WorldWideScience

Sample records for k13 form factor

  1. Current algebra constraints on K13 form factors

    International Nuclear Information System (INIS)

    Simmons, L.D.

    1975-01-01

    New theoretical constraints on the divergence form factor in K 13 decays are derived. The assumptions underlying the derivation are presented. The constraints on the divergence form factor are derived and summarized in the form of a theorem. It is shown that the finiteness of the leakage charge is a natural consequence of the parallelΔI vectorparallel = 1 / 2 rule. The Lorentz invariance of current algebra sum rules is discussed. The theorem is rederived within the context of the conserved vector current hypothesis. Finally, the implications of the present work are noted with attention being paid to both the theoretical and experimental consequences

  2. Pion transition form factor in k{sub T} factorization

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hsiang-nan [Academica Sinica, Taipei, Taiwan (China). Inst. of Physics; Tsing-Hua Univ., Hsinchu, Taiwan (China). Dept. of Phyiscs; National Cheng-Kung Univ., Tainan, Taiwan (China). Dept. of Physics; National Cheng-Chi Univ, Taipei, Taiwan (China). Inst. of Applied Physics; Mishima, Satoshi [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2009-07-15

    It has been pointed out that the recent BaBar data on the {pi}{gamma}{sup *} {yields} {gamma} transition form factor F{sub {pi}}{sub {gamma}}(Q{sup 2}) at low (high) momentum transfer squared Q{sup 2} indicate an asymptotic (flat) pion distribution amplitude. These seemingly contradictory observations can be reconciled in the k{sub T} factorization theorem: the increase of the measured Q{sup 2}FF{sub {pi}}{sub {gamma}}(Q{sup 2}) for Q{sup 2} > 10 GeV{sup 2} is explained by convoluting a k{sub T} dependent hard kernel with a flat pion distribution amplitude, k{sub T} being a parton transverse momentum. The low Q{sup 2} data are accommodated by including the resummation of {alpha}{sub s} ln{sup 2}x, x being a parton momentum fraction, which provides a stronger suppression at the endpoints of x. The next-to-leading-order correction to the pion transition form factor is found to be less than 20% in the considered range of Q{sup 2}. (orig.)

  3. Electromagnetic form factors of composite systems

    International Nuclear Information System (INIS)

    Nowak, E.J.

    1978-01-01

    Electromagnetic form factors are examined for a spin-zero, two-body composite system with emphasis on the case of small momentum transfer and/or deep (relativistic) binding. Perturbation theory calculations are first performed using spin-zero and then spin-one-half constituents. A dispersion representation of the bound-state vertex function is conjectured first for scalar and then for fermion constituents. Then a relativistic effective range approximation (RERA) is developed for each case and applied to the calculation of the electromagnetic form factor. The approach is applied to the study of the charge radii of the K 0 and K + mesons. The K/sub l3/ form factor is calculated in the fermion constituent RERA model, and restrictions are imposed on the model parameters from available experimental data. With these restrictions the limits 0.24fm less than or equal to √[abs. value ( 2 >/sub K 0 /)] less than or equal to = 0.36fm and 0.66fm less than or equal to = √( 2 >/sub K + /) less than or equal to 0.79fm are obtained for the kaon charge radii, and -.22 less than or equal to xi less than or equal to -.13 is found for the ratio of the neutral to charged kaon charge radius squared

  4. Semileptonic form factors D{yields}{pi},K and B{yields}{pi},K from a fine lattice

    Energy Technology Data Exchange (ETDEWEB)

    Al-Haydari, A.; Ali Khan, A. [Taiz Univ. (Yemen). Dept. of Physics; Braun, V.M.; Collins, S.; Goeckeler, M.; Schaefer, A. [Regensburg Univ. (Germany). Inst. for Theoretical Physics; Lacagnina, G.N. [INFN, Milan (Italy); Panero, M. [Regensburg Univ. (Germany). Inst. for Theoretical Physics; ETH Zuerich (Switzerland). Inst. for Theoretical Physics; Schierholz, G. [Regensburg Univ. (Germany). Inst. for Theoretical Physics; Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2009-03-15

    We extract the form factors relevant for semileptonic decays of D and B mesons from a relativistic computation on a fine lattice in the quenched approximation. The lattice spacing is a=0.04 fm (corresponding to a{sup -1}=4.97 GeV), which allows us to run very close to the physical B meson mass, and to reduce the systematic errors associated with the extrapolation in terms of a heavy quark expansion. For decays of D and D{sub s} mesons, our results for the physical form factors at q{sup 2}=0 are as follows: f{sub +}{sup D{yields}}{sup {pi}}(0)=0.74(6)(4), f{sub +}{sup D{yields}}{sup K}(0)=0.78(5)(4) and f{sub +}{sup D{sub s}{yields}}{sup K}(0)=0.68(4)(3). Similarly, for B and B{sub s} we find: f{sub +}{sup B{yields}}{sup {pi}}(0)=0.27(7)(5), f{sub +}{sup B{yields}}{sup K}(0)=0.32(6)(6) and f{sub +}{sup B{sub s}{yields}}{sup K}(0)=0.23(5)(4). We compare our results with other quenched and unquenched lattice calculations, as well as with lightcone sum rule predictions, finding good agreement. (orig.)

  5. The K-meson form factor and charge radius: linking low-energy data to future Jefferson Laboratory measurements

    Energy Technology Data Exchange (ETDEWEB)

    Krutov, A.F. [Samara University, Samara (Russian Federation); Troitsky, S.V. [Institute for Nuclear Research of the Russian Academy of Sciences, 60th October Anniversary Prospect 7a, Moscow (Russian Federation); Troitsky, V.E. [M.V. Lomonosov Moscow State University, D.V. Skobeltsyn Institute of Nuclear Physics, Moscow (Russian Federation)

    2017-07-15

    Starting from a successful model of the π-meson electromagnetic form factor, we calculate a similar form factor, F{sub K}(Q{sup 2}), of the charged K meson for a wide range of the momentum transfer squared, Q{sup 2}. The only remaining free parameter is to be determined from the measurements of the K-meson charge radius, r{sub K}. We fit this single parameter to the published data of the NA-7 experiment which measured F{sub K}(Q{sup 2}) at Q{sup 2} → 0 and determine our preferred range of r{sub K}, which happens to be close to recent lattice results. Still, the accuracy in the determination of r{sub K} is poor. However, future measurements of the K-meson electromagnetic form factor at Q{sup 2} K} significantly. (orig.)

  6. On the D → K-bar*e+νe form factors

    International Nuclear Information System (INIS)

    Hussain, F.; Ivanov, A.N.; Troitskaya, N.I.

    1994-01-01

    The infinite mass effective theory, when a heavy quark mass goes to infinity, and chiral perturbation theory at the quark level, based on the extended Nambu-Jona-Lasinio model, are applied for the calculation of the D → K-bar * e + ν e decay form factors. The theoretical results agree with experimental data. (author). 16 refs

  7. Acinetobacter baumannii K13 and K73 capsular polysaccharides differ only in K-unit side branches of novel non-2-ulosonic acids: di-N-acetylated forms of either acinetaminic acid or 8-epiacinetaminic acid.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Notaro, Anna; Arbatsky, Nikolay P; Speciale, Immacolata; Shashkov, Alexander S; De Castro, Cristina; Hall, Ruth M; Knirel, Yuriy A

    2017-11-27

    Structures of capsular polysaccharides of Acinetobacter baumannii isolates carrying KL13 and KL73 gene clusters were established. The closely related KL73 and KL13 gene clusters differ only by one gene in the module responsible for synthesis of the non-2-ulosonic acids. The K13 and K73 polysaccharides differ only in a single side-chain sugar, which is either 5,7-diacetamido-3,5,7,9-tetradeoxy-l-glycero-l-altro- or -d-glycero-l-altro-non-2-ulosonic acid [di-N-acetylated forms of acinetaminic acid (Aci5Ac7Ac) or 8-epiacinetaminic acid (8eAci5Ac7Ac), respectively]. The KL13 also is closely related to the KL12 gene cluster, which contains a different wzy gene encoding the K unit polymerase. Accordingly, the otherwise near identical K units are linked differently via an α-d-FucpNAc-(1 → 4)-d-Galp linkage in K13 and K73 or an α-d-FucpNAc-(1 → 3)-d-GalpNAc linkage in K12. This finding confirms the predicted substrate of the ItrB3 initiating transferase as d-FucpNAc. Glycosyltransferases predicted to catalyse the linkage of d-Galp or d-GalpNAc to l-FucpNAc in the growing K13 and K73 or K12 units, respectively, differ by only two amino acids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Spacelike and timelike form factors for ω→πγ* and K*→Kγ* in the light-front quark model

    International Nuclear Information System (INIS)

    Choi, Ho-Meoyng

    2008-01-01

    We investigate space- and timelike form factors for ω→πγ* and K*→Kγ* decays using the light-front quark model constrained by the variational principle for the QCD-motivated effective Hamiltonian. The momentum dependent spacelike form factors are obtained in the q + =0 frame and then analytically continued to the timelike region. Our prediction for the timelike form factor F ωπ (q 2 ) is in good agreement with the experimental data. We also find that the spacelike form factor F K* ± K ± (Q 2 ) for charged kaons encounters a zero because of the negative interference between the two currents to the quark and the antiquark.

  9. Measurement of the form factor in the decay K+ → π0e+vsub(e)

    International Nuclear Information System (INIS)

    Martyn, H.U.

    1974-01-01

    Following an introduction into the theory of the K(l3) decay, the fundamentals for the measuring methods of the form factor are derived. The choice of the quantity of nuclear events, the problems of the detection probabilities and of the background, and the form factor analysis are dealt with in detail. The analysis shows that the form factor can be very well described by a linear parametrization. The upper limits for scalar and tensorial interaction contributions are given; these results confirm the validity of the V-A theory also for strangeness-changing decays. (BJ/LH) [de

  10. Tensor form factor for the D → π(K) transitions with Twisted Mass fermions.

    Science.gov (United States)

    Lubicz, Vittorio; Riggio, Lorenzo; Salerno, Giorgio; Simula, Silvano; Tarantino, Cecilia

    2018-03-01

    We present a preliminary lattice calculation of the D → π and D → K tensor form factors fT (q2) as a function of the squared 4-momentum transfer q2. ETMC recently computed the vector and scalar form factors f+(q2) and f0(q2) describing D → π(K)lv semileptonic decays analyzing the vector current and the scalar density. The study of the weak tensor current, which is directly related to the tensor form factor, completes the set of hadronic matrix element regulating the transition between these two pseudoscalar mesons within and beyond the Standard Model where a non-zero tensor coupling is possible. Our analysis is based on the gauge configurations produced by the European Twisted Mass Collaboration with Nf = 2 + 1 + 1 flavors of dynamical quarks. We simulated at three different values of the lattice spacing and with pion masses as small as 210 MeV and with the valence heavy quark in the mass range from ≃ 0.7 mc to ≃ 1.2mc. The matrix element of the tensor current are determined for a plethora of kinematical conditions in which parent and child mesons are either moving or at rest. As for the vector and scalar form factors, Lorentz symmetry breaking due to hypercubic effects is clearly observed in the data. We will present preliminary results on the removal of such hypercubic lattice effects.

  11. Form factors of descendant operators: reduction to perturbed M(2,2s+1) models

    International Nuclear Information System (INIS)

    Lashkevich, Michael; Pugai, Yaroslav

    2015-01-01

    In the framework of the algebraic approach to form factors in two-dimensional integrable models of quantum field theory we consider the reduction of the sine-Gordon model to the Φ 13 -perturbation of minimal conformal models of the M(2,2s+1) series. We find in an algebraic form the condition of compatibility of local operators with the reduction. We propose a construction that make it possible to obtain reduction compatible local operators in terms of screening currents. As an application we obtain exact multiparticle form factors for the compatible with the reduction conserved currents T ±2k , Θ ±(2k−2) , which correspond to the spin ±(2k−1) integrals of motion, for any positive integer k. Furthermore, we obtain all form factors of the operators T 2k T −2l , which generalize the famous TT̄ operator. The construction is analytic in the s parameter and, therefore, makes sense in the sine-Gordon theory.

  12. Nuclear critical opalescence and the M1 form factors of 12C and 13C

    International Nuclear Information System (INIS)

    Delorme, J.; Figureau, A.; Guichon, P.

    1981-01-01

    It is shown that core polarization by the nuclear pion field has opposite effects on the M1 form factors of 12 C(15.11 MeV) and 13 C(g.s.). New data on 13 C are found to agree with this prediction and a common interpretation of the experiments is shown to be possible for the two nuclei in terms of critical opalescence. Discrimination from alternative explanations of the observed anomalies should await further experiments, especially photopion reactions. (orig.)

  13. Detailed design of a 13 kA 13 kV dc solid-state turn-off switch

    International Nuclear Information System (INIS)

    Praeg, W.F.

    1985-01-01

    An experimental facility for the study of electromagnetic effects in the First Wall-Blanket-shield (FWBS) systems of fusion reactors has been constructed at Argonne National Laboratory (ANL). In a test volume of 0.76 m 3 , a vertical, pulsed 5 kG dipole field (B -1 ) is perpendicular to a 10 kG solenoid field. Power supplies of 2.75 MW at 550 V dc and 5.5 MW at 550 V dc and a solid-state switch rated at 13 kA and 13 kV (169 MW) control the pulsed magnetic fields. The total stored energy in the coils is 2.6 MJ. This paper describes the design and construction features of the solid-state switching circuit which turns off a dc of 13 kA in approximately 82 μs and holds off voltages of < 13 kV

  14. Measurement of the electromagnetic form factors of $\\pi$ and $K$ mesons at the SPS

    CERN Multimedia

    2002-01-01

    This experiment will measure the electro-magnetic form factors of $\\pi$ and K mesons by determining the elastic scattering cross sections of these particles from stationary electrons in a liquid hydrogen target. It is planned to use an incident beam momentum of 300 GeV/c which corresponds to a maximum four momentum transfer of 0.29 (GeV/c)$^{2}$ for $\\pi$-e scattering and of 0.17 (GeV/c)$^{2}$ for K-e scattering. \\\\ \\\\ The apparatus will consist of the forward spectrometer of the NA1 experiment as described in proposal SPSC/74-15/P6 and addenda, preceded by modules of multiwire proportional chambers which determine the trajectories of the incident and scattered particles. The event trigger will be produced by scintillation counters arranged to discriminate against the strong interaction background and by the identification of one of the scattered particles as an electron by the photon detectors which form part of the forward spectrometer.

  15. NA48/2 final results on charged semileptonic kaon decays and $|V_{(us)}|$, NA48 measurements of the $K\\mu3$ form factors from $K_{L}$ decays

    CERN Document Server

    Dabrowski , A

    2007-01-01

    Measured ratios of decay rates for $\\Re_{Ke3/K2π}, \\Re_{K\\mu3/K2\\pi}$ and $\\Re_{K\\mu 3/Ke3}$ are presented, based on $K^{\\pm}$ decays collected in a dedicated run in 2003 by the NA48/2 experiment at CERN. The results obtained are $\\Re_{Ke3/K2\\pi} = 0.2470 \\pm 0.0009_{stat} \\pm 0.0004_{syst}$ and $\\Re_{K\\mu3/K2\\pi} = 0.1637 \\pm 0.0006_{stat} \\pm 0.0003_{syst}$. Using the PDG average for the $K^{\\pm} \\rightarrow \\pi^{\\pm}\\pi^{0}$ normalisation mode, both values are found to be larger than the current values given by the Particle Data Book [1] and lead to a larger magnitude of the $|V_{us}|$ element in the CabibboKobayashi-Maskawa (CKM) matrix than previously accepted. When combined with the latest Particle Data Book value of $|V_{ud}|$[1], the result is in agreement with unitarity of the CKM matrix. In addition, a new measured value of $Re_{K\\mu3/K2\\pi} = 0.663 \\pm 0.003_{stat} \\pm 0.001_{syst}$ is compared to the semi-empirical predictions based on the latest form factor measurements. The $K\\mu 3$ form factor...

  16. Detailed design of a 13 kA 13 kV dc solid-state turn-off switch. [Revision

    International Nuclear Information System (INIS)

    Praeg, W.F.

    1985-01-01

    An experimental facility for the study of electromagnetic effects in the First Wall-Blanket-Shield (FWBS) systems of fusion reactors has been constructed at Argonne National Laboratory (ANL). In a test volume of 0.76 m 3 , a vertical, pulsed 5 kG dipole field (B dot less than or equal to 320 kGs -1 ) is perpendicular to a 10 kG solenoid field. Power supplies of 2.75 MW at 550 V dc and 5.5 MW at 550 V dc and a solid-state switch rated at 13 kA and 13 kV (169 MW) control the pulsed magnetic fields. The total stored energy in the coils is 2.6 MJ. This paper describes the design and construction features of the solid-state switching circuit which turns off a dc current of 13 kA in approximately 82 μs and holds off voltages of less than or equal to 13 kV. 14 figs

  17. Measurement of form-factor-independent observables in the decay B0→K*0μ+μ-

    NARCIS (Netherlands)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; Anderlini, L.; Anderson, J.; Andreassen, P.R.; Andrews, J.E.; Appleby, R. B.; Aquines Gutierrez, O.; Archilli, F.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J. J.; Baesso, C.; Balagura, V.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Bauer, Th.; Bay, A.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Belogurov, S.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Benton, J.; Berezhnoy, A.; Bernet, R.; Bettler, M-O.; Van Beuzekom, Martin; Bien, A.; Bifani, S.; Bird, T.D.; Bizzeti, A.; Bjørnstad, P. M.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Brambach, T.; Van Den Brand, J.; Bressieux, J.; Brett, D.; Britsch, M.; Britton, T.; Brook, N. H.; Brown, H.; Burducea, I.; Bursche, A.; Busetto, G.; Buytaert, J.; Cadeddu, S.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carranza-Mejia, H.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Castillo Garcia, L.; Cattaneo, M.; Cauet, Ch; Cenci, R.; Charles, M.; Charpentier, Ph; Chen, P.; Chiapolini, N.; Chrzaszcz, M.; Ciba, K.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coca-Pelaz, A.; Coco, V.; Cogan, J.; Cogneras, E.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombes, M.; Coquereau, S.; Corti, G.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Cunliffe, S.; Currie, C.R.; D'Ambrosio, C.; David, P.; David, P. N Y; Davis, A.; De Bonis, I.; De Bruyn, K.; De Capua, S.; De Cian, M.; de Miranda, J. M.; Paula, L.E.; da-Silva, W.S.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Déléage, N.; Derkach, D.; Deschamps, O.; Dettori, F.; Di Canto, A.; Dijkstra, H.; Dogaru, M.; Donleavy, S.; Dordei, F.; Dosil Suárez, A.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; Van Eijk, D.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; El Rifai, I.; Elsasser, Ch.; Falabella, A.; Färber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Ferguson, D.; Fernandez Albor, V.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fiore, M.; Fitzpatrick, C.; Fontana, Mark; Fontanelli, F.; Forty, R.; De Aguiar Francisco, O.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Furfaro, E.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garofoli, J.; Garosi, P.; Garra Tico, J.; Garrido, L.; Carvalho-Gaspar, M.; Gauld, Rhorry; Gersabeck, E.; Gersabeck, M.; Gershon, T. J.; Ghez, Ph; Gibson, V.; Giubega, L.; Gligorov, V. V.; Göbel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.Q.; Gorbounov, P.; Head-Gordon, Teresa; Gotti, C.; Grabalosa Gándara, M.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graziani, G.; Grecu, A.; Greening, E.; Gregson, S.; Griffith, P.; Grünberg, O.; Gui, B.; Gushchin, E.; Guz, Yu; Gys, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hall, S.; Hamilton, B.; Hampson, T.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; Hartmann, T.; He, J.; Head, T.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J. A.; van Herwijnen, E.; Hess, H.M.; Hicheur, A.; Hicks, G.E.; Hill, D.; Hoballah, M.; Hombach, C.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, J.T.; Hussain, N.; Hutchcroft, D. E.; Hynds, D.; Iakovenko, V.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jans, E.; Jaton, P.; Jawahery, A.; Jing, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Kaballo, M.; Kandybei, S.; Kanso, W.; Karacson, M.; Karbach, T. M.; Kenyon, I. R.; Ketel, T.; Keune, A.; Khanji, B.; Kochebina, O.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Korolev, M.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kucharczyk, M.; Kudryavtsev, V.; Kurek, K.; Kvaratskheliya, T.; La Thi, V. N.; Lacarrere, D.; Lafferty, G. D.; Lai, A.; Lambert, D.M.; Lambert, R. W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T. E.; Lazzeroni, C.; Le Gac, R.; Van Leerdam, J.; Lees, J. P.; Lefèvre, R.; Leflat, A.; Lefrançois, J.; Di Leo, S.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y.; Li Gioi, L.; Liles, M.; Lindner, R.; Linn, S.C.; Liu, B.; Liu, G.; Lohn, S.; Longstaff, I.; Lopes, J. H.; Lopez-March, N.; Lu, H.; Lucchesi, D.; Luisier, J.; Luo, H.; Machefert, F.; Machikhiliyan, I. V.; Maciuc, F.; Maev, O.; Malde, S.; Manca, G.; Mancinelli, G.; Maratas, J.; Marconi, U.; Marino, P.; Märki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martín Sánchez, A.; Martinelli-Boneschi, F.; Martinez-Santos, D.; Martins Tostes, D.; Martynov, A.; Massafferri, A.; Matev, R.; Mathe, Z.; Matteuzzi, C.; Maurice, E.; Mazurov, A.; McCarthy, J.; Mcnab, A.; McNulty, R.; McSkelly, B.; Meadows, B. T.; Meier, F.; Meissner, M.; Merk, M.; Milanes, D. A.; Minard, M. N.; Molina Rodriguez, J.; Monteil, S.; Moran-Zenteno, D.; Morawski, P.; Mordà, A.; Morello, M. J.; Mountain, R.; Mous, I.; Muheim, F.; Müller, Karl; Muresan, R.; Muryn, B.; Muster, B.; Naik, P.; Nakada, T.; Nandakumar, R.; Nasteva, I.; Needham, M.; Neubert, S.; Neufeld, N.; Nguyen, A. D.; Nguyen, T. D.; Nguyen-Mau, C.; Nicol, M.; Niess, V.; Niet, R.; Nikitin, N.; Nikodem, T.; Nomerotski, A.; Novoselov, A.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J. M.; Owen, R.P.; Oyanguren, A.; Pal, B. K.; Palano, A.; Palczewski, T.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C. J.; Passaleva, G.; Patel, G. D.; Patel, M.; Patrick, G. N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perez Trigo, E.; Pérez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pescatore, L.; Pesen, E.; Petridis, K.; Petrolini, A.; Phan, A.; Picatoste Olloqui, E.; Pietrzyk, B.; Pilař, T.; Pinci, D.; Playfer, S.; Plo Casasus, M.; Polci, F.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, A.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; Prisciandaro, J.; Pritchard, C.A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, Y.W.; Rademacker, J. H.; Rakotomiaramanana, B.; Rangel, M. S.; Raniuk, I.; Rauschmayr, N.; Raven, G.; Redford, S.; Reid, M.; dos Reis, A. C.; Ricciardi, S.; Richards, Al.; Rinnert, K.; Rives Molina, V.; Roa Romero, D. A.; Robbe, P.; Roberts, D. A.; Rodrigues, L.E.T.; Rodriguez Perez, P.; Roiser, S.; Romanovsky, V.; Romero Vidal, A.; Rouvinet, J.; Ruf, T.; Ruffini, F.; Ruiz, van Hapere; Ruiz Valls, P.; Sabatino, G.; Saborido Silva, J. J.; Sagidova, N.; Sail, P.; Saitta, B.; Salustino Guimaraes, V.; Sanmartin Sedes, B.; Sannino, M.; Santacesaria, R.; Santamarina Rios, C.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schindler, R. H.; Schlupp, M.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M. H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Silva Coutinho, R.; Sirendi, M.; Skwarnicki, T.; Smith, N. A.; Smith, E.; Smith, J; Smith, M.; Sokoloff, M. D.; Soler, F. J. P.; Soomro, F.; de Souza, D.K.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stevenson-Moore, P.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Subbiah, V. K.; Sun, L.; Swientek, S.; Syropoulos, V.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teklishyn, M.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; Van Tilburg, J.; Tisserand, V.; Tobin, M. N.; Tolk, S.; Tonelli, D.; Topp-Joergensen, S.; Torr, N.; Tournefier, E.; Tourneur, S.; Tran, N.T.M.T.; Tresch, M.; Tsaregorodtsev, A.; Tsopelas, P.; Tuning, N.; Ubeda Garcia, M.; Ukleja, A.; Urner, D.; Ustyuzhanin, A.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vallier, A.; Van Dijk, M.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vázquez Sierra, C.; Vecchi, S.; Velthuis, M.J.; Veltri, M.; Veneziano, G.; Vesterinen, M.; Viaud, B.; Vieira, D.; Vilasis-Cardona, X.; Vollhardt, A.; Volyanskyy, D.; Voong, D.; Vorobyev, A.; Vorobyev, V.; Voß, C.; Voss, H.; Waldi, R.; Wallace, C.; Wallace, R.; Wandernoth, S.; Wang, J.; Ward, D. R.; Watson, N. K.; Webber, A. D.; Websdale, D.; Whitehead, M.; Wicht, J.; Wiechczynski, J.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M.P.; Williams, M.; Wilson, James F; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wotton, S. A.; Wright, S.J.; Wu, S.; Wyllie, K.; Xie, Y.; Xing, Z.; Yang, Z.; Young, D. R.; Yuan, X.; Yushchenko, O.; Zangoli, M.; Zavertyaev, M.; Zhang, F.; Zhang, L.; Zhang, W. C.; Zhang, Y.; Zhelezov, A.; Zhokhov, A.; Zhong, L.; Zvyagin, A.

    2013-01-01

    We present a measurement of form-factor-independent angular observables in the decay B0→K*(892) 0μ+μ-. The analysis is based on a data sample corresponding to an integrated luminosity of 1.0 fb-1, collected by the LHCb experiment in pp collisions at a center-of-mass energy of 7 TeV. Four observables

  18. In-Medium K^+ Electromagnetic Form Factor with a Symmetric Vertex in a Light Front Approach

    Science.gov (United States)

    Yabusaki, George H. S.; de Melo, J. P. B. C.; de Paula, Wayne; Tsushima, K.; Frederico, T.

    2018-05-01

    Using the light-front K^ +-Meson wave function based on a Bethe-Salpeter amplitude model for the Quark-Antiquark bound state, we study the Electromagnetic Form Factor (EMFF) of the K^ +-Meson in nuclear medium within the framework of light-front field theory. The K^ +-Meson model we adopt is well constrained by previous and recent studies to explain its properties in vacuum. The in-medium K^ +-Meson EMFF is evaluated for the plus-component of the electromagnetic current, J^+, in the Breit frame. In order to consistently incorporate the constituent up and antistrange Quarks of the K^ +-Meson immersed in symmetric nuclear matter, we use the Quark-Meson coupling model, which has been widely applied to various hadronic and nuclear phenomena in a nuclear medium with success. We predict the in-medium modification of the K^ +-Meson EMFF in symmetric nuclear matter. It is found that, after a fine tuning of the regulator mass, i.e. m_R = 0.600 GeV, the model is suitable to fit the available experimental data in vacuum within the theoretical uncertainties, and based on this we predict the in-medium modification of the K^ +-Meson EMFF.

  19. D → π and D → K semileptonic form factors with Nf = 2 + 1 + 1 twisted mass fermions

    Science.gov (United States)

    Lubicz, Vittorio; Riggio, Lorenzo; Salerno, Giorgio; Simula, Silvano; Tarantino, Cecilia

    2018-03-01

    We present a lattice determination of the vector and scalar form factors of the D → π(K)lv semileptonic decays, which are relevant for the extraction of the CKM matrix elements |Vcd| and |Vcs| from experimental data. Our analysis is based on the gauge configurations produced by the European Twisted Mass Collaboration with Nf = 2 + 1 +1 flavors of dynamical quarks. We simulated at three different values of the lattice spacing and with pion masses as small as 210 MeV. The matrix elements of both vector and scalar currents are determined for a plenty of kinematical conditions in which parent and child mesons are either moving or at rest. Lorentz symmetry breaking due to hypercubic effects is clearly observed in the data and included in the decomposition of the current matrix elements in terms of additional form factors. After the extrapolations to the physical pion mass and to the continuum limit the vector and scalar form factors are determined in the whole kinematical region from q2 = 0 up to qmax2 = (MD - Mπ(K))2 accessible in the experiments, obtaining a good overall agreement with experiments, except in the region at high values of q2 where some deviations are visible.

  20. Developing the Scale for Quality of Life in Pediatric Oncology Patients Aged 13-18: Adolescent Form and Parent Form.

    Science.gov (United States)

    Bektas, Murat; Akdeniz Kudubes, Aslı; Ugur, Ozlem; Vergin, Canan; Demirag, Bengü

    2016-06-01

    This study aimed to develop the Scale for Quality of Life in Pediatric Oncology Patients Aged 13-18: Adolescent Form and Parent Form. We used the child and parent information form, Visual Quality of Life Scale, and our own scale, the Scale for Quality of Life in Pediatric Oncology Patients Aged 13-18: Adolescent Form and Parent Form. We finalized the 35-item scale to determine the items, received opinions from 14 specialists on the scale, and pilot-tested the scale in 25 children and their parents. We used Pearson correlation analysis, Cronbach α coefficient, factor analysis and receiver operating characteristics analysis to analyze the data. The total Cronbach α of the parent form was .97, the total factor load was .60-.97 and the total variance was 80.4%. The cutoff point of the parent form was 85.50. The total Cronbach α of the adolescent form was .98, the total factor load was .62-.96, and the total variance explained was 83.4%. The cutoff point of the adolescent form was 75.50. As a result of the parent form factor analysis, we determined the Kaiser-Meyer-Olkin coefficient as .83, the Barlett test χ(2) as 12,615.92; the factor coefficients of all items of the parent form ranged from .63 to .98. The factor coefficients of all items of the adolescent form ranged from .34 to .99. As a result of the adolescent form factor analysis, we determined the KMO as .79, and the Barlett test χ(2) as 13,970.62. Conclusively, we found that the adolescent form and the parent form were valid and reliable in assessing the children's quality of life. Copyright © 2016. Published by Elsevier B.V.

  1. Chiral behavior of K →π l ν decay form factors in lattice QCD with exact chiral symmetry

    Science.gov (United States)

    Aoki, S.; Cossu, G.; Feng, X.; Fukaya, H.; Hashimoto, S.; Kaneko, T.; Noaki, J.; Onogi, T.; Jlqcd Collaboration

    2017-08-01

    We calculate the form factors of the K →π l ν semileptonic decays in three-flavor lattice QCD and study their chiral behavior as a function of the momentum transfer and the Nambu-Goldstone boson masses. Chiral symmetry is exactly preserved by using the overlap quark action, which enables us to directly compare the lattice data with chiral perturbation theory (ChPT). We generate gauge ensembles at a lattice spacing of 0.11 fm with four pion masses covering 290-540 MeV and a strange quark mass ms close to its physical value. By using the all-to-all quark propagator, we calculate the vector and scalar form factors with high precision. Their dependence on ms and the momentum transfer is studied by using the reweighting technique and the twisted boundary conditions for the quark fields. We compare the results for the semileptonic form factors with ChPT at next-to-next-to-leading order in detail. While many low-energy constants appear at this order, we make use of our data of the light meson electromagnetic form factors in order to control the chiral extrapolation. We determine the normalization of the form factors as f+(0 )=0.9636 (36 )(-35+57) and observe reasonable agreement of their shape with experiment.

  2. Study of the form factors of the leptonic decays of the K{sub L}{sup 0}; Etude des facteurs de forme des desintegrations leptoniques du K{sub L}{sup 0}

    Energy Technology Data Exchange (ETDEWEB)

    Zylberajch, S [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1969-04-01

    About 24 000 K{sub L}{sup 0} decays have been observed in a spark chamber spectrometer. 11 000 K{sub e3} and 7 000 K{sub {mu}}{sub 3} decays were identified and their distribution in the Dalitz plot analyzed. In the study of the K{sub {mu}}{sub 3} mode K{sub L}{sup 0} {yields} {pi}{sup {+-}} {mu}{sup {+-}} the interaction is found to be essentially a vectorial one. For the ratio {xi} = f{sub -} / f{sub +} a double solution is found: {xi} = -3.9 {+-} 0.18 and {xi} = 1.5 {+-} 0.18. The first solution is more likely. The study of the K{sub e3} mode K{sub L}{sup 0} {yields} {pi}{sup {+-}} e{sup {+-}} {nu} also confirms the vectorial nature of the interaction. It is found that: | A{sub S} /A{sub V} | < 11 per cent; | A{sub T} /A{sub V} | < 6 per cent. The q{sup 2} dependence of the form factor f{sub +} is weak: {lambda}{sub +} = 0.023 {+-} 0.012. (author) [French] Environ 24 000 desintegrations du K{sub L}{sup 0} ont ete observees et etudiees a l'aide de chambres a etincelles. 11 000 K{sub e3} et 7000 K{sub {mu}}{sub 3} ont ete identifies et etudies en analysant leur repartition dans le diagramme de Dalitz. L'etude du mode K{sub {mu}}{sub 3}: K{sub L}{sup 0} {yields} {pi}{sup {+-}} {mu}{sup {+-}} a confirme la nature essentiellement vectorielle de l'interaction. On trouve pour le rapport {xi} = f{sub -} / f{sub +} une double solution: {xi} = -3.9 {+-} 0.18 and {xi} = 1.5 {+-} 0.18. La premiere est la plus probable. L'etude du mode K{sub e3}: K{sub L}{sup 0} {yields} {pi}{sup {+-}} e{sup {+-}} {nu} confirme egalement la nature vectorielle de l'interaction avec | A{sub S} /A{sub V} | < 11 pour cent; | A{sub T} /A{sub V} | < 6 pour cent. Le facteur de forme f{sub +} varie peu avec le moment transfere. On trouve: {lambda}{sub +} = 0.023 {+-} 0.012. (auteur)

  3. Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

    Science.gov (United States)

    Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

    2016-01-01

    Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

  4. Hot reactions of 13N in solid methane at 77 K

    International Nuclear Information System (INIS)

    Fiergolla, J.; Nebeling, B.; Roessler, K.

    1987-09-01

    The chemical reactions of recoil- 13 N were studied in solid methane at 77 K. 13 N was generated via the the nuclear reaction 12 C(d,n) 13 N. The radiation dose deliverd by the 8.5 MeV deuterons amounted to D * = 0.6 eV per target molecule. The products formed by high energy chemical processes (hot chemistry) were analyzed by radio-gaschromatography. 13 NH 3 with 52% and CH 3 13 NH 2 with 25% radiochemical yield were found to be the main products. HC 13 N was not formed, but CH 3 13 CN amounts to 4%. For the more complex products carbon chain prolongation is prefered over multiple methylation such as show the yields of 8% for C 2 H 5 13 NH 2 and 3% (CH 3 ) 2 13 NH. (CH 3 ) 3 N was not detected. The formation of 13 NH 3 is due to hydrogen abstraction, that of CH 3 13 NH 2 due to insertion of NH radical into the C-H bond of CH 4 . Another, however, less probable pathway could be the insertion of 13 N into methane. The methylamine radical may react with another methane molecule via hydrogen transfer to methylamine or attack to CH 4 to dimethylamine. The 13 N-products were formed with high radiochemical purity and can potentially be applied for the synthesis of 13 N-radiopharmaceuticals. The reactions studied bear also informations on chemical processes in space (e.g. solar wind interactions with comets or interplanetary dust). 13 N-high energy chemical products are, however, of a less exobiological significance then those formed by hot carbon atoms, e.g. in the 'mirror' system 11 C/NH 3 (s). (orig.) [de

  5. Form factors and QCD in spacelike and timelike region

    International Nuclear Information System (INIS)

    A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

    2000-01-01

    The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  6. Form factors and QCD in spacelike and timelike regions

    International Nuclear Information System (INIS)

    Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

    2000-01-01

    We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  7. Design and Control of a 13.2 kV/10 kVA Single-Phase Solid-State-Transformer with 1.7 kV SiC Devices

    Directory of Open Access Journals (Sweden)

    Jeong-Woo Lim

    2018-01-01

    Full Text Available This paper describes the power stage design, control, and performance evaluation of a 13.2 kV/10 kVA solid-state-transformer (SST for a power distribution system. The proposed SST consists of 10 modules where each individual module contains a unidirectional three-level power factor correction (PFC converter for the active-front-end (AFE stage and an LLC resonant converter for the isolated DC-DC stage. The operating principles of the converters are analyzed and the modulation and the control schemes for the entire module are described in detail. The DC-link voltage imbalance is also less than other SST topologies due to the low number of uncontrollable switching states. In order to simplify the control of the power stage, a modulation strategy for the AFE stage is proposed, and the modulation frequency of the LLC converter is also fixed. In addition, a compensation algorithm is suggested to eliminate the current measurement offset in the AFE stage. The proposed SST achieves the unity power factor at the input AC current regardless of the reactive or nonlinear load and a low voltage regulation at the AC output. In order to verify the effectiveness of the SST, the 13.2 kV/10 kV SST prototype is built and tested. Both the simulation and the experimental results under actual 13.2 kV line show the excellent performance of the proposed SST scheme.

  8. Dispersion-theoretical analysis of the nucleon electromagnetic form factors

    Energy Technology Data Exchange (ETDEWEB)

    Belushkin, M.

    2007-09-29

    The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the {pi}{pi}, K anti K and the {rho}{pi} continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

  9. Dispersion-theoretical analysis of the nucleon electromagnetic form factors

    International Nuclear Information System (INIS)

    Belushkin, M.

    2007-01-01

    The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the ππ, K anti K and the ρπ continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

  10. A computational profiling of changes in gene expression and transcription factors induced by vFLIP K13 in primary effusion lymphoma.

    Directory of Open Access Journals (Sweden)

    Vasu Punj

    Full Text Available Infection with Kaposi's sarcoma associated herpesvirus (KSHV has been linked to the development of primary effusion lymphoma (PEL, a rare lymphoproliferative disorder that is characterized by loss of expression of most B cell markers and effusions in the body cavities. This unique clinical presentation of PEL has been attributed to their distinctive plasmablastic gene expression profile that shows overexpression of genes involved in inflammation, adhesion and invasion. KSHV-encoded latent protein vFLIP K13 has been previously shown to promote the survival and proliferation of PEL cells. In this study, we employed gene array analysis to characterize the effect of K13 on global gene expression in PEL-derived BCBL1 cells, which express negligible K13 endogenously. We demonstrate that K13 upregulates the expression of a number of NF-κB responsive genes involved in cytokine signaling, cell death, adhesion, inflammation and immune response, including two NF-κB subunits involved in the alternate NF-κB pathway, RELB and NFKB2. In contrast, CD19, a B cell marker, was one of the genes downregulated by K13. A comparison with K13-induced genes in human vascular endothelial cells revealed that although there was a considerable overlap among the genes induced by K13 in the two cell types, chemokines genes were preferentially induced in HUVEC with few exceptions, such as RANTES/CCL5, which was induced in both cell types. Functional studies confirmed that K13 activated the RANTES/CCL5 promoter through the NF-κB pathway. Taken collectively, our results suggest that K13 may contribute to the unique gene expression profile, immunophenotype and clinical presentation that are characteristics of KSHV-associated PEL.

  11. Measurements of the Electric Form Factor of the Neutron at Q2=0.45 and 1.13 (GeV/c)2

    International Nuclear Information System (INIS)

    Shigeyuki Tajima

    2003-01-01

    Precise measurements of the electric form factor of the neutron, Gn E, over a wide range of the square of the four-momentum transfer, Q2, are important for understanding nucleon and nuclear electromagnetic structure. In the non-relativistic limit, the electric and magnetic form factors are related to the charge and magnetization distribution inside a nucleon, respectively. The measured values of the form factors also serve as an important test for nucleon models. Among the four nucleon form factors, the electric form factor of the neutron, Gn E, is the most difficult one to measure and therefore has been very poorly known especially in the region Q2 > 1 (GeV/c)2 due to the lack of a free neutron target and the small value of Gn E. The Jefferson Laboratory E93-038 collaboration measured the ratio of the electric to magnetic form factor of the neutron, g = Gn E/Gn M, at three acceptance-averaged Q2 values of 0.45, 1.13 and 1.45 (GeV/c)2 using the quasi-elastic 2H(∼e, e0∼n)1H reaction. In our experiment, an electron was scattered quasielastically from a neutron in a liquid-deuterium target, and the electron was detected in an electron spectrometer in coincidence with the neutron which was detected in a neutron polarimeter. The polarimeter was used to analyze the polarization of the recoil neutrons by measuring the np elastic scattering asymmetry. The experiment was performed in Hall-C at Thomas Jefferson National Accelerator Facility during the period from September 2000 to April 2001. The value of g was determined from the measured ratio of the sideways and longitudinal components of the neutron polarization vector. The values for Gn E were computed from our measured values of g = Gn E/Gn M using the Gn M values obtained from a fit to the world data. The E93-038 collaboration reported the first measurements of Gn E using polarization techniques at Q2 greater than 1 (GeV/c)2. Furthermore, our measurements of Gn E at the two higher Q2 values of 1.13 and 1.45 (Ge

  12. 17 CFR 249.618 - Form BD-Y2K, information required of broker-dealers pursuant to section 17 of the Securities...

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form BD-Y2K, information... Exchange Members, Brokers, and Dealers § 249.618 Form BD-Y2K, information required of broker-dealers... FR 37674, July 13, 1998] Editorial Note: For Federal Register citations affecting Form BD-Y2K, see...

  13. NMR 1H,13C, 15N backbone and 13C side chain resonance assignment of the G12C mutant of human K-Ras bound to GDP.

    Science.gov (United States)

    Sharma, Alok K; Lee, Seung-Joo; Rigby, Alan C; Townson, Sharon A

    2018-05-02

    K-Ras is a key driver of oncogenesis, accounting for approximately 80% of Ras-driven human cancers. The small GTPase cycles between an inactive, GDP-bound and an active, GTP-bound state, regulated by guanine nucleotide exchange factors and GTPase activating proteins, respectively. Activated K-Ras regulates cell proliferation, differentiation and survival by signaling through several effector pathways, including Raf-MAPK. Oncogenic mutations that impair the GTPase activity of K-Ras result in a hyperactivated state, leading to uncontrolled cellular proliferation and tumorogenesis. A cysteine mutation at glycine 12 is commonly found in K-Ras associated cancers, and has become a recent focus for therapeutic intervention. We report here 1 H N, 15 N, and 13 C resonance assignments for the 19.3 kDa (aa 1-169) human K-Ras protein harboring an oncogenic G12C mutation in the GDP-bound form (K-RAS G12C-GDP ), using heteronuclear, multidimensional NMR spectroscopy. Backbone 1 H- 15 N correlations have been assigned for all non-proline residues, except for the first methionine residue.

  14. PROTEOLYTIC PROCESSING OF VON WILLEBRAND FACTOR BY ADAMTS13 AND LEUKOCYTE PROTEASES

    Directory of Open Access Journals (Sweden)

    Stefano Lancellotti

    2013-09-01

    Full Text Available ADAMTS13 is a 190 kDa zinc protease encoded by a gene located on chromosome 9q34.   This protease specifically hydrolyzes von Willebrand factor (VWF multimers, thus causing VWF size reduction. ADAMTS13 belongs to the A Disintegrin And Metalloprotease with ThromboSpondin type 1 repeats (ADAMTS family, involved in proteolytic processing of many matrix proteins. ADAMTS13 consists of numerous domains including a metalloprotease domain, a disintegrin domain, several thrombospondin type 1 (TSP1 repeats, a cysteine-rich domain, a spacer domain and 2 CUB (Complement c1r/c1s, sea Urchin epidermal growth factor, and Bone morphogenetic protein domains. ADAMTS13 cleaves a single peptide bond (Tyr1605-Met1606 in the central A2 domain of the VWF molecule. This proteolytic cleavage is essential to reduce the size of ultra-large VWF polymers, which, when exposed to high shear stress in the microcirculation, are prone to form with platelets clumps, which cause severe syndromes called thrombotic microangiopathies (TMAs. In this review, we a discuss the current knowledge of structure-function aspects of ADAMTS13 and its involvement in the pathogenesis of TMAs, b address the recent findings concerning proteolytic processing of VWF multimers by different proteases, such as the leukocyte-derived serine and metallo-proteases and c indicate the direction of future investigations

  15. Measurement of the form factor ratios in semileptonic decays of charm mesons

    International Nuclear Information System (INIS)

    R. Zaliznyak

    1999-01-01

    I have measured the form factor ratios r 2 = A 2 (0)/A 1 (0) and r V = V (0)/A 1 (0) in the semileptonic charm meson decay D + → (anti K) *0 e + ν e from data collected by the Fermilab E791 collaboration. Form factors are introduced in the calculation of the hadronic current in semileptonic decays of strange, charm, or bottom mesons, such as D + → (anti K) *0 e + ν e . Semileptonic decays provide insight into quark coupling to the W boson since the leptonic and hadronic amplitudes in the Feynman diagram for the decay are completely separate. There are no strong interactions between the final state leptons and quarks. A number of theoretical models predict the values of the form factors for D + → (anti K) *0 e + ν e , though there is a large range of predictions. E791 is a hadroproduction experiment that recorded over 20 billion interactions with a 500 GeV π - beam incident on five thin targets during the 1991-92 Fermilab fixed-target run. Approximately 3000 D + → (anti K) *0 e + ν e decays are fully reconstructed. In order to extract the form factor ratios from the data, I implement a multidimensional unbinned maximum likelihood fit with a large sample of simulated (Monte Carlo) D + → (anti K) *0 e + ν e events. The large E791 data sample provides the most precise measurement of the form factor ratios to date. The measured values for the form factor ratios are r 2 = 0.71 ± 0.08 ± 0.09 and r V = 1.84 ± 0.11 ± 0.08. These results are in good agreement with some Lattice Gauge calculations. However the agreement with quark model predictions is not as good

  16. 19 CFR 146.13 - Customs forms and procedures.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...

  17. Form factors and radiation widths of the giant multipole resonances

    International Nuclear Information System (INIS)

    Denisov, V.Yu.

    1990-01-01

    Simple analytic relations for the form factors of inelastic electron scattering in the Born approximation and radiation widths of the isovector and isoscalar giant multipole resonances are derived. The dynamic relationship between the volume and surface density vibrations were taken into account in this calculation. The form factors in the Born approximation were found to be in satisfactory agreement with experimental data in the region of small transferred momenta. The radiation widths of isoscalar multipole resonances increase when the number of nucleons increase as A 1/3 , and for isovector resonances this dependence has the form f(A)A 1/3 , where f(A) is a slowly increasing function of A. Radiation widths well fit the experimental data

  18. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  19. Pion form factor within QCD instanton vacuum model

    International Nuclear Information System (INIS)

    Dorokhov, A.E.

    1997-01-01

    Instanton induced pion wave function is constructed. It provides an intrinsic k 1 dependence which suppress soft virtual one-gluon exchanges and thus legitimate the perturbative QCD (pQCD) calculations of the pion electromagnetic form factor in the region of momentum transfers above the scale. (author)

  20. Bilateral comparison of 1 Ω and 10 kΩ standards (ongoing BIPM key comparisons BIPM.EM-K13.a and 13.b) between the NSAI NML (Ireland) and the BIPM

    Science.gov (United States)

    Rolland, B.; Fletcher, N.; Power, O.

    2017-01-01

    This report gives the result of a bilateral comparison of resistance between the NSAI NML (Ireland) and the BIPM carried out in 2014-2015. Two 1 Ω and two 10 kΩ travelling standards belonging to the BIPM were used. The comparison was carried out with an 'A-B-A' pattern of measurements; the standards were measured first at the BIPM for a period of about one month, then for a similar period at the NSAI-NML, and finally again at the BIPM. The measurand was the 4 terminal dc resistance at low power. The BIPM was the pilot laboratory, and the comparison forms part of the ongoing BIPM key comparisons BIPM.EM-K13.a (for 1 Ω) and BIPM.EM-K13b (for 10 kΩ). The results from the NSAI NML and the BIPM were found to be in good agreement, with a difference smaller than the relative expanded uncertainties (95% confidence, k = 2) of 0.16 × 10-6 for 1 Ω and 0.42 × 10-6 for 10 kΩ. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCEM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  1. Measurement of form-factor independent observables in the decay $B^{0} \\to K^{*0} \\mu^+ \\mu^-$

    CERN Document Server

    Aaij, R; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gorbounov, P; Gordon, H; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hess, M; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Martynov, A; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palczewski, T; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

    2013-01-01

    We present a measurement of form-factor independent angular observables in the decay $B^0\\to K^{*}(892)^{0}\\mu^+ \\mu^-$. The analysis is based on a data sample corresponding to an integrated luminosity of 1.0 fb$^{-1}$, collected by the LHCb experiment in $pp$ collisions at a center-of-mass energy of 7TeV. Four observables are measured in six bins of the dimuon invariant mass squared, $q^2$, in the range 0.1 < $q^2$ < 19.0 GeV$^{2}/c^{4}$. Agreement with Standard Model predictions is found for 23 of the 24 measurements. A local discrepancy, corresponding to 3.7 Gaussian standard deviations, is observed in one $q^2$ bin for one of the observables. Considering the 24 measurements as independent, the probability to observe such a discrepancy, or larger, in one is 0.5%.

  2. Measurement of the form factor ratios in semileptonic decays of charm mesons

    Energy Technology Data Exchange (ETDEWEB)

    Zaliznyak, Renata [Stanford Univ., CA (United States)

    1998-05-01

    I have measured the form factor ratios r2 = A2 (0)/A1 (0) and rV = V (0)/A1 (0) in the semileptonic charm meson decay D+ → $\\bar{K}$*0 e+ve from data collected by the Fermilab E791 collaboration. Form factors are introduced in the calculation of the hadronic current in semileptonic decays of strange, charm, or bottom mesons, such as D+ → $\\bar{K}$*0 e+ ve . Semileptonic decays provide insight into quark coupling to the W boson since the leptonic and hadronic amplitudes in the Feynman diagram for the decay are completely separate. There are no strong interactions between the final state leptons and quarks. A number of theoretical models predict the values of the form factors for D+ → $\\bar{K}$*0 e+ ve , though there is a large range of predictions. E791 is a hadroproduction experiment that recorded over 20 billion interactions with a 500 GeV π- beam incident on five thin targets during the 1991-92 Fermilab fixed-target run. Approximately 3000 D+ → $\\bar{K}$*0 e+ ve decays are fully reconstructed. In order to extract the form factor ratios from the data, I implement a multidimensional unbinned maximum likelihood fit with a large sample of simulated (Monte Carlo) D+ → $\\bar{K}$*0 e+ve events. The large E791 data sample provides the most precise measurement of the form factor ratios to date. The measured values for the form factor ratios are r2 = 0.71 ± 0.08 ± 0.09 and rV = 1.84 ± 0.11 ±} 0.08. These results are in good agreement with some Lattice Gauge calculations. However the agreement with quark model predictions is not as good.

  3. 13 CFR 108.100 - Business form.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Business form. 108.100 Section 108.100 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Qualifications for the NMVC Program Organizing A Nmvc Company § 108.100 Business form. A NMVC...

  4. Strange mesons and kaon-to-pion transition form factors from holography

    International Nuclear Information System (INIS)

    Abidin, Zainul; Carlson, Carl E.

    2009-01-01

    We present a calculation of the K l3 transition form factors using the AdS/QCD correspondence. We also solidify and extend our ability to calculate quantities in the flavor-broken versions of AdS/QCD. The normalization of the form factors is a crucial ingredient for extracting |V us | from data, and the results obtained here agree well with results from chiral perturbation theory and lattice gauge theory. The slopes and curvature of the form factors agree well with the data, and with what results are available from other methods of calculation.

  5. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  6. Quark-flavor mixing and the nucleon strangeness form factors

    International Nuclear Information System (INIS)

    Ito, H.

