 domain usually found in conventional immunoglobulins. A recombinant single antigen-binding entity, named VHH (or Nanobody® was generated by reengineering the variable domains from HCAb. This study focuses on the detection of camelid´s immunoglobulins as well as their derivative nanobodies using a universal anti-camel antibody produced in rabbit (rIgG. Starting from a crude rabbit serum, a standard stock of rIgG (1 mg/ml was prepared after purification by affinity chromatography using protein-A column. As expected, rIgG was able to detect camel antibodies in ELISA and immunoblotting, and its reactivity was equal against all different camel IgG subclasses, which were purified from serum by differential affinity chromatography on protein-G and -A. Interestingly, rIgG also recognized nanobodies since they were originally part of camel HCAbs, providing an alternative method to detect the corpus of these recombinant proteins rather than targeting their artificial tags. These data suggest that the anti-camel rIgG described here could be efficiently applied at different stages of nanobody technology, including the quantitation of the issued nanobodies and their detection when bound to target antigens.

Taxonomic status of the roses (Rosa) described by S.G. Dimitrov from Bulgaria

DEFF Research Database (Denmark)

Zielinski, J.; Petrova, A; Tan, Kit

2004-01-01

The original herbarium vouchers for six species of Rosa (Rosaceae) described by S. G. Dimitrov from Bulgaria are taxonomically evaluated. Two species (R. balcanica, R. orphei) are considered hybrids, four other names (R. bulgarica, R. parilica, R. pontica and R. rhodopaea) are taxonomic synonyms...

Curcumin sensitizes prostate cancer cells to radiation partly via epigenetic activation of miR-143 and miR-143 mediated autophagy inhibition.

Science.gov (United States)

Liu, Jianbo; Li, Min; Wang, Yuewei; Luo, Jianchao

2017-08-01

Curcumin has been reported as a radiosensitizer in prostate cancer. But the underlying mechanism is not well understood. In this study, we firstly assessed how curcumin affects the expression of miR-143/miR-145 cluster. Then, we investigated whether miR-143 is involved in regulation of radiosensitivity and its association with autophagy in prostate cancer cells. Our data showed that PC3, DU145 and LNCaP cells treated with curcumin had significantly restored miR-143 and miR-145 expression. Curcumin showed similar effect as 5-AZA-dC on reducing methylation of CpG dinucleotides in miR-143 promoter. In addition, curcumin treatment reduced the expression of DNMT1 and DNMT3B, which contribute to promoter hypermethylation of the miR-143/miR-145 cluster. Therefore, we infer that curcumin can restore miR-143 and miR-145 expression via hypomethylation. MiR-143 overexpression and curcumin pretreatment enhanced radiation induced cancer cell growth inhibition and apoptosis. MiR-143 and curcumin remarkably reduced radiation-induced autophagy in PC3 and DU145 cells. MiR-143 overexpression alone also reduced the basal level of autophagy in DU145 cells. Mechanistically, miR-143 can suppress autophagy in prostate cancer cells at least via downregulating ATG2B. Based on these findings, we infer that curcumin sensitizes prostate cancer cells to radiation partly via epigenetic activation of miR-143 and miR-143 mediated autophagy inhibition.

The queue-length in GI/G/s queues

Directory of Open Access Journals (Sweden)

Le Gall Pierre

2000-01-01

Full Text Available The distribution of the queue-length in the stationary symmetrical GI/G/s queue is given with an application to the M/G/s queue, particularly in the case of the combination of several packet traffics, with various constant service times, to dimension the buffer capacity.

Robustness and backbone motif of a cancer network regulated by miR-17-92 cluster during the G1/S transition.

Directory of Open Access Journals (Sweden)

Lijian Yang

Full Text Available Based on interactions among transcription factors, oncogenes, tumor suppressors and microRNAs, a Boolean model of cancer network regulated by miR-17-92 cluster is constructed, and the network is associated with the control of G1/S transition in the mammalian cell cycle. The robustness properties of this regulatory network are investigated by virtue of the Boolean network theory. It is found that, during G1/S transition in the cell cycle process, the regulatory networks are robustly constructed, and the robustness property is largely preserved with respect to small perturbations to the network. By using the unique process-based approach, the structure of this network is analyzed. It is shown that the network can be decomposed into a backbone motif which provides the main biological functions, and a remaining motif which makes the regulatory system more stable. The critical role of miR-17-92 in suppressing the G1/S cell cycle checkpoint and increasing the uncontrolled proliferation of the cancer cells by targeting a genetic network of interacting proteins is displayed with our model.

[Rapid expression and preparation of the recombinant fusion protein sTNFRII-gAD by adenovirus vector system].

Science.gov (United States)

Lu, Yue; Liu, Dan; Zhang, Xiaoren; Liu, Xuerong; Shen, Wei; Zheng, Gang; Liu, Yunfan; Dong, Xiaoyan; Wu, Xiaobing; Gao, Jimin

2011-08-01

We expressed and prepared the recombinant fusion protein sTNFRII-gAD consisted of soluble TNF receptor II and the globular domain of adiponectin by Adenovirus Vector System in mammalian BHK21c022 cells. First we used the adenovirus vector containing EGFP gene (rAd5-EGFP) to infect BHK21c022 cells at different MOI (from 0 to 1 000), and then evaluated their transduction efficiency and cytotoxicity. Similarly, we constructed the replication-deficient adenovirus type 5-sTNFRII-gAD (rAd5-sTNFRII-gAD). We collected the supernatants for Western blotting to determine the optimal MOI by comparing the expression levels of sTNFRII-gAD fusion protein, 48 h after the BHK21c022 cells were infected by rAd5-sTNFRII-gAD at different MOIs (from 0 to 1 000). Then, we chose rAd5-sTNFRII-gAD at MOI 100 to infect five bottles of BHK21c022 cells in 100 mL of serum-free chemically defined media 100 mL, harvested the supernatant every 48 h for 6 times, and condense and purify sTNFRII-gAD fusion protein by ammonium sulfate salt-out and size-exclusion chromatography, respectively. Finally, we analyzed anti-TNFalpha activity of sTNFRII-gAD fusion protein on L929 cells in vitro. The results showed that the number of BHK21c022 cells expressing EGFP protein was increased significantly with the increase of MOI. However, some cells died at MOI of 1 000 while there was no significant cytotoxicity at MOI from 0 to 100. Western blotting analysis showed that the more adenoviruses, the higher expression of sTNFRII-gAD fusion protein in the supernatant with the highest expression at MOI 1 000. We successfully obtained about 11 mg bioactive and purified sTNFRII-gAD fusion protein at last. The in vitro assay demonstrated that the sTNFRII-gAD fusion protein was potent to antagonize TNFalpha's cytotoxicity to L929 cells. Put together, we established a recombinant adenovirus vector/BHK21 cell expression system, characteristic of the efficient serum-free culture and easy scaling-up.

Pairing and Blocking in High-K Isomers: Variation of the Collective Parameter gR

Directory of Open Access Journals (Sweden)

Stone N.J.

2013-12-01

Full Text Available Using the principle of additivity, the quasi-particle contribution to magnetism in high-K isomers of Lu - Re has been estimated. Based on these estimates band structure branching ratio data is used to explore the behavior of the collective contribution as the number and neutron/proton nature (Np, Nn, of the quasi-particle excitations, change. A striking systematic variation of the collective g-factor gR with the difference, Np – Nn, is revealed. Basic ideas of pairing, its quenching by quasi-particle excitation and the consequent changes to moment of inertia and collective magnetism are discussed. The new found systematic behaviour of gR opens a fresh window on these effects amenable to detailed theoretical investigation.

b → s+γ and b → s+g in N=1 supergravity theories

International Nuclear Information System (INIS)

Masiero, A.; Ridolfi, G.

1988-01-01

We compute the b → s+γ and b → s+g decay rates in a spontaneously broken N=1 supergravity theory with radiative electroweak breaking. We find that the ARGUS result BR (B 0 → K 0* +γ) -4 implies lower bounds on the masses of the gluinos and the lightest down squark which are in the same region as those provided by the direct (unsuccessful) searches of UA1. An improvement on the existing limit of BR (b → s+γ) by an order of magnitude can certainly rule out values of squark and gluino masses which are still allowed by the UA1 bounds. (orig.)

Inconel 718 süper alaşımının farklı gerilme ve sıcaklıklarda yüksek sıcaklık sürünme davranışının incelenmesi

Directory of Open Access Journals (Sweden)

Ergün Subaşı

2016-04-01

Full Text Available Bu çalışmada, havacılıkta yaygın olarak kullanılan Inconel 718 süper alaşımının sürünme davranışına sıcaklık ve gerilmenin etkileri incelenmiştir. Deneyler; 750°C, 800°C sıcaklıklarında ve 200-350MPa gerilme aralığında gerçekleştirilmiştir. Deneysel çalışma sonuçlarından, gerilme üssü (n, sürünme hızı (έ ve aktivasyon enerjisi (Q hesaplanmıştır. Hesaplanan sonuçlara göre; sürünme hızlarının artan gerilme ile arttığı, ayrıca sıcaklığın artmasıyla birlikte sürünme hızları çok daha fazla artmaktadır. Aynı şekilde, artan gerilme ile birlikte aktivasyon enerjisi artmaktadır. Deney sonuçlarından elde edilen gerilme üssü değerlerine göre; etkin deformasyon mekanizmasının dislokasyon sürünmesi olduğu tespit edilmiştir. Inconel 718 süper alaşımının kopma sürünme ömrünü tahmin etmek için, Larson Miller grafiği çizilmiştir. Bu grafikle, Inconel 718’in yüksek sıcaklık sürünme ömürleri hesaplanabilir.

A highly sensitive fluorescence quenching method for perphenazine detection based on its catalysis of K{sub 2}S{sub 2}O{sub 8} oxidizing rhodamine 6G

Energy Technology Data Exchange (ETDEWEB)

Zhang, Lihong; Huang, Qitong; Lin, Changqing [Department of Food and Biological Engineering, Zhangzhou Institute of Technology, Zhangzhou, 363000 (China); Lin, Xiaofeng [College of Chemistry and Environment, Minnan Normal University, Zhangzhou, 363000 (China); Huang, Yiqun [Zhangzhou Affiliated Hospital of Fujian Medical University, Zhangzhou 363000 (China); Liu, Jiaming, E-mail: mnsdljm@163.com [College of Chemistry and Environment, Minnan Normal University, Zhangzhou, 363000 (China); Ma, Xudong, E-mail: maxudong005@hotmail.com [Zhangzhou Affiliated Hospital of Fujian Medical University, Zhangzhou 363000 (China)

2014-12-15

In this paper, the fluorescence spectra of Rhod 6G (rhodamine 6G)–K{sub 2}S{sub 2}O{sub 8}–PPH (perphenazine) were studied. We found that Rhod 6G existed in the form of Rhod 6G{sup +} under the conditions of 60 °C, 10 min and pH 5.42, and Rhod 6G{sup +} can emit strong and stable fluorescence. Further study showed that when PPH and Rhod 6G{sup +} coexisted, the ester exchange reaction carried out between -OH of PPH and -COOC{sub 2}H{sub 5} of Rhod 6G{sup +} to produced Rhod 6G{sup +}–PPH compound. More interestingly, K{sub 2}S{sub 2}O{sub 8} could oxidize Rhod 6G{sup +} and quench its RTP signal, while PPH was oxidized to red compound PPH′ by K{sub 2}S{sub 2}O{sub 8}, and Rhod 6G{sup +}–PPH′ and PPH were produced in the ester exchange reaction between the -OH of PPH′ and the -COOC{sub 2}H{sub 5} of Rhod 6G{sup +}–PPH. In the above process, PPH catalyzed K{sub 2}S{sub 2}O{sub 8} oxidizing Rhod 6G, which caused the fluorescence signal of the system to quench sharply. Hence, a catalytic fluorescence quenching method for the determination of residual PPH has been developed based on the its catalyzing K{sub 2}S{sub 2}O{sub 8} oxidize rhodamine 6G. This sensitive, accurate, simple and selective fluorescence quenching method was used to determine residual PPH in biological samples with the results consisting with those obtained by high performance liquid chromatography (HPLC), showing good accuracy. The structures of Rhod 6G{sup +}, PPH and Rhod 6G{sup +}–PPH were characterized by infrared spectra. The reaction mechanism of the determination of PPH was also discussed. - Highlights: • Fluorescence for the determination of perphenazine (PPH) had been established. • This method had high sensitivity (limit of detection was 3.3×10{sup −14} g mL{sup −1}). • This method had been applied to determination of PPH in biological samples. • Structures of Rhod 6G{sup +}, PPH and Rhod 6G{sup +}–PPH were characterized by infrared spectra. • Mechanism

Karasu (Sakarya Bölgesi Deniz Balıkçılarının Sosyo-Ekonomik Yapısı.

Directory of Open Access Journals (Sweden)

Selçuk Uzmanoğlu

2015-12-01

Full Text Available Bu çalışmada, Sakarya ili Karasu ilçesi deniz balıkçılarının sosyo-ekonomik yapısı incelenmiştir. Bu amaçla hazırlanan anket formları Temmuz 2004-Temmuz 2005 tarihleri arasında toplam dört kez bölgeye gidilerek uygulanmıştır. Karasu ilçesinde, deniz balıkçılığı yapan, Sakarya Tarım İl Müdürlüğü’ne kayıtlı 143 adet balıkçı teknesi mevcuttur. 36 balıkçı teknesi trol ve gırgır, 107 tekne ise 11.00 m den ufak diğer sınıfına ait ruhsata sahiptir. Balıkçıların yaş dağılımları, eğitim durumları, medeni durumları, eşlerinin eğitim ve iş durumu, çocukların eğitim durumları, avlanmanın hangi dönemlerde yapıldığı, toplam av günü sayısı, av sahasının limana olan uzaklığı, avlanan su ürünleri türleri, balıkçı teknelerinin özellikleri ve kullanılan av araçları incelenmiştir. Balıkçı teknelerinin boyu maksimum 22.00 m ve minimum 6.50 m, tekne yaşı maksimum 45 yıl ve minimum 2 yıl, avlanma süresi maksimum 240 gün ve minimum 30 gün olduğu; palamut, lüfer, barbunya, tekir, mezgit, istavrit, kalkan, kefal, tirsi, köpek balığı, vatoz, kum midyesi ve deniz salyangozunun ağırlıklı olarak avlandığı belirlenmiştir

Interaction between G Protein-Coupled Receptor 143 and Tyrosinase: Implications for Understanding Ocular Albinism Type 1.

Science.gov (United States)

De Filippo, Elisabetta; Schiedel, Anke C; Manga, Prashiela

2017-02-01

Developmental eye defects in X-linked ocular albinism type 1 are caused by G-protein coupled receptor 143 (GPR143) mutations. Mutations result in dysfunctional melanosome biogenesis and macromelanosome formation in pigment cells, including melanocytes and retinal pigment epithelium. GPR143, primarily expressed in pigment cells, localizes exclusively to endolysosomal and melanosomal membranes unlike most G protein-coupled receptors, which localize to the plasma membrane. There is some debate regarding GPR143 function and elucidating the role of this receptor may be instrumental for understanding neurogenesis during eye development and for devising therapies for ocular albinism type I. Many G protein-coupled receptors require association with other proteins to function. These G protein-coupled receptor-interacting proteins also facilitate fine-tuning of receptor activity and tissue specificity. We therefore investigated potential GPR143 interaction partners, with a focus on the melanogenic enzyme tyrosinase. GPR143 coimmunoprecipitated with tyrosinase, while confocal microscopy demonstrated colocalization of the proteins. Furthermore, tyrosinase localized to the plasma membrane when coexpressed with a GPR143 trafficking mutant. The physical interaction between the proteins was confirmed using fluorescence resonance energy transfer. This interaction may be required in order for GPR143 to function as a monitor of melanosome maturation. Identifying tyrosinase as a potential GPR143 binding protein opens new avenues for investigating the mechanisms that regulate pigmentation and neurogenesis. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

R S Khadayate

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. R S Khadayate. Articles written in Bulletin of Materials Science. Volume 30 Issue 2 April 2007 pp 129-133 Thin Films. Ethanol vapour sensing properties of screen printed WO3 thick films · R S Khadayate R B Waghulde M G Wankhede J V Sali P P Patil · More Details Abstract ...

Providing QoS guarantee in 3G wireless networks

Science.gov (United States)

Chuah, MooiChoo; Huang, Min; Kumar, Suresh

2001-07-01

The third generation networks and services present opportunities to offer multimedia applications and services that meet end-to-end quality of service requirements. In this article, we present UMTS QoS architecture and its requirements. This includes the definition of QoS parameters, traffic classes, the end-to-end data delivery model, and the mapping of end-to-end services to the services provided by the network elements of the UMTS. End-to-end QoS of a user flow is achieved by the combination of the QoS control over UMTS Domain and the IP core Network. In the Third Generation Wireless network, UMTS bearer service manager is responsible to manage radio and transport resources to QoS-enabled applications. The UMTS bearer service consists of the Radio Access Bearer Service between Mobile Terminal and SGSN and Core Network bearer service between SGSN and GGSN. The Radio Access Bearer Service is further realized by the Radio Bearer Service (mostly air interface) and Iu bearer service. For the 3G air interface, one can provide differentiated QoS via intelligent burst allocation scheme, adaptive spreading factor control and weighted fair queueing scheduling algorithms. Next, we discuss the requirements for the transport technologies in the radio access network to provide differentiated QoS to multiple classes of traffic. We discuss both ATM based and IP based transport solutions. Last but not least, we discuss how QoS mechanism is provided in the core network to ensure e2e quality of service requirements. We discuss how mobile terminals that use RSVP as QoS signaling mechanisms can be are supported in the 3G network which may implement only IETF diffserv mechanism. . We discuss how one can map UMTS QoS classes with IETF diffserv code points. We also discuss 2G/3G handover scenarios and how the 2G/3G QoS parameters can be mapped.

Hepatik Echinococcus multilocularis (alveolaris), olgu sunumu ve literatürün gözden geçirilmesi

OpenAIRE

ÖZİN, Yasemin; KILIÇ, Z. Mesut Yalın; PARLAK, Erkan; KAÇAR, Sabite; TURHAN, Nesrin; ŞAŞMAZ, Nurgül; ŞAHİN, Burhan

2008-01-01

Ekinokokkoz; köpeklerde yaşayan Echinococcus granulosus'un larva ve kist dönemlerinin insanlarda oluşturduğu hastalıktır. Kesin konakçı sı köpek, ara konakçısı koyun, sığır ve insandır. Yaygın olarak görülen ekinokokoz enfeksiyonlarından Echinococcus granulosus sorumlu iken Echinococcus alveolaris karaciğerdeki tüm ekinokokal lezyonların sadece %3'ünden sorumludur. Echinococcus alveolaris'in karaciğerde neden olduğu hastalık yavaş ilerleyen paraziter bir hastalıktır; ancak dokuya infiltrasyon...

Assessing the Impact of the Three-Year Ohio Teen B.R.I.D.G.E.S. AmeriCorps Program.

Science.gov (United States)

Safrit, R. Dale; Schmiesing, Ryan; King, Jeffrey E.; Villard, Judy; Wells, Betty

2003-01-01

Ohio Teen B.R.I.D.G.E.S (Building Responsibility In teen Drivers through Growth in self-Esteem and Safety) was evaluated using 12 focus groups. Program impacts included heightened awareness of vehicular safety issues among teens and communities, enhanced public speaking for youth volunteers, and meaningful leadership and volunteer opportunities…

Constructing National Unity. Commemorations of Tomáš G. Masaryk´s Death

Czech Academy of Sciences Publication Activity Database

Hájková, Dagmara

2012-01-01

Roč. 4, č. 1 (2012), s. 33-55 ISSN 1803-9243 R&D Projects: GA ČR GAP410/10/0544 Institutional research plan: CEZ:AV0Z70900502 Keywords : Masaryk, T. G. * Czechoslovakia, history * national identity Subject RIV: AB - History

Cell cycle G2/M arrest through an S phase-dependent mechanism by HIV-1 viral protein R.

Science.gov (United States)

Li, Ge; Park, Hyeon U; Liang, Dong; Zhao, Richard Y

2010-07-07

Cell cycle G2 arrest induced by HIV-1 Vpr is thought to benefit viral proliferation by providing an optimized cellular environment for viral replication and by skipping host immune responses. Even though Vpr-induced G2 arrest has been studied extensively, how Vpr triggers G2 arrest remains elusive. To examine this initiation event, we measured the Vpr effect over a single cell cycle. We found that even though Vpr stops the cell cycle at the G2/M phase, but the initiation event actually occurs in the S phase of the cell cycle. Specifically, Vpr triggers activation of Chk1 through Ser345 phosphorylation in an S phase-dependent manner. The S phase-dependent requirement of Chk1-Ser345 phosphorylation by Vpr was confirmed by siRNA gene silencing and site-directed mutagenesis. Moreover, downregulation of DNA replication licensing factors Cdt1 by siRNA significantly reduced Vpr-induced Chk1-Ser345 phosphorylation and G2 arrest. Even though hydroxyurea (HU) and ultraviolet light (UV) also induce Chk1-Ser345 phosphorylation in S phase under the same conditions, neither HU nor UV-treated cells were able to pass through S phase, whereas vpr-expressing cells completed S phase and stopped at the G2/M boundary. Furthermore, unlike HU/UV, Vpr promotes Chk1- and proteasome-mediated protein degradations of Cdc25B/C for G2 induction; in contrast, Vpr had little or no effect on Cdc25A protein degradation normally mediated by HU/UV. These data suggest that Vpr induces cell cycle G2 arrest through a unique molecular mechanism that regulates host cell cycle regulation in an S-phase dependent fashion.

Cell cycle G2/M arrest through an S phase-dependent mechanism by HIV-1 viral protein R

Directory of Open Access Journals (Sweden)

Liang Dong

2010-07-01

Full Text Available Abstract Background Cell cycle G2 arrest induced by HIV-1 Vpr is thought to benefit viral proliferation by providing an optimized cellular environment for viral replication and by skipping host immune responses. Even though Vpr-induced G2 arrest has been studied extensively, how Vpr triggers G2 arrest remains elusive. Results To examine this initiation event, we measured the Vpr effect over a single cell cycle. We found that even though Vpr stops the cell cycle at the G2/M phase, but the initiation event actually occurs in the S phase of the cell cycle. Specifically, Vpr triggers activation of Chk1 through Ser345 phosphorylation in an S phase-dependent manner. The S phase-dependent requirement of Chk1-Ser345 phosphorylation by Vpr was confirmed by siRNA gene silencing and site-directed mutagenesis. Moreover, downregulation of DNA replication licensing factors Cdt1 by siRNA significantly reduced Vpr-induced Chk1-Ser345 phosphorylation and G2 arrest. Even though hydroxyurea (HU and ultraviolet light (UV also induce Chk1-Ser345 phosphorylation in S phase under the same conditions, neither HU nor UV-treated cells were able to pass through S phase, whereas vpr-expressing cells completed S phase and stopped at the G2/M boundary. Furthermore, unlike HU/UV, Vpr promotes Chk1- and proteasome-mediated protein degradations of Cdc25B/C for G2 induction; in contrast, Vpr had little or no effect on Cdc25A protein degradation normally mediated by HU/UV. Conclusions These data suggest that Vpr induces cell cycle G2 arrest through a unique molecular mechanism that regulates host cell cycle regulation in an S-phase dependent fashion.

Plasma Membrane Density of GABA(B)-R1a, GABA(B)-R1b, GABA-R2 and Trimeric G-proteins in the Course of Postnatal Development of Rat Brain Cortex

Czech Academy of Sciences Publication Activity Database

Dlouhá, Kateřina; Kagan, Dmytro; Roubalová, Lenka; Ujčíková, Hana; Svoboda, Petr

2013-01-01

Roč. 62, č. 5 (2013), s. 547-559 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GAP207/12/0919; GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:67985823 Keywords : GABAB-receptors * postnatal development * rat brain cortex * G-proteins * Na, K- ATPase Subject RIV: CE - Biochemistry Impact factor: 1.487, year: 2013

A személyiség kaizen-elve

OpenAIRE

Titkos, Csaba

2009-01-01

A cikk a képzés és a fejlesztés területének sajátos, új szeletével foglalkozik. A tréningmódszer kompetenciahatárát, érvényességét tisztázva rámutat a személyiségfejlesztés, a személyiség átdolgozásának fontosságára és módszertani lehetőségeire. A szerző feltevése szerint az érett személyiség, mint a jungi individuációs processzus terméke, viselkedést meghatározó kompetencia. Van, hogy oktatni kell, máskor tréningezni, olykor a viselkedésváltozás hiánya, a kudarc miatt a viselkedé...

Definition of IgG- and albumin-binding regions of streptococcal protein G.

Science.gov (United States)

Akerström, B; Nielsen, E; Björck, L

1987-10-05

Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

Versenyképesség a szakirodalomban – A fogalmi megközelítések összegzése és elemzése (I. rész)

OpenAIRE

Somogyi, Márta

2009-01-01

A szerző jelen tanulmányában a versenyképesség fogalma körül kialakult megközelítéseket veszi sorra és hasonlítja össze. A versenyképességi fogalmakat, értelmezéseket – a lehetőségekhez képest – időbeli kialakulásuk, megfogalmazásuk sorrendjében mutatja be; ez a megközelítés ugyanis lehetőséget biztosít arra, hogy a fogalom időbeli alakulását (fejlődését, bővülését) is nyomon követhesse. Teszi mindezt azzal a szándékkal, hogy a megismert fogalmak, megközelítési módok és értelmezés...

A new photometric metal abundance and luminosity calibration for field G and K giants

International Nuclear Information System (INIS)

Jennens, P.A.; Helfer, H.L.

1975-01-01

Photometry of 260 G and K giants, using a fast broad-intermediate band photometric system (UBViyz system) is used to calibrate chemical composition, Fe/H], luminosity, Mv and colour excess, E(B-V). A single S-20 surface photomultiplier is used. The UBVi photometry is transformed to be on the Johnson UBVRI system. Calibrations applicable to the ranges 0.40< R-I<0.65 (G2-K3), 0.65< R-I<0.90 (K3-K5) are given. A photometric luminosity index, Mv(yz), is derived for which rms errors are +-1 mag. Several indices are calibrated for chemical composition, [Fe/H], and typical rms errors of +-0.15 in [Fe/H] are obtained for stars of known colour excess, E(B-V). For stars of unknown colour excess, E(B-V) is determined with an rms error of +-0.06 and [Fe/H] with an rms error of approximately +-0.4. For stars with Mv-1, the errors are larger. (author)

α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

International Nuclear Information System (INIS)

Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

1988-01-01

cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

Essai de caractérisation sédimentologique et géochimique des ...

African Journals Online (AJOL)

Ivoire (Afrique de l'Ouest) ... Les études réalisées dans ce travail portent sur la caractérisation sédimentologique et géochimique des dépôts argileux dénommés black .... subsidence (Campanien – Maastrichtien) qui dépose en transgression des ...

Diagonal K-matrices and transfer matrix eigenspectra associated with the G(1)2 R-matrix

International Nuclear Information System (INIS)

Yung, C.M.; Batchelor, M.T.

1995-01-01

We find all the diagonal K-matrices for the R-matrix associated with the minimal representation of the exceptional affine algebra G (1) 2 . The corresponding transfer matrices are diagonalized with a variation of the analytic Bethe ansatz. We find many similarities with the case of the Izergin-Korepin R-matrix associated with the affine algebra A (2) 2 . ((orig.))

Synthesis and evaluation of MoWCoS/G and MoWCuS/G as new transition metal dichalcogenide nanocatalysts for electrochemical hydrogen evolution reaction

Science.gov (United States)

Askari, Mohammad Bagher; Beheshti-Marnani, Amirkhosro; Banizi, Zoha Tavakoli; Seifi, Majid; Ramezan zadeh, Mohammad Hassan

2018-01-01

New nanocomposites based on transition metal dichalcogenides, MoWCoS and MoWCuS, were synthesized through one step hydrothermal method. X-ray diffraction (XRD) and energy dispersive X-ray (EDX) techniques as well as field emission scanning electron microscopy (FESEM) and transmission electron microscopy (TEM) images confirmed the synthesis of nanocomposites. For investigation of hydrogen evolution reaction (HER) properties of new nanocomposites, linear sweep voltammetry (LSV) was applied for this purpose. According to the results of similar previous works, the prepared nanocomposites showed promising HER properties as low overpotential equal to 41.4 mV/dec for MoWCoS hybridized with reduced graphene (G) and a little higher one equal to 49 mV/dec for MoWCuS hybridized with reduced graphene. Based on obtained Tafel slopes 38 and 53 mV/dec for MoWCoS/G and MoWCuS/G, respectively, the "Heyrovsky-Volmer" mechanism was suggested for the new HER three component nanocatalysts as the first effort to this purpose.

Structure of the (0+,1+) mesons Bs0 and Bs1, and the strong coupling constant gBs0BK and gBs1B*K

International Nuclear Information System (INIS)

Wang, Z. G.

2008-01-01

In this article, we take the point of view that the bottomed (0 + ,1 + ) mesons B s0 and B s1 are the conventional bs meson and calculate the strong coupling constants g B s0 BK and g B s1 B*K with the light-cone QCD sum rules. The numerical values of strong coupling constants g B s1 B*K and g B s0 BK are very large and support the hadronic dressing mechanism. Just like the scalar mesons f 0 (980), a 0 (980), D s0 and axial-vector meson D s1 , the (0 + ,1 + ) bottomed mesons B s0 and B s1 may have small bs kernels of the typical bs meson size. The strong couplings to the hadronic channels (or the virtual mesons loops) may result in smaller masses than the conventional bs mesons in the potential quark models and enrich the pure bs states with other components.

Analyses of {ital D}{sup +}{r_arrow}{ital K}{sup 0}{sub {ital S}}{ital K}{sup +} and {ital D}{sup +}{r_arrow}{ital K}{sup 0}{sub {ital S}}{pi}{sup +}

Energy Technology Data Exchange (ETDEWEB)

Bishai, M.; Fast, J.; Gerndt, E.; Hinson, J.; Menon, N.; Miller, D.; Shibata, E.; Shipsey, I.; Yurko, M.; Kwak, N. [Purdue University, West Lafayette, Indiana 47907 (United States); Gibbons, L.; Johnson, S.; Kwon, Y.; Roberts, S.; Thorndike, E. [University of Rochester, Rochester, New York 14627 (United States); Jessop, C.; Lingel, K.; Marsiske, H.; Perl, M.; Schaffner, S.; Ugolini, D.; Wang, R.; Zhou, X.; Severini, H.; Wappler, F. [Stanford Linear Accelerator Center, Stanford University, Stanford, California 94309 (United States); Coan, T.; Fadeyev, V.; Korolkov, I.; Maravin, Y.; Narsky, I.; Shelkov, V.; Staeck, J.; Stroynowski, R.; Volobouev, I.; Ye, J. [Southern Methodist University, Dallas, Texas 75275 (United States); Artuso, M.; Efimov, A.; Frasconi, F.; Gao, M.; Goldberg, M.; He, D.; Kopp, S.; Moneti, G.; Mountain, R.; Mukhin, Y.; Schuh, S.; Skwarnicki, T.; Stone, S.; Viehhauser, G.; Xing, X. [Syracuse University, Syracuse, New York 13244 (United States); Bartelt, J.; Csorna, S.; Jain, V.; Marka, S. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Freyberger, A.; Gibaut, D.; Godang, R.; Kinoshita, K.; Lai, I.; Pomianowski, P.; Schrenk, S. [Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061 (United States); Bonvicini, G.; Cinabro, D.; Greene, R.; Perera, L. [Wayne State University, Detroit, Michigan 48202 (United States); Barish, B.; Chadha, M.; Chan, S.; Eigen, G.; Miller, J.; OGrady, C.; Schmidtler, M.; Urheim, J.; Weinstein, A.; Wuerthwein, F. [California Institute of Technology, Pasadena, California 91125 (United States); Asner, D.; Bliss, D.; Brower, W.; Masek, G.; Paar, H.; Sharma, V. [University of California, San Diego, La Jolla, California 92093 (United States); Gronberg, J.; Kutschke, R.; Lange, D.; Menary, S.; Morrison, R.; Nelson, H.; Nelson, T.; Qiao, C.; Richman, J.; Roberts, D.; Ryd, A.; Witherell, M. [University of California, Santa Barbara, California 93106 (United States)

1997-04-01

Using data collected with the CLEO II detector at the Cornell Electron Storage Ring, we present new measurements of the branching fractions for D{sup +}{r_arrow}K{sub S}K{sup +} and D{sup +}{r_arrow}K{sub S}{pi}{sup +}. These results are combined with other CLEO measurements to extract the ratios of isospin amplitudes and phase shifts for D{r_arrow}KK and D{r_arrow}K{pi}. {copyright} {ital 1997} {ital The American Physical Society}

NOUVELLES ETUDES CONCERNANT L’ALIMENTARITE : Evaluation de la sécurité des aliments issus d’organismes génétiquement modifiés : acquis et incertitudes

Directory of Open Access Journals (Sweden)

Besançon Pierre

2000-07-01

Full Text Available Une très grande variété de produits alimentaires issus d’organismes génétiquement modifiés sont proposés - ou susceptibles de l’être - à la consommation humaine, puisque les techniques du génie génétique sont applicables aussi bien aux micro-organismes qu’aux végétaux et aux animaux. La plupart d’entre eux sont considérés comme de nouveaux aliments ou de nouveaux ingrédients alimentaires et relèvent du règlement européen EC 258-97 [1]. À ce titre, l’évaluation de leur innocuité s’impose.

Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

Science.gov (United States)

Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

2008-01-15

The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

G.P.S. Occhialini 1907-93

International Nuclear Information System (INIS)

Peyrou, C.

1994-01-01

G.P.S. Occhialini, a legendary figure for all who remember the very beginnings of cosmic ray particle physics, died on 30 December. Born on 5 December 1907 in Rossombrone, near Urbino, he studied in Florence. Here he met Bruno Rossi, whom, although only two years his senior, he always regarded as a master. In 1932 Occhialini went to Cambridge where he worked with P.M.S. Blackett. They invented and perfected the counter-triggered Wilson chamber technique, recording cascade showers which confirmed the existence of the positron, discovered slightly earlier by Anderson, and demonstrating its symmetry with the electron

X-ray diffraction using synchrotron radiation on the G.I.L.D.A. beam line at the E.S.R.F

Energy Technology Data Exchange (ETDEWEB)

Balerna, A [INFN, Laboratori Nazionali di Frascati, Rome (Italy); Meneghini, C [INFN, Laboratori Nazionali di Frascati, Rome (Italy); [INFM, Genoa (Italy); Bordoni, S [Rome Univ. ` Tor Vergata` (Italy). Dip. di Fisica; Mobilio, S [Rome Univ. III (Italy). Dip. di Fisica ` E. Amaldi`

1996-09-01

The aim of this lecture is to make a short introduction on Synchrotron radiation, its history and main properties. The main components of a synchrotron radiation beam line will be described. The Italian beam line, General purpose Italian beam line Line for Diffraction and Absorption (G.I.L.D.A.) at the European Synchrotron Radiation Facility (E.S.R.F.) in Grenoble will be used as an example. The G.I.L.D.A. diffractometer will be described in detail reporting also some experimental results.

Disease-Causing Mutations in the G Protein Gαs Subvert the Roles of GDP and GTP.

Science.gov (United States)

Hu, Qi; Shokat, Kevan M

2018-05-17

The single most frequent cancer-causing mutation across all heterotrimeric G proteins is R201C in Gαs. The current model explaining the gain-of-function activity of the R201 mutations is through the loss of GTPase activity and resulting inability to switch off to the GDP state. Here, we find that the R201C mutation can bypass the need for GTP binding by directly activating GDP-bound Gαs through stabilization of an intramolecular hydrogen bond network. Having found that a gain-of-function mutation can convert GDP into an activator, we postulated that a reciprocal mutation might disrupt the normal role of GTP. Indeed, we found R228C, a loss-of-function mutation in Gαs that causes pseudohypoparathyroidism type 1a (PHP-Ia), compromised the adenylyl cyclase-activating activity of Gαs bound to a non-hydrolyzable GTP analog. These findings show that disease-causing mutations in Gαs can subvert the canonical roles of GDP and GTP, providing new insights into the regulation mechanism of G proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

[18S-25S rDNA variation in tissue culture of some Gentiana L. species].

Science.gov (United States)

Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

2007-01-01

18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

Design, fabrication, commissioning, and testing of a 250 g/s, 2-K helium cold compressor system

International Nuclear Information System (INIS)

V. Ganni; D. M. Arenius; B. S. Bevins; W. C. Chronis; J. D. Creel; J. D. Wilson Jr.

2002-01-01

In June 1999 the Thomas Jefferson National Accelerator Facility (TJNAF) Cryogenic Systems Group had completed the design, fabrication, and commissioning of a cold compressor system capable of pumping 250 g/s of 2-K helium vapor to a pressure above 1 bar. The 2-K cold box consists of five stages of centrifugal variable speed compressors with LN2 cooled drive motors and magnetic bearings, a plate fin heat exchanger, and an LN2 shield system. The new 2-K cold box (referred to as the SCN) was built as a redundant system to an existing four stage cold compressor SCM cold box that was commissioned in May 1994. The SCN has been in continuous service supporting the facility experiments since commissioning. This system has achieved a significant improvement in the total 2-K refrigeration system capacity and stability and has substantially increased the operating envelope both in cold compressor flow and operating pressure range. This paper describes the cold box configuration and the experience s in the design, fabrication, commissioning and performance evaluation. The capacity of the system for various operating pressures (0.040 to 0.025 bar at the load corresponding to a total compressor pressure ratio of 28 to 54) is presented. An effort is made to characterize the components and their operating data over the tested range. This includes the return side pressure drop in the distribution system, the heat exchanger, and the cold compressor characteristics. The system design parameters and their effects on performance are outlined

PCNA is recruited to irradiated chromatin in late S-phase and is most pronounced in G2 phase of the cell cycle

Czech Academy of Sciences Publication Activity Database

Bártová, Eva; Suchánková, Jana; Legartová, Soňa; Malyšková, Barbora; Hornacek, M.; Skalníková, M.; Mašata, M.; Raška, I.; Kozubek, Stanislav

2017-01-01

Roč. 254, č. 5 (2017), s. 2035-2043 ISSN 0033-183X R&D Projects: GA ČR GBP302/12/G157; GA MŠk 7F14369 Institutional support: RVO:68081707 Keywords : nuclear antigen pcna * excision dna-repair * homologous recombination * replication Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 2.870, year: 2016

TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

Science.gov (United States)

H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

2014-06-01

The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

Derivation of the Verlinde formula from Chern-Simons theory and the G/G model

International Nuclear Information System (INIS)

Blau, M.; Thompson, G.

1993-01-01

We give a derivation of the Verlinde formula for the G k WZW model from Chern-Simons theory, without taking recourse to CFT, by calculating explicitly the partition function Z ΣxS 1 of Σ x S 1 with an arbitrary number of labelled punctures. By what is essentially a suitable gauge choice, Z ΣxS 1 is reduced to the partition function of an abelian topological field theory on Σ (a deformation of non-abelian BF and Yang-Mills theory) whose evaluation is straightforward. This relates the Verlinde formula to the Ray-Singer torsion of Σ x S 1 . We derive the G k /G k model from Chern-Simons theory, proving their equivalence, and give an alternative derivation of the Verlinde formula by calculating the G k /G k path integral via a functional version of the Weyl integral formula. From this point of view the Verlinde formula arises from the corresponding jacobian, the Weyl determinant. Also, a novel derivation of the shift k → k + h is given, based on the index of the twisted Dolbeault complex. (orig.)

Impact of DNA demethylation of the G0S2 gene on the transcription of G0S2 in squamous lung cancer cell lines with or without nuclear receptor agonists

International Nuclear Information System (INIS)

Kusakabe, Masashi; Watanabe, Kousuke; Emoto, Noriko; Aki, Naomi; Kage, Hidenori; Nagase, Takahide; Nakajima, Jun; Yatomi, Yutaka; Ohishi, Nobuya; Takai, Daiya

2009-01-01

We recently identified that DNA methylation of the G0S2 gene was significantly more frequent in squamous lung cancer than in non-squamous lung cancer. However, the significance of G0S2 methylation levels on cancer cells is not yet known. We investigated the effect of G0S2 methylation levels on cell growth, mRNA expression, and chromatin structure using squamous lung cancer cell lines and normal human bronchial epithelial cells. DNA methylation and mRNA expression of G0S2 were inversely correlated, and in one of the squamous lung cancer cell lines, LC-1 sq, G0S2 was completely methylated and suppressed. Overexpression of G0S2 in LC-1 sq did not show growth arrest or apoptosis. The G0S2 gene has been reported to be a target gene of all-trans retinoic acid and peroxisome proliferator-activated receptor agonists. We treated LC-1 sq with 5-Aza-2'-deoxycytidine, Trichostatin A, all-trans retinoic acid, Wy 14643, or Pioglitazone either alone or in combination. Only 5-Aza-2'-deoxycytidine restored mRNA expression of G0S2. Chromatin immunoprecipitation revealed that histone H3 lysine 9 was methylated regardless of DNA methylation or mRNA expression. In summary, mRNA expression of G0S2 was regulated mainly by DNA methylation in squamous lung cancer cell lines. When the G0S2 gene was methylated, nuclear receptor agonists could not restore mRNA expression of G0S2 and did not show any additive effect on mRNA expression of G0S2 even after the treatment with 5-Aza-2'-deoxycytidine.