    1995-01-01

    We have calculated the strangeness form factors of the nucleon G E s (Q), G M s (Q) and G A s (Q) and the electromagnetic form factors G E N (Q) as well, by using a relativistic constituent quark model of the nucleon wave function on the light-cone. Octet of Goldstone bosons (π, K, η) are assumed to induce the SU flavor mixing among the light constituent quarks; d-→K+s →d for example, and this mechanism induces the strangeness content in the nucleon. To calculate the meson-loop corrections to the electroweak couplings of constituent quarks, we have employed two models of the quark-meson vertex; (1) composite model of the Goldstone bosons (2) and (3) chiral quark Lagrangian. The loop momenta are regulated in a gauge-invariant way for both models

  7. On form factors and correlation functions in twistor space

    International Nuclear Information System (INIS)

    Koster, Laura; Mitev, Vladimir; Staudacher, Matthias; Wilhelm, Matthias

    2017-01-01

    In this paper, we continue our study of form factors and correlation functions of gauge-invariant local composite operators in the twistor-space formulation of N=4 super Yang-Mills theory. Using the vertices for these operators obtained in our recent papers (DOI: 10.1103/PhysRevLett.117.011601; 10.1007/JHEP06(2016)162 ), we show how to calculate the twistor-space diagrams for general N k MHV form factors via the inverse soft limit, in analogy to the amplitude case. For general operators without α-dot indices, we then reexpress the NMHV form factors from the position-twistor calculation in terms of momentum twistors, deriving and expanding on a relation between the two twistor formalisms previously observed in the case of amplitudes. Furthermore, we discuss the calculation of generalized form factors and correlation functions as well as the extension to loop level, in particular providing an argument promised in https://www.doi.org/10.1002/prop.201400085.

  8. On form factors and correlation functions in twistor space

    Energy Technology Data Exchange (ETDEWEB)

    Koster, Laura [Institut für Mathematik, Institut für Physik und IRIS Adlershof,Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Mitev, Vladimir [PRISMA Cluster of Excellence, Institut für Physik, WA THEP,Johannes Gutenberg-Universität Mainz,Staudingerweg 7, 55128 Mainz (Germany); Staudacher, Matthias [Institut für Mathematik, Institut für Physik und IRIS Adlershof,Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark)

    2017-03-24

    In this paper, we continue our study of form factors and correlation functions of gauge-invariant local composite operators in the twistor-space formulation of N=4 super Yang-Mills theory. Using the vertices for these operators obtained in our recent papers (DOI: 10.1103/PhysRevLett.117.011601; 10.1007/JHEP06(2016)162 ), we show how to calculate the twistor-space diagrams for general N{sup k}MHV form factors via the inverse soft limit, in analogy to the amplitude case. For general operators without α-dot indices, we then reexpress the NMHV form factors from the position-twistor calculation in terms of momentum twistors, deriving and expanding on a relation between the two twistor formalisms previously observed in the case of amplitudes. Furthermore, we discuss the calculation of generalized form factors and correlation functions as well as the extension to loop level, in particular providing an argument promised in https://www.doi.org/10.1002/prop.201400085.

  9. Measurement of weak meson form factors in spacelike regions

    CERN Document Server

    Brene, N

    1973-01-01

    With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

  10. Low-energy analysis of the nucleon electromagnetic form factors[12.39.Fe; 13.40.Gp; 14.20.Dh; Nucleon electromagnetic form factors; Chiral perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Kubis, Bastian. E-mail: b.kubis@fz-juelich.de; Meissner, Ulf-G. E-mail: Ulf-G.Meissner@fz-juelich.de

    2001-01-01

    We analyze the electromagnetic form factors of the nucleon to fourth order in relativistic baryon chiral perturbation theory. We employ the recently proposed infrared regularization scheme and show that the convergence of the chiral expansion is improved as compared to the heavy-fermion approach. We also discuss the inclusion of vector mesons and obtain an accurate description of all four-nucleon form factors for momentum transfer squared up to Q{sup 2}{approx_equal}0.4 GeV{sup 2}.

  11. Genotyping of K-ras codons 12 and 13 mutations in colorectal cancer by capillary electrophoresis.

    Science.gov (United States)

    Chen, Yen-Ling; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

    2009-06-26

    Point mutations of the K-ras gene located in codons 12 and 13 cause poor responses to the anti-epidermal growth factor receptor (anti-EGFR) therapy of colorectal cancer (CRC) patients. Besides, mutations of K-ras gene have also been proven to play an important role in human tumor progression. We established a simple and effective capillary electrophoresis (CE) method for simultaneous point mutation detection in codons 12 and 13 of K-ras gene. We combined one universal fluorescence-based nonhuman-sequence primer and two fragment-oriented primers in one tube, and performed this two-in-one polymerase chain reaction (PCR). PCR fragments included wild type and seven point mutations at codons 12 and 13 of K-ras gene. The amplicons were analyzed by single-strand conformation polymorphism (SSCP)-CE method. The CE analysis was performed by using a 1x Tris-borate-EDTA (TBE) buffer containing 1.5% (w/v) hydroxyethylcellulose (HEC) (MW 250,000) under reverse polarity with 15 degrees C and 30 degrees C. Ninety colorectal cancer patients were blindly genotyped using this developed method. The results showed good agreement with those of DNA sequencing method. The SSCP-CE was feasible for mutation screening of K-ras gene in populations.

  12. Measurement of the q2 Dependence of the Hadronic Form Factor in D0 to K- e+ nu_e Decays

    Energy Technology Data Exchange (ETDEWEB)

    Aubert, B.

    2006-09-26

    A preliminary measurement of the q{sup 2} dependence of the D{sup 0} {yields} K{sup -}e{sup +}{nu}{sub e} decay rate is presented. This rate is proportional to the hadronic form factor squared, specified by a single parameter. This is either the mass in the simple pole ansatz m{sub pole} = (1.854 {+-} 0.016 {+-} 0.020) GeV/c{sup 2} or the scale in the modified pole ansatz {alpha}{sub pole} = 0.43 {+-} 0.03 {+-} 0.04. The first error refers to the statistical, the second to the systematic uncertainty.

  13. Multiple vitamin K forms exist in dairy foods

    Science.gov (United States)

    Background: The plant-based form of vitamin K (phylloquinone, vitamin K-1) has been well quantified in the US diet. Menaquinones (vitamin K-2) are another class of vitamin K compounds that differ from phylloquinone in the length and saturation of their side chain, but they have not been well charact...

  14. 6 CFR 13.26 - Filing, form and service of papers.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Filing, form and service of papers. 13.26 Section 13.26 Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY PROGRAM FRAUD CIVIL REMEDIES § 13.26 Filing, form and service of papers. (a) Filing and form. (1) Documents filed with...

  15. 13 CFR 120.194 - Use of computer forms.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Use of computer forms. 120.194... Applying to All Business Loans Computerized Sba Forms § 120.194 Use of computer forms. Any Applicant or Participant may use computer generated SBA application forms, closing forms, and other forms designated by SBA...

  16. Dispersive analysis of the scalar form factor of the nucleon

    Science.gov (United States)

    Hoferichter, M.; Ditsche, C.; Kubis, B.; Meißner, U.-G.

    2012-06-01

    Based on the recently proposed Roy-Steiner equations for pion-nucleon ( πN) scattering [1], we derive a system of coupled integral equations for the π π to overline N N and overline K K to overline N N S-waves. These equations take the form of a two-channel Muskhelishvili-Omnès problem, whose solution in the presence of a finite matching point is discussed. We use these results to update the dispersive analysis of the scalar form factor of the nucleon fully including overline K K intermediate states. In particular, we determine the correction {Δ_{σ }} = σ ( {2M_{π }^2} ) - {σ_{{π N}}} , which is needed for the extraction of the pion-nucleon σ term from πN scattering, as a function of pion-nucleon subthreshold parameters and the πN coupling constant.

  17. Measurement of the $\\Lambda_{b}^{0}$ Decay Form Factor

    CERN Document Server

    Abdallah, J; Adam, W; Adzic, P; Albrecht, T; Alderweireld, T; Alemany-Fernandez, R; Allmendinger, T; Allport, P P; Amaldi, Ugo; Amapane, N; Amato, S; Anashkin, E; Andreazza, A; Andringa, S; Anjos, N; Antilogus, P; Apel, W D; Arnoud, Y; Ask, S; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Ballestrero, A; Bambade, P; Barbier, R; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Battaglia, Marco; Baubillier, M; Becks, K H; Begalli, M; Behrmann, A; Ben-Haim, E; Benekos, N C; Benvenuti, Alberto C; Bérat, C; Berggren, M; Berntzon, L; Bertrand, D; Besançon, M; Besson, N; Bloch, D; Blom, M; Bluj, M; Bonesini, M; Boonekamp, M; Booth, P S L; Borisov, G; Botner, O; Bouquet, B; Bowcock, T J V; Boyko, I; Bracko, M; Brenner, R; Brodet, E; Brückman, P; Brunet, J M; Bugge, L; Buschmann, P; Calvi, M; Camporesi, T; Canale, V; Carena, F; Castro, N; Cavallo, F R; Chapkin, M M; Charpentier, P; Checchia, P; Chierici, R; Shlyapnikov, P; Chudoba, J; Chung, S U; Cieslik, K; Collins, P; Contri, R; Cosme, G; Cossutti, F; Costa, M J; Crawley, B; Crennell, D J; Cuevas-Maestro, J; D'Hondt, J; Dalmau, J; Da Silva, T; Da Silva, W; Della Ricca, G; De Angelis, A; de Boer, Wim; De Clercq, C; De Lotto, B; De Maria, N; De Min, A; De Paula, L S; Di Ciaccio, Lucia; Di Simone, A; Doroba, K; Drees, J; Dris, M; Eigen, G; Ekelöf, T J C; Ellert, M; Elsing, M; Espirito-Santo, M C; Fanourakis, G K; Fassouliotis, D; Feindt, M; Fernández, J; Ferrer, A; Ferro, F; Flagmeyer, U; Föth, H; Fokitis, E; Fulda-Quenzer, F; Fuster, J A; Gandelman, M; García, C; Gavillet, P; Gazis, E N; Gokieli, R; Golob, B; Gómez-Ceballos, G; Gonçalves, P; Graziani, E; Grosdidier, G; Grzelak, K; Guy, J; Haag, C; Hallgren, A; Hamacher, K; Hamilton, K; Haug, S; Hauler, F; Hedberg, V; Hennecke, M; Herr, H; Hoffman, J; Holmgren, S O; Holt, P J; Houlden, M A; Hultqvist, K; Jackson, J N; Jarlskog, G; Jarry, P; Jeans, D; Johansson, E K; Johansson, P D; Jonsson, P; Joram, C; Jungermann, L; Kapusta, F; Katsanevas, S; Katsoufis, E C; Kernel, G; Kersevan, Borut P; Kerzel, U; Kiiskinen, A P; King, B T; Kjaer, N J; Kluit, P; Kokkinias, P; Kourkoumelis, C; Kuznetsov, O; Krumshtein, Z; Kucharczyk, M; Lamsa, J; Leder, G; Ledroit, F; Leinonen, L; Leitner, R; Lemonne, J; Lepeltier, V; Lesiak, T; Liebig, W; Liko, D; Lipniacka, A; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J; Malek, A; Maltezos, S; Mandl, F; Marco, J; Marco, R; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Masik, J; Mastroyiannopoulos, N; Matorras, F; Matteuzzi, C; Mazzucato, F; Mazzucato, M; McNulty, R; Meroni, C; Meyer, W T; Myagkov, A; Migliore, E; Mitaroff, W A; Mjörnmark, U; Moa, T; Moch, M; Mönig, K; Monge, R; Montenegro, J; Moraes, D; Moreno, S; Morettini, P; Müller, U; Münich, K; Mulders, M; Mundim, L M; Murray, W; Muryn, B; Myatt, Gerald; Myklebust, T; Nassiakou, M; Navarria, Francesco Luigi; Nawrocki, K; Nicolaidou, R; Nikolenko, M; Oblakowska-Mucha, A; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Österberg, K; Ouraou, A; Oyanguren, A; Paganoni, M; Paiano, S; Palacios, J P; Palka, H; Papadopoulou, T D; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Passon, O; Peralta, L; Perepelitsa, V F; Perrotta, A; Petrolini, A; Piedra, J; Pieri, L; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Poireau, V; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Pukhaeva, N; Pullia, Antonio; Rames, J; Ramler, L; Read, A; Rebecchi, P; Rehn, J; Reid, D; Reinhardt, R; Renton, P B; Richard, F; Rídky, J; Rivero, M; Rodríguez, D; Romero, A; Ronchese, P; Rosenberg, E I; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ryabtchikov, D; Sadovskii, A; Salmi, L; Salt, J; Savoy-Navarro, A; Schwickerath, U; Segar, A; Sekulin, R L; Siebel, M; Sissakian, A N; Smadja, G; Smirnova, O G; Sokolov, A; Sopczak, A; Sosnowski, R; Spassoff, Tz; Stanitzki, M; Stocchi, A; Strauss, J; Stugu, B; Szczekowski, M; Szeptycka, M; Szumlak, T; Tabarelli de Fatis, T; Taffard, A C; Tegenfeldt, F; Timmermans, J; Tkatchev, L G; Tobin, M; Todorovova, S; Tomé, B; Tonazzo, A; Tortosa, P; Travnicek, P; Treille, D; Tristram, G; Trochimczuk, M; Troncon, C; Turluer, M L; Tyapkin, I A; Tyapkin, P; Tzamarias, S; Uvarov, V; Valenti, G; van Dam, P; Van Eldik, J; Van Lysebetten, A; Van Remortel, N; Van Vulpen, I B; Vegni, G; Veloso, F; Venus, W A; Verdier, P; Verzi, V; Vilanova, D; Vitale, L; Vrba, V; Wahlen, H; Washbrook, A J; Weiser, C; Wicke, D; Wickens, J H; Wilkinson, G; Winter, M; Witek, M; Yushchenko, O P; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zhuravlov, V; Zimin, N I; Zinchenko, A I; Zupan, M

    2004-01-01

    The form factor of Lambda_b^0 baryons is estimated using 3.46 10^6 hadronic Z decays collected by the DELPHI experiment between 1992 and 1995. Charmed Lambda_c^+ baryons fully reconstructed in the pK-pi+, pK0_S, and Lambda pi+pi+pi- modes, are associated to a lepton with opposite charge in order to select Lambda_b^0 -> Lambda_c^+ l^- anti-nu_l decays. From a combined likelihood and event rate fit to the distribution of the Isgur-Wise variable w, and using the Heavy Quark Effective Theory (HQET), the slope of the b-baryon form factor is measured to be: rho-hat^2 = 2.03 +/- 0.46 (stat) ^{+0.72}_{-1.00} (syst). The exclusive semileptonic branching fraction Br(Lambda_b^0 -> Lambda_c^+ l^- anti-nu_l) can be derived from rho-hat^2 and is found to be (5.0^{+1.1}_{-0.8} (stat) ^{+1.6}_{-1.2} (syst))%. Limits on other branching fractions are also obtained.

  18. Strange mesonic transition form factor in the chiral constituent quark model

    International Nuclear Information System (INIS)

    Ito, H.; Ramsey-Musolf, M.J.

    1998-01-01

    The form factor g ρπ (S) (Q 2 ) of the strange vector current transition matrix element left-angle ρ|bar sγ μ s|π right-angle is calculated within the chiral quark model. A strange vector current of the constituent U and D quarks is induced by kaon radiative corrections and this mechanism yields the nonvanishing values of g ρπ (S) (0). The numerical result at the photon point is consistent with the one given by the φ-meson dominance model, but the falloff in the Q 2 dependence is faster than the monopole form factor. Mesonic radiative corrections are also examined for the electromagnetic ρ-to-π and K * -to-K transition amplitudes. copyright 1998 The American Physical Society

  19. B --> K$*\\gamma$ from hybrid sum rule

    CERN Document Server

    Narison, Stéphan

    1994-01-01

    Using the {\\it hybrid} moments-Laplace sum rule (HSR), which is well-defined for M_b \\rar \\infty, in contrast with the popular double Borel (Laplace) sum rule (DLSR), which blows up in this limit when applied to the heavy-to-light processes, we show that the form factor of the B \\rar K^* \\ \\gamma radiative transition is dominated by the light-quark condensate for M_b \\rar \\infty and behaves like \\sqrt M_b. The form factor is found to be F^{B\\rar K^*}_1(0) \\simeq (30.8 \\pm 1.3 \\pm 3.6 \\pm 0.6)\\times 10^{-2}, where the errors come respectively from the procedure in the sum rule analysis, the errors in the input and in the SU(3)_f-breaking parameters. This result leads to Br(B\\rar K^* \\ \\gamma) \\simeq (4.45 \\pm 1.12) \\times 10^{-5} in agreement with the recent CLEO data. Parametrization of the M_b-dependence of the form factor including the SU(3)_f-breaking effects is given in (26), which leads to F^{B\\rar K^*}_1(0)/ F^{B\\rar \\rho}_1(0) \\simeq (1.14 \\pm 0.02).

  20. Form factors and charge radii in a quantum chromodynamics ...

    Indian Academy of Sciences (India)

    tic form factors and charge radii of D, Ds,B,Bs and Bc mesons in a quantum chromodynamics. (QCD)-inspired ... as pointed out in [12,13], one can expect a similar success here too. .... 0 were large and the formalism failed to account for large ...

  1. IL-13 regulates human nasal epithelial cell differentiation via H3K4me3 modification

    Directory of Open Access Journals (Sweden)

    Yu L

    2018-01-01

    Full Text Available Lei Yu,1 Na Li,1 Jisheng Zhang,2 Yan Jiang1 1Department of Otorhinolaryngology, 2Key Laboratory of Otolaryngology-Head and Neck Surgery, Affiliated Hospital of Qingdao University, Qingdao, China Introduction: Epigenetic regulation has been shown to play an important role in the development of inflammatory diseases, including chronic rhinosinusitis and nasal polyps. The latter are characterized by epithelial mis-differentiation and infiltration of inflammatory cytokines. H3K4me3 has been shown to be involved in regulating lineage commitment. However, the underlying mechanisms, especially in human nasal epithelial cells (HNEpC, remain underexplored. The objective of this study was to investigate the role of H3K4me3 in HNEpC differentiation treated with the Th2 cytokine IL-13. Patients and methods: The expression levels of mRNA and proteins were investigated using reverse transcription-polymerase chain reaction (RT-PCR assays and Western blot in nasal polyp tissues and human nasal epithelial cells respectively. We measured these levels of H3K4me3, MLL1 and targeted genes compared with control subjects.Results: We demonstrate that expression of H3K4me3 and its methyltransferase MLL1 was significantly upregulated in IL-13-treated HNEpC. This elevation was also observed in nasal polyps. Expression of cilia-related transcription factors FOXJ1 and DNAI2 decreased, while goblet cell-derived genes CLCA1 and MUC5a increased upon IL-13 treatment. Mechanistically, knockdown of MLL1 restored expression of these four genes induced by IL-13. Conclusion: These findings suggest that H3K4me3 is a critical regulator in control of nasal epithelial cell differentiation. MLL1 may be a potential therapeutic target for nasal inflammatory diseases. Keywords: IL-13, H3K4me3 modification, nasal epithelial cell, differentiation 

  2. Measurement of the energy dependence of the form factor $f_{+}$ in $K^{0}_{e3}$ decay

    CERN Document Server

    Apostolakis, Alcibiades J; Backenstoss, Gerhard; Bargassa, P; Behnke, O; Benelli, A; Bertin, V; Blanc, F; Bloch, P; Carlson, P J; Carroll, M; Cawley, E; Chertok, M B; Danielsson, M; Dejardin, M; Derré, J; Ealet, A; Eleftheriadis, C; Fetscher, W; Fidecaro, Maria; Filipcic, A; Francis, D; Fry, J; Gabathuler, Erwin; Gamet, R; Gerber, H J; Go, A; Haselden, A; Hayman, P J; Henry-Coüannier, F; Hollander, R W; Jon-And, K; Kettle, P R; Kokkas, P; Kreuger, R; Le Gac, R; Leimgruber, F; Mandic, I; Manthos, N; Marel, Gérard; Mikuz, M; Miller, J; Montanet, François; Müller, A; Nakada, Tatsuya; Pagels, B; Papadopoulos, I M; Pavlopoulos, P; Polivka, G; Rickenbach, R; Roberts, B L; Ruf, T; Schäfer, M; Schaller, L A; Schietinger, T; Schopper, A; Tauscher, Ludwig; Thibault, C; Touchard, F; Touramanis, C; van Eijk, C W E; Vlachos, S; Weber, P; Wigger, O; Wolter, M; Zavrtanik, D; Zimmerman, D

    2000-01-01

    Neutral-kaon decays to \\pielnu\\ % recorded by the CPLEAR experimentwere analysed to determine the $q^2$ dependence of the \\Kzet\\ electroweak form factor $f_+$. Based on $365\\,612$ events,this form factor was found to have a linear dependence on $q^2$with a slope $\\lambda_+ = 0.0245 \\pm 0.0012_{\\text{stat}} \\pm 0.0022_{\\text{syst}}$.

  3. 21 CFR 1305.13 - Procedure for filling DEA Forms 222.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Procedure for filling DEA Forms 222. 1305.13... I AND II CONTROLLED SUBSTANCES DEA Form 222 § 1305.13 Procedure for filling DEA Forms 222. (a) A purchaser must submit Copy 1 and Copy 2 of the DEA Form 222 to the supplier and retain Copy 3 in the...

  4. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  5. Form factors and structure functions of hadrons in parton model

    International Nuclear Information System (INIS)

    Volkonskij, N.Yu.

    1979-01-01

    The hadron charge form factors and their relation to the deep-inelastic lepton-production structure functions in the regions of asymptotically high and small momentum transfer Q 2 are studied. The nucleon and pion charge radii are calculated. The results of calculations are in good agreement with the experimental data. The K- and D-meson charge radii are estimated. In the region of asymptotically high Q 2 the possibility of Drell-Yan-West relation violation is analyzed. It is shown, that for pseudoscalar mesons this relation is violated. The relation between the proton and neutron form factor asymptotics is obtained

  6. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  7. Current algebra method for form factors and strong decays with hard pions and kaons

    International Nuclear Information System (INIS)

    Srivastava, P.P.

    1969-01-01

    The F K /F Π ratio between the kaon and pion decay couplings in one lepton pair, sum rules for Weinberg spectral functions, form factor renormalization of the K l3 decay because of the SU(3) symmetry violation and the calculations of strong decays of the K* and K A strange resonances are presented and discussed. (L.C.) [pt

  8. Antimicrobial effects of GL13K peptide coatings on S. mutans and L. casei

    Science.gov (United States)

    Schnitt, Rebecca Ann

    Background: Enamel breakdown around orthodontic brackets, so-called "white spot lesions", is the most common complication of orthodontic treatment. White spot lesions are caused by bacteria such as Streptococci and Lactobacilli, whose acidic byproducts cause demineralization of enamel crystals. Aims: The aim of this project was to develop an antimicrobial peptide coating for titanium alloy that is capable of killing acidogenic bacteria, specifically Streptococcus mutans and Lactobacillus casei. The long-term goal is to create an antimicrobial-coated orthodontic bracket with the ability to reduce or prevent the formation of white spot lesions in orthodontic patients thereby improving clinical outcomes. Methods: First, an alkaline etching method with NaOH was established to allow effective coating of titanium discs with GL13K, an antimicrobial peptide derived from human saliva. Coatings were verified by contact angle measures, and treated discs were characterized using scanning electron microscopy. Secondly, GL13K coatings were tested against hydrolytic, proteolytic and mechanical challenges to ensure robust coatings. Third, a series of qualitative and quantitative microbiology experiments were performed to determine the effects of GL13K--L and GL13K--D on S. mutans and L. casei, both in solution and coated on titanium. Results: GL13K-coated discs were stable after two weeks of challenges. GL13K--D was effective at killing S. mutans in vitro at low doses. GL13K--D also demonstrated a bactericidal effect on L. casei, however, in contrast to S. mutans, the effect on L. casei was not statistically significant. Conclusion: GL13K--D is a promising candidate for antimicrobial therapy with possible applications for prevention of white spot lesions in orthodontics.

  9. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.

    1976-01-01

    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  10. CCT-K2.1: NRC/VNIIFTRI bilateral comparison of capsule-type standard platinum resistance thermometers from 13.8 K to 273.16 K

    Energy Technology Data Exchange (ETDEWEB)

    Hill, K.D.; Steele, A.G. [National Research Council of Canada, Institute for National Measurement Standards, Ottawa, ON (Canada); Dedikov, Y.A.; Shkraba, V.T. [Institute for Physical-Technical and Radiotechnical Measurements (VNIIFTRI), Moscow (Russian Federation)

    2005-04-01

    The Consultative Committee for Thermometry Key Comparison 2 (CCT-K2) results were published two years ago (2002 Metrologia 39 551-71). NRC served as the pilot laboratory for CCT-K2 and remains able to provide a scale and measurement system suitable for performing bilateral comparisons linked to the original key comparison results. In March 2003, measurements of two VNIIFTRI 100 {omega} capsule-style platinum resistance thermometers (CSPRTs), S/N 356 and 476, were undertaken to relate their local calibration to the results from the CCT-K2 exercise. The NRC Leeds and Northrup (L and N) CSPRT S/N 1872174 provides the link to the CCT-K2 results. The three CSPRTs were compared at the eight defining cryogenic temperatures of the International Temperature Scale of 1990 (ITS-90) in the range from 13.8033 K to 273.16 K. The reader is referred to the full text of the CCT-K2 report for a detailed explanation of the methodology employed for the comparison. Only the details unique to the measurements reported here will be addressed in this article. The NRC/VNIIFTRI bilateral comparison of capsule-style platinum resistance thermometers over the range 13.8 K to 273.16 K has revealed calibrations at VNIIFTRI to be in agreement with the KCRV of CCT-K2 within the expanded uncertainty for all temperatures of the comparison with the exception of the triple point of hydrogen at 13.8033 K. One of the two CSPRTs supplied by VNIIFTRI was found to be discrepant as revealed by differences at the triple point of water and at the lowest temperatures of the comparison, and was therefore excluded from further analysis. The linkage to the CCT-K2 data supports the evaluation of the VNIIFTRI CMCs in Appendix C of the KCDB. (authors)

  11. Electromagnetic Hadronic Form-Factors

    International Nuclear Information System (INIS)

    Edwards, Robert G.

    2005-01-01

    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks

  12. Construction of a 13 kG magnetic coil system

    International Nuclear Information System (INIS)

    Rossi, J.O.; Aso, Y.; Castro, P.J.; Barroso, J.J.; Ludwig, G.O.; Montes, A.; Nono, M.C.A.; Correa, R.A.

    1991-08-01

    The construction of magnetic coil system for a 35 GHz gyrotron is reported in great detail. This system is designed to generate a magnetic induction of 13,2 kG over an extension of 13 cm. By using an operating current of about 100 A, it was verified that both the axial magnetic field profile and the spatial non-uniformity are in close agreement with those theoretically predicted. (author)

  13. A study of K*(890) and K*(1420) production mechanisms in K/sup +/p. -->. K/sup +/. pi. /sup -/. delta. /sup + +/ at 13 GeV/c. [Exchange mechanisms, angular distributions

    Energy Technology Data Exchange (ETDEWEB)

    Estabrooks, P; Martin, A D [Durham Univ. (UK); Brandenburg, G W; Carnegie, R K; Cashmore, R J; Davier, M; Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S.; Matthews, J A.J.

    1976-04-05

    Amplitudes for K*(890) and K*(1420) production, and their lower spin background, are determined from an analysis of the K..pi.. angular distribution observed in K/sup +/p..-->..K/sup +/..pi../sup -/..delta../sup + +/ at 13 GeV/c. The exchange mechanisms responsible for K*..delta.. production are studied, and a simple model is introduced which describes all features of the data.

  14. 13 CFR 120.610 - Form and terms of Certificates.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Form and terms of Certificates. 120.610 Section 120.610 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Secondary Market Certificates § 120.610 Form and terms of Certificates. (a) General form and content. Each...

  15. Electroweak form factors of the Skyrmion

    International Nuclear Information System (INIS)

    Braaten, E.; Sze-Man Tse; Willcox, C.

    1986-01-01

    The electroweak form factors of baryons are studied in the semiclassical approximation to the Skyrme model. General expressions for the form factors are given for arbitrary choices of the Skyrme-model Lagrangian. They are applied to the original two-parameter Skyrme model to compute the electric, magnetic, and axial-vector form factors of the nucleon and the electromagnetic nucleon-Δ transition form factors. The dependence of the form factors on the momentum transfer is compared with phenomenological dipole parametrizations

  16. A g-factor metric for k-t SENSE and k-t PCA based parallel imaging.

    Science.gov (United States)

    Binter, Christian; Ramb, Rebecca; Jung, Bernd; Kozerke, Sebastian

    2016-02-01

    To propose and validate a g-factor formalism for k-t SENSE, k-t PCA and related k-t methods for assessing SNR and temporal fidelity. An analytical gxf -factor formulation in the spatiotemporal frequency domain is derived, enabling assessment of noise and depiction fidelity in both the spatial and frequency domain. Using pseudoreplica analysis of cardiac cine data the gxf -factor description is validated and example data are used to analyze the performance of k-t methods for various parameter settings. Analytical gxf -factor maps were found to agree well with pseudoreplica analysis for 3x, 5x, and 7x k-t SENSE and k-t PCA. While k-t SENSE resulted in lower average gxf values (gx (avg) ) in static regions when compared with k-t PCA, k-t PCA yielded lower gx (avg) values in dynamic regions. Temporal transfer was better preserved with k-t PCA for increasing undersampling factors. The proposed gxf -factor and temporal transfer formalism allows assessing noise performance and temporal depiction fidelity of k-t methods including k-t SENSE and k-t PCA. The framework enables quantitative comparison of different k-t methods relative to frame-by-frame parallel imaging reconstruction. © 2015 Wiley Periodicals, Inc.

  17. Pharmacokinetics and whole body distribution of elastase derived angiostatin (k1-3) in rats

    NARCIS (Netherlands)

    Molema, Grietje; van Veen-Hof, Ingrid; van Loenen - Weemaes, Anne-miek; Proost, Johannes; de Leij, Lou F.M.H.; Meijer, Dirk K.F.

    2001-01-01

    In the current study, we determined short-term pharmacokinetics and whole body distribution of elastase derived angiostatin [angiostatin((k1-3))] in rats after i.v. injection of radiolabelled protein. Since In gamma-camera studies, no tumor specific angiostatin((k1-3)) accumulation was observed,

  18. Bethe Ansatz and exact form factors of the O(N) Gross Neveu-model

    International Nuclear Information System (INIS)

    Babujian, Hrachya M.; Foerster, Angela; Karowski, Michael

    2016-01-01

    We apply previous results on the O(N) Bethe Ansatz http://dx.doi.org/10.1088/1751-8113/45/5/055207, http://arxiv.org/abs/1204.3479, http://dx.doi.org/10.1007/JHEP11(2013)089 to construct a general form factor formula for the O(N) Gross-Neveu model. We examine this formula for several operators, such as the energy momentum, the spin-field and the current. We also compare these results with the 1/N expansion of this model and obtain full agreement. We discuss bound state form factors, in particular for the three particle form factor of the field. In addition for the two particle case we prove a recursion relation for the K-functions of the higher level Bethe Ansatz.

  19. Joint resummation for pion wave function and pion transition form factor

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hsiang-nan [Institute of Physics, Academia Sinica,Academia Rd., Taipei, Taiwan 115 (China); Department of Physics, National Cheng-Kung University,University Rd., Tainan, Taiwan 701 (China); Department of Physics, National Tsing-Hua University,Kuang-Fu Rd., Hsinchu, Taiwan 300 (China); Shen, Yue-Long [College of Information Science and Engineering, Ocean University of China,Songling Rd, Qingdao, Shandong 266100 (China); Wang, Yu-Ming [Institut für Theoretische Teilchenphysik und Kosmologie RWTH Aachen,Physikzentrum Otto-Blumenthal-Straße, D-52056 Aachen (Germany); Physik Department T31, Technische Universität München,James-Franck-Straße, D-85748 Garching (Germany)

    2014-01-03

    We construct an evolution equation for the pion wave function in the k{sub T} factorization formalism, whose solution sums the mixed logarithm ln xln k{sub T} to all orders, with x (k{sub T}) being a parton momentum fraction (transverse momentum). This joint resummation induces strong suppression of the pion wave function in the small x and large b regions, b being the impact parameter conjugate to k{sub T}, and improves the applicability of perturbative QCD to hard exclusive processes. The above effect is similar to those from the conventional threshold resummation for the double logarithm ln{sup 2} x and the conventional k{sub T} resummation for ln{sup 2} k{sub T}. Combining the evolution equation for the hard kernel, we are able to organize all large logarithms in the γ{sup ∗}π{sup 0}→γ scattering, and to establish a scheme-independent k{sub T} factorization formula. It will be shown that the significance of next-to-leading-order contributions and saturation behaviors of this process at high energy differ from those under the conventional resummations. It implies that QCD logarithmic corrections to a process must be handled appropriately, before its data are used to extract a hadron wave function. Our predictions for the involved pion transition form factor, derived under the joint resummation and the input of a non-asymptotic pion wave function with the second Gegenbauer moment a{sub 2}=0.05, match reasonably well the CLEO, BaBar, and Belle data.

  20. TRASYS form factor matrix normalization

    Science.gov (United States)

    Tsuyuki, Glenn T.

    1992-01-01

    A method has been developed for adjusting a TRASYS enclosure form factor matrix to unity. This approach is not limited to closed geometries, and in fact, it is primarily intended for use with open geometries. The purpose of this approach is to prevent optimistic form factors to space. In this method, nodal form factor sums are calculated within 0.05 of unity using TRASYS, although deviations as large as 0.10 may be acceptable, and then, a process is employed to distribute the difference amongst the nodes. A specific example has been analyzed with this method, and a comparison was performed with a standard approach for calculating radiation conductors. In this comparison, hot and cold case temperatures were determined. Exterior nodes exhibited temperature differences as large as 7 C and 3 C for the hot and cold cases, respectively when compared with the standard approach, while interior nodes demonstrated temperature differences from 0 C to 5 C. These results indicate that temperature predictions can be artificially biased if the form factor computation error is lumped into the individual form factors to space.

  1. Protein expression of P13K and P53 in prediction of response to radiotherapy in cervical cancer

    International Nuclear Information System (INIS)

    Teja Kisnanto; Devita Tetriana; Iin Kurnia; Sudiono S; Mellova Amir; Budiningsih Siregar; Ramli; Andrijono; Setiawan Soetopo; Irwan; Tjahya Kurjana; Bethy S Hernowo; Maringan DL Tobing

    2015-01-01

    Cervical cancer is a malignant disease that is common in women and is the first order of malignant disease in Indonesia. Radiotherapy is the main treatment on cervical cancer, especially at an advanced stage (IIB-IIB). P13K and P-53 protein plays a role in the regulation of apoptosis (programmed cell death). The purpose of this study was to determine the protein expression of P13K and P-53 in the prediction of response to radiotherapy action in patients with cervical cancer. Microscopic preparations obtained from biopsy tissue cancer (IIB-IIIB) to 20 patients from RSCM and RSHS. The method used is the method of immunohistochemistry using P13K and P-53 protein biomarkers in cervical cancer tissue preparations. P13K protein expression value obtained by the method of immuno reactive Score (IRS). P13K protein positive expression marked in blue on the cell cytoplasm and P-53 protein is characterized by brown or dark colors contained in the cell nucleus. Results showed that IRS value by 10% a negative P13K, P13K IRS weaker by 70%, IRS P13K was at 15%, and the IRS P13K stronger by 5%. While the index positive P-53 was obtained by 75% and negative P-53 index by 5%. Radiotherapy response analysis showed that there were 75% good response and 25% a bad response. The conclusion from this study is the expression of the protein P13K and P-53 for response prediction of radiotherapy IRS P13K values obtained in response to both radiotherapy is higher compared with radiotherapy response is bad, and the P-53 protein is not found differences in response to radiotherapy between positive and negative expressions. (author)

  2. Cluster self-organization of germanate systems: suprapolyhedral precursor clusters and self-assembly of K2Nd4Ge4O13(OH)4, K2YbGe4O10(OH), K2Sc2Ge2O7(OH)2, and KScGe2O6(PYR)

    International Nuclear Information System (INIS)

    Ilyushin, G.D.; Dem'yanets, L.N.

    2008-01-01

    One performed the computerized (the TOPOS 4.0 software package) geometric and topological analyses of all known types of K, TR-germanates (TR = La-Lu, Y, Sc, In). The skeleton structure are shown as three-dimensional 3D, K, TR, Ge-patterns (graphs) with remote oxygen atoms. TR 4 3 3 4 3 3 + T 4 3 4 3, K 2 YbGe 4 O 14 (OH) pattern, TR 6 6 3 6 + T1 6 8 6 + T2 3 6 8, K 2 Sc 2 Ge 2 O 7 (OH) 2 , TR 6 4 6 4 + T 6 4 6 and KScGe 2 O 6 - TR 6 6 3 6 3 4 + T1 6 3 6 + T2 6 4 3 patterns served as crystal-forming 2D TR,Ge-patterns for K 2 Nd 4 Ge 4 O 13 (OH) 4 . One performed the 3D-simulation of the mechanism of self-arrangement of the crystalline structures: cluster-precursor - parent chain - microlayer - microskeleton (super-precursor). Within K 2 Nd 4 Ge 4 O 13 (OH) 4 , K 2 Sc 2 Ge 2 O 7 (OH) 2 and KScGe 2 O 6 one identified the invariant type of the cyclic hexapolyhedral cluster-precursor consisting of TR-octahedrons linked by diorthogroups stabilized by K atoms. For K 2 Nd 4 Ge 4 O 13 (OH) 4 one determined the type of the cyclic tetrapolyhedral cluster-precursor consisting of TR-octavertices linked by tetrahedrons. The cluster CN within the layer just for KScGe 2 O 6 water-free germanate (the PYR pyroxene analog) is equal to 6 (the maximum possible value), while in the rest OH-containing germanates it constitutes 4. One studied the formation mechanism of Ge-radicals in the form of Ge 2 O 7 and Ge 4 O 13 groupings, GeO 3 chain and the tubular structure consisting of Ge 8 O 20 fixed cyclic groupings [ru

  3. A water-cooled 13-kG magnet system

    International Nuclear Information System (INIS)

    Rossi, J.O.; Goncalves, J.A.N.; Barroso, J.J.; Patire Junior, H.; Spassovsky, I.P.; Castro, P.J.

    1993-01-01

    The construction, performance, and reliability of a high field magnet system are reported. The magnet is designed to generate a flat top 13 kG magnetic induction required for the operation of a 35 GHz, 100 k W gyrotron under development at INPE. The system comprises three solenoids, located in the gun, cavity, and collector regions, consisting of split pair magnets with the field direction vertical. The magnets are wound from insulated copper tube whose rectangular cross section has 5.0 mm-diameter hole leading the cooling water. On account of the high power (∼ 100 k W) supplied to the cavity coils, it turned out necessary to employ a cooling system which includes hydraulic pump a heat exchanger. The collector and gun magnets operate at lower DC current (∼ 150 A), and, in this case, flowing water provided by wall pipes is far enough to cool down the coils. In addition, a 250 k V A high power AC/DC Nutek converser is used to supply power to the cavity magnet. For the collector and gun magnets, 30 V/600 A DC power supplies are used. (author)

  4. Form factors in (HI,HI') direct reactions

    International Nuclear Information System (INIS)

    Chu, Y.H.

    1981-01-01

    Using the semiclassical theory, the inelastic transition form factors are analyzed. For the first order form factors, we find that: (i) In the strong absorption limit, the Austern-Blair theory is a good approximation to the inelastic form factor--even in highly mismatched reactions. (ii) In weak to moderate absorption, the amplitude of the inelastic form factor oscillates due to overlapping potential resonances. The internal part of the form factor can be expressed in a simple form, which may easily be used to analyze heavy-ion inelastic scattering. (iii) In the presence of an isolated resonance, the inelastic form factor is enhanced greatly at the resonance due to multiple reflections inside the potential well. The second order form factors contain two terms, i.e. the one-step direct process (OSD) term and the two-step process (TS) term. It is found that: (i) In the strong absorption limit, OSD and TS form factors are equally important and interfere destructively near the grazing angular momentum. The Austern-Blair theory gives satisfactory results for well-matched reactions. The angular distributions of the mutual and double excitations are out of phase compared with that of the single excitation. (ii) For the weak absorption case, the internal part of the TS form factor is so enhanced that the OSD form factor can simply be neglected. The internal TS form factor can be parameterized in a form proportional to the internal-wave elastic Smatrix, where the angular distribution shows characteristically refractive phenomenon

  5. Thermal Runaway of the 13 kA Busbar Joints in the LHC

    OpenAIRE

    Verweij, A P

    2010-01-01

    Triggered by the incident in the LHC in September 2008, the thermo-electrical stability of the 10,000 soldered busbar joints in the 13 kA circuits of the LHC has been re-assessed. For this purpose the computer model QP3 has been developed. In this paper the results of some calculations are presented, and it is shown how the results have been used to improve the quench detection system and ensure safe future operation. First the layout of the 13 kA circuits, the geometry of the soldered joints...

  6. New metastable form of glibenclamide prepared by redispersion from ternary solid dispersions containing polyvinylpyrrolidone-K30 and sodium lauryl sulfate.

    Science.gov (United States)

    Thongnopkoon, Thanu; Puttipipatkhachorn, Satit

    2016-01-01

    Modification of polymorphic forms of poorly water-soluble drugs is one way to achieve the desirable properties. In this study, glibenclamide (GBM) particles with different polymorphic forms, including a new metastable form, were obtained from redispersion of ternary solid dispersion systems. The ternary solid dispersion systems, consisting of GBM, polyvinylpyrrolidone-K30 (PVP-K30) and sodium lauryl sulfate (SLS), were prepared by solvent evaporation method and subsequently redispersed in deionized water. The precipitated drug particles were then collected at a given time period. The drug particles with different polymorphic forms could be achieved depending on the polymer/surfactant ratio. Amorphous drug nanoparticles could be obtained by using a high polymer/surfactant ratio, whereas two different crystalline forms were obtained from the systems containing low polymer/surfactant ratios. Interestingly, a new metastable form IV of GBM with improved dissolution behavior could be obtained from the system of GBM:PVP-K30:SLS with the weight ratio of 2:2:4. This new polymorphic form IV of GBM was confirmed by differential scanning calorimetry (DSC), Fourier transform infrared (FT-IR) spectroscopy, powder X-ray diffractometry (PXRD) and solid state 13 C nuclear magnetic resonance (NMR) spectroscopy. The molecular arrangement of the new polymorphic form IV of GBM was proposed. The GBM particles with polymorphic form IV also showed an improved dissolution behavior. In addition, it was found that the formation of the new polymorphic form IV of GBM by this process was reproducible.

  7. Study of K. pi. scattering using the reactions K/sup + -/p. -->. K/sup + -/. pi. /sup +/n and K/sup + -/p. -->. K/sup + -/. pi. /sup -/. delta. /sup + +/ at 13 GeV/c

    Energy Technology Data Exchange (ETDEWEB)

    Estabrooks, P [McGill Univ., Montreal, Quebec (Canada); Carnegie, R K [Carleton Univ., Ottawa, Ontario (Canada); Martin, A D [Durham Univ. (UK); Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S. [Stanford Linear Accelerator Center, Calif. (USA)

    1978-02-27

    An elastic K..pi.. partial-wave analysis is presented. It is based on high-statistics data for the reactions K/sup + -/p ..-->.. K/sup + -/..pi../sup +/n and K/sup + -/p ..-->.. K/sup + -/..pi../sup -/..delta../sup + +/ at 13 GeV obtained in a spectrometer experiment performed at SLAC. For each reaction, a t-dependent parametrization of the production amplitudes provides information on both the K..pi.. mass dependence of the production mechanisms and on K..pi.. scattering. Knowledge of the t-dependence then allows a calculation of the K..pi.. partial-wave amplitudes for K..pi.. masses from 0.7 to 1.9 GeV. The results of such analyses using data for (i) the neutral recoil reactions, (ii) the ..delta../sup + +/ recoil reactions, and (iii) both neutron and ..delta../sup + +/ recoil reactions simultaneously are presented.

  8. Electromagnetic form factors

    International Nuclear Information System (INIS)

    Desplanques, B.

    1987-01-01

    Electromagnetic form factors, in first approximation, are sensitive to spatial distribution of nucleons and to their current. In second approximation, more precise effects are concerned, whose role is increasing with momentum transfer and participating essentially of short range nuclei description. They concern of course the nucleon-nucleon interaction while approaching each other and keeping their free-state identity, but also mutually polarizing one the other. In this last effect, radial and orbital excitations of nucleon, the nucleon mesonic cloud modification and the nucleon antinucleon pair excitation are included. In this paper, these contributions are discussed while trying to find the important elements for a good description of form factors. Current questions are also discussed. Light nuclei are essentially concerned [fr

  9. Determination of the K/sub L/0 → π-μ+ν/sub μ/ form factor xi(q2) by muon polarization measurements

    International Nuclear Information System (INIS)

    Shen, G.

    1975-09-01

    The polarization of the muon in the decay K 0 /sub L/ → π - μ + ν/sub μ/ was measured as a function of q 2 , the four-momentum transferred to the lepton pair. The kinematic information was used to compute the polarization expected on the basis of various assumed values of the form factor xi(q 2 ). By comparing the interpolated curve of the polarization as a function of xi(q 2 ) to the experimentally measured polarization, one has determined xi(q 2 ) as a function of q 2 . If one parameterizes the q 2 dependence of xi by xi(q 2 ) = xi(0) + Λ q 2 /m 2 /sub π/, then xi(0) = 0.178 +- 0.105 - 3.80 Λ

  10. An experimental survey of the factors that affect leaching from low-level radioactive waste forms

    International Nuclear Information System (INIS)

    Dougherty, D.R.; Pietrzak, R.F.; Fuhrmann, M.; Colombo, P.

    1988-09-01

    This report represents the results of an experimental survey of the factors that affect leaching from several types of solidified low-level radioactive waste forms. The goal of these investigations was to determine those factors that accelerate leaching without changing its mechanism(s). Typically, although not in every case,the accelerating factors include: increased temperature, increased waste loading (i.e., increased waste to binder ratio), and decreased size (i.e., decreased waste form volume to surface area ratio). Additional factors that were studied were: increased leachant volume to waste form surface area ratio, pH, leachant composition (groundwaters, natural and synthetic chelating agents), leachant flow rate or replacement frequency and waste form porosity and surface condition. Other potential factors, including the radiation environment and pressure, were omitted based on a survey of the literature. 82 refs., 236 figs., 13 tabs

  11. Chou-Yang model and PHI form factor

    Energy Technology Data Exchange (ETDEWEB)

    Fazal-e-Aleem; Saleem, M.; Rafique, M.

    1988-03-01

    By using the deduced differential cross-section data for PHIp elastic scattering at 175 GeV/c in the Chou-Yang model, the PHI form factor has been computed and parametrized. Then in conjunction with the proton form factor this form factor is used in the pristine Chou-Yang model to obtain differential cross-section data at Fermilab energies. The theoretical results agree with the experimental measurements, endorsing the conjecture that the hadronic form factor of neutral particle is proportional to its magnetic form factor.

  12. KEY COMPARISON: CCT-K2.1: NRC/VNIIFTRI bilateral comparison of capsule-type standard platinum resistance thermometers from 13.8 K to 273.16 K

    Science.gov (United States)

    Hill, K. D.; Steele, A. G.; Dedikov, Y. A.; Shkraba, V. T.

    2005-01-01

    The Consultative Committee for Thermometry Key Comparison 2 (CCT-K2) results were published two years ago (2002 Metrologia 39 551-71). NRC served as the pilot laboratory for CCT-K2 and remains able to provide a scale and measurement system suitable for performing bilateral comparisons linked to the original key comparison results. In March 2003, measurements of two VNIIFTRI 100 Ω capsule-style platinum resistance thermometers (CSPRTs), S/N 356 and 476, were undertaken to relate their local calibration to the results from the CCT-K2 exercise. The NRC Leeds and Northrup (L&N) CSPRT S/N 1872174 provides the link to the CCT-K2 results. The three CSPRTs were compared at the eight defining cryogenic temperatures of the International Temperature Scale of 1990 (ITS-90) in the range from 13.8033 K to 273.16 K. The reader is referred to the full text of the CCT-K2 report for a detailed explanation of the methodology employed for the comparison. Only the details unique to the measurements reported here will be addressed in this article. The NRC/VNIIFTRI bilateral comparison of capsule-style platinum resistance thermometers over the range 13.8 K to 273.16 K has revealed calibrations at VNIIFTRI to be in agreement with the KCRV of CCT-K2 within the expanded uncertainty for all temperatures of the comparison with the exception of the triple point of hydrogen at 13.8033 K. One of the two CSPRTs supplied by VNIIFTRI was found to be discrepant as revealed by differences at the triple point of water and at the lowest temperatures of the comparison, and was therefore excluded from further analysis. The linkage to the CCT-K2 data supports the evaluation of the VNIIFTRI CMCs in Appendix C of the KCDB. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCT, according to the provisions

  13. The neutron electric form factor to Q² = 1.45 (GeV/c)²

    Energy Technology Data Exchange (ETDEWEB)

    Plaster, Bradley [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States)

    2004-02-01

    The nucleon elastic electromagnetic form factors are fundamental quantities needed for an understanding of nucleon and nuclear electromagnetic structure. The evolution of the Sachs electric and magnetic form factors with Q2, the square of the four-momentum transfer, is related to the distribution of charge and magnetization within the nucleon. High precision measurements of the nucleon form factors are essential for stringent tests of our current theoretical understanding of confinement within the nucleon. Measurements of the neutron form factors, in particular, those of the neutron electric form factor, have been notoriously difficult due to the lack of a free neutron target and the vanishing integral charge of the neutron. Indeed, a precise measurement of the neutron electric form factor has eluded experimentalists for decades; however, with the advent of high duty-factor polarized electron beam facilities, experiments employing polarization degrees of freedom have finally yielded the first precise measurements of this fundamental quantity. Following a general overview of the experimental and theoretical status of the nucleon form factors, a detailed description of an experiment designed to extract the neutron electric form factor from measurements of the neutron's recoil polarization in quasielastic 2H(e, e')1H scattering is presented. The experiment described here employed the Thomas Jefferson National Accelerator Facility's longitudinally polarized electron beam, a magnetic spectrometer for detection of the scattered electron, and a neutron polarimeter designed specifically for this experiment. Measurements were conducted at three Q2 values of 0.45, 1.13, and 1.45 (GeV/c)2, and the final results extracted from an analysis of the data acquired in this experiment are reported and compared with recent theoretical predictions for the nucleon form factors.

  14. Synthesis, crystal structure and properties of K2Ta2S10: A novel ternary tantalum polysulfide with TaS8 polyhedra forming infinite anionic chains

    International Nuclear Information System (INIS)

    Wu Yuandong; Naether, Christian; Bensch, Wolfgang

    2005-01-01

    The new ternary alkali tantalum polysulfide K 2 Ta 2 S 10 has been synthesized by reacting TaS 2 with an in situ formed melt of K 2 S 3 and S at 773K. The compound crystallizes with four formula units in the monoclinic space group P2 1 /n (No. 14) with lattice parameters of a=14.9989(13)A,b=6.4183(4)A,c=15.1365(13)A,β=117.629(9) o . The structure contains two different zigzag chain anions [TaS 5 ] - , running parallel to the crystallographic b-axis separated by potassium cations. The two crystallographically independent tantalum atoms are in a distorted bi-capped trigonal prismatic environment of eight sulfur atoms which was never observed before. The TaS 8 polyhedra share three S atoms on each side to form the anionic chains. The compound was characterized with FIR and Raman spectroscopy

  15. Spin trapping of radicals formed in gamma-irradiated methanol: effect of the irradiation temperature from 77K to 300K

    International Nuclear Information System (INIS)

    Schlick, S.; Kevan, L.