[Evaluation of immune status of kidney transplant recipients by combined HLA-G5 and sCD30].

Science.gov (United States)

JIN, Zhan-kui; TIAN, Pu-xun; XUE, Wu-jun; DING, Xiao-ming; PAN, Xiao-ming; DING, Chen-guang; JIA, Li-ning; GE, Guan-qun; HAO, Jun-jun

2010-09-28

to study the relationship between the expression of serum human leucocyte antigen-G5 (HLA-G5)/soluble CD30 (sCD30) and the function of renal graft in kidney transplant recipients and investigate the immune status of recipients with combined HLA-G5 and sCD30. from January 2002 to November 2008, a total of 66 kidney transplant recipients in our centre were selected as subjects and divided into three groups: stable function of renal graft (n = 38), acute rejection (n = 15) and chronic rejection (n = 13). The expressions of serum HLA-G5 and sCD30 were detected. There were two different immune conditions with acute/chronic allograft rejection and normal renal graft in kidney transplant recipients as evaluated by combined HLA-G5 and sCD30. The sensitivity, specificity and critical value of the method were analyzed by the curve of receiver operating characteristic. the levels of HLA-G5 and sCD30 were significantly correlated with serum creatinine (r = -0.493, 0.691, both P transplantation, the sensitivity was 78.6% and the specificity 85.7% when HLA-G5 critical value 82 microg/L and sCD30 critical value 12.2 microg/L. After one year post-transplantation: the sensitivity was 92.3% and the specificity 84.6% when HLA-G5 critical value 141 microg/L and sCD30 critical value 10.3 microg/L. the immune state of recipients are evaluated by combine HLA-G5 and sCD30 which may be a simple and valid method.

Fine structure of the 1s5f and 1s5g levels of He I

International Nuclear Information System (INIS)

Kriescher, Y.; Hilt, O.; Oppen, G. v.

1994-01-01

The fine structure of the 1s 5f and 1s 5g levels of He I was measured using microwave spectroscopy. The helium atoms were excited by ion impact, and the eleven allowed 1s 5f 2S+1 F J -1s 5g 2S'+1 G J , transitions near ν∼15 GHz were induced and detected by measuring the 1s 4d-1s 2p or 1s 3d-1s 2p spectral-line intensities of the impact radiation as a function of the microwave frequency. The measured transition frequencies are in accord with theoretical values and, except for one transition frequency, with earlier experimental data. The existing discrepancy between these earlier data and theory could be solved. (orig.)

Role of polyamines at the G1/S boundary and G2/M phase of the cell cycle.

Science.gov (United States)

Yamashita, Tomoko; Nishimura, Kazuhiro; Saiki, Ryotaro; Okudaira, Hiroyuki; Tome, Mayuko; Higashi, Kyohei; Nakamura, Mizuho; Terui, Yusuke; Fujiwara, Kunio; Kashiwagi, Keiko; Igarashi, Kazuei

2013-06-01

The role of polyamines at the G1/S boundary and in the G2/M phase of the cell cycle was studied using synchronized HeLa cells treated with thymidine or with thymidine and aphidicolin. Synchronized cells were cultured in the absence or presence of α-difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, plus ethylglyoxal bis(guanylhydrazone) (EGBG), an inhibitor of S-adenosylmethionine decarboxylase. When polyamine content was reduced by treatment with DFMO and EGBG, the transition from G1 to S phase was delayed. In parallel, the level of p27(Kip1) was greatly increased, so its mechanism was studied in detail. Synthesis of p27(Kip1) was stimulated at the level of translation by a decrease in polyamine levels, because of the existence of long 5'-untranslated region (5'-UTR) in p27(Kip1) mRNA. Similarly, the transition from the G2/M to the G1 phase was delayed by a reduction in polyamine levels. In parallel, the number of multinucleate cells increased by 3-fold. This was parallel with the inhibition of cytokinesis due to an unusual distribution of actin and α-tubulin at the M phase. Since an association of polyamines with chromosomes was not observed by immunofluorescence microscopy at the M phase, polyamines may have only a minor role in structural changes of chromosomes at the M phase. In general, the involvement of polyamines at the G2/M phase was smaller than that at the G1/S boundary. Copyright © 2013 Elsevier Ltd. All rights reserved.

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

Science.gov (United States)

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-10-15

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ahlaki sıkıntı: Türkiye’de sağlık alanında gündeme gelmeyen bir boyut

OpenAIRE

Gülay Yıldırım; Dilek Özden; Şerife Karagözoğlu

2013-01-01

Özet Ahlaki sıkıntı (moral distres) sağlık bakım alanlarında çalışan profesyoneller ve yöneticilerde yaygın olarak yaşanan bir problemdir. Ahlaki sıkıntı, bir profesyonelin yapılacak doğru eylemi bildiği halde engeller nedeniyle doğru eylemi gerçekleştirememesi durumunda yaşadığı bir sıkıntıdır. Bireysel ve kurumsal birçok durumun neden olduğu ahlaki sıkıntı, sağlık profesyonellerinde öfke ve engellenme duygusundan iş doyumunda azalmaya, tükenmişlik ve meslekten ayrılmaya kadar önemli sonuçla...

Pengembangan Game Edukatif G30S/PKI Berbasis Android

Directory of Open Access Journals (Sweden)

Annisa Hedlina Hendraputri

2014-11-01

Full Text Available Gaya hidup masyarakat zaman sekarang tak pernah lepas dari kemajuan teknologi. Masyarakat menengah keatas, baik dari anak-anak hingga orang dewasa, hampir tidak ada yang tidak meggunakan perangkat mobile seperti handphone atau tablet. Namun sayangnya masyarakat zaman sekarang cenderung apatis dengan kondisi sekitarnya, bahkan tidak mengenal sejarah negaranya. Penelitian ini dilakukan untuk mendekatkan kembali anak-anak dengan sejarah terutama peristiwa G30S/PKI melalui game perangkat seluler berbasis Android. Penelitian ini dilakukan dengan menerapkan tahap pengembangan MDLC (Multimedia Development Life Cycle mulai dari tahap penentuan konsep sampai dengan sidtribusi. Sebagai sumber yang relevan, cerita sejarah diambil langsung dari Monumen Pancasila Sakti di Lubang Buaya, Jakarta Timur, sebagai salah satu tempat bersejarah yang erat kaitannya dengan peristiwa G30S/PKI. Hasil dari penelitian ini berupa suatu aplikasi permainan yang menceritakan peristiwa sejarah G30S/PKI yang dikemas menjadi aplikasi perangkat seluler dengan sistem operasi Android. Penelitian ini diharapkan mampu menarik minat anak-anak khususnya usia 9 sampai dengan 12 tahun untuk mempelajari dan mencintai sejarah Indonesia.

The DNA Replication Checkpoint Directly Regulates MBF-Dependent G1/S Transcription▿

OpenAIRE

Dutta, Chaitali; Patel, Prasanta K.; Rosebrock, Adam; Oliva, Anna; Leatherwood, Janet; Rhind, Nicholas

2008-01-01

The DNA replication checkpoint transcriptionally upregulates genes that allow cells to adapt to and survive replication stress. Our results show that, in the fission yeast Schizosaccharomyces pombe, the replication checkpoint regulates the entire G1/S transcriptional program by directly regulating MBF, the G1/S transcription factor. Instead of initiating a checkpoint-specific transcriptional program, the replication checkpoint targets MBF to maintain the normal G1/S transcriptional program du...

Sağlık ve Beslenme Açısından Sebzelerin Önemi

Directory of Open Access Journals (Sweden)

Atilla Eriş

2015-02-01

Full Text Available Sağlıklı bir yaşam için en önemli faktör dengeli beslenmedir. Bu ise, gerek hayvansal gerek bitkisel besin maddelerinden bilinçli biçimde yararlanmakla sağlanır. Tek taraflı bir beslenme insan metabolizmasında çok kısa sürede anormalliklere yol açar ve fizyolojik dengeyi bozar. İnsan büyümesi, gelişmesi ve yaşamındaki bir çok fonksiyonun etkilendiği beslenme olayı üzerinde dururken; bitkisel besin maddelerinden sebzelere özel bir yer vermek gerekir. Esas olarak besinlerin değerlendirilmesi, bunların kapsadıkları kimyasal öğelere göre yapılır. Böylece bir kimsenin vücudunun gereksinimleri de biyokimyasal kavramlarla saptanabilir. Sebzelerin bünyesinde temel besin maddelerinden karbonhidratlar, proteinler, yağlar, madensel maddeler, vitaminler ve su bulunur. Genel olarak 100 g sebzenin bünyesinde karbonhidrat 2.2-28.2 g; protein 0.6-7.0 g; yağ 0.1-1.3 g; madensel maddelerden demir 0.2-12.7 mg; kalsiyum 6-392 mg arasında bulunur. Keza vitamin yönünden oldukça zengin olmaları, sebzelerin temeldeki değerini bir kat daha arttırmaktadır. Bu konudaki veriler Cetvel 2’de görülmektedir. Özellikle A, B, C, E, K ve PP vitaminlerince zengin olan sebzelerin bu vitaminlerinden gereği gibi yararlanmak için bozulmamalarına dikkat etmek gerekir. Bunun için sebzelerin hasadından taze tüketimine kadar geçen süreyi oldukça kısa tutmalıdır. Sebzeler pişirilerek yenecek ise, sularını atmamalı ve kızartmamalıdır. Özellikle haşlama olarak veya buğday pişirilmelidir. Taze olarak veya işlenecek tüketimde sebzeleri fazla hırpalamamalıdır. Böylece olanaklar içinde vitaminlerden daha çok yararlanılabilir. Sebzelerin beslenme ve sağlık için gerekli olmalarının nedenlerini de şöyle sıralayabiliriz. a Vitamin kapsamları geniştir, b Madensel maddeler yönünden vücudun gereksinimini karşılarlar, c Az miktarda kalori sağladıklarından genellikle kilo aldırmazlar, d İştah a

Synthesis and characterization of CdS and CdSe nanoparticles ...

Indian Academy of Sciences (India)

Administrator

hare L B, Jain V K, Phadnis P P and Nethaji M 2006. Dalton Trans. 2714; (f) Kedarnath G, Jain V K, Gho- shal S, Dey G K, Ellis C A and Tiekink E R T 2007. Eur. J. Inorg. Chem. 1566; (g) Kedarnath G, Dey S,. Jain V K, Dey G K and Varghese B 2006 Polyhedron. 25 2383. 4. Mugesh G, Singh H B and Butcher R J 1999 Eur. J.

Orman yangınları açısından riskli yılların güneş leke döngüsüne bağlı olarak önceden tahmin edilebilmesi

Directory of Open Access Journals (Sweden)

Yüksek Lisans Uğur Baltacı

2017-11-01

Full Text Available Ülkemizde ve dünya genelinde, bazı yıllar daha çok sayıda ve büyük ölçekte orman yangınları görülmekte iken, bazı yıllarda orman yangını sayısı ve büyüklüğü azalmaktadır. Orman yangını istatistikleri yangın adedi ve yanan alan olarak zamana bağlı grafik haline dönüştürüldüğünde, minimum ve maksimum noktaları farklı sinüzoidal eğriler şeklinde periyodik bir dalgalanma görülmektedir. Bu durum, orman yangınlarının bir dış etkene bağlı olarak artıp azaldığını gösterebilir. Bu çalışmamızda; adet ve alan olarak orman yangınları ile Güneş Leke Döngüsü (Güneş Radyasyon Döngüsü karşılaştırılmış ve aralarında güçlü bir ilişkinin olduğu bulunmuştur. Çalışma sonucunda elde edilen bulgular, orman yangını açısından riski yüksek yılların tahmininde kullanılabilecektir. Orman yangınları ile mücadelede orta ve uzun vadeli programlar yapılırken bu tespitlerin göz önünde bulundurulmasının büyük önem arz ettiği düşünülmektedir. Özellikle bütçe planlamaları ve önceden alınacak tedbirler açısından bu öngörülerin dikkate alınması uygun olacaktır.

Ergenlerde Ana-Babaya Bağlanma Örüntüsünün Benlik Saygısı ve Yalnızlık ile İlişkisi

OpenAIRE

Kaya, Şule

2017-01-01

Bu çalışmada ergenlerin ana babalarına bağlanma biçimlerinin benlik saygısı ve yalnızlık üzerinde etkisi olup olmadığının incelenmesi amaçlanmıştır. Çalışmaya Özel Sultan Fatih Lisesi 9, 10, ve 11. sınıflarında öğrenim görmekte olan 50 kız, 50 erkek öğrenci katılmıştır. Araştırmada Ana Babaya Bağlanma Ölçeği (Parental Bonding Instrument, PBI), CSEI (Coopersmith Seif Esteem lnventory) Coopersmith Benlik Saygısı Ölçeği’ nin 25 maddelik kısa formu, UCLA Yalnızlık Ölçeği (UCLA Loneliness Scale) k...

A földpiaci sajátosságok és tendenciák

OpenAIRE

Kurucz, Adrienn

2010-01-01

Az elmúlt években ugyan emelkedtek a hazai földárak, de az uniós csatlakozástól várt jelentős árnövekedés és földpiaci forgalomélénkülés elmaradt, sőt, a bérleti díjakban sem hozott átütő fordulatot. A közelmúltban erősödött a magyarországi földpiac megmozdulását várók tábora, a 2011 májusában lejáró derogáció miatt. A szakemberek optimisták, mert a lejáró derogációval kiszélesedhet a vásárlói kör. A hazai agrárgazdaság egyik legnagyobb gondja a tőkehiány, ami akadályozza a technikai és techn...

A kettős adóztatás elkerüléséről szóló korai magyar egyezmények = Earlier tax treaties of Hungary

OpenAIRE

Kolozs, Borbála

2012-01-01

Ennek a dolgozatnak az a célja, hogy bemutassa Magyarország történeti kettős adóztatás elkerüléséről szóló egyezményeit. A bevezetés, az első és a második fejezet a nemzetközi adózással kapcsolatos alapfogalmakat tisztázza. A harmadik fejezet Magyarország XVII-XVIII. századi gazdasági és politikai helyzetét írja le. Az ezt követő fejezetek a világháborúk előtti, közötti és utánuk következő időszak adóegyezményeinek történetével foglalkoznak. Az egyik fejezet a KGST tagállamok által kötött ket...

Evolution du génome des Streptomyces : transfert horizontal et variabilité des extrémités chromosomiques

OpenAIRE

Choulet, Frédéric

2006-01-01

L'analyse et la comparaison des génomes permettent d'appréhender les forces évolutives à la base de leur dynamique et les contraintes qui s'opposent à la variabilité. Chez les bactéries, le transfert horizontal joue un rôle majeur dans leur diversification. Ce travail traite de l'évolution du génome des Streptomyces qui sont des bactéries du sol responsables de la biosynthèse d'une très grande diversité de composés actifs. Leur intérêt applicatif est considérable et touche des domaines variés...

Projecto de rede de distribuição de gás natural

OpenAIRE

Marques, Pedro Daniel Relvas Dias

2014-01-01

O gás natural foi introduzido em Portugal em 1997. Desde essa data, a estrutura de consumo de gás natural evidencia que, logo após o sector da produção de electricidade, é o sector industrial que regista o maior consumo de gás natural. O consumo de gás natural reduz de forma significativa as emissões de CO2 para a atmosfera, em comparação com outros combustíveis fósseis (p. ex.: carvão, nafta), pois é uma energia mais limpa e menos poluente. Apresenta também a vantagem ser ener...

O gênero Eleocharis R. Br. (Cyperaceae no Rio Grande do Sul, Brasil

Directory of Open Access Journals (Sweden)

Ilsi Iob Boldrin

2008-02-01

Full Text Available O estudo taxonômico do gênero Eleocharis R. Br. para o Rio Grande do Sul foi desenvolvido através dos métodos tradicionais em taxonomia. Os dados foram obtidos através da bibliografia, revisão de herbários regionais e coleta de exemplares a campo. O gênero está representado no Rio Grande do Sul por 27 espécies: Eleocharis acutangula (Roxb. Schult., E. bonariensis Nees, E. contracta Maury, E. dunensis Kük., E. elegans (Kunth Roem. & Schult., E. filiculmis Kunth, E. flavescens (Poir. Urb., E. geniculata (L. Roem. & Schult., E. interstincta (Vahl Roem. & Schult., E. laeviglumis R. Trevis. & Boldrini, E. loefgreniana Boeck., E. maculosa (Vahl Roem. & Schult., E. minima Kunth var. minima, E. montana (Kunth Roem. & Schult., E. montevidensis Kunth, E. nudipes (Kunth Palla, E. obtusetrigona (Lindl. & Nees Steud., E. parodii Barros, E. quinquangularis Boeck., E. rabenii Boeck., E. radicans (Poir. Kunth, E. sellowiana Kunth, E. squamigera Svenson, E. subarticulata (Nees Boeck., E. viridans Kük. ex Osten, Eleocharis sp.1 e Eleocharis sp.2. O trabalho apresenta descrições, ilustrações, dados sobre distribuição geográfica, habitat e períodos de floração e frutificação das espécies, além de uma chave dicotômica para diferenciá-las.

Proliferation and Differentiation of Murine Myeloid Precursor 32D/G-CSF-R Cells

Czech Academy of Sciences Publication Activity Database

Zjablovskaja, Polina; Daněk, Petr; Kardošová, Miroslava; Alberich-Jorda, Meritxell

č. 132 (2018), č. článku e57033. ISSN 1940-087X R&D Projects: GA ČR GA15-03796S Institutional support: RVO:68378050 Keywords : 32D/G-CSF-R cells * murine myeloid precursor cells * liquid culture * differentiation * neutrophils * proliferation * cytokines * IL-3 * G-CSF Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.232, year: 2016

Frequency of the LRRK2 G2019S mutation in late-onset sporadic patients with Parkinson’s disease

Directory of Open Access Journals (Sweden)

Hsin Fen Chien

2014-05-01

Full Text Available Mutations in the LRRK2 gene, predominantly G2019S, have been reported in individuals with autosomal dominant inheritance and sporadic Parkinson’s disease (PD. The G2019S mutation has an age-dependent penetrance and evidence shows common ancestry. The clinical manifestations are indistinguishable from idiopathic PD. Its prevalence varies according to the population studied ranging from less than 0.1% in Asians to 41% in North African Arabs. This study aimed to identify G2019S mutation in Brazilian idiopathic PD patients. Method: We sampled 100 PD patients and 100 age- and gender-matched controls. Genetical analysis was accomplished by polymerase chain reaction (PCR. Results: No G2019S mutations were found in both patients with sporadic PD and controls. Conclusions: Our results may be explained by the relatively small sample size.

Analysis of syringyl and guaiacyl (S/G) ratio in lignin

CSIR Research Space (South Africa)

Spark, A

2006-12-01

Full Text Available the acidolysis products – Validate the new S/G ratio method Why are S/G ratios important? Gives a good indication of the reactivity of the lignin Experimental design Literature Review Establishing Acidolysis conditions Permanganate oxidation Lignin...-method is quick • Permanganate oxidation-method is slow but it is the standard method used at present • Nitrobenzene Oxidation, Pyrolysis, Cupric Oxidation and Thioacidolysis Lignin can be broken down to syringyl and guaiacyl subunits: OCH3 OH OCH3 OH...

Holomorphic two-spheres in the complex Grassmann manifold G(k, n)

Indian Academy of Sciences (India)

of Sciences, Beijing 100049, People's Republic of China. 2Department of Mathematics, University of Science and Technology of China, Hefei, ..... author's knowledge is concerned, there is no corresponding example or counterexample. Example. Through direct calculations, one can show that f : S2 −→ G(k, 2k) defined by.

The association between the RAGE G82S polymorphism, sRAGE and chronic periodontitis in Taiwanese individuals with and without diabetes.

Science.gov (United States)

Wu, T-L; Tsai, C-C; Wang, Y-Y; Ho, K-Y; Wu, Y-M; Hung, H-C; Lin, Y-C

2015-12-01

The present study investigated the association between the RAGE G82S polymorphism, the plasma levels of sRAGE and chronic periodontitis in subjects with and without diabetes mellitus (DM). A total of 230 patients with DM and 264 non-DM participants were recruited for this study. Genotyping of the RAGE G82S polymorphism was accomplished using polymerase chain reaction-restriction fragment length polymorphism, and associations were analyzed with the chi-squared test and logistic regression analysis. In the non-DM group, the chi-squared test showed that the frequency distributions of the G82S polymorphism were significantly different between chronic periodontitis and non-chronic periodontitis subjects (χ(2) = 8.39, p = 0.02). A multivariate logistic regression model showed that the (G82S + S82S) genotypes were associated with a significantly increased risk of chronic periodontitis development compared to the G82G genotype (adjusted odds ratio = 2.06, 95% confidence interval: 1.08-4.07). In the DM group, there was no association between the G82S polymorphism and chronic periodontitis development when a multivariate logistic regression was performed. Plasma levels of sRAGE were significantly higher in subjects with the G82G genotype compared to those with the (G82S + S82S) genotypes in both the non-DM (856.6 ± 332.0 vs. 720.4 ± 311.4 pg/mL, p = 0.003) and DM groups (915.3 ± 497.1 vs. 603.5 ± 298.3 pg/mL, p chronic periodontitis and non-chronic periodontitis subjects in both the DM and non-DM groups. Moreover, when the subjects were further sub-divided by the G82S polymorphism, the difference in plasma levels of sRAGE between chronic periodontitis and non-chronic periodontitis subjects in the DM and non-DM groups remained statistically insignificant. The present study revealed that the RAGE G82S polymorphism was associated with chronic periodontitis in the non-DM group but not in the DM group. Our results also showed that the plasma levels of sRAGE were

First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

Science.gov (United States)

Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

2016-05-01

This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

Assessing the osteoblast transcriptome in a model of enhanced bone formation due to constitutive G{sub s}–G protein signaling in osteoblasts

Energy Technology Data Exchange (ETDEWEB)

Wattanachanya, Lalita, E-mail: lalita_md@yahoo.com [Endocrine Research Unit, Veterans Affairs Medical Center and Departments of Medicine and Physiology, University of California, San Francisco, CA (United States); Division of Endocrinology and Metabolism, Department of Medicine, Faculty of Medicine, Chulalongkorn University and King Chulalongkorn Memorial Hospital, Thai Red Cross Society, Bangkok (Thailand); Wang, Liping, E-mail: lipingwang05@yahoo.com [Endocrine Research Unit, Veterans Affairs Medical Center and Departments of Medicine and Physiology, University of California, San Francisco, CA (United States); Millard, Susan M., E-mail: susan.millard@mater.uq.edu.au [Endocrine Research Unit, Veterans Affairs Medical Center and Departments of Medicine and Physiology, University of California, San Francisco, CA (United States); Lu, Wei-Dar, E-mail: weidar_lu@yahoo.com [Endocrine Research Unit, Veterans Affairs Medical Center and Departments of Medicine and Physiology, University of California, San Francisco, CA (United States); O’Carroll, Dylan, E-mail: dylancocarroll@gmail.com [Endocrine Research Unit, Veterans Affairs Medical Center and Departments of Medicine and Physiology, University of California, San Francisco, CA (United States); Hsiao, Edward C., E-mail: Edward.Hsiao@ucsf.edu [Division of Endocrinology and Metabolism, Department of Medicine, University of California, San Francisco, CA (United States); Conklin, Bruce R., E-mail: bconklin@gladstone.ucsf.edu [Gladstone Institute of Cardiovascular Disease, San Francisco, CA (United States); Department of Medicine, University of California, San Francisco, CA (United States); Department of Cellular and Molecular Pharmacology, University of California, San Francisco, CA (United States); Nissenson, Robert A., E-mail: Robert.Nissenson@ucsf.edu [Endocrine Research Unit, Veterans Affairs Medical Center and Departments of Medicine and Physiology, University of California, San Francisco, CA (United States)

2015-05-01

G protein-coupled receptor (GPCR) signaling in osteoblasts (OBs) is an important regulator of bone formation. We previously described a mouse model expressing Rs1, an engineered constitutively active G{sub s}-coupled GPCR, under the control of the 2.3 kb Col I promoter. These mice showed a dramatic age-dependent increase in trabecular bone of femurs. Here, we further evaluated the effects of enhanced G{sub s} signaling in OBs on intramembranous bone formation by examining calvariae of 1- and 9-week-old Col1(2.3)/Rs1 mice and characterized the in vivo gene expression specifically occurring in osteoblasts with activated G{sub s} G protein-coupled receptor signaling, at the cellular level rather than in a whole bone. Rs1 calvariae displayed a dramatic increase in bone volume with partial loss of cortical structure. By immunohistochemistry, Osterix was detected in cells throughout the inter-trabecular space while Osteocalcin was expressed predominantly in cells along bone surfaces, suggesting the role of paracrine mediators secreted from OBs driven by 2.3 kb Col I promoter could influence early OB commitment, differentiation, and/or proliferation. Gene expression analysis of calvarial OBs revealed that genes affected by Rs1 signaling include those encoding proteins important for cell differentiation, cytokines and growth factors, angiogenesis, coagulation, and energy metabolism. The set of G{sub s}-GPCRs and other GPCRs that may contribute to the observed skeletal phenotype and candidate paracrine mediators of the effect of G{sub s} signaling in OBs were also determined. Our results identify novel detailed in vivo cellular changes of the anabolic response of the skeleton to G{sub s} signaling in mature OBs. - Highlights: • OB expression of an engineered G{sub s}-coupled receptor dramatically increases bone mass. • We investigated the changes in gene expression in vivo in enhanced OB G{sub s} signaling. • Genes in cell cycle and transcription were increased in

Identification of novel splice site mutation IVS9 + 1(G > A) and novel complex allele G355R/R359X in Type 1 Gaucher patients heterozygous for mutation N370S.

Science.gov (United States)

Hoitsema, Kourtnee; Amato, Dominick; Khan, Aneal; Sirrs, Sandra; Choy, Francis Y M

2016-09-01

Gaucher disease is an autosomal recessive lysosomal storage disorder resulting from deficient glucocerebrosidase activity. More than 350 mutations that cause Gaucher disease have been described to date. Novel mutations can potentially provide insight into the glucocerebrosidase structure-function relationship and biochemical basis of the disease. Here, we report the identification of two novel mutations in two unrelated patients with type I (non-neuronopathic) Gaucher disease: 1) a splice site mutation IVS9 + 1G > A; and (2) a complex allele (cis) G355R/R359X. Both patients have a common N370S mutation in the other allele. The splice site mutation results from an intronic base substitution (G to A, c.1328 + 1, g.5005) at the donor splice site of exon and intron 9. The complex allele results from two point mutations in exon 8 of glucocerebrosidase (G to C at c.1180, g.4396, and T to C at c. 1192, g.4408) substituting glycine by arginine (G355R) and arginine by a premature termination (R359X), respectively. In order to demonstrate that G355R/R359X are in cis arrangement, PCR-amplified glucocerebrosidase exon 8 genomic DNA from the patient was cloned into the vector pJET1.2 in Escherichia coli TOP10® strain. Out of the 15 clones that were sequence analyzed, 10 contained the normal allele sequence and 5 contained the complex allele G355R/R359X sequence showing both mutations in cis arrangement. Restriction fragment length polymorphism analysis using Hph1 restriction endonuclease digest was established for the IVS9 + 1G > A mutation for confirmation and efficient identification of this mutation in future patients. Past literature suggests that mutations affecting splicing patterns of the glucocerebrosidase transcript as well as mutations in Gaucher complex alleles are detrimental to enzyme activity. However, compound heterozygosity with N370S, a mild mutation, will lead to a mild phenotype. The cases reported here support these past findings.

VizieR Online Data Catalog: Catalogue of features in the S4G (Herrera-Endoqui+, 2015)

Science.gov (United States)

Herrera-Endoqui, M.; Diaz-Garcia, S.; Laurikainen, E.; Salo, H.

2015-08-01

Table 2 contains the properties of bars, ring- and lens-structures in the S4G. Data for bars contains the visual estimated barlength, the maximum ellipticity in the bar region, the visual estimated position angle, and the barlength obtained from the ellipticity maximum. They are given in both the sky plane and the disk plane, the conversion is made using P4 orientation parameters (Salo et al., 2015ApJS..219....4S; Table 1). For bars the disk plane values are given only when a reliable ellipticity maximum was found and the galaxy inclination i<65 deg. For other features the parameters are obtained from fitting ellipses to points tracing the structure. A quality flag for our measurement is also given: 1 indicates a good fit and unambiguously identified feature, 2 indicates a hard to trace feature, 3 indicates an uncertain feature identification (due to high inclination of host galaxy or incomplete feature). Table 3 contains the properties of spiral arms in the S4G. Type of spiral arms, the pitch angle, the inner and the outer radius are given for every spiral segment (see the catalogue web page). The type of spiral arms are taken from Buta et al. (2015ApJS..217...32B, Cat. J/ApJS/217/32): G for grand design, M for multiple, and F for flocculent spiral arms. Our estimation of the quality of the fit is also given (1.0 = good; 2.0 = acceptable). (2 data files).

Çocuklarda görülen ayak deformitelerinin hérédité ile ilişkisi

OpenAIRE

SARI, Fzt.Zübeyir; OTMAN, Fzt.A. Saadet; AKMAN, Dr.M.Nafİz

2015-01-01

Ayak deformiteleri, çocukluk çağında en sık görülen kas-iskelet patolojilerinden birisidir. Erken tam ve tedavi, gelişebilecek daha ciddi problemleri önlemek için büyük önem taşır. Çalışmamız, basit tesadüfi örnekleme yöntemi ile seçilen 221 öğrenci ve bunların yakın akrabalarından oluşan toplam 1105 olgu üzerinde gerçekleştirilmiştir. Çalışmamıza Nörolojik kökenli ve kas kuvvet dengesizliğinden kaynaklanan ayak deformitelerine sahip olgular dahil edilmemiştir. Yapılan istatistiksel incelemel...

Temel eğitimden ortaöğretime geçiş sınavlarına ilişkin 9. sınıf öğrencilerinin görüşleri

OpenAIRE

Akman, Ozan

2017-01-01

Araştırmanın amacı, temel eğitimden ortaöğretime geçişte yapılmakta olan Temel Eğitimden Ortaöğretime Geçiş (TEOG) Sınavlarına ilişkin dokuzuncu sınıf öğrencilerinin görüşlerinin incelenmesidir. Araştırmada betimsel araştırma yöntemlerinden tarama modeli çerçevesinde nicel yöntem kullanılmıştır. Araştırmanın evrenini 2015-2016 eğitim öğretim yılında Zonguldak ili Ereğli ilçesinde devlet okullarında öğrenim gören 2715 dokuzuncu sınıf öğrencisi oluşturmaktadır. Araştırmanın örneklemini 1022 öğr...

TINDAKAN NEGARA TERKAIT PERISTIWA G30S: STUDI MAKNA GADAMERIAN PADA PESELAMAT

Directory of Open Access Journals (Sweden)

Hamdan Tri Atmaja

2012-07-01

Full Text Available This study aims to gain knowledge of a deep understanding of the state action related to the G30S event. The research method used was a qualitative research approach initiated by Gadamer's hermeneutics. The results showed that state action against survivors were to arrest, investigate, and imprison them to the island of Buru (for men survivors and Plantungan (for women survivors. The G30S event, by survivors, was interpreted as a story of the assassination of the generals by Indonesian Communist Party (PKI, as well as the form of a political conspiracy for Sukarno’s power within ideological background. Investigation and arrest were interpreted by them as an act of unwarranted, political scapegoat, and a form of abuse against them. While prison life, for survivors, was as a form of forced labor, punishment to stigmatize and isolate women Keywords: State Action, the G30S event, Meaning, and Survivor.   Tulisan ini mendeskripsikan secara mendalam tindakan negara terkait peristiwa G30S. Metode penelitian yang digunakan adalah penelitian kualitatif dengan pendekatan hermeneutika yang digagas Gadamer. Hasil penelitian menunjukkan tindakan negara terhadap peselamat adalah melakukan penangkapan, pemeriksaan, dan penahanan serta memenjarakan mereka ke pulau Buru (untuk peselamat laki-laki dan Plantungan (untuk peselamat perempuan. Peristiwa G30S oleh peselamat dimaknai sebagai kisah pembunuhan para jendral oleh PKI, bentuk konspirasi politik memperebutkan kekuasaan Soekarno dengan latar belakang ideologi. Pemeriksaan dan penangkapan dimaknai peselamat sebagai tindakan tidak beralasan, politik kambing hitam, dan sebagai bentuk kesewenang-wenangan terhadap peselamat. Kehidupan penjara dimaknai peselamat sebagai bentuk kerja paksa, hukuman dengan menstigmatisasi dan mengisolasi kaum perempuan. Kata kunci: Tindakan Negara, Peristiwa G30S, Makna, dan  Peselamat.      

Ueda Akinari y el gótico japonés

Directory of Open Access Journals (Sweden)

José Ricardo Chaves

2015-06-01

Full Text Available El uso del término ‘gótico’ en las letras surgió en el siglo XVIII para describir un movimiento que, a contracorriente de la racionalidad recién entronizada, ponía énfasis en el carácter contingente e inexplicable del mundo humano y natural. Coincidentemente, en la misma época se publicó en el archipiélago japonés una colección de narraciones centradas en lo sobrenatural, titulada Ugetsu monogatari, de Ueda Akinari. Este ensayo explora los interesantes paralelismos entre la obra de Akinari y la de escritores como Horace Walpole, Ann Radcliffe y Mathew Lewis, no con el afán de mostrar una relación directa entre el gótico europeo y el “gótico” japonés (algo imposible, dado el aislamiento que marcó el final del periodo feudal en Japón, sino para señalar el carácter transcultural del género, fuera de las estrechas definiciones espaciales y temporales que solemos asignarle.

Structure of a Stable G-Hairpin

Czech Academy of Sciences Publication Activity Database

Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

2017-01-01

Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

New contribution on the LRRK2 G2019S mutation associated to ...

African Journals Online (AJOL)

... generations ago. Conclusion: Our conclusion is that the G2019S mutation of the LRRK2 gene originates 3,840 (95% CI 3,210-5,400) years ago in parkinsonian Moroccan Berbers patients. Key words: Parkinson's disease (PD), Leucine-rich repeat kinase 2 (LRRK2) gene, G2019S mutation, Haplotype, Founding mutation.

The 5HT(1A) receptor ligand, S15535, antagonises G-protein activation: a [35S]GTPgammaS and [3H]S15535 autoradiography study.

Science.gov (United States)

Newman-Tancredi, A; Rivet, J; Chaput, C; Touzard, M; Verrièle, L; Millan, M J

1999-11-19

4-(Benzodioxan-5-yl)1-(indan-2-yl)piperazine (S15535) is a highly selective ligand at 5-HT(1A) receptors. The present study compared its autoradiographic labelling of rat brain sections with its functional actions, visualised by guanylyl-5'-[gamma-thio]-triphosphate ([35S]GTPgammaS) autoradiography, which affords a measure of G-protein activation. [3H]S15535 binding was highest in hippocampus, frontal cortex, entorhinal cortex, lateral septum, interpeduncular nucleus and dorsal raphe, consistent with specific labelling of 5-HT(1A) receptors. In functional studies, S15535 (10 microM) did not markedly stimulate G-protein activation in any brain region, but abolished the activation induced by the selective 5-HT(1A) agonist, (+)-8-hydroxy-dipropyl-aminotetralin ((+)-8-OH-DPAT, 1 microM), in structures enriched in [3H]S15535 labelling. S15535 did not block 5-HT-stimulated activation in caudate nucleus or substantia nigra, regions where (+)-8-OH-DPAT was ineffective and [3H]S15535 binding was absent. Interestingly, S15535 attenuated (+)-8-OH-DPAT and 5-HT-stimulated G-protein activation in dorsal raphe, a region in which S15535 is known to exhibit agonist properties in vivo [Lejeune, F., Millan, M.J., 1998. Induction of burst firing in ventral tegmental area dopaminergic neurons by activation of serotonin (5-HT)(1A) receptors: WAY100,635-reversible actions of the highly selective ligands, flesinoxan and S15535. Synapse 30, 172-180.]. The present data show that (i) [3H]S15535 labels pre- and post-synaptic populations of 5-HT(1A) sites in rat brain sections, (ii) S15535 exhibits antagonist properties at post-synaptic 5-HT(1A) receptors in corticolimbic regions, and (iii) S15535 also attenuates agonist-stimulated G-protein activation at raphe-localised 5-HT(1A) receptors.

G-warm inflation

Energy Technology Data Exchange (ETDEWEB)

Herrera, Ramón, E-mail: ramon.herrera@pucv.cl [Instituto de Física, Pontificia Universidad Católica de Valparaíso, Avenida Brasil 2950, Casilla 4059, Valparaíso (Chile)

2017-05-01

A warm inflationary universe in the context of Galileon model or G-model is studied. Under a general formalism we study the inflationary dynamics and the cosmological perturbations considering a coupling of the form G (φ, X )= g (φ) X . As a concrete example, we consider an exponential potential together with the cases in which the dissipation and Galilean coefficients are constants. Also, we study the weak regime given by the condition R <1+3 gH φ-dot , and the strong regime in which 1< R +3 gH φ-dot . Additionally, we obtain constraints on the parameters during the evolution of G-warm inflation, assuming the condition for warm inflation in which the temperature T > H , the conditions or the weak and strong regimes, together with the consistency relation r = r ( n {sub s} ) from Planck data.

Uncoupling of M1 muscarinic receptor/G-protein interaction by amyloid beta(1-42)

Czech Academy of Sciences Publication Activity Database

Janíčková, Helena; Rudajev, Vladimír; Zimčík, Pavel; Jakubík, Jan; Tanila, H.; El-Fakahany, E. E.; Doležal, Vladimír

2013-01-01

Roč. 67, April (2013), s. 272-283 ISSN 0028-3908 R&D Projects: GA ČR(CZ) GA305/09/0681; GA ČR(CZ) GBP304/12/G069; GA MŠk(CZ) 7E10060 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : Alzheimer ´s Disease * muscarinic receptors * G-proteins Subject RIV: ED - Physiology Impact factor: 4.819, year: 2013

Vyresnių klasių moksleivių aleksitimiškumo sąsajos su tabako rūkymu, alkoholinių gėrimų vartojimu ir požiūriu į juos

OpenAIRE

Kalninytė, Eglė

2010-01-01

Aleksitimiški žmonės pasižymi silpnu gebėjimu kognityviai apdoroti ir reguliuoti emocijas, dėl to jiems yra sunku emocijas ir jausmus atskirti nuo kūno pojūčių, sunku jomis bendrauti, tokie žmonės pasižymi į išorę orientuotu mąstymu ir silpna vidine introspekcija. Šio tyrimo tikslas - nustatyti vyresnių klasių moksleivių aleksitimiškumo sąsajas su tabako rūkymu, alkoholinių gėrimų vartojimu ir požiūriu į juos bei šias medžiagas vartojančius asmenis. Tyrime dalyvavo 236 dviejų Jurbarko mokyklų...

Salicilo rūgšties įtaka kvapiojo baziliko ir vaistinio čiobrelio atsparumui sausrai atšilusio klimato sąlygomis

OpenAIRE

Vaitkevičiūtė, Birutė

2018-01-01

Pastaraisiais metais vis labiau ir labiau tampa aktualūs pasauliniai klimato pokyčiai. Taigi, svarbu nustatyti ir aptarti kaip šie veiksniai veikia vaistinių augalų fiziologinius, morfometrinius ir biocheminius rodiklius. Yra atlikta daug tyrimų kaip klimato kaita veikia kultūrinius augalus, maisto kokybę ir piktžoles. Tačiau beveik nėra tyrimų kaip salicilo rūgštimi (SR) veikti augalai reaguoja į atšilusio klimato ir sausros sąlygas. Augalai buvo auginami automatiškai kontroliuojamomis dabar...

Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

Science.gov (United States)

Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

2013-01-01

We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

Evaporation of Cu, Sn, and S from Fe-C-Cu-Sn-S Liquid Alloys in the Temperature Range from 1513 K to 1873 K (1240 °C to 1600 °C)

Science.gov (United States)

Tafwidli, Fahmi; Choi, Moo-Eob; Yi, Sang-Ho; Kang, Youn-Bae

2018-06-01

Evaporation of Cu or Sn from liquid iron alloys containing C and S was experimentally investigated. The initial C concentration, [pct C]0, in the liquid alloy was varied from zero to C saturation, and the evaporation temperature was varied from 1513 K to 1773 K (1240 °C to 1500 °C). Along with the report by one of the present authors, the evaporation mechanism of Cu and Sn from liquid Fe-C-S alloy is proposed, after a modification from the previous mechanism. It was proposed that Cu and Sn evaporate as Cu(g) and Sn(g) and also evaporate as CuS(g) and SnS(g), which are more volatile species. Therefore, availability of S in the alloy affects the overall evaporation rate of Cu and Sn. At the same time, C in the alloy also forms volatile carbosulfides CS(g) and CS2(g), thereby competing with Cu and Sn. Moreover, C increases the activity coefficients of Cu, Sn, and S. This increases the thermodynamic driving force for the formation of CuS(g) and SnS(g). Therefore, increasing [pct C] partly accelerates the evaporation rate of Cu and Sn by increasing the activity coefficient but partly decelerates the evaporation rate by lowering the available S content. S partly accelerates the evaporation rate by increasing the available S for the sulfide gas species but partly decelerates the evaporation rate due to the surface poisoning effect. Increasing the reaction temperature increases the overall evaporation rate. All these facts were taken into account in order to develop an evaporation rate model. This model was extended from the present authors' previous one by taking into account (1) CS(g), S(g), and CS2(g) (therefore, the following species were considered as dominant evaporating species: Cu(g), CuS(g), Sn(g), SnS(g), S(g), CS(g), and CS2(g)); (2) the effect of C and temperature on the activity coefficients of Cu, Sn, and S; (3) the effect of C and temperature on the density of the liquid alloy; and (4) the effect of temperature on the S adsorption coefficient. This revised

Evaporation of Cu, Sn, and S from Fe-C-Cu-Sn-S Liquid Alloys in the Temperature Range from 1513 K to 1873 K (1240 °C to 1600 °C)

Science.gov (United States)

Tafwidli, Fahmi; Choi, Moo-Eob; Yi, Sang-Ho; Kang, Youn-Bae

2018-02-01

Evaporation of Cu or Sn from liquid iron alloys containing C and S was experimentally investigated. The initial C concentration, [pct C]0, in the liquid alloy was varied from zero to C saturation, and the evaporation temperature was varied from 1513 K to 1773 K (1240 °C to 1500 °C). Along with the report by one of the present authors, the evaporation mechanism of Cu and Sn from liquid Fe-C-S alloy is proposed, after a modification from the previous mechanism. It was proposed that Cu and Sn evaporate as Cu(g) and Sn(g) and also evaporate as CuS(g) and SnS(g), which are more volatile species. Therefore, availability of S in the alloy affects the overall evaporation rate of Cu and Sn. At the same time, C in the alloy also forms volatile carbosulfides CS(g) and CS2(g), thereby competing with Cu and Sn. Moreover, C increases the activity coefficients of Cu, Sn, and S. This increases the thermodynamic driving force for the formation of CuS(g) and SnS(g). Therefore, increasing [pct C] partly accelerates the evaporation rate of Cu and Sn by increasing the activity coefficient but partly decelerates the evaporation rate by lowering the available S content. S partly accelerates the evaporation rate by increasing the available S for the sulfide gas species but partly decelerates the evaporation rate due to the surface poisoning effect. Increasing the reaction temperature increases the overall evaporation rate. All these facts were taken into account in order to develop an evaporation rate model. This model was extended from the present authors' previous one by taking into account (1) CS(g), S(g), and CS2(g) (therefore, the following species were considered as dominant evaporating species: Cu(g), CuS(g), Sn(g), SnS(g), S(g), CS(g), and CS2(g)); (2) the effect of C and temperature on the activity coefficients of Cu, Sn, and S; (3) the effect of C and temperature on the density of the liquid alloy; and (4) the effect of temperature on the S adsorption coefficient. This revised

Newspaper: Files. Radiotherapy and accidental radiation protection. Scientific management between I.G.R. and I.P.S.N

International Nuclear Information System (INIS)

1999-02-01

The Gustave-Roussy Institute (I.G.R.), the biggest european center of cancer treatment, and the Institute of Protection and Nuclear Safety (I.P.S.N.) that lead important researches and expertise in accidental radiation protection have established an agreement for a research program for six years. The objective is to speed up the researches in radio-pathology and radiobiology to improve the techniques used to treat the irradiated persons, for therapeutic or accidental reasons. Three principal themes have been chosen as starting point: Diagnosis and prognosis bio-indicators of irradiation effects on the digestive system, biological dosimetry and long term effects of a high dose irradiation. New themes will be tackled in function of the results or new needs. (N.C.)

VizieR Online Data Catalog: Abundances in the local region. I. G and K giants (Luck, 2015)

Science.gov (United States)

Luck, R. E.

2015-10-01

At the start of this program, the observation list for giants was set to sample the G/K giants of the local region out to about 100pc from the Sun in all directions. The region was subdivided into cubes that were 25pc on a side; from each sub-volume, appropriate stars were selected north of declination -30°. This sample yielded the 286 G/K giants found in Luck et al. 2007 (cat. J/AJ/133/2464). This data set was also augmented by the addition of numerous G/K giants, increasing the number in the 100pc volume to 594 stars. Because the volume selection criteria used in Luck et al. 2007 (cat. J/AJ/133/2464) formally extended out to 115pc, a more precise comparison is that the current sample has 740 stars out to the older limit. Additional stars from the Bright Star Catalog (Hoffleit & Jaschek, 1991bsc..book.....H) were added, driving the sample out to about 200pc. The spectral database was supplemented using the ELODIE and ESO Archives. The ESO addition adds the southern sky. The bulk of the northern stars were observed using the McDonald Observatory Struve Telescope and Sandiford Cassegrain Echelle Spectrograph. For the ELODIE and ESO data archives, a list of all stars available was obtained and spectral type for each from SIMBAD was retrieved. Stars having a spectral type of F, G, or K III were then processed. The ESO data derives from the HARPS and UVES spectrographs. Basic observational data for the program stars can be found in Table1, along with some derived quantities, such as distance. The primary source of observational data for this study is a set of high signal-to-noise ratio (S/N) spectra obtained during numerous observing runs between 1997 and 2010 at McDonald Observatory using the 2.1m Struve Telescope and the Sandiford Cassegrain Echelle Spectrograph. The spectra continuously cover a wavelength range from about 484 to 700nm, with a resolving power of about 60000. Typical S/N values for the spectra are in excess of 150. To enable cancellation of telluric

Passion Plays: The Dominican Diaspora in Waddys Jáquez’s P.A.R.G.O.

Directory of Open Access Journals (Sweden)

Maja Horn

2008-06-01

Full Text Available This article analyzes how the play P.A.R.G.O. (2001, written, directed, and performed by the Dominican Waddys Jáquez represents the contemporary experience of the Dominican diaspora. Jaquéz himself forms part of a new generation of diasporic artists who frequently return “home,” to the Dominican Republic, and who, unlike the previous generation of diasporic artists and writers, continue to find their most valuable audience there. This tendency towards an increasing interconnectivity between diaspora and homeland is represented and a/effectively reinforced in P.A.R.G.O. The play brings the experience of the diaspora close to home for the audience, not by compelling them to identify with the characters’ particular identities, but rather by placing center stage their ongoing negotiations and “making do” with personal and economic difficulties that define their lives both at home and abroad.

Identification of herpesvirus proteins that contribute to G1/S arrest.

Science.gov (United States)

Paladino, Patrick; Marcon, Edyta; Greenblatt, Jack; Frappier, Lori

2014-04-01

Lytic infection by herpesviruses induces cell cycle arrest at the G1/S transition. This appears to be a function of multiple herpesvirus proteins, but only a minority of herpesvirus proteins have been examined for cell cycle effects. To gain a more comprehensive understanding of the viral proteins that contribute to G1/S arrest, we screened a library of over 200 proteins from herpes simplex virus type 1, human cytomegalovirus, and Epstein-Barr virus (EBV) for effects on the G1/S interface, using HeLa fluorescent, ubiquitination-based cell cycle indicator (Fucci) cells in which G1/S can be detected colorimetrically. Proteins from each virus were identified that induce accumulation of G1/S cells, predominantly tegument, early, and capsid proteins. The identification of several capsid proteins in this screen suggests that incoming viral capsids may function to modulate cellular processes. The cell cycle effects of selected EBV proteins were further verified and examined for effects on p53 and p21 as regulators of the G1/S transition. Two EBV replication proteins (BORF2 and BMRF1) were found to induce p53 but not p21, while a previously uncharacterized tegument protein (BGLF2) was found to induce p21 protein levels in a p53-independent manner. Proteomic analyses of BGLF2-interacting proteins identified interactions with the NIMA-related protein kinase (NEK9) and GEM-interacting protein (GMIP). Silencing of either NEK9 or GMIP induced p21 without affecting p53 and abrogated the ability of BGLF2 to further induce p21. Collectively, these results suggest multiple viral proteins contribute to G1/S arrest, including BGLF2, which induces p21 levels likely by interfering with the functions of NEK9 and GMIP. Most people are infected with multiple herpesviruses, whose proteins alter the infected cells in several ways. During lytic infection, the viral proteins block cell proliferation just before the cellular DNA replicates. We used a novel screening method to identify proteins

Når sproget gør modstand

DEFF Research Database (Denmark)

Sundahl Olsen, Lone

2010-01-01

For de fleste danske børn går udviklingen af sprog og generelle kommunikative færdigheder let. Hos nogle børn forløber den sproglige udvikling dog langsomt, eller tilegnelsen af vigtige sproglige færdigheder udebliver helt.......For de fleste danske børn går udviklingen af sprog og generelle kommunikative færdigheder let. Hos nogle børn forløber den sproglige udvikling dog langsomt, eller tilegnelsen af vigtige sproglige færdigheder udebliver helt....

A tulajdonnév funkciója a görög mitológiában. [The function of names in Greek mythology

Directory of Open Access Journals (Sweden)

Slíz, Mariann

2013-12-01

Full Text Available This study presents the mythological function of names in Greek myths, emphasizing though that most of the observed functions are not typical in mythology in general. Names were collected from the general work “Görög mitológia [Greek Mythology]” (1977/1997 by KÁROLY KERÉNYI, a scholarly book paying attention even to the different versions of the myths, and, occasionally, from the popular work “Görög regék [Greek Tales]” (1976 by IMRE TRENCSÉNYI-WALDAPFEL. The research focuses rather on the overall mythological function of names and name types, and also on the interrelations of names than on the etymologies of names. Topics presented in the paper include the specific transitionary state of mythological names between common and proper nouns and the frequent changes between these two categories; the synonymity of names (e.g. in connection with the several names of a god; names compressing the storyline of a myth; the appearance of a new name as a linguistic manifestation of the change in one’s mythological role; pseudonyms as indicators of temporary mythological roles; and the magic function of names.

Design principles of the yeast G1/S switch.

Directory of Open Access Journals (Sweden)

Xiaojing Yang

2013-10-01

Full Text Available A hallmark of the G1/S transition in budding yeast cell cycle is the proteolytic degradation of the B-type cyclin-Cdk stoichiometric inhibitor Sic1. Deleting SIC1 or altering Sic1 degradation dynamics increases genomic instability. Certain key facts about the parts of the G1/S circuitry are established: phosphorylation of Sic1 on multiple sites is necessary for its destruction, and both the upstream kinase Cln1/2-Cdk1 and the downstream kinase Clb5/6-Cdk1 can phosphorylate Sic1 in vitro with varied specificity, cooperativity, and processivity. However, how the system works as a whole is still controversial due to discrepancies between in vitro, in vivo, and theoretical studies. Here, by monitoring Sic1 destruction in real time in individual cells under various perturbations to the system, we provide a clear picture of how the circuitry functions as a switch in vivo. We show that Cln1/2-Cdk1 sets the proper timing of Sic1 destruction, but does not contribute to its destruction speed; thus, it acts only as a trigger. Sic1's inhibition target Clb5/6-Cdk1 controls the speed of Sic1 destruction through a double-negative feedback loop, ensuring a robust all-or-none transition for Clb5/6-Cdk1 activity. Furthermore, we demonstrate that the degradation of a single-phosphosite mutant of Sic1 is rapid and switch-like, just as the wild-type form. Our mathematical model confirms our understanding of the circuit and demonstrates that the substrate sharing between the two kinases is not a redundancy but a part of the design to overcome the trade-off between the timing and sharpness of Sic1 degradation. Our study provides direct mechanistic insight into the design features underlying the yeast G1/S switch.

The DNA replication checkpoint directly regulates MBF-dependent G1/S transcription.

Science.gov (United States)

Dutta, Chaitali; Patel, Prasanta K; Rosebrock, Adam; Oliva, Anna; Leatherwood, Janet; Rhind, Nicholas

2008-10-01

The DNA replication checkpoint transcriptionally upregulates genes that allow cells to adapt to and survive replication stress. Our results show that, in the fission yeast Schizosaccharomyces pombe, the replication checkpoint regulates the entire G(1)/S transcriptional program by directly regulating MBF, the G(1)/S transcription factor. Instead of initiating a checkpoint-specific transcriptional program, the replication checkpoint targets MBF to maintain the normal G(1)/S transcriptional program during replication stress. We propose a mechanism for this regulation, based on in vitro phosphorylation of the Cdc10 subunit of MBF by the Cds1 replication-checkpoint kinase. Replacement of two potential phosphorylation sites with phosphomimetic amino acids suffices to promote the checkpoint transcriptional program, suggesting that Cds1 phosphorylation directly regulates MBF-dependent transcription. The conservation of MBF between fission and budding yeast, and recent results implicating MBF as a target of the budding yeast replication checkpoint, suggests that checkpoint regulation of the MBF transcription factor is a conserved strategy for coping with replication stress. Furthermore, the structural and regulatory similarity between MBF and E2F, the metazoan G(1)/S transcription factor, suggests that this checkpoint mechanism may be broadly conserved among eukaryotes.

The DNA Replication Checkpoint Directly Regulates MBF-Dependent G1/S Transcription▿

Science.gov (United States)

Dutta, Chaitali; Patel, Prasanta K.; Rosebrock, Adam; Oliva, Anna; Leatherwood, Janet; Rhind, Nicholas

2008-01-01

The DNA replication checkpoint transcriptionally upregulates genes that allow cells to adapt to and survive replication stress. Our results show that, in the fission yeast Schizosaccharomyces pombe, the replication checkpoint regulates the entire G1/S transcriptional program by directly regulating MBF, the G1/S transcription factor. Instead of initiating a checkpoint-specific transcriptional program, the replication checkpoint targets MBF to maintain the normal G1/S transcriptional program during replication stress. We propose a mechanism for this regulation, based on in vitro phosphorylation of the Cdc10 subunit of MBF by the Cds1 replication-checkpoint kinase. Replacement of two potential phosphorylation sites with phosphomimetic amino acids suffices to promote the checkpoint transcriptional program, suggesting that Cds1 phosphorylation directly regulates MBF-dependent transcription. The conservation of MBF between fission and budding yeast, and recent results implicating MBF as a target of the budding yeast replication checkpoint, suggests that checkpoint regulation of the MBF transcription factor is a conserved strategy for coping with replication stress. Furthermore, the structural and regulatory similarity between MBF and E2F, the metazoan G1/S transcription factor, suggests that this checkpoint mechanism may be broadly conserved among eukaryotes. PMID:18662996

Évaluation de la réussite de l'ouvrage de protection de berges de la Romanche au barrage de Livet, réalisé à l'aide de techniques de génie végétal

Directory of Open Access Journals (Sweden)

DELAGE, Camille

2017-05-01

Full Text Available À l’interface entre les écosystèmes aquatiques et terrestres, le génie végétal sur les berges de cours d’eau s’inspire et utilise les capacités naturelles des végétaux comme matériel de base à la reconstruction de berges. Cette alternative au génie civil, confère aux écosystèmes une meilleure capacité de retour vers des systèmes plus naturels et surtout plus diversifiés. Toutefois, la restauration écologique et particulièrement les techniques de génie végétal souffrent de l’absence généralisée d’évaluation du succès et de retours d’expérience sur le développement des espèces et la tenue des différentes techniques. Cet article présente la démarche adoptée ainsi que les principaux résultats du suivi du réaménagement des berges de la Romanche au barrage de Livet, réalisé avec des techniques mixtes associant enrochements et différentes techniques de génie végétal.

Ortaöğretim dokuzuncu sınıf matematik ders kitabına ilişkin öğretmen ve öğrenci görüşleri

OpenAIRE

Karaca Gün, Canan

2009-01-01

Bu araştırmanın amacı, ortaöğretim okullarının 9. sınıflarında okutulan matematik ders kitabına ilişkin öğretmen ve öğrenci görüşlerini belirlemektir. Araştırmanın çalışma evrenini, Aydın il merkezindeki toplam 19 ortaöğretim okulunda görev yapan matematik öğretmenleri ve bu okullarda öğrenim gören 9. sınıf öğrencileri oluşturmaktadır. Araştırmada nicel araştırma ve nitel araştırma yöntemleri birlikte kullanılarak, sayısal veriler sözel veriler ile desteklenmiştir. Örneklem seçimi iki farklı ...

Birinci basamak Helikobakter pilori eradikasyon tedavisinde 7 ve 14 günlük lansoprazol, amoksisilin, metronidazol protokolünün karşılaştırılması

OpenAIRE

UYGUN, Ahmet; KANTARCIOĞLU, Murat; POLAT, Zülfikar; KİLCİLER, Güldem; GÜLŞEN, Mustafa

2010-01-01

Giriş ve Amaç: Ülkemizde günümüzde birinci basamak Helikobakter pilori eradikasyon tedavisinde protokollerin süresi ve eradikasyon oranları konusunda tartışmalar sürmektedir. Bu çalışmadaki amacımız; nonülser dispepsili Helikobakter pilori pozitif hastalarda lansoprazol, amoksisilin, metronidazol'den oluşan 7 ve 14 günlük tedavi protokollerinin eradikasyon oranlarını karşılaştırmaktır. Gereç ve Yöntem: Çalışmaya Helikobakter pilori pozitif nonülser dispepsili 180 hasta (84 kadın,...

Comment on ‘Positron scattering in helium: Virtual-positronium resonances’ by G.P. Karwasz, D. Pliszka, A. Zecca, R.S. Brusa [Nucl. Instr. and Meth. B 240 (2005) 666

Science.gov (United States)

Zecca, Antonio

2006-10-01

A recent paper [G.P. Karwasz, D. Pliszka, A. Zecca, R.S. Brusa, Nucl. Instr. and Meth. B 240 (2005) 666] claims the observation of scattering resonances in the total cross section for positron scattering from helium. In this comment we question the reality of such resonances. Our discussion will be based on the detailed knowledge of the general capabilities of the Trento spectrometer and will be invigorated by new checks we have made on the measurement procedure employed in [G.P. Karwasz, D. Pliszka, A. Zecca, R.S. Brusa, Nucl. Instr. and Meth. B 240 (2005) 666]. We conclude that the observed structures are most likely an experimental artefact rather than being due to the positron-helium interaction.

Fabrication and Enhanced Photoelectrochemical Performance of MoS₂/S-Doped g-C₃N₄ Heterojunction Film.

Science.gov (United States)

Ye, Lijuan; Wang, Dan; Chen, Shijian

2016-03-02

We report on a novel MoS2/S-doped g-C3N4 heterojunction film with high visible-light photoelectrochemical (PEC) performance. The heterojunction films are prepared by CVD growth of S-doped g-C3N4 film on indium-tin oxide (ITO) glass substrates, with subsequent deposition of a low bandgap, 1.69 eV, visible-light response MoS2 layer by hydrothermal synthesis. Adding thiourea into melamine as the coprecursor not only facilitates the growth of g-C3N4 films but also introduces S dopants into the films, which significantly improves the PEC performance. The fabricated MoS2/S-doped g-C3N4 heterojunction film offers an enhanced anodic photocurrent of as high as ∼1.2 × 10(-4) A/cm(2) at an applied potential of +0.5 V vs Ag/AgCl under the visible light irradiation. The enhanced PEC performance of MoS2/S-doped g-C3N4 film is believed due to the improved light absorption and the efficient charge separation of the photogenerated charge at the MoS2/S-doped g-C3N4 interface. The convenient preparation of carbon nitride based heterojunction films in this work can be widely used to design new heterojunction photoelectrodes or photocatalysts with high performance for H2 evolution.

The identity of Plectomirtha Oliv. with Pennantia J. R. & G. Forster (Icacinaceae)

NARCIS (Netherlands)

Sleumer, H.

1970-01-01

In 1948, W. B. R. Oliver described the new monotypic genus Plectomirtha, collected by G. T. S. Baylis in 1945 from a single tree on a small rocky islet of the Three King’s Islands off New Zealand. He placed it in the Anacardiaceae, a family hitherto absent from New Zealand. This aroused a certain

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

Science.gov (United States)

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

Bağlam temelli öğrenme ile lise fizik derslerinde kullanılabilecek günlük hayattan konular [Daily life subjects that can be used with context based learning in high school physics lessons

Directory of Open Access Journals (Sweden)

Ali ÇETİN

2014-04-01

Full Text Available Bu çalışmanın amacı bağlam temelli öğrenme sırasında kullanılabilecek günlük hayattan konuların belirlenmesi, bu konuların sınıf seviyelerine ve cinsiyetlere göre sınıflandırmasının yapılmasıdır. Çalışmada nitel araştırma yöntemi kullanılmıştır. Veri analizinde içerik analizi, yüzde ve frekans analizi gibi betimsel analizler kullanılmıştır. Bilgiler belirli kriterlere göre kategoriler halinde gruplandırılmış ve sayısal, yüzdesel ve oransal olarak görülme sıklığı ortaya konmuştur. Çalışmaya Ankara il sınırları içerisindeki bir okulun 9., 10. ve 11. sınıflarında okuyan 94 öğrenci katılmıştır ve günlük hayata ilişkin fizik konularında ayrı ayrı birer poster hazırlamaları istenmiştir. Toplanan posterler konu başlıklarına, sınıf seviyelerine ve cinsiyetlere göre sınıflandırılarak alt kategoriler oluşturulmuştur. Her alt kategoride hazırlanan poster sayıları kullanılarak, öğrencilerin bu alt başlığa olan ilgileri ortaya konmuştur. Başlıklar kullanılarak oluşturulan alt kategoride fizik dersindeki sekiz konu başlığı (mekanik, elektrik, uçan cisimler, astronomi ve uzay, gökyüzü, modern fizik, optik, dalgalar ortaya çıkmıştır. Sınıf seviyeleri kullanılarak oluşturulan alt kategoriye göre 9. sınıf öğrencilerinin en fazla gökyüzü, 10. sınıf öğrencilerinin en fazla astronomi ve uzay konularına ilgi duydukları ortaya çıkmıştır. Cinsiyete göre yapılan sınıflandırmada ise 9. sınıflarda sadece erkek öğrencilerin uçan cisimler konusunu seçtiği, mekanik, astronomi ve uzay konularında erkeklerin ilgilerinin kızlara göre daha yüksek olduğu, dalgalar konusunda ise kızların erkeklerden daha çok ilgi duydukları ortaya çıkmıştır. Çalışmanın sonuç kısmında ortaöğretim fizik programı ile öğrencilerin fizik derslerinde görmek istedikleri konuların benzerlik ve farklılıkları karşılaştırılmıştır.

Using the measurement technique by G. P. S. satellite for mining exploitations; Utilizacion de la Tecnica de Medicion por Satelite G. P. S. para la Demarcacion y Deslinde de Concesiones Mineras

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-12-31

This project attempts to establish a methodology for the use of the global positioning techniques for the G. P. S. satellite, within the limits and allowances of investigation and exploitation in geological resources. The concessions to be limited may be old fashioned or restricted, modern or square metred surface. In the first case the implantation required G. P. S. receptors, coordinated in the points which were used as references and via calculations from the total coordinates from the starting point and the corners of the concession, so that they can later be reimplanted on the land. In the second case, the intention is reimplant the points situated in the limites of the mining concessions whose geographic coordiantes are know ({lambda},{phi}) referring to Hayford ellipsoid. In both cases a working method using a combination of techniques G. P. S. receptors and topographical instruments is required or the use of G. P. S. receptors in real time. (Author)

Using the measurement technique by G. P. S. satellite for mining exploitations; Utilizacion de la Tecnica de Medicion por Satelite G. P. S. para la Demarcacion y Deslinde de Concesiones Mineras

Energy Technology Data Exchange (ETDEWEB)

NONE

1999-12-31

This project attempts to establish a methodology for the use of the global positioning techniques for the G. P. S. satellite, within the limits and allowances of investigation and exploitation in geological resources. The concessions to be limited may be old fashioned or restricted, modern or square metred surface. In the first case the implantation required G. P. S. receptors, coordinated in the points which were used as references and via calculations from the total coordinates from the starting point and the corners of the concession, so that they can later be reimplanted on the land. In the second case, the intention is reimplant the points situated in the limites of the mining concessions whose geographic coordiantes are know ({lambda},{phi}) referring to Hayford ellipsoid. In both cases a working method using a combination of techniques G. P. S. receptors and topographical instruments is required or the use of G. P. S. receptors in real time. (Author)

Quantification of homocysteine-related metabolites and the role of betaine-homocysteine S-methyltransferase in HepG2 cells

Czech Academy of Sciences Publication Activity Database

Kořínek, M.; Šístek, V.; Mládková, Jana; Mikeš, P.; Jiráček, Jiří; Selicharová, Irena

2013-01-01

Roč. 27, č. 1 (2013), s. 111-121 ISSN 0269-3879 R&D Projects: GA ČR(CZ) GAP207/10/1277 Institutional support: RVO:61388963 Keywords : homocysteine * BHMT * LC-MS/MS * HepG2 * metabolites Subject RIV: CE - Biochemistry Impact factor: 1.662, year: 2013

Ranking Iranian biomedical research centers according to H-variants (G, M, A, R) in Scopus and Web of Science.

Science.gov (United States)

Mahmudi, Zoleikha; Tahamtan, Iman; Sedghi, Shahram; Roudbari, Masoud

2015-01-01

We conducted a comprehensive bibliometrics analysis to calculate the H, G, M, A and R indicators for all Iranian biomedical research centers (IBRCs) from the output of ISI Web of Science (WoS) and Scopus between 1991 and 2010. We compared the research performance of the research centers according to these indicators. This was a cross-sectional and descriptive-analytical study, conducted on 104 Iranian biomedical research centers between August and September 2011. We collected our data through Scopus and WoS. Pearson correlation coefficient between the scientometrics indicators was calculated using SPSS, version 16. The mean values of all indicators were higher in Scopus than in WoS. Drug Applied Research Center of Tabriz University of Medical Sciences had the highest number of publications in both WoS and Scopus databases. This research center along with Royan Institute received the highest number of citations in both Scopus and WoS, respectively. The highest correlation was seen between G and R (.998) in WoS and between G and R (.990) in Scopus. Furthermore, the highest overlap of the 10 top IBRCs was between G and H in WoS (100%) and between G-R (90%) and H-R (90%) in Scopus. Research centers affiliated to the top ranked Iranian medical universities obtained a better position with respect to the studied scientometrics indicators. All aforementioned indicators are important for ranking bibliometrics studies as they refer to different attributes of scientific output and citation aspects.

La migration des hydrocarbures dans les bassins sédimentaires: aspects géologiques et géochimiques Migration of Hydrocarbons in Sedimentary Basins: Geological and Geochemical Aspects

OpenAIRE

Tissot B. P.

2006-01-01

La migration du pétrole vers les réservoirs et les pièges, et particulièrement son expulsion hors de la roche-mère où il s'est formé (migration primaire), est demeurée longtemps un des problèmes les plus mal connus de toute la géologie pétrolière. Le déplacement du pétrole et du gaz s'effectue en phase hydrocarbure séparée. L'eau, souvent considérée comme le véhicule du pétrole dans la migration, joue en fait un rôle négatif : il faut que la saturation en eau ait suffisamment diminué (par exp...

40 CFR 63.465 - Test methods.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Test methods. 63.465 Section 63.465... Halogenated Solvent Cleaning § 63.465 Test methods. (a) Except as provided in paragraphs (f) and (g) of this... Reference Method 307 in appendix A of this part. (b) Except as provided in paragraph (g) of this section for...

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

Czech Academy of Sciences Publication Activity Database

Garcia, S.; Kovařík, Aleš

2013-01-01

Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013

Symplectic S5 action on symplectic homotopy K3 surfaces

Indian Academy of Sciences (India)

HONGXIA LI

Let X be a symplectic homotopy K3 surface and G = S5 act on X symplectically. In this paper, we give a weak classification of the G action on X by discussing the fixed-point set structure. Besides, we analyse the exoticness of smooth structures of X under the action of G. Keywords. K3 surfaces; symplectic actions; exotic ...

Turen går til Second Life

DEFF Research Database (Denmark)

Christensen, Inger-Marie F.

2009-01-01

Artiklen giver et overblik over Second Life for at gøre det lettere for især nybegyndere at orientere sig og planlægge mere målrettede og dermed succesfulde besøg i den virtuelle verden. Artiklen går ikke i dybden men forsyner læseren med en indledende begrebsafklaring, fakta, praktiske oplysninger...... og links til yderligere information. Sidste del af artiklen indeholder slurls til og beskrivelser af interessant steder i Second Life, som er et besøg værd....

2e Congrès de recherche en médecine générale

OpenAIRE

2009-01-01

Le développement de la recherche en soins primaires effectuée par des généralistes est un fait récent en France. Il s’inscrit dans un processus de reconnaissance de la médecine générale en tant que discipline scientifique, après l’étape de son enseignement à la faculté. Dans l’esprit des organisateurs, initiateurs du mouvement de légitimation de la médecine générale comme discipline médicale à part entière, il s’agit moins de produire des connaissances et des savoirs spécifiques que d’évaluer...

Kriz Dönemlerinde Türk Bankacılık Sektörünün Toplam Faktör Verimlilik Değişimi

Directory of Open Access Journals (Sweden)

Ferda Keskin Önen

2016-10-01

Full Text Available Bankaların etkinliğini arttırabilmenin ön koşulu rekabet edilebilirliktir. Rekabet gücü yüksek bankacılık sektörü ile ekonomik dinamizm arttırılır ve ekonomik istikrar ortamı sağlanır. Makro ekonomik koşullardaki değişim, bankacılık sektörünün performansını ve finansal istikrarı etkilemektedir. Bu çalışmada 1990 - 2012 döneminde faaliyet gösteren 19 mevduat bankasının aracılık ve karlılık yaklaşımına göre etkinliklerini analiz etmek için Malmquist Verimlilik Endeksi kullanılmıştır. Bankalar, kriz dönemlerinde her iki yaklaşıma göre de verimlilik kaybı yaşamıştır. Kriz sonrası dönemde karlılık yaklaşımına göre büyük ölçekli bankaların verimlilik kaybının daha düşük olduğu görülmektedir. Bankaların aracılık fonksiyonunun etkinliği; bankacılık sektörü yeniden yapılandırma programı dahilinde yapılan regülasyonlar ve dezenflasyon süreci dolayısıyla artmıştır. Bankalar, kriz dönemlerinde her iki yaklaşıma göre de verimlilik kaybı yaşamıştır. karlılık yaklaşımına göre büyük ölçekli bankaların verimlilik kaybının kriz sonrası dönemde daha düşük olduğu görülmektedir. bankacılık sektöründe aracılık fonksiyonunun etkinliği; bankacılık sektörü yeniden yapılandırma programı dahilinde yapılan regülasyonlar ve dezenflasyon süreci dolayısıyla artmıştır. Regresyon analizi sonuçları; mevduatın krediye dönüşüm oranı, ROA, ROE ve TUFE oranının bankaların toplam faktör verimliliğine etkisinin pozitif olduğunu göstermektedir. Aracılık yaklaşımına göre ROE artınca, bankaların toplam faktör verimliliği azalmıştır. Aracılık ve karlılık yaklaşımına göre GSYH oranındaki artış bankaların teknik etkinliklerinde artışa yol açmıştır.

The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

DEFF Research Database (Denmark)

Liu, M; Kirpekar, F; Van Wezel, G P

2000-01-01

tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

Search for B^0 meson decays to \\pi^0 K^0_S K^0_S, \\eta K^0_S K^0_S, and \\eta^{\\prime}K^0_S K^0_S

Energy Technology Data Exchange (ETDEWEB)

Aubert, B.

2009-05-08

We describe searches for B{sup 0} meson decays to the charmless final states {pi}{sup 0}K{sub S}{sup 0}K{sub S}{sup 0}, {eta}K{sub S}{sup 0}K{sub S}{sup 0}, and {eta}{prime}K{sub S}{sup 0}K{sub S}{sup 0}. The data sample corresponds to 467 x 10{sup 6} B{bar B} pairs produced in e{sup +}e{sup -} annihilation and collected with the BABAR detector at the SLAC National Accelerator Laboratory. We find no significant signals and determine the 90% confidence level upper limits on the branching fractions, in units of 10{sup -7}, {Beta}(B{sup 0} {yields} {pi}{sup 0}K{sub S}{sup 0}K{sub S}{sup 0}) < 12, {Beta}(B{sup 0} {yields} {eta}K{sub S}{sup 0}K{sub S}{sup 0}) < 10, and {Beta}(B{sup 0} {yields} {eta}{prime}K{sub S}{sup 0}K{sub S}{sup 0}) < 20.

Estimation of S/G ratio in woods using 1064 nm FT-Raman spectroscopy

Science.gov (United States)

Umesh P. Agarwal; Sally A. Ralph; Dharshana Padmakshan; Sarah Liu; Steven D. Karlen; Cliff Foster; John Ralph

2015-01-01

Two simple methods based on the 370 cm-1 Raman band intensity were developed for estimation of syringyl-to-guaiacyl (S/G) ratio in woods. The methods, in principle, are representative of the whole cell wall lignin and not just the portion of lignin that gets cleaved to release monomers, for example, during certain S/G chemical analyses. As such,...

The importance of G1/S-border and mitosis in the fixation

International Nuclear Information System (INIS)

Iliakis, G.; Nuesse, M.

1983-01-01

The ability of synchronized Ehrlich ascites tumour cells to repair PLD was measured by introducing delays in their progression through the cell cycle either in the same phase as that where the irradiation was given or in a subsequent phase. Cells were incubated for this purpose either in balanced salt solution which nonspecifically delayed progression in all cell cycle phases or with 0.5 μg/ml aphidicolin which delayed cells in S-phase. Cells which had been delayed in their progression through the cell cycle were able to repair PLD irrespective of the phase at which they were held. In cases where the delay in the progression through the cell cycle was introduced in a phase subsequent to that of the exposure to irradiation, repair of PLD was observed only if the cells had not passed the G1/S-border or mitosis. Based on these results, the importance of G1/S-border and mitosis in the fixation of PLD is suggested. (orig.)

Aglycemia keeps mitochondrial oxidative phosphorylation under hypoxic conditions in HepG2 cells

Czech Academy of Sciences Publication Activity Database

Plecitá-Hlavatá, Lydie; Ježek, Jan; Ježek, Petr

2015-01-01

Roč. 47, č. 6 (2015), s. 467-476 ISSN 0145-479X R&D Projects: GA ČR(CZ) GAP302/10/0346; GA ČR(CZ) GA13-02033S; GA MŠk(CZ) LH11055 Institutional support: RVO:67985823 Keywords : cancer mitochondria * non-canonical response to hypoxia * hypoxia-inducible factor * glutaminolysis * HepG2 cell s Subject RIV: ED - Physiology Impact factor: 2.080, year: 2015

Når dataindsamlingen går online

DEFF Research Database (Denmark)

Larsen, Malene Charlotte

2012-01-01

Internettet er i dag blevet essentielt for mange forskere; både som forskningsobjekt, dataindsamlings-værktøj, kommunikationsplatform, samlingssted eller publiceringskanal. I dette kapitel skal vi se på, hvad der sker, når dataindsamlingen går online, og vi studerer internetbaserede praksisser...

Matematikaoktatás a bolognai típusú gazdasági képzésekben (Maths instruction in Bologna-type economics tuition)

OpenAIRE

Kánnai, Zoltán; Pintér, Miklós; Tasnádi, Attila

2010-01-01

A gazdálkodási és közgazdasági alap- és mesterszakok tanterveiben számos matematikai tárgy szerepel. A kétciklusú bolognai képzésre történő áttérés Európa-szerte igényelte a matematikaoktatás szerkezetének, mennyiségének és mélységének újragondolását a gazdálkodási és közgazdasági képzési területeken. Mivel az átállás országonként és intézményenként párhuzamosan és jelentős mértékben egymástól függetlenül ment végbe, egyetemenként számos eltérő megoldással találkozhatunk. Az egyetemek operatí...

Rubinstein S. L., Osnovy obshchei psikhologii (Les fondements de la psychologie générale. Professionnalisation et développement professionnel

Directory of Open Access Journals (Sweden)

Ludmila Namolovan-Stephan

2011-06-01

Full Text Available L’ouvrage classique en langue russe « Les fondements de la psychologie générale » de S.L. Rubinstein appartient aux œuvres les plus reconnues de la psychologie russe. L’étendue des généralisations théoriques, l’envergure encyclopédique du matériel historique et expérimental, la clarté des principes méthodologiques exposés ont fait de cet ouvrage une référence pour plusieurs générations de psychologues, pédagogues et philosophes.Cet ouvrage présente trois intérêts majeurs :D’abord, il intègre ...

G+K 1Σ+/sub g/ double-minimum excited state of H2

International Nuclear Information System (INIS)

Glover, R.M.; Weinhold, F.

1977-01-01

We have obtained a Born--Oppenheimer potential curve for the previously uncharacterized third 1 Σ + /sub g/ state of H 2 , using a correlated 20-term wavefunction of generalized James--Coolidge type. We find this potential curve to have a double-minimum character, with the inner (Rydberg-like) and outer (''ionic'') wells having minima at about 1.99 and 3.30 bohr, respectively, and an intervening maximum at 2.76 bohr. Unlike the extensively studied E+F double-minimum state, the outer well here appears to be the deeper, by some 450 cm -1 in our calculation. The inner and outer minima can apparently be associated with spectral lines that in experimental tables have previously been attributed to distinct G and K electronic states. The appropriate spectroscopic term symbol of this combined state is accordingly G+K 1 Σ + /sub g/ (1ssigma3dsigma+2pπ 2 )

Several classes of graphs and their r-dynamic chromatic numbers

Science.gov (United States)

Dafik; Meganingtyas, D. E. W.; Dwidja Purnomo, K.; Dicky Tarmidzi, M.; Hesti Agustin, Ika

2017-06-01

Let G be a simple, connected and undirected graph. Let r, k be natural numbers. By a proper k-coloring of a graph G, we mean a map c : V (G) → S, where |S| = k, such that any two adjacent vertices receive different colors. An r-dynamic k-coloring is a proper k-coloring c of G such that |c(N(v))| ≥ min{r, d(v)} for each vertex v in V (G), where N(v) is the neighborhood of v and c(S) = {c(v) : v ∈ S} for a vertex subset S. The r-dynamic chromatic number, written as χ r (G), is the minimum k such that G has an r-dynamic k-coloring. By simple observation it is easy to see that χ r (G) ≤ χ r+1(G), however χ r+1(G) - χ r (G) does not always show a small difference for any r. Thus, finding an exact value of χ r (G) is significantly useful. In this paper, we will study some of them especially when G are prism graph, three-cyclical ladder graph, joint graph and circulant graph.

Status and strategy for technical nuclear cooperation between R.O.K. and U.S.A

International Nuclear Information System (INIS)

Kim, Kyoung Pyo; Hong, Young Don

1998-06-01

The seven Joint Coordinating Committees between R.O.K. and other countries, including the U.S. are currently in operation. Among these, the most amicable and fruitful one is the R.O.K.-U.S.A. Joint Standing Committee on Nuclear Energy Cooperation(JSCNEC). It is a prerequisite to assess the current status of international joint research which is under way for the effective implementation of international cooperation. It is anticipated that this can be realized by devising continuous follow-up measures based on its assessment and smooth feedback. Various matters encompassing 8 policy matters, 14 technological cooperation matters, 13 nuclear safety cooperation matters and 6 safeguards matters were discussed at the 19th R.O.K.-U.S.A. JSCNEC held June 22-26 in Seoul and Taejon. Among these, matters related to KAERI are the 13 technical cooperation and 2 nuclear safety cooperation concerns. The background and current status of matters in the technical cooperation and nuclear safety cooperation areas as well as our position and discussion direction for each item, with a review of the summary record of the 18th R.O.K.-U.S.A. JSCNEC are presented in this report. At the same time, its publication is meaningful in that after this committee meeting, a status of nuclear technological and safety cooperation between R.O.K. and U.S., which are related to KAERI, has been complied and is clear at a glance. This will be a review of the discussion results from the 19th R.O.K.-U.S.A. JSCNEC. After its publication, we intend to implement a bilateral cooperation with the U.S. more effectively by devising follow-up measures for each issue. This will be achieved through a thorough management of its progress and systematic cooperation in work affairs between personnel of the government and KAERI responsible for bilateral cooperation with the U.S. (author)

gDsDK*0 and gBsDK*0 coupling constants in QCD sum rules

International Nuclear Information System (INIS)

Şahin, S; Sundu, H; Azizi, K

2012-01-01

In the present study, we calculate the strong coupling constants g D s DK* 0 (800) and g B s DK* 0 (800) within the three-point QCD sum rules approach. We evaluate the correlation function of the considered vertices taking into account both D[B] and K* 0 (800) mesons as off-shell states.

G2S: A web-service for annotating genomic variants on 3D protein structures.