    1976-01-01

    The neutral radicals formed in gamma-irradiated methanol were studied by spin trapping with phenyl-t-butylnitrone (PBN) in an attempt to probe the primary neutral radicals formed. In the temperature range from approximately 157 K to 300 K both CH 2 OH and CH 3 O spin adducts are observed and their limiting ratio at high PBN concentrations is CH 2 OH/CH 3 O=1.5 over this temperature range. Below approximately 157 K this ratio increases exponentially with decreasing temperature with an apparent activation energy of 5.8 kJ/mole (1.4 kcal/mole); this is consistent with the finding that only CH 2 OH radicals are formed by gamma radiolysis at 77 K. Several possible models for the primary neutral radicals formed in gamma-irradiated methanol and their subsequent reactions as a function of irradiation temperature are discussed. It is suggested that the primary radical formation mechanisms are similar in the gas and liquid phases and become temperature dependent when molecular motion is arrested in the solid. (Auth.)

  16. What is the Real K Factor?

    OpenAIRE

    Vogt, R.

    2002-01-01

    The theoretical K factor, describing the difference between the leading and higher order cross sections, has no precise definition. The definition is sensitive to the order of the fit to the parton densities and the number of loops at which alpha_s is evaluated. We describe alternate ways to define the K factor and show how the definition affects its magnitude and shape for examples of hadroproduction of W^+ bosons, Drell-Yan lepton pairs, and heavy quarks. We discuss which definition is appr...

  17. Heavy meson form factors from QCD

    International Nuclear Information System (INIS)

    Falk, A.F.; Georgi, H.; Grinstein, B.

    1990-01-01

    We calculate the leading QCD radiative corrections to the relations which follow from the decoupling of the heavy quark spin as the quark mass goes infinity and from the symmetry between systems with different heavy quarks. One of the effects we calculate gives the leading q 2 -dependence of the form factor of a heavy quark, which in turn dominates the q 2 -dependence of the form factors of bound states of the heavy quark with light quarks. This, combined with the normalization of the form factor provided by symmetry, gives us a first principles calculation of the heavy meson (or baryon) form factors in the limit of very large heavy quark mass. (orig.)

  18. Make Projects Small Form Factor PCs

    CERN Document Server

    Wessels, Duane

    2006-01-01

    Shoebox sized and smaller, small-form-factor PCs can pack as much computing muscle as a full-sized desktop computer. They consumer less power, have few or no moving parts, and are very quiet. Whether you plan to use one as a standalone PC or want to embed it in your next hacking project, a small-form-factor PC can be a lot of fun to build. Make Projects: Small Form Factor PCs is the only book available that shows you how to build small-form-factor PCs -- from kits and from scratch -- that are more interesting and more personalized than what a full-sized PC can give you. Included in the book

  19. An electron spin resonance study on the gamma-irradiation of urea, urea- d4, 1-3-dimethylurea, 1-3-diethylurea and 1,1',3,3'-tetramthylurea

    International Nuclear Information System (INIS)

    Kang, Y.S.; McManus, H.J.D.; Kevan, L.

    1994-01-01

    Urea, urea-d 4 , 1,3-dimethylurea, 1,3-diethylurea powder and 1,1',3,3'-tetramethylurea, and their solutions in D 2 O were γ-irradiated with 0.0882 kGy both at room temperature and at 77 K. The product radicals were identified with X-band electron spin resonance, based on the g-factor and hyperfine coupling constants. The radicals formed from urea and urea-d 4 were identified as nitrogen-centered and resulted from N-H bond dissociation. The radicals produced from 1,3-dimethylurea, 1,3-diethylurea and 1,1',3,3'-tetramethylurea were identified as carbon-centered and resulted from C-H bond cleavage. The electron spin resonance signals of 1,3-dimethylurea, 1,3-diethylurea and 1,1',3,3'-tetramethylurea are similar in both the powder and D 2 O solution. The radicals observed from 1,3-dimethylurea, 1,3-diethylurea and 1,1',3,3'-tetramethylurea were identified as . NH-CH 2 , . NH-CHCH 3 and . (CH 3 )(CH 2 ), respectively. (author)

  20. 13 CFR 107.820 - Financings in the form of guarantees.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Financings in the form of... BUSINESS INVESTMENT COMPANIES Financing of Small Businesses by Licensees Structuring Licensee's Financing of Eligible Small Businesses: Types of Financing § 107.820 Financings in the form of guarantees. At...

  1. 13 CFR 108.820 - Financings in the form of guarantees.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Financings in the form of... VENTURE CAPITAL (âNMVCâ) PROGRAM Financing of Small Businesses by NMVC Companies Structuring Nmvc Company's Financing of Eligible Small Businesses § 108.820 Financings in the form of guarantees. (a) General...

  2. Asymptotics of Heavy-Meson Form Factors

    CERN Document Server

    Grozin, A.G.; Grozin, Andrey G.; Neubert, Matthias

    1997-01-01

    Using methods developed for hard exclusive QCD processes, we calculate the asymptotic behaviour of heavy-meson form factors at large recoil. It is determined by the leading- and subleading-twist meson wave functions. For $1\\ll |v\\cdot v'|\\ll m_Q/\\Lambda$, the form factors are dominated by the Isgur--Wise function, which is determined by the interference between the wave functions of leading and subleading twist. At $|v\\cdot v'|\\gg m_Q/\\Lambda$, they are dominated by two functions arising at order $1/m_Q$ in the heavy-quark expansion, which are determined by the leading-twist wave function alone. The sum of these contributions describes the form factors in the whole region $|v\\cdot v'|\\gg 1$. As a consequence, there is an exact zero in the form factor for the scattering of longitudinally polarized $B^*$ mesons at some value $v\\cdot v'\\sim m_b/\\Lambda$, and an approximate zero in the form factor of $B$ mesons in the timelike region ($v\\cdot v'\\sim -m_b/\\Lambda$). We obtain the evolution equations and sum rules ...

  3. Disconnected electromagnetic form factors

    International Nuclear Information System (INIS)

    Wilcox, Walter

    2001-01-01

    Preliminary results of a calculation of disconnected nucleon electromagnetic factors factors on the lattice are presented. The implementation of the numerical subtraction scheme is outlined. A comparison of results for electric and magnetic disconnected form factors on two lattice sizes with those of the Kentucky group is presented. Unlike previous results, the results found in this calculation are consistent with zero in these sectors

  4. 13 CFR 107.810 - Financings in the form of Loans.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Financings in the form of Loans... INVESTMENT COMPANIES Financing of Small Businesses by Licensees Structuring Licensee's Financing of Eligible Small Businesses: Types of Financing § 107.810 Financings in the form of Loans. You may make Loans to...

  5. Microstructures and Dehydrogenation Properties of Ball-milled MgH2-K2Ti6O13-Ni Composite Systems

    Directory of Open Access Journals (Sweden)

    ZHANG Jian

    2016-11-01

    Full Text Available The K2Ti6O13 whisker separate-doped and K2Ti6O13 whisker and Ni powder multi-doped MgH2 hydrogen storage composite systems were prepared by mechanical milling method. The microstructures and dehydrogenation properties of the prepared samples were characterized by some testing methods such as X-ray diffraction (XRD, scanning electron microscope (SEM and differential scanning calorimeter (DSC. The results show that the K2Ti6O13 whisker not only plays the roles in refining the MgH2 crystalline grain, but also inhibit the agglomeration of MgH2 particles in K2Ti6O13 whisker separate-doped system, which results in the decreased dehydrogenation temperature of MgH2 matrix. When the mass ratio of K2Ti6O13 to MgH2 is 3:7, the improvement effect on dehydrogenation properties of MgH2 is the most remarkable. As compared with pure ball-milled MgH2, the dehydrogenation temperature of MgH2 in K2Ti6O13 whisker separate-doped system is decreased by nearly 75℃. For K2Ti6O13 whisker and Ni powder multi-dopedsystem, the dehydrogenation temperature of MgH2 matrix is further decreased compared to K2Ti6O13 whisker separate-doped one due to the dual effects of refined MgH2 crystalline grain by K2Ti6O13 whisker and destabilized MgH2 lattice by Ni solution. As compared with pure ball-milled MgH2, the dehydrogenation temperature of MgH2 in K2Ti6O13 whisker and Ni powder multi-doped system is decreased by nearly 87℃.

  6. Amplitudes and exchange mechanisms for K*(890) and K*(1420) production. [Exchange degenerate Regge poles, 13 GeV/c, nonevasive cuts

    Energy Technology Data Exchange (ETDEWEB)

    Estabrooks, P; Martin, A D [Durham Univ. (UK); Brandenburg, G W; Carnegie, R K; Cashmore, R J; Davier, M; Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S.; Matthews, J A.J.

    1976-02-16

    The anti K*(890) and antiK*(1420) production amplitudes are determined using data on the reaction K/sup -/p..-->..K/sup -/..pi../sup +/n at 13 GeV/c. The energy dependence of anti K*(890) production is investigated by using in addition the corresponding data at 4 GeV/c. A simple model, based on exchange degenerate Regge poles together with non-evasive 'cut' contributions is found to provide a good description of all features of the data.

  7. Synthesis and characterization of MoO3 films by acid hydrolysis of K2Mo4O13

    International Nuclear Information System (INIS)

    Hernan, L.; Morales, J.

    1989-01-01

    The behaviour of K 2 Mo 4 O 13 heated under reflux in an acid medium has been studied. A metastable polymorphic MoO 3 phase crystallizing in the hexagonal system was obtained. Lengthy treatment led to the formation of orthorhombic MoO 3 with the (010) planes perfectly oriented parallel to the substrate. SEM images do not support a topotactic mechanism for the successive transformations. The reactions involved probably take place through the polymerization of discrete units formed in the bulk solution

  8. Magnetic form factors of the trinucleons

    Energy Technology Data Exchange (ETDEWEB)

    Schiavilla, R; Pandharipande, V R; Riska, Dan-Olof

    1989-11-01

    The magnetic form factors of 3H and 3He are calculated with the Monte Carlo method from variational ground-state wave functions obtained for the Argonne and Urbana two- and three-nucleon interactions. The electromagnetic current operator contains one- and two-body terms that are constructed so as to satisfy the continuity equation with the two-nucleon potential in the Hamiltonian. The results obtained with the Argonne two-nucleon interaction are in overall agreement with the empirical values. It appears that the remaining theoretical uncertainty, in the calculation of these form factors from a given interaction model, is dominated by that in the electromagnetic form factors of the nucleon. It is found that the isovector magnetic form factors are rather sensitive to the details of the isospin-dependent tensor force, and they are much better reproduced with the Argonne than the Urbana potential. The isoscalar magnetic form factors appear to be sensitive to the spin-orbit interactions, and are better reproduced with the Urbana potential. The Argonne potential has a stronger τ1∙τ2 tensor force, while the Urbana one has a shorter-range spin-orbit interaction.

  9. Measurement of the pion form factor

    International Nuclear Information System (INIS)

    Dally, E.; Hauptman, J.; May, C.

    1977-01-01

    The pion form factor has been measured in the momentum transfer range of 0.03( 2 by scattering pions from atomic electrons in a liquid hydrogen target. The pion form factor is defined to be the elastic scattering cross section divided by that predicted for a point pion. The experiment has been performed in a 100 GeV/c negative pion beam incident on a 50 cm liquid hydrogen target at Fermi laboratory. The corrected form factor equals 0.33+-0.06 f 2 . Vector dominance predicts 0.40 f 2

  10. Spread of artemisinin-resistant Plasmodium falciparum in Myanmar: a cross-sectional survey of the K13 molecular marker.

    Science.gov (United States)

    Tun, Kyaw M; Imwong, Mallika; Lwin, Khin M; Win, Aye A; Hlaing, Tin M; Hlaing, Thaung; Lin, Khin; Kyaw, Myat P; Plewes, Katherine; Faiz, M Abul; Dhorda, Mehul; Cheah, Phaik Yeong; Pukrittayakamee, Sasithon; Ashley, Elizabeth A; Anderson, Tim J C; Nair, Shalini; McDew-White, Marina; Flegg, Jennifer A; Grist, Eric P M; Guerin, Philippe; Maude, Richard J; Smithuis, Frank; Dondorp, Arjen M; Day, Nicholas P J; Nosten, François; White, Nicholas J; Woodrow, Charles J

    2015-04-01

    Emergence of artemisinin resistance in southeast Asia poses a serious threat to the global control of Plasmodium falciparum malaria. Discovery of the K13 marker has transformed approaches to the monitoring of artemisinin resistance, allowing introduction of molecular surveillance in remote areas through analysis of DNA. We aimed to assess the spread of artemisinin-resistant P falciparum in Myanmar by determining the relative prevalence of P falciparum parasites carrying K13-propeller mutations. We did this cross-sectional survey at malaria treatment centres at 55 sites in ten administrative regions in Myanmar, and in relevant border regions in Thailand and Bangladesh, between January, 2013, and September, 2014. K13 sequences from P falciparum infections were obtained mainly by passive case detection. We entered data into two geostatistical models to produce predictive maps of the estimated prevalence of mutations of the K13 propeller region across Myanmar. Overall, 371 (39%) of 940 samples carried a K13-propeller mutation. We recorded 26 different mutations, including nine mutations not described previously in southeast Asia. In seven (70%) of the ten administrative regions of Myanmar, the combined K13-mutation prevalence was more than 20%. Geospatial mapping showed that the overall prevalence of K13 mutations exceeded 10% in much of the east and north of the country. In Homalin, Sagaing Region, 25 km from the Indian border, 21 (47%) of 45 parasite samples carried K13-propeller mutations. Artemisinin resistance extends across much of Myanmar. We recorded P falciparum parasites carrying K13-propeller mutations at high prevalence next to the northwestern border with India. Appropriate therapeutic regimens should be tested urgently and implemented comprehensively if spread of artemisinin resistance to other regions is to be avoided. Wellcome Trust-Mahidol University-Oxford Tropical Medicine Research Programme and the Bill & Melinda Gates Foundation. Copyright © 2015

  11. Charge-symmetry-breaking nucleon form factors

    International Nuclear Information System (INIS)

    Kubis, Bastian

    2011-01-01

    A quantitative understanding of charge-symmetry breaking is an increasingly important ingredient for the extraction of the nucleon’s strange vector form factors. We review the theoretical understanding of the charge-symmetry-breaking form factors, both for single nucleons and for 4 He.

  12. Study of K/sup -/p. -->. anti K*(890)n at 13GeV. [Differential cross sections, density matrix elements

    Energy Technology Data Exchange (ETDEWEB)

    Brandenburg, G W; Dunwoodie, W M; Lasinski, T A; Leith, D W.G.S.; Williams, S H [Stanford Linear Accelerator Center, Calif. (USA); Carnegie, R K [Carleton Univ., Ottawa, Ontario (Canada). Dept. of Physics; Cashmore, R J [Oxford Univ. (UK). Dept. of Physics; Davier, M [Lab. de l' Accelerateur Lineaire, Orsay, France; Matthews, J A.J. [Michigan State Univ., East Lansing (USA). Dept. of Physics; Walden, P [British Columbia Univ., Vancouver (Canada). TRIUMF Facility

    1975-11-24

    The results of a wire chamber spectrometer experiment studying anti K*(890) production in the reaction K/sup -/p..-->..K/sup -/..pi../sup +/n at 13 GeV are presented. Strong forward structure is observed for mod(t)..rho/sup 0/n data and are characteristic of ..pi.. exchange. In contrast in the intermediate, mod(t)approximately 0.2 GeV/sup 2/, and large momentum transfer regions anti K*(890) production is dominated by the natural parity rho-A/sub 2/ exchange contribution.

  13. Interpolation of Gamma-ray buildup Factors for Arbitrary Source Energies in the Vicinity of the K-edge

    International Nuclear Information System (INIS)

    Michieli, I.

    1998-01-01

    Recently, a new buildup factors approximation formula based on the expanded polynomial set (E-P function) was successfully introduced (Michieli 1994.) with the maximum approximation error below 4% throughout the standard data domain. Buildup factors interpolation in E-P function parameters for arbitrary source energies, near the K-edge in lead, was satisfactory. Maximum interpolation error, for lead, lays within 12% what appears to be acceptable for most Point Kernel application. 1991. Harima at. al., showed that, near the K-edge, fluctuation in energy of exposure rate attenuation factors i.e.: D(E)B(E, μ E r)exp(-μ E r), given as a function of penetration depth (r) in ordinary length units (not mfps.), is not nearly as great as that of buildup factors. That phenomenon leads to the recommendation (ANSI/ANS-6.4.3) that interpolations in that energy range should be made in the attenuation factors B(E, μ E r)exp(-μ E r) rather than in the buildup factors alone. In present article, such interpolation approach is investigated by applying it to the attenuation factors in lead, with E-P function representation of exposure buildup factors. Simple form of the E-P function leads to strait calculation of new function parameters for arbitrary source energy near the K-edge and thus allowing the same representation form of buildup factors as in the standard interpolation procedure. results of the interpolation are discussed and compared with those from standard approach. (author)

  14. K13 mutations and pfmdr1 copy number variation in Plasmodium falciparum malaria in Myanmar.

    Science.gov (United States)

    Win, Aye A; Imwong, Mallika; Kyaw, Myat P; Woodrow, Charles J; Chotivanich, Kesinee; Hanboonkunupakarn, Borimas; Pukrittayakamee, Sasithon

    2016-02-24

    Artemisinin-based combination therapy has been first-line treatment for falciparum malaria in Myanmar since 2005. The wide extent of artemisinin resistance in the Greater Mekong sub-region and the presence of mefloquine resistance at the Myanmar-Thailand border raise concerns over resistance patterns in Myanmar. The availability of molecular markers for resistance to both drugs enables assessment even in remote malaria-endemic areas. A total of 250 dried blood spot samples collected from patients with Plasmodium falciparum malarial infection in five malaria-endemic areas across Myanmar were analysed for kelch 13 sequence (k13) and pfmdr1 copy number variation. K13 mutations in the region corresponding to amino acids 210-726 (including the propeller region of the protein) were detected by nested PCR amplification and sequencing, and pfmdr1 copy number variation by real-time PCR. In two sites, a sub-set of patients were prospectively followed up for assessment of day-3 parasite clearance rates after a standard course of artemether-lumefantrine. K13 mutations and pfmdr1 amplification were successfully analysed in 206 and 218 samples, respectively. Sixty-nine isolates (33.5 %) had mutations within the k13 propeller region with 53 of these (76.8 %) having mutations already known to be associated with artemisinin resistance. F446I (32 isolates) and P574L (15 isolates) were the most common examples. K13 mutation was less common in sites in western border regions (29 of 155 isolates) compared to samples from the east and north (40 of 51 isolates; p Myanmar. There is a low prevalence of parasites with multiple pfmdr1 copies across the country. The efficacy of artemisinin-based combination therapy containing mefloquine and lumefantrine is, therefore, expected to be high, although regular monitoring of efficacy will be important.

  15. Charge-symmetry-breaking nucleon form factors

    Energy Technology Data Exchange (ETDEWEB)

    Kubis, Bastian, E-mail: kubis@hiskp.uni-bonn.de [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik (Theorie) and Bethe Center for Theoretical Physics (Germany)

    2011-11-15

    A quantitative understanding of charge-symmetry breaking is an increasingly important ingredient for the extraction of the nucleon's strange vector form factors. We review the theoretical understanding of the charge-symmetry-breaking form factors, both for single nucleons and for {sup 4}He.

  16. Spatial patterns of leaf δ13C and its relationship with plant functional groups and environmental factors in China

    Science.gov (United States)

    Li, Mingxu; Peng, Changhui; Wang, Meng; Yang, Yanzheng; Zhang, Kerou; Li, Peng; Yang, Yan; Ni, Jian; Zhu, Qiuan

    2017-07-01

    The leaf carbon isotope ratio (δ13C) is a useful parameter for predicting a plant's water use efficiency, as an indicator for plant classification, and even in the reconstruction of paleoclimatic environments. In this study, we investigated the spatial pattern of leaf δ13C values and its relationship with plant functional groups and environmental factors throughout China. The high leaf δ13C in the database appeared in central and western China, and the averaged leaf δ13C was -27.15‰, with a range from -21.05‰ to -31.5‰. The order of the averaged δ13C for plant life forms from most positive to most negative was subshrubs > herbs = shrubs > trees > subtrees. Leaf δ13C is also influenced by some environmental factors, such as mean annual precipitation, relative humidity, mean annual temperature, solar hours, and altitude, although the overall influences are still relatively weak, in particular the influence of MAT and altitude. And we further found that plant functional types are dominant factors that regulate the magnitude of leaf δ13C for an individual site, whereas environmental conditions are key to understanding spatial patterns of leaf δ13C when we consider China as a whole. Ultimately, we conducted a multiple regression model of leaf δ13C with environmental factors and mapped the spatial distribution of leaf δ13C in China by using this model. However, this partial least squares model overestimated leaf δ13C for most life forms, especially for deciduous trees, evergreen shrubs, and subtrees, and thus need more improvement in the future.

  17. Calculation of nucleon electromagnetic form factors

    International Nuclear Information System (INIS)

    Renner, D.B.; Brower, R.; Dolgov, D.; Eicker, N.; Lippert, Th.; Negele, J.W.; Pochinsky, A.; Schilling, K.

    2003-01-01

    The formalism is developed to express nucleon matrix elements of the electromagnetic current in terms of form factors consistent with the translational, rotational, and parity symmetries of a cubic lattice. We calculate the number of these form factors and show how appropriate linear combinations approach the continuum limit

  18. Apelin-13 upregulates Egr-1 expression in rat vascular smooth muscle cells through the PI3K/Akt and PKC signaling pathways

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Qi-Feng [Department of Cardiology, The First Affiliated Hospital of Liaoning Medical University, Jinzhou 121001 (China); Yu, Hong-Wei [Department of Cardiology, Jinzhou Central Hospital, Jinzhou 121001 (China); Sun, Li-Li [Department of Ophthalmology, The Third Affiliated Hospital of Liaoning Medical University, Jinzhou 121001 (China); You, Lu; Tao, Gui-Zhou [Department of Cardiology, The First Affiliated Hospital of Liaoning Medical University, Jinzhou 121001 (China); Qu, Bao-Ze, E-mail: qubaoze1971@hotmail.com [Department of Cardiology, The First Affiliated Hospital of Liaoning Medical University, Jinzhou 121001 (China)

    2015-12-25

    Previous studies have shown that Apelin-13 upregulates early growth response factor-1 (Egr-1) via the extracellular signal-regulated protein kinase (ERK) signaling pathway. Apelin-13 induces proliferation and migration of vascular smooth muscle cells (VSMCs) as well as the upregulation of osteopontin (OPN) via the upregulation of Egr-1. This study was designed to further explore the activity of Apelin-13 in VSMCs by investigating members of the mitogen-activated protein kinase (MAPK) family, in particular Jun kinase (JNK) and p38 mitogen-activated protein kinase (P38). We also examined whether the phosphatidylinositol 3 kinase (PI3K)/protein kinase B (Akt) and protein kinase C (PKC) signaling pathways were involved in the regulation of Egr-1 by Apelin-13. We treated rat aortic VSMCs with Apelin-13 and examined the expression of JNK, p-JNK, P38, and p-P38 to investigate whether Apelin-13-mediated increases in Egr-1 occurred through the JNK and P38 signaling pathways. We then pretreated VSMCs with the Gi protein inhibitor pertussis toxin (PTX) and the Gq inhibitor YM254890, added Apelin-13 and looked for changes in Egr-1 expression. Finally, we pretreated with the PI3K inhibitor LY294002 and the PKC inhibitor GF109203X, and treated with Apelin-13. Our results showed that JNK and P38 did not participate in Apelin-13-mediated increase in Egr-1. Instead, Apelin-13 upregulation of Egr-1 was mediated by a PTX-sensitive Gi protein. Apelin-13 did increase ERK phosphorylation through the PI3K/Akt and PKC signaling pathways, resulting in changes in Egr-1 expression. These data provide important targets for future studies to modulate vascular remodeling. - Highlights: • Apelin-13 mediates Egr-1 upregulation in vascular smooth muscle cells via ERK1/2. • The underlying mechanisms are unknown, but exclude Jnk or p38 pathway activation. • Apelin-13 binds to Gi, activating the PI3K/Akt and PKC signaling cascades. • Consequent ERK phosphorylation results in increased Egr-1

  19. Apelin-13 upregulates Egr-1 expression in rat vascular smooth muscle cells through the PI3K/Akt and PKC signaling pathways

    International Nuclear Information System (INIS)

    Liu, Qi-Feng; Yu, Hong-Wei; Sun, Li-Li; You, Lu; Tao, Gui-Zhou; Qu, Bao-Ze

    2015-01-01

    Previous studies have shown that Apelin-13 upregulates early growth response factor-1 (Egr-1) via the extracellular signal-regulated protein kinase (ERK) signaling pathway. Apelin-13 induces proliferation and migration of vascular smooth muscle cells (VSMCs) as well as the upregulation of osteopontin (OPN) via the upregulation of Egr-1. This study was designed to further explore the activity of Apelin-13 in VSMCs by investigating members of the mitogen-activated protein kinase (MAPK) family, in particular Jun kinase (JNK) and p38 mitogen-activated protein kinase (P38). We also examined whether the phosphatidylinositol 3 kinase (PI3K)/protein kinase B (Akt) and protein kinase C (PKC) signaling pathways were involved in the regulation of Egr-1 by Apelin-13. We treated rat aortic VSMCs with Apelin-13 and examined the expression of JNK, p-JNK, P38, and p-P38 to investigate whether Apelin-13-mediated increases in Egr-1 occurred through the JNK and P38 signaling pathways. We then pretreated VSMCs with the Gi protein inhibitor pertussis toxin (PTX) and the Gq inhibitor YM254890, added Apelin-13 and looked for changes in Egr-1 expression. Finally, we pretreated with the PI3K inhibitor LY294002 and the PKC inhibitor GF109203X, and treated with Apelin-13. Our results showed that JNK and P38 did not participate in Apelin-13-mediated increase in Egr-1. Instead, Apelin-13 upregulation of Egr-1 was mediated by a PTX-sensitive Gi protein. Apelin-13 did increase ERK phosphorylation through the PI3K/Akt and PKC signaling pathways, resulting in changes in Egr-1 expression. These data provide important targets for future studies to modulate vascular remodeling. - Highlights: • Apelin-13 mediates Egr-1 upregulation in vascular smooth muscle cells via ERK1/2. • The underlying mechanisms are unknown, but exclude Jnk or p38 pathway activation. • Apelin-13 binds to Gi, activating the PI3K/Akt and PKC signaling cascades. • Consequent ERK phosphorylation results in increased Egr-1

  20. 13C, 15N Resonance Assignment of Parts of the HET-s Prion Protein in its Amyloid Form

    International Nuclear Information System (INIS)

    Siemer, Ansgar B.; Ritter, Christiane; Steinmetz, Michel O.; Ernst, Matthias; Riek, Roland; Meier, Beat H.

    2006-01-01

    The partial 15 N and 13 C solid-state NMR resonance assignment of the HET-s prion protein fragment 218-289 in its amyloid form is presented. It is based on experiments measured at MAS frequencies in the range of 20-40 kHz using exclusively adiabatic polarization-transfer schemes. The resonance assignment within each residue is based on two-dimensional 13 C-- 13 C correlation spectra utilizing the DREAM mixing scheme. The sequential linking of the assigned residues used a set of two- and three-dimensional 15 N-- 13 C correlation experiments. Almost all cross peaks visible in the spectra are assigned, but only resonances from 43 of the 78 amino-acid residues could be detected. The missing residues are thought to be highly disordered and/or highly dynamic giving rise to broad resonance lines that escaped detection in the experiments applied. The line widths of the observed resonances are narrow and comparable to line widths observed in micro-crystalline samples. The 43 assigned residues are located in two fragments of about 20 residues

  1. Series Production of 13 kA Current Leads with Dry and Compact Warm Terminals

    CERN Document Server

    Andersen, T P; Vullierme, B

    2005-01-01

    For the LHC magnet test benches 13 pairs of conventional helium vapour-cooled 13 kA current leads are required. The current leads have been designed and built by industry. Attention was given to economical and reliable design and to a design of the warm terminal in order to avoid any condensation. Three pairs of them were tested at CERN. The dry warm terminal enables voltage test at 4.1 kV at cold condition. The paper describes construction details and compares calculated and measured values of the main parameters.

  2. Electromagnetic form factors in the light-front dynamics

    International Nuclear Information System (INIS)

    Karmanov, V.A.; Smirnov, A.V.

    1992-01-01

    It is shown that the electromagnetic vertex of a nucleus (and of any bound system), expressed through the wave function in the light-front dynamics at relativistic values of momentum transfer, contains a contribution of nonphysical form factors which increases the total number of invariant form factors (for the deuteron from 3 up to 11). This fact explains an ambiguity in the form factors calculated previously. The physical and nonphysical form factors are covariantly separated. Explicit expressions for physical form factors of systems with spin 0, 1/2 and 1 through the vertex functions are obtained. (orig.)

  3. 13 CFR 107.815 - Financings in the form of Debt Securities.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Financings in the form of Debt... BUSINESS INVESTMENT COMPANIES Financing of Small Businesses by Licensees Structuring Licensee's Financing of Eligible Small Businesses: Types of Financing § 107.815 Financings in the form of Debt Securities...

  4. Development of Highly Selective Kv1.3-Blocking Peptides Based on the Sea Anemone Peptide ShK

    Directory of Open Access Journals (Sweden)

    Michael W. Pennington

    2015-01-01

    Full Text Available ShK, from the sea anemone Stichodactyla helianthus, is a 35-residue disulfide-rich peptide that blocks the voltage-gated potassium channel Kv1.3 at ca. 10 pM and the related channel Kv1.1 at ca. 16 pM. We developed an analog of this peptide, ShK-186, which is currently in Phase 1b-2a clinical trials for the treatment of autoimmune diseases such as multiple sclerosis and rheumatoid arthritis. While ShK-186 displays a >100-fold improvement in selectivity for Kv1.3 over Kv1.1 compared with ShK, there is considerable interest in developing peptides with an even greater selectivity ratio. In this report, we describe several variants of ShK that incorporate p-phophono-phenylalanine at the N-terminus coupled with internal substitutions at Gln16 and Met21. In addition, we also explored the combinatorial effects of these internal substitutions with an alanine extension at the C-terminus. Their selectivity was determined by patch-clamp electrophysiology on Kv1.3 and Kv1.1 channels stably expressed in mouse fibroblasts. The peptides with an alanine extension blocked Kv1.3 at low pM concentrations and exhibited up to 2250-fold selectivity for Kv1.3 over Kv1.1. Analogs that incorporates p-phosphono-phenylalanine at the N-terminus blocked Kv1.3 with IC50s in the low pM range and did not affect Kv1.1 at concentrations up to 100 nM, displaying a selectivity enhancement of >10,000-fold for Kv1.3 over Kv1.1. Other potentially important Kv channels such as Kv1.4 and Kv1.6 were only partially blocked at 100 nM concentrations of each of the ShK analogs.

  5. Nucleon Form Factors Using Spin Degrees of Freedom

    International Nuclear Information System (INIS)

    Jones, Mark

    2002-01-01

    An overview of recent measurements of the neutron and proton electromagnetic form factors from double polarization experiments. Spin observables are sensitive to the product of nucleon form factor which allows access to the small nucleon electric form factors

  6. 13 CFR 108.800 - Financings in the form of equity interests.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Financings in the form of equity... VENTURE CAPITAL (âNMVCâ) PROGRAM Financing of Small Businesses by NMVC Companies Structuring Nmvc Company's Financing of Eligible Small Businesses § 108.800 Financings in the form of equity interests. You...

  7. Baryon electromagnetic form factors at BESIII

    Directory of Open Access Journals (Sweden)

    Dbeyssi Alaa

    2017-01-01

    Full Text Available Electromagnetic form factors are fundamental quantities which parameterize the electric and magnetic structure of hadrons. This contribution reports on the measurements of baryon electromagnetic form factors at the BESIII experiment in Beijing. The Beijing e+e− collider BEPCII is a double-ring symmetric collider running at √s between 2.0 and 4.6 GeV. Baryon electromagnetic form factors can be measured at BESIII in direct e+e−-annihilation and in initial state radiation processes. Based on the data collected by the BESIII detector at 12 center of mass energies between 2.23 and 3.67 GeV, the e+e− → p̄p cross section and the time-like proton form factor is measured. Preliminary results from the analysis of the initial state radiation process e+e− → p̄pγ using a data set of 7.408 fb−1 collected at center-of-mass energies between 3.773 and 4.6 GeV, are also presented. The cross section for e+e−→Λ¯Λ${e^ + }{e^ - } \\to \\bar \\Lambda \\Lambda $ is measured based on 40.5 pb−1 data collected at 4 energy points from the threshold up to 3.08 GeV. Preliminary results on the total cross section and the Λ effective form factor are shown. Ongoing analysis based on the high luminosity energy scan from 2015 and from radiative return at different √s are also described.

  8. On form factors of boundary changing operators

    Energy Technology Data Exchange (ETDEWEB)

    Bajnok, Z., E-mail: bajnok.zoltan@wigner.mta.hu [MTA Lendület Holographic QFT Group, Wigner Research Centre for Physics, P.O.B. 49, H-1525 Budapest 114 (Hungary); Hollo, L., E-mail: hollo.laszlo@wigner.mta.hu [MTA Lendület Holographic QFT Group, Wigner Research Centre for Physics, P.O.B. 49, H-1525 Budapest 114 (Hungary); Laboratoire de Physique Théorique, École Normale Supérieure, 24, rue Lhomond, 75005 Paris (France)

    2016-04-15

    We develop a form factor bootstrap program to determine the matrix elements of local, boundary condition changing operators. We propose axioms for these form factors and determine their solutions in the free boson and Lee–Yang models. The sudden change in the boundary condition, caused by an operator insertion, can be interpreted as a local quench and the form factors provide the overlap of any state before the quench with any outgoing state after the quench.

  9. Electromagnetic form factors of a massive neutrino

    International Nuclear Information System (INIS)

    Dvornikov, M.S.; Studenikin, A.I.

    2004-01-01

    Electromagnetic form factors of a massive neutrino are studied in a minimally extended standard model in an arbitrary R ξ gauge and taking into account the dependence on the masses of all interacting particles. The contribution from all Feynman diagrams to the electric, magnetic, and anapole form factors, in which the dependence of the masses of all particles as well as on gauge parameters is accounted for exactly, are obtained for the first time in explicit form. The asymptotic behavior of the magnetic form factor for large negative squares of the momentum of an external photon is analyzed and the expression for the anapole moment of a massive neutrino is derived. The results are generalized to the case of mixing between various flavors of the neutrino. Explicit expressions are obtained for the electric, magnetic, and electric dipole and anapole transitional form factors as well as for the transitional electric dipole moment

  10. Involvement of Clostridium botulinum ATCC 3502 sigma factor K in early-stage sporulation.

    Science.gov (United States)

    Kirk, David G; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu; Lindström, Miia

    2012-07-01

    A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σ(K) is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods.

  11. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    Science.gov (United States)

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  12. Hadronic form factors in kaon photoproduction

    Energy Technology Data Exchange (ETDEWEB)

    Syukurilla, L., E-mail: tmart@fisika.ui.ac.id; Mart, T., E-mail: tmart@fisika.ui.ac.id [Department Fisika, FMIPA, Universitas Indonesia, Depok, 164242 (Indonesia)

    2014-09-25

    We have revisited the effect of hadronic form factors in kaon photoproduction process by utilizing an isobaric model developed for kaon photoproduction off the proton. The model is able to reproduce the available experimental data nicely as well as to reveal the origin of the second peak in the total cross section, which was the main source of confusion for decades. Different from our previous study, in the present work we explore the possibility of using different hadronic form factors in each of the KΛN vertices. The use of different hadronic form factors, e.g. dipole, Gaussian, and generalized dipole, has been found to produce a more flexible isobar model, which can provide a significant improvement in the model.

  13. Processing of high-molecular-weight form adrenocorticotropin in human adrenocorticotropin-secreting tumor cell line (DMS-79) after transfection of prohormone convertase 1/3 gene.

    Science.gov (United States)

    Tateno, T; Kato, M; Tani, Y; Yoshimoto, T; Oki, Y; Hirata, Y

    2010-02-01

    Ectopic ACTH-producing tumors preferentially secrete biologically inactive ACTH precursors and ACTH-related fragments. DMS-79 is known to secrete unprocessed high-molecular-weight (HMW) form ACTH. To determine whether prohormone convertase (PC) 1/3 is involved in the abnormal processing of proopiomelanocortin (POMC), we studied whether PC1/3 and 2 genes are expressed in DMS-79, and whether overexpression of PC1/3 gene affects POMC processing pattern. Steady-state mRNA levels of PC1/3 and 2 were determined by real-time RT-PCR. Molecular weights of ACTH-related peptides were determined by chromatographical analyses coupled with ACTH and beta-endorphin (beta-END) radioimmunoassays. PC1/3 gene was transfected into DMS-79 by retrovirus transduction using pMX-IP vector encoding PC1/3 cDNA. The steady-state mRNA levels of PC1/3 and 2 in DMS-79 were lower than those in ACTH-secreting and nonfunctioning pituitary tumors. DMS-79 predominantly secreted HMW form with both ACTH and beta-END immunoreactivities by size-exclusion chromatography. After purification by immunoaffinity chromatography with anti-ACTH antibody, the apparent molecular weight of HMW form ACTH was estimated to be 16 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis with silver staining. After retroviral transfection of PC1/3 cDNA into DMS-79 and puromycin selection, PC1/3 stably-expressing cell line (DMS-79T) secreted two immunoreactive ACTH components, a major one coeluting with ACTH(1-39) and a minor one as a HMW form as well as two beta- END immunoreactive components coeluting with beta-lipotropic hormone and beta-END, respectively. Thus, we have established PC1/3 stably-expressing cell line (DMS-79T) capable of proteolytically processing ACTH precursor molecule(s) into mature ACTH and beta-END.

  14. The pion form factor from first principles

    International Nuclear Information System (INIS)

    Heide, J. van der

    2004-01-01

    We calculate the electromagnetic form factor of the pion in quenched lattice QCD. The non-perturbatively improved Sheikoleslami-Wohlert lattice action is used together with the O(a) improved current. We calculate form factor for pion masses down to mπ = 380 MeV. We compare the mean square radius for the pion extracted from our form factors to the value obtained from the 'Bethe Salpeter amplitude'. Using (quenched) chiral perturbation theory, we extrapolate our results towards the physical pion mass

  15. Zeros in the electromagnetic and hadronic form factors

    International Nuclear Information System (INIS)

    Martini, A.F.; Menon, M.J.; Montanha, J.

    2004-01-01

    We discuss the evidences for the existence of zeros in the electric and in the hadronic form factors of the proton. We show that the shape of both form factors are similar, but there is indication that the hadronic form factors can depend on the energy. (author)

  16. 17 CFR 249.325 - Form 13F, report of institutional investment manager pursuant to section 13(f) of the Securities...

    Science.gov (United States)

    2010-04-01

    ... institutional investment manager pursuant to section 13(f) of the Securities Exchange Act of 1934. 249.325... manager pursuant to section 13(f) of the Securities Exchange Act of 1934. This form shall be used by institutional investment managers which are required to furnish reports pursuant to section 13(f) of the...

  17. Meson Form Factors and Deep Exclusive Meson Production Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Horn, Tanja [The Catholic Univ. of America, Washington, DC (United States); Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2017-05-01

    Pion and kaon electroproduction data play a unique role in Nature and our understanding of them is essential for explaining hadron structure. Precision longitudinaltransverse separated pion and kaon cross sections are of particular interest. They allow for the extraction of meson form factors and validation of understanding of hard exclusive and semi-inclusive reactions (π+, K+, π0, γ) towards 3D hadron imaging and potential future flavor decomposition. We review recent data and present prospects for deep exclusive pion and kaon electroproduction at the 12 GeV Jefferson Lab including the prospects to use projected charged- and neutral pion data to further determine the spin, charge-parity and flavor of GPDs, including the helicity-flip GPDs.

  18. ON THE MEASUREMENT OF THE 13C(α, n)16O S-FACTOR AT NEGATIVE ENERGIES AND ITS INFLUENCE ON THE s-PROCESS

    International Nuclear Information System (INIS)

    La Cognata, M.; Spitaleri, C.; Trippella, O.; Kiss, G. G.; Guardo, G. L.; Puglia, S. M. R.; Romano, S.; Spartà, R.; Rogachev, G. V.; Avila, M.; Koshchiy, E.; Kuchera, A.; Santiago, D.; Mukhamedzhanov, A. M.; Lamia, L.

    2013-01-01

    The 13 C(α, n) 16 O reaction is the neutron source for the main component of the s-process, responsible for the production of most of the nuclei in the mass range 90 ∼ 8 K, corresponding to an energy interval where the 13 C(α, n) 16 O reaction is effective in the range of 140-230 keV. In this regime, the astrophysical S(E)-factor is dominated by the –3 keV sub-threshold resonance due to the 6.356 MeV level in 17 O, giving rise to a steep increase in the S-factor. Its contribution is still controversial as extrapolations, e.g., through the R-matrix and indirect techniques such as the asymptotic normalization coefficient (ANC), yield inconsistent results. The discrepancy amounts to a factor of three or more precisely at astrophysical energies. To provide a more accurate S-factor at these energies, we have applied the Trojan horse method (THM) to the 13 C( 6 Li, n 16 O)d quasi-free reaction. The ANC for the 6.356 MeV level has been deduced through the THM as well as the n-partial width, allowing us to attain unprecedented accuracy for the 13 C(α, n) 16 O astrophysical factor. A larger ANC for the 6.356 MeV level is measured with respect to the ones in the literature, (C-tilde α 13 C 17O(1/2+)2 = 7.7 ± 0.3 stat -1.5 +1. |6 norm fm –1 , yet in agreement with the preliminary result given in our preceding letter, indicating an increase of the 13 C(α, n) 16 O reaction rate below about 8 × 10 7 K if compared with the recommended values. At ∼10 8 K, our reaction rate agrees with most of the results in the literature and the accuracy is greatly enhanced thanks to this innovative approach

  19. Muscle K+, Na+, and Cl- disturbances and Na+-K+ pump inactivation: implications for fatigue

    DEFF Research Database (Denmark)

    McKenna, Michael J; Bangsbo, Jens; Renaud, Jean-Marc

    2008-01-01

    (+)-ATPase activity during exercise stabilizes Na(+) and K(+) concentration gradients and membrane excitability and thus protects against fatigue. However, during intense contraction some Na(+)-K(+) pumps are inactivated and together with further ionic disturbances, likely precipitate muscle fatigue.......Membrane excitability is a critical regulatory step in skeletal muscle contraction and is modulated by local ionic concentrations, conductances, ion transporter activities, temperature, and humoral factors. Intense fatiguing contractions induce cellular K(+) efflux and Na(+) and Cl(-) influx......, causing pronounced perturbations in extracellular (interstitial) and intracellular K(+) and Na(+) concentrations. Muscle interstitial K(+) concentration may increase 1- to 2-fold to 11-13 mM and intracellular K(+) concentration fall by 1.3- to 1.7-fold; interstitial Na(+) concentration may decline by 10 m...

  20. π-exchange NN interaction model with overlapping nucleon form factors

    International Nuclear Information System (INIS)

    Bagnoud, X.

    1986-01-01

    The nucleon-nucleon (NN) interaction model includes a π-exchange and takes into account the first excited state Δ(1232) of the nucleon. It is supplemented by a short-range repulsion which has been derived from the nucleon form factor (rms radius b/sub f/) combined with the three-quark wave function (rms radius b/sub q/). The optimization of the model on empirical scattering phase shifts below 300 MeV gives, for a minimum chi 2 , the root-mean-square radii b/sub f/ = b/sub q/ = 0.51 fm and a coupling constant G/sub π/ 2 /4π = 13

  1. Color-kinematic duality for form factors

    International Nuclear Information System (INIS)

    Boels, Rutger H.; Kniehl, Bernd A.; Tarasov, Oleg V.; Yang, Gang

    2012-12-01

    Recently a powerful duality between color and kinematics has been proposed for integrands of scattering amplitudes in quite general gauge theories. In this paper the duality proposal is extended to the more general class of gauge theory observables formed by form factors. After a discussion of the general setup the existence of the duality is verified in two and three loop examples in four dimensional maximally supersymmetric Yang-Mills theory which involve the stress energy tensor multiplet. In these cases the duality reproduces known results in a particularly transparent and uniform way. As a non-trivial application we obtain a very simple form of the integrand of the four-loop two-point (Sudakov) form factor which passes a large set of unitarity cut checks.

  2. Color-kinematic duality for form factors

    Energy Technology Data Exchange (ETDEWEB)

    Boels, Rutger H.; Kniehl, Bernd A.; Tarasov, Oleg V.; Yang, Gang [Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik

    2012-12-15

    Recently a powerful duality between color and kinematics has been proposed for integrands of scattering amplitudes in quite general gauge theories. In this paper the duality proposal is extended to the more general class of gauge theory observables formed by form factors. After a discussion of the general setup the existence of the duality is verified in two and three loop examples in four dimensional maximally supersymmetric Yang-Mills theory which involve the stress energy tensor multiplet. In these cases the duality reproduces known results in a particularly transparent and uniform way. As a non-trivial application we obtain a very simple form of the integrand of the four-loop two-point (Sudakov) form factor which passes a large set of unitarity cut checks.

  3. Aliphatic semisynthetic amino terminal variants of myoglobin: enrichment with carbon-13, determination and interpretation of terminal pK values and motions

    International Nuclear Information System (INIS)

    Busch, M.R.

    1985-01-01

    The synthesis of a series of myoglobins substituted in the amino terminal residue to provide variation in the aliphatic nature of the side chain and enrichment in 13 C was accomplished by semisynthetic methods. The replacements of valine, the native first residue, included 13 C enriched glycine, alanine, valine, leucine, and isoleucine. The products were extensively characterized and found to be virtually indistinguishable by most physical methods. 13 C NMR spectroscopy showed significant differences in the amino terminal pK value, ranging from 7.72 for myoglobin to 7.15 for myoglobin. Consideration of the electrostatic effects of the charge array indicated a balance of interactions at this site not significantly altered by variations in the side chain. By examination of the crystal structure, consideration of earlier work regarding the interactions of the side chain of Leu-2, and data regarding the motions of the terminal residue, it was concluded that the interaction of the side chain of the first residue with the hydrophobic cluster formed primarily by close contact of invariant residues Leu-2 and Leu-137 was the primary cause for the reduction in the terminal pK values seen for the larger aliphatics. By restricting the freedom of the residue, this interaction limits the available hydration volume, and consequently favors the unprotonated form of the amine. The concurrent observation of both functional elements in the series of α amino terminal residues brings out the interrelated consequences for the two categories of solvent interactions controlling structural and functional properties in a graded way

  4. Form factor determination of the semileptonic K{sup ±} → π{sup 0}μ{sup ±}ν decay with the NA48/2 experiment; Formfaktor-Bestimmung des semileptonischen K{sup ±} → π{sup 0}μ{sup ±}ν-Zerfalls mit dem NA48/2-Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Hita-Hochgesand, Manuel

    2011-03-15

    The semileptonic decay K{sup ±} → π{sup 0}μ{sup ±}ν (K{sub μ3}{sup ±}) provide a accurate and theoretically clean way to measure the CKM matrix element vertical stroke V{sub us} vertical stroke. The hadronic matrix element of this decay is described by two dimensionless form factors f{sub ±}(t), which depend on the squared four-momentum t = (p{sub K} - p{sub π}){sup 2} transferred to the lepton system. These form factors are important input parameters to the phase space integral of those decays for the determination of vertical stroke V{sub us} vertical stroke. Also the discrepancies of the NA48 results in comparison to the results of the experiments KLOE, KTeV and ISTRA+ motivates this analysis. The data of the minimum bias run collected in 2004 by the NA48/2 experiment were analysed and 1.8 million K{sub μ3}{sup ±} candidates, with a background contamination of less then 0.1%, were selected. The following parameter values were obtained from a modified X{sup 2} fit to the dalitsplot destiny, using the quadratic, pole and dispersive parametrisation: λ{sub 0}=(14.82±1.67{sub stat}±0.62{sub sys}) x 10{sup -3}, λ{sub +}{sup '}=(25.53±3.51{sub stat}±1.90{sub sys}) x 10{sup -3}, λ{sub +}''=(1.40±1.30{sub stat}±0.48{sub sys}) x 10{sup -3}, m{sub S}=1204.8±32.0{sub stat}±11.4{sub sys} MeV/c{sup 2}, m{sub V}=877.4±11.1{sub stat}±11.2{sub sys} MeV/c{sup 2}, ln C=0.1871±0.0088{sub stat}±0.0031{sub sys}±=0.0056{sub ext}, Λ{sub +}=(25.42±0.73{sub stat}±0.73{sub sys}±=1.52{sub ext}) x 10{sup -3} This results are in good comparison with the ones given by KLOE, KTeV und ISTRA+, and offers a improvement of the global fit of the form factors. Using the dispersive parametrisation of the form factors in combination with the Callan-Treiman-theorem, a calculation of f{sub +}(0) was done. The value is given below: f{sub +}(0)=0.987± 0.011{sub NA48/2}±0.008{sub ext}. The result is in good comparison with the values given by KLOE, KTeV and

  5. The interactions in K{sub μ3} and K{sub e3} decay

    Energy Technology Data Exchange (ETDEWEB)

    McDowell, S. W. [Brazilian Centre of Research in Physics, Rio de Janeiro (Brazil)

    1963-01-15

    An attractive feature common to all present theories of weak interactions is the assumption that they result from the coupling (either direct or via intermediate bosons) of vector-axial vector currents. The V-A coupling of leptonic currents and baryonic currents conserving strangeness successfully explains the characteristic properties of μ-decay, π-decay and μ-decay. On the other hand, the leptonic decay modes of K-mesons provide the best source of information on the nature of the currents carrying strangeness. From K{sub μ2} one learns that there must exist an axial-vector current carrying strangeness; further, if the leptonic weak interaction is universal, one can explain the absence of the K{sub e2} mode by excluding a pseudo-scalar interaction. From K{sub μ3} and K{sub e3} decay one can obtain information on scalar, vector and tensor coupling of strangeness non-conserving currents with leptons. In recent experiments on K{sub e3} decay a good fitting of the pion spectrum was obtained with a constant vector form factor. Although regarding this result as strong evidence of pure vector coupling, one might still argue that other possibilities, such as a mixture of vector and tensor couplings with energy-dependent form factors, are not excluded. I shall discuss here, in the first place, some properties of the transition amplitudes which are independent of the structure of form factors. They provide a test of universality and a criterion for unambiguous determination of the nature of the weak interaction involved in these processes. Secondly, I shall discuss the structure of form factors, by means of dispersion relations and introducing explicitly the effect of the K*-resonance in the Kπ-interaction.

  6. MesonNet Workshop on Meson Transition Form Factors

    CERN Document Server

    Eidelman, S; Hanhart, C; Kubis, B; Kupsc, A; Leupold, S; Moskal, P; Schadmand, S

    2012-01-01

    The mini-proceedings of the Workshop on Meson Transition Form Factors held in Cracow from May 29th to 30th, 2012 introduce the meson transition form factor project with special emphasis on the interrelations between the various form factors (on-shell, single off-shell, double off-shell). Short summaries of the talks presented at the workshop follow.