Science.gov (United States)

Wang, Juexin; Sheridan, Robert; Sumer, S Onur; Schultz, Nikolaus; Xu, Dong; Gao, Jianjiong

2018-01-27

Accurately mapping and annotating genomic locations on 3D protein structures is a key step in structure-based analysis of genomic variants detected by recent large-scale sequencing efforts. There are several mapping resources currently available, but none of them provides a web API (Application Programming Interface) that support programmatic access. We present G2S, a real-time web API that provides automated mapping of genomic variants on 3D protein structures. G2S can align genomic locations of variants, protein locations, or protein sequences to protein structures and retrieve the mapped residues from structures. G2S API uses REST-inspired design conception and it can be used by various clients such as web browsers, command terminals, programming languages and other bioinformatics tools for bringing 3D structures into genomic variant analysis. The webserver and source codes are freely available at https://g2s.genomenexus.org. g2s@genomenexus.org. Supplementary data are available at Bioinformatics online. © The Author (2018). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

Czech Academy of Sciences Publication Activity Database

Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

2017-01-01

Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

ROLE OF PI3K-AKT-mTOR AND Wnt SIGNALING PATHWAYS IN G1-S TRANSITION OF CELL CYCLE IN CANCER CELLS

Directory of Open Access Journals (Sweden)

LAKSHMIPATHI eVADLAKONDA

2013-04-01

Full Text Available The PI3K–Akt pathway together with one of its downstream targets, the mechanistic target of rapamycin (mTOR is a highly deregulated pathway in cancers. There is a reciprocal relation between the Akt phosphorylation and mTOR complexes. Akt phosphorylated at T308 activates mTORC1 by inhibition of the tuberous sclerosis complex (TSC1/2, where as mTORC2 is recognized as the kinase that phosphorylates Akt at S473. Recent developments in the research on regulatory mechanisms of autophagy places mTORC1 mediated inhibition of autophagy at the central position in activation of proliferation and survival pathways in cells. Autophagy is a negative regulator of Wnt signaling pathway and the downstream effectors of Wnt signaling pathway, cyclin D1 and the c-Myc, are the key players in initiation of cell cycle and regulation of the G1-S transition in cancer cells. Production of reaction oxygen species (ROS, a common feature of a cancer cell metabolism, activates several downstream targets like the transcription factors FoxO, which play key roles in promoting the progression of cell cycle. A model is presented on the role of PI3K -Akt - mTOR and Wnt pathways in regulation of the progression of cell cycle through Go-G1-and S phases.

Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

Science.gov (United States)

2016-11-01

proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with

International Advisory Committee B Barish, Caltech S Ozaki, BNL S ...

Indian Academy of Sciences (India)

National Organizing Committee. Tariq Aziz, TIFR, Mumbai. N K Mondal, TIFR, Mumbai. Sunanda Banerjee, TIFR, Mumbai. B Mukhopadhyaya, HRI, Allahabad. Rahul Basu, IMSc, Chennai. G Rangarajan, IISc, Bangalore. R K Bhandari, VECC, Kolkata. S Raychaudhury, IIT, Kanpur. Debajyoti Choudhury, Delhi University S ...

Solvothermal synthesis of Zinc sulfide decorated Graphene (ZnS/G) nanocomposites for novel Supercapacitor electrodes

International Nuclear Information System (INIS)

Ramachandran, Rajendran; Saranya, Murugan; Kollu, Pratap; Raghupathy, Bala P.C.; Jeong, Soon Kwan; Grace, Andrews Nirmala

2015-01-01

Highlights: • ZnS/G nanocomposites were prepared by a simple solvothermal process. • Electrochemical measurements were carried out in 6 M KOH electrolyte. • Cyclic voltammetry showed the excellent capacitive behavior of the composites. • A specific capacitance of 197.1 F/g was observed for ZnS/G-60 nanocomposites. - Abstract: Zinc sulfide decorated graphene nanocomposites are synthesized by a facile solvothermal approach and the prepared composites are analyzed by X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), High Resolution Transmission electron microscopy (HRTEM), Fourier transform infrared (FTIR), Ultraviolet visible spectroscopy (UV), Photoluminescence spectroscopy (PL) and Raman spectrum. Results show the effective reduction of graphene oxide (GO) to graphene and decoration of ZnS nanoparticles on graphene sheets. Towards supercapacitor applications, the electrochemical measurements of different electrodes are performed in 6 M KOH electrolyte. A series of composites with different loadings of graphene is synthesized and tested for its electrochemical properties. The specific capacitance of the electrodes are evaluated from cyclic voltammetry (CV) studies and a maximum specific capacitance of 197.1 F/g is achieved in ZnS/G-60 electrode (60 indicates the weight ratio of GO) at scan rate of 5 mV s"−"1. A capacitance retention of about 94.1% is observed even after 1000 cycles for ZnS/G-60 electrode, suggesting the long time cyclic stability of the composite electrode. Galvanostatic charge–discharge curves show the highly reversible process of ZnS/G-60 electrode. Electrochemical Impedance Spectrum (EIS) shows a high conductivity of composite electrode suggesting that the composites are good candidates for energy storage.

Expression of G(alpha)(s) proteins and TSH receptor signalling in hyperfunctioning thyroid nodules with TSH receptor mutations.

Science.gov (United States)

Holzapfel, Hans-Peter; Bergner, Beate; Wonerow, Peter; Paschke, Ralf

2002-07-01

Constitutively activating mutations of the thyrotrophin receptor (TSHR) are the main molecular cause of hyperfunctioning thyroid nodules (HTNs). The G protein coupling is an important and critical step in the TSHR signalling which mainly includes G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins. We investigated the in vitro consequences of overexpressing G(alpha) proteins on signalling of the wild-type (WT) or mutated TSHR. Moreover, we investigated whether changes in G(alpha) protein expression are pathophysiologically relevant in HTNs or cold thyroid nodules (CTNs). Wild-type TSH receptor and mutated TSH receptors were coexpressed with G(alpha)(s), G(alpha)(i) or G(alpha)(q)/11, and cAMP and inositol phosphate (IP) production was measured after stimulation with TSH. The expression of G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins was examined by Western blotting in 28 HTNs and 14 CTNs. Coexpression of G(alpha)(s) with the WT TSH receptor in COS 7 cells significantly increased the basal and TSH-stimulated cAMP accumulation while coexpression of the G(alpha)(q) or G(alpha)11 protein significantly increased the production of cAMP and inositol triphosphate (IP(3)). The coexpression of the TSH receptor mutants (I486F, DEL613-621), known to couple constitutively to G(alpha)(s) and G(alpha)(q) with G(alpha)(s) and G(alpha)(q)/11, significantly increased the basal and stimulated cAMP and IP(3) accumulation. Coexpression of the TSH receptor mutant V556F with G(alpha)(s) only increased the basal and stimulated cAMP production while its coexpression with G(alpha)(q)/11 increased the basal and stimulated IP(3) signalling. The expression of G(alpha)(s) protein subunits determined by Western blotting was significantly decreased in 14 HTNs with a constitutively activating TSH receptor mutation in comparison with the corresponding surrounding tissue, while in 14 HTNs without TSH receptor or G(alpha)(s) protein mutation and in 14 CTNs the expression of G(alpha)(s

Proposed plan for the K-Area Bingham Pump Outage Pit (643-1G)

International Nuclear Information System (INIS)

Palmer, E.

1997-06-01

This Proposed Plan is issued by the U.S. Department of Energy (DOE), which functions as the lead agency for SRS remedial activities, and with concurrence by the U.S. Environmental Protection Agency (EPA) and the South Carolina Department of Health and Environmental Control (SCDHEC). The purpose of this Proposed Plan is to describe the preferred remedial alternative for addressing the K-Area Bingham Pump Outage Pit (643-1G) (K BPOP) located at the Savannah River Site (SRS) in Aiken, South Carolina and to solicit public comments on the preferred alternative

Les généraux de l’OAS à la prison de Tulle : réalités et rumeurs

Directory of Open Access Journals (Sweden)

Pierre Calvas

2012-05-01

Full Text Available L’histoire de certains établissements pénitentiaires reste indélébilement marquée par des événements sociopolitiques qui, au cours des années, prennent une dimension de mythe fondateur. Il en est ainsi de la maison d’arrêt de Tulle, en Corrèze, qui d’août 1961 à juin 1968 a reçu les officiers impliqués dans ce qu’on a communément appelé le « putsch des généraux ». Cette présence de hauts gradés de l’armée française (ils seront jusqu’à dix-huit a paradoxalement suscité peu d’intérêt de la par...

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

Des banques de gènes de maïs aident les petits agriculteurs à ...

International Development Research Centre (IDRC) Digital Library (Canada)

28 oct. 2010 ... Des banques de gènes de maïs aident les petits agriculteurs à ... On a ensuite permis aux agriculteurs d'avoir accès aux variétés provenant de ces banques de gènes, et ils ont ainsi pu produire par ... Articles connexes ...

Dopaminergic neuronal loss, reduced neurite complexity and autophagic abnormalities in transgenic mice expressing G2019S mutant LRRK2.

Directory of Open Access Journals (Sweden)

David Ramonet

2011-04-01

Full Text Available Mutations in the leucine-rich repeat kinase 2 (LRRK2 gene cause late-onset, autosomal dominant familial Parkinson's disease (PD and also contribute to idiopathic PD. LRRK2 mutations represent the most common cause of PD with clinical and neurochemical features that are largely indistinguishable from idiopathic disease. Currently, transgenic mice expressing wild-type or disease-causing mutants of LRRK2 have failed to produce overt neurodegeneration, although abnormalities in nigrostriatal dopaminergic neurotransmission have been observed. Here, we describe the development and characterization of transgenic mice expressing human LRRK2 bearing the familial PD mutations, R1441C and G2019S. Our study demonstrates that expression of G2019S mutant LRRK2 induces the degeneration of nigrostriatal pathway dopaminergic neurons in an age-dependent manner. In addition, we observe autophagic and mitochondrial abnormalities in the brains of aged G2019S LRRK2 mice and markedly reduced neurite complexity of cultured dopaminergic neurons. These new LRRK2 transgenic mice will provide important tools for understanding the mechanism(s through which familial mutations precipitate neuronal degeneration and PD.

G-factor for the K-6, Jsup(π) = 6+ isomer in 178Hf

International Nuclear Information System (INIS)

Faestermann, T.; Haeusser, O.; Ward, D.; Andrews, H.R.; Alexander, T.K.; Horn, D.

1978-01-01

High-K isomers are prevalent towards the end of the rare-earth region of deformed nuclei where the valence particles fill high Ω orbitals. Very little is known about the g-factors for these isomers mainly because in the half-life range encountered, 50 ns-50 μs, quadrupole and paramagnetic relaxation effects can destroy the nuclear alignment very rapidly. In 178 Hf a Isub(π)K=6 + 6 isomer with a half-life of 78 ns has recently been found. It decays predominantly to the ground band (K=O) 6 + and 4 + levels with gamma rays of 921.8 keV and 1247.3 keV respectively. The authors have measured the g-factor of this isomer with the method of perturbed angular distributions. (Auth.)

Role of ICAM-1 polymorphisms (G241R, K469E) in mediating its single-molecule binding ability: Atomic force microscopy measurements on living cells

Energy Technology Data Exchange (ETDEWEB)

Bai, Rui [Chinese (301) General Hospital, 28 Fuxing Road, Haidian District, Beijing 100853 (China); Yi, Shaoqiong [Beijing Institute of Biotechnology, 20 Dongdajie, Fengtai, Beijing 100071 (China); Zhang, Xuejie [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China); Liu, Huiliang, E-mail: lhl518@vip.sina.com [Department of Cardiology, The General Hospital of Chinese People’s Armed Police Forces, Beijing 100039 (China); Fang, Xiaohong, E-mail: xfang@iccas.ac.cn [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China)

2014-06-13

Highlights: • We evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations. • AFM was used to measure single-molecule binding ability on living cells. • The SNP of ICAM-1 may induce changes in expressions rather than single-molecule binding ability. - Abstract: Atherosclerosis (As) is characterized by chronic inflammation and is a major cause of human mortality. ICAM-1-mediated adhesion of leukocytes in vessel walls plays an important role in the pathogenesis of atherosclerosis. Two single nucleotide polymorphisms (SNPs) of human intercellular adhesion molecule-1 (ICAM-1), G241R and K469E, are associated with a number of inflammatory diseases. SNP induced changes in ICAM-1 function rely not only on the expression level but also on the single-molecule binding ability which may be affected by single molecule conformation variations such as protein splicing and folding. Previous studies have shown associations between G241R/K469E polymorphisms and ICAM-1 gene expression. Nevertheless, few studies have been done that focus on the single-molecule forces of the above SNPs and their ligands. In the current study, we evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations – GK (G241/K469), GE (G241/E469), RK (R241/K469) and RE (R241/E469). No difference in adhesion ability was observed via cell adhesion assay or atomic force microscopy (AFM) measurement when comparing the GK, GE, RK, or RE genotypes of ICAM-1 to each other. On the other hand, flow cytometry suggested that there was significantly higher expression of GE genotype of ICAM-1 on transfected CHO cells. Thus, we concluded that genetic susceptibility to diseases related to ICAM-1 polymorphisms, G241R or K469E, might be due to the different expressions of ICAM-1 variants rather than to the single-molecule binding ability of ICAM-1.

Szolgáltatásminőség fejlesztés a kiskereskedelemben. Egy lehetséges mérési modell és az arra épülő döntéstámogató rendszer alapjai = Improving service quality in retail trade. The premises of a potential measurement model and a decision support system based on it

OpenAIRE

Becser, Norbert

2008-01-01

A minőség – és ezen belül a szolgáltatások minősége – mára az egyik legfontosabb fogalommá vált a menedzsment szakirodalomban. A fogyasztói társadalom térnyerésével egyre inkább olyan termékek, illetve szolgáltatások iránt nőtt meg a kereslet, amelyek – a minőség egyik meghatározásával élve – a vevő által kimondott (sőt akár sok esetben még ki sem mondott) elvárásoknak megfelel. A kiélezett gazdasági versenyben a kiskereskedelmi szolgáltató szervezetek számára a versenyképesség fenntartásához...

Parkinson's disease-related LRRK2 G2019S mutation results from independent mutational events in humans.

Science.gov (United States)

Lesage, Suzanne; Patin, Etienne; Condroyer, Christel; Leutenegger, Anne-Louise; Lohmann, Ebba; Giladi, Nir; Bar-Shira, Anat; Belarbi, Soraya; Hecham, Nassima; Pollak, Pierre; Ouvrard-Hernandez, Anne-Marie; Bardien, Soraya; Carr, Jonathan; Benhassine, Traki; Tomiyama, Hiroyuki; Pirkevi, Caroline; Hamadouche, Tarik; Cazeneuve, Cécile; Basak, A Nazli; Hattori, Nobutaka; Dürr, Alexandra; Tazir, Meriem; Orr-Urtreger, Avi; Quintana-Murci, Lluis; Brice, Alexis

2010-05-15

Mutations in the leucine-rich-repeat kinase 2 (LRRK2) gene have been identified in families with autosomal dominant Parkinson's disease (PD) and in sporadic cases; the G2019S mutation is the single most frequent. Intriguingly, the frequency of this mutation in PD patients varies greatly among ethnic groups and geographic origins: it is present at <0.1% in East Asia, approximately 2% in European-descent patients and can reach frequencies of up to 15-40% in PD Ashkenazi Jews and North African Arabs. To ascertain the evolutionary dynamics of the G2019S mutation in different populations, we genotyped 74 markers spanning a 16 Mb genomic region around G2019S, in 191 individuals carrying the mutation from 126 families of different origins. Sixty-seven families were of North-African Arab origin, 18 were of North/Western European descent, 37 were of Jewish origin, mostly from Eastern Europe, one was from Japan, one from Turkey and two were of mixed origins. We found the G2019S mutation on three different haplotypes. Network analyses of the three carrier haplotypes showed that G2019S arose independently at least twice in humans. In addition, the population distribution of the intra-allelic diversity of the most widespread carrier haplotype, together with estimations of the age of G2019S determined by two different methods, suggests that one of the founding G2019S mutational events occurred in the Near East at least 4000 years ago.

THE POLICING OF MAJOR EVENTS IN CANADA: LESSONS FROM TORONTO’S G20 AND VANCOUVER’S OLYMPICS

Directory of Open Access Journals (Sweden)

Wes Pue

2015-10-01

tenue de grands événements, comme les événements sportifs ou les grandes conférences internationales, mène au chaos, au déploiement d’escouades anti-émeute et à des arrestations massives. Un retour sur les événements entourant la tenue d’un sommet du G20 à Toronto et des Jeux olympiques d’hiver de Vancouver nous donne un aperçu des choses qui peuvent bien fonctionner et des dérapages possibles à ces occasions. Dans le présent article, nous passons en revue ces événements afin d’explorer les lacunes que comporte le droit canadien, y compris les écarts entre le droit théorique et le droit pratique.      Les paramètres juridiques qui régissent les événements de grande envergure influent sur l’efficacité des mesures liées à la sécurité publique, à la restriction des risques de chaos et à la protection des libertés fondamentales. Fait étonnant, les grands événements se déroulent souvent sans qu’un cadre juridique ait été mis au point, ce qui mène à la confusion entre les autorités policières fédérales et locales et les autorités civiles. Nous nous penchons tour à tour sur l’application passée des règles de common law, d’un règlement de la ville de Vancouver, de la Loi sur la protection des ouvrages publics de l’Ontario et des dispositions relatives à la surveillance policière et à la sécurité de la Loi sur les missions étrangères et les organisations internationales (loi fédérale afin de déterminer les types de mesures juridiques les plus susceptibles d’assurer une gestion réussie des événements. Étant donné que les grands événements tenus au Canada sont planifiés le plus souvent dans la pénombre du droit, en l’absence d’une autorisation juridique ou de directives législatives claires régissant les mesures qui sont nécessaires, tant la gestion efficace que les libertés ordinaires sont compromises. Lorsque la situation dégénère et que le pire survient, les relations entre la

The G Allele of CaSR R990G Polymorphism Increases Susceptibility to Urolithiasis and Hypercalciuria: Evidences from a Comprehensive Meta-Analysis

Directory of Open Access Journals (Sweden)

Kang Liu

2015-01-01

Full Text Available Background. The calcium-sensing receptor gene (CaSR is a candidate to explain urolithiasis. A number of case-control studies were conducted to investigate associations between CaSR polymorphisms with risks of hypercalciuria and urolithiasis in humans. But the results were still inconsistent. Methods. A meta-analysis was performed to address this issue. Crude odds ratios (ORs with 95% confidence intervals (CIs were calculated to estimate the strength of associations between CaSR polymorphisms and the risk of urolithiasis. The pooled standardized mean difference (SMD with 95% CI was used for the meta-analysis of CaSR polymorphisms and urine calcium concentration. Results. For urolithiasis association, the SS genotype of A986S polymorphism was a risk factor for urolithiasis in Asians and PHPT patients, but a protective factor in Caucasians. The GG genotype of R990 polymorphism was associated with an increased risk of urolithiasis, especially in Caucasians and healthy population. Regarding urine calcium concentration association, individuals with the G allele had a higher level of urine calcium than the noncarriers. Conclusions. This meta-analysis revealed that the G allele of CaSR R990G polymorphism increases susceptibility to urolithiasis and hypercalciuria. The A986S and Q1011E polymorphisms were associated with urolithiasis and hypercalciuria in specific populations.

Crystal structure and magnetic properties of LaCa0.143 (4O0.857 (4F0.143 (4Bi0.857 (4S2

Directory of Open Access Journals (Sweden)

Rongtie Huang

2016-06-01

Full Text Available The synthesis, structure, and magnetic properties of lithium dibarium calcium oxide fluoride disulfide are reported. LaCa0.143 (4O0.857 (4F0.143 (4Bi0.857 (4S2 crystallizes in the tetragonal space group P4/nmm. The structure exhibits disorder of the Ca2+ and Bi3+ cations, and the O2− and F− anions. The structure is composed of a stacking of [(O,F2La2] layers and double [(Bi,CaS2] layers. Magnetic property measurements indicate a very small magnetization at 300 K and the existence of weak ferromagnetism at 2 K.

Alignement général du CLIC: stratégie et progrès

CERN Document Server

Mainaud-Durand, H

2008-01-01

La faisabilité concernant le pré-alignement actif du CLIC sera démontrée si l?on peut prouver qu?il existe une référence et ses capteurs associés permettant l?alignement des composants à mieux que 3 microns (1?). Pour répondre à ce challenge, une méthode de mesure d?écarts à un fil tendu est proposée, basée sur 40 ans de pratique de cette technique au CERN. Quelques problèmes demeurent concernant cette méthode : la connaissance de la forme du fil tendu utilisé comme référence droite, la détermination du géoïde à la précision souhaitée et le développement de capteurs bas coût permettant des mesures sub-micrométriques. Des études ont été entreprises afin de lever les derniers points en suspens, pendant que cette solution est intégrée dans une proposition concernant l?alignement général du CLIC. Cela implique un grand nombre d?interactions au niveau du projet, dans des domaines aussi différents que le génie civil, l?intégration, la physique du faisceau, la métrologie des �...

A. G. Tassin’s 1877 Manuscript Account of the Mohave Indians

OpenAIRE

Schaefer, Jerry; Laylander, Don

2014-01-01

U.S. Army Lieutenant A. G. Tassin, stationed on the lower Colorado River in 1877, prepared this previously unpublished account of the Mohave Indians. AlthoughTassin’s account re ects many of the ethnic stereotypes or misunderstandings of his era, it is among the earliest detailed ethnographic descriptions of the Mohave. It suggests interesting insights into their history, material culture, social organization, and belief systems.

The substructure of immunoglobulin G resolved to 25 kDa using amplitude modulation AFM in air

International Nuclear Information System (INIS)

Thomson, Neil H.

2005-01-01

Amplitude modulation (or tapping-mode) atomic force microscopy (AM AFM or TM AFM) in air can reveal sub-molecular details of isolated multi-subunit proteins, such as immunoglobulin G (IgG) antibodies, on atomically flat support surfaces such as mica [A. San Paulo, R. Garcia, Biophys. J. 78(3) (2000) 1599]. This is achieved by controlling the microscope imaging parameters (e.g. cantilever drive frequency and set-point amplitude) to keep the AFM tip predominantly in the attractive force regime. Under these conditions, the 50 kDa F c and F ab subunits can be resolved when the molecule has the appropriate orientation on the surface. The presence of a water layer on hydrophilic mica is an important factor affecting imaging contrast, a consequence of capillary neck formation between tip and surface [L. Zitzler, S. Herminghaus, F. Mugele, Phys. Rev. B 66(15) (2002) 155436]. Desiccation of samples to remove surface bound water layers can yield reproducible imaging of the IgG substructure [N.H. Thomson, J. Microsc. (Oxford) 217(3) (2004) 193]. This approach has also given higher resolution than previously achieved, down to about 25 kDa, and these data are detailed here. These subdomains are formed as two immunoglobulin folds from the light and heavy peptide chains of the IgG crossover. This result has been validated by comparing the AFM images with X-ray crystallography data from the protein data bank. These data show that the AFM can obtain 25 kDa resolution on isolated protein molecules with commercially available silicon tips, but, as expected for a local probe technique, resolution is highly dependent on the macromolecular orientation on the support surface

Multicolored spanning subgraphs in G-colorings of complete graphs

International Nuclear Information System (INIS)

Akbari, S.; Zare, S.

2007-08-01

Let G = {g 1 , ..., g n } be a finite abelian group. Consider the complete graph with the vertex set {g 1 , ..., g n }}. The G-coloring of K n is a proper edge coloring in which the color of edge {g i , g j } is g i + g j , l ≤ i ≤ j ≤ n. We prove that in the G-coloring of the complete graph K n , there exists a multicolored Hamilton path if G is not an elementary abelian 2-group. Furthermore, we show that if n is odd, then the G-coloring of K n can be decomposed into multicolored 2-factors and if l r is the number of elements of order r in G, 3 ≤ r ≤ n. then there are exactly (l r )/2 multicolored r-uniform 2-factors in this decomposition. This provides a generalization of a recent result due to Constantine which states: For any prime number p > 2, there exists a proper edge coloring of K p which is decomposable into multicolored Hamilton cycles. (author)

CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease by haploinsufficiency.

Science.gov (United States)

Brockmann, Sarah J; Freischmidt, Axel; Oeckl, Patrick; Müller, Kathrin; Ponna, Srinivas K; Helferich, Anika M; Paone, Christoph; Reinders, Jörg; Kojer, Kerstin; Orth, Michael; Jokela, Manu; Auranen, Mari; Udd, Bjarne; Hermann, Andreas; Danzer, Karin M; Lichtner, Peter; Walther, Paul; Ludolph, Albert C; Andersen, Peter M; Otto, Markus; Kursula, Petri; Just, Steffen; Weishaupt, Jochen H

2018-02-15

Mutations in the mitochondrially located protein CHCHD10 cause motoneuron disease by an unknown mechanism. In this study, we investigate the mutations p.R15L and p.G66V in comparison to wild-type CHCHD10 and the non-pathogenic variant p.P34S in vitro, in patient cells as well as in the vertebrate in vivo model zebrafish. We demonstrate a reduction of CHCHD10 protein levels in p.R15L and p.G66V mutant patient cells to approximately 50%. Quantitative real-time PCR revealed that expression of CHCHD10 p.R15L, but not of CHCHD10 p.G66V, is already abrogated at the mRNA level. Altered secondary structure and rapid protein degradation are observed with regard to the CHCHD10 p.G66V mutant. In contrast, no significant differences in expression, degradation rate or secondary structure of non-pathogenic CHCHD10 p.P34S are detected when compared with wild-type protein. Knockdown of CHCHD10 expression in zebrafish to about 50% causes motoneuron pathology, abnormal myofibrillar structure and motility deficits in vivo. Thus, our data show that the CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease primarily based on haploinsufficiency of CHCHD10. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Güney-Batı Anadolu Bölgesindeki kızılçam (Pinus brutia Ten. kültür ormanlarında değişik silvikültürel uygulamalara göre artım ve büyüme ilişkileri

Directory of Open Access Journals (Sweden)

Dr. Neşat Erkan

2017-11-01

Full Text Available Bu çalışma ile sıklık çağına gelmiş kızılçam ağaçlandırma alanlarında yapılacak değişik dozdaki ayıklamaların ve aralamaların, meşcere artım ve büyümesi üzerine olan etkilerinin incelenmesi amaçlanmıştır. Araştırma, 1982-2016 yılları arasında Kaş-Tekircik ve Eğirdir-Aşağı Narlı kızılçam ağaçlandırma alanı olmak üzere iki yerde yürütülmüştür. Rastlantı blokları deneme deseni kullanılmış; Kaş ve Eğirdir deneme alanlarında toplam 5 blok ve 35 parselden elde edilen veriler değerlendirilmiştir. Araştırmada aralama şiddeti işlem olarak; 1 kontrol, 2 mutedil aralama ve 3 şiddetli aralama şeklinde üç işlemli bir uygulama yapılmıştır. Deneme parsellerinde, kontrol parselleri hariç olmak üzere, 1990 ve 2004 yıllarında, meşcerenin ihtiyaç gösterdiği parsellerde ve düzeyde aralamalara devam edilmiştir. Araştırma sonucu; Meşcereye müdahale edilen parsellerde, 1985, 1990 ve 2004 yıllarında yapılan ölçme sonuçlarına göre Ortalama çapın, belirgin bir şekilde arttığını göstermiştir. Yine her iki yerde, toplam 5 blok üzerinden yapılan varyans analiz sonucunda, aralamaların göğüs yüzeyi ve kalan meşcere hacmi üzerinde p<0,05 anlamlılık düzeyinde etkili olduğu anlaşılmıştır. Parsellerde 44. yaşında, kalan meşcere hacmi için yapılan varyans analizi sonuçlarına göre, aralama şiddetinin kalan meşcere hacmi üzerinde etkili olduğu gözlenmiştir. Genel meşcere hacminin ise, yapılan istatistik analizler sonucunda p<0,05 anlamlılık düzeyinde, aralamalardan etkilenmediği sonucuna ulaşılmıştır. Sonuç olarak, kızılçam ormanlarında, işletme amaçları çerçevesinde, büyümeyi kaliteli gövdeler üzerinde toplamaya yönelik olarak, büyümenin hızlı olduğu genç yaşlarda, ekonomik açıdan da uygun olacağı düşüncesi ile müdahale sıklığını azaltmak ve bunun için de şiddetli aralama ile göğüs y

High frequency of mutation G377S in Brazilian type 3 Gaucher disease patients

Directory of Open Access Journals (Sweden)

R. Rozenberg

2006-09-01

Full Text Available Gaucher disease (GD, the most prevalent lysosome storage disorder, presents an autosomal recessive mode of inheritance. It is a paradigm for therapeutic intervention in medical genetics due to the existence of effective enzyme replacement therapy. We report here the analysis of GD in 262 unrelated Brazilian patients, carried out in order to establish the frequency of the most common mutations and to provide prognostic information based on genotype-phenotype correlations. Among 247 type 1 GD patients, mutation N370S was detected in 47% of all the alleles, but N370S/N370S homozygosity was found in only 10% of the patients, a much lower frequency than expected, suggesting that most individuals presenting this genotype may not receive medical attention. Recombinant alleles were detected at a high frequency: 44% of the chromosomes bearing mutation L444P had other mutations derived from the pseudogene sequence, present in 25% of patients. Three neuronopathic type 2 patients were homozygous for L444P, all presenting additional mutations (E326K or recombinant alleles that probably lead to the more severe phenotypes. Six children, classified as type 1 GD patients, had a L444P/L444P genotype, showing that neuronopathic symptoms may only manifest later in life. This would indicate the need for a higher treatment dose during enzyme replacement therapy. Finally, mutation G377S was present in 4 homozygous type 1 patients and also in compound heterozygosity in 5 (42% type 3 patients. These findings indicate that G377S cannot be unambiguously classified as mild and suggest an allele-dose effect for this mutation.

[(35)S]-GTPgammaS autoradiography reveals alpha(2) adrenoceptor-mediated G-protein activation in amygdala and lateral septum.

Science.gov (United States)

Newman-Tancredi, A; Chaput, C; Touzard, M; Millan, M J

2000-04-03

alpha(2)-adrenoceptor-mediated G-protein activation was examined by [(35)S]-GTPgammaS autoradiography. In alpha(2)-adrenoceptor-rich regions (amygdala, lateral septum), noradrenaline stimulated [(35)S]-GTPgammaS binding. These actions were abolished by the selective alpha(2) antagonist, atipamezole. Conversely, in caudate nucleus, which expresses few alpha(2) receptors, noradrenaline-induced stimulation was not inhibited by atipamezole, suggesting that it is not mediated by alpha(2)-adrenoceptors.

Arrest of irradiated G1, S, or G2 cells at mitosis using nocodazole promotes repair of potentially lethal damage

International Nuclear Information System (INIS)

Iliakis, G.; Nuesse, M.

1984-01-01

The ability of synchronized Ehrlich ascites tumor cells, irradiated in G1, S, and G2 phases, to repair potentially lethal damage when arrested at mitosis by using 0.4 μg/ml nocodazole, a specific inhibitor of microtubule polymerization, has been studied. Cells irradiated in these phases were found to repair potentially lethal damage at mitosis. The extent of this repair was similar to that observed for cells irradiated at the same stages in the cell cycle but allowed to repair potentially lethal damage by incubating in balanced salt solution for 6 hr after X irradiation

Isı geri kazanımı ve depolanmasında sıcaklık farklarının korunması için cam yünü ile donatılı tankların ısıl incelenmesi

Directory of Open Access Journals (Sweden)

Korhan Ökten

2016-08-01

Full Text Available Enerjinin verimli kullanımı için atık ısının veya yenilenebilir enerji kaynağı olan güneş enerjisi gibi sadece belli bir zaman periyodunda var olan ısının depolanması gerekmektedir. Bunun için ısıl kapasitesi yüksek olan su yaygın olarak depolama kütlesi olarak kullanılmaktadır. Bu çalışmada, depolama sırasında suyun taşınım akımlarını engellemek ve geri kazanılan ısının yüksek sıcaklıkta elde edilmesi için cam yünü ile emdirilmiş su kullanılmış ve test edilmiştir. Elde edilen sonuçlara göre, cam yünü ile emdirilmiş su kütlesinin katı cisim gibi davranmasından dolayı, ısının cam yünü olmayan depoya göre daha yüksek sıcaklıkta geri alınabildiği görülmüştür. Diğer taraftan, depolanan enerji miktarında azalma olduğu ve ısı geçişinin azaldığı belirlenmiştir.

Common low-density lipoprotein receptor p.G116S variant has a large effect on plasma low-density lipoprotein cholesterol in circumpolar inuit populations.

Science.gov (United States)

Dubé, Joseph B; Wang, Jian; Cao, Henian; McIntyre, Adam D; Johansen, Christopher T; Hopkins, Scarlett E; Stringer, Randa; Hosseinzadeh, Siyavash; Kennedy, Brooke A; Ban, Matthew R; Young, T Kue; Connelly, Philip W; Dewailly, Eric; Bjerregaard, Peter; Boyer, Bert B; Hegele, Robert A

2015-02-01

Inuit are considered to be vulnerable to cardiovascular disease because their lifestyles are becoming more Westernized. During sequence analysis of Inuit individuals at extremes of lipid traits, we identified 2 nonsynonymous variants in low-density lipoprotein receptor (LDLR), namely p.G116S and p.R730W. Genotyping these variants in 3324 Inuit from Alaska, Canada, and Greenland showed they were common, with allele frequencies 10% to 15%. Only p.G116S was associated with dyslipidemia: the increase in LDL cholesterol was 0.54 mmol/L (20.9 mg/dL) per allele (P=5.6×10(-49)), which was >3× larger than the largest effect sizes seen with other common variants in other populations. Carriers of p.G116S had a 3.02-fold increased risk of hypercholesterolemia (95% confidence interval, 2.34-3.90; P=1.7×10(-17)), but did not have classical familial hypercholesterolemia. In vitro, p.G116S showed 60% reduced ligand-binding activity compared with wild-type receptor. In contrast, p.R730W was associated with neither LDL cholesterol level nor altered in vitro activity. LDLR p.G116S is thus unique: a common dysfunctional variant in Inuit whose large effect on LDL cholesterol may have public health implications. © 2014 American Heart Association, Inc.

Enzymatic Inactivation of Endogenous IgG by IdeS Enhances Therapeutic Antibody Efficacy.

Science.gov (United States)

Järnum, Sofia; Runström, Anna; Bockermann, Robert; Winstedt, Lena; Crispin, Max; Kjellman, Christian

2017-09-01

Endogenous plasma IgG sets an immunologic threshold that dictates the activity of tumor-directed therapeutic antibodies. Saturation of cellular antibody receptors by endogenous antibody limits antibody-dependent cell-mediated cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP). Here, we show how enzymatic cleavage of IgG using the bacterial enzyme IdeS can be utilized to empty both high and low affinity Fcγ-receptors and clear the entire endogenous antibody pool. Using in vitro models, tumor animal models as well as ex vivo analysis of sera collected during a previous clinical trial with IdeS, we show how clearing of competing plasma antibody levels with IdeS unblocks cellular antibody receptors. We show that therapeutic antibodies against breast cancer (trastuzumab), colon cancer (cetuximab), and lymphomas (rituximab and alemtuzumab) can be potentiated when endogenous IgG is removed. Overall, IdeS is shown to be a potent tool to reboot the human antibody repertoire and to generate a window to preferentially load therapeutic antibodies onto effector cells and thereby create an armada of dedicated tumor-seeking immune cells. Mol Cancer Ther; 16(9); 1887-97. ©2017 AACR . ©2017 American Association for Cancer Research.

Common Low-Density Lipoprotein Receptor p.G116S Variant Has a Large Effect on Plasma Low-Density Lipoprotein Cholesterol in Circumpolar Inuit Populations

DEFF Research Database (Denmark)

Dube, J. B.; Wang, J.; Cao, H.

2015-01-01

.G116S and p.R730W. METHODS AND RESULTS: Genotyping these variants in 3324 Inuit from Alaska, Canada, and Greenland showed they were common, with allele frequencies 10% to 15%. Only p.G116S was associated with dyslipidemia: the increase in LDL cholesterol was 0.54 mmol/L (20.9 mg/dL) per allele (P=5.6x...

77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

Science.gov (United States)

2012-08-21

... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

G0S2: A small giant controller of lipolysis and adipose-liver fatty acid flux.

Science.gov (United States)

Zhang, Xiaodong; Heckmann, Bradlee L; Campbell, Latoya E; Liu, Jun

2017-10-01

The discovery of adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) provided a major paradigm shift in the understanding of intracellular lipolysis in both adipocytes and nonadipocyte cells. The subsequent discovery of G0/G1 switch gene 2 (G0S2) as a potent endogenous inhibitor of ATGL revealed a unique mechanism governing lipolysis and fatty acid (FA) availability. G0S2 is highly conserved in vertebrates, and exhibits cyclical expression pattern between adipose tissue and liver that is critical to lipid flux and energy homeostasis in these two tissues. Biochemical and cell biological studies have demonstrated that a direct interaction with ATGL mediates G0S2's inhibitory effects on lipolysis and lipid droplet degradation. In this review we examine evidence obtained from recent in vitro and in vivo studies that lends support to the proof-of-principle concept that G0S2 functions as a master regulator of tissue-specific balance of TG storage vs. mobilization, partitioning of metabolic fuels between adipose and liver, and the whole-body adaptive energy response. This article is part of a Special Issue entitled: Recent Advances in Lipid Droplet Biology edited by Rosalind Coleman and Matthijs Hesselink. Copyright © 2017 Elsevier B.V. All rights reserved.

Etat nutritionnel des enfants âgés de 6 à 59 mois infectés par le VIH mais non traités aux ARV à Lubumbashi

Science.gov (United States)

Mwadianvita, Costa Kazadi; Kanyenze, Faustin Ngoy; Wembonyama, Cecile Watu; Mutomb, Florence Mujing A; Mupoya, Kalombo; Nkoy, Albert Mwembo–Tambwe A; Mwenze, Prosper Kalenga

2014-01-01

Introduction L'infection par le VIH provoque et/ou aggrave les déficits nutritionnels de l'enfant. Ce travail avait pour objectif d'analyser l’état nutritionnel des enfants infectés par le VIH à Lubumbashi. Méthodes Une étude transversale portant sur 83 enfants âgés de 6 à 60 mois s'est déroulée de mai 2010 à mai 2011 dans trois(3) centres de prise en charge des Personnes Vivant avec le VIH(PVV), notamment le Centre d'Excellence(CE) de l'hôpital Sendwe, le Centre Amo-Congo de la Kenya et le Centre de Référence de la Kenya. Les statistiques descriptives usuelles ont été utilisées. Résultats La prévalence de la malnutrition globale était de 60,2% (n = 50) dont 8,4% de malnutrition sévère. Le poids moyen était de 11,6±4,1 kg avec un minimum de 5 kg et un maximum de 22 kg. Le taux d'hémoglobine moyen était d'environ 9,8± 2,0 g/dl avec une prévalence globale de l'anémie (hémoglobine VIH. La survenue de l'anémie n’était pas associée au déficit nutritionnel (p = 0,6). Conclusion Ces résultats révèlent que l'infection à VIH modifie l’état nutritionnel des enfants à Lubumbashi avec 60,2% de malnutrition globale et 8,4% de retard de croissance. Les enfants au stade avancé de l'infection à VIH en sont plus affectés. PMID:25574336

Project Plan 7930 Cell G PaR Remote Handling System Replacement

International Nuclear Information System (INIS)

Kinney, Kathryn A.

2009-01-01

For over 40 years the US Department of Energy (DOE) and its predecessors have made Californium-252 ( 252 Cf) available for a wide range of industries including medical, nuclear fuels, mining, military and national security. The Radiochemical Engineering Development Center (REDC) located within the Oak Ridge National Laboratory (ORNL) processes irradiated production targets from the High Flux Isotope Reactor (HFIR). Operations in Building 7930, Cell G provide over 70% of the world's demand for 252 Cf. Building 7930 was constructed and equipped in the mid-1960s. Current operations for 252 Cf processing in Building 7930, Cell G require use of through-the-wall manipulators and the PaR Remote Handling System. Maintenance and repairs for the manipulators is readily accomplished by removal of the manipulator and relocation to a repair shop where hands-on work can be performed in glove boxes. Contamination inside cell G does not currently allow manned entry and no provisions were created for a maintenance area inside the cell. There has been no maintenance of the PaR system or upgrades, leaving operations vulnerable should the system have a catastrophic failure. The Cell G PaR system is currently being operated in a run to failure mode. As the manipulator is now 40+ years old there is significant risk in this method of operation. In 2006 an assessment was completed that resulted in recommendations for replacing the manipulator operator control and power centers which are used to control and power the PaR manipulator in Cell G. In mid-2008 the chain for the bridge drive failed and subsequent examinations indicated several damaged links (see Figure 1). To continue operations the PaR manipulator arm is being used to push and pull the bridge as a workaround. A retrieval tool was fabricated, tested and staged inside Cell G that will allow positioning of the bridge and manipulator arm for removal from the cell should the PaR system completely fail. A fully functioning and

Diff(S1)/SL(2,R) and Teichmueller space

International Nuclear Information System (INIS)

Nag, S.; Verjovsky, A.

1988-08-01

It is shown that the unique homogeneous Kaehler metric carried by M=Diff(S 1 )/SL(2,R) induces the Weil-Petersson metric on the Teichmueller space. This is via our identification of M as a holomorphic submanifold of universal Teichmueller space T(1). The identification was obtained simply by noting that every diffeomorphism of S 1 is a quasisymmetric homeomorphism. Our computations allow us also to prove that every T(G), G any infinite Fuchsian group, projects out of M transversely. This last assertion is related to the ''fractal'' nature of G-invariant quasicircles. (author). 12 refs

Overexpression of catalase delays G0/G1- to S-phase transition during cell cycle progression in mouse aortic endothelial cells.

Science.gov (United States)

Onumah, Ogbeyalu E; Jules, George E; Zhao, Yanfeng; Zhou, LiChun; Yang, Hong; Guo, ZhongMao

2009-06-15

Although it is understood that hydrogen peroxide (H(2)O(2)) promotes cellular proliferation, little is known about its role in endothelial cell cycle progression. To assess the regulatory role of endogenously produced H(2)O(2) in cell cycle progression, we studied the cell cycle progression in mouse aortic endothelial cells (MAECs) obtained from mice overexpressing a human catalase transgene (hCatTg), which destroys H(2)O(2). The hCatTg MAECs displayed a prolonged doubling time compared to wild-type controls (44.0 +/- 4.7 h versus 28.6 +/- 0.8 h, pcatalase inhibitor, prevented the observed diminished growth rate in hCatTg MAECs. Inhibition of catalase activity with aminotriazole abrogated catalase overexpression-induced antiproliferative action. Flow cytometry analysis indicated that the prolonged doubling time was principally due to an extended G(0)/G(1) phase in hCatTg MAECs compared to the wild-type cells (25.0 +/- 0.9 h versus 15.9 +/- 1.4 h, pinhibitors, p21 and p27, which inhibit the Cdk activity required for the G(0)/G(1)- to S-phase transition. Knockdown of p21 and/or p27 attenuated the antiproliferative effect of catalase overexpression in MAECs. These results, together with the fact that catalase is an H(2)O(2) scavenger, suggest that endogenously produced H(2)O(2) mediates MAEC proliferation by fostering the transition from G(0)/G(1) to S phase.

Foam generation during G.S. [Girdler sulphide] process and its prevention

International Nuclear Information System (INIS)

Lammirato, Alberto; Rojo, Enrique.

1989-01-01

Available literature, from both foreign and local sources, regarding foam generation during Girdler Sulphide (G.S.) process operation, was compiled. Assembly and operation of a loop for hydraulic process conditions simulation, of which further tests are to be expected, is reported. (Author) [es

Revisiting r > g-The asymptotic dynamics of wealth inequality

Science.gov (United States)

Berman, Yonatan; Shapira, Yoash

2017-02-01

Studying the underlying mechanisms of wealth inequality dynamics is essential for its understanding and for policy aiming to regulate its level. We apply a heterogeneous non-interacting agent-based modeling approach, solved using iterated maps to model the dynamics of wealth inequality based on 3 parameters-the economic output growth rate g, the capital value change rate a and the personal savings rate s and show that for a income distribution. If a > g, the wealth distribution constantly becomes more and more inegalitarian. We also show that when a economic output, which also implies that the wealth-disposable income ratio asymptotically converges to s /(g - a) .

Toxicity and immunogenicity of Enterotoxigenic Escherichia coli heat-labile and heat-stable toxoid fusion 3xSTa(A14Q-LT(S63K/R192G/L211A in a murine model.

Directory of Open Access Journals (Sweden)

Chengxian Zhang

Full Text Available Diarrhea is the second leading cause of death to young children. Enterotoxigenic Escherichia coli (ETEC are the most common bacteria causing diarrhea. Adhesins and enterotoxins are the virulence determinants in ETEC diarrhea. Adhesins mediate bacterial attachment and colonization, and enterotoxins including heat-labile (LT and heat-stable type Ib toxin (STa disrupt fluid homeostasis in host cells that leads to fluid hyper-secretion and diarrhea. Thus, adhesins and enterotoxins have been primarily targeted in ETEC vaccine development. A recent study reported toxoid fusions with STa toxoid (STa(P13F fused at the N- or C-terminus, or inside the A subunit of LT(R192G elicited neutralizing antitoxin antibodies, and suggested application of toxoid fusions in ETEC vaccine development (Liu et al., Infect. Immun. 79:4002-4009, 2011. In this study, we generated a different STa toxoid (STa(A14Q and a triple-mutant LT toxoid (LT(S63K/R192G/L211A, tmLT, constructed a toxoid fusion (3xSTa(A14Q-tmLT that carried 3 copies of STa(A14Q for further facilitation of anti-STa immunogenicity, and assessed antigen safety and immunogenicity in a murine model to explore its potential for ETEC vaccine development. Mice immunized with this fusion antigen showed no adverse effects, and developed antitoxin antibodies particularly through the IP route. Anti-LT antibodies were detected and were shown neutralizing against CT in vitro. Anti-STa antibodies were also detected in the immunized mice, and serum from the IP immunized mice neutralized STa toxin in vitro. Data from this study indicated that toxoid fusion 3xSTa(A14Q-tmLT is safe and can induce neutralizing antitoxin antibodies, and provided helpful information for vaccine development against ETEC diarrhea.

Out-of-equilibrium nanocrystalline R1-s(Fe,M)5+2s alloys (R=Sm,Pr; M=Co,Si,Ga)

International Nuclear Information System (INIS)

Bessais, L.; Djega-Mariadassou, C.

2005-01-01

The out-of-equilibrium hexagonal P6/mmm R 1-s (Fe,M) 5+2s (R=Sm,Pr and M=Co, Si or Ga) intermetallics are obtained by controlled nanocrystallization. A model is presented to explain the structure of the hexagonal phases, which stoichiometry is consistent with Sm(Fe,M) 9 and R(Fe,Ti,Co) 10 . The Curie temperatures increase versus Ga, Si, Co content. The analysis of the Moessbauer spectra leads to monotonous variation of the hyperfine parameters. The refinement of the Moessbauer spectra was performed on the basis of the correlation between Wigner-Seitz cell volumes obtained from X-ray diffraction results and isomer shifts. The abundance of each magnetic site was calculated by the multinomial distribution law. For a given substituting Co, Si, Ga content, the sequence for the isomer shift in the hexagonal cell is 2e>3g>6l. With increasing M content, the isomer shift of the 3g site remains quasi-constant. Those approaches lead to the location of Si, Ga, Co in 3g site, Ti in 6l site. (copyright 2005 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.

Science.gov (United States)

Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J

2017-11-02

One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.

GUIer gør godt - Introduktion til GUIer i Matlab

DEFF Research Database (Denmark)

Jacobsen, Niels Gjøl

2003-01-01

GUI er en forkortelse for 'Graphical User Interface', og det er en særdeles nyttig måde at visualisere sine data, og det gør det ligeledes på en simpel måde muligt at ændre enkelte parametrer i beregninger og se de fysiske, matematiske eller andre ændringer, som sker i forbindelse med ændringen a...... disse parametrer. Ydermere hjælper GUIer til, at der bliver skabt en grænse for, hvor meget brugeren kan ændre i programmet, da der ikke direkte kontakt til den bagvedliggende kode. Denne introduktion er skrevet til Matlab 6.5. R13....

RNAi Mediated Silencing of LRRK2G2019S in Parkinson’s Disease

Science.gov (United States)

2013-08-01

WT, but not LRRK2 mutant, protected 446 dopaminergic neurons against rotenone or paraquat toxicity, 447Q12 agents which compromise [52]. The...and animal models of G2019S-mediated neurotoxicity to establish a novel therapy for PD. To achieve this objective we proposed the following Specific...kinase domain (kinase dead mutants) diminishes neurotoxicity and basal kinase levels appear to be required for the toxicity of all LRRK2 mutants [6

Samsun İli Bafra İlçesinde İkinci Ürün Silajlık Mısır Üretiminde Toplam Masraf, İş Gücü Gereksinimi ve İş Başarılarının Belirlenmesi

Directory of Open Access Journals (Sweden)

Taner Yıldız

2016-12-01

Full Text Available Bu çalışma, Samsun ili Bafra ilçesi ova kesiminde ikinci ürün silajlık mısır üreten işletmelerde toplam masraf, iş gücü gereksinimi ve iş başarılarının belirlenmesi amacıyla yapılmıştır. Elde edilen sonuçlara göre; toplam değişken ve sabit masraflar 2827,80 TL ha-1 ve 4224,60 TL ha-1 olarak hesaplanmıştır. Değişken ve sabit masrafların toplam üretim masrafları içerisindeki payları sırasıyla, %40,10 ve %59,90 olarak belirlenmiştir. Değişken masraflar içerisinde en yüksek payı gübreleme (%10,30 ve ilaçlama masrafları (%7,00 alırken; sabit masraflarda en yüksek payı ise arazi kiralama masrafı (%24,70 oluşturmuştur. En yüksek iş gücü gereksinimi hasat işlemlerinde (4,28 h ha-1 ve en düşük iş gücü gereksinimi ise ilaçlama işlemlerinde (2,35 h ha-1 ortaya çıkmıştır. İş başarıları bakımından en yüksek iş başarısı, nakliye işlemlerinde (0,53 ha h-1 elde edilmiştir.

LRRK2 G2385R and R1628P Mutations Are Associated with an Increased Risk of Parkinson's Disease in the Malaysian Population

Science.gov (United States)

Chua, Jing Yi; Lim, Thien Thien; Mohamed Ibrahim, Norlinah; Tan, Ai Huey; Eow, Gaik Bee; Abdul Aziz, Zariah; Puvanarajah, Santhi Datuk; Viswanathan, Shanthi; Lim, Soo Kun; Tan, Li Ping; Chong, Yip Boon; Tan, Chong Tin; Zhao, Yi; Tan, E. K.

2014-01-01

The LRRK2 gene has been associated with both familial and sporadic forms of Parkinson's disease (PD). The G2019S variant is commonly found in North African Arab and Caucasian PD patients, but this locus is monomorphic in Asians. The G2385R and R1628P variants are associated with a higher risk of developing PD in certain Asian populations but have not been studied in the Malaysian population. Therefore, we screened the G2385R and R1628P variants in 1,202 Malaysian subjects consisting of 695 cases and 507 controls. The G2385R and R1628P variants were associated with a 2.2-fold (P = 0.019) and 1.2-fold (P = 0.054) increased risk of PD, respectively. Our data concur with other reported findings in Chinese, Taiwanese, Singaporean, and Korean studies. PMID:25243190

K-3 vitamininin sıçan glioma (C6) ve insan glioblastomamultiforme hücre çoğalmasına invitro etkileri

OpenAIRE

Öztopçu, Pınar; Kabadere, Selda; Uyar, Ruhi

2005-01-01

Amaç: Glioblastoma multiforme beyin dokusu içerisine hızla yayılan ve onu yıkıma ugratan, sinir sisteminde görülme sıklıgı yüksek oldukça tehlikeli bir tümör çesididir. K-3 vitamininin çesitli kanser hücre dizileri üzerinde hücre çogalmasını baskılayıcı etkisi oldugu bildirilmektedir. Çalısmamızda K-3 vitamininin, sıçan glioma (C6) ve insan glioblastoma multiforme hücrelerinin çogalması üzerindeki baskılayıcı etkilerini karsılastırarak belirlemeyi amaçladık. Yöntem: K-3 vitamin...

Spread of neuronal degeneration in a dopaminergic, Lrrk-G2019S model of Parkinson disease

Science.gov (United States)

Hindle, Samantha J.; Elliott, Christopher J.H.

2013-01-01

Flies expressing the most common Parkinson disease (PD)-related mutation, LRRK2-G2019S, in their dopaminergic neurons show loss of visual function and degeneration of the retina, including mitochondrial abnormalities, apoptosis and autophagy. Since the photoreceptors that degenerate are not dopaminergic, this demonstrates nonautonomous degeneration, and a spread of pathology. This provides a model consistent with Braak’s hypothesis on progressive PD. The loss of visual function is specific for the G2019S mutation, implying the cause is its increased kinase activity, and is enhanced by increased neuronal activity. These data suggest novel explanations for the variability in animal models of PD. The specificity of visual loss to G2019S, coupled with the differences in neural firing rate, provide an explanation for the variability between people with PD in visual tests. PMID:23529190

Activation of multiple G-proteins by muscarinic M1 and M2 receptors

Czech Academy of Sciences Publication Activity Database

Michal, Pavel; El-Fakahany, E. E.; Doležal, Vladimír

2006-01-01

Roč. 27, č. S1 (2006), s. 404-404 ISSN 1671-4083. [World Congress of Pharmacology /15./. 02.07.2006-07.07.2006, Beijing] R&D Projects: GA ČR(CZ) GP305/05/P209; GA ČR(CZ) GA305/05/0452; GA MŠk(CZ) LC554 Grant - others:NIH(US) NS25743 Institutional research plan: CEZ:AV0Z50110509 Keywords : muscarinic receptors * multiple G-protein coupling Subject RIV: ED - Physiology

A soluble form of IL-13 receptor alpha 1 promotes IgG2a and IgG2b production by murine germinal center B cells.

Science.gov (United States)

Poudrier, J; Graber, P; Herren, S; Gretener, D; Elson, G; Berney, C; Gauchat, J F; Kosco-Vilbois, M H

1999-08-01

A functional IL-13R involves at least two cell surface proteins, the IL-13R alpha 1 and IL-4R alpha. Using a soluble form of the murine IL-13R alpha 1 (sIL-13R), we reveal several novel features of this system. The sIL-13R promotes proliferation and augmentation of Ag-specific IgM, IgG2a, and IgG2b production by murine germinal center (GC) B cells in vitro. These effects were enhanced by CD40 signaling and were not inhibited by an anti-IL4R alpha mAb, a result suggesting other ligands. In GC cell cultures, sIL-13R also promoted IL-6 production, and interestingly, sIL-13R-induced IgG2a and IgG2b augmentation was absent in GC cells isolated from IL-6-deficient mice. Furthermore, the effects of the sIL-13R molecule were inhibited in the presence of an anti-IL-13 mAb, and preincubation of GC cells with IL-13 enhanced the sIL-13R-mediated effects. When sIL-13R was injected into mice, it served as an adjuvant-promoting production to varying degrees of IgM and IgG isotypes. We thus propose that IL-13R alpha 1 is a molecule involved in B cell differentiation, using a mechanism that may involve regulation of IL-6-responsive elements. Taken together, our data reveal previously unknown activities as well as suggest that the ligand for the sIL-13R might be a component of the IL-13R complex or a counterstructure yet to be defined.

Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

Science.gov (United States)

Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

2010-01-01

N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

Science.gov (United States)

Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

2007-02-23

N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

Les immigrés, rescapés d’un génocide, sont des émigrés de nulle part

Directory of Open Access Journals (Sweden)

Janine Altounian

2007-09-01

Full Text Available À partir d’une expérience qui m’est familière, l'exposé porte sur un type d’immigration, paradoxal en ses termes puisque son lieu de référence n’existe plus et ne s’inscrit plus dans le monde comme ayant jamais existé : celui des descendants de rescapés du génocide arménien qui, abandonnant Constantinople dans les années 20, débarquèrent à Marseille en qualité de réfugiés politiques et de main-d’œuvre importée, munis d’un passeport portant la mention « sans retour possible ».Este estudio, a partir de una historia personal, presenta una forma de inmigración paradójica, en la medida en que su lugar de origen ya no existe y parece nunca haber existido: el de los descendientes de los supervivientes del genocidio armenio que, al abandonar Constantinopla en los años veinte, desembarcaron en Marsella como refugiados políticos y mano de obra importada, con un pasaporte en el cual iba escrito, «sin vuelta posible».From an experience which is familiar to me, this paper deals with a type of immigration, paradoxical in its terms since its reference place does not exist any more and is not registered any more in the world as having ever existed: that of the descendants of survivors of the Armenian genocide who, abandoning Constantinople in the 20s, landed in Marseilles as political refugees and imported manpower, provided with a passport being marked “without possible return”.

Oracle JDeveloper 11gR2 Cookbook

CERN Document Server

Haralabidis, Nick

2012-01-01

"Oracle JDeveloper 11gR2 Cookbook" is a practical cookbook which goes beyond the basics with immediately applicable recipes for building ADF applications at an intermediate-to-advanced level. If you are a JavaEE developer who wants to go beyond the basics of building ADF applications with Oracle JDeveloper 11gR2 and get hands on with practical recipes, this book is for you. You should be comfortable with general Java development principles, the JDeveloper IDE, and ADF basics

Electrochemical cleaning of Sv-08G2S wire surface

International Nuclear Information System (INIS)

Kozlov, E.I.; Degtyarev, V.G.; Novikov, M.P.

1981-01-01

Results of industrial tests of the Sv-08G2S wire with different state of surface fwith technological lubrication, after mechanical cleaning, with electrochemically cleaned surface) are presented. Advantages of welding-technological properties of the wire with electroe chemically cleaned surface are shown. An operation principle of the electrochemical cleaning facility is described. A brief specf ification f of the facility is given [ru

Nouvelles géographies des activités extractives 

Directory of Open Access Journals (Sweden)

Géraud Magrin

2011-10-01

Full Text Available Après un premier dossier consacré aux mines d’Afrique de l’Ouest, EchoGéo prolonge ici l’exploration de la géographie contemporaine des activités extractives en s’intéressant à de nouveaux espaces (Burkina Faso, Guyane, Gabon, Golfe de Guinée ; Asie du Sud et Afrique orientale et à des ressources variées (or, fer, pétrole, gemmes. Les cinq textes qui composent le présent dossier invitent à l’exploration de lieux, de stratégies d’acteurs, de relations entre acteurs et entre acteurs et milieu...

Lærernes vilkår gør det svært at lykkes med inklusion og differentieret undervisning

DEFF Research Database (Denmark)

Hedegaard-Sørensen, Lotte; Grumløse, Sine Penthin

2017-01-01

Debatindlæg i Skoleliv Politiken om sammenhængen mellem læreres vilkår for at arbejde inkluderende med særligt fokus på organisatoriske betingelser for samarbejde og fælles forberedelse med andre faggrupper....

Small Molecule TH-39 Potentially Targets Hec1/Nek2 Interaction and Exhibits Antitumor Efficacy in K562 Cells via G0/G1 Cell Cycle Arrest and Apoptosis Induction.

Science.gov (United States)

Zhu, Yongxia; Wei, Wei; Ye, Tinghong; Liu, Zhihao; Liu, Li; Luo, Yong; Zhang, Lidan; Gao, Chao; Wang, Ningyu; Yu, Luoting

2016-01-01

Cancer is still a major public health issue worldwide, and new therapeutics with anti-tumor activity are still urgently needed. The anti-tumor activity of TH-39, which shows potent anti-proliferative activity against K562 cells with an IC50 of 0.78 µM, was investigated using immunoblot, co-immunoprecipitation, the MTT assay, and flow cytometry. Mechanistically, TH-39 may disrupt the interaction between Hec1 and Nek2 in K562 cells. Moreover, TH-39 inhibited cell proliferation in a concentration- and time-dependent manner by influencing the morphology of K562 cells and inducing G0/G1 phase arrest. G0/G1 phase arrest was associated with down-regulation of CDK2-cyclin E complex and CDK4/6-cyclin D complex activities. Furthermore, TH-39 also induced cell apoptosis, which was associated with activation of caspase-3, down-regulation of Bcl-2 expression and up-regulation of Bax. TH-39 could also decrease mitochondrial membrane potential (Δψm) and increase reactive oxygen species (ROS) accumulation in K562 cells. The results indicated that TH-39 might induce apoptosis via the ROS-mitochondrial apoptotic pathway. This study highlights the potential therapeutic efficacy of the anti-cancer compound TH-39 in treatment-resistant chronic myeloid leukemia. © 2016 The Author(s) Published by S. Karger AG, Basel.

Endonuclease G is a novel determinant of cardiac hypertrophy and mitochondrial function

Czech Academy of Sciences Publication Activity Database

McDermott-Roe, Ch.; Ye, J.; Ahmed, R.; Sun, X. M.; Serafín, A.; Ware, J.; Bottolo, L.; Muckett, P.; Caňas, X.; Zhang, J.; Rowe, G. C.; Buchan, R.; Lu, H.; Braithwaite, A.; Mancini, M.; Hauton, D.; Martí, R.; García-Arumí, E.; Hubner, N.; Jacob, H.; Serikawa, T.; Zídek, Václav; Papoušek, František; Kolář, František; Cardona, M.; Ruiz-Meana, M.; García-Dorado, D.; Comella, J. X.; Felkin, L. E.; Barton, P. J. R.; Arany, Z.; Pravenec, Michal; Petretto, E.; Sanchis, D.; Cook, S.A.

2011-01-01

Roč. 478, č. 7367 (2011), s. 114-118 ISSN 0028-0836 R&D Projects: GA MŠk(CZ) 1M0520; GA ČR(CZ) GA301/08/0166 Institutional research plan: CEZ:AV0Z50110509 Keywords : left ventricular hypertrophy * endonuclease G * mitochondrial dysfunction Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 36.280, year: 2011

Histone H1 interphase phosphorylation becomes largely established in G1 or early S phase and differs in G1 between T-lymphoblastoid cells and normal T cells

Directory of Open Access Journals (Sweden)

Gréen Anna

2011-08-01

Full Text Available Abstract Background Histone H1 is an important constituent of chromatin, and is involved in regulation of its structure. During the cell cycle, chromatin becomes locally decondensed in S phase, highly condensed during metaphase, and again decondensed before re-entry into G1. This has been connected to increasing phosphorylation of H1 histones through the cell cycle. However, many of these experiments have been performed using cell-synchronization techniques and cell cycle-arresting drugs. In this study, we investigated the H1 subtype composition and phosphorylation pattern in the cell cycle of normal human activated T cells and Jurkat T-lymphoblastoid cells by capillary electrophoresis after sorting of exponentially growing cells into G1, S and G2/M populations. Results We found that the relative amount of H1.5 protein increased significantly after T-cell activation. Serine phosphorylation of H1 subtypes occurred to a large extent in late G1 or early S phase in both activated T cells and Jurkat cells. Furthermore, our data confirm that the H1 molecules newly synthesized during S phase achieve a similar phosphorylation pattern to the previous ones. Jurkat cells had more extended H1.5 phosphorylation in G1 compared with T cells, a difference that can be explained by faster cell growth and/or the presence of enhanced H1 kinase activity in G1 in Jurkat cells. Conclusion Our data are consistent with a model in which a major part of interphase H1 phosphorylation takes place in G1 or early S phase. This implies that H1 serine phosphorylation may be coupled to changes in chromatin structure necessary for DNA replication. In addition, the increased H1 phosphorylation of malignant cells in G1 may be affecting the G1/S transition control and enabling facilitated S-phase entry as a result of relaxed chromatin condensation. Furthermore, increased H1.5 expression may be coupled to the proliferative capacity of growth-stimulated T cells.

Dose rate, mitotic cycle duration, and sensitivity of cell transitions from G1 → S and G2 → M to protracted gamma radiation in root meristems

International Nuclear Information System (INIS)

Evans, L.S.; Hof, J.V.

1975-01-01

Experiments were designed to determine the relative radiosensitivity of the cell transition points of G1 → S and G2 → M in root meristems of several plant species. Label and mitotic indices and microspectrophotometry were used to measure the proportions of cells in each mitotic cycle stage in root meristems after protracted gamma radiation. The criterion of radiosensitivity was the dose rate needed to produce a tissue with less than 1 percent cells in S and none in M after 3 days of continuous exposure. The results show that DNA is the primary radiation target in proliferative root meristems and that the cycle duration stipulates the time interval of vulnerability. In each species, nonrandom reproducible cell proportions were established with 2C:4C:8C amounts of nuclear DNA after 3 days of exposure. Roots of Helianthus annuus, Crepis capillaris, and Tradescantia clone 02 had 80 percent cells with a 2C amount of DNA and 20 percent had a 4C amount of DNA. In these species the transition point of G1 → S was more radiosensitive than G2 → M. Roots of Pisum sativum and Triticum aestivum had cell proportions at 2C:4C:8C amounts of DNA in frequencies of 0.10 to 0.20:0.40 to 0.60:0.30 to 0.40. In these two species 0.30 to 0.40 cells underwent radiation-induced endoreduplication that resulted from a rapid inhibition of cell transit from G2 → M and a slower impairment of G1 → S. Cells increased from 2C to 4C and from 4C to 8C amounts of DNA during irradiation. The proportions of nuclei with 2C:4C:8C amounts of DNA were dependent in part upon the relative radiosensitivity of the G1 → S and G2 → M control points. The data show the relative radiosensitivity of the transition points from G1 → S and from G2 → M was species specific and unrelated to the cycle duration and mean nuclear DNA content of the plant species

42 CFR Appendix G to Part 5 - Criteria for Designation of Areas Having Shortages of Veterinary Professional(s)

Science.gov (United States)

2010-10-01

... of Veterinary Professional(s) G Appendix G to Part 5 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT... Pt. 5, App. G Appendix G to Part 5—Criteria for Designation of Areas Having Shortages of Veterinary Professional(s) Part I—Geographic Areas A. Criteria for Food Animal Veterinary Shortage. A geographic area will...

Sphingosine-1-phosphate (S1P) enhances glomerular endothelial cells activation mediated by anti-myeloperoxidase antibody-positive IgG.

Science.gov (United States)

Sun, Xiao-Jing; Chen, Min; Zhao, Ming-Hui

2018-03-01

Cumulating evidences suggested an important role of sphingosine-1-phosphate (S1P) and its receptors in regulating endothelial barrier integrity. Our previous study revealed that the circulating S1P levels and renal expression of S1PRs correlated with disease activity and renal damage in patients with antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV). This study investigated the role of S1P and its receptors in myeloperoxidase (MPO)-ANCA-positive IgG-mediated glomerular endothelial cell (GEnC) activation. The effect of S1P on morphological alteration of GEnCs in the presence of MPO-ANCA-positive IgG was observed. Permeability assay was performed to determine endothelial monolayer activation in quantity. Both membrane-bound and soluble ICAM-1 and VCAM-1 levels were measured. Furthermore, antagonists and/or agonists of various S1PRs were employed to determine the role of different S1PRs. S1P enhanced MPO-ANCA-positive IgG-induced disruption of tight junction and disorganization of cytoskeleton in GEnCs. S1P induced further increase in monolayer permeability of GEnC monolayers in the presence of MPO-ANCA-positive IgG. S1P enhanced MPO-ANCA-positive IgG-induced membrane-bound and soluble ICAM-1/VCAM-1 up-regulation of GEnCs. Soluble ICAM-1 levels in the supernatants of GEnCs stimulated by S1P and MPO-ANCA-positive IgG increased upon pre-incubation of S1PR1 antagonist, while pre-incubation of GEnCs with the S1PR1 agonist down-regulated sICAM-1 level. Blocking S1PR2-4 reduced sICAM-1 levels in the supernatants of GEnCs stimulated by S1P and MPO-ANCA-positive IgG. Pre-incubation with S1PR5 agonist could increase sICAM-1 level in the supernatants of GEnC stimulated by S1P and MPO-ANCA-positive IgG. S1P can enhance MPO-ANCA-positive IgG-mediated GEnC activation through S1PR2-5. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Transient Analysis of a k-out-of-n:G System with N-Policy, Repairmen’s Multiple Vacations, and Redundant Dependency

Directory of Open Access Journals (Sweden)

Wenqing Wu

2015-01-01

Full Text Available This paper analyzes a k-out-of-n:G repairable system with N-policy, repairmen’s multiple synchronous vacations, and redundant dependency. When there is no failed component in the system, the repairmen leave for a vacation, the duration of which follows a phase type distribution. Upon returning from vacation, they should take another vacation if there are less than N failed components waiting in the system. This pattern continues until at least N failed components are waiting. Moreover, the redundant dependency which is a special kind of failure dependency is taken into account in the multicomponent system. Under such assumptions, the availability, the rate of occurrence of failures, and the reliability of the system are derived in transient regime by applying the quasi-birth-and-death process. Furthermore, the Runge-Kutta method is carried out to numerically discuss the time-dependent behavior of the system reliability measures. Finally, a special case of the system is presented to show the validity of our model.

Muscarinic M2 receptors directly activate Gq/11 and Gs G-proteins

Czech Academy of Sciences Publication Activity Database

Michal, Pavel; El-Fakahany, E. E.; Doležal, Vladimír

2007-01-01

Roč. 320, č. 2 (2007), s. 607-614 ISSN 0022-3565 R&D Projects: GA ČR GP305/05/P209; GA ČR GA305/05/0452; GA MŠk(CZ) LC554 Grant - others:NIH(US) NS25743 Institutional research plan: CEZ:AV0Z50110509 Keywords : muscarinic * siRNA * G-proteins Subject RIV: CE - Biochemistry Impact factor: 4.003, year: 2007

[Comparison of two types of cell cultures for preparation of sTNFRII-gAD fusion protein].

Science.gov (United States)

Huang, Shigao; Yin, Yuting; Xiong, Chunhui; Wang, Caihong; Lü, Jianxin; Gao, Jimin

2013-01-01

In this study we used two types of cell cultures, i.e., anchorage-dependent basket and full suspension batch cultures of sTNFRII-gAD-expressing CHO cells in the CelliGen 310 bioreactor (7.5 L) to compare their yields in order to optimize the culturing conditions for efficient expression of sTNFRII-gAD fusion protein consisting of soluble tumor necrosis factor receptor II and globular domain of adiponectin. The anchorage-dependent basket culture was performed in 4L 10% serum-containing medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 3 days, and then switched to 4 L serum-free LK021 medium to continue the culture for 4 days. The full suspension batch culture was carried out in the 4 L serum-free LK021 medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 7 days. The culturing conditions were monitored in real-time to maintain pH and dissolved oxygen stability through the whole process. The supernatants were collected by centrifuge, and the protein was concentrated through Pellicon flow ultrafiltration system and then purified by DEAE anion exchange. The results showed that the yields of sTNFRII-gAD fusion protein were 8.0 mg/L with 95% purity and 7.5 mg/L with 98% purity in the anchorage-dependent basket and the full suspension batch cultures, respectively. The study provided the framework for the pilot production of sTNFRII-gAD fusion protein.

Preliminary assessment of an S.G.H.W. type research reactor

International Nuclear Information System (INIS)

Bicevskis, A.; Chapman, A.G.; Hesse, E.W.

1970-08-01

A preliminary design study has been made of a research reactor, based on the enriched S.G.H.W.R. concept, to be used for power reactor fuel irradiation, isotope production, basic research, and training in nuclear technology. A reactor physics assessment established a core size which would allow uninterrupted operation for the required irradiation period consistent with low capital and operating costs. A design was selected with 24 channels, a D 2 O calandria diameter of 2.7 m and an overall core height of 4.0 m. The capital cost was estimated as $750,000 for the fuel and $1,600,000 for the moderator, the refuelling cost being $340,000 per annum. A thermal design study showed that the fission heat of 65 MW could be transmitted to pressurised light water at 200 lb/in 2 abs. and rejected to sea water in two conventional U-tube heat exchangers. The basic design is flexible and can be adapted to meet many special requirements. (author)

Link invariant and $G_2$ web space

OpenAIRE

Sakamoto, Takuro; Yonezawa, Yasuyoshi

2017-01-01

In this paper, we reconstruct Kuperberg’s $G_2$ web space [5, 6]. We introduce a new web diagram (a trivalent graph with only double edges) and new relations between Kuperberg’s web diagrams and the new web diagram. Using the web diagrams, we give crossing formulas for the $R$-matrices associated to some irreducible representations of $U_q(G_2)$ and calculate $G_2$ quantum link invariants for generalized twist links.

Granüler Yol Malzemeleri için Düsük Maliyetli Dinamik Üç Eksenli Test Cihazı Geliştirilmesi

Directory of Open Access Journals (Sweden)

Altan YILMAZ

2009-04-01

Full Text Available Dinamik üç eksenli deneyleri ile yol malzemelerinin trafik yükleri altındaki mekanik özellikleri belirlenebilmektedir. Laboratuar deneyleri ile belirlenen bu malzeme parametreleri genellikle üstyapı tasarımında kullanılmaktadır. Bu çalısma kapsamında, granüler yol malzemelerinin mekanik özelliklerinin (Esneklik modülü, Poisson oranı belirlenebilmesi için, düsük maliyetli dinamik bir üç eksenli test cihazı gelistirilmistir. Cihaz bilgisayar kontrollü olup deneyi süren program da bu makalenin yazarları tarafından hazırlanmıstır, dolayısıyla program üzerinde degisiklik yapmak, yeni veriler eklemek mümkündür. Deney cihazında yük kontrolü yük hücresi aracılıgı ile yüklemeler ise elektro-pnömatik valf sistemi ile yapılmaktadır. Bu cihaz ile 100x200mm ve 150x300mm ebatlarındaki silindir numuneler test edilebilmektedir. Gelistirilen deney cihazının maliyeti ithal fiyatının yaklasık 1/5'i civarındadır. Gelistirilen bu dinamik deney düzenegi ile gerçeklestirilen üç eksenli deneylerinden elde edilen veriler benzer çalısmalarla karsılastırıldıgında basarılı sonuçların elde edildigi görülmüstür.

Utilization of titanium sponge in H. T. G. R

Energy Technology Data Exchange (ETDEWEB)

Tone, H [Japan Atomic Energy Research Inst., Oarai, Ibaraki. Oarai Research Establishment

1977-10-01

The high temperature, gas-cooled reactor (H.T.G.R.) uses helium as a coolant and graphite as both the moderator and the fuel tube material. At first sight, there should not be any problem concerning the compatibility of these materials in the H.T.G.R. core region where temperature exceeds 700/sup 0/C, however, it is possible that the graphite core and other structural materials are oxidized by traces of impurities in the coolant. In large-power H.T.G.R., water inleakage from both heat exchangers and coolant circulation pumps will probably be the major source of impurity which will react with the graphite-producing H/sub 2/, CO and CO/sub 2/. In the near future, the nuclear heat of H.T.G.R. will be used as a major heat source for steel production and the chemical industry. For these purposes, it will be necessary to construct a reactor using a helium coolant of greater than 1000/sup 0/C. Therefore, not only the development of refractory metals as structural materials but also an effective helium coolant purification system are the keys for H.T.G.R. construction. Recently, in the helium coolant purification system of H.T.G. Reactors, which have been developed in the several nations advanced in atomic reactors, titanium sponge is used very frequently to remove hydrogen gas as an impurity in helium coolant. Titanium sponge can absorb very large quantities of hydrogen and its absorption-capacity can be very easily controlled by controlling the temperature of the titanium sponge-since titanium hydride is formed by endothermic reaction. The titanium sponge trap is used also in OGL-1 (Oarai Gas Loop-1), helium coolant purification system for large scale irradiation apparatus which is used for nuclear fuels of H.T.G.R. This apparatus has been installed in the Japan Material Testing Reactor. In this report, the coolant purification system of H.T.G.R., OGL-1 and the experimental results of the titanium sponge trap are explained briefly.

Tet1 is required for Rb phosphorylation during G1/S phase transition

International Nuclear Information System (INIS)

Huang, Shengsong; Zhu, Ziqi; Wang, Yiqin; Wang, Yanru; Xu, Longxia; Chen, Xuemei; Xu, Qing; Zhang, Qimin; Zhao, Xin; Yu, Yi; Wu, Denglong

2013-01-01

Highlights: •Tet1 was required for NIT3T3 proliferation. •Tet1 depletion inhibited G1-S entry. •Cyclin D1 accumulation and Rb phosphorylation was blocked by Tet1 knockdown. -- Abstract: DNA methylation plays an important role in many biological processes, including regulation of gene expression, maintenance of chromatin conformation and genomic stability. TET-family proteins convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which indicates that these enzymes may participate in DNA demethylation. The function of TET1 has not yet been well characterized in somatic cells. Here, we show that depletion of Tet1 in NIH3T3 cells inhibits cell growth. Furthermore, Tet1 knockdown blocks cyclin D1 accumulation in G1 phase, inhibits Rb phosphorylation and consequently delays entrance to G1/S phase. Taken together, this study demonstrates that Tet1 is required for cell proliferation and that this process is mediated through the Rb pathway

Caractéristiques végétales, typologie et fonctions des bois sacrés au ...

African Journals Online (AJOL)

Les bois sacrés assurent aux populations, plusieurs fonctions: écologique, cultuelle, socio-culturelle, magique et mixte. Parmi les bois sacrés, seuls ceux qui suscitent la crainte à l'endroit de la population sont intégralement protégés. Mots clés: Bois sacré, enquête ethnobotanique, caractéristiques végétales, fonctions, ...

Low-temperature solid-state preparation of ternary CdS/g-C_3N_4/CuS nanocomposites for enhanced visible-light photocatalytic H_2-production activity

International Nuclear Information System (INIS)

Cheng, Feiyue; Yin, Hui; Xiang, Quanjun

2017-01-01

Highlights: • CdS/g-C_3N_4/CuS composite were synthesized by low-temperature solid-state method. • CdS/g-C_3N_4/CuS show enhanced visible-light photocatalytic H_2 evolution activity. • The enhanced photocatalytic H_2 production activity is due to the heterojunction. • Heterojunction between the components promote charge separation/transfer property. - Abstract: Low-temperature solid-state method were gradually demonstrated as a high efficiency, energy saving and environmental protection strategy to fabricate composite semiconductor materials. CdS-based multiple composite photocatalytic materials have attracted increasing concern owning to the heterostructure constituents with tunable band gaps. In this study, the ternary CdS/g-C_3N_4/CuS composite photocatalysts were prepared by a facile and novel low-temperature solid-state strategy. The optimal ternary CdS/g-C_3N_4/CuS composite exhibits a high visible-light photocatalytic H_2-production rate of 57.56 μmol h"−"1 with the corresponding apparent quantum efficiency reaches 16.5% at 420 nm with Na_2S/Na_2SO_3 mixed aqueous solution as sacrificial agent. The ternary CdS/g-C_3N_4/CuS composites show the enhanced visible-light photocatalytic H_2-evolution activity comparing with the binary CdS-based composites or simplex CdS. The enhanced photocatalytic activity is ascribed to the heterojunctions and the synergistic effect of CuS and g-C_3N_4 in promotion of the charge separation and charge mobility. This work shows that the low-temperature solid-state method is efficient and environmentally benign for the preparation of CdS-based multiple composite photocatalytic materials with enhanced visible-light photocatalytic H_2-production activity.

Przypadki obrażeń rąbanych głowy bez skutku śmiertelnego

Directory of Open Access Journals (Sweden)

Magdalena Cychowska

2014-10-01

Full Text Available Rany rąbane, z uwagi na fakt, że zlokalizowane są najczęściej w obrębie głowy, a do ich powstania dochodzi przy użyciu narzędzia o znacznej masie, prowadzą zazwyczaj do zgonu z powodu rozległego uszkodzenia struktur czaszkowo-mózgowych. Przeżyciowe rany rąbane głowy spotykane są niezwykle rzadko w praktyce sądowo-lekarskiej. W niniejszej pracy przedstawiono trzy przypadki, w których do powstania ran doszło przy użyciu siekiery. W pierwszym przypadku odniesione obrażenia skutkowały chorobą realnie zagrażającą życiu. W drugim przypadku odniesione obrażenia wyczerpywały znamiona narażenia na bezpośrednie niebezpieczeństwo utraty życia i zdrowia w rozumieniu odpowiedniego artykułu kodeksu karnego. Trzeci przypadek uznać można za interesujący, nie tylko z uwagi na charakter doznanych zmian pourazowych, ale również okoliczności zgonu pokrzywdzonej w okresie późniejszym.

GLOBULAR CLUSTER POPULATIONS: FIRST RESULTS FROM S{sup 4}G EARLY-TYPE GALAXIES

Energy Technology Data Exchange (ETDEWEB)

Zaritsky, Dennis [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Aravena, Manuel [Núcleo de Astronomía, Facultad de Ingeniería, Universidad Diego Portales, Avenida Ejército 441, Santiago (Chile); Athanassoula, E.; Bosma, Albert [Aix Marseille Université, CNRS, LAM (Laboratoire d' Astrophysique de Marseille) UMR 7326, F-13388 Marseille (France); Comerón, Sébastien; Laine, Jarkko; Laurikainen, Eija; Salo, Heikki [Astronomy Division, Department of Physics, P.O. Box 3000, FI-90014 University of Oulu (Finland); Elmegreen, Bruce G. [IBM T. J. Watson Research Center, 1101 Kitchawan Road, Yorktown Heights, NY 10598 (United States); Erroz-Ferrer, Santiago; Knapen, Johan H. [Instituto de Astrofísica de Canarias, Vía Lácteas, E-38205 La Laguna (Spain); Gadotti, Dimitri A.; Muñoz-Mateos, Juan Carlos [European Southern Observatory, Casilla 19001, Santiago 19 (Chile); Hinz, Joannah L. [MMT Observatory, P.O. Box 210065, Tucson, AZ 85721 (United States); Ho, Luis C. [Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Holwerda, Benne [Leiden Observatory, University of Leiden, Niels Bohrweg 4, NL-2333 Leiden (Netherlands); Sheth, Kartik, E-mail: dennis.zaritsky@gmail.com [National Radio Astronomy Observatory/NAASC, 520 Edgemont Road, Charlottesville, VA 22903 (United States)

2015-02-01

Using 3.6 μm images of 97 early-type galaxies, we develop and verify methodology to measure globular cluster populations from the S{sup 4}G survey images. We find that (1) the ratio, T {sub N}, of the number of clusters, N {sub CL}, to parent galaxy stellar mass, M {sub *}, rises weakly with M {sub *} for early-type galaxies with M {sub *} > 10{sup 10} M {sub ☉} when we calculate galaxy masses using a universal stellar initial mass function (IMF) but that the dependence of T {sub N} on M {sub *} is removed entirely once we correct for the recently uncovered systematic variation of IMF with M {sub *}; and (2) for M {sub *} < 10{sup 10} M {sub ☉}, there is no trend between N {sub CL} and M {sub *}, the scatter in T {sub N} is significantly larger (approaching two orders of magnitude), and there is evidence to support a previous, independent suggestion of two families of galaxies. The behavior of N {sub CL} in the lower-mass systems is more difficult to measure because these systems are inherently cluster-poor, but our results may add to previous evidence that large variations in cluster formation and destruction efficiencies are to be found among low-mass galaxies. The average fraction of stellar mass in clusters is ∼0.0014 for M {sub *} > 10{sup 10} M {sub ☉} and can be as large as ∼0.02 for less massive galaxies. These are the first results from the S{sup 4}G sample of galaxies and will be enhanced by the sample of early-type galaxies now being added to S{sup 4}G and complemented by the study of later-type galaxies within S{sup 4}G.