  7. Measurement of Multiple Vitamin K Forms in Processed and Fresh-Cut Pork Products in the U.S. Food Supply.

    Science.gov (United States)

    Fu, Xueyan; Shen, Xiaohua; Finnan, Emily G; Haytowitz, David B; Booth, Sarah L

    2016-06-08

    Vitamin K food composition data have historically been limited to plant-based phylloquinone (vitamin K1). The purpose of this study was to expand analysis of vitamin K to animal products and to measure phylloquinone and 10 forms of menaquinones (vitamin K2) in processed and fresh-cut pork products. Nationally representative samples of processed pork products (n = 28) were obtained through USDA's National Food and Nutrition Analysis Program, and fresh pork (six cuts; n = 5 per cut) and bacon (n = 4) were purchased from local retail outlets. All samples were analyzed by high-performance liquid chromatography (phylloquinone and menaquinone-4) and atmospheric-pressure chemical ionization-liquid chromatography-mass spectrometry (menaquinone-5 to menaquinone-13). Although low in phylloquinone (processed pork products and fresh pork cuts contained menaquinone-4, menaquinone-10, and menaquinone-11 (range: [35.1 ± 11.0]-[534 ± 89.0] μg of menaquinones per 100 g). The total menaquinone contents of processed pork products were correlated with fat contents (r = 0.935). In summary, processed and fresh-cut pork products are a rich dietary source of menaquinones that are currently unaccounted for in assessment of vitamin K in the food supply.

  8. Current s - quark mass corrections to the form factors of D - meson semileptonic decays

    International Nuclear Information System (INIS)

    Hussain, F.; Ivanov, A.N.; Troitskaya, N.I.

    1994-11-01

    The infinite mass effective theory, when a heavy quark mass tends to infinity, and Chiral perturbation theory at the quark level, based on the extended Nambu - Jona - Lasinio model with linear realization of chiral U(3) x U(3) symmetry, are applied to the calculations of current s - quark mass corrections to the form factors of the D → K-bar e + ν e and D → K-bar * e + ν e decays. These corrections turn out to be quite significant, of the order of 7 - 20%. The theoretical results are compared with experimental data. (author). 17 refs

  9. Nucleon form factors at high q2 within constituent quark models

    International Nuclear Information System (INIS)

    Desplanques, B.; Silvestre-Brac, B.; Cano, F.; Noguera, S.; Gonzalez, P.; .

    2000-01-01

    The nucleon form factors are calculated using a non-relativistic description in terms of constituent quarks. The emphasis is put on present numerical methods used to solve the three-body problem in order to reliably predict the expected asymptotic behavior of form factors. Nucleon wave functions obtained in the hyperspherical formalism or employing Faddeev equations have been considered. While a q -8 behavior is expected at high q for a quark-quark force behaving like 1/r at short distances, it is found that the hyper central approximation in the hyperspherical formalism (K = 0) leads to a q -7 behavior. An infinite set of waves would be required to get the correct behavior. Solutions of the Faddeev equations lead to the q -8 behavior. The coefficient of the corresponding term, however, depends on the number of partial waves retained in the Faddeev amplitude. The convergence to the asymptotic behavior has also been studied. Approximate expressions characterizing this one have been derived. From the comparison with the most complete Faddeev calculation, a validity range is inferred for restricted calculations. Refs. 46 (author)

  10. 17 CFR 240.16a-13 - Change in form of beneficial ownership.

    Science.gov (United States)

    2010-04-01

    ... exercise or conversion of a derivative security or deposit into or withdrawal from a voting trust, that... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Change in form of beneficial ownership. 240.16a-13 Section 240.16a-13 Commodity and Securities Exchanges SECURITIES AND EXCHANGE...

  11. Form factors in the projected linear chiral sigma model

    International Nuclear Information System (INIS)

    Alberto, P.; Coimbra Univ.; Bochum Univ.; Ruiz Arriola, E.; Fiolhais, M.; Urbano, J.N.; Coimbra Univ.; Goeke, K.; Gruemmer, F.; Bochum Univ.

    1990-01-01

    Several nucleon form factors are computed within the framework of the linear chiral soliton model. To this end variational means and projection techniques applied to generalized hedgehog quark-boson Fock states are used. In this procedure the Goldberger-Treiman relation and a virial theorem for the pion-nucleon form factor are well fulfilled demonstrating the consistency of the treatment. Both proton and neutron charge form factors are correctly reproduced, as well as the proton magnetic one. The shapes of the neutron magnetic and of the axial form factors are good but their absolute values at the origin are too large. The slopes of all the form factors at zero momentum transfer are in good agreement with the experimental data. The pion-nucleon form factor exhibits to great extent a monopole shape with a cut-off mass of Λ=690 MeV. Electromagnetic form factors for the vertex γNΔ and the nucleon spin distribution are also evaluated and discussed. (orig.)

  12. Absorptive form factors for high-energy electron diffraction

    International Nuclear Information System (INIS)

    Bird, D.M.; King, Q.A.

    1990-01-01

    The thermal diffuse scattering contribution to the absorptive potential in high-energy electron diffraction is calculated in the form of an absorptive contribution to the atomic form factor. To do this, the Einstein model of lattice vibrations is used, with isotropic Debye-Waller factors. The absorptive form factors are calculated as a function of scattering vector s and temperature factor M on a grid which enables polynomial interpolation of the results to be accurate to better than 2% for much of the ranges 0≤Ms 2 ≤6 and 0≤M≤2 A 2 . The computed values, together with an interpolation routine, have been incorporated into a Fortran subroutine which calculates both the real and absorptive form factors for 54 atomic species. (orig.)

  13. Molecular form factors in X-ray crystallography

    NARCIS (Netherlands)

    Groenewegen, P.P.M.; Feil, D.

    1969-01-01

    The calculation of molecular form factors from ab initio molecular electronic wavefunctions is discussed, and a scheme for application to X-ray diffraction structure analysis is given. The method is used to calculate the form factor of the NH+4 molecular ion from three accurate molecular

  14. PHF13 is a molecular reader and transcriptional co-regulator of H3K4me2/3

    DEFF Research Database (Denmark)

    Chung, Ho-Ryun; Xu, Chao; Fuchs, Alisa

    2016-01-01

    and its molecular chromatin context. Size exclusion chromatography, mass spectrometry, X-ray crystallography and ChIP sequencing demonstrate that PHF13 binds chromatin in a multivalent fashion via direct interactions with H3K4me2/3 and DNA, and indirectly via interactions with PRC2 and RNA Pol......II. Furthermore, PHF13 depletion disrupted the interactions between PRC2, RNA PolII S5P, H3K4me3 and H3K27me3 and resulted in the up and down regulation of genes functionally enriched in transcriptional regulation, DNA binding, cell cycle, differentiation and chromatin organization. Together our findings argue...... that PHF13 is an H3K4me2/3 molecular reader and transcriptional co-regulator, affording it the ability to impact different chromatin processes....

  15. Hadron form factors in the constituent quark model

    International Nuclear Information System (INIS)

    Cardarelli, F.; Salme', G.; Simula, S.; Pace, E.

    1998-01-01

    Hadron electromagnetic form factors are evaluated in a light-front constituent quark model based on the eigenfunctions of a mass operator, including in the q-q interaction a confining term and a one-gluon-exchange term (OGE). The spin-dependent part of the interaction plays an essential role for obtaining both a proper fit of the experimental nucleon electromagnetic form factors and the faster than dipole decrease of the magnetic N-P 33 (1232) transition form factor. The effects of the D wave, produced by the tensor part of the OGE interaction, on the quadrupole and Coulomb N-P 33 (1232) transition form factors have been found to be negligible. (author)

  16. INTRINSIC SHAPE OF STAR-FORMING BzK GALAXIES AT z ∼ 2 IN GOODS-N

    International Nuclear Information System (INIS)

    Yuma, Suraphong; Ohta, Kouji; Yabe, Kiyoto; Kajisawa, Masaru; Ichikawa, Takashi

    2011-01-01

    We study the structure of star-forming galaxies at z ∼ 2 in a Great Observatories Origins Deep Survey North field selected as star-forming BzK (sBzK) galaxies down to K AB B > C, we find that the mean B/A ratio is 0.61 +0.05 -0.08 and disk thickness C/A is 0.28 +0.03 -0.04 . This indicates that the single-component sBzK galaxies at z ∼ 2 have a bar-like or oval shape rather than a round disk shape. The shape seems to resemble a bar/oval structure that forms through bar instability; if this is the case, the intrinsic shape may give us a clue to understand dynamical evolution of baryonic matter in a dark matter halo.

  17. Pancreatic beta cells express two autoantigenic forms of glutamic acid decarboxylase, a 65-kDa hydrophilic form and a 64-kDa amphiphilic form which can be both membrane-bound and soluble

    DEFF Research Database (Denmark)

    Christgau, S; Schierbeck, H; Aanstoot, H J

    1991-01-01

    The 64-kDa pancreatic beta-cell autoantigen, which is a target of autoantibodies associated with early as well as progressive stages of beta-cell destruction, resulting in insulin-dependent diabetes (IDDM) in humans, has been identified as the gamma-aminobutyric acid-synthesizing enzyme glutamic...... acid decarboxylase. We have identified two autoantigenic forms of this protein in rat pancreatic beta-cells, a Mr 65,000 (GAD65) hydrophilic and soluble form of pI 6.9-7.1 and a Mr 64,000 (GAD64) component of pI 6.7. GAD64 is more abundant than GAD65 and has three distinct forms with regard to cellular...

  18. Dispersive analysis of the pion transition form factor

    Science.gov (United States)

    Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.

    2014-11-01

    We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.

  19. Phenomenological Application of $k_T$ factorization

    CERN Document Server

    Keum, Yong-Yeon

    2004-01-01

    We discuss applications of the perturbative QCD approach in the exclusive non-leptonic two body B-meson decays. We briefly review its ingredients and some important theoretical issues on the factorization approaches. PQCD results are compatible with present experimantal data for the charmless B-meson decays. We predict the possibility of large direct CP asymmetry in $B^0 \\to \\pi^{+}\\pi^{-}$ $(23\\pm7 %)$ and $B^0\\to K^{+}\\pi^{-}$ $(-17\\pm5%)$. We also investigate the Branching ratios, CP asymmetry and isopsin symmetry breaking in radiative $B \\to (K^*/\\rho) \\gamma$ decays.

  20. Modeling the Spray Forming of H13 Steel Tooling

    Science.gov (United States)

    Lin, Yaojun; McHugh, Kevin M.; Zhou, Yizhang; Lavernia, Enrique J.

    2007-07-01

    On the basis of a numerical model, the temperature and liquid fraction of spray-formed H13 tool steel are calculated as a function of time. Results show that a preheated substrate at the appropriate temperature can lead to very low porosity by increasing the liquid fraction in the deposited steel. The calculated cooling rate can lead to a microstructure consisting of martensite, lower bainite, retained austenite, and proeutectoid carbides in as-spray-formed material. In the temperature range between the solidus and liquidus temperatures, the calculated temperature of the spray-formed material increases with increasing substrate preheat temperature, resulting in a very low porosity by increasing the liquid fraction of the deposited steel. In the temperature region where austenite decomposition occurs, the substrate preheat temperature has a negligible influence on the cooling rate of the spray-formed material. On the basis of the calculated results, it is possible to generate sufficient liquid fraction during spray forming by using a high growth rate of the deposit without preheating the substrate, and the growth rate of the deposit has almost no influence on the cooling rate in the temperature region of austenite decomposition.

  1. TU-F-BRE-05: Experimental Determination of K Factor in Small Field Dosimetry

    International Nuclear Information System (INIS)

    Das, I; Akino, Y; Francescon, P

    2014-01-01

    Purpose: Small-field dosimetry is challenging due to charged-particle disequilibrium, source occlusion and more importantly finite size of detectors. IAEA/AAPM has published approach to convert detector readings to dose by k factor. Manufacturers have been trying to provide various types of micro-detectors that could be used in small fields. However k factors depends on detector perturbations and are derived using Monte Carlo simulation. PTW has introduced a microDiamond for small-field dosimetry. An experimental approach is presented to derive the k factor for this detector. Methods: PTW microDiamond is a small volume detector with 1.1 mm radius and 1.0 micron thick synthetic diamond. Output factors were measured from 1×1cm2 to 12×12 cm2 on a Varian machine at various depths using various micro-detectors with published k factors. Dose is calculated as reading * K. Assuming k factor is accurate, output factor should be identical with every micro-detectors. Hence published k values (Francescon et al Med Phys 35, 504-513,2008) were used to covert readings and then output factors were computed. Based on the converged curve from other detectors, k factor for microDiamond was computed versus field size. Results: Traditional output factors as ratio of readings normalized to 10×10 cm2 differ significantly for micro-detectors for fields smaller than 3×3 cm2 which are now being used extensively. When readings are converted to dose, the output factor is independent of detector. Based on this method, k factor for microDiamond was estimated to be nearly constant 0.993±0.007 over varied field sizes. Conclusion: Our method provides a unique opportunity to determine the k factor for any unknown detector. It is shown that even though k factor depends on machine type due to focal spot, however for fields ≥1×1 cm2 this method provides accurate evaluation of k factor. Additionally microDiamond could be used with assumption that k factor is nearly unity

  2. {sup 13}C, {sup 15}N Resonance Assignment of Parts of the HET-s Prion Protein in its Amyloid Form

    Energy Technology Data Exchange (ETDEWEB)

    Siemer, Ansgar B. [Physical Chemistry (Switzerland); Ritter, Christiane [Salk Institute, Structural Biology Laboratory (United States); Steinmetz, Michel O. [Paul Scherrer Institut, Biomolecular Research, Structural Biology (Switzerland); Ernst, Matthias [Physical Chemistry (Switzerland); Riek, Roland [Salk Institute, Structural Biology Laboratory (United States); Meier, Beat H. [Physical Chemistry (Switzerland)

    2006-02-15

    The partial {sup 15}N and {sup 13}C solid-state NMR resonance assignment of the HET-s prion protein fragment 218-289 in its amyloid form is presented. It is based on experiments measured at MAS frequencies in the range of 20-40 kHz using exclusively adiabatic polarization-transfer schemes. The resonance assignment within each residue is based on two-dimensional {sup 13}C--{sup 13}C correlation spectra utilizing the DREAM mixing scheme. The sequential linking of the assigned residues used a set of two- and three-dimensional {sup 15}N--{sup 13}C correlation experiments. Almost all cross peaks visible in the spectra are assigned, but only resonances from 43 of the 78 amino-acid residues could be detected. The missing residues are thought to be highly disordered and/or highly dynamic giving rise to broad resonance lines that escaped detection in the experiments applied. The line widths of the observed resonances are narrow and comparable to line widths observed in micro-crystalline samples. The 43 assigned residues are located in two fragments of about 20 residues.

  3. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009–2013)

    OpenAIRE

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-01-01

    Background Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Ca...

  4. Zero thermal expansion in NaZn13-type La(Fe,Si)13 compounds.

    Science.gov (United States)

    Wang, Wei; Huang, Rongjin; Li, Wen; Tan, Jie; Zhao, Yuqiang; Li, Shaopeng; Huang, Chuanjun; Li, Laifeng

    2015-01-28

    A zero thermal expansion material in a pure form of NaZn13-type La(Fe,Si)13 was fabricated. Through optimizing the chemical composition, an isotropic zero thermal expansion material is achieved. The obtained materials exhibit a low expansion of |α| linear thermal expansion) over a broad temperature range (15-150 K). The present study indicates that the thermal expansion behavior of the NaZn13-type La(Fe,Si)13 compounds depends mainly on the content of Si element. This new material is desirable in many fields of industry as a reliable and low-cost zero thermal expansion material.

  5. Proposal for the Award of a Contract for the Supply of 13 kA and 20.5 kA, 18 V Switched-Mode Power Converters for the LHC

    CERN Document Server

    2003-01-01

    This document concerns the award of a contract for the supply of 13 kA and 20.5 kA, 18 V switched-mode power converters using sub-converters of 3.25 kA. Following a market survey (MS-2866/SL/LHC) carried out among 81 firms in seventeen Member States and a call for tenders for prototypes (IT-2919/SL/LHC) sent on 11 June 2001, a call for tenders for the supply of the pre-series and series of 13 kA and 20.5 kA, 18 V switched-mode power converters both using sub-converters of 3.25 kA was sent to two firms on 17 September 2002. The Finance Committee is invited to agree to the negotiation of a contract with TRANSTECHNIK (DE), the only firm that has delivered a successfully qualifying prototype, for the supply of eighteen 13 kA and one 20.5 kA, 18 V switched-mode power converters and spares for a total amount of 4 607 731 euros (6 747 300 Swiss francs), not subject to revision. The rate of exchange used is that stipulated in the tender. The firm has indicated the following distribution by country of the contract val...

  6. Características de las fallas en alimentadores de 13,8 kV del sistema soterrado de La Habana;Characteristic of 13,8 kV feeders faults of the Havana underground system

    Directory of Open Access Journals (Sweden)

    Boris Alba - Valle

    2011-06-01

    Full Text Available El sistema soterrado de La Habana enfrenta problemas de continuas fallas en sus alimentadores de 13,8 kV. En este trabajo se determinan las características de estas averías, en el período comprendido entre los años 2007 y 2009, y se proponen algunas medidas objetivas con el fin de contribuir a su disminución. La investigación se basó fundamentalmente en el estudio de la base de datos de los alimentadores de 13,8 kV proporcionada por el departamento técnico de la Unidad Empresarial Básica (UEB Soterrada y en el uso de herramientas estadísticas digitales. Como resultado se pudo constatar que las fallas son más frecuentes en los alimentadores de la subestación de Tallapiedra producto de la humedad en cables y empalmes con aislamiento de PILC (papel impregnado en aceite y con cubierta de plomo, dispuestos por tierra muerta. Finalmente, las medidas propuestas tuvieron un impacto positivo en la disminución de estas fallas, en un período inferior a un año.The Havana underground system has problems of continuous faults in their 13,8 kV feeders. In this article the characteristics of these mishaps in the period of 2007 to 2009 are determined and purpose some objective measurements with the end of contributing to their decrease. The investigation was fundamentally based on the study of the 13,8 kV feeders database proportioned by the technical department of the Underground Basic Managerial Unit (UEB and the use of digital statistical tools. As a result, it was verified that the faults occur with more frequency in the Tallapiedra substation feeders, due to the humidity in cables and connections with PILC isolation (impregnated in oil and lead covered paper, prepared for undergrounding directly in the earth. Finally, the proposed measures had a positive impact in the decrease of these faults, in a period less than to a year.

  7. Chiral analysis of baryon form factors

    Energy Technology Data Exchange (ETDEWEB)

    Gail, T.A.

    2007-11-08

    This work presents an extensive theoretical investigation of the structure of the nucleon within the standard model of elementary particle physics. In particular, the long range contributions to a number of various form factors parametrizing the interactions of the nucleon with an electromagnetic probe are calculated. The theoretical framework for those calculations is chiral perturbation theory, the exact low energy limit of Quantum Chromo Dynamics, which describes such long range contributions in terms of a pion-cloud. In this theory, a nonrelativistic leading one loop order calculation of the form factors parametrizing the vector transition of a nucleon to its lowest lying resonance, the {delta}, a covariant calculation of the isovector and isoscalar vector form factors of the nucleon at next to leading one loop order and a covariant calculation of the isoscalar and isovector generalized vector form factors of the nucleon at leading one loop order are performed. In order to perform consistent loop calculations in the covariant formulation of chiral perturbation theory an appropriate renormalization scheme is defined in this work. All theoretical predictions are compared to phenomenology and results from lattice QCD simulations. These comparisons allow for a determination of the low energy constants of the theory. Furthermore, the possibility of chiral extrapolation, i.e. the extrapolation of lattice data from simulations at large pion masses down to the small physical pion mass is studied in detail. Statistical as well as systematic uncertainties are estimated for all results throughout this work. (orig.)

  8. Implications of the Super-K atmospheric, long baseline, and reactor data for the mixing angles θ13 and θ23

    Science.gov (United States)

    Escamilla-Roa, J.; Latimer, D. C.; Ernst, D. J.

    2010-01-01

    A three-neutrino analysis of oscillation data is performed using the recent, more finely binned Super-K oscillation data, together with the CHOOZ, K2K, and MINOS data. The solar parameters Δ21 and θ12 are fixed from a recent analysis and Δ32, θ13, and θ23 are varied. We utilize the full three-neutrino oscillation probability and an exact treatment of Earth’s Mikheyev-Smirnov-Wolfenstein (MSW) effect with a castle-wall density. By including terms linear in θ13 and ɛ:=θ23-π/4, we find asymmetric errors for these parameters θ13=-0.07-0.11+0.18 and ɛ=0.03-0.15+0.09. For θ13, we see that the lower bound is primarily set by the CHOOZ experiment while the upper bound is determined by the low energy e-like events in the Super-K atmospheric data. We find that the parameters θ13 and ɛ are correlated—the preferred negative value of θ13 permits the preferred value of θ23 to be in the second octant, and the true value of θ13 affects the allowed region for θ23.

  9. Weak form factors of beauty baryons

    International Nuclear Information System (INIS)

    Ivanov, M.A.; Lyubovitskij, V.E.

    1992-01-01

    Full analysis of semileptonic decays of beauty baryons with J p =1/2 2 and J p =3/2 2 into charmed ones within the Quark Confinement Model is reported. Weak form factors and decay rates are calculated. Also the heavy quark limit m Q →∞ (Isgur-Wise symmetry) is examined. The weak heavy-baryon form factors in the Isgur-Wise limit and 1/m Q -corrections to them are computered. The Ademollo-Gatto theorem is spin-flavour symmetry of heavy quarks is checked. 33 refs.; 1 fig.; 9 tabs

  10. Transcriptional activation of Mina by Sp1/3 factors.

    Science.gov (United States)

    Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

    2013-01-01

    Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

  11. Thermal Runaway of the 13 kA Busbar Joints in the LHC

    CERN Document Server

    Verweij, A P

    2010-01-01

    Triggered by the incident in the LHC in September 2008, the thermo-electrical stability of the 10,000 soldered busbar joints in the 13 kA circuits of the LHC has been re-assessed. For this purpose the computer model QP3 has been developed. In this paper the results of some calculations are presented, and it is shown how the results have been used to improve the quench detection system and ensure safe future operation. First the layout of the 13 kA circuits, the geometry of the soldered joints and the quench detection system will be described. Special focus is put on several types of defects in the joint that have been found in the LHC. The difference between slow and fast thermal run-away will be discussed, focusing on quench propagation and reduced thermal and electrical contacts between the various parts of the joint. It is shown that an enhancement of the LHC quench detection system with a much lower threshold will greatly reduce the risk of burn-out of the joint. Finally it is discussed that protection is...

  12. Study of the Ds+ → K+K-e+νe decay channel with the Babar experiment

    International Nuclear Information System (INIS)

    Serrano, J.

    2008-04-01

    Charm semileptonic decays allow a validation of lattice QCD calculations through the measurement of the hadronic form factors, which characterize the effect of strong interaction in these reactions. The accuracy of such calculations is crucial for the improvement of the test of the standard model in flavour physics. This thesis presents a study of the D s + → K + K - e + ν e channel using 214fb -1 recorded by de Babar experiment. For events with a K + K - mass in the range between 1.01 GeV/c 2 and 1.03 GeV/c 2 , the φ → K + K - is the dominant component. Using the simple pole model to parameterize the q 2 dependence of the form factors -V(q 2 ), A 1 (g 2 ) and A 2 (q 2 )- the following ratios are measured at q 2 = 0: r v = V(0)/A 1 (0) 1.868±0.061±0.079, r 2 = A 2 (0)/A 1 (0) = 0.763±0.072±0.062. The mass pole of the axial-vector form factor is also obtained: m A (2.30 0.18 +0.24 ±0.21) GeV/c 2 . In the same mass range, the semileptonic branching fraction, relative to the D s + → φπ + channel, is measured, and the absolute normalisation of the axial-vector form factor is extracted: A 1 (q 2 = 0) = 0.605 ± 0.012 ± 0.018 ± 0.018. The stated errors refer to the statistical, systematic and errors from external inputs, respectively. An S wave component in the K + K - system, possibly originating from a f 0 , is also studied through its interference with the φ. An S wave component is observed for the first time in this decay channel with a 5σ significance. (author)

  13. Hadronic Form Factors in Asymptotically Free Field Theories

    Science.gov (United States)

    Gross, D. J.; Treiman, S. B.

    1974-01-01

    The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q{sup 2} behavior of nucleon form factors. Duality arguments of Bloom and Gilman suggest a connection between the form factors and the threshold properties of the deep inelastic structure functions. The latter are addressed directly in an analysis of asymptotically free theories; and through the duality connection we are then led to statements about the form factors. For very large q{sup 2} the form factors are predicted to fall faster than any inverse power of q{sup 2}. For the more modest range of q{sup 2} reached in existing experiments the agreement with data is fairly good, though this may well be fortuitous. Extrapolations beyond this range are presented.

  14. Magnetic form factors of rare earth ions

    International Nuclear Information System (INIS)

    Deckman, H.W.

    1976-01-01

    The magnetic scattering of neutrons by atoms has been investigated by exploiting its similarity to the radiation problem in spectroscopy. Expressions for the magnetic scattering amplitude were developed for cases in whcih an atom in the l/sup n/ electronic configuration is described either by a relativistic or nonrelativistic Hamiltonian. For each of these cases, it has been shown that the magnetic scattering amplitude can be expressed in terms of relativistic or nonrelativistic matrix elements of magnetic and electric multipole operators. For a nonrelativistic atom, the calculation of these matrix elements has been separated into evaluating radial matrix elements and matrix elements of Racah tensors W/(sup 0,k)k/ and W/(sup 1,k')k/. For a relativistic atom the effective operator approach has been used to define effective multipole operators so that a relativistic result is obtained by taking matrix elements of these effective operators between nonrelativistic states of the atom. The calculation of matrix elements of these effective operators has been reduced to evaluating relativistic radial integrals and matrix elements of the Racah tensors taken between nonrelativistic states of the atom. It is shown tha for the case of elastic scattering by either a relativistic or nonrelativistic atom in single Russel-Saunders state, the magnetic scattering amplitude can be written in the conventional form p(vector q)vector q/sub m/.vector sigma. General expressions for p(vector q) as well as elastic magnetic form factorshave been obtained. The formalism has been illustrated throughout by applying it to the case of scattering by rare earth ions

  15. New lipid family that forms inverted cubic phases in equilibrium with excess water: molecular structure-aqueous phase structure relationship for lipids with 5,9,13,17-tetramethyloctadecyl and 5,9,13,17-tetramethyloctadecanoyl chains.

    Science.gov (United States)

    Yamashita, Jun; Shiono, Manzo; Hato, Masakatsu

    2008-10-02

    With a view to discovering a new family of lipids that form inverted cubic phases, the aqueous phase behavior of a series of lipids with isoprenoid-type hydrophobic chains has been examined over a temperature range from -40 to 65 degrees C by using optical microscopy, DSC (differential scanning calorimetry), and SAXS (small-angle X-ray scattering) techniques. The lipids examined are those with 5,9,13,17-tetramethyloctadecyl and 5,9,13,17-tetramethyloctadecanoyl chains linked to a series of headgroups, that is, erythritol, pentaerythritol, xylose, and glucose. All of the lipid/water systems displayed a "water + liquid crystalline phase" two-phase coexistence state when sufficiently diluted. The aqueous phase structures of the most diluted liquid crystalline phases in equilibrium with excess water depend both on the lipid molecular structure and on the temperature. Given an isoprenoid chain, the preferred phase consistently follows a phase sequence of an H II (an inverted hexagonal phase) to a Q II (an inverted bicontinuous cubic phase) to an L alpha (a lamellar phase) as A* (cross-section area of the headgroup) increases. For a given lipid/water system, the phase sequence observed as the temperature increases is L alpha to Q II to H II. The present study allowed us to find four cubic phase-forming lipid species, PEOC 18+4 [mono- O-(5,9,13,17-tetramethyloctadecyl)pentaerythritol], beta-XylOC 18+4 [1- O-(5,9,13,17-tetramethyloctadecyl)-beta- d-xylopyranoside], EROCOC 17+4 [1- O-(5,9,13,17-tetramethyloctadecanoyl)erythritol], and PEOCOC 17+4 [mono- O-(5,9,13,17-tetramethyloctadecanoyl)pentaerythritol]. The values of T K (hydrated solid-liquid crystalline phase transition temperature) of the cubic phase-forming lipids are all below 0 degrees C. Quantitative analyses of the lipid molecular structure-aqueous phase structure relationship in terms of the experimentally evaluated "surfactant parameter" allow us to rationally select an optimum combination of hydrophilic

  16. Pseudoscalar form factors in tau-neutrino nucleon scattering

    International Nuclear Information System (INIS)

    Hagiwara, K.; Mawatari, K.; Yokoya, H.

    2004-01-01

    We investigate the pseudoscalar transition form factors of nucleon for quasi-elastic scattering and Δ resonance production in tau-neutrino nucleon scattering via the charged current interactions. Although the pseudoscalar form factors play an important role for the τ production in neutrino-nucleon scattering, these are not known well. In this Letter, we examine their effects in quasi-elastic scattering and Δ resonance production and find that the cross section, Q 2 distribution, and spin polarization of the produced τ ± leptons are quite sensitive to the pseudoscalar form factors

  17. Calculation of pion form factor

    International Nuclear Information System (INIS)

    Vahedi, N.; Amirarjomand, S.

    1975-09-01

    The pion form factor is calculated using the structure function Wsub(2), which incorporates kinematical constraints, threshold behaviour and scaling. The Bloom-Gilman sum rule is used and only the two leading Regge trajectories are taken into account

  18. Factorization of heavy-to-light form factors in soft-collinear effective theory

    CERN Document Server

    Beneke, Martin; Feldmann, Th.

    2004-01-01

    Heavy-to-light transition form factors at large recoil energy of the light meson have been conjectured to obey a factorization formula, where the set of form factors is reduced to a smaller number of universal form factors up to hard-scattering corrections. In this paper we extend our previous investigation of heavy-to-light currents in soft-collinear effective theory to final states with invariant mass Lambda^2 as is appropriate to exclusive B meson decays. The effective theory contains soft modes and two collinear modes with virtualities of order m_b*Lambda (`hard-collinear') and Lambda^2. Integrating out the hard-collinear modes results in the hard spectator-scattering contributions to exclusive B decays. We discuss the representation of heavy-to-light currents in the effective theory after integrating out the hard-collinear scale, and show that the previously conjectured factorization formula is valid to all orders in perturbation theory. The naive factorization of matrix elements in the effective theory ...

  19. Animal products and K-ras codon 12 and 13 mutations in colon carcinomas

    NARCIS (Netherlands)

    Kampman, E.; Voskuil, D.W.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't

    2000-01-01

    K-ras gene mutations (codons 12 and 13) were determined by PCR-based mutant allele-specific amplification (MASA) in tumour tissue of 185 colon cancer patients: 36% harboured mutations, of which 82% were located in codon 12. High intakes of animal protein, calcium and poultry were differently

  20. Pion-nucleon form factor in the Chew-Low theory

    International Nuclear Information System (INIS)

    Ernst, D.J.; Johnson, M.B.

    1978-01-01

    We find a solution to the static Chew-Low theory of pion-nucleon scattering, avoiding the ''one-meson approximation.'' Our basic equation is crossing symmetric and may be solved for phase shifts delta (p) by standard numerical techniques, upon specifying a form factor v (p) and a set of inelasticities. With v (p) = exp(-p 2 /30) we reproduce experimental delta (p) for p/sub L/ < or = 1.2 GeV/c in the (3,3) state; in the (1,3) states and (3,1) states delta (p) compare well on the average but in the (1,1) state delta (p) have opposite signs. We show the importance of crossing symmetry and the coupling to inelastic channels, and we discuss the possibility of determining v (p) directly from elastic scattering by an inverse scattering formula

  1. Phenotype and 244k array-CGH characterization of chromosome 13q deletions: an update of the phenotypic map of 13q21.1-qter

    DEFF Research Database (Denmark)

    Kirchhoff, Maria; Bisgaard, Anne-Marie; Stoeva, Radka

    2009-01-01

    Partial deletions of the long arm of chromosome 13 lead to variable phenotypes dependant on the size and position of the deleted region. In order to update the phenotypic map of chromosome 13q21.1-qter deletions, we applied 244k Agilent oligonucleotide-based array-CGH to determine the exact break......-genotype correlation on chromosome 13. In contrast to previous reports of carriers of 13q32 band deletions as the most seriously affected patients, we present two such individuals with long-term survival, 28 and 2.5 years....

  2. Software development for estimating the conversion factor (k-factor) at suitable scan areas, relating the dose length product to the effective dose

    International Nuclear Information System (INIS)

    Kobayashi, Masanao; Asada, Yasuki; Suzuki, Syouichi; Kato, Ryouichi; Matsubara, Kosuke; Koshida, Kichiro; Matsunaga, Yuta; Kawaguchi, Ai; Haba, Tomonobu; Toyama, Hiroshi

    2017-01-01

    We developed a k-factor-creator software (kFC) that provides the k-factor for CT examination in an arbitrary scan area. It provides the k-factor from the effective dose and dose-length product by Imaging Performance Assessment of CT scanners and CT-EXPO. To assess the reliability, we compared the kFC-evaluated k-factors with those of the International Commission on Radiological Protection (ICRP) publication 102. To confirm the utility, the effective dose determined by coronary computed tomographic angiography (CCTA) was evaluated by a phantom study and k-factor studies. In the CCTA, the effective doses were 5.28 mSv in the phantom study, 2.57 mSv (51%) in the k-factor of ICRP, and 5.26 mSv (1%) in the k-factor of the kFC. Effective doses can be determined from the kFC-evaluated k-factors in suitable scan areas. Therefore, we speculate that the flexible k-factor is useful in clinical practice, because CT examinations are performed in various scan regions. (authors)

  3. US Pharmacopeial Convention safety evaluation of menaquinone-7, a form of vitamin K.

    Science.gov (United States)

    Marles, Robin J; Roe, Amy L; Oketch-Rabah, Hellen A

    2017-07-01

    Vitamin K plays important biological roles in maintaining normal blood coagulation, bone mineralization, soft tissue physiology, and neurological development. Menaquinone-7 is a form of vitamin K2 that occurs naturally in some animal-derived and fermented foods. It is also available as an ingredient of dietary supplements. Menaquinone-7 has greater bioavailability than other forms of vitamin K, which has led to increasing sales and use of menaquinone-7 supplements. This special article reviews the chemistry, nomenclature, dietary sources, intake levels, and pharmacokinetics of menaquinones, along with the nonclinical toxicity data available and the data on clinical outcomes related to safety (adverse events). In conclusion, the data reviewed indicate that menaquinone-7, when ingested as a dietary supplement, is not associated with any serious risk to health or with other public health concerns. On the basis of this conclusion, US Pharmacopeia monographs have been developed to establish quality standards for menaquinone-7 as a dietary ingredient and as a dietary supplement in various dosage forms. © The Author(s) 2017. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. 13 CFR 107.640 - Requirement to file Portfolio Financing Reports (SBA Form 1031).

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement to file Portfolio Financing Reports (SBA Form 1031). 107.640 Section 107.640 Business Credit and Assistance SMALL BUSINESS... (SBA Form 1031). For each Financing of a Small Business (excluding guarantees), you must submit a...

  5. 13 CFR 108.640 - Requirement to file portfolio financing reports (SBA Form 1031).

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement to file portfolio financing reports (SBA Form 1031). 108.640 Section 108.640 Business Credit and Assistance SMALL BUSINESS... portfolio financing reports (SBA Form 1031). For each Financing you make (excluding guarantees), you must...

  6. Solid state NMR sequential resonance assignments and conformational analysis of the 2x10.4 kDa dimeric form of the Bacillus subtilis protein Crh

    Energy Technology Data Exchange (ETDEWEB)

    Boeckmann, Anja [Institut de Biologie et Chimie des Proteines, C.N.R.S UMR 5086 (France)], E-mail: a.bockmann@ibcp.fr; Lange, Adam [Max-Planck-Institute for Biophysical Chemistry, Solid-state NMR (Germany); Galinier, Anne [Institut de Biologie Structurale et Microbiologie, C.N.R.S UPR 9043 (France); Luca, Sorin [Max-Planck-Institute for Biophysical Chemistry, Solid-state NMR (Germany); Giraud, Nicolas; Juy, Michel [Institut de Biologie et Chimie des Proteines, C.N.R.S UMR 5086 (France); Heise, Henrike [Max-Planck-Institute for Biophysical Chemistry, Solid-state NMR (Germany); Montserret, Roland; Penin, Francois [Institut de Biologie et Chimie des Proteines, C.N.R.S UMR 5086 (France); Baldus, Marc [Max-Planck-Institute for Biophysical Chemistry, Solid-state NMR (Germany)], E-mail: maba@mpibpc.mpg.de

    2003-12-15

    Solid state NMR sample preparation and resonance assignments of the U-[{sup 13}C,{sup 15}N] 2x10.4 kDa dimeric form of the regulatory protein Crh in microcrystalline, PEG precipitated form are presented. Intra- and interresidue correlations using dipolar polarization transfer methods led to nearly complete sequential assignments of the protein, and to 88% of all {sup 15}N, {sup 13}C chemical shifts. For several residues, the resonance assignments differ significantly from those reported for the monomeric form analyzed by solution state NMR. Dihedral angles obtained from a TALOS-based statistical analysis suggest that the microcrystalline arrangement of Crh must be similar to the domain-swapped dimeric structure of a single crystal form recently solved using X-ray crystallography. For a limited number of protein residues, a remarkable doubling of the observed NMR resonances is observed indicative of local static or dynamic conformational disorder. Our study reports resonance assignments for the largest protein investigated by solid state NMR so far and describes the conformational dimeric variant of Crh with previously unknown chemical shifts.

  7. Hadron collisions and the fifth form factor

    International Nuclear Information System (INIS)

    Dokshitzer, Yu.L.; Marchesini, G.

    2005-01-01

    Logarithmically enhanced effects due to radiation of soft gluons at large angles in 2->2 QCD scattering processes are treated in terms of the ''fifth form factor'' that accompanies the four collinear singular Sudakov form factors attached to incoming and outgoing hard partons. Unexpected symmetry under exchange of internal and external variables of the problem is pointed out for the anomalous dimension that governs soft gluon effects in hard gluon-gluon scattering

  8. Strange mesonic transition form factor

    International Nuclear Information System (INIS)

    Goity, J.L.; Musolf, M.J.

    1996-01-01

    The strange-quark vector current ρ-to-π meson transition form factor is computed at one-loop order using strange meson intermediate states. A comparison is made with a φ-meson dominance model estimate. We find that one-loop contributions are comparable in magnitude to those predicted by φ-meson dominance. It is possible that the one-loop contribution can make the matrix element as large as those of the electromagnetic current mediating vector meson radiative decays. However, due to the quadratic dependence of the one-loop results on the hadronic form factor cutoff mass, a large uncertainty in the estimate of the loops is unavoidable. These results indicate that non-nucleonic strange quarks could contribute appreciable in moderate-parallel Q 2 parallel parity-violating electron-nucleus scattering measurements aimed at probing the strange-quark content of the nucleon. copyright 1996 The American Physical Society

  9. Long-term Spot-Coverage Variations of 13 BY Dra G-K Dwarfs

    Science.gov (United States)

    Alekseev, I. Yu.; Kozhevnikova, A. V.

    2018-06-01

    The results of spot-coverage modeling for 13 active G-K dwarf stars based on many-year photometric observations are presented. The results of UBV RI observations of eight stars performed at the Crimean Astrophysical Observatory were used together with data from the literature in this analysis. The spot-coverage parameters for 13 selected BY Dra active red dwarfs have been redetermined to improve the zonal spot-coverage model for the stellar photospheres, which currently allows for the presence of two active longitudes. Time variations of the spot-activity characteristics of these systems were analyzed with the aim of searching for possible cyclic variations. All the stars, with the exception of OU Gem and BE Cet, show fairly strong correlations between variations in the spot latitudes and spot areas, with absolute values of the correlation coefficients, R(, S), ranging from 0.38 to 0.92. For five stars, an anti-correlation between the mean latitude and area of the spots was found ( R(, S) from-0.24 to-0.73). This behavior may reflect the drift of spots toward the equator in the course of their development. Eight stars feature positive correlations, i.e. the spots drift towards the pole as their areas increase. Nine stars demonstrate activity cycles, which are reflected in photometric variations as well as variations of the spot areas and mean latitudes. The periods of the latitude drift of the spots are found for five stars; the magnitudes of the spot-latitude drift rates are lower than the corresponding value for sunspots by a factor of 1.5-3.

  10. Strange nucleon electromagnetic form factors from lattice QCD

    Science.gov (United States)

    Alexandrou, C.; Constantinou, M.; Hadjiyiannakou, K.; Jansen, K.; Kallidonis, C.; Koutsou, G.; Avilés-Casco, A. Vaquero

    2018-05-01

    We evaluate the strange nucleon electromagnetic form factors using an ensemble of gauge configurations generated with two degenerate maximally twisted mass clover-improved fermions with mass tuned to approximately reproduce the physical pion mass. In addition, we present results for the disconnected light quark contributions to the nucleon electromagnetic form factors. Improved stochastic methods are employed leading to high-precision results. The momentum dependence of the disconnected contributions is fitted using the model-independent z-expansion. We extract the magnetic moment and the electric and magnetic radii of the proton and neutron by including both connected and disconnected contributions. We find that the disconnected light quark contributions to both electric and magnetic form factors are nonzero and at the few percent level as compared to the connected. The strange form factors are also at the percent level but more noisy yielding statistical errors that are typically within one standard deviation from a zero value.

  11. Dispersive analysis of the pion transition form factor

    Energy Technology Data Exchange (ETDEWEB)

    Hoferichter, M. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, ExtreMe Matter Institute EMMI, Darmstadt (Germany); University of Bern, Albert Einstein Center for Fundamental Physics, Institute for Theoretical Physics, Bern (Switzerland); Kubis, B.; Niecknig, F.; Schneider, S.P. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany); Leupold, S. [Uppsala Universitet, Institutionen foer fysik och astronomi, Box 516, Uppsala (Sweden)

    2014-11-15

    We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the e{sup +}e{sup -} → 3π cross section, generalizing previous studies on ω, φ → 3π decays and γπ → ππ scattering, and verify our result by comparing to e{sup +}e{sup -} → π{sup 0}γ data. We perform the analytic continuation to the space-like region, predicting the poorlyconstrained space-like transition form factor below 1 GeV, and extract the slope of the form factor at vanishing momentum transfer a{sub π} = (30.7 ± 0.6) x 10{sup -3}. We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon. (orig.)

  12. Software Development for Estimating the Conversion Factor (K-Factor) at Suitable Scan Areas, Relating the Dose Length Product to the Effective Dose.

    Science.gov (United States)

    Kobayashi, Masanao; Asada, Yasuki; Matsubara, Kosuke; Suzuki, Syouichi; Koshida, Kichiro; Matsunaga, Yuta; Kawaguchi, Ai; Haba, Tomonobu; Toyama, Hiroshi; Kato, Ryouichi

    2017-05-01

    We developed a k-factor-creator software (kFC) that provides the k-factor for CT examination in an arbitrary scan area. It provides the k-factor from the effective dose and dose-length product by Imaging Performance Assessment of CT scanners and CT-EXPO. To assess the reliability, we compared the kFC-evaluated k-factors with those of the International Commission on Radiological Protection (ICRP) publication 102. To confirm the utility, the effective dose determined by coronary computed tomographic angiography (CCTA) was evaluated by a phantom study and k-factor studies. In the CCTA, the effective doses were 5.28 mSv in the phantom study, 2.57 mSv (51%) in the k-factor of ICRP, and 5.26 mSv (1%) in the k-factor of the kFC. Effective doses can be determined from the kFC-evaluated k-factors in suitable scan areas. Therefore, we speculate that the flexible k-factor is useful in clinical practice, because CT examinations are performed in various scan regions. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. arXiv Measurement of the $\\pi^0$ electromagnetic transition form factor slope

    CERN Document Server

    Lazzeroni, C.; Romano, A.; Blazek, T.; Koval, M.; Ceccucci, A.; Danielsson, H.; Falaleev, V.; Gatignon, L.; Goy Lopez, S.; Hallgren, B.; Maier, A.; Peters, A.; Piccini, M.; Riedler, P.; Frabetti, P.L.; Gersabeck, E.; Kekelidze, V.; Madigozhin, D.; Misheva, M.; Molokanova, N.; Movchan, S.; Potrebenikov, Yu.; Shkarovskiy, S.; Zinchenko, A.; Rubin, P.; Baldini, W.; Cotta Ramusino, A.; Dalpiaz, P.; Fiorini, M.; Gianoli, A.; Norton, A.; Petrucci, F.; Savrié, M.; Wahl, H.; Bizzeti, A.; Bucci, F.; Iacopini, E.; Lenti, M.; Veltri, M.; Antonelli, A.; Moulson, M.; Raggi, M.; Spadaro, T.; Eppard, K.; Hita-Hochgesand, M.; Kleinknecht, K.; Renk, B.; Wanke, R.; Winhart, A.; Winston, R.; Bolotov, V.; Duk, V.; Gushchin, E.; Ambrosino, F.; Di Filippo, D.; Massarotti, P.; Napolitano, M.; Palladino, V.; Saracino, G.; Anzivino, G.; Imbergamo, E.; Piandani, R.; Sergi, A.; Cenci, P.; Pepe, M.; Costantini, F.; Doble, N.; Giudici, S.; Pierazzini, G.; Sozzi, M.; Venditti, S.; Balev, S.; Collazuol, G.; DiLella, L.; Gallorini, S.; Goudzovski, E.; Lamanna, G.; Mannelli, I.; Ruggiero, G.; Cerri, C.; Fantechi, R.; Kholodenko, S.; Kurshetsov, V.; Obraztsov, V.; Semenov, V.; Yushchenko, O.; D'Agostini, G.; Leonardi, E.; Serra, M.; Valente, P.; Fucci, A.; Salamon, A.; Bloch-Devaux, B.; Peyaud, B.; Engelfried, J.; Coward, D.; Kozhuharov, V.; Litov, L.; Arcidiacono, R.; Bifani, S.; Biino, C.; Dellacasa, G.; Marchetto, F.; Numao, T.; Retière, F.

    2017-05-10

    The NA62 experiment collected a large sample of charged kaon decays in 2007 with a highly efficient trigger for decays into electrons. A measurement of the $\\pi^{0}$ electromagnetic transition form factor slope parameter from $1.11\\times10^{6}$ fully reconstructed $K^\\pm \\to \\pi^\\pm \\pi^0_D, \\; \\pi^0_D \\to e^+ e^- \\, \\gamma$ events is reported. The measured value $a = \\left(3.68 \\pm 0.57\\right)\\times 10^{-2}$ is in good agreement with theoretical expectations and previous measurements, and represents the most precise experimental determination of the slope in the time-like momentum transfer region.

  14. Psychometric assessment of the patient activation measure short form (PAM-13) in rural settings.

    Science.gov (United States)

    Hung, Man; Carter, Marjorie; Hayden, Candace; Dzierzon, Rhonda; Morales, Jose; Snow, Laverne; Butler, Jorie; Bateman, Kim; Samore, Matthew

    2013-04-01

    The patient activation measure short form (PAM-13) assesses patients' self-reported health management skills, knowledge, confidence, and motivation. We used item response theory to evaluate the psychometric properties of the PAM-13 utilized in rural settings. A Rasch partial credit model analysis was conducted on the PAM-13 instrument using a sample of 812 rural patients recruited by providers and our research staff. Specially, we examined dimensionality, item fit, and quality of measures, category response curves, and item differential functioning. Convergent and divergent validities were also examined. The PAM-13 instrument has excellent convergent and divergent validities. It is fairly unidimensional, and all items fit the Rasch model well. It has relatively high person and item reliability indices. Majority of the items were free of item differential functioning. There were, however, some issues with ceiling effects. Additionally, there was a lack of responses for category one across all items. Patient activation measure short form (PAM-13) performs well in some areas, but not all. In general, more items need to be added to cover the upper end of the trait. The four response categories of PAM-13 should be collapsed into three.

  15. Comments on electromagnetic form factors of the nucleon

    International Nuclear Information System (INIS)

    Sachs, R.G.; Wali, K.C.

    1989-01-01

    This paper draws the concept of nucleon form factors further to consider the electromagnetic aspect based on the magnetic moment of the nucleon. These are seen as valid physical interpretations of form factors in electron-nucleon interactions. A linear combination of two functions, associated with charge radius, is derived, which agreed well with experimental results. The paper also expands the specific form to include relativistic cases and consider appropriate frames of reference. (UK)

  16. Factors affecting the 27K DNA methylation pattern in asthmatic and healthy children from locations with various environments

    Czech Academy of Sciences Publication Activity Database

    Rössnerová, Andrea; Tulupová, Elena; Tabashidze, Nana; Schmuczerová, Jana; Dostál, Miroslav; Rössner ml., Pavel; Gmuender, H.; Šrám, Radim

    2013-01-01

    Roč. 741-742, January (2013), s. 18-26 ISSN 0027-5107 R&D Projects: GA ČR GAP503/11/0084; GA ČR GA13-13458S; GA MŽP(CZ) SP/1B3/8/08 Institutional support: RVO:68378041 Keywords : 27K BeadChip * air pollution * bronchial asthma Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.440, year: 2013

  17. Nucleon mass difference and off-shell form factors

    International Nuclear Information System (INIS)

    Kimel, I.

    1981-08-01

    The use of off-shell form factors in calculating the proton-neutron mass difference is advocated. These form factors appear in a Cottingham rotated Born-like expression for the mass difference and could lead to a good value for Δ = M sub(p) - M sub(n). (Author) [pt

  18. Electromagnetic form factors at large momenta from lattice QCD

    Science.gov (United States)

    Chambers, A. J.; Dragos, J.; Horsley, R.; Nakamura, Y.; Perlt, H.; Pleiter, D.; Rakow, P. E. L.; Schierholz, G.; Schiller, A.; Somfleth, K.; Stüben, H.; Young, R. D.; Zanotti, J. M.; Qcdsf/Ukqcd/Cssm Collaborations

    2017-12-01

    Accessing hadronic form factors at large momentum transfers has traditionally presented a challenge for lattice QCD simulations. Here, we demonstrate how a novel implementation of the Feynman-Hellmann method can be employed to calculate hadronic form factors in lattice QCD at momenta much higher than previously accessible. Our simulations are performed on a single set of gauge configurations with three flavors of degenerate mass quarks corresponding to mπ≈470 MeV . We are able to determine the electromagnetic form factors of the pion and nucleon up to approximately 6 GeV2 , with results for the ratio of the electric and magnetic form factors of the proton at our simulated quark mass agreeing well with experimental results.

  19. Surface sensitivity of nuclear-knock-out form factors

    International Nuclear Information System (INIS)

    Fratamico, G.

    1984-01-01

    A numerical calculation has been performed to investigate the sensitivity of nuclear-knock-out form factors to nuclear-surface behaviour of bound-state wave functions. The result of our investigation suggests that one can extract the bound-state behaviour at the surface from experimental information on nuclear-knock-out form factors

  20. Cluster form factor calculation in the ab initio no-core shell model

    International Nuclear Information System (INIS)

    Navratil, Petr

    2004-01-01

    We derive expressions for cluster overlap integrals or channel cluster form factors for ab initio no-core shell model (NCSM) wave functions. These are used to obtain the spectroscopic factors and can serve as a starting point for the description of low-energy nuclear reactions. We consider the composite system and the target nucleus to be described in the Slater determinant (SD) harmonic oscillator (HO) basis while the projectile eigenstate to be expanded in the Jacobi coordinate HO basis. This is the most practical case. The spurious center of mass components present in the SD bases are removed exactly. The calculated cluster overlap integrals are translationally invariant. As an illustration, we present results of cluster form factor calculations for 5 He vertical bar 4 He+n>, 5 He vertical bar 3 H+d>, 6 Li vertical bar 4 He+d>, 6 Be vertical bar 3 He+ 3 He>, 7 Li vertical bar 4 He+ 3 H>, 7 Li vertical bar 6 Li+n>, 8 Be vertical bar 6 Li+d>, 8 Be vertical bar 7 Li+p>, 9 Li vertical bar 8 Li+n>, and 13 C vertical bar 12 C+n>, with all the nuclei described by multi-(ℎ/2π)Ω NCSM wave functions

  1. Theoretical Study of the Endogenous Production of N-13 in 115 kJ Plasma Focus Device Using Methane Gas

    Science.gov (United States)

    Faghih Haghani, Saeedeh; Sadighzadeh, A.; Talaei, A.; Zaeem, A. A.; Sadat Kiai, S. M.; Heydarnia, A.; Damideh, V.