Korespondence T. G. Masaryka s jižními Slovany

Czech Academy of Sciences Publication Activity Database

Hladký, Ladislav

2016-01-01

Roč. 20, č. 1 (2016), s. 659-663 ISSN 1450-5061 Institutional support: RVO:67985963 Keywords : T. G. Masaryk * south Slavs * correspondence * Czechoslovak-Yugoslav relations * Czechoslovak-Bulgarian relations Subject RIV: AB - History OBOR OECD: History (history of science and technology to be 6.3, history of specific sciences to be under the respective headings)

A comparison of the chromosome G-banding pattern in two Sorex species, S. satunini and S. araneus (Mammalia, Insectivora

Directory of Open Access Journals (Sweden)

Yuri Borisov

2012-08-01

Full Text Available The G-banded karyotype of S. satunini was compared with the karyotype of Sorex araneus. Extensive homology was revealed. The major chromosomal rearrangements involved in the evolutionary divergence of these species have been identified as centric fusions and centromeric shifts. From the known palaeontological age of S. satunini it is obvious that the vast chromosomal polymorphism of the S. araneus group originated during the middle Pleistocene.

Men kör såhär, så slipper du göra bort dig : Hur svenskans du-reform återspeglas i reklamfilmer

OpenAIRE

Fremer, Maria

2015-01-01

Around 1970 Swedish address forms underwent a change from an intricate system of honorifics, titles and names, to a nearly universal use of the informal 2nd person singular du. The Swedish socalled “du-reform” was more forceful than the corresponding processes of informalization in other languages around the same time period, e.g. in English, French, German and Finnish. Most studies on this subject, however, have been based entirely on reported usage. There are very few attempts at analyzing ...

Lack of association between miR-218 rs11134527 A>G and Kawasaki disease susceptibility.

Science.gov (United States)

Pi, Lei; Fu, Lanyan; Xu, Yufen; Che, Di; Deng, Qiulian; Huang, Xijing; Li, Meiai; Zhang, Li; Huang, Ping; Gu, Xiaoqiong

2018-05-01

Abstract Kawasaki disease (KD) is a type of disease that includes the development of a fever that lasts at least five days and involves the clinical manifestation of multicellular vasculitis. KD has become one of the most common pediatric cardiovascular diseases. Previous studies have reported that miR-218 rs11134527 A>G is associated with susceptibility to various cancer risks. However, there is a lack of evidence regarding the relationship between this polymorphism and KD risk. This study explored the correlation between the miR-218 rs11134527 A>G polymorphism and the risk of KD. We recruited 532 patients with KD and 623 controls to genotype the miR-218 rs11134527 A>G polymorphism with a TaqMan allelic discrimination assay. Our results illustrated that the miR-218 rs11134527 A>G polymorphism was not associated with KD risk. In an analysis stratified by age, sex, and coronary artery lesions, we found only that the risk of KD was significantly decreased for children older than 5 years (GG vs. AA/AG: adjusted OR=0.26, 95% CI=0.07-0.94, P =0.041). This study demonstrated that the miR-218 rs1113452 A>G polymorphism may have an age-related relationship with KD susceptibility that has not previously been revealed. ©2018 The Author(s).

The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)

Science.gov (United States)

Jacobson, Nathan S.; Myers, Dwight L.

2011-01-01

The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.

Structural insight into the rearrangement of the switch I region in GTP-bound G12A K-Ras

Energy Technology Data Exchange (ETDEWEB)

Xu, Shenyuan; Long, Brian N.; Boris, Gabriel H.; Chen, Anqi; Ni, Shuisong; Kennedy, Michael A.

2017-11-10

K-Ras, a molecular switch that regulates cell growth, apoptosis and metabolism, is activated when it undergoes a conformation change upon binding GTP and is deactivated following the hydrolysis of GTP to GDP. Hydrolysis of GTP in water is accelerated by coordination to K-Ras, where GTP adopts a high-energy conformation approaching the transition state. The G12A mutation reduces intrinsic K-Ras GTP hydrolysis by an unexplained mechanism. Here, crystal structures of G12A K-Ras in complex with GDP, GTP, GTPγS and GppNHp, and of Q61A K-Ras in complex with GDP, are reported. In the G12A K-Ras–GTP complex, the switch I region undergoes a significant reorganization such that the Tyr32 side chain points towards the GTP-binding pocket and forms a hydrogen bond to the GTP γ-phosphate, effectively stabilizing GTP in its precatalytic state, increasing the activation energy required to reach the transition state and contributing to the reduced intrinsic GTPase activity of G12A K-Ras mutants.

Oracle BAM 11gR1 Handbook

CERN Document Server

Wang, Pete

2012-01-01

"Oracle BAM 11gR1 Handbook" is a practical best practices tutorial focused entirely on Oracle Business Activity Monitoring. An intermediate-to-advanced guide, step-by-step instructions and an accompanying demo project will help SOA report developers through application development and producing dashboards and reports. If you are a developer/report developer or SOA Architect who wants to learn valuable Oracle BAM best practices for monitoring your operations in real time, then "Oracle BAM 11gR1 Handbook" is for you. Administrators will also find the book useful. You should already be comfortabl

KECK OBSERVATIONS OF THE GALACTIC CENTER SOURCE G2: GAS CLOUD OR STAR?

Energy Technology Data Exchange (ETDEWEB)

Phifer, K.; Meyer, L.; Ghez, A. M.; Witzel, G.; Yelda, S.; Boehle, A.; Morris, M. R.; Becklin, E. E. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095 (United States); Do, T. [Dunlap Institute for Astronomy and Astrophysics, University of Toronto, Toronto, Ontario, M5S 3H4 (Canada); Lu, J. R. [Institute for Astronomy, University of Hawaii, Hilo, HI 96720 (United States); Matthews, K., E-mail: ghez@astro.ucla.edu [Division of Physics, Mathematics, and Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States)

2013-08-10

We present new observations and analysis of G2-the intriguing red emission-line object which is quickly approaching the Galaxy's central black hole. The observations were obtained with the laser guide star adaptive optics systems on the W. M. Keck I and II telescopes (2006-2012) and include spectroscopy (R {approx} 3600) centered on the hydrogen Br{gamma} line as well as K' (2.1 {mu}m) and L' (3.8 {mu}m) imaging. Analysis of these observations shows the Br{gamma} line emission has a positional offset from the L' continuum. This offset is likely due to background source confusion at L'. We therefore present the first orbital solution derived from Br{gamma} line astrometry, which, when coupled with radial velocity measurements, results in a later time of closest approach (2014.21 {+-} 0.14), closer periastron (130 AU, 1600 R{sub s}), and higher eccentricity (0.9814 {+-} 0.0060) compared to a solution using L' astrometry. It is shown that G2 has no K' counterpart down to K' {approx} 20 mag. G2's L' continuum and the Br{gamma} line emission appears unresolved in almost all epochs, which implies that the bulk of the emission resides in a compact region. The observations altogether suggest that while G2 has a gaseous component that is tidally interacting with the central black hole, there is likely a central star providing the self-gravity necessary to sustain the compact nature of this object.

Supersymmetric M3-branes and G{sub 2} manifolds

Energy Technology Data Exchange (ETDEWEB)

Cvetic, M. E-mail: cvetic@cvetic.hep.upenn.edu; Gibbons, G.W.; Lue, H.; Pope, C.N

2002-01-07

We obtain a generalisation of the original complete Ricci-flat metric of G{sub 2} holonomy on R{sup 4}xS{sup 3} to a family with a nontrivial parameter {lambda}. For generic {lambda} the solution is singular, but it is regular when {lambda}={l_brace}-1,0,+1{r_brace}. The case {lambda}=0 corresponds to the original G{sub 2} metric, and {lambda}={l_brace}-1,1{r_brace} are related to this by an S{sub 3} automorphism of the SU(2){sup 3} isometry group that acts on the S{sup 3}xS{sup 3} principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G{sub 2} metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G{sub 2} holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.

Modélisations géostatistiques du faciès petrophysique du réservoir ...

African Journals Online (AJOL)

1] Turner P., Pilling D., Walker D., Binnie J., Sabaou N., 2001. Sequence stratigraphy and sedimentology of the late Triassic. TAGI (Blocks 401- 402. Berkine, Algeria), Marine Petroleum Geology, Vol. 18, 959 – 981. [2] McKenna S. & Hedley R., ...

Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

DEFF Research Database (Denmark)

Rosendahl, G; Hansen, L H; Douthwaite, S

1995-01-01

The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

Il lessico sanscrito dell’amore (śr̥ṅgāra rasa nella Satasaī di Bihārī Lāla Caube

Directory of Open Access Journals (Sweden)

Marchetto, Monia

2016-06-01

Full Text Available The Satasaī of Bihārī Lāla Caube is an anthology of seven hundred dohās and some sorṭhās, independent stanzas of two rhythmical lines, composed at Amber court during the seventeenth century. Since the beginning, it was valued a masterpiece of brajabhāṣā poetry. For its elegant style, the profusion of rhetorical figures and the profound poetic sensitivity the Satasaī is considered as a piece of Indian classical literature, kāvya, and a significant text of rīti literary tendency, the so-called ‘Indian Mannerism’. The language of the Satasaī includes a great number of words of Sanskrit origin, along with terms from Persian, Arabic and Vernaculars from northern India. Numerous Sanskrit words express the śr̥ṅgāra rasa, affection and passion between lovers. The forms (tatsama or tadbhava, the meanings and the cultural connotations of these terms are herein thoroughly investigated.

SABİT ODAKLI SİLİNDİRİK P ARAB OLİK BİR YOdUNLAŞTIRlCIDA KIZGIN SU ELDE EDİLMESİ

Directory of Open Access Journals (Sweden)

FETHİ HALICI

1999-12-01

Full Text Available Bu çalışn1ada, odağı sabit yansıtıcısı ha reketli olarak imal edilen silindirik parabolik yoğunlaştırıcıda (SPY kızgın su ve sıcak su için yapılan deney sonuçları ve pe rfoımans değerleri verilmiştir. (SPY 'nın yansıtıcı yüzeyi 2ınx3 m boyutlarında olup toplam açıklık alanı 6 ın2 dir. Odaktaki yut ucu yüzey yan yana yerleştirilen 2 kanatlı borudan imal edilmiştir. Odak uzaklığı 6 m olan (SPY kuzey güney doğrultusu nda yerleştirilerek özel yapılan bir ınekanizma ile güneşi doğu batı doğrultusunda izl emesi sağJanmıştır. (SPY' da yaklaşık 120 °C değerlerinde kız gın su elde edilmiştir. leneylerde ölçümü yapıJan sıcaklık, debi ve güneş ışınını şiddeti değerleri verilerek, sistemin performansı irdelennıiştir

New Admissions to the K.G. Paustovsky Moscow Literary Museum-Center

Directory of Open Access Journals (Sweden)

Angelica I. Dormidontova

2018-03-01

Full Text Available This is an overview of а new collection received by the K.G. Paustovsky Moscow Literary Museum-Center in 2017, the year of the 125th anniversary of his birth. The collection consists of 366 items. Among them are manuscripts, biographical documents, letters, books with autographs, photographs, posters, booklets, and drawings. These items are of considerable interest for the study of the writer’s methods, his biography as well as for understanding the circle of his contacts. The overview incorporates a number of authentic documents.

A propósito da “síntese brasileira” nos estudos de gêneros

Directory of Open Access Journals (Sweden)

Benedito Gomes Bezerra

2016-03-01

Full Text Available Em publicações recentes, pesquisadores estrangeiros têm mencionado a existência de uma “síntese brasileira” nos estudos de gêneros (textuais/discursivos, a qual teria sido impulsionada pelos Parâmetros Curriculares Nacionais (PCN e pelo Simpósio Internacional de Estudos de Gêneros Textuais (SIGET, configurando-se como um modelo teórico alternativo, uma quarta ou quinta grande tendência mundial de estudos de gêneros, capaz de conciliar abordagens linguísticas, retóricas, sociológicas e pedagógicas. O aludido modelo brasileiro encontraria suas bases teóricas e metodológicas na Escola de Genebra e no interacionismo sociodiscursivo. Este trabalho tem como objetivo discutir o estatuto da “síntese brasileira” conforme defendida principalmente por Bawarshi e Reiff ([2010] 2013, mas também por Swales (2012, a partir de um levantamento panorâmico das abordagens teóricas correntes no país, incluindo uma discussão das principais influências que marcam a pesquisa brasileira no campo dos gêneros. Para isso, uma atenção especial é dedicada a estudos que buscam mapear abordagens teóricas, bem como combinações entre abordagens, nos trabalhos de pesquisadores brasileiros, além de se realizar um exame crítico de publicações que contribuíram para a divulgação dos estudos brasileiros de gêneros no exterior e fundamentaram a hipótese da síntese. Os resultados indicam a existência de uma significativa complexidade e ecletismo nas abordagens de gêneros por autores brasileiros, ao lado da adesão a perspectivas específicas e diferenciadas, o que problematiza em muito a possibilidade de uma síntese entendida como uma perspectiva única e unificada.

Is the G(1440) a glueball

International Nuclear Information System (INIS)

Milton, K.A.; Palmer, W.F.; Pinsky, S.S.

1982-01-01

The G(1440) qualitatively satisfies all criteria for a glueball: It is an isosinglet preferentially produced in hard gluon channels which mediate OZI inhibited processes in an SU(3) symmetric way. A simple pole model is used to predict G → deltaπ, rhoγ, omega γ, phiγ, γγ, rhoππ, and etaππ. The small G → eta ππ rate is explained by a cancellation between G → deltaπ → etaππ and G → etaepsilon → etaππ amplitudes which has also been observed in the corresponding s(1275) amplitude. While the G does not fit naturally into a pure radial excitation nonet - one cannot account for the mass spectrum - standard octet-singlet mixing with angle THETA/sub R/ = -18 0 yields rates for psi → γG and psi → γs(1275) production that are not now inconsistent with the limit on G production in π - p → Gn. 41 references

L’involution géographique : des données géosociales aux algorithmes

Directory of Open Access Journals (Sweden)

Teriitutea Quesnot

2017-03-01

Full Text Available Les données géolocalisées émanant du web social suscitent actuellement un vif intérêt chez les géographes. Certains voient en elles un potentiel indéniable pour la recherche académique. D’autres, en revanche, se contentent d’émettre des réserves quant à leur réelle utilité. Je soutiens pour ma part que les bénéfices que nous pouvons tirer de leur analyse sont très minces, voire inexistants ; pour peu que l’on considère l’espace non pas comme une simple étendue, mais comme un véritable contenu de la relation sociale. Trois arguments que j’explicite ici me poussent à formuler une telle affirmation : les « données » « géosociales » sont (1 fabriquées de toute pièce par des sociétés privées dont l’objectif premier est d’engranger des capitaux, (2 dépourvues de contexte et de ce fait (3 uniquement interprétables en termes de position.

Job på særlige vilkår

DEFF Research Database (Denmark)

Holt, Helle; Sonnefeld Jørgensen, Martin; Hohnen, Pernille

Job på særlige vilkår afviger fra ordinære job ved, at der kan medfølge et offentligt løntilskud, at jobbet kan være midlertidigt, og/eller at arbejdstid, præstationskrav og løn er anderledes. Ordningerne er en del af regeringens aktive arbejdsmarkedspolitik for at skabe et rummeligt arbejdsmarked...... og dermed undgå, at personer med nedsat arbejdsevne havner i passiv forsørgelse. Denne rapport gennemgår den viden, der findes om job på særlige vilkår. Det gælder både viden om de personer, der er ansat i et job på særlige vilkår, om de virksomheder, der ansætter personer på særlige vilkår, og om...... det system, der visiterer personer til job på særlige vilkår....

Helicobacter pylori eradikasyon tedavisinde 7 ve 14 günlük lansoprazol, amoksisilin, klaritromisin protokolünün karşılaştırılması

OpenAIRE

UYGUN, Ahmet; TÜZÜN, Ahmet; YEŞİLOVA, Zeki; ASLAN, Murat; ATEŞ, Yüksel; POLAT, Zülfikar; ERDİL, Ahmet; BAĞCI, Sait; GÜNHAN, Ömer; GÜLŞEN, Mustafa; DAĞALP, Kemal

2015-01-01

Giriş ve amaç: Günümüzde birinci basamak Helicobacter pylori (Hp) eradikasyon tedavisinde protokollerin süresi ve eradikasyon oranları konusunda tartışmalar sürmektedir. Bu çalışmadaki amacımız; nonülser dispepsili Hp pozitif hastalarda lansoprazol, klaritromisin ve amoksisilin'den oluşan 7 ve 14 günlük tedavi protokollerinin eradikasyon oranları nı karşılaştırmaktır. Gereç ve yöntem: Çalışmaya Hp pozitif nonülser dispepsili 188 hasta (92 kadın, 96 erkek, ortalama yaş 44.8 yıl) alı...

Co-administration of rIpaB domain of Shigella with rGroEL of S. Typhi enhances the immune responses and protective efficacy against Shigella infection.

Science.gov (United States)

Chitradevi, Sekar Tamil Selvi; Kaur, Gurpreet; Uppalapati, Sivaramakrishna; Yadav, Anandprakash; Singh, Dependrapratap; Bansal, Anju

2015-11-01

Shigella species cause severe bacillary dysentery in humans and are associated with high morbidity and mortality. The Invasion plasmid antigen (IpaB) protein, which is conserved across all Shigella spp., induces macrophage cell death and is required to invade host cells. The present study evaluates the immunogenicity and protective efficacy of the recombinant (r) domain region of IpaB (rIpaB) of S. flexneri. rIpaB was administered either alone or was co-administered with the rGroEL (heat shock protein 60) protein from S. Typhi as an adjuvant in a mouse model of intranasal immunization. The IpaB domain region (37 kDa) of S. flexneri was amplified from an invasion plasmid, cloned, expressed in BL21 Escherichia coli cells and purified. Immunization with the rIpaB domain alone stimulated both humoral and cell-mediated immune responses. Furthermore, robust antibody (IgG, IgA) and T-cell responses were induced when the rIpaB domain was co-administered with rGroEL. Antibody isotyping revealed higher IgG1 and IgG2a antibody titers and increased interferon-gamma (IFN-γ) secretion in the co-administered group. Immunization of mice with the rIpaB domain alone protected 60%-70% of the mice from lethal infection by S. flexneri, S. boydii and S. sonnei, whereas co-administration with rGroEL increased the protective efficacy to 80%-85%. Organ burden and histopathological studies also revealed a significant reduction in lung infection in the co-immunized mice compared with mice immunized with the rIpaB domain alone. This study emphasizes that the co-administration of the rIpaB domain and rGroEL protein improves immune responses in mice and increases protective efficacy against Shigella infection. This is also the first report to evaluate the potential of the GroEL (Hsp 60) protein of S. Typhi as an adjuvant molecule, thereby overcoming the need for commercial adjuvants.

Modeling the emission of the galactic very high energy γ-ray sources G 1.9+0.3, G 330.2+1.0, HESS J1303-631 and PSR B1259-63/LS 2883 observed with H.E.S.S

International Nuclear Information System (INIS)

Sushch, Iurii

2012-01-01

Recently, imaging atmospheric Cherenkov telescopes (IACTs) have discovered numerous new sources representing various source classes in the very high energy (VHE; E>100 GeV) sky. This work presents studies of representatives of three types of Galactic VHE emitters: the Supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0, the pulsar wind nebula (PWN) HESS J1303.631 and the binary system PSR B1259.63/LS 2883. The analysis of the H.E.S.S. data and the broadband emission modeling are presented. G1.9+0.3 and G330.2+1.0 are synchrotron-dominated SNRs whose non-thermal X-ray emission implies that intensive particle acceleration occurs at their shock fronts. This makes them promising candidates for the detection at VHEs. They were observed by the High Energy Stereoscopic System (H.E.S.S.) yielding no signs of significant VHE γ-ray emission from either SNR. The 99% confidence level upper limits on the TeV flux were determined. For an assumed spectral index of 2.5 the obtained upper limits are F G1.9 (>260 GeV) -13 cm -2 s -1 for G1.9+0.3 and F G330 (>380 GeV) -12 cm -2 s -1 for G330.2+1.0. Upper limits on the VHE emission provide constraints on the interior magnetic field in the context of a leptonic scenario and on the interstellar medium (ISM) density and cosmic-ray (CR) efficiency in a hadronic scenario. Lower limits on the interior magnetic fields were estimated at 15 μG for G1.9+0.3 and 14 μG for G330.2+1.0. In the case of the hadronic scenario, the H.E.S.S. upper limits are two orders of magnitude greater than the flux prediction. Obtained upper limits on the ISM densities are compatible with other estimates of the densities (from the thermal X-ray emission for G330.2+1.0 and from the expansion rate for G1.9+0.3). The CR efficiency cannot be constrained with the current H.E.S.S. upper limits. HESS J1303-631 is an initially unidentified H.E.S.S. source which was recently identified as a PWN associated with the pulsar PSR J1301-6305. The broadband emission of the source

Készletgazdálkodás és visszutas logisztika

OpenAIRE

Dobos, Imre

2012-01-01

A modern gazdaság egyre inkább szembesül a természetes erőforrások beszűkülésével. A meg nem újuló erőforrások készleteinek csökkenése a gazdaság szereplőit arra kényszeríti, hogy korlátozottan rendelkezésre álló ásványi anyagokat megkímélje. Ez a koncepció vezet a fenntartható fejlődés vállalati gazdálkodásba történő átültetésének szükségességéhez. A dolgozat célja a környezettudatos anyag- és készletgazdálkodás matematikai modelljeinek vizsgálata. A környezettudatos anyag- és készletga...

Når vi går i drift

DEFF Research Database (Denmark)

Svejvig, Per

2012-01-01

Implementering af store forretningssystemer til CRM og ERP optager mange danske virksomheder. Denne artikel fokuserer på forandringsledelse som en meget vigtig og integreret del af den samlede implementering. Artiklen berører især tiden efter at man er gået i drift med forretningssystemet....

A previously unidentified deletion in G protein-coupled receptor 143 causing X-linked congenital nystagmus in a Chinese family

Directory of Open Access Journals (Sweden)

Jing Liu

2016-01-01

Full Text Available Background: Congenital nystagmus (CN is characterized by conjugated, spontaneous, and involuntary ocular oscillations. It is an inherited disease and the most common inheritance pattern is X-linked CN. In this study, our aim is to identify the disease-causing mutation in a large sixth-generation Chinese family with X-linked CN. Methods: It has been reported that mutations in four-point-one, ezrin, radixin, moesin domain-containing 7 gene (FRMD7 and G protein-coupled receptor 143 gene (GPR143 account for the majority patients of X-linked nystagmus. We collected 8 ml blood samples from members of a large sixth-generation pedigree with X-linked CN and 100 normal controls. FRMD7 and GPR143 were scanned by polymerase chain reaction (PCR-based DNA sequencing assays, and multiplex PCR assays were applied to detect deletions. Results: We identified a previously unreported deletion covering 7 exons in GPR143 in a Chinese family. The heterozygous deletion from exon 3 to exon 9 of GPR143 was detected in all affected males in the family, while it was not detected in other unaffected relatives or 100 normal controls. Conclusions: This is the first report of molecular characterization in GPR143 gene in the CN family. Our results expand the spectrum of GPR143 mutations causing CN and further confirm the role of GPR143 in the pathogenesis of CN.

Identification of the G143A mutation associated with QoI resistance in Cercospora beticola field isolates from Michigan, United States.

Science.gov (United States)

Bolton, Melvin D; Rivera, Viviana; Secor, Gary

2013-01-01

Cercospora leaf spot (CLS), caused by the fungus Cercospora beticola, is the most serious foliar disease of sugar beet (Beta vulgaris L.) worldwide. Disease control is mainly achieved by timely fungicide applications. In 2011, CLS control failures were reported in spite of application of quinone outside inhibitor (QoI) fungicide in several counties in Michigan, United States. The purpose of this study was to confirm the resistant phenotype and identify the molecular basis for QoI resistance of Michigan C. beticola isolates. Isolates collected in Michigan in 1998 and 1999 that had no previous exposure to the QoI fungicides trifloxystrobin or pyraclostrobin exhibited QoI EC(50) values of ≤ 0.006 µg mL(-1) . In contrast, all isolates obtained in 2011 exhibited EC(50) values of > 0.92 µg mL(-1) to both fungicides and harbored a mutation in cytochrome b (cytb) that led to an amino acid exchange from glycine to alanine at position 143 (G143A) compared with baseline QoI-sensitive isolates. Microsatellite analysis of the isolates suggested that QoI resistance emerged independently in multiple genotypic backgrounds at multiple locations. A real-time PCR assay utilizing dual-labeled fluorogenic probes was developed to detect and differentiate QoI-resistant isolates harboring the G143A mutation from sensitive isolates. The G143A mutation in cytb is associated with QoI resistance in C. beticola. Accurate monitoring of this mutation will be essential for fungicide resistance management in this pathosystem. This article is a US Government work and is in the public domain in the USA. Published 2012 by John Wiley & Sons, Ltd.

The reaction of (R)-limonene with S-thioacids

International Nuclear Information System (INIS)

Mattos, Marcio C.S. de; Bernini, Rafael Berrelho

2007-01-01

The reaction of (R)-limonene with equimolar amount of S-thioacetic or S-thiobenzoic acids in refluxing toluene proceeded regioselectively in anti-Markovnikoff fashion forming 9-[(4R, 8RS)-p-menthenyl] S-thiocarboxylates (71 and 61% yield, respectively). The montmorillonite K-10 clay-catalyzed reaction of (R)-limonene with S-thioacetic acid led to the S-thioester (65%) along with p-menthadienes and p-cymene. It was observed that K-10 clay promoted the isomerization of limonene to p-menthadienes and further disproportionation to p-cymene. (author)

Peletlenmiş zeytin küspesinin süt ineklerinde süt verimi ve süt kompozisyonu üzerine etkileri

OpenAIRE

Çıbık, Mert

2014-01-01

Tarıma dayalı bir sanayi yan ürünü olan zeytin küspesi ile yapılan çalışmaların çoğu küçükbaş hayvanlarda gerçekleştirilmekte, süt sığırlarının beslenmesinde zeytin küspesinin kullanımı ile yeterli çalışma bulunmamaktadır. Bu çalışmada zeytin küspesinin yüksek verimli süt sığırlarında süt verimi, süt kompozisyonu ve yem tüketimi üzerine olan etkileri araştırılmıştır. Araştırmada, 3 mm’lik elekten geçirilerek çekirdekleri ayıklanmış, peletlenmiş formdaki zeytin küspesi kullan...

Subcellular redistribution of trimeric G-proteins – potential mechanism of desensitization of hormone response: internalisation, solubilization, down-regulation

Czech Academy of Sciences Publication Activity Database

Drastichová, Zdeňka; Bouřová, Lenka; Lisý, Václav; Hejnová, L.; Rudajev, Vladimír; Stöhr, Jiří; Durchánková, Dana; Ostašov, Pavel; Teisinger, Jan; Soukup, Tomáš; Novotný, Jiří; Svoboda, Petr

2008-01-01

Roč. 57, Suppl.3 (2008), S1-S10 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA309/06/0121 Institutional research plan: CEZ:AV0Z50110509 Keywords : brain * subcellular fractionation * trimeric G-proteins Subject RIV: CE - Biochemistry Impact factor: 1.653, year: 2008

Radiolabeling of antibody for epitope of human carbonic anhydrase IX (IgG M75) by 61Cu and 64Cu and its biological testing

Czech Academy of Sciences Publication Activity Database

Čepa, Adam; Ráliš, Jan; Pavelka, A.; Marešová, L.; Kleinová, M.; Seifert, Daniel; Sieglová, Irena; Král, Vlastimil; Polášek, Miroslav; Lebeda, Ondřej; Paúrová, M.; Lázníček, M.

2015-01-01

Roč. 42, S (2015), s. 465-466 ISSN 1619-7070. [28th Annual congress of the European-Association-of-Nuclear-Medicine (EANM). 10.10.2015-14.10.2015, Hamburg] R&D Projects: GA TA ČR TA02010797; GA MŠk(CZ) LM2011019 Institutional support: RVO:61389005 ; RVO:68378050 Keywords : antibodies * Cu-61 * Cu-64 Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders; EB - Genetics ; Molecular Biology (UMG-J)

Identification of Novel G Protein-Coupled Receptor 143 Ligands as Pharmacologic Tools for Investigating X-Linked Ocular Albinism.

Science.gov (United States)

De Filippo, Elisabetta; Manga, Prashiela; Schiedel, Anke C

2017-06-01

GPR143 regulates melanosome biogenesis and organelle size in pigment cells. The mechanisms underlying receptor function remain unclear. G protein-coupled receptors (GPCRs) are excellent pharmacologic targets; thus, we developed and applied a screening approach to identify potential GPR143 ligands and chemical modulators. GPR143 interacts with β-arrestin; we therefore established a β-arrestin recruitment assay to screen for compounds that modulate activity. Because GPR143 is localized intracellularly, screening with the wild-type receptor would be restricted to agents absorbed by the cell. For the screen we used a mutant receptor, which shows similar basal activity as the wild type but traffics to the plasma membrane. We tested two compound libraries and investigated validated hits for their effects on melanocyte pigmentation. GPR143, which showed high constitutive activity in the β-arrestin assay, was inhibited by several compounds. The three validated inhibitors (pimozide, niclosamide, and ethacridine lactate) were assessed for impact on melanocytes. Pigmentation and expression of tyrosinase, a key melanogenic enzyme, were reduced by all compounds. Because GPR143 appears to be constitutively active, these compounds may turn off its activity. X-linked ocular albinism type I, characterized by developmental eye defects, results from GPR143 mutations. Identifying pharmacologic agents that modulate GPR143 activity will contribute significantly to our understanding of its function and provide novel tools with which to study GPCRs in melanocytes and retinal pigment epithelium. Pimozide, one of three GPR143 inhibitors identified in this study, maybe be a good lead structure for development of more potent compounds and provide a platform for design of novel therapeutic agents.

Comparison of laser welds in thick section S700 high-strength steel manufactured in flat (1G) and horizontal (2G) positions

OpenAIRE

Guo, Wei; Liu, Qiang; Francis, John Anthony; Crowther, Dave; Thompson, Alan; Liu, Zhu; Li, Lin

2015-01-01

Lack of penetration, undercut and melt sagging are common welding defects for single-pass laser welds in thick plates, particularly when using a traditional 1G welding position (laser directed towards ground). This investigation shows, for the first time, that welding 13 mm thick high-strength S700 steel plates in the 2G position (laser beam perpendicular to the direction of gravity) can mitigate some of the common welding defects including undercut and sagging. A computational fluid dynamic ...

Türkiye Göçmeni Ve Yerli Kıbrıslılarda Dindarlık: Kuzey Kıbrıs Türk Cumhuriyeti Örneği

Directory of Open Access Journals (Sweden)

Asım Yapıcı

2015-12-01

Full Text Available Bu çalışmada, Kuzey Kıbrıs Türk Cumhuriyeti (KKTC vatandaşlarının dindarlık görüntüleri, sosyo-demografik değişkenler açısından incelenmiştir. Araştırmanın verilerini toplamak üzere hazırlanan anket formunda cinsiyet, yaş, eğitim düzeyi, köken, ikamet gibi sosyo-demografik değişkenler ve “Bir yaratıcının varlığına inanma”, “Allah’ın varlığını hissetme”, “namaz kılma”, “oruç tutma” ve “dua etme” sıklığını tespit etmeye yönelik dinî değişkenler kullanılmıştır. Tarama modelinde yürütülen çalışma, basit rastlantısal yöntemle seçilen 194’ü erkek, 207’si kadın toplam 401 kişiden oluşmaktadır. Verilerin analizinde t-testi, tek yönlü varyans analizi ve Pearson korelasyon teknikleri kullanılmıştır. Araştırma sonucunda, kökene (Türkiye Göçmeni ve Yerli Kıbrıslı göre dinî değişkenlerin tamamında Türkiye Göçmenleri lehinde anlamlı farklılıkların olduğu anlaşılmıştır. Katılımcıların dindarlık görüntülerinin cinsiyete, ikamete ve eğitim düzeyine göre anlamlı farklılaştığı, yaşa göre ise anlamlı bir fark bulunmadığı görülmüştür.

Comparison of human glutamate carboxypeptidases II and III reveals their divergent substrate specificities

Czech Academy of Sciences Publication Activity Database

Navrátil, Michal; Tykvart, Jan; Schimer, Jiří; Pachl, Petr; Navrátil, Václav; Rokob, T. A.; Hlouchová, Klára; Rulíšek, Lubomír; Konvalinka, Jan

2016-01-01

Roč. 283, č. 13 (2016), s. 2528-2545 ISSN 1742-464X R&D Projects: GA ČR(CZ) GBP208/12/G016; GA ČR(CZ) GA14-31419S; GA MŠk LO1302; GA MŠk(CZ) LO1304 Institutional support: RVO:61388963 Keywords : arene-binding site * GCPIII * prostate -specific membrane antigen * QM/MM calculations * beta-citryl-L-glutamate Subject RIV: CE - Biochemistry Impact factor: 3.902, year: 2016

Relativité générale et astrophysique problèmes et exercices corrigés

CERN Document Server

Gialis, Denis

2015-01-01

La relativité générale a entraîné une mutation en physique. Il existe de bons ouvrages de cours mais des calculs mathématiques délicats sont souvent nécessaires pour s'approprier la physique sous-jacente. Le pari est ici de proposer un apprentissage par la pratique à la fois du raisonnement et du calcul. Sont ainsi proposées de nombreuses démonstrations, certaines classiques et d autres moins courantes. Le livre couvre les bases habituelles (géométrie différentielle, calcul tensoriel, espace-temps) avec des exemples de la métrique de Schwarzschild (les trous noirs), l'espace-temps de Kerr, les ondes gravitationnelles, les modèles de matière et les bases de l'électromagnétisme... On notera également quelques sujets plus avancés (dualité de Hodge, formalisme 3 +1...). Les solutions proposées sont très détaillées tant sur le plan des techniques de calcul que sur l'interprétation physique. Elles permettent ainsi d acquérir une réelle autonomie pour comprendre les concepts de base et �...

Genes ycfR, sirA and yigG contribute to the surface attachment of Salmonella enterica Typhimurium and Saintpaul to fresh produce.

Directory of Open Access Journals (Sweden)

Joelle K Salazar

Full Text Available Salmonella enterica is a frequent contaminant of minimally-processed fresh produce linked to major foodborne disease outbreaks. The molecular mechanisms underlying the association of this enteric pathogen with fresh produce remain largely unexplored. In our recent study, we showed that the expression of a putative stress regulatory gene, ycfR, was significantly induced in S. enterica upon exposure to chlorine treatment, a common industrial practice for washing and decontaminating fresh produce during minimal processing. Two additional genes, sirA involved in S. enterica biofilm formation and yigG of unknown function, were also found to be differentially regulated under chlorine stress. To further characterize the roles of ycfR, sirA, and yigG in S. enterica attachment and survival on fresh produce, we constructed in-frame deletions of all three genes in two different S. enterica serovars, Typhimurium and Saintpaul, which have been implicated in previous disease outbreaks linked to fresh produce. Bacterial attachment to glass and polystyrene microtiter plates, cell aggregation and hydrophobicity, chlorine resistance, and surface attachment to intact spinach leaf and grape tomato were compared among wild-type strains, single-gene deletion mutants, and their respective complementation mutants. The results showed that deletions of ycfR, sirA, and yigG reduced bacterial attachment to glass and polystyrene as well as fresh produce surface with or without chlorine treatment in both Typhimurium and Saintpaul. Deletion of ycfR in Typhimurium significantly reduced bacterial chlorine resistance and the attachment to the plant surfaces after chlorinated water washes. Deletions of ycfR in Typhimurium and yigG in Saintpaul resulted in significant increase in cell aggregation. Our findings suggest that ycfR, sirA, and yigG collectively contribute to S. enterica surface attachment and survival during post-harvest minimal processing of fresh produce.

I. T. - R. O. C. K. S. Comet Nuclei Sample Return Mission

Science.gov (United States)

Dalcher, N.

2009-04-01

samples will be performed by touch and go manoeuvres and a penetrator device [10]. Solar arrays are used as energy source and additional cooling is required to keep the samples at low temperatures (Lisse C., Schultz P., Meech K. J., Delamere W. A. Icarus 187,4-15 (2007). [4] Simon S.B., Joswiak D.J., Ishii H.A., Bradley J.P., Chi M., Grossman L., Aléon J., Brownlee D.E., Fallon S., Hutcheon I.D., Matrajt G., Mckeegan K.D.: Refractory Inclusion Returned by Stardust from Comet P81/Wild 2. Meteoritics and Planetary Science (2007). [5] George D. Cody, Harald Ade, Conel M. O'D. Alexander, Tohru Araki, Anna Butterworth, Holger Fleckenstein, George Flynn, Mary K. Gilles, Chris Jacobsen, A.L. D. Kilcoyne, Keiko Messenger, Scott A. Sandford, Tolek Tyliszczak, Andrew J.Westphal4, Susan Wirick, and Hikaru Yabuta. Quantitative Organic and Light Element analysis of Comet 81P/Wild 2 particles using C-, N-, and O- µ-XANES, Meteoretics and Planetary Science: In Press. [6] Stern, S. et al. Alice: The Rosetta Ultraviolet Imaging Spectrograph. Space Science Reviews 128, 507-527 (2007). [7] Balsiger, H. et al. Rosina-Rosetta Orbiter Spectrometer for Ion and Neutral Analysis. Space Science Reviews 128, 745-801 (2007). [8] Colangeli, L. et al. The Grain Impact Analyser and Dust Accumulator (GIADA) Experiment for the Rosetta Mission: Design, Performances and First Results. Space Science Reviews 128, 803-821 (2007). [9] Yoshimitsu, T., Kubota, T., Nakatani, I., Adachi, T. & Saito, H. Micro-hopping robot for asteroid exploration. Acta Astronautica 52, 441-446 (2003). [10] Lorenz, R. et al. Demonstration of comet sample collection by penetrator. ESA SP-542, 387-393 (2003). [11] Küppers et al. Triple F—a comet nucleus sample return mission. Experimental Astronomy, Online First (2008).

Uusien 5G-teknologioiden energiatehokkuus

OpenAIRE

Jurvakainen, Tuukka

2016-01-01

Mobiiliverkkojen datamäärän kasvaessa räjähdysmäisesti tarvitaan uutta 5G-teknologiaa lisäämään langattomien verkkojen kapasiteettia. 5G-verkkoja kehitettäessä yksi tärkeä tutkimuskysymys on, kuinka saada niistä energiatehokkaita. Tässä tutkielmassa käydään läpi tieteellistä keskustelua aiheesta. Tieteellisestä keskustelusta keskeisimmiksi teknologioiksi 5G-verkkoihin nousevat muun muassa laitteistotekniikan kehittyminen, millimetriaallot, kognitiivinen radioverkko, massiivinen MIMO ja hetero...

5S ribosomal RNA database Y2K.

Science.gov (United States)

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

Modeling the emission of the galactic very high energy {gamma}-ray sources G 1.9+0.3, G 330.2+1.0, HESS J1303-631 and PSR B1259-63/LS 2883 observed with H.E.S.S

Energy Technology Data Exchange (ETDEWEB)

Sushch, Iurii

2012-10-19

Recently, imaging atmospheric Cherenkov telescopes (IACTs) have discovered numerous new sources representing various source classes in the very high energy (VHE; E>100 GeV) sky. This work presents studies of representatives of three types of Galactic VHE emitters: the Supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0, the pulsar wind nebula (PWN) HESS J1303.631 and the binary system PSR B1259.63/LS 2883. The analysis of the H.E.S.S. data and the broadband emission modeling are presented. G1.9+0.3 and G330.2+1.0 are synchrotron-dominated SNRs whose non-thermal X-ray emission implies that intensive particle acceleration occurs at their shock fronts. This makes them promising candidates for the detection at VHEs. They were observed by the High Energy Stereoscopic System (H.E.S.S.) yielding no signs of significant VHE {gamma}-ray emission from either SNR. The 99% confidence level upper limits on the TeV flux were determined. For an assumed spectral index of 2.5 the obtained upper limits are F{sub G1.9}(>260 GeV)<4.6 x 10{sup -13} cm{sup -2}s{sup -1} for G1.9+0.3 and F{sub G330}(>380 GeV)<1.6 x 10{sup -12} cm{sup -2}s{sup -1} for G330.2+1.0. Upper limits on the VHE emission provide constraints on the interior magnetic field in the context of a leptonic scenario and on the interstellar medium (ISM) density and cosmic-ray (CR) efficiency in a hadronic scenario. Lower limits on the interior magnetic fields were estimated at 15 {mu}G for G1.9+0.3 and 14 {mu}G for G330.2+1.0. In the case of the hadronic scenario, the H.E.S.S. upper limits are two orders of magnitude greater than the flux prediction. Obtained upper limits on the ISM densities are compatible with other estimates of the densities (from the thermal X-ray emission for G330.2+1.0 and from the expansion rate for G1.9+0.3). The CR efficiency cannot be constrained with the current H.E.S.S. upper limits. HESS J1303-631 is an initially unidentified H.E.S.S. source which was recently identified as a PWN associated with

Localized movement and morphology of UBF1-positive nucleolar regions are changed by -irradiation in G2 phase of the cell cycle

Czech Academy of Sciences Publication Activity Database

Sorokin, D.V.; Stixová, Lenka; Sehnalová, Petra; Legartová, Soňa; Suchánková, Jana; Šimara, P.; Kozubek, Stanislav; Matula, Pavel; Skalníková, M.; Raška, I.; Bártová, Eva

2015-01-01

Roč. 6, č. 4 (2015), s. 301-313 ISSN 1949-1034 R&D Projects: GA ČR GBP302/12/G157; GA ČR GA13-07822S; GA MŠk 7F14369; GA MŠk(CZ) EE2.3.30.0030 Institutional support: RVO:68081707 Keywords : DNA damage * live cells * nucleolus Subject RIV: BO - Biophysics Impact factor: 2.446, year: 2015

Muon’s (g-2): the obstinate deviation from the Standard Model

CERN Multimedia

Antonella Del Rosso

2011-01-01

It’s been 50 years since a small group at CERN measured the muon (g-2) for the first time. Several other experiments have followed over the years. The latest measurement at Brookhaven (2004) gave a value that obstinately remains about 3 standard deviations away from the prediction of the Standard Model. Francis Farley, one of the fathers of the (g-2) experiments, argues that a statement such as “everything we observe is accounted for by the Standard Model” is not acceptable.   Francis J. M. Farley. Francis J. M. Farley, Fellow of the Royal Society since 1972 and the 1980 winner of the Hughes Medal "for his ultra-precise measurements of the muon magnetic moment, a severe test of quantum electrodynamics and of the nature of the muon", is among the scientists who still look at the (g-2) anomaly as one of the first proofs of the existence of new physics. “Although it seems to be generally believed that all experiments agree with the Stan...