    2013-08-01

    Mather type plasma focus device with the bank energy of 115 kJ (40 kV, 144μF) was studied for induced activity of N-13; a short-lived radioisotope β+ emitter with 511 keV of gamma rays and has a half-life of t1/2 = 9.93 min through 12C (d, n)13N nuclear reaction. N-13 radioisotope is used in Positron Emission Tomography (PET) for imaging and treatment. In this paper endogenous production of 13N is considered. It is shown by adding 3-4 % CH4 to the chamber, the induced activity of N-13 has increased about 4 %. Our study is representative of producing 106 - 109 Bq induced activity of this SLR in IR-MPF-100 device.

  2. Effects of an electromagnetic quark form factor on meson properties

    International Nuclear Information System (INIS)

    Silvestre-Brac, B.

    2002-01-01

    A form factor is introduced in the quark electromagnetic current. Its effect is analyzed on charge mean square radii and form factors in the mesonic sector. The decay of a vector meson into lepton-antilepton pair is also affected. Two different expressions for the form factors, and two different types of quark potential are tested and some relativistic kinematical corrections are proposed. In any case the introduction of a quark form factor greatly improves the agreement with experimental data

  3. The heavy quark form factors at two loops

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); Behring, A. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); RWTH Aachen Univ. (Germany). Inst. fuer Theoretische Teilchenphysik und Kosmologie; Bluemlein, J.; Freitas, A. de; Marquard, P.; Rana, N. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Falcioni, G. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Nikhef, Amsterdam (Netherlands). Theory Group

    2017-12-15

    We compute the two-loop QCD corrections to the heavy quark form factors in case of the vector, axial-vector, scalar and pseudo-scalar currents up to second order in the dimensional parameter ε=(4-D)/2. These terms are required in the renormalization of the higher order corrections to these form factors.

  4. Artemisinin Resistance-Associated Polymorphisms at the K13-Propeller Locus Are Absent in Plasmodium falciparum Isolates from Haiti

    Science.gov (United States)

    Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.

    2015-01-01

    Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258

  5. The connected prescription for form factors in twistor space

    Energy Technology Data Exchange (ETDEWEB)

    Brandhuber, A.; Hughes, E.; Panerai, R.; Spence, B.; Travaglini, G. [Centre for Research in String Theory, School of Physics and Astronomy,Queen Mary University of London,Mile End Road, London E1 4NS (United Kingdom)

    2016-11-23

    We propose a connected prescription formula in twistor space for all tree-level form factors of the stress tensor multiplet operator in N=4 super Yang-Mills, which is a generalisation of the expression of Roiban, Spradlin and Volovich for superamplitudes. By introducing link variables, we show that our formula is identical to the recently proposed four-dimensional scattering equations for form factors. Similarly to the case of amplitudes, the link representation of form factors is shown to be directly related to BCFW recursion relations, and is considerably more tractable than the scattering equations. We also discuss how our results are related to a recent Grassmannian formulation of form factors, and comment on a possible derivation of our formula from ambitwistor strings.

  6. Form factors of the finite quantum XY-chain

    International Nuclear Information System (INIS)

    Iorgov, Nikolai

    2011-01-01

    Explicit factorized formulas for the matrix elements (form factors) of the spin operators σ x and σ y between the eigenvectors of the Hamiltonian of the finite quantum periodic XY-chain in a transverse field were derived. The derivation is based on the relations between three models: the model of quantum XY-chain, Ising model on 2D lattice and N = 2 Baxter-Bazhanov-Stroganov τ (2) -model. Due to these relations we transfer the formulas for the form factors of the latter model recently obtained by the use of separation of variables method to the model of quantum XY-chain. Hopefully, the formulas for the form factors will help in analysis of multipoint dynamic correlation functions at a finite temperature. As an example, we re-derive the asymptotics of the two-point correlation function in the disordered phase without the use of the Toeplitz determinants and the Wiener-Hopf factorization method.

  7. Paramagnetic form factors from itinerant electron theory

    International Nuclear Information System (INIS)

    Cooke, J.F.; Liu, S.H.; Liu, A.J.

    1985-01-01

    Elastic neutron scattering experiments performed over the past two decades have provided accurate information about the magnetic form factors of paramagnetic transition metals. These measurements have traditionally been analyzed in terms of an atomic-like theory. There are, however, some cases where this procedure does not work, and there remains the overall conceptual problem of using an atomistic theory for systems where the unpaired-spin electrons are itinerant. We have recently developed computer codes for efficiently evaluating the induced magnetic form factors of fcc and bcc itinerant electron paramagnets. Results for the orbital and spin contributions have been obtained for Cr, Nb, V, Mo, Pd, and Rh based on local density bands. By using calculated spin enhancement parameters, we find reasonable agreement between theory and neutron form factor data. In addition, these zero parameter calculations yield predictions for the bulk susceptibility on an absolute scale which are in reasonable agreement with experiment in all treated cases except palladium

  8. Asymptotical behaviour of pion electromagnetic form factor in QCD

    International Nuclear Information System (INIS)

    Efremov, A.V.; Radyushkin, A.V.

    1978-01-01

    In the framework of the renormalizable quantum field theory a new approach is developed to the investigation of asymptotical behaviour of two-particle bound state electromagnetic form factor. It is shown that the behaviour of the pion EM form factor in quantum chromodynamics at sufficiently large momentum transfers is controlled by the short-distance dynamics only. The formula is obtained which expresses the asymptotical behaviour of the pion form factor in terms of the fundamental constants of the theory

  9. Model of separated form factors for unilamellar vesicles

    International Nuclear Information System (INIS)

    Kiselev, M.A.; Aksenov, V.L.; Lesieur, P.; Lombardo, D.; Kiselev, A.M.

    2001-01-01

    A new model of separated form factors is proposed for the evaluation of small-angle neutron scattering curves from large unilamellar vesicles. The validity of the model was checked via comparison with the model of a hollow sphere. The model of separated form factors and the hollow sphere model give a reasonable agreement in the evaluation of vesicle parameters

  10. ELECTROMAGENTIC FORM FACTORS OF THE PROTON AND NEUTRON

    Energy Technology Data Exchange (ETDEWEB)

    Griffy, T. A.; Hofstadter, R.; Hughes, E. B.; Janssens, T.; Yearian, M. R.

    1963-06-15

    Proton form factors in the four-momentum-transfer range q/sup 2/ = 4.6 to 32.0 f/sup -2/ and neutron form factors in the range q/sup 2/ = 2.5 to 10.0 f/ sup -2/ are measured by means of electron elastic scattering by protons and electron inelastic scattering by deuterons. (T.F.H.)

  11. Unconjugated Bilirubin Inhibits Proteolytic Cleavage of von Willebrand Factor by ADAMTS13 Protease

    Science.gov (United States)

    Lu, Rui-Nan; Yang, Shangbin; Wu, Haifeng M.; Zheng, X. Long

    2015-01-01

    Summary Background Bilirubin is a yellow breakdown product of heme catabolism. Increased serum levels of unconjugated bilirubin are conditions commonly seen in premature neonates and adults with acute hemolysis including thrombotic microangiopathy. Previous studies have shown that unconjugated bilirubin lowers plasma ADAMTS13 activity, but the mechanism is not fully understood. Objectives The study is to determine whether unconjugated bilirubin directly inhibits the cleavage of von Willebrand factor (VWF) and its analogs by ADAMTS13. Methods Fluorogenic, SELDI-TOF mass spectrometric assay, and Western blotting analyses were employed to address this question. Results Unconjugated bilirubin inhibits the cleavage of F485-rVWF73-H, D633-rVWF73-H, and GST-rVWF71-11K by ADAMTS13 in a concentration-dependent manner with a half-maximal inhibitory concentration (IC50) of ~13 μM, ~70 μM, and ~17 μM, respectively. Unconjugated bilirubin also dose-dependently inhibits the cleavage of multimeric VWF by ADAMTS13 under denaturing conditions. The inhibitory activity of bilirubin on the cleavage of D633-rVWF73-H and multimeric VWF, but not F485-rVWF73-H, was eliminated after incubation with bilirubin oxidase that converts bilirubin to biliverdin. Furthermore, plasma ADAMTS13 activity in patients with hyperbilirubinemia is lower prior to than after treatment with bilirubin oxidase. Conclusions unconjugated bilirubin directly inhibits ADAMTS13’s ability to cleave both peptidyl and native VWF substrates in addition to its interference with certain fluorogenic assays. Our findings may help proper interpretation of ADAMTS13 results under pathological conditions. Whether elevated serum unconjugated bilirubin has an adverse effect in vivo remains to be determined in our future study. PMID:25782102

  12. Anomaly, mixing and transition form factors of pseudoscalar mesons

    International Nuclear Information System (INIS)

    Klopot, Yaroslav; Oganesian, Armen; Teryaev, Oleg

    2011-01-01

    We derive the exact non-perturbative QCD sum rule for the transition form factors of η and η ′ using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on η,η ′ transition form factors in the range from real to highly virtual photons was obtained.

  13. Parallel Integer Factorization Using Quadratic Forms

    National Research Council Canada - National Science Library

    McMath, Stephen S

    2005-01-01

    .... In 1975, Daniel Shanks used class group infrastructure to modify the Morrison-Brillhart algorithm and develop Square Forms Factorization, but he never published his work on this algorithm or provided...

  14. Baryon form factors at high momentum transfer and generalized parton distributions

    International Nuclear Information System (INIS)

    Stoler, Paul

    2002-01-01

    Nucleon form factors at high momentum transfer t are treated in the framework of generalized parton distributions (GPD's). The possibility of obtaining information about parton high transverse momentum components by application of GPD's to form factors is discussed. This is illustrated by applying an ad hoc 2-body parton wave function to elastic nucleon form factors F 1 and F 2 , the N→Δ transition magnetic form factor G M * , and the wide angle Compton scattering form factor R 1

  15. Anomaly, mixing and transition form factors of pseudoscalar mesons

    Energy Technology Data Exchange (ETDEWEB)

    Klopot, Yaroslav, E-mail: klopot@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Oganesian, Armen, E-mail: armen@itep.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Institute of Theoretical and Experimental Physics, B. Cheremushkinskaya 25, Moscow 117218 (Russian Federation); Teryaev, Oleg, E-mail: teryaev@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation)

    2011-10-15

    We derive the exact non-perturbative QCD sum rule for the transition form factors of {eta} and {eta}{sup Prime} using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on {eta},{eta}{sup Prime} transition form factors in the range from real to highly virtual photons was obtained.

  16. Two-body form factors at high Q2

    International Nuclear Information System (INIS)

    Gross, F.; Keister, B.D.

    1983-02-01

    The charge form factor of a scalar deuteron at high momentum transfer is examined in a model employing scalar nucleons and mesons. With an eye toward establishing consistency criteria for more realistic calculations, several aspects of the model are examined in detail: the role of nucleon and meson singularities in the one-loop impulse diagram, the role of positive-and negative-energy nucleons, and the relationship to time-ordered perturbation theory. It is found that at large Q 2 (1) the form factor is dominated by a term in which the spectator nucleon is on the mass shell, and (2) the meson singularity structure of the d-n-p vertex function is unimportant in determining the overall high-Q 2 behaviour of the form factor

  17. The QCD form factor of massive quarks and applications

    International Nuclear Information System (INIS)

    Moch, S.

    2009-11-01

    We review the electromagnetic form factor of heavy quarks with emphasis on the QCD radiative corrections at two-loop order in the perturbative expansion. We discuss important properties of the heavy-quark form factor such as its exponentiation in the high-energy limit and its role in QCD factorization theorems for massive n-parton amplitudes. (orig.)

  18. 18 CFR 16.13 - Standards and factors for issuing a new license.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Standards and factors for issuing a new license. 16.13 Section 16.13 Conservation of Power and Water Resources FEDERAL... and 15 of the Federal Power Act § 16.13 Standards and factors for issuing a new license. (a) In...

  19. Classical limit of diagonal form factors and HHL correlators

    Energy Technology Data Exchange (ETDEWEB)

    Bajnok, Zoltan [MTA Lendület Holographic QFT Group, Wigner Research Centre,H-1525 Budapest 114, P.O.B. 49 (Hungary); Janik, Romuald A. [Institute of Physics, Jagiellonian University,ul. Łojasiewicza 11, 30-348 Kraków (Poland)

    2017-01-16

    We propose an expression for the classical limit of diagonal form factors in which we integrate the corresponding observable over the moduli space of classical solutions. In infinite volume the integral has to be regularized by proper subtractions and we present the one, which corresponds to the classical limit of the connected diagonal form factors. In finite volume the integral is finite and can be expressed in terms of the classical infinite volume diagonal form factors and subvolumes of the moduli space. We analyze carefully the periodicity properties of the finite volume moduli space and found a classical analogue of the Bethe-Yang equations. By applying the results to the heavy-heavy-light three point functions we can express their strong coupling limit in terms of the classical limit of the sine-Gordon diagonal form factors.

  20. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    Energy Technology Data Exchange (ETDEWEB)

    Safari, L., E-mail: laleh.safari@ist.ac.at [IST Austria (Institute of Science and Technology Austria), Am Campus 1, 3400 Klosterneuburg (Austria); Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Santos, J. P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Amaro, P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Physikalisches Institut, Universität Heidelberg, D-69120 Heidelberg (Germany); Jänkälä, K. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Fratini, F. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Institute of Atomic and Subatomic Physics, TU Wien, Stadionallee 2, 1020 Wien (Austria); Departamento de Física, Instituto de Ciências Exatas, Universidade Federal de Minas Gerais, 31270-901 Belo Horizonte, MG (Brazil)

    2015-05-15

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  1. Skyrme-model πNN form factor and nucleon-nucleon interaction

    International Nuclear Information System (INIS)

    Holzwarth, G.; Machleidt, R.

    1997-01-01

    We apply the strong πNN form factor, which emerges from the Skyrme model, in the two-nucleon system using a one-boson-exchange (OBE) model for the nucleon-nucleon (NN) interaction. Deuteron properties and phase parameters of NN scattering are reproduced well. In contrast to the form factor of monopole shape that is traditionally used in OBE models, the Skyrme form factor leaves low-momentum transfers essentially unaffected while it suppresses the high-momentum region strongly. It turns out that this behavior is very appropriate for models of the NN interaction and makes it possible to use a soft pion form factor in the NN system. As a consequence, the πN and the NN systems can be described using the same πNN form factor, which is impossible with the monopole. copyright 1997 The American Physical Society

  2. Marine Cyclotripeptide X-13 Promotes Angiogenesis in Zebrafish and Human Endothelial Cells via PI3K/Akt/eNOS Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Zhong Pei

    2012-06-01

    Full Text Available Cyclotripeptide X-13 is a core of novel marine compound xyloallenoide A isolated from mangrove fungus Xylaria sp. (no. 2508. We found that X-13 dose-dependently induced angiogenesis in zebrafish embryos and in human endothelial cells, which was accompanied by increased phosphorylation of eNOS and Akt and NO release. Inhibition of PI3K/Akt/eNOS by LY294002 or l-NAME suppressed X-13-induced angiogenesis. The present work demonstrates that X-13 promotes angiogenesis via PI3K/Akt/eNOS pathways.

  3. Perturbative QCD and electromagnetic form factors

    International Nuclear Information System (INIS)

    Carlson, C.E.; Gross, F.

    1987-01-01

    We calculate nucleon magnetic form factors using perturbative QCD for several distribution amplitudes including a general one given in terms of Appell polynomials. We find that the magnitude and sign of both nucleon magnetic form factors can be explained within perturbative QCD. The observed normalization of G/sub Mp/ requires that the distribution amplitude be broader than its superhigh momentum transfer limit, and the G/sub Mn//G/sub Mp/ data may require the distribution amplitude to be asymmetric, in accord with distribution amplitudes derived from QCD sum rules. Some speculation as to how an asymmetric distribution amplitude can come about is offered. Finally, we show that the soft contributions corresponding to the particular distribution amplitudes we use need not be bigger than the data. 16 refs., 6 figs

  4. The development and characterization of an ELISA specifically detecting the active form of cathepsin K

    DEFF Research Database (Denmark)

    Sun, S; Karsdal, M A; Bay-Jensen, A C

    2013-01-01

    Cathepsin K plays essential roles in bone resorption and is intensely investigated as a therapeutic target for the treatment of osteoporosis. Hence an assessment of the active form of cathepsin K may provide important biological information in metabolic bone diseases, such as osteoporosis or anky...

  5. ON THE MEASUREMENT OF THE {sup 13}C(α, n){sup 16}O S-FACTOR AT NEGATIVE ENERGIES AND ITS INFLUENCE ON THE s-PROCESS

    Energy Technology Data Exchange (ETDEWEB)

    La Cognata, M.; Spitaleri, C.; Trippella, O.; Kiss, G. G.; Guardo, G. L.; Puglia, S. M. R.; Romano, S.; Spartà, R. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali del Sud, I-95123, Catania (Italy); Rogachev, G. V.; Avila, M.; Koshchiy, E.; Kuchera, A.; Santiago, D. [Department of Physics, Florida State University, Tallahassee, FL (United States); Mukhamedzhanov, A. M. [Cyclotron Institute, Texas A and M University, College Station, TX (United States); Lamia, L., E-mail: lacognata@lns.infn.it [Dipartimento di Fisica e Astronomia, Università di Catania, I-95123 Catania (Italy)

    2013-11-10

    The {sup 13}C(α, n){sup 16}O reaction is the neutron source for the main component of the s-process, responsible for the production of most of the nuclei in the mass range 90 ∼< A ∼< 208. This reaction takes place inside the helium-burning shell of asymptotic giant branch stars, at temperatures ∼< 10{sup 8} K, corresponding to an energy interval where the {sup 13}C(α, n){sup 16}O reaction is effective in the range of 140-230 keV. In this regime, the astrophysical S(E)-factor is dominated by the –3 keV sub-threshold resonance due to the 6.356 MeV level in {sup 17}O, giving rise to a steep increase in the S-factor. Its contribution is still controversial as extrapolations, e.g., through the R-matrix and indirect techniques such as the asymptotic normalization coefficient (ANC), yield inconsistent results. The discrepancy amounts to a factor of three or more precisely at astrophysical energies. To provide a more accurate S-factor at these energies, we have applied the Trojan horse method (THM) to the {sup 13}C({sup 6}Li, n {sup 16}O)d quasi-free reaction. The ANC for the 6.356 MeV level has been deduced through the THM as well as the n-partial width, allowing us to attain unprecedented accuracy for the {sup 13}C(α, n){sup 16}O astrophysical factor. A larger ANC for the 6.356 MeV level is measured with respect to the ones in the literature, (C-tilde{sub α{sup 1}{sup 3}C}{sup 17O(1/2+)2} = 7.7 ± 0.3{sub stat} {sub -1.5}{sup +1.}|6 norm fm{sup –1}, yet in agreement with the preliminary result given in our preceding letter, indicating an increase of the {sup 13}C(α, n){sup 16}O reaction rate below about 8 × 10{sup 7} K if compared with the recommended values. At ∼10{sup 8} K, our reaction rate agrees with most of the results in the literature and the accuracy is greatly enhanced thanks to this innovative approach.

  6. Evaluation of E2 form factor = 24Mg

    International Nuclear Information System (INIS)

    Marinelli, J.R.; Moreira, J.R.

    1988-11-01

    Longitudinal and transverse electron scattering form factors for the 2 + state at 1.37 Mev of the 24 Mg nucleus was evaluated with rotational model wavefunctions. Four different approaches were used for the transverse E2 form factor: PHF, cranking model, ridig rotor and irrotational flow. For the nuclear intrinsic wavefunction, the Nilsson model was assumed in all approaches yielding the calculation of the form factor in PWBA and DWBA. The results are discussed and compared with a recent measurement performed with 180 0 electron scattered from this state. The DWBA calculation, taking into account first order corrections shows that PHF and irrotational flow models give the best agreements with the available data and compete in quality with more complex calculation performed under the 'shell model' approach. (author) [pt

  7. K-α emission form medium and high-Z materials irradiated by femtosecond laser pulses

    International Nuclear Information System (INIS)

    Limpouch, J.; Klimo, O.; Zhavoronkov, N.; Andreev, A.A.

    2006-01-01

    Complete test of publication follows. Fast electrons are created at the target surface during the interaction of high intensity ultra short laser pulses with solids. Fast electrons penetrate deep into the target where they generate K-α and Bremsstrahlung radiation. Generated high brightness K-α pulses offer the prospect of creating a cheap and compact X-ray source, posing a promising alternative to synchrotron radiation, e.g. in medical application and in material science. With an increase in laser intensity, efficient X-ray emission in the multi-keV range with pulse duration shorter than few picoseconds is expected. This short incoherent but monochromatic X-ray emission synchronized with laser pulses may be used for time-resolved measurements. Acceleration of fast electrons, their transport and K-α photon generation and emission from the target surface in both forward and backward directions are studied here numerically. The results are compared to recent experiments studying K-α emission from the front and rear surface of copper foil targets of various thicknesses and for various parameters of the laser plasma interaction. One-dimensional PIC simulations coupled with 3D time-resolved Monte Carlo simulations show that account of ionization processes and of density profile formed by laser ASE emission is essential for reliable explanation of experimental data. While sub-relativistic intensities are optimum for laser energy transformation into K-α emission for medium-Z targets, relativistic laser intensities have to be used for hard X-ray generation in high-Z materials. The cross-section for K-α shell ionization of high-Z elements by electrons increases or remains approximately constant within a factor of two at relativistic electron energies up to electron energies in the 100-MeV range. Moreover, the splitting ratio of K-α photon emission to Auger electron emission is favorable for high-Z materials, and thus efficient K-α emission is possible. In our

  8. Asymptotic behavior of composite-particle form factors and the renormalization group

    International Nuclear Information System (INIS)

    Duncan, A.; Mueller, A.H.

    1980-01-01

    Composite-particle form factors are studied in the limit of large momentum transfer Q. It is shown that in models with spinor constituents and either scalar or gauge vector gluons, the meson electromagnetic form factor factorizes at large Q 2 and is given by independent light-cone expansions on the initial and final meson legs. The coefficient functions are shown to satisfy a Callan-Symanzik equation. When specialized to quantum chromodynamics, this equation leads to the asymptotic formula of Brodsky and Lepage for the pion electromagnetic form factor. The nucleon form factors G/sub M/(Q 2 ), G/sub E/(Q 2 ) are also considered. It is shown that momentum flows which contribute to subdominant logarithms in G/sub M/(Q 2 ) vitiate a conventional renormalization-group interpretation for this form factor. For large Q 2 , the electric form factor G/sub E/(Q 2 ) fails to factorize, so that a renormalization-group treatment seems even more unlikely in this case

  9. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  10. Up- and Down-Quark Contributions to the Nucleon Form Factors

    Directory of Open Access Journals (Sweden)

    Qattan I. A.

    2014-03-01

    Full Text Available Recent measurements of the neutron s electric to magnetic form factors ratio, Rn = µnGnE/GnM, up to 3.4 (GeV/c2 combined with existing Rp = µpGpE/GpM measurements in the same Q2 range allowed, for the first time, a separation of the up- and downquark contributions to the form factors at high Q2, as presented by Cates, et al.. Our analysis expands on the original work by including additional form factor data, applying two-photon exchange (TPE corrections, and accounting for the uncertainties associated with all of the form factor measurements.

  11. From quarks and gluons to baryon form factors.

    Science.gov (United States)

    Eichmann, Gernot

    2012-04-01

    I briefly summarize recent results for nucleon and [Formula: see text] electromagnetic, axial and transition form factors in the Dyson-Schwinger approach. The calculation of the current diagrams from the quark-gluon level enables a transparent discussion of common features such as: the implications of dynamical chiral symmetry breaking and quark orbital angular momentum, the timelike structure of the form factors, and their interpretation in terms of missing pion-cloud effects.

  12. Inclusive Higgs boson production at the LHC in the kT-factorization approach

    International Nuclear Information System (INIS)

    Abdulov, N.A.; Malyshev, M.A.

    2017-08-01

    We investigate the inclusive Higgs boson production in proton-proton collisions at the CERN LHC conditions using the k T -factorization approach. Our analysis is based on the dominant off-shell gluon-gluon fusion subprocess (where the transverse momenta of initial gluons are taken into account) and covers H→γγ, H→ZZ * →4l (where l=e,μ) and H→W + W - →e ± μ -+ ν anti ν decay channels. The transverse momentum dependent (or unintegrated) gluon densities in a proton were derived from Ciafaloni-Catani-Fiorani-Marchesini equation or, alternatively, were chosen in accordance with Kimber-Martin-Ryskin prescription. We estimate the theoretical uncertainties of our calculations and compare our results with next-to-next-to-leading-order plus next-to-next-to-leading-logarithmic ones obtained using collinear QCD factorization. Our predictions agree well with the latest experimental data taken by the CMS and ATLAS Collaborations at √(s)=8 and 13 TeV.

  13. Electric Form Factor of the Neutron

    Science.gov (United States)

    Feuerbach, Robert

    2007-10-01

    Recent polarization-based precision measurements of the nucleons' elastic electric form factors have led to surprising results. The measurement of the ratio of the proton's electromagnetic form factors, μpGE^p/GM^p, was found to drop nearly linearly with Q^2 out to at least 5 GeV^2, inconsistent with the older Rosenbluth-type experiments. A recent measurement of GE^n, the neutron's electric form-factor saw GE^n does not fall off as quickly as commonly expected up to Q^2 1.5 GeV^2. Extending this study, a precision measurement of GE^n up to Q^2=3.5 GeV^2 was completed in Hall A at Jefferson Lab. The ratio GE^n/GM^n was measured through the beam-target asymmetry A of electrons quasi-elastically scattered off polarized neutrons in the reaction ^3He(e,e' n). The experiment took full advantage of the electron beam, recent target developments, as well as two detectors new to Jefferson Lab. The measurement used the accelerator's 100% duty-cycle high-polarization (typically 84%) electron beam and a new, hybrid optically-pumped polarized ^3He target which achieved in-beam polarizations in excess of 50%. A medium acceptance (80msr) open-geometry magnetic spectrometer (BigBite) detected the scattered electron, while a geometrically matched neutron detector observed the struck neutron. Preliminary results from this measurement will be discussed and compared to modern calculations of GE^n.

  14. Studies of Three-Body Decay of B to J/ψηK and B(Bs to ηcπK*

    Directory of Open Access Journals (Sweden)

    Behnam Mohammadi

    2014-01-01

    Full Text Available We investigate the B0→J/ψηK0 and B+→J/ψηK+ decay by using the Dalitz plot analysis. As we know there are tree, penguin, emission, and emission-annihilation diagrams for these decay modes in the factorization approach. The transition matrix element is factorized into a B→ηK form factor multiplied by J/ψ decay constant and also a B→K form factor multiplied by J/ψη decay constant. According to QCD factorization approach and using the Dalitz plot analysis, we calculate the branching ratios of the B0→J/ψηK0 and B+→J/ψηK+ three-body decay in view of the η-η' mixing and obtain the value of the (9.22-1.47+2.67×10-5, while the experimental results of them are (8±4×10-5 and (10.8±3.3×10-5, respectively. In this research we also analyze the B(Bs→ηcπK* decay which is similar to the previous decay, but there is no experimental data for the last decay. Since for calculations of the B(Bs→ηcπK* decay we use assumptions of the B→J/ψηK decay, we hope that if this decay will be measured by the LHCb in the future, the experimental results will be in agreement with our calculations.

  15. 31 CFR Appendix II to Part 13 - Form of Bill for Reimbursement

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Form of Bill for Reimbursement II Appendix II to Part 13 Money and Finance: Treasury Office of the Secretary of the Treasury PROCEDURES FOR... title) of ______ (Country) to participate in the work of ______ (International Organization) or...

  16. Heavy-to-light form factors for non-relativistic bound states

    International Nuclear Information System (INIS)

    Bell, G.; Feldmann, Th.

    2007-01-01

    We investigate transition form factors between non-relativistic QCD bound states at large recoil energy. Assuming the decaying quark to be much heavier than its decay product, the relativistic dynamics can be treated according to the factorization formula for heavy-to-light form factors obtained from the heavy-quark expansion in QCD. The non-relativistic expansion determines the bound-state wave functions to be Coulomb-like. As a consequence, one can explicitly calculate the so-called 'soft-overlap' contribution to the transition form factor

  17. Validation of surface crack stress intensity factors of a tubular K-joint

    International Nuclear Information System (INIS)

    Lie, S.T.; Lee, C.K.; Chiew, S.P.; Shao, Y.B.

    2005-01-01

    Tubular K-joints are encountered widely in offshore structures, and the prediction of damaged joints depends very much on the accuracy of stress intensity factor solutions (SIFs). No parametric equations and very few results have been proposed and published in the literature for estimating the SIFs of any K-joints subjected to complex loading conditions. In this paper, a mesh generation method proposed previously for the Y-joint and T-joint has been extended to the K-joint. This method is realized by dividing the K-joint into several sub-zones with each zone consisting of different types of elements and mesh densities. This method has a distinct advantage of controlling the mesh quality, and most importantly the aspect ratio of the elements along the crack front. When the mesh of all the sub-zones has been generated automatically and completely, they are merged to form the complete model. The two most commonly used methods, namely the J-integral and displacement extrapolation, are used to evaluate the SIF values along the crack front of a typical K-joint. To validate the accuracy of these computed SIFs, a full-scale K-joint specimen was tested to failure under fatigue loading conditions. The standard alternating current potential drop (ACPD) technique was used to monitor the rate of crack propagation of the surface crack located at the hot spot stress region. Using the given material parameters C and m, the experimental SIFs were deduced, and they are found to be in good agreement with the computed SIFs obtained from the generated models. Hence, the proposed finite element models are both efficient and reliable

  18. Conformal symmetry and pion form factor: Soft and hard contributions

    International Nuclear Information System (INIS)

    Choi, Ho-Meoyng; Ji, Chueng-Ryong

    2006-01-01

    We discuss a constraint of conformal symmetry in the analysis of the pion form factor. The usual power-law behavior of the form factor obtained in the perturbative QCD analysis can also be attained by taking negligible quark masses in the nonperturbative quark model analysis, confirming the recent AdS/CFT correspondence. We analyze the transition from soft to hard contributions in the pion form factor considering a momentum-dependent dynamical quark mass from an appreciable constituent quark mass at low momentum region to a negligible current quark mass at high momentum region. We find a correlation between the shape of nonperturbative quark distribution amplitude and the amount of soft and hard contributions to the pion form factor

  19. Electromagnetic form factors at large momenta from lattice QCD

    International Nuclear Information System (INIS)

    Chambers, Alexander J.; Dragos, J.; Michigan State Univ., East Lansing, MI; Horsley, R.

    2017-01-01

    Accessing hadronic form factors at large momentum transfers has traditionally presented a challenge for lattice QCD simulations. Here we demonstrate how a novel implementation of the Feynman-Hellmann method can be employed to calculate hadronic form factors in lattice QCD at momenta much higher than previously accessible. Our simulations are performed on a single set of gauge configurations with three flavours of degenerate mass quarks corresponding to m_π∼470 MeV. We are able to determine the electromagnetic form factors of the pion and nucleon up to approximately 6 GeV"2, with results for G_E/G_M in the proton agreeing well with experimental results.

  20. Effect of thyroid status on the development of the different molecular forms of Na+,K+-ATPase in rat brain.

    Science.gov (United States)

    Atterwill, C K; Reid, J; Athayde, C M

    1985-05-01

    The effect of thyroid status on the postnatal development of the two molecular forms of Na+,K+-ATPase, distinguished kinetically on the basis of their ouabain sensitivity, was examined in rat brain. Hypothyroidism induced by PTU from day 1 postnatally significantly reduced the Na+,K+-ATPase activity in cerebellum (22-30 days) but not forebrain, whereas hyperthyroidism (T4 treatment from day 1) had no effect. The hypothyroidism-induced reduction in cerebellum was reflected by a 20-45% reduction in the activity of the alpha(+) form of Na+,K+-ATPase (high ouabain affinity) against control brains compared to a 60-70% reduction in the activity of the alpha form (low ouabain affinity). These results show that neonatally induced hypothyroidism leads to a selectively greater impairment of the ontogenesis of the activity of cerebellar alpha form of Na+,K+-ATPase. This may possibly reflect a retarded development of a selective cerebellar cell population containing predominantly the alpha form of the enzyme.

  1. Consolidation of the 13 kA Interconnects in the LHC for Operation at 7 TeV

    CERN Document Server

    Verweij, A P; Tock, J P; Willering, G P; Steckert, J; Perin, A; Scheuerlein, C; Mathot, S; Koratzinos, M; Garion, C; Denz, R; Fessia, P; Charifoulline, Z; Bertinelli, F; Sgobba, S; ten Kate, H H J

    2011-01-01

    The accident in the LHC in September 2008 occurred in an interconnection between two magnets of the 13 kA dipole circuit. Successive measurements of the resistance of other interconnects revealed other defective joints, even though the SC cables were properly connected. These defective joints are characterized by a poor bonding between the SC cable and the copper stabilizer in combination with an electrical discontinuity in the copper stabilizer. A quench at the 7-13 kA level in such a joint can lead to a fast and unprotected thermal run-away and hence opening of the circuit. It has therefore been decided to operate the LHC at a reduced and safe current of 6 kA corresponding to 3.5 TeV beam energy until all defective joints are repaired. A task force is reviewing the status of all electrical joints in the magnet circuits and preparing for the necessary repairs. The principle solution is to resolder the worst defective joints and, in addition, to apply an electrical shunt made of copper across all joints with ...

  2. The Usage of the K Factor in Heavy Ion Physics

    International Nuclear Information System (INIS)

    Vogt, R.

    2003-02-01

    The theoretical K factor, describing the difference between the leading and higher order cross sections, has no precise definition. The definition is sensitive to the order of the fit to the parton densities and the number of loops at which alpha s is evaluated. We describe alternate ways to define the K factor and show how the definition affects its magnitude and shape for examples of hadro production of W+ bosons, Drell-Yan lepton pairs, and heavy quarks. We discuss which definition is appropriate under certain circumstances

  3. Fabrication and properties of aluminum silicate fibrous materials with in situ synthesized K2Ti6O13 whiskers

    Science.gov (United States)

    Liu, Hao; Wei, Nan; Wang, Zhou-fu; Wang, Xi-tang; Ma, Yan

    2017-11-01

    To improve their mechanical and thermal insulation properties, aluminum silicate fibrous materials with in situ synthesized K2Ti6O13 whiskers were prepared by firing a mixture of short aluminum silicate fibers and gel powders obtained from a sol-gel process. During the preparation process, the fiber surface was coated with K2Ti6O13 whiskers after the fibers were subjected to a heat treatment carried out at various temperatures. The effects of process parameters on the microstructure, compressive strength, and thermal conductivity were analyzed systematically. The results show that higher treatment temperatures and longer treatment durations promoted the development of K2Ti6O13 whiskers on the surface of aluminum silicate fibers; in addition, the intersection structure between whiskers modulated the morphology and volume of the multi-aperture structure among fibers, substantially increasing the fibers' compressive strength and reducing their heat conduction and convective heat transfer at high temperatures.

  4. Hyperon decay form factors in chiral perturbation theory

    International Nuclear Information System (INIS)

    Lacour, Andre; Kubis, Bastian; Meissner, Ulf-G.

    2007-01-01

    We present a complete calculation of the SU(3)-breaking corrections to the hyperon vector form factors up to O(p 4 ) in covariant baryon chiral perturbation theory. Partial higher-order contributions are obtained, and we discuss chiral extrapolations of the vector form factor at zero momentum transfer. In addition we derive low-energy theorems for the subleading moments in hyperon decays, the weak Dirac radii and the weak anomalous magnetic moments, up to O(p 4 )

  5. 17 CFR 249.619 - Form TA-Y2K, information required of transfer agents pursuant to section 17 of the Securities...

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form TA-Y2K, information... Certain Exchange Members, Brokers, and Dealers § 249.619 Form TA-Y2K, information required of transfer... affecting Form TA-Y2K, see the List of CFR Sections Affected, which appears in the Finding Aids section of...

  6. Form factor expansion for thermal correlators

    NARCIS (Netherlands)

    Pozsgay, B.; Takács, G.

    2010-01-01

    We consider finite temperature correlation functions in massive integrable quantum field theory. Using a regularization by putting the system in finite volume, we develop a novel approach (based on multi-dimensional residues) to the form factor expansion for thermal correlators. The first few terms

  7. Covariance dynamics and symmetries, and hadron form factors

    International Nuclear Information System (INIS)

    Bhagwat, M.S.; Cloet, I.C.; Roberts, C.D.

    2007-01-01

    We summarize applications of Dyson-Schwinger equations to the theory and phenomenology of hadrons. Some exact results for pseudoscalar mesons are highlighted with details relating to the U A (1) problem. We describe inferences from the gap equation relating to the radius of convergence for expansions of observables in the current-quark mass. We recapitulate upon studies of nucleon electromagnetic form factors, providing a comparison of the ln-weighted ratios of Pauli and Dirac form factors for the neutron and proton.

  8. Deuteron form factor measurements at low momentum transfers

    Directory of Open Access Journals (Sweden)

    Schlimme B. S.

    2016-01-01

    Full Text Available A precise measurement of the elastic electron-deuteron scattering cross section at four-momentum transfers of 0.24 fm−1 ≤ Q ≤ 2.7 fm−1 has been performed at the Mainz Microtron. In this paper we describe the utilized experimental setup and the necessary analysis procedure to precisely determine the deuteron charge form factor from these data. Finally, the deuteron charge radius rd can be extracted from an extrapolation of that form factor to Q2 = 0.

  9. Analysis of K/sup -/K/sup +/ and. pi. /sup -/. pi. /sup +/ final states in 13 GeV K/sup -/p interactions. [Differential cross sections, density matrix elements, branching ratio

    Energy Technology Data Exchange (ETDEWEB)

    Brandenburg, G W; Carnegie, R K; Cashmore, R J; Davier, M; Lasinski, T A; Leith, D W.G.S.; Mathews, J A.J.; Walden, P; Williams, S H [Stanford Linear Accelerator Center, Calif. (USA)

    1976-03-01

    The differential cross sections and density matrix elements for the phi and rho/sup 0/ mesons have been measured in the reactions K/sup -/p..-->..K/sup -/K/sup +/(..lambda..,..sigma../sup 0/) and K/sup -/p..--> pi../sup -/..pi../sup +/(..lambda..,..sigma../sup 0/) at 13 GeV using a wire chamber spectrometer. The analysis shows that while the vector meson production is dominated by the natural parity exchange amplitude, some unnatural parity exchange is also required. Furthermore the phi and rho natural exchange cross sections are identical in shape and have the 2:1 relative strength expected in the quark model with K* and K** exchange degeneracy. The analysis of the clear peak-dip rho/sup 0/-..omega.. interference pattern observed in the ..pi../sup -/..pi../sup +/ data indicates that the ..omega.. production is in phase with the rho and of similar magnitude. Both the S* and f' meson are clearly observed in this experiment. The S* data are found to be consistent with S* parameters deduced from ..pi pi.. scattering analyses. The f' density matrix elements and a new limit on the f'..--> pi../sup -/..pi../sup +/ branching ratio are presented.

  10. Mechanism and Influencing Factors of Iron Nuggets Forming in Rotary Hearth Furnace Process at Lower Temperature

    Science.gov (United States)

    Han, Hongliang; Duan, Dongping; Chen, Siming; Yuan, Peng

    2015-10-01

    In order to improve the efficiency of slag and iron separation, a new idea of "the separation of slag (solid state) and iron (molten state) in rotary hearth furnace process at lower temperature" is put forward. In this paper, the forming process of iron nuggets has been investigated. Based on those results, the forming mechanisms and influencing factors of iron nugget at low temperature are discussed experimentally using an electric resistance furnace simulating a rotary hearth furnace process. Results show that the reduction of iron ore, carburization of reduced iron, and the composition and quantity of slag are very important for producing iron nuggets at lower temperature. Reduction reaction of carbon-containing pellets is mainly at 1273 K and 1473 K (1000 °C and 1200 °C). When the temperature is above 1473 K (1200 °C), the metallization rate of carbon-containing pellets exceeds 93 pct, and the reduction reaction is substantially complete. Direct carburization is the main method for carburization of reduced iron. This reaction occurs above 1273 K (1000 °C), with carburization degree increasing greatly at 1473 K and 1573 K (1200 °C and 1300 °C) after particular holding times. Besides, to achieve the "slag (solid state) and iron (molten state) separation," the melting point of the slag phase should be increased. Slag (solid state) and iron (molten state) separation can be achieved below 1573 K (1300 °C), and when the holding time is 20 minutes, C/O is 0.7, basicity is less than 0.5 and a Na2CO3 level of 3 pct, the recovery rate of iron can reach 90 pct, with a proportion of iron nuggets more than 3.15 mm of nearly 90 pct. This study can provide theoretical and technical basis for iron nugget production.

  11. Calculation of the Nucleon Axial Form Factor Using Staggered Lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Aaron S. [Fermilab; Hill, Richard J. [Perimeter Inst. Theor. Phys.; Kronfeld, Andreas S. [Fermilab; Li, Ruizi [Indiana U.; Simone, James N. [Fermilab

    2016-10-14

    The nucleon axial form factor is a dominant contribution to errors in neutrino oscillation studies. Lattice QCD calculations can help control theory errors by providing first-principles information on nucleon form factors. In these proceedings, we present preliminary results on a blinded calculation of $g_A$ and the axial form factor using HISQ staggered baryons with 2+1+1 flavors of sea quarks. Calculations are done using physical light quark masses and are absolutely normalized. We discuss fitting form factor data with the model-independent $z$ expansion parametrization.

  12. Magnetic form factor of NpAs2: a crystal field wave function for 5f electrons

    International Nuclear Information System (INIS)

    Amoretti, G.; Blaise, A.; Bonnet, M.; Boucherle, J.X.; Delapalme, A.; Fournier, J.M.; Vigneron, F.

    1982-10-01

    Neptunium magnetic form factor measurements in the ferromagnetic phase of NpAs 2 (T = 4.2 K, H = 4.6 T) are analysed under different assumptions: Np 3 + , Np 4 + or Np 5 + , with a free ion wave-function (Russel-Saunders and intermediate coupling scheme) or with a Crystal Field Wave function for 5f electrons: sub(m)sup(μ)asub(m)asub(m)/J,m>. The experimental results are compatible with either a 3+ or 4+ state

  13. Helicity non-conserving form factor of the proton

    Energy Technology Data Exchange (ETDEWEB)

    Voutier, E.; Furget, C.; Knox, S. [Universite Joseph Fourier, Grenoble (France)] [and others

    1994-04-01

    The study of the hadron structure in the high Q{sup 2} range contributes to the understanding of the mechanisms responsible for the confinement of quarks and gluons. Among the numerous experimental candidates sensitive to these mechanisms, the helicity non-conserving form factor of the proton is a privileged observable since it is controlled by non-perturbative effects. The authors investigate here the feasibility of high Q{sup 2} measurements of this form factor by means of the recoil polarization method in the context of the CEBAF 8 GeV facility. For that purpose, they discuss the development of a high energy proton polarimeter, based on the H({rvec p},pp) elastic scattering, to be placed at the focal plane of a new hadron spectrometer. It is shown that this experimental method significantly improves the knowledge of the helicity non-conserving form factor of the proton up to 10 GeV{sup 2}/c{sup 2}.

  14. Analytic properties of form factors in strictly confining models

    International Nuclear Information System (INIS)

    Csikor, F.

    1979-12-01

    An argument is presented showing that strict confinement implies the possible existence of an (unwanted) branch point at q 2 =0 in the form factors. In case of a bag extended to infinity in the relative time, the branch point is certainly there (provided that the form factor is non zero at q 2 =0). (author)

  15. Master integrals for the four-loop Sudakov form factor

    International Nuclear Information System (INIS)

    Boels, Rutger; Kniehl, Bernd A.; Yang, Gang; Chinese Academy of Sciences, Beijing

    2015-08-01

    The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N=4) supersymmetric Yang-Mills theory (SYM) in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. Probably the simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was obtained in integrand form in a previous work for N=4 SYM, up to a single parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP) identities using (a tweaked version of) Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. The appearing master integrals are cross-checked using algebraic techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N=4 SYM and beyond are identified.

  16. Model for next-to-leading order threshold resummed form factors

    International Nuclear Information System (INIS)

    Aglietti, Ugo; Ricciardi, Giulia

    2004-01-01

    We present a model for next-to-leading order resummed threshold form factors based on a timelike coupling recently introduced in the framework of small x physics. Improved expressions for the form factors in N-space are obtained which are not plagued by Landau-pole singularities, as the included absorptive effects - usually neglected - act as regulators. The physical reason is that, because of faster decay of gluon jets, there is not enough resolution time to observe the Landau pole. Our form factors reduce to the standard ones when the absorptive parts related to the coupling are neglected. The inverse transform from N-space to x-space can be done directly without any prescription and we obtain analytical expressions for the form factors, which are well defined in all x-space

  17. DSM-IV-TR "pain disorder associated with psychological factors" as a nonhysterical form of somatization.

    Science.gov (United States)

    Aragona, Massimiliano; Tarsitani, Lorenzo; De Nitto, Serena; Inghilleri, Maurizio

    2008-01-01

    Elevated Minnesota Multiphasic Personality Inventory (MMPI) scores on the hysteria (Hy) scale are reported in several forms of pain. Previous results were possibly biased by diagnostic heterogeneity (psychogenic, somatic and mixed pain syndromes included in the same index sample) or Hy heterogeneity (failure to differentiate Hy scores into clinically meaningful subscales, such as admission of symptoms [Ad] and denial of symptoms [Dn]). To overcome this drawback, 48 patients diagnosed as having a Diagnostic and Statistical Manual of Mental Disorders, 4th edn, Text Revision (DSM-IV-TR) diagnosis of "pain disorder associated with psychological factors" were compared with 48 patients experiencing somatic pain excluding psychological factors, and 42 somatic controls without pain. MMPI Hy and hypochondriasis (Hs) scores were significantly higher in the pain disorder group than in control groups, who scored similarly. MMPI correction (K) scores and Dn scores were similar in the three groups, whereas Ad was significantly higher in the pain disorder group and lower and similar in the two control groups, respectively. In the pain disorder group, Ad and Dn were negatively correlated, whereas in control groups they were unrelated. These findings suggest that whereas a pattern of high Hs and Hy scores together with a normal K score might characterize patients with a pain disorder associated with psychological factors, elevated Hy scores per se do not indicate hysterical traits. In the pain disorder group, elevated Hy scores reflected the Ad subscale alone, indicating a strikingly high frequency of distressing somatic symptoms. They tend not to repress or deny the emotional malaise linked to symptoms, as the hysterical construct expects. The pain disorder designation should be considered a nonhysterical form of somatization.

  18. Pharmacological effects and potential therapeutic targets of DT-13.

    Science.gov (United States)

    Khan, Ghulam Jilany; Rizwan, Mohsin; Abbas, Muhammad; Naveed, Muhammad; Boyang, Yu; Naeem, Muhammad Ahsan; Khan, Sara; Yuan, Shengtao; Baig, Mirza Muhammad Faran Ashraf; Sun, Li

    2018-01-01

    DT-13 is an isolated compound from Dwarf lillytruf tuber and currently among active research drugs by National Natural Science foundation of China for its several potential effects. The drug has been reported for its multiple pharmacological actions however no thorough review studies are available on it. Our present study is highlighting the pros and cons of DT-13 focusing on its potential pharmacological actions, therapeutic utilization and further exploration for novel targets. The drug possesses very low toxicity profile, quick onset and long duration of action with slow elimination that combinely makes it favorable for the clinical studies. In vivo and in vitro studies show that the drug regulates multiple cellular functions for its several pharmacological effects including, anti-adhesive effects via regulation of tissue factor and transforming growth factor; anti-migratory effects through indirect regulation of NM-IIA in the tumor microenvironment, Tissue factor, down-regulation of CCR5-CCL5 axis and MMP-2/9 inhibition; anti-metastatic effects via regulation of MMPs and tissue factor; pro-apoptotic effects by modulation of endocytosis of EGF receptor; anti-angiogenic effects via regulation of HIF-1α,ERK, Akt signalling and autophagy inducing characteristics by regulating PI3K/Akt/mTOR signalling pathway. In addition to anti-tumor activities, DT-13 has significant anti-inflammatory, cardioprotective, hepatoprotective and immunomodulating effects. Pharmaceutical dosage form and targeted drug delivery system for DT-13 has not been established yet. Moreover, DT-13, has not been studied for its action on brain, colorectal, hepatic, pancreatic, prostate and blood cancers. Similarly the effects of drug on carbohydrate and glucose metabolism is another niche yet to be explored. In some traditional therapies, crude drug from the plant is used against diabetic and neurological disorders that are not reported in scientific literature, however due to profound effects of

  19. IL-13-induced proliferation of airway epithelial cells: mediation by intracellular growth factor mobilization and ADAM17

    Directory of Open Access Journals (Sweden)

    Sandifer Tracy

    2007-07-01

    Full Text Available Abstract Background The pleiotrophic cytokine interleukin (IL-13 features prominently in allergic and inflammatory diseases. In allergic asthma, IL-13 is well established as an inducer of airway inflammation and tissue remodeling. We demonstrated previously that IL-13 induces release of transforming growth factor-α (TGFα from human bronchial epithelial cells, with proliferation of these cells mediated by the autocrine/paracrine action of this growth factor. TGFα exists as an integral membrane protein and requires proteolytic processing to its mature form, with a disintegrin and metalloproteinase (ADAM17 responsible for this processing in a variety of tissues. Methods In this study, normal human bronchial epithelial (NHBE cells grown in air/liquid interface (ALI culture were used to examine the mechanisms whereby IL-13 induces release of TGFα and cellular proliferation. Inhibitors and antisense RNA were used to examine the role of ADAM17 in these processes, while IL-13-induced changes in the intracellular expression of TGFα and ADAM17 were visualized by confocal microscopy. Results IL-13 was found to induce proliferation of NHBE cells, and release of TGFα, in an ADAM17-dependent manner; however, this IL-13-induced proliferation did not appear to result solely from ADAM17 activation. Rather, IL-13 induced a change in the location of TGFα expression from intracellular to apical regions of the NHBE cells. The apical region was also found to be a site of significant ADAM17 expression, even prior to IL-13 stimulation. Conclusion Results from this study indicate that ADAM17 mediates IL-13-induced proliferation and TGFα shedding in NHBE cells. Furthermore, they provide the first example wherein a cytokine (IL-13 induces a change in the intracellular expression pattern of a growth factor, apparently inducing redistribution of intracellular stores of TGFα to the apical region of NHBE cells where expression of ADAM17 is prominent. Thus, IL-13

  20. Normalization Of Thermal-Radiation Form-Factor Matrix

    Science.gov (United States)

    Tsuyuki, Glenn T.

    1994-01-01

    Report describes algorithm that adjusts form-factor matrix in TRASYS computer program, which calculates intraspacecraft radiative interchange among various surfaces and environmental heat loading from sources such as sun.

  1. Simple parametrization of nucleon form factors

    International Nuclear Information System (INIS)

    Kelly, J.J.

    2004-01-01

    This Brief Report provides simple parametrizations of the nucleon electromagnetic form factors using functions of Q 2 that are consistent with dimensional scaling at high Q 2 . Good fits require only four parameters each for G Ep , G Mp , and G Mn and only two for G En

  2. Data on the electromagnetic pion form factor and p-wave

    International Nuclear Information System (INIS)

    Dubnicka, S.; Meshcheryakov, V.A.; Milko, J.