La migration des hydrocarbures dans les bassins sédimentaires: aspects géologiques et géochimiques Migration of Hydrocarbons in Sedimentary Basins: Geological and Geochemical Aspects

Directory of Open Access Journals (Sweden)

Tissot B. P.

2006-11-01

Full Text Available La migration du pétrole vers les réservoirs et les pièges, et particulièrement son expulsion hors de la roche-mère où il s'est formé (migration primaire, est demeurée longtemps un des problèmes les plus mal connus de toute la géologie pétrolière. Le déplacement du pétrole et du gaz s'effectue en phase hydrocarbure séparée. L'eau, souvent considérée comme le véhicule du pétrole dans la migration, joue en fait un rôle négatif : il faut que la saturation en eau ait suffisamment diminué (par expulsion et que la saturation en hydrocarbures ait suffisamment augmenté (par génération à partir du kérogène pour que l'écoulement d'une phase hydrocarbure devienne possible. Le moteur de cette expulsion est le gradient de pression : l'élévation de la pression dans l'espace poreux des roches-mères résulte de trois causes (la charge sédimentaire, la genèse des hydrocarbures, et l'expansion thermique de l'eau. La microfissuration, qui survient quand la pression interne des fluides dépasse la résistance mécanique de la roche peut jouer un rôle important. Les observations dans les bassins sédimentaires de cas bien documentés sont encore trop rares. Il est, en particulier, difficile de calculer les réserves mobilisées à l'échelle d'un permis ou d'un bassin. La modélisation numérique de la migration, associée à celle de la genèse du pétrole et du gaz, offre des perspectives dans ce sens, mais elle demande encore des travaux complémentaires. Parmi les conséquences de la migration, on peut citer : la possibilité de corrélation huile/roche-mère, la teneur plus faible en produits lourds dans les réservoirs que dans les roches-mères et le rôle souvent joué par un déplacement où hydrocarbures liquides et gazeux forment une phase unique, qui migre en laissant progressivement derrière elle les fractions plus lourdes, par condensation rétrograde. Oil migration toward reservoirs and traps, and especially its

Low-temperature solid-state preparation of ternary CdS/g-C3N4/CuS nanocomposites for enhanced visible-light photocatalytic H2-production activity

Science.gov (United States)

Cheng, Feiyue; Yin, Hui; Xiang, Quanjun

2017-01-01

Low-temperature solid-state method were gradually demonstrated as a high efficiency, energy saving and environmental protection strategy to fabricate composite semiconductor materials. CdS-based multiple composite photocatalytic materials have attracted increasing concern owning to the heterostructure constituents with tunable band gaps. In this study, the ternary CdS/g-C3N4/CuS composite photocatalysts were prepared by a facile and novel low-temperature solid-state strategy. The optimal ternary CdS/g-C3N4/CuS composite exhibits a high visible-light photocatalytic H2-production rate of 57.56 μmol h-1 with the corresponding apparent quantum efficiency reaches 16.5% at 420 nm with Na2S/Na2SO3 mixed aqueous solution as sacrificial agent. The ternary CdS/g-C3N4/CuS composites show the enhanced visible-light photocatalytic H2-evolution activity comparing with the binary CdS-based composites or simplex CdS. The enhanced photocatalytic activity is ascribed to the heterojunctions and the synergistic effect of CuS and g-C3N4 in promotion of the charge separation and charge mobility. This work shows that the low-temperature solid-state method is efficient and environmentally benign for the preparation of CdS-based multiple composite photocatalytic materials with enhanced visible-light photocatalytic H2-production activity.

Les sociétés insulaires de la Mer Égée au temps de la domination ottomane. Routes communes et trajectoires séparées

Directory of Open Access Journals (Sweden)

Dimitris Dimitropoulos

2005-01-01

Full Text Available L'objectif de ce texte est d'identifier les éléments qui ont joué un rôle unificateur et, respectivement, les facteurs qui ont différencié les îles de la mer Égée, pendant la domination ottomane. Il traite notamment du rôle qu'ont joué l'emplacement géographique, l'insularité, et la grandeur de chaque île, dans la formation de leur économie et la constitution des sociétés locales. L'argumentation se concentre surtout sur les petites îles de l'Égée et sur des sujets comme la forme et le type des bourgades, le caractère de leur fortification et son évolution, le rôle et les effets du pouvoir ottoman dans les institutions locales et l'administration communale, le caractère de l'économie insulaire et ses rapports avec la mer, les réseaux de communication entre les insulaires et l'évolution indépendante et particulière de chaque île, les déplacements des populations de et vers les îles, la migration et la mobilité des groupes professionnels à l'intérieur ou à l'extérieur de la région de l'Égée, et enfin le rôle des monastères dans le développement des réseaux de communication dans l'espace insulaire.

Aspects descriptifs du VIH/SIDA chez les sujets âgés de 50 ans et plus suivis au Centre de Traitement Agréé de Bafoussam - Cameroun

Science.gov (United States)

Mbopi-Kéou, François-Xavier; Djomassi, Lucienne Dempouo; Monebenimp, Francisca

2012-01-01

Introduction La littérature scientifique dispose de très peu de données relatives à l’épidémiologie du VIH chez les sujets âgés en Afrique subsaharienne. Au Cameroun, les caractéristiques épidémiologiques de l'infection par le VIH chez les sujets âgés de 50 ans et plus ne sont pas documentées. Méthodes Dans une étude de cohorte rétrospective et une enquête transversale, nous avons comparé les caractéristiques clinico-biologiques et la survie post thérapeutique des patients âgés de 50 ans et plus, sous traitement antirétroviral au Centre de Traitement Agrée de Bafoussam - Cameroun, aux adultes plus jeunes. Résultats L’âge moyen était de 39 ans, les extrêmes étant 17 et 88 ans. Les sujets âgés de 50 ans et plus représentaient 14,1% des cas. Les plus âgés étaient moins bien informés sur les modes de transmission du virus (p = 0,04). Leur séropositivité au VIH était le plus souvent découverte au décours d'une infection opportuniste (p = 0,02). La fréquence de comorbidité était significativement plus élevée chez les personnes âgées de 50 ans et plus (p VIH. La promotion du dépistage et les programmes d’éducation sanitaire relatifs au VIH/SIDA devraient être renforcés au sein de cette communauté déjà affaiblie par le poids de l’âge, afin de réduire l'incidence du SIDA et de leur assurer prise en charge précoce. PMID:23133707

Synthesis of MoS_2/g-C_3N_4 nanosheets as 2D heterojunction photocatalysts with enhanced visible light activity

International Nuclear Information System (INIS)

Li, Juan; Liu, Enzhou; Ma, Yongning; Hu, Xiaoyun; Wan, Jun; Sun, Lin; Fan, Jun

2016-01-01

Graphical abstract: TEM image and schematic diagram of photocatalytic mechanism of 2D MoS_2/g-C_3N_4 composites. - Highlights: • g-C_3N_4 nanosheets coupled with MoS_2 nanosheets as 2D heterojunction photocatalysts were synthesized successfully. • The 2D MoS_2/g-C_3N_4 heterojunctions show higher photocatalytic activity than pure g-C_3N_4. • The photocatalytic mechanism of the 2D MoS_2/g-C_3N_4 heterojunction was described. - Abstract: g-C_3N_4 nanosheets coupled with MoS_2 nanosheets as 2D heteroconjuction were prepared via a facile impregnation and calcination method. The structure characterization clearly indicated that MoS_2 nanosheets were successfully horizontal loaded on g-C_3N_4 nanosheets. The investigation indicated that the formation of 2D heterojunction between the g-C_3N_4 nanosheets and MoS_2 nanosheets promoted the charge transfer and enhanced separation efficiency of photoinduced electron–hole pairs. Furthermore, the measurement of photocatalytic activity for the degradation of rhodamine B and methyl orange revealed that the as-prepared 2D MoS_2/g-C_3N_4 heterojunction exhibited the significantly enhanced photocatalytic activity and considerable stability under visible light irradiation. The 2D MoS_2/g-C_3N_4 heterojunction prepared with 3 wt% of MoS_2 exhibited the optimal photodegradable efficiency. The present work shows that the formation of 2D heterojunction should be a good strategy to design efficient photocatalysts.

Long-term Spot-Coverage Variations of 13 BY Dra G-K Dwarfs

Science.gov (United States)

Alekseev, I. Yu.; Kozhevnikova, A. V.

2018-06-01

The results of spot-coverage modeling for 13 active G-K dwarf stars based on many-year photometric observations are presented. The results of UBV RI observations of eight stars performed at the Crimean Astrophysical Observatory were used together with data from the literature in this analysis. The spot-coverage parameters for 13 selected BY Dra active red dwarfs have been redetermined to improve the zonal spot-coverage model for the stellar photospheres, which currently allows for the presence of two active longitudes. Time variations of the spot-activity characteristics of these systems were analyzed with the aim of searching for possible cyclic variations. All the stars, with the exception of OU Gem and BE Cet, show fairly strong correlations between variations in the spot latitudes and spot areas, with absolute values of the correlation coefficients, R(, S), ranging from 0.38 to 0.92. For five stars, an anti-correlation between the mean latitude and area of the spots was found ( R(, S) from-0.24 to-0.73). This behavior may reflect the drift of spots toward the equator in the course of their development. Eight stars feature positive correlations, i.e. the spots drift towards the pole as their areas increase. Nine stars demonstrate activity cycles, which are reflected in photometric variations as well as variations of the spot areas and mean latitudes. The periods of the latitude drift of the spots are found for five stars; the magnitudes of the spot-latitude drift rates are lower than the corresponding value for sunspots by a factor of 1.5-3.

Streptococcus pyogenes Infection and the Human Proteome with a Special Focus on the Immunoglobulin G-cleaving Enzyme IdeS.

Science.gov (United States)

Karlsson, Christofer A Q; Järnum, Sofia; Winstedt, Lena; Kjellman, Christian; Björck, Lars; Linder, Adam; Malmström, Johan A

2018-06-01

Infectious diseases are characterized by a complex interplay between host and pathogen, but how these interactions impact the host proteome is unclear. Here we applied a combined mass spectrometry-based proteomics strategy to investigate how the human proteome is transiently modified by the pathogen Streptococcus pyogenes , with a particular focus on bacterial cleavage of IgG in vivo In invasive diseases, S. pyogenes evokes a massive host response in blood, whereas superficial diseases are characterized by a local leakage of several blood plasma proteins at the site of infection including IgG. S. pyogenes produces IdeS, a protease cleaving IgG in the lower hinge region and we find highly effective IdeS-cleavage of IgG in samples from local IgG poor microenvironments. The results show that IdeS contributes to the adaptation of S. pyogenes to its normal ecological niches. Additionally, the work identifies novel clinical opportunities for in vivo pathogen detection. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Sarcocystis neurona-specific immunoglobulin G in the serum and cerebrospinal fluid of horses administered S neurona vaccine.

Science.gov (United States)

Witonsky, Sharon; Morrow, Jennifer K; Leger, Clare; Dascanio, John; Buechner-Maxwell, Virginia; Palmer, Wally; Kline, Kristen; Cook, Anne

2004-01-01

A vaccine against Sarcocystis neurona, which induces equine protozoal myeloencephalitis (EPM), has received conditional licensure in the United States. A major concern is whether the immunoglobulin G (IgG) response elicited by the vaccine will compromise the use of Western blotting (WB) as a diagnostic tool in vaccinated horses with neurologic disease. Our goals were to determine if vaccination (1) causes seroconversion: (2) causes at least a transient increase in S neurona-specific IgG in the cerebrospinal fluid (CSF); and (3) induces an IgG response that can be differentiated from that induced by natural exposure. Horses included in the study (n = 29) were older than 6 months with no evidence of neurologic disease. The presence or absence of anti-S neurona antibodies in the serum of each horse was determined by WB analysis. Seropositive horses had CSF collected and submitted for cytology, CSF index, and WB analysis. The vaccine was administered to all the horses and boostered 3-4 weeks later. On day 14 after the 2nd administration, serum and CSF were collected and analyzed. Eighty-nine percent (8 of 9) of the initial seronegative horses seroconverted after vaccination, of which 57% (4 of 7) had anti-S neurona IgG in their CSE Eighty percent (16 of 20) of the seropositive horses had an increase in serum S neurona IgG after vaccination. Of the 6 of 20 horses that were initially seropositive/CSF negative, 2 were borderline positive for anti-S neurona IgG in the CSF, 2 tested positive, and 2 were excluded because the CSF sample had been contaminated by blood. There were no WB banding patterns that distinguished samples from horses that seroconverted due to vaccination versus natural exposure. Caution must be used in interpreting WB analysis from neurologic horses that have been recently vaccinated for EPM.

”Øvelse gør mester” i Næstved Kommune

DEFF Research Database (Denmark)

Siren, Anu; Brünner, Rikke Nøhr; Jørgensen, Rune Christian Holger

I januar 2012 iværksatte Næstved Kommune rehabiliteringsprojektet ”Øvelse gør mester” på alle kommunens plejecentre. Målet var at gøre beboerne mere selvhjulpne og derigennem øge deres livskvalitet. Denne rapport er en evaluering af projektet. ”Øvelse gør mester” består af individuelt tilrettelagte...

Bovine herpesvirus type-1 glycoprotein K (gK) interacts with UL20 and is required for infectious virus production

Energy Technology Data Exchange (ETDEWEB)

Haque, Muzammel; Stanfield, Brent; Kousoulas, Konstantin G.

2016-12-15

We have previously shown that the HSV-1 gK and UL20 proteins interact and function in virion envelopment, membrane fusion, and neuronal entry. Alignment of the predicted secondary structures of gKs encoded by BoHV-1, HSV-1, HSV-2, EHV-1 and VZV indicated a high degree of domain conservation. Two BoHV-1 gK-null mutant viruses were created by either gK gene deletion or stop codon insertion. In addition, a V5 epitope-tag was inserted at the carboxyl terminus of gK gene to detect gK. The engineered gK-null mutant viruses failed to replicate and produce viral plaques. Co-immunoprecipitation of gK and UL20 expressed via different methods revealed that gK and UL20 physically interacted in the presence or absence of other viral proteins. Confocal microscopy showed that gK and UL20 colocalized in infected cells. These results indicate that BoHV-1 gK and UL20 may function in a similar manner to other alphaherpesvirus orthologues specified by HSV-1, PRV and EHV-1. -- Highlights: •Glycoprotein K(gK) is conserved among alphaherpesviruses and serves similar functions. •The bovine herpesvirus-1 gK and UL20 proteins physically interact in a similar manner to herpes simplex virus type 1 and equine herpesvirus-1. •The bovine herpesvirus-1 (BoHV-1) gK interacts with UL20 and is essential for virus replication and spread.

Bovine herpesvirus type-1 glycoprotein K (gK) interacts with UL20 and is required for infectious virus production

International Nuclear Information System (INIS)

Haque, Muzammel; Stanfield, Brent; Kousoulas, Konstantin G.

2016-01-01

We have previously shown that the HSV-1 gK and UL20 proteins interact and function in virion envelopment, membrane fusion, and neuronal entry. Alignment of the predicted secondary structures of gKs encoded by BoHV-1, HSV-1, HSV-2, EHV-1 and VZV indicated a high degree of domain conservation. Two BoHV-1 gK-null mutant viruses were created by either gK gene deletion or stop codon insertion. In addition, a V5 epitope-tag was inserted at the carboxyl terminus of gK gene to detect gK. The engineered gK-null mutant viruses failed to replicate and produce viral plaques. Co-immunoprecipitation of gK and UL20 expressed via different methods revealed that gK and UL20 physically interacted in the presence or absence of other viral proteins. Confocal microscopy showed that gK and UL20 colocalized in infected cells. These results indicate that BoHV-1 gK and UL20 may function in a similar manner to other alphaherpesvirus orthologues specified by HSV-1, PRV and EHV-1. -- Highlights: •Glycoprotein K(gK) is conserved among alphaherpesviruses and serves similar functions. •The bovine herpesvirus-1 gK and UL20 proteins physically interact in a similar manner to herpes simplex virus type 1 and equine herpesvirus-1. •The bovine herpesvirus-1 (BoHV-1) gK interacts with UL20 and is essential for virus replication and spread.

QoS Self-Provisioning and Interference Management for Co-Channel Deployed 3G Femtocells

DEFF Research Database (Denmark)

Kolding, Troels; Ochal, Pawel; Jørgensen, Niels T.K.

2013-01-01

A highly efficient self-provisioning interference management scheme is derived for 3G Home Node-Bs (HNB). The proposed scheme comprises self-adjustment of the HNB transmission parameters to meet the targeted QoS (quality of service) requirements in terms of downlink and uplink guaranteed minimum ...... live 3G high-speed packet access (HSPA) HNB field-trials, confirming the validity of major simulation results and assumptions....

Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

Science.gov (United States)

Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

2018-03-01

A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

İl sağlık müdürlüklerinde bulaşıcı hastalıklar insan gücünün değerlendirmesi

Directory of Open Access Journals (Sweden)

Raika Durusoy

2011-09-01

Full Text Available ÖzetAmaç: Türkiye’de il sağlık müdürlüklerinin bulaşıcı hastalıklar şubelerinde görev yapan personelin ve yöneticilerinin; meslek, deneyim, personel değişimi ve hizmet içi eğitimlerini değerlendirmek. Yöntem: Kesitsel tipteki bu araştırma kapsamında 2007 yılında Türkiye’de İl Sağlık Müdürlüklerinde bulaşıcı hastalıklar konusunda çalışan sağlık personeline (müdür yardımcıları ve bulaşıcı hastalıklar şube personeli bir anket uygulanmıştır. Anket resmi yazı ile şubelere ulaştırılmış, şubeler tarafından doldurulan anketler değerlendirilmiştir. Seksen bir ilin 78’inden yanıt alınmıştır (yanıt oranı %96.3. Ankette bulaşıcı hastalıklar konusunda çalışan personelin sosyodemografik özellikleri, meslekleri, görev süreleri, öğrenim durumları ve aldıkları hizmet içi eğitimler sorulmuştur. Ayrıca Bulaşıcı Hastalıklar Şubesinden son iki yılda ayrılanların sayısı ve özellikleri de sorgulanmıştır. Bulgular: Sağlık Bakanlığı’nın il düzeyinde bulaşıcı hastalık kontrolünde çalışan insan gücü, yanıt alınan 78 Sağlık Müdürlüğü için 77 il sağlık müdür yardımcısı, 71 şube müdürü ve 518 şube personelinden oluşmaktadır. Müdür yardımcılarının %97.4’ü, şube müdürlerinin %80.3’ü hekimdir. Müdür yardımcılarının Bulaşıcı Hastalıklar Şube Müdürlüğünde çalışma deneyimine bakıldığında %73.3’ünün daha önce şube müdürlüğü yapmadığı saptanmıştır, %97.3’ünün şube müdürlüğü dışındaki pozisyonlardan herhangi biri için şubede çalışmadığı saptanmıştır. Şube müdürlerinin %22.5’inin şubede çalışma deneyimi vardır. Kırk bir (%57.7 şube müdürü ve 22 (%28.6 müdür yardımcısı, bulaşıcı hastalıklar konusunda eğitici eğitimi almıştır. Bulaşıcı Hastalık Şube Müdürlüklerinde Şube Müdürü dışında çalışan personelin meslek

Dicty_cDB: SLC465 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

Implementation of DoS attack and mitigation strategies in IEEE 802.11b/g WLAN

Science.gov (United States)

Deng, Julia; Meng, Ke; Xiao, Yang; Xu, Roger

2010-04-01

IEEE 802.11 wireless Local Area Network (WLAN) becomes very prevalent nowadays. Either as a simple range extender for a home wired Ethernet interface, or as a wireless deployment throughout an enterprise, WLAN provides mobility, convenience, and low cost. However, an IEEE 802.11b/g wireless network uses the frequency of unlicensed 2.4GHz, which makes the network unsafe and more vulnerable than traditional Ethernet networks. As a result, anyone who is familiar with wireless network may initiate a Denial of Service (DoS) attack to influence the common communication of the network or even make it crash. In this paper, we present our studies on the DoS attacks and mitigation strategies for IEEE 802.11b/g WLANs and describe some initial implementations using IEEE 802.11b/g wireless devices.

L’évaluation systématique des instruments pour mesurer la douleur chez les personnes âgées ayant des capacités réduites à communiquer*

Science.gov (United States)

Aubin, Michèle; Giguère, Anik; Hadjistavropoulos, Thomas; Verreault, René

2007-01-01

La douleur chronique est souvent sous-détectée et insuffisamment traitée dans les milieux de soins de longue durée. Les outils d’autorapport (ou autoévaluation) de la douleur, comme l’échelle visuelle analogique, n’ont été validés que partiellement chez les populations âgées, en raison de la prévalence élevée de déficits visuels, auditifs, moteurs et cognitifs que l’on y trouve. Des outils d’observation des patients ont été développés pour pallier ces difficultés d’utilisation des échelles d’autorapport de la douleur. Le présent projet vise l’identification de ces échelles et leur évaluation sur la base de la validité de contenu (12 questions), de la validité de construit (12 questions), de la fiabilité (13 questions) et de l’utilité clinique (10 questions). Parmi les 24 instruments recensés, plusieurs apparaissent prometteurs pour évaluer la douleur chez les personnes âgées atteintes de démence sévère. Des efforts additionnels de validation sont cependant requis avant leur intégration à la pratique régulière en soins de longue durée. PMID:17717611

G673 could be a novel mutational hot spot for intragenic suppressors of pheS5 lesion in Escherichia coli.

Science.gov (United States)

Ponmani, Thangaraj; Munavar, M Hussain

2014-06-01

The pheS5 Ts mutant of Escherichia coli defined by a G293 → A293 transition, which is responsible for thermosensitive Phenylalanyl-tRNA synthetase has been well studied at both biochemical and molecular level but genetic analyses pertaining to suppressors of pheS5 were hard to come by. Here we have systematically analyzed a spectrum of Temperature-insensitive derivatives isolated from pheS5 Ts mutant and identified two intragenic suppressors affecting the same base pair coordinate G673 (pheS19 defines G673 → T673 ; Gly225 → Cys225 and pheS28 defines G673 → C673 ; Gly225 → Arg225). In fact in the third derivative, the intragenic suppressor originally named pheS43 (G673 → C673 transversion) is virtually same as pheS28. In the fourth case, the very pheS5 lesion itself has got changed from A293 → T293 (named pheS40). Cloning of pheS(+), pheS5, pheS5-pheS19, pheS5-pheS28 alleles into pBR322 and introduction of these clones into pheS5 mutant revealed that excess of double mutant protein is not at all good for the survival of cells at 42°C. These results clearly indicate a pivotal role for Gly225 in the structural/functional integrity of alpha subunit of E. coli PheRS enzyme and it is proposed that G673 might define a hot spot for intragenic suppressors of pheS5. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Supplemental Table S4.xls

Indian Academy of Sciences (India)

143, AT3G05200.1, 8262, I, 0.6, 259312_at, ATL6 (Arabidopsis T?xicos en Levadura 6); protein binding / zinc ion binding. 144, LOC_Os08g37760.1, 8262, D, -1.07, Os.17554.1.S1_at, zinc finger, C3HC4 type family protein, expressed. 145, AT5G27420.1, 8262, D, -0.95, 246777_at, zinc finger (C3HC4-type RING finger) ...

Contribution of G.I.S. for the survey and the management of water ...

African Journals Online (AJOL)

Contribution of G.I.S. for the survey and the management of water resources in the basin ... Journal of Fundamental and Applied Sciences ... having a relationship with the study and the management of the water resources of the basin of ...

Astonishing 35S rDNA diversity in the gymnosperm species Cycas revoluta Thunb

Czech Academy of Sciences Publication Activity Database

Wang, W.; Ma, L.; Becher, H.; Garcia, S.; Kovaříková, Alena; Leitch, I. J.; Leitch, A. R.; Kovařík, Aleš

2016-01-01

Roč. 125, č. 4 (2016), s. 683-699 ISSN 0009-5915 R&D Projects: GA ČR GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : ribosomal-rna gene * internal transcribed spacer * genome evolution Subject RIV: BO - Biophysics Impact factor: 4.414, year: 2016

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

Science.gov (United States)

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Triple helical polynucleotidic structures: an FTIR study of the C+ .G. Ctriplet.

Science.gov (United States)

Akhebat, A; Dagneaux, C; Liquier, J; Taillandier, E

1992-12-01

Triple helixes containing one homopurine poly dG or poly rG strand and two homopyrimidine poly dC or poly rC strands have been prepared and studied by FTIR spectroscopy in H2O and D2O solutions. The spectra are discussed by comparison with those of the corresponding third strands (auto associated or not) and of double stranded poly dG.poly dC and poly rG.poly rC in the same concentration range and salt conditions. The triplex formation is characterized by the study of the base-base interactions reflected by changes in the spectral domain involving the in-plane double bond vibrations of the bases. Modifications of the initial duplex conformation (A family form for poly rG.poly rC, B family form for poly dG.poly dC) when the triplex is formed have been investigated. Two spectral domains (950-800 and 1450-1350 cm-1) containing absorption bands markers of the N and S type sugar geometries have been extensively studied. The spectra of the triplexes prepared starting with a double helix containing only riboses (poly rC+.poly rG.poly rC and poly dC+.poly rG.poly rC) as well as that of poly rC+.poly dG.poly dC present exclusively markers of the North type geometry of the sugars. On the contrary in the case of the poly dC+.poly dG.poly dC triplex both N and S type sugars are shown to coexist. The FTIR spectra allow us to propose that in this case the sugars of the purine (poly dG) strand adopt the S type geometry.

Evidence for prehistoric origins of the G2019S mutation in the North African Berber population.

Science.gov (United States)

Ben El Haj, Rafiqua; Salmi, Ayyoub; Regragui, Wafa; Moussa, Ahmed; Bouslam, Naima; Tibar, Houyam; Benomar, Ali; Yahyaoui, Mohamed; Bouhouche, Ahmed

2017-01-01

The most common cause of the monogenic form of Parkinson's disease known so far is the G2019S mutation of the leucine-rich repeat kinase 2 (LRRK2) gene. Its frequency varies greatly among ethnic groups and geographic regions ranging from less than 0.1% in Asia to 40% in North Africa. This mutation has three distinct haplotypes; haplotype 1 being the oldest and most common. Recent studies have dated haplotype 1 of the G2019S mutation to about 4000 years ago, but it remains controversial whether the mutation has a Near-Eastern or Moroccan-Berber ancestral origin. To decipher this evolutionary history, we genotyped 10 microsatellite markers spanning a region of 11.27 Mb in a total of 57 unrelated Moroccan PD patients carrying the G2019S mutation for which the Berber or Arab origin was established over 3 generations based on spoken language. We estimated the age of the most recent common ancestor for the 36 Arab-speaking and the 15 Berber-speaking G2019S carriers using the likelihood-based method with a mutation rate of 10-4. Data analysis suggests that the shortest haplotype originated in a patient of Berber ethnicity. The common founder was estimated to have lived 159 generations ago (95% CI 116-224) for Arab patients, and 200 generations ago (95% CI 123-348) for Berber patients. Then, 29 native North African males carrying the mutation were assessed for specific uniparental markers by sequencing the Y-chromosome (E-M81, E-M78, and M-267) and mitochondrial DNA (mtDNA) hypervariable regions (HV1 and HV2) to examine paternal and maternal contributions, respectively. Results showed that the autochthonous genetic component reached 76% for mtDNA (Eurasian and north African haplogroups) and 59% for the Y-chromosome (E-M81 and E-M78), suggesting that the G2019S mutation may have arisen in an autochthonous DNA pool. Therefore, we conclude that LRRK2 G2019S mutation most likely originated in a Berber founder who lived at least 5000 years ago (95% CI 3075-8700).

Supersymmetric M3-branes and G2 manifolds

International Nuclear Information System (INIS)

Cvetic, M.; Gibbons, G.W.; Lue, H.; Pope, C.N.

2002-01-01

We obtain a generalisation of the original complete Ricci-flat metric of G 2 holonomy on (R 4 xS 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G 2 metric, and λ={-1,1} are related to this by an S 3 automorphism of the SU(2) 3 isometry group that acts on the S 3 xS 3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G 2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G 2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric

Supersymmetric M3-branes and G2 manifolds

Science.gov (United States)

Cvetič, M.; Gibbons, G. W.; Lü, H.; Pope, C. N.

2002-01-01

We obtain a generalisation of the original complete Ricci-flat metric of G2 holonomy on R4×S 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G2 metric, and λ={-1,1} are related to this by an S3 automorphism of the SU(2) 3 isometry group that acts on the S3× S3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.

G2019S LRRK2 mutant fibroblasts from Parkinson’s disease patients show increased sensitivity to neurotoxin 1-methyl-4-phenylpyridinium dependent of autophagy

International Nuclear Information System (INIS)

Yakhine-Diop, Sokhna M.S.; Bravo-San Pedro, José M.; Gómez-Sánchez, Rubén; Pizarro-Estrella, Elisa; Rodríguez-Arribas, Mario; Climent, Vicente; Aiastui, Ana; López de Munain, Adolfo

2014-01-01

Parkinson’s disease (PD) is a neurodegenerative disorder of unknown etiology. It is considered as a multifactorial disease dependent on environmental and genetic factors. Deregulation in cell degradation has been related with a significant increase in cell damage, becoming a target for studies on the PD etiology. In the present study, we have characterized the parkinsonian toxin 1-methyl-4-phenylpyridinium ion (MPP + )-induced damage in fibroblasts from Parkinson’s patients with the mutation G2019S in leucine-rich repeat kinase 2 protein (LRRK2) and control individuals without this mutation. The results reveal that MPP + induces mTOR-dependent autophagy in fibroblasts. Moreover, the effects of caspase-dependent cell death to MPP + were higher in cells with the G2019S LRRK2 mutation, which showed basal levels of autophagy due to the G2019S LRRK2 mutation (mTOR-independent). The inhibition of autophagy by 3-methyladenine (3-MA) treatment reduces these sensitivity differences between both cell types, however, the inhibition of autophagosome–lysosome fusion by bafilomycin A1 (Baf A1) increases these differences. This data confirm the importance of the combination of genetic and environmental factors in the PD etiology. Thereby, the sensitivity to the same damage may be different in function of a genetic predisposition, reason why individuals with certain mutations can develop some early-onset diseases, such as individuals with G2019S LRRK2 mutation and PD

Resolution of alpha/beta-amino acids by enantioselective penicillin G acylase from Achromobacter sp

Czech Academy of Sciences Publication Activity Database

Grulich, Michal; Brezovský, J.; Štěpánek, Václav; Palyzová, Andrea; Kyslíková, Eva; Kyslík, Pavel

2015-01-01

Roč. 122, DEC 2015 (2015), s. 240-247 ISSN 1381-1177 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Penicillin G acylase * Enantioselectivity * Homologous model Subject RIV: CE - Biochemistry Impact factor: 2.189, year: 2015

Delta-Opioid receptors exhibit high efficiency when activating trimeric G proteins in membrane domains

Czech Academy of Sciences Publication Activity Database

Bouřová, Lenka; Koštrnová, Alexandra; Hejnová, Lucie; Moravcová, Zuzana; Moon, H. E.; Novotný, Jiří; Milligan, G.; Svoboda, Petr

2003-01-01

Roč. 85, č. 1 (2003), s. 34-49 ISSN 0022-3042 R&D Projects: GA MŠk LN00A026; GA ČR GA309/01/0255 Grant - others:Welcome Trust(GB) xx Institutional research plan: CEZ:AV0Z5011922 Keywords : membrane domains * GTPase activity * G protein coupling Subject RIV: CE - Biochemistry Impact factor: 4.825, year: 2003

Insight into the molecular mechanism of yeast acetyl-coenzyme A carboxylase mutants F510I, N485G, I69E, E477R, and K73R resistant to soraphen A

Science.gov (United States)

Gao, Jian; Liang, Li; Chen, Qingqing; Zhang, Ling; Huang, Tonghui

2018-02-01

Acetyl-coenzyme A carboxylases (ACCs) is the first committed enzyme of fatty acid synthesis pathway. The inhibition of ACC is thought to be beneficial not only for diseases related to metabolism, such as type-2 diabetes, but also for infectious disease like bacterial infection disease. Soraphen A, a potent allosteric inhibitor of BC domain of yeast ACC, exhibit lower binding affinities to several yeast ACC mutants and the corresponding drug resistance mechanisms are still unknown. We report here a theoretical study of binding of soraphen A to wild type and yeast ACC mutants (including F510I, N485G, I69E, E477R, and K73R) via molecular dynamic simulation and molecular mechanics/generalized Born surface area free energy calculations methods. The calculated binding free energies of soraphen A to yeast ACC mutants are weaker than to wild type, which is highly consistent with the experimental results. The mutant F510I weakens the binding affinity of soraphen A to yeast ACC mainly by decreasing the van der Waals contributions, while the weaker binding affinities of Soraphen A to other yeast ACC mutants including N485G, I69E, E477R, and K73R are largely attributed to the decreased net electrostatic (ΔE ele + ΔG GB) interactions. Our simulation results could provide important insights for the development of more potent ACC inhibitors.

Enhanced visible-light photocatalytic decomposition of 2,4-dichlorophenoxyacetic acid over ZnIn_2S_4/g-C_3N_4 photocatalyst

International Nuclear Information System (INIS)

Qiu, Pengxiang; Yao, Jinhua; Chen, Huan; Jiang, Fang; Xie, Xianchuan

2016-01-01

Highlights: • A novel flower-on-sheet ZnIn_2S_4/g-C_3N_4 nanocomposite was synthesized. • ZnIn_2S_4/g-C_3N_4 showed high visible light catalytic activity for 2,4-D degradation. • The photocatalytic degradation pathway of 2,4-D was investigated. - Abstract: ZnIn_2S_4/g-C_3N_4 heterojunction photocatalyst was successfully synthesized via a simple hydrothermal method and applied to visible-light photocatalytic decomposition of 2,4-dichlorophenoxyacetic acid (2,4-D) from aqueous phase. The flower-like ZnIn_2S_4 particles were dispersed on the surface of g-C_3N_4 nanosheets in the ZnIn_2S_4/g-C_3N_4 composite. The composite showed higher separation rate of electron-hole pairs as compared to ZnIn_2S_4 and g-C_3N_4. Consequently, the ZnIn_2S_4/g-C_3N_4 composite exhibited enhanced visible light photocatalytic decomposition efficiency of 2,4-D, within 20% ZnIn_2S_4/g-C_3N_4 composite owning the highest photocatalytic efficiency and initial rate. The initial rates of 2,4-D degradation on g-C_3N_4, ZnIn_2S_4, and 20% ZnIn_2S_4/g-C_3N_4 were 1.23, 0.57 and 3.69 mmol/(g_c_a_t h), respectively. The h"+ and O_2"·"− were found to be the dominant active species for 2,4-D decomposition. The photocatalytic degradation pathways of 2,4-D by ZnIn_2S_4/g-C_3N_4 under visible light irradiation were explored. The ZnIn_2S_4/g-C_3N_4 composite displayed high photostability in recycling tests, reflecting its promising potential as an effective visible light photocatalyst for 2,4-D treatment.

Significance of Lignin S/G Ratio in Biomass Recalcitrance of Populus trichocarpa Variants for Bioethanol Production

Energy Technology Data Exchange (ETDEWEB)

Yoo, Chang Geun [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dumitrache, Alexandru [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Muchero, Wellington [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Natzke, Jace [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Akinosho, Hannah [Georgia Inst. of Technology, Atlanta, GA (United States); Li, Mi [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sykes, Robert W. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Brown, Steven D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Davison, Brian [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Tuskan, Gerald A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Pu, Yunqiao [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ragauskas, Arthur J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Univ. of Tennessee, Knoxville, TN (United States)

2017-12-11

Lignin S/G ratio has been investigated as an important factor in biomass recalcitrance to bioethanol production. Because of the complexity and variety of biomass, recalcitrance was also reportedly influenced by several other factors, such as total lignin content, degree of cellulose polymerization, etc. In addition, the effect of S/G ratio on biomass conversion is not uniform across plant species. Herein, 11 Populus trichocarpa natural variants grown under the same conditions with similar total lignin content were selected to minimize the effects of other factors. The lignin S/G ratio of the selected P. trichocarpa natural variants showed negative correlations with p-hydroxybenzoate (PB) and β–5 linkage contents, while it had positive ones with β-O-4 linkage, lignin molecular weight, and ethanol production. In conclusion, this study showed the importance of lignin S/G ratio as an independent recalcitrance factor that may aid future energy crop engineering and biomass conversion strategies.

Significance of Lignin S/G Ratio in Biomass Recalcitrance of Populus trichocarpa Variants for Bioethanol Production

Energy Technology Data Exchange (ETDEWEB)

Yoo, Chang Geun [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; UT−ORNL; Dumitrache, Alexandru [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; Muchero, Wellington [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; Natzke, Jace [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; Akinosho, Hannah [School; Li, Mi [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; UT−ORNL; Sykes, Robert W. [National Renewable Energy Laboratory, U.S. Department of Energy, 15013 Denver West Parkway, Golden, Colorado 80401, United States; Brown, Steven D. [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; Davison, Brian [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; Tuskan, Gerald A. [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; Pu, Yunqiao [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; UT−ORNL; Ragauskas, Arthur J. [BioEnergy; amp, Center for BioEnergy Innovation, Biosciences; UT−ORNL; Department; amp, Center for Renewable

2017-12-27

Lignin S/G ratio has been investigated as an important factor in biomass recalcitrance to bioethanol production. Because of the complexity and variety of biomass, recalcitrance was also reportedly influenced by several other factors, such as total lignin content, degree of cellulose polymerization, etc. In addition, the effect of S/G ratio on biomass conversion is not uniform across plant species. Herein, 11 Populus trichocarpa natural variants grown under the same conditions with similar total lignin content were selected to minimize the effects of other factors. The lignin S/G ratio of the selected P. trichocarpa natural variants showed negative correlations with p-hydroxybenzoate (PB) and ..beta..-5 linkage contents, while it had positive ones with ..beta..-O-4 linkage, lignin molecular weight, and ethanol production. This study showed the importance of lignin S/G ratio as an independent recalcitrance factor that may aid future energy crop engineering and biomass conversion strategies.