    1980-01-01

    The pion form factor absolute value data (free of the omega meson contribution) are unified with the P-wave isovector ππ phase shift. The resultant real and imaginary parts of the pion form factor are described by means of the Pade approximation. All the data, which involve the pion form factor experimental points from the range of momenta - 0.8432 GeV 2 2 , the pion charge radius, and the P-wave isovector ππ phase shift in the elastic region (including also the generally accepted value of the scattering length) are mutually consistent. The data themselves through the Pade approximation reveal that the aforementioned consistency can be achieved only if the pion form factor left-hand cut from the second Riemann sheet is taken into account. Almost in all of the considered Pade approximations one stable pion form factor zero is found in the space-like region, which might indicate the existence of a diffraction minimum in the differential cross section for elastic e - π scattering as a consequence of the constituent structure of the pion like in the case of the electron elastic scattering on nuclei

  3. A 13 kA current lead, measuring 1.5 m in length. The lower part consists of a high-temperature superconductor (Bi-2223), operating at between 50 K and 4.5 K, while the heat-exchanger upper part allows the current to be brought from room temperature to 50 K.

    CERN Multimedia

    2004-01-01

    A 13 kA current lead, measuring 1.5 m in length. The lower part consists of a high-temperature superconductor (Bi-2223), operating at between 50 K and 4.5 K, while the heat-exchanger upper part allows the current to be brought from room temperature to 50 K.

  4. Two classes of ouabain binding sites in ferret heart and two forms of Na+-K+-ATPase

    Energy Technology Data Exchange (ETDEWEB)

    Ng, Y.C.; Akera, T.

    1987-05-01

    In partially purified Na+-K+-adenosinetriphosphatase (ATPase) obtained from ferret heart, ouabain produced a monophasic inhibition curve; however, the curve spanned over 5 logarithmic units, indicating the presence of more than one classes of enzyme. (/sup 3/H)ouabain binding studies revealed high-and low-affinity binding sites in approximately equal abundance, with apparent dissociation constants of 10 and 230 nM, respectively. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of phosphoenzyme formed from (gamma-/sup 32/P)ATP showed two distinct K+-sensitive bands of approximately 100,000 molecular weight. Phosphoenzyme formation from the high-molecular-weight alpha(+) form was selectively inhibited by N-ethylmaleimide. Ouabain caused a 50% inhibition of phosphorylation of the alpha(+) form at 40 nM and the lower-molecular-weight alpha form at 300 nM. In papillary muscle preparations, 1-30 nM ouabain produced a modest positive inotropic effect that reached an apparent plateau at 30 nM. Further increases in ouabain concentrations, however, produced additional and prominent inotropic effects at 0.1-10 microM. These results indicate for the first time in cardiac muscle that the high- and low-affinity ouabain binding sites are associated with the alpha(+) and alpha forms of the Na+-K+-ATPase, respectively, and that binding of ouabain to either of these sites causes enzyme inhibition and the positive inotropic effect.

  5. The B → D*lv form factor at zero recoil

    International Nuclear Information System (INIS)

    Simone, J.N.; Hashimoto, S.; El-Khadra, A.X.; Kronfeld, A.S.; Mackenzie, P.B.; Ryan, S.M.

    2000-01-01

    We describe a model independent lattice QCD method for determining the deviation from unity for h A1 (1), the B → D*lv form factor at zero recoil. We extend the double ratio method previously used to determine the B → Dlv form factor. The bulk of statistical and systematic errors cancel in the double ratios we consider, yielding form factors which promise to reduce present theoretical uncertainties in the determination of parallel V cb parallel. We present results from a prototype calculation at a single lattice spacing corresponding to β = 5.7

  6. Measurement of B -> D Form Factors in the Semileptonic Decay B -> D* l nu at BaBar

    Energy Technology Data Exchange (ETDEWEB)

    Gill, Mandeep Singh; /SLAC

    2006-01-27

    We present here the results of a measurement of the three semileptonic form factors involved in the decay B{sup 0} {yields} D*{ell}{nu}, where {ell} is one of the two light charged leptons (i.e. an electron or muon--though the final results in this work are determined only for {ell} = electron). This measurement uses the Babar 2000-2002 data set, which is altogether approximately 85 x 10{sup 6} B{bar B}-pairs in 78 fb{sup -1} of integrated luminosity. The D*{sup +} was reconstructed in the channel D*{sup +} {yields} D{sup 0}{pi}{sup +}, and the D{sup 0} in the channel D{sup 0} {yields} K{sup -}{pi}{sup +}. This analysis was based ultimately on {approx} 16,386 reconstructed events with an estimated background contamination of {approx} 15%. The method of the measurement was to perform a unbinned maximum likelihood fit in the four kinematic variables that describe the decay for the three form factor parameters R{sub 1}, R{sub 2}, and {rho}{sup 2}. The results obtained for the form factor ratios are R{sub 1} = 1.328 {+-} 0.055 {+-} 0.025 {+-} 0.025 and R{sub 2} = 0.920 {+-} 0.044 {+-} 0.020 {+-} 0.013 for the ratios and {rho}{sup 2} = 0.769 {+-} 0.039 {+-} 0.019 {+-} 0.032 for the form factor slope. The errors given are statistical, Monte Carlo statistical and systematic respectively.

  7. Inclusive Higgs boson production at the LHC in the k{sub T}-factorization approach

    Energy Technology Data Exchange (ETDEWEB)

    Abdulov, N.A. [Lomonosov Moscow State Univ. (Russian Federation). Faculty of Physics; Lipatov, A.V. [Lomonosov Moscow State Univ. (Russian Federation). Skobeltsyn Inst. of Nuclear Physics; Joint Institute for Nuclear Research, Dubna (Russian Federation); Malyshev, M.A. [Lomonosov Moscow State Univ. (Russian Federation). Skobeltsyn Inst. of Nuclear Physics

    2017-08-15

    We investigate the inclusive Higgs boson production in proton-proton collisions at the CERN LHC conditions using the k{sub T}-factorization approach. Our analysis is based on the dominant off-shell gluon-gluon fusion subprocess (where the transverse momenta of initial gluons are taken into account) and covers H→γγ, H→ZZ{sup *}→4l (where l=e,μ) and H→W{sup +}W{sup -}→e{sup ±}μ{sup -+}ν anti ν decay channels. The transverse momentum dependent (or unintegrated) gluon densities in a proton were derived from Ciafaloni-Catani-Fiorani-Marchesini equation or, alternatively, were chosen in accordance with Kimber-Martin-Ryskin prescription. We estimate the theoretical uncertainties of our calculations and compare our results with next-to-next-to-leading-order plus next-to-next-to-leading-logarithmic ones obtained using collinear QCD factorization. Our predictions agree well with the latest experimental data taken by the CMS and ATLAS Collaborations at √(s)=8 and 13 TeV.

  8. Nucleon electromagnetic form factors from lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Koutsou, G.; Negele, J. W.; Tsapalis, A.

    2006-01-01

    We evaluate the isovector nucleon electromagnetic form factors in quenched and unquenched QCD on the lattice using Wilson fermions. In the quenched theory we use a lattice of spatial size 3 fm at β=6.0 enabling us to reach low momentum transfers and a lowest pion mass of about 400 MeV. In the unquenched theory we use two degenerate flavors of dynamical Wilson fermions on a lattice of spatial size 1.9 fm at β=5.6 and lowest pion mass of about 380 MeV enabling comparison with the results obtained in the quenched theory. that unquenching effects are small for the pion masses considered in this work. We compare our lattice results to the isovector part of the experimentally measured form factors

  9. Nucleon form factors. Probing the chiral limit

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Physik-Dept.; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)

    2006-10-15

    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  10. Nucleon form factors. Probing the chiral limit

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.

    2006-10-01

    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  11. Small Form Factor RFID Applicator, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The proposed development of a small form factor Astrobee dedicated RFID label applicator will allow current and future free flying vehicles to place RFID labels...

  12. Non-perturbative QCD Effect on K-Factor of Drell-Yan Process

    International Nuclear Information System (INIS)

    Hou Zhaoyu; Zhi Haisu; Chen Junxiao

    2006-01-01

    By using a non-perturbative quark propagator with the lowest-dimensional condensate contributions from the QCD vacuum, the non-perturbative effect to K-factor of the Drell-Yan process is numerically investigated for 12 6 C- 12 6 C collision at the center-of-mass energy (s) 1/2 = 200 GeV, 630 GeV respectively. Calculated results show that the non-perturbative QCD effect has just a weak influence on K-factor in the two cases.

  13. Nucleoli in human early erythroblasts (K2, K1, K1/2 cells).

    Science.gov (United States)

    Smetana, K; Jirásková, I; Klamová, H

    2005-01-01

    Human early erythroid precursors classified according to the nuclear size were studied to provide information on nucleoli in these cells using simple cytochemical procedures for demonstration of RNA and proteins of silver-stained nucleolar organizers. K2 cells with nuclear diameter larger than 13 microm and K1 cells with nuclear diameter larger than 9 microm corresponding to proerythroblasts and macroblasts (large basophilic erythroblasts) mostly possessed large irregularly shaped nucleoli with multiple fibrillar centres representing "active nucleoli". K1/2 cells with nuclear diameter smaller than 9 microm corresponding to small basophilic erythroblasts were usually characterized by the presence of micronucleoli representing "inactive nucleolar types". On the other hand, a few K1/2 cells contained large nucleoli with multiple fibrillar centres similar to those present in K2 cells and thus appeared as "microproerythroblasts". The nucleolar asynchrony expressed by the presence of large irregularly shaped nucleoli with multiple nucleoli (active nucleoli) and ring-shaped nucleoli (resting nucleoli) in one and the same nucleus of K2 or K1 cells was not exceptional and might reflect a larger resistance of these cells to negative factors influencing the erythropoiesis. The intranucleolar translocation of silver-stained nucleolus organized regions was noted in K2 cells and might indicate the premature aging of these cells without further differentiation. More studies, however, are required in this direction.

  14. Inactivation of dhaD and dhaK abolishes by-product accumulation during 1,3-propanediol production in Klebsiella pneumoniae.

    Science.gov (United States)

    Horng, Yu-Tze; Chang, Kai-Chih; Chou, Ta-Chung; Yu, Chung-Jen; Chien, Chih-Ching; Wei, Yu-Hong; Soo, Po-Chi

    2010-07-01

    1,3-Propanediol (1,3-PD) can be used for the industrial synthesis of a variety of compounds, including polyesters, polyethers, and polyurethanes. 1,3-PD is generated from petrochemical and microbial sources. 1,3-Propanediol is a typical product of glycerol fermentation, while acetate, lactate, 2,3-butanediol, and ethanol also accumulate during the process. Substrate and product inhibition limit the final concentration of 1,3-propanediol in the fermentation broth. It is impossible to increase the yield of 1,3-propanediol by using the traditional whole-cell fermentation process. In this study, dhaD and dhaK, the genes for glycerol dehydrogenase and dihydroxyacetone kinase, respectively, were inactivated by homologous recombination in Klebsiella pneumoniae. The dhaD/dhaK double mutant (designated TC100), selected from 5,000 single or double cross homologous recombination mutants, was confirmed as a double cross by using polymerase chain reaction. Analysis of the cell-free supernatant with high-performance liquid chromatography revealed elimination of lactate and 2,3-butanediol, as well as ethanol accumulation in TC100, compared with the wild-type strain. Furthermore, 1,3-propanediol productivity was increased in the TC100 strain expressing glycerol dehydratase and 1,3-PDO dehydrogenase regulated by the arabinose P(BAD) promoter. The genetic engineering and medium formulation approaches used here should aid in the separation of 1,3-propanediol from lactate, 2,3-butanediol, and ethanol and lead to increased production of 1,3-propanediol in Klebsiella pneumoniae.

  15. Molecular assessment of artemisinin resistance markers, polymorphisms in the k13 propeller, and a multidrug-resistance gene in the eastern and western border areas of Myanmar.

    Science.gov (United States)

    Nyunt, Myat Htut; Hlaing, Thaung; Oo, Htet Wai; Tin-Oo, Lu-Lu Kyaw; Phway, Hnin Phyu; Wang, Bo; Zaw, Ni Ni; Han, Soe Soe; Tun, Thurein; San, Kyaw Kyaw; Kyaw, Myat Phone; Han, Eun-Taek

    2015-04-15

    As K13 propeller mutations have been recently reported to serve as molecular markers, assessment of K13 propeller polymorphisms in multidrug-resistant gene in isolates from Myanmar, especially the eastern and western border areas, is crucial if we are to understand the spread of artemisinin resistance. A 3-day surveillance study was conducted in the eastern and western border areas in Myanmar, and K13 propeller and Plasmodium falciparum multidrug resistance-associated protein 1 (pfmrp1) mutations were analyzed. Among the 1761 suspected malaria cases screened, a total of 42 uncomplicated falciparum cases from the eastern border and 49 from the western border were subjected to 3 days of surveillance after artemether-lumefantrine treatment. No parasitemic case showing positivity on day 3 was noted from the western border, but 26.2% (11/42) of cases were positive in the eastern border. Although we found no marked difference in the prevalence of the pfmrp1 mutation in the eastern and western borders (36% vs 31%, respectively), K13 mutations were more frequent in the eastern border area (where the 3-day persistent cases were detected; 48% vs 14%). C580Y, M476I, A481V, N458Y, R539T, and R516Y accounted for 68.9% of all K13 mutations significantly associated with day 3 parasitaemia. The K13 mutations were significantly associated with day 3 parasitaemia, emphasizing the importance of K13 surveillance. The low prevalence of K13 mutations and the absence of day 3 parasitaemic cases indicate that artemisinin resistance may not have spread to the western Myanmar border region. Although analysis of multiple K13 mutations is challenging, it should be done at various sentinel sites in Myanmar. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Determination of K shell absorption jump factors and jump ratios of 3d transition metals by measuring K shell fluorescence parameters

    International Nuclear Information System (INIS)

    Kaçal, Mustafa Recep; Han, İbrahim; Akman, Ferdi

    2015-01-01

    Energy dispersive X-ray fluorescence technique (EDXRF) has been employed for measuring K-shell absorption jump factors and jump ratios for Ti, Cr, Fe, Co, Ni and Cu elements. The jump factors and jump ratios for these elements were determined by measuring K shell fluorescence parameters such as the Kα X-ray production cross-sections, K shell fluorescence yields, Kβ-to-Kα X-rays intensity ratios, total atomic absorption cross sections and mass attenuation coefficients. The measurements were performed using a Cd-109 radioactive point source and an Si(Li) detector in direct excitation and transmission experimental geometry. The measured values for jump factors and jump ratios were compared with theoretically calculated and the ones available in the literature. - Highlights: • This work regard the K shell absorption jump ratios and jump factors of Ti, Cr, Fe, Co, Ni and Cu. • This paper presents the first measurement of these parameters using the experimental K shell fluorescence parameters. • A good agreement was found between experimental and theoretical values. • The EDXRF technique was suitable, precise and reliable for the measurement of these atomic parameters

  17. Finite volume form factors in the presence of integrable defects

    International Nuclear Information System (INIS)

    Bajnok, Z.; Buccheri, F.; Hollo, L.; Konczer, J.; Takacs, G.

    2014-01-01

    We developed the theory of finite volume form factors in the presence of integrable defects. These finite volume form factors are expressed in terms of the infinite volume form factors and the finite volume density of states and incorporate all polynomial corrections in the inverse of the volume. We tested our results, in the defect Lee–Yang model, against numerical data obtained by truncated conformal space approach (TCSA), which we improved by renormalization group methods adopted to the defect case. To perform these checks we determined the infinite volume defect form factors in the Lee–Yang model exactly, including their vacuum expectation values. We used these data to calculate the two point functions, which we compared, at short distance, to defect CFT. We also derived explicit expressions for the exact finite volume one point functions, which we checked numerically. In all of these comparisons excellent agreement was found

  18. Relationship between ABO blood groups and von Willebrand factor, ADAMTS13 and factor VIII in patients undergoing hemodialysis.

    Science.gov (United States)

    Rios, Danyelle R A; Fernandes, Ana Paula; Figueiredo, Roberta C; Guimarães, Daniela A M; Ferreira, Cláudia N; Simões E Silva, Ana C; Carvalho, Maria G; Gomes, Karina B; Dusse, Luci Maria Sant' Ana

    2012-05-01

    Several studies have demonstrated that non-O blood groups subjects present an increased VTE risk as compared to those carrying O blood group. The aim of this study was to investigate the ABO blood groups influence on factor VIII (FVIII) activity, von Willebrand factor (VWF), and ADAMTS13 plasma levels in patients undergoing hemodialysis (HD). Patients undergoing HD (N=195) and 80 healthy subjects (control group) were eligible for this cross-sectional study. The ABO blood group phenotyping was performed by the reverse technique. FVIII activity was measured through coagulometric method, and VWF and ADAMTS13 antigens were assessed by ELISA. FVIII activity and VWF levels were significantly higher and ADAMTS13 levels was decreased in HD patients, as compared to healthy subjects (P blood groups showed a significant increase in FVIII activity (P = 0.001) and VWF levels (P blood group. However, no significant difference was observed in ADAMTS13 levels (P = 0.767). In the control group, increased in FVIII activity (P = 0.001) and VWF levels (P = 0.002) and decreased in ADAMTS13 levels (P = 0.005) were observed in subjects carrying non-O blood groups as compared to carriers of O blood group.Our data confirmed that ABO blood group is an important risk factor for increased procoagulant factors in plasma, as FVIII and VWF. Admitting the possible role of kidneys in ADAMTS13 synthesis or on its metabolism, HD patients were not able to increase ADAMTS13 levels in order to compensate the increase of VWF levels mediated by ABO blood groups. Considering that non-O blood groups constitute a risk factor for thrombosis, it is reasonable to admit that A, B and AB HD patients need a careful and continuous follow-up in order to minimize thrombotic events.

  19. Study of the slope-mass correlation in the low mass K. pi pi. system. [13 GeV/c

    Energy Technology Data Exchange (ETDEWEB)

    Carnegie, R K; Cashmore, R J; Davier, M; Dunwoodie, W; Lasinski, T A; Leith, D W.G.S.; Stroynowski, R; Williams, S H [Stanford Linear Accelerator Center, Calif. (USA)

    1976-07-19

    The shape of the four-momentum transfer t' distribution in the reactions K/sup + -/p..-->..K/sup + -/..pi../sup +/..pi../sup -/p at 13 GeV/c is studied for various partial waves as a function of the K..pi pi.. mass. Strong variation of the slope with effective mass is observed for the dominant Jsup(P) = 1/sup +/ waves. For natural parity exchange it is found that, for K..pi pi.. masses up to 1.6 GeV, the slope of the t' distribution is decreasing with increasing spin of the excited system, B/sub 0/->B/sub 1/+>B/sub 2/+.

  20. 48 CFR 13.307 - Forms.

    Science.gov (United States)

    2010-10-01

    ...) Other than commercial items. (1) Except when quotations are solicited electronically or orally, the SF 1449; SF 18, Request for Quotations; or an agency form/automated format may be used. Each agency request for quotations form/automated format should conform with the SF 18 or SF 1449 to the maximum...

  1. K-factors in the deep inelastic Compton and Drell-Yan processes

    International Nuclear Information System (INIS)

    Czechowski, A.; Krawczyk, M.

    1983-01-01

    The associated production of hadrons is used to answer the question about the nature of large QCD corrections for hard processes. The results of the order α s calculation of K-factors for the deep inelastic Compton process and some predictions for the large p perpendicular to Drell-Yan pair production in hadron-hadron collision are presented. In the soft gluon approximation a significant difference between K-factors corresponding to different inclusive distributions in each of these processes is found. (author)

  2. Electron form factors of deformable nuclei

    International Nuclear Information System (INIS)

    Tartakovskii, V.K.; Isupov, V.Yu.

    1988-01-01

    Using the smallness of the deformation parameter of the nucleus, we obtain simple explicit expressions for the form factors of electroexcitation of the low-lying rotation-vibration states of light, deformable, even-even nuclei. The expressions satisfactorily describe the experimental data on the excitation of collective nuclear states by the inelastic scattering of fast electrons

  3. Measurement of the Charged Pion Electromagnetic Form Factor

    International Nuclear Information System (INIS)

    J. Volmer; David Abbott; H. Anklin; Chris Armstrong; John Arrington; K. Assamagan; Steven Avery; Oliver K. Baker; Henk Blok; C. Bochna; Ed Brash; Herbert Breuer; Nicholas Chant; Jim Dunne; Tom Eden; Rolf Ent; David Gaskell; Ron Gilman; Kenneth Gustafsson; Wendy Hinton; Garth Huber; Hal Jackson; Mark K. Jones; Cynthia Keppel; P.H. Kim; Wooyoung Kim; Andi Klein; Doug Koltenuk; Meme Liang; George Lolos; Allison Lung; David Mack; D. McKee; David Meekins; Joseph Mitchell; H. Mkrtchian; B. Mueller; Gabriel Niculescu; Ioana Niculescu; D. Pitz; D. Potterveld; Liming Qin; Juerg Reinhold; I.K. Shin; Stepan Stepanyan; V. Tadevosian; L.G. Tang; R.L.J. van der Meer; K. Vansyoc; D. Van Westrum; Bill Vulcan; Stephen Wood; Chen Yan; W.X. Zhao; Beni Zihlmann

    2001-01-01

    Separated longitudinal and transverse structure functions for the reaction 1H(e,eprime pi+)n were measured in the momentum transfer region Q2=0.6-1.6 (GeV/c)**2 at a value of the invariant mass W=1.95 GeV. New values for the pion charge form factor were extracted from the longitudinal cross section by using a recently developed Regge model. The results indicate that the pion form factor in this region is larger than previously assumed and is consistent with a monopole parameterization fitted to very low Q2 elastic data

  4. Master integrals for the four-loop Sudakov form factor

    Directory of Open Access Journals (Sweden)

    Rutger H. Boels

    2016-01-01

    Full Text Available The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N=4 supersymmetric Yang–Mills theory (SYM in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. The simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was largely obtained in integrand form in a previous work for N=4 SYM, up to a free parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP identities using a modified version of Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. Moreover, two of the integral topologies vanish after reduction. The appearing master integrals are cross-checked using independent algebraic-geometry techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Discrepancies between explicitly solving the IBP relations and the MINT approach are highlighted. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N=4 SYM and beyond are identified.

  5. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  6. Two-loop SL(2) form factors and maximal transcendentality

    International Nuclear Information System (INIS)

    Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

    2016-01-01

    Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  7. Two-loop SL(2) form factors and maximal transcendentality

    Energy Technology Data Exchange (ETDEWEB)

    Loebbert, Florian [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Sieg, Christoph [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark); Yang, Gang [CAS Key Laboratory of Theoretical Physics,Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany)

    2016-12-19

    Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  8. Electromagnetic form factors of the Ω- in lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Korzec, T.; Koutsou, G.; Negele, J. W.; Proestos, Y.

    2010-01-01

    We present results on the omega baryon (Ω - ) electromagnetic form factors using N f =2+1 domain-wall fermion configurations for three pion masses in the range of about 350 to 300 MeV. We compare results obtained using domain-wall fermions with those of a mixed-action (hybrid) approach, which combines domain-wall valence quarks on staggered sea quarks, for a pion mass of about 350 MeV. We pay particular attention in the evaluation of the subdominant electric quadrupole form factor to sufficient accuracy to exclude a zero value, by constructing a sequential source that isolates it from the dominant form factors. The Ω - magnetic moment, μ Ω - , and the electric charge and magnetic radius, E0/M1 2 >, are extracted for these pion masses. The electric quadrupole moment is determined for the first time using dynamical quarks.

  9. 13 CFR 108.160 - Special rules for NMVC Companies formed as limited partnerships.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Special rules for NMVC Companies formed as limited partnerships. 108.160 Section 108.160 Business Credit and Assistance SMALL BUSINESS... of a limited partner pending SBA's written approval of such transfer or succession; and (4) You must...

  10. 2-(2-Chlorobenzoylimino)-1,3-thiazolidine: structure refinement from neutron diffraction data at 113 K and charge density deformation maps

    International Nuclear Information System (INIS)

    Cohen-Addad, C.; Savariault, J.-M.; Lehmann, M.S.

    1981-01-01

    The structure of 2-(2-chlorobenzoylimino)-1,3-thiazolidine, C 10 H 9 ClN 2 OS, has been redetermined by neutron diffraction at 113 K. The space group is P2 1 /c with lattice parameters a = 19.950 (4), b = 7.420 (2), c = 11.566 (3) A, β = 109.10 (3) 0 , Z = 4, Msub(r) = 240.7 and dsub(calc) = 1.52 Mg m -3 . The final R(F 2 ) was 0.045 for 1768 reflections. The structural results show unambiguously that the molecule is found in the imino form with an H atom located near the endocyclic N atom of the thiazolidine group. Based on deformation electron density maps and the interatomic distances it is speculated that the difference in geometry between the two tautomeric forms (imino and amino) is small and that the occurrence of one or the other is strongly dependent on the substituents. A short intramolecular S-O contact of 2.68 A is found and is believed to constitute a very weak bond. (Auth.)

  11. A 30 mK, 13.5 T scanning tunneling microscope with two independent tips

    Energy Technology Data Exchange (ETDEWEB)

    Roychowdhury, Anita [Laboratory for Physical Sciences, College Park, Maryland 20742 (United States); Center for Nanophysics and Advanced Materials, Department of Physics, University of Maryland, College Park, Maryland 20740 (United States); Gubrud, M. A.; Dana, R.; Dreyer, M. [Laboratory for Physical Sciences, College Park, Maryland 20742 (United States); Anderson, J. R.; Lobb, C. J.; Wellstood, F. C. [Center for Nanophysics and Advanced Materials, Department of Physics, University of Maryland, College Park, Maryland 20740 (United States)

    2014-04-15

    We describe the design, construction, and performance of an ultra-low temperature, high-field scanning tunneling microscope (STM) with two independent tips. The STM is mounted on a dilution refrigerator and operates at a base temperature of 30 mK with magnetic fields of up to 13.5 T. We focus on the design of the two-tip STM head, as well as the sample transfer mechanism, which allows in situ transfer from an ultra high vacuum preparation chamber while the STM is at 1.5 K. Other design details such as the vibration isolation and rf-filtered wiring are also described. Their effectiveness is demonstrated via spectral current noise characteristics and the root mean square roughness of atomic resolution images. The high-field capability is shown by the magnetic field dependence of the superconducting gap of Cu{sub x}Bi{sub 2}Se{sub 3}. Finally, we present images and spectroscopy taken with superconducting Nb tips with the refrigerator at 35 mK that indicate that the effective temperature of our tips/sample is approximately 184 mK, corresponding to an energy resolution of 16 μeV.

  12. A 30 mK, 13.5 T scanning tunneling microscope with two independent tips.

    Science.gov (United States)

    Roychowdhury, Anita; Gubrud, M A; Dana, R; Anderson, J R; Lobb, C J; Wellstood, F C; Dreyer, M

    2014-04-01

    We describe the design, construction, and performance of an ultra-low temperature, high-field scanning tunneling microscope (STM) with two independent tips. The STM is mounted on a dilution refrigerator and operates at a base temperature of 30 mK with magnetic fields of up to 13.5 T. We focus on the design of the two-tip STM head, as well as the sample transfer mechanism, which allows in situ transfer from an ultra high vacuum preparation chamber while the STM is at 1.5 K. Other design details such as the vibration isolation and rf-filtered wiring are also described. Their effectiveness is demonstrated via spectral current noise characteristics and the root mean square roughness of atomic resolution images. The high-field capability is shown by the magnetic field dependence of the superconducting gap of CuxBi2Se3. Finally, we present images and spectroscopy taken with superconducting Nb tips with the refrigerator at 35 mK that indicate that the effective temperature of our tips/sample is approximately 184 mK, corresponding to an energy resolution of 16 μeV.

  13. Electromagnetic and axial-vector form factors of the quarks and nucleon

    Science.gov (United States)

    Dahiya, Harleen; Randhawa, Monika

    2017-11-01

    In light of the improved precision of the experimental measurements and enormous theoretical progress, the nucleon form factors have been evaluated with an aim to understand how the static properties and dynamical behavior of nucleons emerge from the theory of strong interactions between quarks. We have analyzed the vector and axial-vector nucleon form factors (GE,Mp,n(Q2) and GAp,n(Q2)) using the spin observables in the chiral constituent quark model (χCQM) which has made a significant contribution to the unraveling of the internal structure of the nucleon in the nonperturbative regime. We have also presented a comprehensive analysis of the flavor decomposition of the form factors (GEq(Q2), GMq(Q2) and GAq(Q2) for q = u,d,s) within the framework of χCQM with emphasis on the extraction of the strangeness form factors which are fundamental to determine the spin structure and test the chiral symmetry breaking effects in the nucleon. The Q2 dependence of the vector and axial-vector form factors of the nucleon has been studied using the conventional dipole form of parametrization. The results are in agreement with the available experimental data.

  14. Effects of the d-state quarks on the nucleon electric form factors

    International Nuclear Information System (INIS)

    Oh, Y.J.; Kong, K.J.; Cheon, I.T.

    1987-11-01

    Considering the d-orbital excitation of a quark in the bag, we calculate the nucleon electric form factors in the cloudy bag model. In these calculations, we have taken into account the πNN, πΔN and πγ form factors though neglecting the c.m. correction. It turns out that the neutron charge form factor is very sensitive to the d-state quark admixture in the overall region of the momentum transfer but the proton charge form factor remains unchanged. Taking the d-state quark admixture in the intermediate state baryons, we can obtain the nucleon rms radii in remarkable agreement with the experimental values. We also investigate the roles of Δ particles in the nucleon charge form factors. (author). 20 refs, 10 figs

  15. Measurements of the deuteron and proton magnetic form factors at large momentum transfers

    International Nuclear Information System (INIS)

    Bosted, P.E.; Katramatou, A.T.; Arnold, R.G.; Benton, D.; Clogher, L.; DeChambrier, G.; Lambert, J.; Lung, A.; Petratos, G.G.; Rahbar, A.; Rock, S.E.; Szalata, Z.M.; Debebe, B.; Frodyma, M.; Hicks, R.S.; Hotta, A.; Peterson, G.A.; Gearhart, R.A.; Alster, J.; Lichtenstadt, J.; Dietrich, F.; van Bibber, K.

    1990-01-01

    Measurements of the deuteron elastic magnetic structure function B(Q 2 ) are reported at squared four-momentum transfer values 1.20≤Q 2 ≤2.77 (GeV/c) 2 . Also reported are values for the proton magnetic form factor G Mp (Q 2 ) at 11 Q 2 values between 0.49 and 1.75 (GeV/c) 2 . The data were obtained using an electron beam of 0.5 to 1.3 GeV. Electrons backscattered near 180 degree were detected in coincidence with deuterons or protons recoiling near 0 degree in a large solid-angle double-arm spectrometer system. The data for B(Q 2 ) are found to decrease rapidly from Q 2 =1.2 to 2 (GeV/c) 2 , and then rise to a secondary maximum around Q 2 =2.5 (GeV/c) 2 . Reasonable agreement is found with several different models, including those in the relativistic impulse approximation, nonrelativistic calculations that include meson-exchange currents, isobar configurations, and six-quark configurations, and one calculation based on the Skyrme model. All calculations are very sensitive to the choice of deuteron wave function and nucleon form factor parametrization. The data for G Mp (Q 2 ) are in good agreement with the empirical dipole fit

  16. Determination of astrophysical 13N(p, γ)14O S-factors from the asymptotic normalization coefficient of 14C→13C + n

    International Nuclear Information System (INIS)

    Guo Bing; Li Zhihong

    2007-01-01

    The angular distribution of the 13 C(d,p) 14 C reaction is reanalysed using the Johnson-Soper approach. The squared asymptotic normalization coefficient (ANC) of virtual decay 14 C→ 13 C + n is then derived to be 21.4 ± 5.0 fm -1 . The squared ANC and spectroscopic factor (SF) of 14 O→ 13 N + p are extracted to be 30.4 ± 7.1 fm -1 and 1.94 ± 0.45, respectively. The astrophysical S-factors and reaction rates of 13 N(p, γ) 14 O are determined from the ANC of 14 O→ 13 N + p using the R-matrix approach. (authors)

  17. Factorization and pion form factor in QCD

    International Nuclear Information System (INIS)

    Efremov, A.V.; Radyushkin, A.V.

    1979-01-01

    The behaviour of the pion electromagnetic form factor (EMFF) in the framework of quantum chromodynamics (QCD) is discussed. Pion is considered to be a quark-antiquark bound state. It is proposed to use an OPE description of the bound state structure by matrix elements of certain local gauge-invariant operators. Short-distance quark interactions is proved using a direct analysis of perturbation theory in the α-parametric representation of the Feynman diagrams. It is shown that the short-distance parton picture privides a self-consistent description of the large Q 2 momentum behaviour of the pion EMFF in QCD. Pion EMFF asymptotics is expressed in terms of fu fundamental constants of the theory

  18. Determination of k0-factors of short-lived nuclides and application of k0-NAA to selected trace elements

    International Nuclear Information System (INIS)

    Acharya, R.; Holzbecher, J.; Chatt, A.

    2012-01-01

    As part of the standardization program of k 0 -based NAA (k 0 -NAA) methods at the Dalhousie University SLOWPOKE-2 reactor (DUSR) facility, the k 0 -factors of 15 analytically important short-lived nuclides (half-life 197 Au). The elemental standards used were prepared mostly from their primary standard solutions. The samples were irradiated in both inner and outer pneumatic sites of the DUSR facility and counted using an HPGe-detector coupled to an ORTEC’s digital gamma-ray spectrometer. The k 0 -factors determined using both inner and outer irradiation sites were found to be within ±5% with respect to either recommended or literature values in most cases. The Z-score values at 95% confidence level were found to be in the range of ±0.03–1.6. The k 0 -NAA method was applied to three different NIST standard reference materials (SRMs) and concentrations of six elements, namely Ag, F, Hf, Rb, Sc, and Se were determined using their short-lived nuclides. The concentrations of these elements were also determined by relative NAA method for comparison purposes.

  19. A measurement of the space-like pion electromagnetic form factor

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Badelek, B.; Batignani, G.; Bedeschi, F.; Bertolucci, E.; Bettoni, D.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Fidecaro, F.; Foa, L.; Focardi, E.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tonelli, G.; Triggiani, G.; Codino, A.; Enorini, M.; Fabbri, F.L.; Laurelli, P.; Satta, L.; Spillantini, P.; Zallo, A.

    1986-01-01

    The pion form factor has been measured in the space-like q 2 region 0.014 to 0.26 (GeV/c) 2 by scattering 300 GeV pions from the electrons of a liquid hydrogen target. A detailed description is given of the apparatus, data analysis and corrections to the data. The mean square charge radius extracted from the data is model-dependent. We find that a form which includes a realistic description of the form factor phase gives a similar result to the naive pole form, and conclude π 2 >=0.439±0.008 fm 2 . (orig.)

  20. The Nucleon Axial Form Factor and Staggered Lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Aaron Scott [Chicago U.

    2017-01-01

    The study of neutrino oscillation physics is a major research goal of the worldwide particle physics program over the upcoming decade. Many new experiments are being built to study the properties of neutrinos and to answer questions about the phenomenon of neutrino oscillation. These experiments need precise theoretical cross sections in order to access fundamental neutrino properties. Neutrino oscillation experiments often use large atomic nuclei as scattering targets, which are challenging for theorists to model. Nuclear models rely on free-nucleon amplitudes as inputs. These amplitudes are constrained by scattering experiments with large nuclear targets that rely on the very same nuclear models. The work in this dissertation is the rst step of a new initiative to isolate and compute elementary amplitudes with theoretical calculations to support the neutrino oscillation experimental program. Here, the eort focuses on computing the axial form factor, which is the largest contributor of systematic error in the primary signal measurement process for neutrino oscillation studies, quasielastic scattering. Two approaches are taken. First, neutrino scattering data on a deuterium target are reanalyzed with a model-independent parametrization of the axial form factor to quantify the present uncertainty in the free-nucleon amplitudes. The uncertainties on the free-nucleon cross section are found to be underestimated by about an order of magnitude compared to the ubiquitous dipole model parametrization. The second approach uses lattice QCD to perform a rst-principles computation of the nucleon axial form factor. The Highly Improved Staggered Quark (HISQ) action is employed for both valence and sea quarks. The results presented in this dissertation are computed at physical pion mass for one lattice spacing. This work presents a computation of the axial form factor at zero momentum transfer, and forms the basis for a computation of the axial form factor momentum dependence

  1. Nucleon quark structure and strong meson-nucleon form factors

    International Nuclear Information System (INIS)

    Efimov, G.V.; Ivanov, M.A.

    1987-01-01

    The nucleon is considered as a three-quark system in virton-quark model. The main statistic properties of proton and neutron are calculated: magnetic moments, electromagnetic radii, G A /G V ratio in weak neutron decay. Strong meson-nucleon form factors which determine nucleon-nucleon potential are obtained as a function of squared transfer momentum of mesons. The results are compared with phenomenological form factors used for description of phases of NN-scattering in the one-boson-, exchange model

  2. Low-energy analysis of the nucleon electromagnetic form factors

    International Nuclear Information System (INIS)

    Kubis, Bastian.; Meissner, Ulf-G.

    2001-01-01

    We analyze the electromagnetic form factors of the nucleon to fourth order in relativistic baryon chiral perturbation theory. We employ the recently proposed infrared regularization scheme and show that the convergence of the chiral expansion is improved as compared to the heavy-fermion approach. We also discuss the inclusion of vector mesons and obtain an accurate description of all four-nucleon form factors for momentum transfer squared up to Q 2 ≅0.4 GeV 2

  3. Development of 20 kW input power coupler for 1.3 GHz ERL main linac. Component test at 30 kW IOT test stand

    International Nuclear Information System (INIS)

    Sakai, Hiroshi; Umemori, Kensei; Sakanaka, Shogo; Takahashi, Takeshi; Furuya, Takaaki; Shinoe, Kenji; Ishii, Atsushi; Nakamura, Norio; Sawamura, Masaru

    2009-01-01

    We started to develop an input coupler for a 1.3 GHz ERL superconducting cavity. Required input power is about 20 kW for the cavity acceleration field of 20 MV/m and the beam current of 100 mA in energy recovery operation. The input coupler is designed based on the STF-BL input coupler and some modifications are applied to the design for the CW 20 kW power operation. We fabricated input coupler components such as ceramic windows and bellows and carried out the high-power test of the components by using a 30 kW IOT power source and a test stand constructed for the highpower test. In this report, we mainly describe the results of the high-power test of ceramic window and bellows. (author)

  4. Proton electromagnetic form factors: present status and future perspectives at PANDA

    Directory of Open Access Journals (Sweden)

    Tomasi-Gustafsson E.

    2015-01-01

    Full Text Available Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt. Measurements of the reaction p̅ + p → e+ + e− by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold, through the reaction p̅ + p → e+ + e− + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

  5. Propuesta del programaS-GeMS para el análisis estadístico espacial de fallas en alimentadores soterrados de 13,8 kV; PropodedS-GEMS program for statistical analysis of failure space of 13.8 kV underground feeders

    Directory of Open Access Journals (Sweden)

    Boris Alba Valle

    2011-06-01

    Full Text Available Actualmente, el sistema soterrado de Ciudad de La Habana, carece de herramientas gráficas de trabajo con lascuales poder visualizar zonas con alta incidencia de fallas en alimentadores de 13,8 kV y que permitan tomardecisiones certeras en cuanto a los tramos de alimentadores a reparar o sustituir por su deterioro. En este trabajo sepropone el uso de los programas S-GeMS (Stanford Geostatistical Modeling Software y Autocad comoherramientas para el análisis estadístico espacial de la cantidad de fallas. Se realiza, en lo fundamental, el estudiode toda la documentación referente a las aplicaciones del programa S-GeMS y la Base de Datos de la cantidad defallas del 2007 al 2009, de los alimentadores de 13,8 kV perteneciente a la Unidad Empresarial Básica (UEBSoterrada. Finalmente se muestran, a modo de ejemplo, los resultados obtenidos con su aplicación al determinarsela dirección preferencial de distribución de la cantidad de fallas.   Nowadays, the Havana City underground system, lacks of graphical working tools which not only allow to visualizehigh faults incidence areas in 13,8 kV feeders but also make good decisions in reference to the feeder sections to berepaired or substituted due to their impairment. The use of S-GeMS (Stanford Geostatistical Modeling Software andAutocad programs as tools for the spatial statistic analysis of faults quantity is proposed in this article. The study ofthe whole documentation related to the S-GeMS program applications is carried out as well as the UndergroundManagement Basic Unit (UEB 13,8 kV feeders faults quantity database from 2007 to 2009. Finally, the results afterdetermining the faults quantity distribution preferential address with the program application are shown, as anexample.

  6. Propuesta del programa S-GeMS para el análisis estadístico espacial de fallas en alimentadores soterrados de 13,8 kV;PropodedS-GEMS program for statistical analysis of failure space of 13.8 kV underground feeders

    Directory of Open Access Journals (Sweden)

    Boris Alba - Valle

    2011-06-01

    Full Text Available Actualmente, el sistema soterrado de Ciudad de La Habana, carece de herramientas gráficas de trabajo con lascuales poder visualizar zonas con alta incidencia de fallas en alimentadores de 13,8 kV y que permitan tomardecisiones certeras en cuanto a los tramos de alimentadores a reparar o sustituir por su deterioro. En este trabajo sepropone el uso de los programas S-GeMS (Stanford Geostatistical Modeling Software y Autocad comoherramientas para el análisis estadístico espacial de la cantidad de fallas. Se realiza, en lo fundamental, el estudiode toda la documentación referente a las aplicaciones del programa S-GeMS y la Base de Datos de la cantidad defallas del 2007 al 2009, de los alimentadores de 13,8 kV perteneciente a la Unidad Empresarial Básica (UEBSoterrada. Finalmente se muestran, a modo de ejemplo, los resultados obtenidos con su aplicación al determinarsela dirección preferencial de distribución de la cantidad de fallas.Nowadays, the Havana City underground system, lacks of graphical working tools which not only allow to visualizehigh faults incidence areas in 13,8 kV feeders but also make good decisions in reference to the feeder sections to berepaired or substituted due to their impairment. The use of S-GeMS (Stanford Geostatistical Modeling Software andAutocad programs as tools for the spatial statistic analysis of faults quantity is proposed in this article. The study ofthe whole documentation related to the S-GeMS program applications is carried out as well as the UndergroundManagement Basic Unit (UEB 13,8 kV feeders faults quantity database from 2007 to 2009. Finally, the results afterdetermining the faults quantity distribution preferential address with the program application are shown, as anexample.

  7. The NE11 experiment at SLAC and the neutron form factors

    International Nuclear Information System (INIS)

    Stuart, L.M.; Lung, A.; Bosted, P.E.

    1993-05-01

    The neutron electromagnetic form factors G En and G Mn , which reflect the charge and magnetization distributions within the neutron, are of fundamental importance for understanding nucleon structure, and are necessary for calculations of processes involving the electromagnetic interaction with complex nuclei. These quantities are functions of Q 2 , the four-momentum transfer squared. SLAC experiment NE11 has measured these form factors out to a Q 2 of 4.0 (GeV/c) 2 with high precision, and the results have been recently published. This paper provides some additional details on the extraction of G Mn and G En from the NE11 measurements. Several formalisms have been developed over the years which attempt to understand the nucleon form factors using basic physical principles. Vector Meson Dominance (VMD) models are based on superpositions of photon couplings to various vector mesons. These models generally involve free parameters which are fit to form factor data at low Q 2 , and are not expected to be valid at high Q 2 . For asymptotically large Q 2 , dimensional scaling methods and perturbative Quantum Chromodynamics (pQCD) predict form factor behavior at large Q 2 , but they do not make absolute magnitude predictions. To describe the form factor behavior at intermediate values of Q 2 , a hybrid model by Gari and Kruempelmann (GK) uses VMD constraints at low Q 2 and pQCD constraints at high Q 2 . Free parameters in the model are adjusted to fit existing form factor data. Other approaches include the use of QCD sum rules to make absolute predictions, diquark models, and relativistic constituent quark models

  8. The Factors of Forming the National HR-Management Model

    Directory of Open Access Journals (Sweden)

    Elena P. Kostenko

    2017-12-01

    Full Text Available There are some factors considered in this article, which influence the forming of national HR-management model. The group-forming criterion is the nature of factors, that determine the system of HR-management as a system of corporate culture values, norms and rules of organizational behavior, ways of realization some important managing functions and dominating approaches to make decisions. This article shows that the plurality of combinations in different factors leads to forming the unique HR-management model. The geoclimatic factor influences the principles of the labor organization (orientation primarily on individual or collective forms of labor, attitude to the management experience of other countries, attitude to resources, etc., the distribution of labor resources, the level of labor mobility, and the psychosocial type of employee. Models of man's labor behavior are constituted In the process of historical development. Attention is focused on the formation of a national HR-model, such as the conducted socio-economic policy, the characteristics of the institutional environment, economic goals and priorities of the country's development, the level of development and the nature of the national productive forces and economic structures. Much attention was paid to the analysis of the historically formed value system and labor traditions, which influence the approaches to HR-management. As far as religion influences the model of person’s inclusion in labor, motives of labor behavior, management culture of a certain employee, preferred payment etc., we examined how the main traditional religions (Christianity, Islam, Judaism, Buddhism, Confucianism, Hinduism influence the HR-management system in different countries.

  9. Two neutron transfer form factor for the reaction 42Ca(p,t)40Ca

    International Nuclear Information System (INIS)

    Meyer, R.H.

    1978-01-01

    In an attempt to better interpret experimental data concerning the two-neutron pickup process 42 Ca(p,t) 40 Ca, a detailed study of the form factors associated with the reaction is carried out. A set of coupled integro-differential equations describing these form factors is derived, starting from a microscopic, model-independent Hamiltonian. These equations allow contributions to the form factors from hole terms as well as from the particle and so-called ''continuum'' states, which were previously studied. An approximate solution of the form factor equations is obtained by neglecting the coupling terms and expressing the form factor in terms of a set of Sturmian states. Form factors for the transition to the 40 Ca ground state (O 1 + ) are calculated using various sets of Sturmian states. The inclusion of hole states is found to have a major effect upon both the shape of the form factor and the size of the related cross section. Finally, a comparison is made between the O 1 + form factors calculated using Sturmian states and a O 1 + form factor obtained using Sturmian states and a O 1 + form factor obtained using the coexistence model. It is found that a form factor based on Sturmian particle and hole states is very similar to the form factor obtained from the coexistence model calculation

  10. Describing the nucleon electromagnetic form factors at high momentum transfers

    International Nuclear Information System (INIS)

    Theussl, L.; Desplanques, B.; Silvestre-Brac, B.; Varga, K.

    1999-01-01

    Electromagnetic form factors of the nucleon are calculated within the framework of a non-relativistic constituent-quark model. The emphasis is put on the reliability and accuracy of present day numerical methods used to solve the three-body problem. The high-q 2 behaviour of the form factors is determined by the form of the wave function at short distances and, due to the small absolute values that one deals with, an accurate solution is essential. Refs. 5, figs. 2 (author)

  11. Analysis of K-factor for five-ply plywood

    Science.gov (United States)

    F.F. Wangarrd; George E. Woodson; William R. Wilcox

    1973-01-01

    K-factor has long been used as a modifier of section modulus in the calculation of bending moment for plywood beams. No comparable modification of moment of intertia is included in current recommendations for calculating plywood deflection at span-depth ratios of 30:1 or greater. Results of limited testing lend support to the authors' contention that, where "...

  12. Determination of K shell absorption jump factors and jump ratios of 3d transition metals by measuring K shell fluorescence parameters.

    Science.gov (United States)

    Kaçal, Mustafa Recep; Han, İbrahim; Akman, Ferdi

    2015-01-01

    Energy dispersive X-ray fluorescence technique (EDXRF) has been employed for measuring K-shell absorption jump factors and jump ratios for Ti, Cr, Fe, Co, Ni and Cu elements. The jump factors and jump ratios for these elements were determined by measuring K shell fluorescence parameters such as the Kα X-ray production cross-sections, K shell fluorescence yields, Kβ-to-Kα X-rays intensity ratios, total atomic absorption cross sections and mass attenuation coefficients. The measurements were performed using a Cd-109 radioactive point source and an Si(Li) detector in direct excitation and transmission experimental geometry. The measured values for jump factors and jump ratios were compared with theoretically calculated and the ones available in the literature. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Nucleon electromagnetic form factors using lattice simulations at the physical point

    International Nuclear Information System (INIS)

    Alexandrou, C.; Cyprus Univ., Nicosia; Constantinou, M.; Hadjiyiannakou, K.; Kallidonis, C.; Koutsou, G.; Jansen, K.; Vaquero Aviles-Casco, A.

    2017-01-01

    We present results for the nucleon electromagnetic form factors using an ensemble of maximally twisted mass clover-improved fermions with pion mass of about 130 MeV. We use multiple sink-source separations and three analysis methods to probe ground-state dominance. We evaluate both the connected and disconnected contributions to the nucleon matrix elements. We find that the disconnected quark loop contributions to the isoscalar matrix elements are small giving an upper bound of up to 2% of the connected and smaller than its statistical error. We present results for the isovector and isoscalar electric and magnetic Sachs form factors and the corresponding proton and neutron form factors. By fitting the momentum dependence of the form factors to a dipole form or to the z-expansion we extract the nucleon electric and magnetic radii, as well as, the magnetic moment. We compare our results to experiment as well as to other recent lattice QCD calculations.

  14. Nucleon electromagnetic form factors using lattice simulations at the physical point

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrou, C. [The Cyprus Institute, Nicosia (Cyprus). Computation-based Science and Technology Research Center; Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; Constantinou, M. [Temple Univ., Philadelphia, PA (United States). Dept. of Physics; Hadjiyiannakou, K.; Kallidonis, C.; Koutsou, G. [The Cyprus Institute, Nicosia (Cyprus). Computation-based Science and Technology Research Center; Jansen, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Vaquero Aviles-Casco, A. [Utah Univ., Salt Lake City, UT (United States). Dept. of Physics and Astronomy

    2017-09-20

    We present results for the nucleon electromagnetic form factors using an ensemble of maximally twisted mass clover-improved fermions with pion mass of about 130 MeV. We use multiple sink-source separations and three analysis methods to probe ground-state dominance. We evaluate both the connected and disconnected contributions to the nucleon matrix elements. We find that the disconnected quark loop contributions to the isoscalar matrix elements are small giving an upper bound of up to 2% of the connected and smaller than its statistical error. We present results for the isovector and isoscalar electric and magnetic Sachs form factors and the corresponding proton and neutron form factors. By fitting the momentum dependence of the form factors to a dipole form or to the z-expansion we extract the nucleon electric and magnetic radii, as well as, the magnetic moment. We compare our results to experiment as well as to other recent lattice QCD calculations.

  15. Novel Potassium-Ion Hybrid Capacitor Based on an Anode of K2Ti6O13 Microscaffolds.

    Science.gov (United States)

    Dong, Shengyang; Li, Zhifei; Xing, Zhenyu; Wu, Xianyong; Ji, Xiulei; Zhang, Xiaogang

    2018-05-09

    To fill the gap between batteries and supercapacitors requires integration of the following features in a single system: energy density well above that of supercapacitors, cycle life much longer than Li-ion batteries, and low cost. Along this line, we report a novel nonaqueous potassium-ion hybrid capacitor (KIC) that employs an anode of K 2 Ti 6 O 13 (KTO) microscaffolds constructed by nanorods and a cathode of N-doped nanoporous graphenic carbon (NGC). K 2 Ti 6 O 13 microscaffolds are studied for potential applications as the anode material in potassium-ion storage for the first time. This material exhibits an excellent capacity retention of 85% after 1000 cycles. In addition, the NGC//KTO KIC delivers a high energy density of 58.2 Wh kg -1 based on the active mass in both electrodes, high power density of 7200 W kg -1 , and outstanding cycling stability over 5000 cycles. The usage of K ions as the anode charge carrier instead of Li ions and the amenable performance of this device suggest that hybrid capacitor devices may welcome a new era of beyond lithium.

  16. Three-body decays of B{sup 0(+)} → K{sup *0(+)}π{sup +}π{sup -}

    Energy Technology Data Exchange (ETDEWEB)

    Mohammadi, Behnam; Mehraban, Hossein [Semnan University, Physics Department, Semnan (Iran, Islamic Republic of)

    2014-08-15

    We are interested in the analysis of the three-body decays of B{sup 0} → K{sup *0}π{sup +}π{sup -} and B{sup +} → K{sup *+}π{sup +}π{sup -}. There are tree and penguin diagrams for these decay modes in the naive factorization approach and the transition matrix element of them is factorized into a B → π{sup +}π{sup -} form factor multiplied by 0 → K{sup *} decay constant and B → K{sup *} form factor multiplied into 0 → π{sup +}π{sup -} weak and electromagnetic vertices form factor. We investigate these decays by using the Dalitz plot analysis. We use the general form of this technique for the calculation of the B{sup 0} → K{sup *0}π{sup +}π{sup -} and B{sup +} → K{sup *+}π{sup +}π{sup -} decays and obtain the values (3.74 ± 0.50) x 10{sup -5} and (9.64 ± 1.37) x 10{sup -5} for the branching ratios, while the experimental results are (5.50 ± 0.50) x 10{sup -5} and (7.50 ± 1.00) x 10{sup -5}, respectively. The branching ratios obtained by applying the Dalitz plot analysis are compatible with the experimental results. (orig.)

  17. Meson widths and form factor at intermediate momentum transfer in nonperturbative QCD

    International Nuclear Information System (INIS)

    Ioffe, B.L.; Smilga, A.V.

    1982-01-01

    A general method is proposed for the QCD based calculations of form factors at intermediate momentum transfer Q 2 and of the partial widths of the low-lying meson resonances. The basic idea is to use the QCD sum rules for the vertex functions. With this method the pion electromagnetic form factor along with electromagnetic form factors of rho- and A 1 mesons and transition form factors γπ → A 1 at 0.5 2 2 are calculated. The widths rho+2π and A 1 → rhoπ are also determined. +.he results are in a good agreement with experiment

  18. Computation of 3D form factors in complex environments

    International Nuclear Information System (INIS)

    Coulon, N.

    1989-01-01

    The calculation of radiant interchange among opaque surfaces in a complex environment poses the general problem of determining the visible and hidden parts of the environment. In many thermal engineering applications, surfaces are separated by radiatively non-participating media and may be idealized as diffuse emitters and reflectors. Consenquently the net radiant energy fluxes are intimately related to purely geometrical quantities called form factors, that take into account hidden parts: the problem is reduced to the form factor evaluation. This paper presents the method developed for the computation of 3D form factors in the finite-element module of the system TRIO, which is a general computer code for thermal and fluid flow analysis. The method is derived from an algorithm devised for synthetic image generation. A comparison is performed with the standard contour integration method also implemented and suited to convex geometries. Several illustrative examples of finite-element thermal calculations in radiating enclosures are given

  19. Factors related to home health-care transition in trisomy 13.

    Science.gov (United States)

    Kitase, Yuma; Hayakawa, Masahiro; Kondo, Taiki; Saito, Akiko; Tachibana, Takashi; Oshiro, Makoto; Ieda, Kuniko; Kato, Eiko; Kato, Yuichi; Hattori, Tetsuo; Hayashi, Seiji; Ito, Masatoki; Hyodo, Reina; Muramatsu, Yukako; Sato, Yoshiaki

    2017-10-01

    Trisomy 13 (T13) is accompanied by severe complications, and it can be challenging to achieve long-term survival without aggressive treatment. However, recently, some patients with T13 have been receiving home care. We conducted this study to investigate factors related to home health-care transition for patients with T13.We studied 28 patients with T13 born between January 2000 and December 2014. We retrospectively compared nine home care transition patients (the home care group) and 19 patients that died during hospitalization (the discharge at death group). The median gestational age of the patients was 36.6 weeks, with a median birth weight of 2,047 g. Currently, three patients (11%) have survived, and 25 (89%) have died. The home care group exhibited a significantly longer gestational age (38.9 vs. 36.3 weeks, p = 0.039) and significantly larger occipitofrontal circumference Z score (-0.04 vs. -0.09, p = 0.019). Congenital heart defects (CHD) was more frequent in the discharge at death group, with six patients in the home care group and 18 patients in the discharge at death group (67% vs. 95%, p = 0.047), respectively. Survival time was significantly longer in the home care group than in the discharge at death group (171 vs. 19 days, p = 0.012). This study has shown that gestational age, occipitofrontal circumference Z score at birth, and the presence of CHD are helpful prognostic factors for determining treatment strategy in patients with T13. © 2017 Wiley Periodicals, Inc.

  20. Separating form factor and nuclear model effects in quasielastic neutrino-nucleus scattering

    Science.gov (United States)

    Wieske, Joseph

    2017-09-01

    When studying neutrino oscillations an understanding of charged current quasielastic (CCQE) neutrino-nucleus scattering is imperative. This interaction depends on a nuclear model as well as knowledge of form factors. In the past, CCQE data from the MiniBooNE experiment was analyzed assuming the Relativistic Fermi Gas (RFG) nuclear model, an axial dipole form factor in, and using the the z-expansion for the axial form factor in. We present the first analysis that combines a non-RFG nuclear model, in particular the Correlated Fermi Gas nuclear model (CFG) of, and the z expansion for the axial form factor. This will allow us to separate form factor and nuclear model effects in CCQE scattering. This project was supported through the Wayne State University REU program under NSF Grant PHY-1460853 and by the DOE Grant DE-SC0007983.

  1. The translation initiation factor 3 subunit eIF3K interacts with PML and associates with PML nuclear bodies

    Energy Technology Data Exchange (ETDEWEB)

    Salsman, Jayme; Pinder, Jordan; Tse, Brenda [Department of Pathology, Dalhousie University, P.O. Box 15000, Halifax, Nova Scotia, Canada B3H 4R2 (Canada); Corkery, Dale [Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia (Canada); Dellaire, Graham, E-mail: dellaire@dal.ca [Department of Pathology, Dalhousie University, P.O. Box 15000, Halifax, Nova Scotia, Canada B3H 4R2 (Canada); Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia (Canada)

    2013-10-15

    The promyelocytic leukemia protein (PML) is a tumor suppressor protein that regulates a variety of important cellular processes, including gene expression, DNA repair and cell fate decisions. Integral to its function is the ability of PML to form nuclear bodies (NBs) that serve as hubs for the interaction and modification of over 90 cellular proteins. There are seven canonical isoforms of PML, which encode diverse C-termini generated by alternative pre-mRNA splicing. Recruitment of specific cellular proteins to PML NBs is mediated by protein–protein interactions with individual PML isoforms. Using a yeast two-hybrid screen employing peptide sequences unique to PML isoform I (PML-I), we identified an interaction with the eukaryotic initiation factor 3 subunit K (eIF3K), and in the process identified a novel eIF3K isoform, which we term eIF3K-2. We further demonstrate that eIF3K and PML interact both in vitro via pull-down assays, as well as in vivo within human cells by co-immunoprecipitation and co-immunofluorescence. In addition, eIF3K isoform 2 (eIF3K-2) colocalizes to PML bodies, particularly those enriched in PML-I, while eIF3K isoform 1 associates poorly with PML NBs. Thus, we report eIF3K as the first known subunit of the eIF3 translation pre-initiation complex to interact directly with the PML protein, and provide data implicating alternative splicing of both PML and eIF3K as a possible regulatory mechanism for eIF3K localization at PML NBs. - Highlights: • The PML-I C-terminus, encoded by exon 9, interacts with translation factor eIF3K. • We identify a novel eIF3K isoform that excludes exon 2 (eIF3K-2). • eIF3K-2 preferentially associates with PML bodies enriched in PML-I vs. PML-IV. • Alternative splicing of eIF3K regulates association with PML bodies.

  2. Nucleon electromagnetic form factors with Wilson fermions

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.

    2007-10-01

    The nucleon electromagnetic form factors continue to be of major interest for experimentalists and phenomenologists alike. They provide important insights into the structure of nuclear matter. For a range of interesting momenta they can be calculated on the lattice. The limiting factor continues to be the value of the pion mass. We present the latest results of the QCDSF collaboration using gauge configurations with two dynamical, non-perturbatively improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  3. Nucleon electromagnetic form factors with Wilson fermions

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Inst. fuer Theoretische Physik; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)

    2007-10-15

    The nucleon electromagnetic form factors continue to be of major interest for experimentalists and phenomenologists alike. They provide important insights into the structure of nuclear matter. For a range of interesting momenta they can be calculated on the lattice. The limiting factor continues to be the value of the pion mass. We present the latest results of the QCDSF collaboration using gauge configurations with two dynamical, non-perturbatively improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  4. Light meson form factors at high Q2 from lattice QCD

    Science.gov (United States)

    Koponen, Jonna; Zimermmane-Santos, André; Davies, Christine; Lepage, G. Peter; Lytle, Andrew

    2018-03-01

    Measurements and theoretical calculations of meson form factors are essential for our understanding of internal hadron structure and QCD, the dynamics that bind the quarks in hadrons. The pion electromagnetic form factor has been measured at small space-like momentum transfer |q2| theory is applicable. This leaves a gap in the intermediate Q2 where the form factors are not known. As a part of their 12 GeV upgrade Jefferson Lab will measure pion and kaon form factors in this intermediate region, up to Q2 of 6 GeV2. This is then an ideal opportunity for lattice QCD to make an accurate prediction ahead of the experimental results. Lattice QCD provides a from-first-principles approach to calculate form factors, and the challenge here is to control the statistical and systematic uncertainties as errors grow when going to higher Q2 values. Here we report on a calculation that tests the method using an ηs meson, a 'heavy pion' made of strange quarks, and also present preliminary results for kaon and pion form factors. We use the nf = 2 + 1 + 1 ensembles made by the MILC collaboration and Highly Improved Staggered Quarks, which allows us to obtain high statistics. The HISQ action is also designed to have small dicretisation errors. Using several light quark masses and lattice spacings allows us to control the chiral and continuum extrapolation and keep systematic errors in check. Warning, no authors found for 2018EPJWC.17506016.

  5. Constraints on the ωπ form factor from analyticity and unitarity

    International Nuclear Information System (INIS)

    Ananthanarayan, B.; Caprini, I.; Kubis, B.

    2014-01-01

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)

  6. Constraints on the ωπ form factor from analyticity and unitarity

    Energy Technology Data Exchange (ETDEWEB)

    Ananthanarayan, B. [Indian Institute of Science, Centre for High Energy Physics, Bangalore (India); Caprini, I. [Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O.B. MG-6, Magurele (Romania); Kubis, B. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen-und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany)

    2014-12-01

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)

  7. Relationship Domain of Form Six Teachers Thinking in Teaching with External Factors of Form Six Teachers

    Science.gov (United States)

    bin Pet, Mokhtar; Sihes, Ahmad Johari Hj

    2015-01-01

    This study aims to examine the external factors of form six teachers who can influence thinking domain form six teachers in their teaching. This study was conducted using a quantitative approach using questionnaires. A total of 300 form six teacher schools in Johor were chosen as respondents. The findings were obtained as student background…

  8. Polymorphisms in Plasmodium falciparum K13-propeller in Angola and Mozambique after the introduction of the ACTs.

    Science.gov (United States)

    Escobar, Carlos; Pateira, Sara; Lobo, Elsa; Lobo, Lis; Teodosio, Rosa; Dias, Fernanda; Fernandes, Natercia; Arez, Ana Paula; Varandas, Luis; Nogueira, Fatima

    2015-01-01

    We report the presence of SNPs in Plasmodium falciparum K13-propeller gene in two African countries, Angola and Mozambique, where malaria is a serious public health problem. Samples were collected before and after ACT introduction as first-line treatment. In each country 50 samples collected before and 50 after ACT introduction were analysed. A total of three different mutations (R471R and R575R in Angola and V494I in Mozambique) were identified in five samples, all collected after the introduction of ACT. The R471R mutation detected in Angola has already been reported in Africa (DR-Congo and Gabon). However, the mutations R575R (Angola) and V494I (Mozambique), have never been reported. V494I is adjacent to the known K13 resistance-associated mutation Y493H, although functional analysis did not predict a deleterious effect on protein function.

  9. Locally formed dopamine inhibits Na+-K+-ATPase activity in rat renal cortical tubule cells

    International Nuclear Information System (INIS)

    Seri, I.; Kone, B.C.; Gullans, S.R.; Aperia, A.; Brenner, B.M.; Ballermann, B.J.

    1988-01-01

    Dopamine, generated locally from L-dopa, inhibits Na + -K + -ATPase in permeabilized rat proximal tubules under maximum transport rate conditions for sodium. To determine whether locally formed dopamine inhibits Na + -K + -ATPase activity in intact cortical tubule cells we studied the effect of L-dopa on ouabain-sensitive oxygen consumption rate (Qo 2 ) and 86 Rb uptake in renal cortical tubule cell suspensions. L-Dopa did not affect ouabain-insensitive Qo 2 or mitochondrial respiration. However, L-dopa inhibited ouabain-sensitive Qo 2 in a concentration-dependent manner, with half-maximal inhibition (K 0.5 ) of 5 x 10 -7 M and a maximal inhibition of 14.1 ± 1.5% at 10 -4 M. L-Dopa also blunted the nystatin-stimulated Qo 2 in a concentration-dependent manner, indicating the L-dopa directly inhibits Na + -K + -ATPase activity and not sodium entry. Ouabain-sensitive 86 Rb uptake was also inhibited by L-dopa. Carbidopa, an inhibitor of the conversion of L-dopa to dopamine, eliminated the effect of L-dopa on ouabain-sensitive Qo 2 and 86 Rb uptake, indicating that dopamine rather than L-dopa was the active agent. The finding that the L-dopa concentration-response curve was shifted to the left by one order of magnitude in the presence of nystatin suggests that the inhibitory effect is enhanced when the intracellular sodium concentration is increased. By studying the effect of L-dopa on ouabain-sensitive Qo 2 at increasing extracellular sodium concentrations in the presence of nystatin, the authors demonstrated that the inhibitory effect of locally formed dopamine on the Na + -K + -ATPase is indeed dependent on the sodium available for the enzyme and occurs in an uncompetitive manner

  10. Inclusive Higgs boson production at the LHC in the kT -factorization approach

    Science.gov (United States)

    Abdulov, N. A.; Lipatov, A. V.; Malyshev, M. A.

    2018-03-01

    We investigate the inclusive Higgs boson production in proton-proton collisions at the CERN LHC conditions using the kT-factorization approach. Our analysis is based on the dominant off-shell gluon-gluon fusion subprocess (where the transverse momenta of initial gluons are taken into account) and covers H →γ γ , H →Z Z*→4 l (where l =e , μ ) and H →W+W-→e±μ∓ν ν ¯ decay channels. The transverse momentum dependent (or unintegrated) gluon densities in a proton were derived from Ciafaloni-Catani-Fiorani-Marchesini equation, which resums large logarithmic terms proportional to ln s ˜ln 1 /x , important at high energies. As an alternative choice, we apply the Kimber-Martin-Ryskin prescription, where the transverse momentum dependent gluon density is constructed from the known conventional parton distributions. We estimate the theoretical uncertainties of our calculations and compare our results with next-to-next-to-leading-order plus next-to-next-to-leading-logarithmic ones obtained using collinear QCD factorization. Our predictions agree well with the latest experimental data taken by the CMS and ATLAS Collaborations at √{s }=8 and 13 TeV.

  11. Path representation of su-hat (2){sub k} states II: Operator construction of the fermionic character and spin-1/2 -RSOS factorization

    Energy Technology Data Exchange (ETDEWEB)

    Lamy-Poirier, Joel, E-mail: jlamypoirier@perimeterinstitute.c [Departement de Physique, de Genie Physique et d' Optique, Universite Laval, Quebec, Canada, G1V 0A6 (Canada); Mathieu, Pierre, E-mail: pmathieu@phy.ulaval.c [Departement de Physique, de Genie Physique et d' Optique, Universite Laval, Quebec, Canada, G1V 0A6 (Canada)

    2011-06-01

    This is the second of two articles (independent of each other) devoted to the analysis of the path description of the states in su-hat (2){sub k} WZW models. Here we present a constructive derivation of the fermionic character at level k based on these paths. The starting point is the expression of a path in terms of a sequence of nonlocal (formal) operators acting on the vacuum ground-state path. Within this framework, the key step is the construction of the level-k operator sequences out of those at level-1 by the action of a new type of operators. These actions of operators on operators turn out to have a path interpretation: these paths are precisely the finitized RSOS paths related to the unitary minimal models M(k+1,k+2). We thus unravel - at the level of the path representation of the states - a direct factorization into a k=1 spinon part times a RSOS factor. It is also pointed out that since there are two fermionic forms describing these finite RSOS paths, the resulting fermionic su-hat (2){sub k} characters arise in two versions. Finally, the relation between the present construction and the Nagoya spectral decomposition of the path space is sketched.

  12. Biosynthesis of 10 kDa and 7.5 kDa insulin-like growth factor II in a human rhabdomyosarcoma cell line

    DEFF Research Database (Denmark)

    Nielsen, F C; Haselbacher, G; Christiansen, Jan

    1993-01-01

    In the present study we have analysed the expression of insulin-like growth factor II (IGF-II) in the human rhabdomyosarcoma cell line IN157.IN157 cells express high levels of three IGF-II mRNAs of 6.0 kb, 4.8 kb and 4.2 kb. In contrast, normal skeletal muscle expresses a negligible amount of IGF......-II mRNA. Two forms of IGF-II with molecular masses of 7.5 kDa and 10 kDa, corresponding to the mature IGF-II and IGF-II with a C-terminal extension of 21 amino acids (IGF-IIE21), were secreted into the culture medium at amounts of 17 ng/ml (2.3 nM) and 15 ng/ml (1.5 nM), respectively. IN157 cells also......-II and IGF-IIE21 with Kd values of 0.5 nM and 2 nM, respectively, and IGF-I with about 500 times lower affinity. IGF-II and IGF-IIE21 stimulated DNA synthesis via the IGF-I receptor, whereas the IGF-II/Man 6-P receptor mediated their rapid internalization and inactivation. During culture of IN157 cells about...

  13. Strangeness Vector and Axial-Vector Form Factors of the Nucleon

    Directory of Open Access Journals (Sweden)

    Pate Stephen

    2014-03-01

    Full Text Available A revised global fit of electroweak ep and vp elastic scattering data has been performed, with the goal of determining the strange quark contribution to the vector and axial-vector form factors of the nucleon in the momentum-transfer range 0 < Q2 < 1 GeV2. The two vector (electric and magnetic form factors GsE(Q2 and GsM(Q2 are strongly constrained by ep elastic scattering data, while the major source of information on the axial-vector form factor GsA(Q2 is vp scattering data. Combining the two kinds of data into a single global fit makes possible additional precision in the determination of these form factors, and provides a unique way to determine the strange quark contribution to the nucleon spin, ΔS , independently of leptonic deep-inelastic scattering. The fit makes use of data from the BNL-E734, SAMPLE, HAPPEx, G0, and PVA4 experiments; we will also compare the result of the fit with recent data from MiniBooNE, and anticipate how this fit can be improved when new data from MicroBooNE become available.

  14. Measurements of K shell absorption jump factors and jump ratios using EDXRF technique

    Science.gov (United States)

    Kacal, Mustafa Recep; Han, İbrahim; Akman, Ferdi

    2015-04-01

    In the present work, the K-shell absorption jump factors and jump ratios for 30 elements between Ti ( Z = 22) and Er ( Z = 68) were measured by energy dispersive X-ray fluorescence (EDXRF) technique. The jump factors and jump ratios for these elements were determined by measuring the K shell fluorescence parameters such as the Kα X-ray production cross-sections, K shell fluorescence yields, Kβ-to- Kα X-rays intensity ratios, total atomic absorption cross sections and mass attenuation coefficients. The measurements were performed using an Am-241 radioactive point source and a Si (Li) detector in direct excitation and transmission experimental geometry. The results for jump factors and jump ratios were compared with theoretically calculated and the ones available in the literature.

  15. Form factors of heavy mesons in QCD

    Energy Technology Data Exchange (ETDEWEB)

    Shifman, M A; Vysotsky, M I [Moskovskii Inst. Theoreticheskoj i Ehksperimental' noj Fiziki (USSR)

    1981-08-10

    We discuss logarithmic corrections to form factors of mesons built from heavy quarks. The reactions e/sup +/e/sup -/ ..-->.. etasub(c)..gamma.. and H ..-->.. J/psi..gamma.. are considered as an example. A novel feature as compared to the well-studied problem of the pion form factor is the existence of transitions between the quark-antiquark state canti c and the gluonic one. O(..cap alpha..sub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms (..cap alpha..sub(s)ln(Q/sup 2//m/sup 2/sub(c)))sup(n) is summed up with the help of the operator technique. Apart from results already known for quark operators, we use some new results referring to gluon operator and their mixing with those made from quarks. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second is based on conformal symmetry considerations.

  16. Form factors of heavy mesons in QCD

    International Nuclear Information System (INIS)

    Shifman, M.A.; Vysotsky, M.I.

    1980-01-01

    Logarithmic corrections to form factors of mesons built from heavy quarks are dirived in the framework of quantum chromodynamics. The reactions e + e - → etasub(c)γ and H → J/PSIγ are considered as an example. A novel feature as compared to the well studied problem of the pion form factor is the existence of the transformations between the quark-antiquark state c anti c and the gluonic one. O(αsub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms is summed up with the help of the operator technique. Apart from already known results for quark operators some new results referring to gluon operators and their mixing with the quark ones are used. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second derivation is based on conformal symmetry considerations

  17. Salubrinal Suppresses IL-17-Induced Upregulation of MMP-13 and Extracellular Matrix Degradation Through the NF-kB Pathway in Human Nucleus Pulposus Cells.

    Science.gov (United States)

    Yao, Zhixiao; Nie, Lin; Zhao, Yunpeng; Zhang, Yuanqiang; Liu, Yi; Li, Jingkun; Cheng, Lei

    2016-12-01

    Matrix metalloproteinase 13 (MMP-13) plays an important role in the process of pro-inflammatory cytokine-induced intervertebral disc degeneration (IDD). This study examined the effect of IL-17 on the regulation of MMP-13 and the extracellular matrix (ECM) in the intervertebral disc (IVD). We then examined whether salubrinal, a known inhibitor of eIF2α dephosphorylation, inhibited the IL-17-induced changes mentioned above. Furthermore, we demonstrated a potential therapeutic role for salubrinal in alleviating the chronic inflammatory-dependent degenerative state commonly observed in IDD. After inflammatory distress with IL-17, RT-PCR and western blot were employed to investigate the expression of MMP-13, collagen type II (COL2A1), collagen type I (COL1A1), and aggrecan (ACAN) in nucleus pulpous (NP) tissue. Activation of the NF-kB pathway was measured by western blot and immunocytochemistry following IL-17 treatment. We also examine the level of eIF2α phosphorylation after IL-17 treatment with or without salubrinal. Then, we investigated interactions of the NF-kB pathway to eIF2α phosphorylation. Moreover, we employed salubrinal and a specific inhibitor of NF-kB (BAY11-7082) to evaluate their effects on IL-17-driven regulation of MMP-13 and the ECM, as well as on the activation of NF-kB. The results showed that IL-17 increased the production of MMP-13 and decreased expression of COL2A1 and ACAN via the NF-kB pathway. Either IL-17 or salubrinal increased the level of eIF2α phosphorylation, but the effects of BAY11-7082 on the level of p-eIF2α were not detectable. BAY11-7082 and salubrinal significantly suppressed IL-17-driven intervertebral disc degeneration. Furthermore, salubrinal produced stronger effects than BAY11-7082. These results imply the potential involvement of IL-17 in IDD through activation of NF-kB signaling, which successively upregulated the expression of MMP-13 and led to the degradation of the ECM. Furthermore, salubrinal can inhibit this

  18. Analysis of the D+ --> K- pi+ e+ nu_e decay channel

    Energy Technology Data Exchange (ETDEWEB)

    del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; /INFN, Bari /Bari U.; Milanes, D.A.; /Bari U.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; /UC, Berkeley; Koch, H.; Schroeder, T.; /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Stanford U., Phys. Dept.

    2011-08-12

    Using 347.5 fb{sup -1} of data recorded by the BABAR detector at the PEP-II electron-positron collider, 244 x 10{sup 3} signal events for the D{sup +} {yields} K{sup -}{pi}{sup +}e{sup +}{nu}{sub e} decay channel are analyzed. This decay mode is dominated by the {bar K}*(892){sup 0} contribution. We determine the {bar K}*(892){sup 0} parameters: m{sub K*(892){sup 0}} = (895.4{+-}0.2{+-}0.2) MeV/c{sup 2}, {Lambda}{sub K*(892){sup 0}}{sup 0} = (46.5{+-}0.3{+-}0.2) MeV/c{sup 2} and the Blatt-Weisskopf parameter r{sub BW} = 2.1{+-}0.5{+-}0.5 (GeV/c){sup -1} where the first uncertainty comes from statistics and the second from systematic uncertainties. We also measure the parameters defining the corresponding hadronic form factors at q{sup 2} = 0 (r{sub V} = V(0)/A{sub 1}(0) = 1.463{+-}0.017{+-}0.031, r{sup 2} = A{sub 2}(0)/A{sub 1}(0) = 0.801{+-}0.020{+-}0.020) and the value of the axial-vector pole mass parameterizing the q{sup 2} variation of A{sub 1} and A{sub 2}: m{sub A} = (2.63{+-}0.10{+-}0.13) GeV/c{sup 2}. The S-wave fraction is equal to (5.79{+-}0.16{+-}0.15)%. Other signal components correspond to fractions below 1%. Using the D{sup +} {yields} K{sup -}{pi}{sup +}{pi}{sup +} channel as a normalization, we measure the D{sup +} semileptonic branching fraction: {Beta}(D{sup +} {yields} K{sup -}{pi}{sup +}e{sup +}{nu}{sub e}) = (4.00 {+-} 0.03 {+-} 0.04 {+-} 0.09) x 10{sup -2} where the third uncertainty comes from external inputs. We then obtain the value of the hadronic form factor A{sub 1} at q{sup 2} = 0: A{sub 1}(0) = 0.6200 {+-} 0.0056 {+-} 0.0065 {+-} 0.0071. Fixing the P-wave parameters we measure the phase of the S-wave for several values of the K{pi} mass. These results confirm those obtained with K{pi} production at small momentum transfer in fixed target experiments.

  19. The effect of formula versus breast feeding and exogenous vitamin K1 supplementation on circulating levels of vitamin K1 and vitamin K-dependent clotting factors in newborns

    NARCIS (Netherlands)

    Hogenbirk, K.; Peters, M.; Bouman, P.; Sturk, A.; Büller, H. A.

    1993-01-01

    The influence of breast or formula feeding together with that of a single supplementation of vitamin K1 at birth, on the vitamin K1 level and vitamin K-dependent clotting factors were studied in 65 breast and 15 formula fed infants. All breast fed newborns without supplementation (n = 25) had very

  20. Feasibility studies of time-like proton electromagnetic form factors at PANDA-FAIR

    Energy Technology Data Exchange (ETDEWEB)

    Dbeyssi, Alaa; Capozza, Luigi; Deiseroth, Malte; Froehlich, Bertold; Khaneft, Dmitry; Mora Espi, Maria Carmen; Noll, Oliver; Rodriguez Pineiro, David; Valente, Roserio; Zambrana, Manuel; Zimmermann, Iris [Helmholtz-Institut Mainz, Mainz (Germany); Maas, Frank [Helmholtz-Institut Mainz, Mainz (Germany); Institute of Nuclear Physics, Mainz (Germany); PRISMA Cluster of Excellence, Mainz (Germany); Marchand, Dominique; Tomasi-Gustafsson, Egle; Wang, Ying [Institut de Physique Nucleaire, Orsay (France); Collaboration: PANDA-Collaboration

    2015-07-01

    Electromagnetic form factors are fundamental quantities which describe the intrinsic electric and magnetic distributions of hadrons. Time-like proton form factors are experimentally accessible through the annihilation processes anti p+p <-> e{sup +}+e{sup -}. Their measurement in the time-like region had been limited by the low statistics achieved by the experiments. This contribution reports on the results of Monte Carlo simulations for future measurements of electromagnetic proton form factors at PANDA (antiProton ANnihilation at DArmstadt). In frame of the PANDARoot software, the statistical precision at which the proton form factors will be determined is estimated. The signal (anti p+p → e{sup +}+e{sup -}) identification and the suppression of the main background process (anti p+p → π{sup +}+π{sup -}) are studied. Different methods have been used and/or developed to generate and analyse the processes of interest. The results show that time-like proton form factors will be measured at PANDA with unprecedented statistical accuracy.

  1. Future Measurements of the Nucleon Elastic Electromagnetic Form Factors at Jefferson Lab

    Science.gov (United States)

    Gilfoyle, Gerard

    2018-01-01

    The elastic, electromagnetic form factors are fundamental observables that describe the internal structure of protons, neutrons, and atomic nuclei. Jefferson Lab in the United States has completed the 12 GeV Upgrade that will open new opportunities to study the form factors. A campaign to measure all four nucleon form factors (electric and magnetic ones for both proton and neutron) has been approved consisting of seven experiments in Halls A, B, and C. The increased energy of the electron beam will extend the range of precision measurements to higher Q2 for all four form factors together. This combination of measurements will allow for the decomposition of the results into their quark components and guide the development of a QCD-based understanding of nuclei in the non-perturbative regime. I will present more details on the 12 GeV Upgrade, the methods used to measure the form factors, and what we may learn.

  2. How well do we know the electromagnetic form factors of the proton?

    International Nuclear Information System (INIS)

    Arrington, J.

    2003-01-01

    Several experiments have extracted proton electromagnetic form factors from elastic cross section measurements using the Rosenbluth technique. Global analyses of these measurements indicate approximate scaling of the electric and magnetic form factors (μ p G E p /G M p ≅1), in contrast to recent polarization transfer measurements from Jefferson Lab. We present here a global reanalysis of the cross section data aimed at understanding the disagreement between the Rosenbluth extraction and the polarization transfer data. We find that the individual cross section measurements are self-consistent, and that the new global analysis yields results that are still inconsistent with polarization measurements. This discrepancy indicates a fundamental problem in one of the two techniques, or a significant error in polarization transfer or cross section measurements. An error in the polarization data would imply a large error in the extracted electric form factor, while an error in the cross sections implies an uncertainty in the extracted form factors, even if the form factor ratio is measured exactly

  3. Charge form factors and alpha-cluster internal structure of 12C

    International Nuclear Information System (INIS)

    Luk'yanov, V.K.; Zemlyanaya, E.V.; Kadrev, D.N.; Antonov, A.N.; Spasova, K.; Anagnostatos, G.S.; Ginis, P.; Giapitzakis, J.

    1999-01-01

    The transition densities and form factors of 0 + , 2 + , and 3 - states in 12 C are calculated in alpha-cluster model using the triangle frame with clusters in the vertices. The wave functions of nucleons in the alpha clusters are taken as they were obtained in the framework of the models used for the description of the 4 He form factor and momentum distribution which are based on the one-body density matrix construction. They contain effects of the short-range NN correlations, as well as the d-shell admixtures in 4 He. Calculations and the comparison with the experimental data show that visible effects on the form and magnitude of the 12 C form factors take place, especially at relatively large momentum transfers

  4. Study of the radiolysis of tetracycline hydrochloride in powder form, in aqueous solutions and in benzyl alcohol, at 77K, by electron paramagnetic resonance spectroscopy

    International Nuclear Information System (INIS)

    Guedes, S.M.L.

    1984-01-01

    The radiolysis of tetracycline hydrochloride in powder form, dissolved in benzyl alcohol and in acid, neutral and alkaline aerated aqueous solutions at 77K is studied by electron paramagnetic resonance spectroscopy. Mechanisms of reactions that occur in the radiolysis of these systems are proposed and some aspects of the reactions that occurs with electrons and with hydrogen atoms at 77K are investigated, since tetracycline hydrochloride captures both paramagnetic species. Also discussed is the influence of some factors in the migration of these species at 77K, such as: the position of solutes, the crystalline structure of the solvent, the kinetic energy of the species and the angle of incidence in the channeling. The rate constants for the reaction between the electron and physical and chemical traps which are present in the alkaline aerated aqueous solutions, at 77k, are calculated. The values found are, respectively: k=9.6 x 10 15 1 mol -1 s -1 and k= 1.8 x 10 10 1 mol -1 s -1 . (Author) [pt

  5. Monte Carlo calculations of kQ, the beam quality conversion factor

    International Nuclear Information System (INIS)

    Muir, B. R.; Rogers, D. W. O.

    2010-01-01

    Purpose: To use EGSnrc Monte Carlo simulations to directly calculate beam quality conversion factors, k Q , for 32 cylindrical ionization chambers over a range of beam qualities and to quantify the effect of systematic uncertainties on Monte Carlo calculations of k Q . These factors are required to use the TG-51 or TRS-398 clinical dosimetry protocols for calibrating external radiotherapy beams. Methods: Ionization chambers are modeled either from blueprints or manufacturers' user's manuals. The dose-to-air in the chamber is calculated using the EGSnrc user-code egs c hamber using 11 different tabulated clinical photon spectra for the incident beams. The dose to a small volume of water is also calculated in the absence of the chamber at the midpoint of the chamber on its central axis. Using a simple equation, k Q is calculated from these quantities under the assumption that W/e is constant with energy and compared to TG-51 protocol and measured values. Results: Polynomial fits to the Monte Carlo calculated k Q factors as a function of beam quality expressed as %dd(10) x and TPR 10 20 are given for each ionization chamber. Differences are explained between Monte Carlo calculated values and values from the TG-51 protocol or calculated using the computer program used for TG-51 calculations. Systematic uncertainties in calculated k Q values are analyzed and amount to a maximum of one standard deviation uncertainty of 0.99% if one assumes that photon cross-section uncertainties are uncorrelated and 0.63% if they are assumed correlated. The largest components of the uncertainty are the constancy of W/e and the uncertainty in the cross-section for photons in water. Conclusions: It is now possible to calculate k Q directly using Monte Carlo simulations. Monte Carlo calculations for most ionization chambers give results which are comparable to TG-51 values. Discrepancies can be explained using individual Monte Carlo calculations of various correction factors which are more

  6. Remarks on electromagnetic form factors of hadrons in the quark model

    International Nuclear Information System (INIS)

    Vainshtein, A.I.; Zakharov, V.I.

    1977-01-01

    Relations between the transversal and longitudinal parts of elastic and quasielastic form factors are studied within the quark model. It is shown that for an even number of the constituent quarks the longitudinal part dominates while for an odd number the transversal part is the largest one. Consequences form this result are considered for deuteron form factor and for matrix elements of the electromagnetic transitions between π, rho, A 1 mesons

  7. Virtual photons in the pion form factors and the energy-momentum tensor

    Energy Technology Data Exchange (ETDEWEB)

    Kubis, Bastian E-mail: b.kubis@fz-juelich.de; Meissner, Ulf-G. E-mail: ulf-g.meissner@fz-juelich.de

    2000-05-22

    We evaluate the vector and scalar form factor of the pion in the presence of virtual photons at next-to-leading order in two-flavor chiral perturbation theory. We also consider the scalar and tensor pion form factors of the energy-momentum tensor. We find that the intrinsic electromagnetic corrections are very small for the vector as well as the charged pion scalar form factor. The scalar radius of the neutral pion is reduced by two percent. We perform infrared regularization by considering electron-positron annihilation into pions and the decay of a light Higgs boson into a pion pair. We discuss the detector resolution dependent contributions to the various form factors and pion radii.

  8. Virtual photons in the pion form factors and the energy-momentum tensor

    International Nuclear Information System (INIS)

    Kubis, Bastian; Meissner, Ulf-G.

    2000-01-01

    We evaluate the vector and scalar form factor of the pion in the presence of virtual photons at next-to-leading order in two-flavor chiral perturbation theory. We also consider the scalar and tensor pion form factors of the energy-momentum tensor. We find that the intrinsic electromagnetic corrections are very small for the vector as well as the charged pion scalar form factor. The scalar radius of the neutral pion is reduced by two percent. We perform infrared regularization by considering electron-positron annihilation into pions and the decay of a light Higgs boson into a pion pair. We discuss the detector resolution dependent contributions to the various form factors and pion radii

  9. Semileptonic Form Factor ratio Bs → Ds/B → D and Its Application to BR(Bs0 → μ+μ-)

    International Nuclear Information System (INIS)

    Du, Daping; DeTar, Carleton; Kronfeld, Andreas; Laiho, Jack; Meurice, Yannick; Qiu, Si-wei

    2011-01-01

    We present a (2+1)-flavor lattice QCD calculation of the form factor ratio between the semileptonic decays (bar B) s 0 → D s + l - (bar ν) and (bar B) 0 → D + l - (bar ν). This ratio is an important theoretical input to the hadronic determination of the B meson fragmentation fraction ratio f s /f d which enters in the measurement of BR(B s 0 → μ + μ - ). Small lattice spacings and high statistics enable us to simulate the decays with a dynamic final D meson of small momentum and reliably extract the hadronic matrix elements at nonzero recoil. We report our preliminary result for the form factor ratio at the corresponding momentum transfer of the two decays f 0 (s) (M π 2 )/f 0 (d) (M K 2 ).

  10. RISK FACTORS FOR DEVELOPMENT OF DISSEMINATED FORMS OF INTRUSIVE CANDIDIASIS AMONG CHILDREN SUFFERING FROM BURNS

    Directory of Open Access Journals (Sweden)

    A.S. Kolbin

    2006-01-01

    Full Text Available The aim of the study is to identify the significant factors for the risk of candidemia development among children, suffering from burns. The authors have conducted an analytical retrospective controlling study. It shows that statistically significant factors the risk of candidemia development among children with major heat injury (burns of III–IV degree were the area of the full? Thickness burn over 40% (or boundless, p = 0,008; use of car bapenem class antibiotics (or 0,16 with 95% confidence interval 0,08–0,36, p = 0,023; glycopeptids (or 0,13 with 95% confidence interval 0,05–0,33, p = 0,008; mucosa colonization of the upper respiratory tracts with сandida SPP (or 0,14 with 95% confidence interval 0,06–0,32, p = 0,011. Among patients with the above listed factors for the risk of candidemia development it is necessary to conduct prophylaxis by systemic antimicotics, such as: lipid associated forms of amphotericin в and fluconasol.Key words: children, burns, intrusive candidiasis, risk factors.

  11. Perturbative corrections to B → D form factors in QCD

    Science.gov (United States)

    Wang, Yu-Ming; Wei, Yan-Bing; Shen, Yue-Long; Lü, Cai-Dian

    2017-06-01

    We compute perturbative QCD corrections to B → D form factors at leading power in Λ/ m b , at large hadronic recoil, from the light-cone sum rules (LCSR) with B-meson distribution amplitudes in HQET. QCD factorization for the vacuum-to- B-meson correlation function with an interpolating current for the D-meson is demonstrated explicitly at one loop with the power counting scheme {m}_c˜ O(√{Λ {m}_b}) . The jet functions encoding information of the hard-collinear dynamics in the above-mentioned correlation function are complicated by the appearance of an additional hard-collinear scale m c , compared to the counterparts entering the factorization formula of the vacuum-to- B-meson correction function for the construction of B → π from factors. Inspecting the next-to-leading-logarithmic sum rules for the form factors of B → Dℓν indicates that perturbative corrections to the hard-collinear functions are more profound than that for the hard functions, with the default theory inputs, in the physical kinematic region. We further compute the subleading power correction induced by the three-particle quark-gluon distribution amplitudes of the B-meson at tree level employing the background gluon field approach. The LCSR predictions for the semileptonic B → Dℓν form factors are then extrapolated to the entire kinematic region with the z-series parametrization. Phenomenological implications of our determinations for the form factors f BD +,0 ( q 2) are explored by investigating the (differential) branching fractions and the R( D) ratio of B → Dℓν and by determining the CKM matrix element |V cb | from the total decay rate of B → Dμν μ .

  12. Constraints on the ωπ Form Factor from Analyticity and Unitarity

    Science.gov (United States)

    Ananthanarayan, B.; Caprini, Irinel; Kubis, Bastian

    Form factors are important low-energy quantities and an accurate knowledge of these sheds light on the strong interactions. A variety of methods based on general principles have been developed to use information known in different energy regimes to constrain them in regions where experimental information needs to be tested precisely. Here we review our recent work on the electromagnetic ωπ form factor in a model-independent framework known as the method of unitarity bounds, partly motivated by the discre-pancies noted recently between the theoretical calculations of the form factor based on dispersion relations and certain experimental data measured from the decay ω → π0γ*. We have applied a modified dispersive formalism, which uses as input the discontinuity of the ωπ form factor calculated by unitarity below the ωπ threshold and an integral constraint on the square of its modulus above this threshold. The latter constraint was obtained by exploiting unitarity and the positivity of the spectral function of a QCD correlator, computed on the spacelike axis by operator product expansion and perturbative QCD. An alternative constraint is obtained by using data available at higher energies for evaluating an integral of the modulus squared with a suitable weight function. From these conditions we derived upper and lower bounds on the modulus of the ωπ form factor in the region below the ωπ threshold. The results confirm the existence of a disagreement between dispersion theory and experimental data on the ωπ form factor around 0:6 GeV, including those from NA60 published in 2016.

  13. Acinetobacter baumannii K27 and K44 capsular polysaccharides have the same K unit but different structures due to the presence of distinct wzy genes in otherwise closely related K gene clusters.

    Science.gov (United States)

    Shashkov, Alexander S; Kenyon, Johanna J; Senchenkova, Sof'ya N; Shneider, Mikhail M; Popova, Anastasiya V; Arbatsky, Nikolay P; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Hall, Ruth M; Knirel, Yuriy A

    2016-05-01

    Capsular polysaccharides (CPSs), from Acinetobacter baumannii isolates 1432, 4190 and NIPH 70, which have related gene content at the K locus, were examined, and the chemical structures established using 2D(1)H and(13)C NMR spectroscopy. The three isolates produce the same pentasaccharide repeat unit, which consists of 5-N-acetyl-7-N-[(S)-3-hydroxybutanoyl] (major) or 5,7-di-N-acetyl (minor) derivatives of 5,7-diamino-3,5,7,9-tetradeoxy-D-glycero-D-galacto-non-2-ulosonic (legionaminic) acid (Leg5Ac7R), D-galactose, N-acetyl-D-galactosamine and N-acetyl-D-glucosamine. However, the linkage between repeat units in NIPH 70 was different to that in 1432 and 4190, and this significantly alters the CPS structure. The KL27 gene cluster in 4190 and KL44 gene cluster in NIPH 70 are organized identically and contain lga genes for Leg5Ac7R synthesis, genes for the synthesis of the common sugars, as well as anitrA2 initiating transferase and four glycosyltransferases genes. They share high-level nucleotide sequence identity for corresponding genes, but differ in the wzy gene encoding the Wzy polymerase. The Wzy proteins, which have different lengths and share no similarity, would form the unrelated linkages in the K27 and K44 structures. The linkages formed by the four shared glycosyltransferases were predicted by comparison with gene clusters that synthesize related structures. These findings unambiguously identify the linkages formed by WzyK27 and WzyK44, and show that the presence of different wzy genes in otherwise closely related K gene clusters changes the structure of the CPS. This may affect its capacity as a protective barrier for A. baumannii. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Vitamin K: the effect on health beyond coagulation – an overview

    Directory of Open Access Journals (Sweden)

    Cees Vermeer

    2012-04-01

    Full Text Available Vitamin K is essential for the synthesis of proteins belonging to the Gla-protein family. To the members of this family belong four blood coagulation factors, which all are exclusively formed in the liver. The importance of vitamin K for hemostasis is demonstrated from the fact that vitamin K-deficiency is an acute, life-threatening condition due to excessive bleeding. Other members of the Gla-protein family are osteocalcin, matrix Gla-protein (MGP, and Gas6 that play key functions in maintaining bone strength, arterial calcification inhibition, and cell growth regulation, respectively. In total 17 Gla-proteins have been discovered at this time. Recently, it was observed that the dietary vitamin K requirement for the synthesis of the coagulation factors is much lower than for that of the extra-hepatic Gla-proteins. This forms the basis of the triage theory stating that during poor dietary supply, vitamins are preferentially utilized for functions that are important for immediate survival. This explains why in the healthy population all clotting factors are synthesized in their active form, whereas the synthesis of other Gla-proteins is sub-optimal in non-supplemented subjects. Prolonged sub-clinical vitamin K deficiency is a risk factor for osteoporosis, atherosclerosis, and cancer. Present recommendations for dietary intake are based on the daily dose required to prevent bleeding. Accumulating scientific data suggests that new, higher recommendations for vitamin K intake should be formulated.

  15. The three-loop form factor in N=4 super Yang-Mills theory

    Energy Technology Data Exchange (ETDEWEB)

    Gehrmann, Thomas [Universitaet Zuerich (Switzerland); Henn, Johannes [IAS Princeton (United States); Huber, Tobias [Universitaet Siegen (Germany)

    2012-07-01

    We present the calculation of the Sudakov form factor in N=4 super Yang-Mills theory to the three-loop order. At leading colour, the latter is expressed in terms of planar and non-planar loop integrals. We show that it is possible to choose a representation in which each loop integral has uniform transcendentality in the Riemann {zeta}-function. We comment on the expected exponentiation of the infrared divergences and the values of the three-loop cusp and collinear anomalous dimensions in dimensional regularisation. We also compare the form factor in N=4 super Yang-Mills to the leading transcendentality pieces of the quark and gluon form factor in QCD. Finally, we investigate the ultraviolet properties of the form factor in D>4 dimensions.

  16. From form factors to generalized parton distributions

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, Markus

    2013-06-15

    I present an extraction of generalized parton distributions from selected data on the electromagnetic nucleon form factors. The extracted distributions can in particular be used to quantify the contribution to the proton spin from the total angular momentum carried by valence quarks, as well as their transverse spatial distribution inside the proton.

  17. Form factors and other measures of strangeness in the nucleon

    International Nuclear Information System (INIS)

    Diehl, M.; Feldmann, T.; Kroll, P.

    2007-11-01

    We discuss the phenomenology of strange-quark dynamics in the nucleon, based on experimental and theoretical results for electroweak form factors and for parton densities. In particular, we construct a model for the generalized parton distribution that relates the asymmetry s(x)- anti s(x) between the longitudinal momentum distributions of strange quarks and antiquarks with the form factor F s 1 (t), which describes the distribution of strangeness in transverse position space. (orig.)

  18. Meson form factors and covariant three-dimensional formulation of composite model

    International Nuclear Information System (INIS)

    Skachkov, N.B.; Solovtsov, I.L.

    1978-01-01

    An approach is developed which is applied in the framework of the relativistic quark model to obtain explicit expressions for meson form factors in terms of covariant wave functions of the two-quark system. These wave functions obey the two-particle quasipotential equation in which the relative motion of quarks is singled out in a covariant way. The exact form of the wave functions is found using the transition to the relativistic configurational representation with the help of the harmonic analysis on the Lorentz group instead of the usual Fourier expansion and then solving the relativistic difference equation thus obtained. The expressions found for form factors are transformed into the three-dimensional covariant form which is a direct geometrical relativistic generalization of analogous expressions of the nonrelativistic quantum mechanics and provides the decrease of the meson form factor by the Fsub(π)(t) approximately t -1 law as -t infinity, in the Coulomb field

  19. Partial wave analysis of the reaction p(3.5 GeV) + p -> pK(+) Lambda to search for the "ppK(-)" bound state

    Czech Academy of Sciences Publication Activity Database

    Agakishiev, G.; Arnold, O.; Belver, D.; Belyaev, A.; Krása, Antonín; Křížek, Filip; Kugler, Andrej; Sobolev, Yuri, G.; Tlustý, Pavel; Wagner, Vladimír

    2015-01-01

    Roč. 742, MAR (2015), s. 242-248 ISSN 0370-2693 R&D Projects: GA MŠk LG12007; GA ČR GA13-06759S Institutional support: RVO:61389005 Keywords : kaonic nuclei * anti-kaon-nucleon physics * ppK(-) * low energy * QCD * partial wave analysis Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 4.787, year: 2015

  20. The structural evolution of Milky-Way-like star-forming galaxies since z ∼ 1.3

    International Nuclear Information System (INIS)

    Patel, Shannon G.; Fumagalli, Mattia; Franx, Marijn; Labbé, Ivo; Muzzin, Adam; Van Dokkum, Pieter G.; Leja, Joel; Skelton, Rosalind E.; Momcheva, Ivelina; Nelson, Erica June; Van der Wel, Arjen; Rix, Hans-Walter; Brammer, Gabriel; Whitaker, Katherine E.; Lundgren, Britt; Wake, David A.; Quadri, Ryan F.

    2013-01-01

    We follow the structural evolution of star-forming galaxies (SFGs) like the Milky Way by selecting progenitors to z ∼ 1.3 based on the stellar mass growth inferred from the evolution of the star-forming sequence. We select our sample from the 3D-HST survey, which utilizes spectroscopy from the HST/WFC3 G141 near-IR grism and enables precise redshift measurements for our sample of SFGs. Structural properties are obtained from Sérsic profile fits to CANDELS WFC3 imaging. The progenitors of z = 0 SFGs with stellar mass M = 10 10.5 M ☉ are typically half as massive at z ∼ 1. This late-time stellar mass growth is consistent with recent studies that employ abundance matching techniques. The descendant SFGs at z ∼ 0 have grown in half-light radius by a factor of ∼1.4 since z ∼ 1. The half-light radius grows with stellar mass as r e ∝M 0.29 . While most of the stellar mass is clearly assembling at large radii, the mass surface density profiles reveal ongoing mass growth also in the central regions where bulges and pseudobulges are common features in present day late-type galaxies. Some portion of this growth in the central regions is due to star formation as recent observations of Hα maps for SFGs at z ∼ 1 are found to be extended but centrally peaked. Connecting our lookback study with galactic archeology, we find the stellar mass surface density at R = 8 kpc to have increased by a factor of ∼2 since z ∼ 1, in good agreement with measurements derived for the solar neighborhood of the Milky Way.

  1. Initiation factor eIF2B not p70 S6 kinase is involved in the activation of the PI-3K signalling pathway induced by the v=src oncogene

    Czech Academy of Sciences Publication Activity Database

    Vojtěchová, Martina; Šloncová, Eva; Kučerová, Dana; Jiřička, Jaroslav; Sovová, Vlasta; Tuháčková, Zdena

    2003-01-01

    Roč. 543, 1-3 (2003), s. 81-86 ISSN 0014-5793 R&D Projects: GA ČR GV312/96/K205; GA ČR GA301/00/0269; GA MZd NC5428 Institutional research plan: CEZ:AV0Z5052915 Keywords : phosphoinositide 3-kinase signalling pathway * mRNA translation * 70 kDa ribosomal protein S6 kinase Subject RIV: CE - Biochemistry Impact factor: 3.609, year: 2003

  2. Mitigation of Hydrogen Gas Generation from the Reaction of Uranium Metal with Water in K Basin Sludge and Sludge Waste Forms

    Energy Technology Data Exchange (ETDEWEB)

    Sinkov, Sergey I.; Delegard, Calvin H.; Schmidt, Andrew J.

    2011-06-08

    corrosion rates in water alone and in simulated sludge were near or slightly below the metal-in-water rate while nitrate-free sludge/Aquaset II decreased rates by about a factor of 3. Addition of 1 M nitrate to simulated sludge decreased the corrosion rate by a factor of ~5 while 1 M nitrate in sludge/Aquaset II mixtures decreased the corrosion rate by ~2.5 compared with the nitrate-free analogues. Mixtures of simulated sludge with Aquaset II treated with 1 M nitrate had uranium corrosion rates about a factor of 8 to 10 lower than the water-only rate law. Nitrate was found to provide substantial hydrogen mitigation for immobilized simulant sludge waste forms containing Aquaset II or Aquaset II G clay. Hydrogen attenuation factors of 1000 or greater were determined at 60°C for sludge-clay mixtures at 1 M nitrate. Hydrogen mitigation for tests with PC and Aquaset II H (which contains PC) were inconclusive because of suspected failure to overcome induction times and fully enter into anoxic corrosion. Lessening of hydrogen attenuation at ~80°C and ~95°C for simulated sludge and Aquaset II was observed with attenuation factors around 100 to 200 at 1 M nitrate. Valuable additional information has been obtained on the ability of nitrate to attenuate hydrogen gas generation from solution, simulant K Basin sludge, and simulant sludge with immobilization agents. Details on characteristics of the associated reactions were also obtained. The present testing confirms prior work which indicates that nitrate is an effective agent to attenuate hydrogen from uranium metal corrosion in water and simulated K Basin sludge to show that it is also effective in potential candidate solidified K Basin waste forms for WIPP disposal. The hydrogen mitigation afforded by nitrate appears to be sufficient to meet the hydrogen generation limits for shipping various sludge waste streams based on uranium metal concentrations and assumed waste form loadings.