Sistemas de liberação controlada com bupivacaína racêmica (S50-R50 e mistura enantiomérica de bupivacaína (S75-R25: efeitos da complexação com ciclodextrinas no bloqueio do nervo ciático em camundongos Sistemas de liberación controlada con bupivacaína racémica (S50-R50 y mescla enantiomérica de bupivacaína (S75-R25: efectos de la complexación con ciclodextrinas en el bloqueo del nervio ciático en ratones Drug-delivery systems for racemic bupivacaine (S50-R50 and bupivacaine enantiomeric mixture (S75-R25: cyclodextrins complexation effects on sciatic nerve blockade in mice

Directory of Open Access Journals (Sweden)

Daniele Ribeiro de Araújo

2005-06-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Os efeitos adversos associados ao uso de bupivacaína levaram à procura por novos anestésicos locais (AL com perfil de bloqueio semelhante e menos tóxicos, surgindo novas preparações como a mistura enantiomérica de bupivacaína (S75-R25. Os sistemas de liberação controlada, contendo AL em carreadores como ciclodextrinas (CD, têm como objetivo melhorar a eficácia anestésica e o índice terapêutico dessas drogas. Este estudo visou a preparação, a caracterização e a avaliação da eficácia anestésica dos complexos de inclusão da mistura enantiomérica da bupivacaína (S75-R25 e da bupivacaína racêmica (S50-R50 com hidroxipropilb-ciclodextrina (HPb-CD comparando-os com as preparações atualmente utilizadas na clínica. MÉTODO: Os complexos de inclusão foram preparados misturando-se quantidades apropriadas de HPb-CD e S50-R50 ou S75-R25 nas razões molares (1:1 e 1:2 e caracterizados por estudos de solubilidade de fases. Determinaram-se as constantes de afinidade (K de cada AL pela HPb-CD. Os bloqueios motor e sensorial induzidos pelas drogas livres e complexadas foram avaliados, em camundongos, através do bloqueio do nervo ciático. Para a realização dos experimentos, utilizaram-se três concentrações de AL: 0,125%; 0,25% e 0,5%. RESULTADOS: Os estudos de solubilidade indicaram a formação de complexos de inclusão de S50-R50 e S75-R25 com HPb-CD, com valores de constante de afinidade (K similares para os dois anestésicos: 14,7 M-1 (S50-R50:HP-bCD e 14,3 M-1 (S75-R25:HP-bCD. Os testes em animais mostraram que a complexação potencializou o bloqueio nervoso diferencial induzido pelos AL: i a duração do bloqueio motor induzido por S75-R25 foi similar à do S50-R50, mas menos intenso (p JUSTIFICATIVA Y OBJETIVOS: Los efectos adversos asociados al uso de bupivacaína llevaron a la búsqueda por nuevos anestésicos locales (AL con perfil de bloqueo semejante y menos tóxicos, surgiendo nuevas

Comment on "What is the entanglement length in a polymer melt?" by M. Pütz, K. Kremer and G. S. Grest

Science.gov (United States)

Wischnewski, A.; Richter, D.

2000-12-01

In a recent letter Pütz, Kremer and Grest claim that finite-chain-length effects have significant influence on the single-chain dynamic structure factor S(Q,t)/S(Q) measured by neutron-spin-echo (NSE) technique with regard to results obtained for a polyethylene (PE) melt with a molecular weight of Mw = 36000 g/mol. As a consequence of these finite-length effects, they assert the tube diameter, determined by this NSE measurement in the framework of the reptation model, to be too high by a factor of approx 1.5. We demonstrate that this is by no means the case.

Parcacik fizigi en kücügü kesfetme macerasi

CERN Document Server

Sekmen, Sezen

2015-01-01

Elinizdeki bu kitap biraz yukarı kuark, biraz aşağı kuark ve bir miktar da elektron namlı leptondan yapılmıştır. Bunlara ulaşmak için kitap çok büyük bir teknolojiyle çok küçük parçlara ayrıştırılabilir. Dahası, elde edilen kuark ve leptonlar farklı şekillerde bir araya getirilip kitap çilekli dondurmaya, fötr şapkaya ya da uzay gemisi motoruna da çevrilebilir. Çünkü kuarklar, leptonlar ve bir kısım diğerleri temel parçacıklardır yani evrendeki herşeyin nihai yapıtaşları. Öte yandan eğer kitabı daha faydalı ve ilginç şeylere dönüştürmek yerine okumak tercih edilirse içeriğinde evrenimizi doğumundan bugüne şenlendiren temel parçacıkların ve onları yakalamak için sürekli uğraşan meraklı fizikçilerin heyecanlı hikayesi bulunabilir.

Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

International Nuclear Information System (INIS)

Wina, E.; Muetzel, S.; Hoffman, E.; Becker, K.; Makkar, H.P.S.

2005-01-01

A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

Fine Structure in Proton Emission from the Deformed 141g.sHo and 141mHo

International Nuclear Information System (INIS)

Karny, M.; Rykaczewski, Krzysztof Piotr; Grzywacz, R.; Batchelder, J.C.; Bingham, C.R.; Goodin, C. T.; Gross, Carl J.; Hamilton, J.H.; Korgul, A.; Krolas, W.; Liddick, S. N.; Li, K.; Maier, Karl; Mazzocchi, C.; Piechaczek, A.; Shapira, Dan; Simpson, D.; Tantawy, M.N.; Winger, J.A.; Yu, Chang-Hong; Zganjar, E. F.

2007-01-01

Fine structure in proton emission from the deformed states 141g.s Ho (T 1/2 = 4.1 ms) and 141 mHo (T 1/2 = 7.4 (micro)s) has been discovered at Oak Ridge by detecting fusion evaporation residues with the Recoil Mass Spectrometer, Si-detectors and digital signal processing electronics. The branching ratios to the first 2 + excited state in 140 Dy were measured to be I p g.s. (2 + ) = 0.9±0.1% and I p m (2 + ) = 1.7±0.5%. A comparison of the available calculations to the experimental values calls for further development of the theoretical models

Inhibition of PI3K by ZSTK474 suppressed tumor growth not via apoptosis but G0/G1 arrest

International Nuclear Information System (INIS)

Dan, Shingo; Yoshimi, Hisashi; Okamura, Mutsumi; Mukai, Yumiko; Yamori, Takao

2009-01-01

Phosphoinositide 3-kinase (PI3K) is a potential target in cancer therapy. Inhibition of PI3K is believed to induce apoptosis. We recently developed a novel PI3K inhibitor ZSTK474 with antitumor efficacy. In this study, we have examined the underlying mode of action by which ZSTK474 exerts its antitumor efficacy. In vivo, ZSTK474 effectively inhibited the growth of human cancer xenografts. In parallel, ZSTK474 treatment suppressed the expression of phospho-Akt, suggesting effective PI3K inhibition, and also suppressed the expression of nuclear cyclin D1 and Ki67, both of which are hallmarks of proliferation. However, ZSTK474 treatment did not increase TUNEL-positive apoptotic cells. In vitro, ZSTK474 induced marked G 0 /G 1 arrest, but did not increase the subdiploid cells or activate caspase, both of which are hallmarks of apoptosis. These results clearly indicated that inhibition of PI3K by ZSTK474 did not induce apoptosis but rather induced strong G 0 /G 1 arrest, which might cause its efficacy in tumor cells.

Didaktisko spēļu izmantošana apkārtnes mācību stundās skolēniem ar vidēji smagiem garīgās attīstības traucējumiem

OpenAIRE

Zarecka, Tatjana

2007-01-01

Diplomarba tēma ir „Didaktisko spēļu izmantošana apkārtnes mācību stundās skolēniem ar vidēji smagiem un smagiem garīgās attīstības traucējumiem”. Pētījuma mērķis: Diplomdarbā teoretiskajā daļā tiek apskatītās pedagoģiskās atziņas par didaktiskajām spēlēm: pedagogus F.Frēbeļa, M.Montesori, K.Ušinska, J.Tihejevas, A.Sorokinas, A.Bondarenko, O.Svenne, I.Kapostas darbu apskats; tiek analizēts terminu „spēle” un „rotaļa” salidzinājums; tiek apskatīta didaktisko spēļu klasifikācija; tiek a...

HAb18G/CD147 Promotes pSTAT3-Mediated Pancreatic Cancer Development via CD44s †, ‡

Science.gov (United States)

Li, Ling; Tang, Wenhua; Wu, Xiaoqing; Karnak, David; Meng, Xiaojie; Thompson, Rachel; Hao, Xinbao; Li, Yongmin; Qiao, Xiaotan T.; Lin, Jiayuh; Fuchs, James; Simeone, Diane M.; Chen, Zhi-Nan; Lawrence, Theodore S.; Xu, Liang

2013-01-01

Purpose STAT3 plays a critical role in initiation and progression of pancreatic cancer. However, therapeutically targeting STAT3 is failure in clinic. We previously identified HAb18G/CD147 as an effective target for cancer treatment. In this study, we aimed to investigate potential role of HAb18G/CD147 in STAT3-involved pancreatic tumorigenesis in vitro and in vivo. Experimental Design The expression of HAb18G/CD147, pSTAT3 and CD44s were determined in tissue microarrays. The tumorigenic function and molecular signaling mechanism of HAb18G/CD147 was assessed by in vitro cellular and clonogenic growth, reporter assay, immunoblot, immunofluorescence staining, immunoprecipitation, and in vivo tumor formationusing loss or gain-of-function strategies. Results Highly expressed HAb18G/CD147 promoted cellular and clonogenic growth in vitro and tumorigenicity in vivo. CyPA, a ligand of CD147, stimulated STAT3 phosphorylation and its downstream genes cyclin D1/survivin through HAb18G/CD147 dependent mechanisms. HAb18G/CD147 was associated and co-localized with cancer stem cell marker CD44s in lipid rafts. The inhibitors of STAT3 and survivin, as well as CD44s neutralizing antibodies suppressed the HAb18G/CD147-induced cell growth. High HAb18G/CD147 expression in pancreatic cancer was significantly correlated with the poor tumor differentiation, and the high co-expression of HAb18G/CD147-CD44s-STAT3 associated with poor survival of patients with pancreatic cancer. Conclusions We identified HAb18G/CD147 as a novel upstream activator of STAT3 via interacts with CD44s and plays a critical role in the development of pancreatic cancer. The data suggest HAb18G/CD147 could be a promising therapeutic target for highly aggressive pancreatic cancer and a surrogate marker in the STAT3-targeted molecular therapies. PMID:24132924

Structure features of TBN1, a P1/S1-like nuclease

Czech Academy of Sciences Publication Activity Database

Koval, Tomáš; Stránský, Jan; Lipovová, P.; Podzimek, Tomáš; Matoušek, Jaroslav; Dušková, Jarmila; Skálová, Tereza; Hašek, Jindřich; Fejfarová, Karla; Kolenko, Petr; Dohnálek, Jan

2014-01-01

Roč. 281, Supplement s1 (2014), s. 601 ISSN 1742-464X. [FEBS EMBO 2014 Conference. 30.08.2014-04.09.2014, Paris] R&D Projects: GA MŠk(CZ) EE2.3.30.0029; GA MŠk LG14009; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61389013 ; RVO:86652036 ; RVO:60077344 Keywords : chitin * chitinase * clostridium Subject RIV: CE - Biochemistry; EI - Biotechnology ; Bionics (BTO-N); EB - Genetics ; Molecular Biology (BC-A) http://onlinelibrary.wiley.com/doi/10.1111/febs.12919/abstract

Reactive scattering of B+(1S/sub g/) by molecular deuterium

International Nuclear Information System (INIS)

Sondergaard, N.A.; Sauers, I.; Kaufman, J.J.; Koski, W.S.

1979-01-01

The angular and energy distribution of ionic products from the reaction of B + ( 1 S/sub g/) with D 2 was studied over a projectile energy range of 10 to 50 eV in the laboratory system. The product states as determined from the limiting values of the translational exoergicity were BD + ( 2 Σ + ) and BD + ( 2 π). The experimental measurements and theoretical considerations suggest that both of these reactions are proceeding through a persistent complex

Thermodynamic evaluation and optimization of the (Na+K+S) system

International Nuclear Information System (INIS)

Lindberg, Daniel; Backman, Rainer; Hupa, Mikko; Chartrand, Patrice

2006-01-01

The (Na+K+S) system is of primary importance for the combustion of black liquor in the kraft recovery boilers in pulp and paper mills. A thermodynamic evaluation and optimization for the (Na+K+S) system has been made. All available data for the system have been critically evaluated to obtain optimized parameters of thermodynamic models for all phases. The liquid model is the quasichemical model in the quadruplet approximation, which evaluates 1st- and 2nd-nearest-neighbour short-range-order. In this model, cations (Na + and K + ) are assumed to mix on a cationic sublattice, while anions (S 2- ,S 2 2- ,S 3 2- ,S 4 2- ,S 5 2- ,S 6 2- ,S 7 2- ,S 8 2- ,Va - ) are assumed to mix on an anionic sublattice. The thermodynamic data of the liquid polysulphide components M 2 S 1+n (M=Na, K and n=1-7) are fitted to ΔG=A(n)+B(n).T for the reaction M 2 S(l)+nS(l)=M 2 S n+1 (l). The solid phases are the alkali alloys, alkali sulphides, several different alkali polysulphides and sulphur. The solid solutions (Na,K) (Na,K) 2 S and (Na,K) 2 S 2 are modelled using the compound energy formalism. The models can be used to predict the thermodynamic properties and phase equilibria in the multicomponent heterogeneous system. The experimental data are reproduced within experimental error limits for equilibria between solid, liquid and gas. The ternary phase diagram of the system (Na 2 S+K 2 S+S) has been predicted as no experimental determinations of the phase diagram have been made previously

MHC class I Dk locus and Ly49G2+ NK cells confer H-2k resistance to murine cytomegalovirus.

Science.gov (United States)

Xie, Xuefang; Stadnisky, Michael D; Brown, Michael G

2009-06-01

Essential NK cell-mediated murine CMV (MCMV) resistance is under histocompatibility-2(k) (H-2(k)) control in MA/My mice. We generated a panel of intra-H2(k) recombinant strains from congenic C57L.M-H2(k/b) (MCMV resistant) mice for precise genetic mapping of the critical interval. Recombination breakpoint sites were precisely mapped and MCMV resistance/susceptibility traits were determined for each of the new lines to identify the MHC locus. Strains C57L.M-H2(k)(R7) (MCMV resistant) and C57L.M-H2(k)(R2) (MCMV susceptible) are especially informative; we found that allelic variation in a 0.3-megabase interval in the class I D locus confers substantial difference in MCMV control phenotypes. When NK cell subsets responding to MCMV were examined, we found that Ly49G2(+) NK cells rapidly expand and selectively acquire an enhanced capacity for cytolytic functions only in C57L.M-H2(k)(R7). We further show that depletion of Ly49G2(+) NK cells before infection abrogated MCMV resistance in C57L.M-H2(k)(R7). We conclude that the MHC class I D locus prompts expansion and activation of Ly49G2(+) NK cells that are needed in H-2(k) MCMV resistance.

Microstructure analysis of chemically synthesized wurtzite-type CdS ...

Indian Academy of Sciences (India)

37, 4682 (1998). [12] O Z Angel and R L Morales, Phys. Rev. B 62, 13064 (2000). [13] S Wei and S B Zhang, Phys. Rev. B 62, 6944 (2000). [14] G Lin, J Zheng and R Xu, J. Phy. Chem. C 112, 7363 (2008). [15] N Bao, L Shen, T Takata, K Domen, A Gupta, K Yanagisawa and C A Grimes, J. Phys. Chem. C 111, 17527 (2007).

Live imaging-based model selection reveals periodic regulation of the stochastic G1/S phase transition in vertebrate axial development.

Directory of Open Access Journals (Sweden)

Mayu Sugiyama

2014-12-01

Full Text Available In multicellular organism development, a stochastic cellular response is observed, even when a population of cells is exposed to the same environmental conditions. Retrieving the spatiotemporal regulatory mode hidden in the heterogeneous cellular behavior is a challenging task. The G1/S transition observed in cell cycle progression is a highly stochastic process. By taking advantage of a fluorescence cell cycle indicator, Fucci technology, we aimed to unveil a hidden regulatory mode of cell cycle progression in developing zebrafish. Fluorescence live imaging of Cecyil, a zebrafish line genetically expressing Fucci, demonstrated that newly formed notochordal cells from the posterior tip of the embryonic mesoderm exhibited the red (G1 fluorescence signal in the developing notochord. Prior to their initial vacuolation, these cells showed a fluorescence color switch from red to green, indicating G1/S transitions. This G1/S transition did not occur in a synchronous manner, but rather exhibited a stochastic process, since a mixed population of red and green cells was always inserted between newly formed red (G1 notochordal cells and vacuolating green cells. We termed this mixed population of notochordal cells, the G1/S transition window. We first performed quantitative analyses of live imaging data and a numerical estimation of the probability of the G1/S transition, which demonstrated the existence of a posteriorly traveling regulatory wave of the G1/S transition window. To obtain a better understanding of this regulatory mode, we constructed a mathematical model and performed a model selection by comparing the results obtained from the models with those from the experimental data. Our analyses demonstrated that the stochastic G1/S transition window in the notochord travels posteriorly in a periodic fashion, with doubled the periodicity of the neighboring paraxial mesoderm segmentation. This approach may have implications for the characterization of

The g0/g1 switch gene 2 is an important regulator of hepatic triglyceride metabolism.

Science.gov (United States)

Wang, Yinfang; Zhang, Yahui; Qian, Hang; Lu, Juan; Zhang, Zhifeng; Min, Xinwen; Lang, Mingjian; Yang, Handong; Wang, Nanping; Zhang, Peng

2013-01-01

Nonalcoholic fatty liver disease is associated with obesity and insulin resistance. Factors that regulate the disposal of hepatic triglycerides contribute to the development of hepatic steatosis. G0/G1 switch gene 2 (G0S2) is a target of peroxisome proliferator-activated receptors and plays an important role in regulating lipolysis in adipocytes. Therefore, we investigated whether G0S2 plays a role in hepatic lipid metabolism. Adenovirus-mediated expression of G0S2 (Ad-G0S2) potently induced fatty liver in mice. The liver mass of Ad-G0S2-infected mice was markedly increased with excess triglyceride content compared to the control mice. G0S2 did not change cellular cholesterol levels in hepatocytes. G0S2 was found to be co-localized with adipose triglyceride lipase at the surface of lipid droplets. Hepatic G0S2 overexpression resulted in an increase in plasma Low-density lipoprotein (LDL)/Very-Low-density (VLDL) lipoprotein cholesterol level. Plasma High-density lipoprotein (HDL) cholesterol and ketone body levels were slightly decreased in Ad-G0S2 injected mice. G0S2 also increased the accumulation of neutral lipids in cultured HepG2 and L02 cells. However, G0S2 overexpression in the liver significantly improved glucose tolerance in mice. Livers expressing G0S2 exhibited increased 6-(N-(7-nitrobenz-2-oxa-1-3-diazol-4-yl) amino)-6-deoxyglucose uptake compared with livers transfected with control adenovirus. Taken together, our results provide evidence supporting an important role for G0S2 as a regulator of triglyceride content in the liver and suggest that G0S2 may be a molecular target for the treatment of insulin resistance and other obesity-related metabolic disorders.

Infotankistid ja Puhas Rõõm esitlevad : R.A.I.S.K. / Piret Räni

Index Scriptorium Estoniae

Räni, Piret

2007-01-01

Rühmitustest Infotankistid ja Puhas Rõõm. Näitusel R.A.I.S.K. (Radikaalne Agiteeriv Intrigeeriv Sotsiaalne Kunst) eksponeeritud töödest, autorid Mart Viljus, Katrin Tees, Ivika Kivi, Sulo Kallas, Piret Räni, Erki Kannus, Anu Vahtra, Maris Suits, Taavi Suits

Farklı ekim zamanı ve uygulamaların Censiyan (Gentiana lutea subs. symphyandra) tohumlarının çıkış gücü üzerine etkilerinin belirlenmesi

OpenAIRE

ERKEN, Serdar; KALECİ, Nilüfer

2014-01-01

Bu çalışma Türkiye’de nadir yayılış gösteren ve nesli tehlike altında olan Censiyan (Gentiana lutea subs.symphyandra) tohumlarının çoğaltılabilme imkanlarının araştırılması amacıyla 2009-2010 yılları arasında Yalova Atatürk Bahçe Kültürleri Merkez Araştırma Enstitüsü’nde yürütülmüştür. Çalışmada, ısıtmasız sera koşullarında farklı tarihlerde ekilen ve farklı ön uygulama yapılan tohumların çıkış gücü ile + 1 ºC’de farklı sürelerde nemli katlamaya tabi tutulan ve farklı dönemlerde ekilen tohuml...

Stability of Schwarzschild-like solutions in f(R,G) gravity models

International Nuclear Information System (INIS)

De Felice, Antonio; Suyama, Teruaki; Tanaka, Takahiro

2011-01-01

We study linear metric perturbations around a spherically symmetric static spacetime for general f(R,G) theories, where R is the Ricci scalar and G is the Gauss-Bonnet term. We find that, unless the determinant of the Hessian of f(R,G) is zero, even-type perturbations have a ghost for any multipole mode. In order for these theories to be plausible alternatives to general relativity, the theory should satisfy the condition that the ghost is massive enough to effectively decouple from the other fields. We study the requirement on the form of f(R,G) which satisfies this condition. We also classify the number of propagating modes both for the odd-type and the even-type perturbations and derive the propagation speeds for each mode.

Cartographie fine de la région du gène PIS de la chèvre

OpenAIRE

Cribiu, E.P.; Schibler, Laurent; Vaiman, D.

2000-01-01

Chez les Mammifères, la différenciation sexuelle résulte d’une cascade complexe dont le premier acteur est le gène SRY, porté par le chromosome Y, qui masculinise la gonade indifférenciée. Cependant, certains individus, en l’absence de SRY, présentent un développement testiculaire et une réversion du sexe. Chez la chèvre, par exemple, la réversion du sexe d’individus XX en l’absence du gène SRY ou d’autres séquences du chromosome Y est étroitement liée à l’absence de corne (mutation motte) pu...

Römorkörcülük Hizmeti Yetki Sahalarında Römorkör Sayısının Simülasyon Modellemesi Yöntemiyle Tespiti

Directory of Open Access Journals (Sweden)

Selçuk NAS

2016-03-01

Full Text Available Römorkörcülük hizmeti verecek bir teşkilatın ilk yatırım maliyetlerinin oldukça yüksek olması nedeniyle, yapılacak yatırımlarda yetki sahası boyutlarına göre belirlenmiş hizmet düzeyini sağlayacak römorkör sayısının, tipinin ve çeki kuvvetlerinin tespiti verimlilik açısından oldukça önemlidir. Her ne kadar serbest rekabet nedeniyle belli bir yetki sahasında ihtiyaçtan fazla römorkör olsa da, yeni pazara giren hizmet sağlayıcılarının deniz trafiğine ait istatistiki verileri analiz ederek optimum sayıdaki römorkörü elinde tutarak rekabetçi gücünü arttırması mümkündür. Bu çalışmada yalnızca römorkör sayısı üzerinde durulmuş olup, genel bir limandaki deniz trafiğine ait bağımsız değişkenlerin, römorkör sayısına ait bağımlı değişken üzerindeki rassal etkilerinin analiz edilebileceği bir simülasyon modeli geliştirilmiştir. Simülasyon modellemesinde Promodel 2011 programı kullanılmıştır. Elde edilen veriler Stat:Fit programı yardımıyla analiz edilmiştir. Sonuç olarak, yetki sahalarında gerekli römorkör sayısının tespit edilebileceği ve her alanda uygulanabilecek bir simülasyon modeli geliştirilmiştir.

One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR).

Science.gov (United States)

Breunig, Christopher T; Durovic, Tamara; Neuner, Andrea M; Baumann, Valentin; Wiesbeck, Maximilian F; Köferle, Anna; Götz, Magdalena; Ninkovic, Jovica; Stricker, Stefan H

2018-01-01

Novel applications based on the bacterial CRISPR system make genetic, genomic, transcriptional and epigenomic engineering widely accessible for the first time. A significant advantage of CRISPR over previous methods is its tremendous adaptability due to its bipartite nature. Cas9 or its engineered variants define the molecular effect, while short gRNAs determine the targeting sites. A majority of CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into single cells, either as an essential precondition, to increase responsive cell populations or to enhance phenotypic outcomes. Despite these requirements, methods allowing the efficient generation and delivery of multiple gRNA expression units into single cells are still sparse. Here we present STAgR (String assembly gRNA cloning), a single step gRNA multiplexing system, that obtains its advantages by employing the N20 targeting sequences as necessary homologies for Gibson assembly. We show that STAgR allows reliable and cost-effective generation of vectors with high numbers of gRNAs enabling multiplexed CRISPR approaches. Moreover, STAgR is easily customizable, as vector backbones as well as gRNA structures, numbers and promoters can be freely chosen and combined. Finally, we demonstrate STAgR's widespread functionality, its efficiency in multi-targeting approaches, using it for both, genome and transcriptome editing, as well as applying it in vitro and in vivo.

Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

International Nuclear Information System (INIS)

Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

2006-01-01

Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

The Escherichia coli BolA Protein IbaG Forms a Histidine-Ligated [2Fe-2S]-Bridged Complex with Grx4.

Science.gov (United States)

Dlouhy, Adrienne C; Li, Haoran; Albetel, Angela-Nadia; Zhang, Bo; Mapolelo, Daphne T; Randeniya, Sajini; Holland, Ashley A; Johnson, Michael K; Outten, Caryn E

2016-12-13

Two ubiquitous protein families have emerged as key players in iron metabolism, the CGFS-type monothiol glutaredoxins (Grxs) and the BolA proteins. Monothiol Grxs and BolA proteins form heterocomplexes that have been implicated in Fe-S cluster assembly and trafficking. The Escherichia coli genome encodes members of both of these proteins families, namely, the monothiol glutaredoxin Grx4 and two BolA family proteins, BolA and IbaG. Previous work has demonstrated that E. coli Grx4 and BolA interact as both apo and [2Fe-2S]-bridged heterodimers that are spectroscopically distinct from [2Fe-2S]-bridged Grx4 homodimers. However, the physical and functional interactions between Grx4 and IbaG are uncharacterized. Here we show that co-expression of Grx4 with IbaG yields a [2Fe-2S]-bridged Grx4-IbaG heterodimer. In vitro interaction studies indicate that IbaG binds the [2Fe-2S] Grx4 homodimer to form apo Grx4-IbaG heterodimer as well as the [2Fe-2S] Grx4-IbaG heterodimer, altering the cluster stability and coordination environment. Additionally, spectroscopic and mutagenesis studies provide evidence that IbaG ligates the Fe-S cluster via the conserved histidine that is present in all BolA proteins and by a second conserved histidine that is present in the H/C loop of two of the four classes of BolA proteins. These results suggest that IbaG may function in Fe-S cluster assembly and trafficking in E. coli as demonstrated for other BolA homologues that interact with monothiol Grxs.

Hydroprocessing Catalysts. Utilization and Regeneration Schemes Catalyseurs d'hydrotraitement. Schémas d'utilisation et de régénération

Directory of Open Access Journals (Sweden)

Furimsky E.

2006-11-01

Full Text Available The catalyst reactor inventory represents an important part of the cost of hydroprocessing operation. The selection of a suitable catalyst and reactor is influenced by feedstock properties. Processes ensuring an uninterrupted operation during catalyst addition and withdrawal are preferred for processing high asphaltene and metal content feedstocks. The spent catalyst can be regenerated and returned to the operation if the extent of its deactivation is not high. The regeneration may be performed either in-situ or off-site. The former is suitable for fixed bed reactors whereas the catalyst from ebullated bed reactors must be regenerated off -site. The regeneration of spent catalysts heavily loaded with metals such as V, Ni and Fe may not be economic. Such catalysts may be suitable for metal reclamation. An environmentally safe method for catalyst disposal must be found if neither regeneration nor metal reclamation from spent catalysts can be performed. La quantité de catalyseurs utilisée représente une part importante du coût d'une opération d'hydrotraitement. Le choix d'un réacteur et d'un catalyseur approprié dépend des propriétés de la charge. On préfère utiliser les procédés permettant un fonctionnement continu pendant le chargement et le soutirage du catalyseur lorsqu'il s'agit de traiter des charges à haute teneur en asphaltène et en métaux. Le catalyseur usé peut être régénéré et remis en fonctionnement s'il n'est pas trop désactivé. La régénération peut être réalisée in situ ou hors du site. La première solution convient pour les réacteurs à lit fixe, tandis que le catalyseur de réacteurs à lit bouillonnant doit être régénéré hors du site. La régénération de catalyseurs usés fortement chargés en métaux tels que le vanadium, le nickel et le fer n'apparaît pas économique. De tels catalyseurs peuvent convenir pour la récupération des métaux. On doit trouver une méthode sans danger pour l

Study of the S427G polymorphism and of MYBL2 variants in patients with acute myeloid leukemia.

Science.gov (United States)

Dolz, Sandra; García, Paloma; Llop, Marta; Fuster, Óscar; Luna, Irene; Ibáñez, Mariam; Gómez, Inés; López, María; Such, Esperanza; Cervera, José; Sanz, Miguel A; De Juan, Inmaculada; Palanca, Sarai; Murria, Rosa; Bolufer, Pascual; Barragán, Eva

2015-06-19

Dysregulation of MYBL2 has been associated to tumorigenesis and the S427G polymorphism could induce partial inactivation of MYBL2, associating it with cancer risk. It has previously been shown that MYBL2 was over-expressed in some acute myeloid leukemias (AML), portending poor prognosis. However, to date no studies have investigated the S427G or other genetic variants of MYBL2 in AML. This study analyzed the S427G in 197 AML patients and 179 controls and screened the MYBL2 sequence in patients. In contrast to other studies in solid tumors, the S427G was not associated with the incidence of AML. This study detected four unannotated genetic alterations, of which the Q67X could be involved in MYBL2 dysfunction. Eight polymorphisms were identified, among which the rs73116571, located in a splicing region, was associated with higher incidence in AML and weaker MYBL2 expression, suggesting pre-disposition to AML. Additional functional studies should be performed to verify these genetic variations as possible targets in AML.

Bisfenol-A içerikli dental materyallere güncel yaklaşım

OpenAIRE

Akyüz, Serap; Yarat, Ayşen; Egil, Edibe

2013-01-01

Bisfenol-A ilk kez 1891 yılında sentezlenmiş ve östrojenik etkileri 1930’larda bulunmuş olan endüstriyel bir kimyasaldır. Bisfenol–A günlük hayatın birçok alanında kullanılan ürünlerden biberon, saklama kapları, su şişeleri ve şişe kapakları, gözlük camları, CD, DVD ve elektronik cihazlar ile çocuk diş hekimliğinde koruyucu amaçla kullanılan rezin bazlı fissür örtücüler ve restoratif diş tedavisinde kullanılan kompozit dolgu materyallerinin yapısında bulunur. Günümüzde Bisfenol-A’nın olası to...

Double Z-scheme ZnO/ZnS/g-C3N4 ternary structure for efficient photocatalytic H2 production

Science.gov (United States)

Dong, Zhifang; Wu, Yan; Thirugnanam, Natarajan; Li, Gonglin

2018-02-01

In the present work, a novel ZnO/ZnS/g-C3N4 ternary nanocomposite with double Z-scheme heterojunction has been designed via a two-step facile chemical conversion route. The spherical ZnS nanoparticles were uniformly loaded onto ZnO nanoflowers surface. And then the ZnO/ZnS nanocomposite was further hybridized with g-C3N4 nanosheets. Ternary ZnO/ZnS/g-C3N4 nanocomposite displays the largest specific surface area (about 76.2 m2/g), which provides plentiful activated sites for photocatalytic reaction. Furthermore, the ternary material exhibits the highest methylene blue photodegradation rate of about 0.0218 min-1 and the optimum photocatalytic H2 production (1205 μmol/g) over water splitting at 4 h under solar light irradiation. Moreover, it showed the highest photocurrent effect and the minimum charge-transfer resistance. These results implied that the higher photoactivity of ZnO/ZnS/g-C3N4 nanocomposite could be attributed to the multi-steps charge transfer and effective electron-hole separation in the double Z-scheme system.

G2LC: Resources Autoscaling for Real Time Bioinformatics Applications in IaaS

Directory of Open Access Journals (Sweden)

Rongdong Hu

2015-01-01

Full Text Available Cloud computing has started to change the way how bioinformatics research is being carried out. Researchers who have taken advantage of this technology can process larger amounts of data and speed up scientific discovery. The variability in data volume results in variable computing requirements. Therefore, bioinformatics researchers are pursuing more reliable and efficient methods for conducting sequencing analyses. This paper proposes an automated resource provisioning method, G2LC, for bioinformatics applications in IaaS. It enables application to output the results in a real time manner. Its main purpose is to guarantee applications performance, while improving resource utilization. Real sequence searching data of BLAST is used to evaluate the effectiveness of G2LC. Experimental results show that G2LC guarantees the application performance, while resource is saved up to 20.14%.

Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats

Directory of Open Access Journals (Sweden)

Croxatto Horacio B

2011-05-01

Full Text Available Abstract Background Mating changes the mechanism by which E2 regulates oviductal egg transport, from a non-genomic to a genomic mode. Previously, we found that E2 increased the expression of several genes in the oviduct of mated rats, but not in unmated rats. Among the transcripts that increased its level by E2 only in mated rats was the one coding for an s100 calcium binding protein G (s100 g whose functional role in the oviduct is unknown. Methods Herein, we investigated the participation of s100 g on the E2 genomic effect that accelerates oviductal transport in mated rats. Thus, we determined the effect of E2 on the mRNA and protein level of s100 g in the oviduct of mated and unmated rats. Then, we explored the effect of E2 on egg transport in unmated and mated rats under conditions in which s100 g protein was knockdown in the oviduct by a morpholino oligonucleotide against s100 g (s100 g-MO. In addition, the localization of s100 g in the oviduct of mated and unmated rats following treatment with E2 was also examined. Results Expression of s100 g mRNA progressively increased at 3-24 h after E2 treatment in the oviduct of mated rats while in unmated rats s100 g increased only at 12 and 24 hours. Oviductal s100 g protein increased 6 h following E2 and continued elevated at 12 and 24 h in mated rats, whereas in unmated rats s100 g protein increased at the same time points as its transcript. Administration of a morpholino oligonucleotide against s100 g transcript blocked the effect of E2 on egg transport in mated, but not in unmated rats. Finally, immunoreactivity of s100 g was observed only in epithelial cells of the oviducts of mated and unmated rats and it was unchanged after E2 treatment. Conclusions Mating affects the kinetic of E2-induced expression of s100 g although it not changed the cellular localization of s100 g in the oviduct after E2 . On the other hand, s100 g is a functional component of E2 genomic effect that accelerates egg

Del hermetismo en el discurso sobre el género : el transexualismo como síndrome cultural: del sexo generado al género transexuado

OpenAIRE

Aler Gay, María Isabel

1992-01-01

Esta tesis pretende un estudio semiológico de los discursos clínicos y del Derecho para llegar a plantear en el contexto situacional el fenómeno social de la transexualidad. La tesis central que mantiene la doctoranda es el hermetismo en el discurso sobre el género: el transexualismo como síndrome cultural del sexo generado al género transexuado

En marketingafdeling gør ingen forskel

DEFF Research Database (Denmark)

Sørensen, Hans Eibe

2007-01-01

Om virksomheden har en marketingafdeling eller ej, gør ingen forskel på niveauet af virksomhedens markedsorientering. Det er den overraskende konklusion på en undersøgelse af danske fremstillingsvirksomheder. Virksomheder uden egentlige marketingansvarlige indsamler markedsinformation og handler ...

G16R single nucleotide polymorphism but not haplotypes of the ß2-adrenergic receptor gene alters cardiac output in humans

DEFF Research Database (Denmark)

Rokamp, Kim Z; Staalsø, Jonatan M; Gartmann, Martin

2013-01-01

Variation in genes encoding the ß2-adrenergic receptor (ADRB2) and angiotensin-converting enzyme (ACE) may influence Q¿ (cardiac output). The 46G>A (G16R) SNP (single nucleotide polymorphism) has been associated with ß2-mediated vasodilation, but the effect of ADRB2 haplotypes on Q¿ has not been...... studied. Five SNPs within ADRB2 (46G>A, 79C>G, 491C>T, 523C>A and 1053G>C by a pairwise tagging principle) and the I/D (insertion/deletion) polymorphism in ACE were genotyped in 143 subjects. Cardiovascular variables were evaluated by the Model flow method at rest and during incremental cycling exercise...... V¿O2 (oxygen uptake) in G16G subjects, but the increase was 0.5 (0.0-0.9) l/min lower in Arg16 carriers (P=0.035). A similar effect size was observed for the Arg16 haplotypes ACCCG and ACCCC. No interaction was found between ADRB2 and ACE polymorphisms. During exercise, the increase in Q¿ was 0...

Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

Czech Academy of Sciences Publication Activity Database

Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

2016-01-01

Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

L{sub g} coda moment rate spectra and discrimination using L{sub g} coda envelopes

Energy Technology Data Exchange (ETDEWEB)

Mayeda, K.M.; Walter, W.R. [Lawrence Livermore National Laboratory, CA (United States)

1994-12-31

Low magnitude seismic monitoring will depend largely on high frequency near-regional discriminants such as ratios of P to S energy and spectral amplitude ratios within P or S phases. Due to high frequency attenuation and sparse distribution of recording stations, small magnitude events will have to be identified with only a few stations, in some instances perhaps only one. Recently, stable single station magnitudes for explosions at NTS and moment rate spectra for earthquakes throughout the western U.S. have been estimated using L{sub g} coda envelopes. The averaging nature of coda waves virtually eliminates the amplitude variability due to source radiation anisotropy and lateral variations in path geology between the source and receiver. In this study, we find that L{sub g} coda spectral ratios are 3 to 4 times less variable than direct phase spectral ratio measurements. Events fired in low strength-high gas porosity material have higher spectral ratios than events in high strength-low gas porosity material, and thus discriminate well from earthquakes which have the lowest spectral ratios. In contrast, P{sub g}/L{sub g} phase ratios for events in low strength-high gas porosity material lie closest to the earthquake population. A combination of both discriminants performs better than either one does alone. Moment rate spectra for explosions show strong depth-dependent spectral peaking that is not observed in normal depth western U.S. earthquakes and is consistent with strong R{sub g} to S scattering near the explosion source. This explosion spectral peaking will be explored in future work as part of a possible broadband discriminant.

Thermodynamic evaluation and optimization of the (Na+K+S) system

Energy Technology Data Exchange (ETDEWEB)

Lindberg, Daniel [Abo Akademi Process Chemistry Centre, Abo Akademi University, Biskopsgatan 8, FI-20500 Turku (Finland)]. E-mail: Daniel.Lindberg@abo.fi; Backman, Rainer [Abo Akademi Process Chemistry Centre, Abo Akademi University, Biskopsgatan 8, FI-20500 Turku (Finland); Energy Technology and Thermal Process Chemistry, Umea University, SE-90187 Umea (Sweden); Hupa, Mikko [Abo Akademi Process Chemistry Centre, Abo Akademi University, Biskopsgatan 8, FI-20500 Turku (Finland); Chartrand, Patrice [Centre de Recherche en Calcul Thermochimique (CRCT), Ecole Polytechnique, Box 6079, Station Downtown, Montreal, Que., H3C 3A7 (Canada)

2006-07-15

The (Na+K+S) system is of primary importance for the combustion of black liquor in the kraft recovery boilers in pulp and paper mills. A thermodynamic evaluation and optimization for the (Na+K+S) system has been made. All available data for the system have been critically evaluated to obtain optimized parameters of thermodynamic models for all phases. The liquid model is the quasichemical model in the quadruplet approximation, which evaluates 1st- and 2nd-nearest-neighbour short-range-order. In this model, cations (Na{sup +} and K{sup +}) are assumed to mix on a cationic sublattice, while anions (S{sup 2-},S{sub 2}{sup 2-},S{sub 3}{sup 2-},S{sub 4}{sup 2-},S{sub 5}{sup 2-},S{sub 6}{sup 2-},S{sub 7}{sup 2-},S{sub 8}{sup 2-},Va{sup -}) are assumed to mix on an anionic sublattice. The thermodynamic data of the liquid polysulphide components M{sub 2}S{sub 1+n} (M=Na, K and n=1-7) are fitted to {delta}G=A(n)+B(n).T for the reaction M{sub 2}S(l)+nS(l)=M{sub 2}S{sub n+1}(l). The solid phases are the alkali alloys, alkali sulphides, several different alkali polysulphides and sulphur. The solid solutions (Na,K) (Na,K){sub 2}S and (Na,K){sub 2}S{sub 2} are modelled using the compound energy formalism. The models can be used to predict the thermodynamic properties and phase equilibria in the multicomponent heterogeneous system. The experimental data are reproduced within experimental error limits for equilibria between solid, liquid and gas. The ternary phase diagram of the system (Na{sub 2}S+K{sub 2}S+S) has been predicted as no experimental determinations of the phase diagram have been made previously.

Inhibition of G1-phase arrest induced by ionizing radiation in hematopoietic cells by overexpression of genes involved in the G1/S-phase transition

International Nuclear Information System (INIS)

Epperly, M.; Berry, L.; Halloran, A.; Greenberger, J.S.

1995-01-01

D-type cyclins and cyclin-dependent kinase (cdk-4) are likely involved in regulating passage of cells through the G 1 phase of the cell cycle. A decrease in the proportion of cells in G 1 , a relatively radiation-sensitive phase of the cell cycle, should result in increased resistance to ionizing radiation; however, the effect of such overexpression on X-ray-induced G 1 -phase arrest is not known. Radiation survival curves were obtained at a dose rate of either 8 cGy/min or 1 Gy/min for subclones of the IL-3-dependent hematopoietic progenitor cell line 32D cl 3 expressing transgenes for either cyclin-D1, D2 or D3 or cdk-4. We compared the results to those with overexpression of the transgene for Bcl-2, whose expression enhances radiation survival and delays apoptosis. Cells overexpressing transgenes for each D-type cyclin or Bcl-2 had an increased number of cells in S phase compared to parent line 32D cl 3; however, overexpression of cdk-4 had no effect on cell cycle distribution. Cell death resulting from withdrawal of IL-3 was not affected by overexpression of D2, cdk-4 or Bcl-2. Flow cytometry 24 h after 5 Gy irradiation demonstrated that overexpression of each G 1 -phase regulatory transgene decreased the proportion of cells at the G 1 /S-phase border. Western analysis revealed induction of cyclin-D protein levels by irradiation, but no change in the D O , but a significant increase in the rvec n for cyclin-D or cdk-4 transgene-overexpressing clones at 1 Gy/min (P 1 /S-phase arrest. 31 refs., 4 figs., 4 tabs