  3. Mitigation of Hydrogen Gas Generation from the Reaction of Uranium Metal with Water in K Basin Sludge and Sludge Waste Forms

    International Nuclear Information System (INIS)

    Sinkov, Sergey I.; Delegard, Calvin H.; Schmidt, Andrew J.

    2011-01-01

    corrosion rates in water alone and in simulated sludge were near or slightly below the metal-in-water rate while nitrate-free sludge/Aquaset II decreased rates by about a factor of 3. Addition of 1 M nitrate to simulated sludge decreased the corrosion rate by a factor of ∼5 while 1 M nitrate in sludge/Aquaset II mixtures decreased the corrosion rate by ∼2.5 compared with the nitrate-free analogues. Mixtures of simulated sludge with Aquaset II treated with 1 M nitrate had uranium corrosion rates about a factor of 8 to 10 lower than the water-only rate law. Nitrate was found to provide substantial hydrogen mitigation for immobilized simulant sludge waste forms containing Aquaset II or Aquaset II G clay. Hydrogen attenuation factors of 1000 or greater were determined at 60 C for sludge-clay mixtures at 1 M nitrate. Hydrogen mitigation for tests with PC and Aquaset II H (which contains PC) were inconclusive because of suspected failure to overcome induction times and fully enter into anoxic corrosion. Lessening of hydrogen attenuation at ∼80 C and ∼95 C for simulated sludge and Aquaset II was observed with attenuation factors around 100 to 200 at 1 M nitrate. Valuable additional information has been obtained on the ability of nitrate to attenuate hydrogen gas generation from solution, simulant K Basin sludge, and simulant sludge with immobilization agents. Details on characteristics of the associated reactions were also obtained. The present testing confirms prior work which indicates that nitrate is an effective agent to attenuate hydrogen from uranium metal corrosion in water and simulated K Basin sludge to show that it is also effective in potential candidate solidified K Basin waste forms for WIPP disposal. The hydrogen mitigation afforded by nitrate appears to be sufficient to meet the hydrogen generation limits for shipping various sludge waste streams based on uranium metal concentrations and assumed waste form loadings.

  4. Iso-vector form factors of the delta and nucleon in QCD sum rules

    International Nuclear Information System (INIS)

    Ozpineci, A.

    2012-01-01

    Form factors are important non-perturbative properties of hadrons. They give information about the internal structure of the hadrons. In this work, iso-vector axial-vector and iso-vector tensor form factors of the nucleon and the iso-vector axial-vector Δ→N transition form factor calculations in QCD Sum Rules are presented.

  5. 75 FR 10018 - Proposed Collection; Comment Request for Form 1041 and Related Schedules D, J, and K-1

    Science.gov (United States)

    2010-03-04

    ... 1041 and Related Schedules D, J, and K-1 AGENCY: Internal Revenue Service (IRS), Treasury. ACTION..., the IRS is soliciting comments concerning Form 1041 and related Schedules D, J, and K-1, U.S. Income...), Accumulation Distribution for Certain Complex Trusts (Schedule J), and Beneficiary's Share of Income...

  6. 78 FR 23981 - Proposed Collection; Comment Request for Form 1041 and Related Schedules D, J, and K-1

    Science.gov (United States)

    2013-04-23

    ... 1041 and Related Schedules D, J, and K-1 AGENCY: Internal Revenue Service (IRS), Treasury. ACTION..., the IRS is soliciting comments concerning Form 1041 and related Schedules D, J, and K-1, U.S. Income... Losses (Schedule D), Accumulation Distribution for Certain Complex Trusts (Schedule J), and Beneficiary's...

  7. Helium Compton Form Factor Measurements at CLAS

    Energy Technology Data Exchange (ETDEWEB)

    Voutier, Eric J.-M. [Laboratoire de Physique Subatomique et Cosmologie

    2013-07-01

    The distribution of the parton content of nuclei, as encoded via the generalized parton distributions (GPDs), can be accessed via the deeply virtual Compton scattering (DVCS) process contributing to the cross section for leptoproduction of real photons. Similarly to the scattering of light by a material, DVCS provides information about the dynamics and the spatial structure of hadrons. The sensitivity of this process to the lepton beam polarization allows to single-out the DVCS amplitude in terms of Compton form factors that contain GPDs information. The beam spin asymmetry of the $^4$He($\\vec {\\mathrm e}$,e$' \\gamma ^4$He) process was measured in the experimental Hall B of the Jefferson Laboratory to extract the real and imaginary parts of the twist-2 Compton form factor of the $^4$He nucleus. The experimental results reported here demonstrate the relevance of this method for such a goal, and suggest the dominance of the Bethe-Heitler amplitude to the unpolarized process in the kinematic range explored by the experiment.

  8. The spin-dependent neutralino-nucleus form factor for 127I

    International Nuclear Information System (INIS)

    Ressell, M.T.

    1996-01-01

    We present the results of detailed shell model calculations of the spin-dependent elastic form factor for the nucleus 127 I. the calculations were performed in extremely large model spaces which adequately describe the configuration mixing in this nucleus. Good agreement between the calculated and experimental values of the magnetic moment are found. Other nuclear observables are also compared to experiment. The dependence of the form factor upon the model space and effective interaction is discussed

  9. Form factors and other measures of strangeness in the nucleon

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, M. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Feldmann, T. [Siegen Univ. (Germany). Theoretische Physik I; Kroll, P. [Bergische Univ., Wuppertal (Germany). Fachbereich Physik

    2007-11-15

    We discuss the phenomenology of strange-quark dynamics in the nucleon, based on experimental and theoretical results for electroweak form factors and for parton densities. In particular, we construct a model for the generalized parton distribution that relates the asymmetry s(x)- anti s(x) between the longitudinal momentum distributions of strange quarks and antiquarks with the form factor F{sup s}{sub 1}(t), which describes the distribution of strangeness in transverse position space. (orig.)

  10. Form factors for semileptonic Bs→Klν decays in lattice QCD

    International Nuclear Information System (INIS)

    Bahr, Felix Tobias

    2015-01-01

    We present an exploratory study of the calculation of the form factor f + (q 2 ) for the semileptonic decay B s →Klν in large-volume lattice QCD simulations with two dynamical sea quark flavours using O(a) improved Wilson fermions. We discuss the computation of relevant two- and three-point functions and consider complementary methods how these can be combined to obtain the form factor. In particular, we put forward the strategy of a combined fit in which data of all correlators enter and which has as fit parameters energies and amplitudes of the correlators and the form factor. The b quark is treated in HQET; our present analysis focuses on the static limit. Meanwhile, we have developed the code and performed the measurements of all needed O(1/m h ) corrections which will be used as soon as their coefficients will have been computed by the ALPHA collaboration. In order to be able to measure the form factor at the same value of the momentum transfer q 2 on all ensembles, we impose twisted boundary conditions on the s and b quarks that allow for a free tuning of the quark momenta and thus of q 2 . We perform measurements on a subset of N f =2 CLS gauge configurations, obtaining the form factor at three different lattice spacings and roughly the same pion mass of about 330 MeV. Using these, we carry out a continuum extrapolation and observe that it is relatively flat in a 2 . A measurement at a different pion mass indicates that quark mass effects are small. We compare our continuum value of the form factor with recently published results of other collaborations and observe a good agreement.

  11. Forecasting electricity spot market prices with a k-factor GIGARCH process

    International Nuclear Information System (INIS)

    Diongue, Abdou Ka; Guegan, Dominique; Vignal, Bertrand

    2009-01-01

    In this article, we investigate conditional mean and conditional variance forecasts using a dynamic model following a k-factor GIGARCH process. Particularly, we provide the analytical expression of the conditional variance of the prediction error. We apply this method to the German electricity price market for the period August 15, 2000-December 31, 2002 and we test spot prices forecasts until one-month ahead forecast. The forecasting performance of the model is compared with a SARIMA-GARCH benchmark model using the year 2003 as the out-of-sample. The proposed model outperforms clearly the benchmark model. We conclude that the k-factor GIGARCH process is a suitable tool to forecast spot prices, using the classical RMSE criteria. (author)

  12. Electromagnetic form factors of the ρ meson in light cone QCD sum rules

    International Nuclear Information System (INIS)

    Aliev, T.M.; Savci, M.

    2004-01-01

    We investigate the electromagnetic form factors of the ρ meson in light cone QCD sum rules. We find that the ratio of the magnetic and charge form factors is larger than 2 at all values of Q 2 (Q 2 ≥0.5 GeV 2 ). The values of the individual form factors at fixed values of Q 2 predicted by the light cone QCD sum rules are quite different compared to the results of other approaches. These results can be checked in the future, when more precise data on ρ meson form factors is available

  13. Association of ABO blood groups with von Willebrand factor, factor VIII and ADAMTS-13 in patients with lung cancer.

    Science.gov (United States)

    Liu, Xia; Chen, Xiaogang; Yang, Jiezuan; Guo, Renyong

    2017-09-01

    Coagulative and fibrinolytic disorders appear to be associated with the development of lung cancer. The aim of the present study was to determine plasma levels of von Willebrand factor (VWF) and a disintegrin and metalloproteinase with a thrombospondin type 1 motif 13 (ADAMTS-13), and factor VIII (FVIII) activity, in association with O and non-O blood groups in patients with lung cancer. Plasma levels of VWF and ADAMTS-13, and FVIII activity were measured in 115 patients with lung cancer and 98 healthy subjects. Phenotyping of the ABO blood groups was also performed for the two groups. Significantly increased VWF levels and FVIII activity, as well as significantly decreased ADAMTS-13 levels, were observed in patients with distant metastasis as compared with those without distant metastasis and the healthy controls. Plasma VWF levels and FVIII activity were significantly increased in subjects with non-O type blood compared with those with type O blood in the two groups. However, a significant decrease in ADAMTS-13 levels was observed only in the control group among those with non-O type blood, compared with those with type O blood. The results of the present study indicate that increased VWF and decreased ADAMTS-13 levels facilitate the invasiveness and metastasis of lung cancer. Non-O blood groups constitute a risk factor for increased VWF and FVIII in plasma. Continued monitoring of VWF and ADAMTS-13 levels, and of FVIII activity in patients with lung cancer with distinct blood groups may help to minimize the incidence of thrombotic events and improve assessment of disease progression.

  14. Counting and tensorial properties of twist-two helicity-flip nucleon form factors

    International Nuclear Information System (INIS)

    Chen Zhang; Ji Xiangdong

    2005-01-01

    We perform a systematic analysis on the off-forward matrix elements of the twist-two quark and gluon helicity-flip operators. By matching the allowed quantum numbers and their crossing channel counterparts (a method developed by Ji and Lebed), we systematically count the number of independent nucleon form factors in off-forward scattering of matrix elements of these quark and gluon spin-flip operators. In particular, we find that the numbers of independent nucleon form factors of twist-two, helicity-flip quark (gluon) operators are 2n-1 (2n-5) if n is odd, and 2n-2 (2n-6) if n is even, with n≥2 (n≥4). We also analyze and write down the tensorial/Lorentz structure and kinematic factors of the expansion of these operators' matrix elements in terms of the independent form factors. These generalized form factors define the off-forward quark and gluon helicity-flip distributions in the literature

  15. Translation, cultural adaptation assessment, and both validity and reliability testing of the kidney disease quality of life - short form version 1.3 for use with Iranian patients

    DEFF Research Database (Denmark)

    Pakpour, Amir; Yekaninejad, Mirsaeed; Mølsted, Stig

    2011-01-01

    AIM: The aims of the study were to translate the Kidney Disease Quality of Life--Short Form version 1.3 (KDQOL-SF ver. 1.3) questionnaire into Iranian (Farsi), and to then assess it in terms of validity and reliability on Iranian patients. METHODS: The questionnaire was first translated into Farsi...... a larger group (212 patients with end-stage renal disease on haemodialysis). Afterwards, reliability was estimated by internal consistency, and validity was assessed using known group comparisons and constructs for the patient group as a whole. Finally, the factor structure of the questionnaire...... be summarized into an 11 factor structure that jointly accounted for 79.81% of the variance. CONCLUSION: The Iranian version of the KDQOL-SF questionnaire is both highly reliable and valid for use with Iranian patients on haemodialysis....

  16. Recoil of the pion-surrounded nucleon bag and axial form factors

    International Nuclear Information System (INIS)

    Klabucar, D.; Picek, I.

    1984-03-01

    A recent method of boosting the bag is extended to the pion-surrounded nucleon bag and developed for the calculation of low-energy nucleon form factors. The usefulness of the method is illustrated by the induced pseudoscalar form factor where both the inclusion of the pion field and the non-vanishing momentum transfer are necessary. (Auth.)

  17. TADPOL: A 1.3 mm Survey of Dust Polarization in Star-forming Cores and Regions

    OpenAIRE

    Hull, Charles L. H.; Plambeck, Richard L.; Kwon, Woojin; Bower, Geoffrey C.; Carpenter, John M.; Crutcher, Richard M.; Fiege, Jason D.; Franzmann, Erica; Hakobian, Nicholas S.; Heiles, Carl; Houde, Martin; Hughes, A. Meredith; Lamb, James W.; Looney, Leslie W.; Marrone, Daniel P.

    2014-01-01

    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ~2".5 resolution TADPOL maps with ~20" resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusi...

  18. Insulin-like growth factor II (IGF II) in human brain: regional distribution of IGF II and of higher molecular mass forms

    International Nuclear Information System (INIS)

    Haselbacher, G.K.; Schwab, M.E.; Pasi, A.; Humbel, R.E.

    1985-01-01

    Twenty-four distinct areas of human brain were analyzed for the presence of insulin-like growth factor (IGF). As reported for cerebrospinal fluid, only IGF II-like immunoreactivity, but no significant amounts of IGF I-like immunoreactivity, could be found. Upon gel permeation chromatography, two to five distinct size classes were separated on the basis of their immunoreactivity. Radioimmunoassays and a bioassay also gave results indistinguishable from those of serum IGF II. The highest amounts of IGF II-like immunoreactivity occur in the anterior pituitary. This is up to 100 times more than in most other brain regions analyzed. The higher molecular mass immunoreactive species were partially characterized. After immunoaffinity purification, the 38- and 26-kDa species are active in a bioassay. Specific IGF-binding protein activity could be shown after purification of the 38- and 26-kDa species on an IGF-affinity column. The 13-kDa species released significant amounts of 7.5-kDa material. The results are interpreted as evidence for the presence of IGF II synthesized locally in human brain

  19. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.

    2015-08-13

    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  20. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.; Peyvandi, F.; Pagliari, M.; Cairo, A.; Abdel-Azeim, Safwat; Chermak, Edrisse; Lazzareschi, I.; Mastrangelo, S.; Cavallo, Luigi; Oliva, R.; De Cristofaro, R.

    2015-01-01

    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  1. Wide temperature range (T = 295 K and 770-1305 K) study of the kinetics of the reactions HCO + NO and HCO + NO2 using frequency modulation spectroscopy.

    Science.gov (United States)

    Dammeier, J; Colberg, M; Friedrichs, G

    2007-08-21

    The rate constants for , HCO + NO --> HNO + CO, and , HCO + NO(2)--> products, have been measured at temperatures between 770 K modulation (FM) absorption spectroscopy. Kinetic simulations based on a comprehensive reaction mechanism showed that the rate constants for the title reactions could be sensitively extracted from the measured HCO profiles. The determined high temperature rate constants are k(1)(769-1307 K) = (7.1 +/- 2.7) x 10(12) cm(3) mol(-1) s(-1) and k(2)(804-1186 K) = (3.3 +/- 1.8) x 10(13) cm(3) mol(-1) s(-1). The room temperature values were found to be in very good agreement with existing literature data and show that both reactions are essentially temperature independent. The weak temperature dependence of can be explained by the interplay of a dominating direct abstraction pathway and a complex-forming mechanism. Both pathways yield the products HNO + CO. In contrast to , no evidence for a significant contribution of a direct high temperature abstraction channel was found for . Here, the observed temperature independent overall rate constant can be described by a complex-forming mechanism with several product channels. Detailed information on the strongly temperature dependent channel branching ratios is provided. Moreover, the high temperature rate constant of , OH + (CHO)(2), has been determined to be k(7) approximately 1.1 x 10(13) cm(3) mol(-1) s(-1).

  2. Nucleon form factors, generalized parton distributions and quark angular momentum

    International Nuclear Information System (INIS)

    Diehl, Markus; Kroll, Peter; Regensburg Univ.

    2013-02-01

    We extract the individual contributions from u and d quarks to the Dirac and Pauli form factors of the proton, after a critical examination of the available measurements of electromagnetic nucleon form factors. From this data we determine generalized parton distributions for valence quarks, assuming a particular form for their functional dependence. The result allows us to study various aspects of nucleon structure in the valence region. In particular, we evaluate Ji's sum rule and estimate the total angular momentum carried by valence quarks at the scale μ=2 GeV to be J u v =0.230 +0.009 -0.024 and J d v =-0.004 +0.010 -0.016 .

  3. Factorization of Constrained Energy K-Network Reliability with Perfect Nodes

    OpenAIRE

    Burgos, Juan Manuel

    2013-01-01

    This paper proves a new general K-network constrained energy reliability global factorization theorem. As in the unconstrained case, beside its theoretical mathematical importance the theorem shows how to do parallel processing in exact network constrained energy reliability calculations in order to reduce the processing time of this NP-hard problem. Followed by a new simple factorization formula for its calculation, we propose a new definition of constrained energy network reliability motiva...

  4. Full-disc 13CO(1-0) mapping across nearby galaxies of the EMPIRE survey and the CO-to-H2 conversion factor

    Science.gov (United States)

    Cormier, D.; Bigiel, F.; Jiménez-Donaire, M. J.; Leroy, A. K.; Gallagher, M.; Usero, A.; Sandstrom, K.; Bolatto, A.; Hughes, A.; Kramer, C.; Krumholz, M. R.; Meier, D. S.; Murphy, E. J.; Pety, J.; Rosolowsky, E.; Schinnerer, E.; Schruba, A.; Sliwa, K.; Walter, F.

    2018-04-01

    Carbon monoxide (CO) provides crucial information about the molecular gas properties of galaxies. While 12CO has been targeted extensively, isotopologues such as 13CO have the advantage of being less optically thick and observations have recently become accessible across full galaxy discs. We present a comprehensive new data set of 13CO(1-0) observations with the IRAM 30-m telescope of the full discs of nine nearby spiral galaxies from the EMPIRE survey at a spatial resolution of ˜1.5 kpc. 13CO(1-0) is mapped out to 0.7 - 1 r25 and detected at high signal-to-noise ratio throughout our maps. We analyse the 12CO(1-0)-to-13CO(1-0) ratio (ℜ) as a function of galactocentric radius and other parameters such as the 12CO(2-1)-to-12CO(1-0) intensity ratio, the 70-to-160 μm flux density ratio, the star formation rate surface density, the star formation efficiency, and the CO-to-H2 conversion factor. We find that ℜ varies by a factor of 2 at most within and amongst galaxies, with a median value of 11 and larger variations in the galaxy centres than in the discs. We argue that optical depth effects, most likely due to changes in the mixture of diffuse/dense gas, are favoured explanations for the observed ℜ variations, while abundance changes may also be at play. We calculate a spatially resolved 13CO(1-0)-to-H2 conversion factor and find an average value of 1.0 × 1021 cm-2 (K km s-1)-1 over our sample with a standard deviation of a factor of 2. We find that 13CO(1-0) does not appear to be a good predictor of the bulk molecular gas mass in normal galaxy discs due to the presence of a large diffuse phase, but it may be a better tracer of the mass than 12CO(1-0) in the galaxy centres where the fraction of dense gas is larger.

  5. Constraints on the [Formula: see text] form factor from analyticity and unitarity.

    Science.gov (United States)

    Ananthanarayan, B; Caprini, I; Kubis, B

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic [Formula: see text] form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the [Formula: see text] form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around [Formula: see text].

  6. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  7. Analysis of B{yields}K{sup *}{sub J}({yields}K{pi}){mu}{sup +}{mu}{sup -} in the higher kaon resonance region

    Energy Technology Data Exchange (ETDEWEB)

    Lue, Cai-Dian [Institute of High Energy Physics, Beijing, BJ (China); Wang, Wei [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2011-11-15

    We study the resonant contributions in the process anti B{sup 0} {yields} K{sup -} {pi}{sup +}{mu}{sup +}{mu}{sup -} with the K{sup -}{pi}{sup +} invariant mass square m{sup 2}{sub K{pi}} element of [1, 5] GeV{sup 2}. Width effects of the involved strange mesons, K{sup *}(1410), K{sup *}{sub 0}(1430), K{sup *}{sub 2}(1430), K{sup *}(1680), K{sup *}{sub 3}(1780) and K{sup *}{sub 4}(2045), are incorporated. In terms of the helicity amplitudes, we derive a compact form for the full angular distributions, through which the branching ratios, forward-backward asymmetries and polarizations are attained. We propose that the uncertainties in the B {yields} K{sup *}{sub J} form factors can be pinned down by the measurements of a set of SU(3)-related processes. Using results from the large energy limit, we derive the dependence of branching fractions on the m{sub K{pi}}, and find that the K{sup *}{sub 2} resonance has a clear signature, in particular, in the transverse polarizations. (orig.)

  8. Towards a dispersive determination of the pion transition form factor

    Science.gov (United States)

    Leupold, Stefan; Hoferichter, Martin; Kubis, Bastian; Niecknig, Franz; Schneider, Sebastian P.

    2018-01-01

    We start with a brief motivation why the pion transition form factor is interesting and, in particular, how it is related to the high-precision standard-model calculation of the gyromagnetic ratio of the muon. Then we report on the current status of our ongoing project to calculate the pion transition form factor using dispersion theory. Finally we present and discuss a wish list of experimental data that would help to improve the input for our calculations and/or to cross-check our results.

  9. Towards a dispersive determination of the pion transition form factor

    Directory of Open Access Journals (Sweden)

    Leupold Stefan

    2018-01-01

    Full Text Available We start with a brief motivation why the pion transition form factor is interesting and, in particular, how it is related to the high-precision standard-model calculation of the gyromagnetic ratio of the muon. Then we report on the current status of our ongoing project to calculate the pion transition form factor using dispersion theory. Finally we present and discuss a wish list of experimental data that would help to improve the input for our calculations and/or to cross-check our results.

  10. The epigenetic effect of glucosamine and a nuclear factor-kappa B (NF-kB) inhibitor on primary human chondrocytes - Implications for osteoarthritis

    Energy Technology Data Exchange (ETDEWEB)

    Imagawa, Kei, E-mail: k.Imagawa@soton.ac.uk [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom); Tohoku University School of Medicine, Sendai (Japan); Andres, MC de [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom); Hashimoto, Ko [Hospital for Special Surgery, NY (United States); Pitt, Dominic [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom); Itoi, Eiji [Tohoku University School of Medicine, Sendai (Japan); Goldring, Mary B. [Hospital for Special Surgery, NY (United States); Roach, Helmtrud I.; Oreffo, Richard O.C. [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom)

    2011-02-18

    Research highlights: {yields} Glucosamine and a NF-kB inhibitor reduce inflammation in OA. {yields} Cytokine induced demethylation of CpG site in IL1{beta} promoter prevented by glucosamine. {yields} Glucosamine and NF-kB inhibitor have epigenetic effects on human chondrocytes. -- Abstract: Objective: Idiopathic osteoarthritis is the most common form of osteoarthritis (OA) world-wide and remains the leading cause of disability and the associated socio-economic burden in an increasing aging population. Traditionally, OA has been viewed as a degenerative joint disease characterized by progressive destruction of the articular cartilage and changes in the subchondral bone culminating in joint failure. However, the etiology of OA is multifactorial involving genetic, mechanical and environmental factors. Treatment modalities include analgesia, joint injection with steroids or hyaluronic acid, oral supplements including glucosamine and chondroitin sulfate, as well as physiotherapy. Thus, there is significant interest in the discovery of disease modifying agents. One such agent, glucosamine (GlcN) is commonly prescribed even though the therapeutic efficacy and mechanism of action remain controversial. Inflammatory cytokines, including IL-1{beta}, and proteinases such as MMP-13 have been implicated in the pathogenesis and progression of OA together with an associated CpG demethylation in their promoters. We have investigated the potential of GlcN to modulate NF-kB activity and cytokine-induced abnormal gene expression in articular chondrocytes and, critically, whether this is associated with an epigenetic process. Method: Human chondrocytes were isolated from the articular cartilage of femoral heads, obtained with ethical permission, following fractured neck of femur surgery. Chondrocytes were cultured for 5 weeks in six separate groups; (i) control culture, (ii) cultured with a mixture of 2.5 ng/ml IL-1{beta} and 2.5 ng/ml oncostatin M (OSM), (iii) cultured with 2 mM N

  11. The epigenetic effect of glucosamine and a nuclear factor-kappa B (NF-kB) inhibitor on primary human chondrocytes - Implications for osteoarthritis

    International Nuclear Information System (INIS)

    Imagawa, Kei; Andres, MC de; Hashimoto, Ko; Pitt, Dominic; Itoi, Eiji; Goldring, Mary B.; Roach, Helmtrud I.; Oreffo, Richard O.C.

    2011-01-01

    Research highlights: → Glucosamine and a NF-kB inhibitor reduce inflammation in OA. → Cytokine induced demethylation of CpG site in IL1β promoter prevented by glucosamine. → Glucosamine and NF-kB inhibitor have epigenetic effects on human chondrocytes. -- Abstract: Objective: Idiopathic osteoarthritis is the most common form of osteoarthritis (OA) world-wide and remains the leading cause of disability and the associated socio-economic burden in an increasing aging population. Traditionally, OA has been viewed as a degenerative joint disease characterized by progressive destruction of the articular cartilage and changes in the subchondral bone culminating in joint failure. However, the etiology of OA is multifactorial involving genetic, mechanical and environmental factors. Treatment modalities include analgesia, joint injection with steroids or hyaluronic acid, oral supplements including glucosamine and chondroitin sulfate, as well as physiotherapy. Thus, there is significant interest in the discovery of disease modifying agents. One such agent, glucosamine (GlcN) is commonly prescribed even though the therapeutic efficacy and mechanism of action remain controversial. Inflammatory cytokines, including IL-1β, and proteinases such as MMP-13 have been implicated in the pathogenesis and progression of OA together with an associated CpG demethylation in their promoters. We have investigated the potential of GlcN to modulate NF-kB activity and cytokine-induced abnormal gene expression in articular chondrocytes and, critically, whether this is associated with an epigenetic process. Method: Human chondrocytes were isolated from the articular cartilage of femoral heads, obtained with ethical permission, following fractured neck of femur surgery. Chondrocytes were cultured for 5 weeks in six separate groups; (i) control culture, (ii) cultured with a mixture of 2.5 ng/ml IL-1β and 2.5 ng/ml oncostatin M (OSM), (iii) cultured with 2 mM N-acetyl GlcN (Sigma

  12. 13CHD2–CEST NMR spectroscopy provides an avenue for studies of conformational exchange in high molecular weight proteins

    International Nuclear Information System (INIS)

    Rennella, Enrico; Huang, Rui; Velyvis, Algirdas; Kay, Lewis E.

    2015-01-01

    An NMR experiment for quantifying slow (millisecond) time-scale exchange processes involving the interconversion between visible ground state and invisible, conformationally excited state conformers is presented. The approach exploits chemical exchange saturation transfer (CEST) and makes use of 13 CHD 2 methyl group probes that can be readily incorporated into otherwise highly deuterated proteins. The methodology is validated with an application to a G48A Fyn SH3 domain that exchanges between a folded conformation and a sparsely populated and transiently formed unfolded ensemble. Experiments on a number of different protein systems, including a 360 kDa half-proteasome, establish that the sensitivity of this 13 CHD 2 13 C–CEST technique can be upwards of a factor of 5 times higher than for a previously published 13 CH 3 13 C–CEST approach (Bouvignies and Kay in J Biomol NMR 53:303–310, 2012), suggesting that the methodology will be powerful for studies of conformational exchange in high molecular weight proteins

  13. Nucleon form factors, generalized parton distributions and quark angular momentum

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, Markus [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Kroll, Peter [Bergische Univ., Wuppertal (Germany). Fachbereich Physik; Regensburg Univ. (Germany). Institut fuer Theoretische Physik

    2013-02-15

    We extract the individual contributions from u and d quarks to the Dirac and Pauli form factors of the proton, after a critical examination of the available measurements of electromagnetic nucleon form factors. From this data we determine generalized parton distributions for valence quarks, assuming a particular form for their functional dependence. The result allows us to study various aspects of nucleon structure in the valence region. In particular, we evaluate Ji's sum rule and estimate the total angular momentum carried by valence quarks at the scale {mu}=2 GeV to be J{sup u}{sub v}=0.230{sup +0.009}{sub -0.024} and J{sup d}{sub v}=-0.004{sup +0.010}{sub -0.016}.

  14. Plasmid Transfer of Plasminogen K1-5 Reduces Subcutaneous Hepatoma Growth by Affecting Inflammatory Factors

    Directory of Open Access Journals (Sweden)

    Lea A. Koch

    2014-01-01

    Full Text Available There is evidence that plasminogen K1-5 (PlgK1-5 directly affects tumour cells and inflammation. Therefore, we analysed if PlgK1-5 has immediate effects on hepatoma cells and inflammatory factors in vitro and in vivo. In vitro, effects of plasmid encoding PlgK1-5 (pK1-5 on Hepa129, Hepa1-6, and HuH7 cell viability, apoptosis, and proliferation as well as VEGF and TNF-alpha expression and STAT3-phosphorylation were investigated. In vivo, tumour growth, proliferation, vessel density, and effects on vascular endothelial growth factor (VEGF and tumour necrosis factor alpha (TNF-alpha expression were examined following treatment with pK1-5. In vivo, pK1-5 halved cell viability; cell death was increased by up to 15% compared to the corresponding controls. Proliferation was not affected. VEGF, TNF-alpha, and STAT3-phosphorylation were affected following treatment with pK1-5. In vivo, ten days after treatment initiation, pK1-5 reduced subcutaneous tumour growth by 32% and mitosis by up to 77% compared to the controls. Vessel density was reduced by 50%. TNF-alpha levels in tumour and liver tissue were increased, whereas VEGF levels in tumours and livers were reduced after pK1-5 treatment. Taken together, plasmid gene transfer of PlgK1-5 inhibits hepatoma (cell growth not only by reducing vessel density but also by inducing apoptosis, inhibiting proliferation, and triggering inflammation.

  15. Astrophysical S factor for 13C(p,γ)14N and asymptotic normalization coefficients

    International Nuclear Information System (INIS)

    Mukhamedzhanov, A.M.; Azhari, A.; Gagliardi, C.A.; Sattarov, A.; Tang, X.; Trache, L.; Tribble, R.E.; Burjan, V.; Kroha, V.

    2002-01-01

    We reanalyze the 13 C(p,γ) 14 N radiative capture reaction within the R-matrix approach. The low-energy astrophysical S factor has important contributions from both resonant and onresonant captures. The normalization of the nonresonant component of the transition to a particular 14 N bound state is expressed in terms of the asymptotic normalization coefficient (ANC). In the analysis we use the experimental ANC's inferred from the 13 C( 14 N, 13 C) 14 N and 13 C( 3 He,d) 14 N reactions. The fits of the calculated S factors to the experimental data are sensitive to the ANC values and are used to test the extracted ANC's. We find that for transitions to all the states in 14 N, except the third excited state, the ANC's determined from the transfer reactions provide the best fit. The astrophysical factor we obtain, S(0)=7.7±1.1 keV b, is in excellent agreement with previous results

  16. Baryon form factors in chiral perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Kubis, B.; Meissner, U.G. [Forschungszentrum Juelich GmbH (Germany). Inst. fuer Kernphysik

    2001-01-01

    We analyze the electromagnetic form factors of the ground state baryon octet to fourth order in relativistic baryon chiral perturbation theory. Predictions for the {sigma}{sup -} charge radius and the {lambda}-{sigma}{sup 0} transition moment are found to be in excellent agreement with the available experimental information. Furthermore, the convergence behavior of the hyperon charge radii is shown to be more than satisfactory. (orig.)

  17. Elastic form factors at higher CEBAF energies

    Energy Technology Data Exchange (ETDEWEB)

    Petratos, G.G. [Kent State Univ., OH (United States)

    1994-04-01

    The prospects for elastic scattering from few body systems with higher beam energies at CEBAF is presented. The deuteron and{sup 3}He elastic structure functions A(Q{sup 2}) can be measured at sufficiently high momentum transfers to study the transition between the conventional meson-nucleon and the constituent quark-gluon descriptions. Possible improvements in the proton magnetic form factor data are also presented.

  18. Form factor of some types of toroidal solenoids

    International Nuclear Information System (INIS)

    Koryavko, V.I.; Litvinenko, Yu.A.

    1979-01-01

    Obtained were the type of dependence between consumed power and formed field for toroidal helical-wound solenoids and the expression for the form factor analogous to the Fabry coefficient for cylindrical solenoids. Determined were optimum dimensions of the helical winding of ''forceless'' toroidal solenoids satisfying the condition of the formation of maximum field at minimum consumed power. Investigations also covered some types of conventional toroidal solenoids. Presented in the paper diagrams permitted to chose dimensions of the considered toroidal solenoids according to their consumed power and winding material volume

  19. Polar Desolvation and Position 226 of Pancreatic and Neutrophil Elastases Are Crucial to their Affinity for the Kunitz-Type Inhibitors ShPI-1 and ShPI-1/K13L.

    Science.gov (United States)

    Hernández González, Jorge Enrique; García-Fernández, Rossana; Valiente, Pedro Alberto

    2015-01-01

    The Kunitz-type protease inhibitor ShPI-1 inhibits human neutrophil elastase (HNE, Ki = 2.35·10-8 M) but does not interact with the porcine pancreatic elastase (PPE); whereas its P1 site variant, ShPI-1/K13L, inhibits both HNE and PPE (Ki = 1.3·10-9 M, and Ki = 1.2·10-8 M, respectively). By employing a combination of molecular modeling tools, e.g., structural alignment, molecular dynamics simulations and Molecular Mechanics Generalized-Born/Poisson-Boltzmann Surface Area free energy calculations, we showed that D226 of HNE plays a critical role in the interaction of this enzyme with ShPI-1 through the formation of a strong salt bridge and hydrogen bonds with K13 at the inhibitor's P1 site, which compensate the unfavorable polar-desolvation penalty of the latter residue. Conversely, T226 of PPE is unable to establish strong interactions with K13, thereby precluding the insertion of K13 side-chain into the S1 subsite of this enzyme. An alternative conformation of K13 site-chain placed at the entrance of the S1 subsite of PPE, similar to that observed in the crystal structure of ShPI-1 in complex with chymotrypsin (PDB: 3T62), is also unfavorable due to the lack of stabilizing pair-wise interactions. In addition, our results suggest that the higher affinity of ShPI-1/K13L for both elastases mainly arises from the lower polar-desolvation penalty of L13 compared to that of K13, and not from stronger pair-wise interactions of the former residue with those of each enzyme. These results provide insights into the PPE and HNE inhibition and may contribute to the design of more potent and/or specific inhibitors toward one of these proteases.

  20. Strange and charge symmetry violating electromagnetic form factors of the nucleon

    International Nuclear Information System (INIS)

    Shanahan, P.E.

    2016-01-01

    We summarise recent work based on lattice QCD simulations of the electromagnetic form factors of the octet baryons from the CSSM/QCDSF/UKQCD collaborations. After an analysis of the simulation results using techniques to approach the infinite volume limit and the physical pseudoscalar masses at non-zero momentum transfer, the extrapolated proton and neutron form factors are found to be in excellent agreement with those extracted from experiment. Given the success of these calculations, we describe how the strange electromagnetic form factors may be estimated from these results under the same assumption of charge symmetry used in experimental determinations of those quantities. Motivated by the necessity of that assumption, we explore a method for determining the size of charge symmetry breaking effects using the same lattice results. (author)

  1. Neutral Pion Transition Form Factor Measurement and Run Control at the NA62 experiment

    CERN Document Server

    AUTHOR|(CDS)2082375; Goudzovski, Evgueni

    The measurement of the 0 electromagnetic transition form factor (TFF) slope a is performed in the time-like region of momentum transfer using a sample of 1.1 $10^6$ $\\pi^0 \\to e^+ e^- \\gamma$ Dalitz decays collected at the NA62-RK experiment in 2007. The event selection, the fit procedure and the study of the systematic ffects are presented. The final result obtained $a = (3.68 \\pm 0.51stat \\pm 0.25syst) \\times 10^{-2} $ is the most precise to date and represents the first evidence of a non-zero $\\pi^0$ TFF slope with more than 3 $\\sigma$ significance. The NA62 experiment based at the CERN SPS is currently taking data and aims at measuring the branching fraction of the $K \\to \\pi \

  2. Bovine serum albumin-catalyzed deprotonation of [1-(13)C]glycolaldehyde: protein reactivity toward deprotonation of the alpha-hydroxy alpha-carbonyl carbon.

    Science.gov (United States)

    Go, Maybelle K; Malabanan, M Merced; Amyes, Tina L; Richard, John P

    2010-09-07

    Bovine serum albumin (BSA) in D(2)O at 25 degrees C and pD 7.0 was found to catalyze the deuterium exchange reactions of [1-(13)C]glycolaldehyde ([1-(13)C]GA) to form [1-(13)C,2-(2)H]GA and [1-(13)C,2,2-di-(2)H]GA. The formation of [1-(13)C,2-(2)H]GA and [1-(13)C,2,2-di-(2)H]GA in a total yield of 51 +/- 3% was observed at early reaction times, and at later times, [1-(13)C,2-(2)H]GA was found to undergo BSA-catalyzed conversion to [1-(13)C,2,2-di-(2)H]GA. The overall second-order rate constant for these deuterium exchange reactions [(k(E))(P)] equals 0.25 M(-1) s(-1). By comparison, (k(E))(P) values of 0.04 M(-1) s(-1) [Go, M. K., Amyes, T. L., and Richard, J. P. (2009) Biochemistry 48, 5769-5778] and 0.06 M(-1) s(-1) [Go, M. K., Koudelka, A., Amyes, T. L., and Richard, J. P. (2010) Biochemistry 49, 5377-5389] have been determined for the wild-type- and K12G mutant TIM-catalyzed deuterium exchange reactions of [1-(13)C]GA, respectively, to form [1-(13)C,2,2-di-(2)H]GA. These data show that TIM and BSA exhibit a modest catalytic activity toward deprotonation of the alpha-hydroxy alpha-carbonyl carbon. We suggest that this activity is intrinsic to many globular proteins, and that it must be enhanced to demonstrate meaningful de novo design of protein catalysts of proton transfer at alpha-carbonyl carbon.

  3. G-factor for the K-6, Jsup(π) = 6+ isomer in 178Hf

    International Nuclear Information System (INIS)

    Faestermann, T.; Haeusser, O.; Ward, D.; Andrews, H.R.; Alexander, T.K.; Horn, D.

    1978-01-01

    High-K isomers are prevalent towards the end of the rare-earth region of deformed nuclei where the valence particles fill high Ω orbitals. Very little is known about the g-factors for these isomers mainly because in the half-life range encountered, 50 ns-50 μs, quadrupole and paramagnetic relaxation effects can destroy the nuclear alignment very rapidly. In 178 Hf a Isub(π)K=6 + 6 isomer with a half-life of 78 ns has recently been found. It decays predominantly to the ground band (K=O) 6 + and 4 + levels with gamma rays of 921.8 keV and 1247.3 keV respectively. The authors have measured the g-factor of this isomer with the method of perturbed angular distributions. (Auth.)

  4. Bleeding and asymptomatic overdose in patients under Vitamin K antagonist therapy: Frequency and risk factors

    Directory of Open Access Journals (Sweden)

    F. Ben Mbarka

    2018-03-01

    Full Text Available Background: Vitamin K antagonists are widely used in the treatment and prevention of thromboembolic disease. However, these drugs can cause serious side effects, especially bleeding. This study aims to evaluate frequency and risk factors of both bleeding and asymptomatic overdose in North African patients undergoing Vitamin K antagonist therapy. Methods: We performed a cross-sectional study in patients undergoing Vitamin K antagonist therapy. A statistical analysis has been conducted to identify overdose and bleeding risk factors by using chi-square test (p < .05. Results: One hundred and eleven patients were included. We recorded 14 cases of bleeding and 26 cases of asymptomatic overdose. Advanced age, poor adherence, concomitant use of paracetamol and history of previous bleeding are significant risk factors of over-anticoagulation. An INR value over 6 at admission, a high therapeutic target range for INR, concomitant use of acetylsalicylic acid, lack of information on overdose signs and measures to be taken in case of bleeding were identified as risk factors for bleeding. Conclusion: Most of the risk factors identified in our study seem to be related to patients lack of information and education. These results highlight the importance of creating a therapeutic patient education program. Keywords: Vitamin K antagonist, Bleeding, Risk factor, Overdose

  5. The electromagnetic Sigma-to-Lambda hyperon transition form factors at low energies

    International Nuclear Information System (INIS)

    Granados, Carlos; Leupold, Stefan; Perotti, Elisabetta

    2017-01-01

    Using dispersion theory the low-energy electromagnetic form factors for the transition of a Sigma to a Lambda hyperon are related to the pion vector form factor. The additionally required input, i.e. the two-pion-Sigma-Lambda amplitudes are determined from relativistic next-to-leading-order (NLO) baryon chiral perturbation theory including the baryons from the octet and optionally from the decuplet. Pion rescattering is again taken into account by dispersion theory. It turns out that the inclusion of decuplet baryons is not an option but a necessity to obtain reasonable results. The electric transition form factor remains very small in the whole low-energy region. The magnetic transition form factor depends strongly on one not very well determined low-energy constant of the NLO Lagrangian. One obtains reasonable predictive power if this low-energy constant is determined from a measurement of the magnetic transition radius. Such a measurement can be performed at the future Facility for Antiproton and Ion Research (FAIR). (orig.)

  6. The electromagnetic Sigma-to-Lambda hyperon transition form factors at low energies

    Energy Technology Data Exchange (ETDEWEB)

    Granados, Carlos [Uppsala Universitet, Institutionen foer Fysik och Astronomi (Sweden); Jefferson Lab, Newport News, VA (United States); Leupold, Stefan; Perotti, Elisabetta [Uppsala Universitet, Institutionen foer Fysik och Astronomi (Sweden)

    2017-06-15

    Using dispersion theory the low-energy electromagnetic form factors for the transition of a Sigma to a Lambda hyperon are related to the pion vector form factor. The additionally required input, i.e. the two-pion-Sigma-Lambda amplitudes are determined from relativistic next-to-leading-order (NLO) baryon chiral perturbation theory including the baryons from the octet and optionally from the decuplet. Pion rescattering is again taken into account by dispersion theory. It turns out that the inclusion of decuplet baryons is not an option but a necessity to obtain reasonable results. The electric transition form factor remains very small in the whole low-energy region. The magnetic transition form factor depends strongly on one not very well determined low-energy constant of the NLO Lagrangian. One obtains reasonable predictive power if this low-energy constant is determined from a measurement of the magnetic transition radius. Such a measurement can be performed at the future Facility for Antiproton and Ion Research (FAIR). (orig.)

  7. Bilateral comparison of 10 kΩ standards (ongoing BIPM key comparison BIPM.EM-K13.b) between the NSAI-NML (Ireland) and the BIPM

    Science.gov (United States)

    Goebel, R.; Power, O.; Fletcher, N.; Stock, M.

    2012-01-01

    This report describes the results obtained from a NML(Ireland)-BIPM bilateral comparison of 10 kΩ resistance standards in 2010. The comparison was carried out in the framework of the BIPM ongoing key comparison BIPM.EM-K13.b. Two BIPM 10 kΩ travelling standards of SR104 type were calibrated first at the BIPM, then at the NMLI and again at the BIPM after their return. The stability of the transfer standards was such that the uncertainty associated with the transfer was significantly smaller than the uncertainty arising from the calibrations. The NMLI and the BIPM calibrations were found to be in agreement, with a mean difference smaller than the standard uncertainty of the comparison. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCEM, according to the provisions of the CIPM Mutual Recognition Arrangement (MRA).

  8. Abnormal thermal expansion properties of cubic NaZn13-type La(Fe,Al)13 compounds.

    Science.gov (United States)

    Li, Wen; Huang, Rongjin; Wang, Wei; Zhao, Yuqiang; Li, Shaopeng; Huang, Chuanjun; Li, Laifeng

    2015-02-28

    The cubic NaZn13-type La(Fe,Al)13 compounds were synthesized, and their linear thermal expansion properties were investigated in the temperature range of 4.2-300 K. It was found that these compounds exhibit abnormal thermal expansion behavior, i.e., pronounced negative thermal expansion (NTE) or zero thermal expansion (ZTE) behavior, below the Curie temperature due to the magnetovolume effect (MVE). Moreover, in the La(Fe,Al)13 compounds, the modification of the coefficient of thermal expansion (CTE) as well as the abnormal thermal expansion (ATE) temperature-window is achieved through optimizing the proportion of Fe and Al. Typically, the average CTE of the LaFe13-xAlx compounds with x = 1.8 reaches as large as -10.47 × 10(-6) K(-1) between 100 and 225 K (ΔT = 125 K). Also, the ZTE temperature-window of the LaFe13-xAlx compounds with x = 2.5 and x = 2.7 could be broadened to 245 K (from 5 to 250 K). Besides, the magnetic properties of these compounds were measured and correlated with the abnormal thermal expansion behavior. The present results highlight the potential application of such La(Fe,Al)13 compounds with abnormal thermal expansion properties in cryogenic engineering.

  9. 76 FR 58029 - Agency Information Collection Activities: Form N-600K, Extension of a Currently Approved...

    Science.gov (United States)

    2011-09-19

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... ACTION: 30-Day Notice of Information Collection Under Review: Form N- 600K; Application for Citizenship and Issuance of Certificate under Section 322. The Department of Homeland Security, U.S. Citizenship...

  10. Relativistic form factors for hadrons with quark-model wave functions

    International Nuclear Information System (INIS)

    Stanley, D.P.; Robson, D.

    1982-01-01

    The relationship between relativistic form factors and quark-potential-model wave functions is examined using an improved version of an approach by Licht and Pagnamenta. Lorentz-contraction effects are expressed in terms of an effective hadron mass which varies as the square root of the number of quark constituents. The effective mass is calculated using the rest-frame wave functions from the mean-square momentum along the direction of the momentum transfer. Applications with the parameter-free approach are made to the elastic form factors of the pion, proton, and neutron using a Hamiltonian which simultaneously describes mesons and baryons. A comparison of the calculated radii for pions and kaons suggests that the measured kaon radius should be slightly smaller than the corresponding pion radius. The large negative squared charge radius for the neutron is partially explained via the quark model but a full description requires the inclusion of a small component of a pion ''cloud'' configuration. The problematic connection between the sizes of hadrons deduced from form factors and the ''measured'' values of average transverse momenta is reconciled in the present model

  11. SU(3) breaking in hyperon transition vector form factors

    International Nuclear Information System (INIS)

    Shanahan, P.E.; Thomas, A.W.; Young, R.D.; Zanotti, J.M.; Rakow, P.E.L.

    2015-08-01

    We present a calculation of the SU(3)-breaking corrections to the hyperon transition vector form factors to O(p 4 ) in heavy baryon chiral perturbation theory with finite-range regularisation. Both octet and decuplet degrees of freedom are included. We formulate a chiral expansion at the kinematic point Q 2 =-(M B 1 -M B 2 ) 2 , which can be conveniently accessed in lattice QCD. The two unknown low-energy constants at this point are constrained by lattice QCD simulation results for the Σ - →n and Ξ 0 →Σ + transition form factors. Hence we determine lattice-informed values of f 1 at the physical point. This work constitutes progress towards the precise determination of vertical stroke V us vertical stroke from hyperon semileptonic decays.

  12. On the large-Q2 behavior of the pion transition form factor

    Directory of Open Access Journals (Sweden)

    Gernot Eichmann

    2017-11-01

    Full Text Available We study the transition of non-perturbative to perturbative QCD in situations with possible violations of scaling limits. To this end we consider the singly- and doubly-virtual pion transition form factor π0→γγ at all momentum scales of symmetric and asymmetric photon momenta within the Dyson–Schwinger/Bethe–Salpeter approach. For the doubly virtual form factor we find good agreement with perturbative asymptotic scaling laws. For the singly-virtual form factor our results agree with the Belle data. At very large off-shell photon momenta we identify a mechanism that introduces quantitative modifications to Efremov–Radyushkin–Brodsky–Lepage scaling.

  13. Specific-heat measurements in superconducting indium-thallium alloys and the pseudopotential form factor

    International Nuclear Information System (INIS)

    Munukutla, L.V.; Cappelletti, R.L.

    1980-01-01

    Normal-state specific heats between 1 and 4.4 K and superconducting transition temperatures of pure indium and In-Tl alloys have been measured. Excellent agreement with previous results was found. N/sub bs/(0) was extracted using our γ values and Dynes's lambda values and shows a large variation. The measured variation of lambda 2 > was also obtained from Dynes's results and found to be nearly linear in spite of the large variation of N/sub bs/(0). This is shown to be a consequence of the fact that the ratio of the calculated average screened pseudopotential form factor to electron density of states, 2 /sub s/>/N/sub bs/(0), is nearly constant across the alloy series for each element. No anomaly was found in the specific heat of In/sub 0.69/Tl/sub 0.31/ at the expected martensitic transition temperature

  14. 1/mQ corrections to form factors and extraction of |Vcb|

    International Nuclear Information System (INIS)

    Liu, J.; Chao, K.

    1997-01-01

    Form factors for 0 - →0 - and 0 - →1 - mesonic transitions in the heavy quark limit and the 1/m Q corrections are analyzed model independently within the Bethe-Salpeter (BS) formalism. The analysis shows that the BS formalism has spin-flavor symmetry in the heavy quark limit and respects Luke's theorem when the 1/m Q corrections are taken into account. All form factors for B→D (*) transitions beyond the zero recoil point are estimated in a relativistic constituent quark model based on the BS formalism. Using these form factors we calculate the branching ratios for the semileptonic decays B→D (*) l + ν l and extract the Cabibbo-Kobayashi-Maskawa matrix element |V cb |. We get |V cb |=0.042±0.003 which is consistent with the current world average. copyright 1997 The American Physical Society

  15. Form factors of Ising spin and disorder fields on the Poincare disc

    International Nuclear Information System (INIS)

    Doyon, Benjamin

    2004-01-01

    Using recent results concerning form factors of certain scaling fields in the massive Dirac theory on the Poincare disc, we find expressions for the form factors of Ising spin and disorder fields in the massive Majorana theory on the Poincare disc. In particular, we verify that these recent results agree with the factorization properties of the fields in the Dirac theory representing tensor products of spin and of disorder fields in the Majorana theory

  16. 13N species formed by proton irradiation of water

    International Nuclear Information System (INIS)

    Tilbury, R.S.; Dahl, J.R.

    1979-01-01

    We have shown that the irradiation of aerated water with 14.5-MeV protons produces as principal radioactive products nitrogen-13-labeled nitrate, nitrite, and ammonium ions. The yield of 13 NH 4 + varied from approximately 40% at low integrated dose (0.01 μAh) to 0.4% at high integrated dose (25 μAh), 13 NO 3 - varied from 50% at low dose to 85% at high dose. 13 N 2 - varied from 10% at low dose to 5% at high dose and 40% at intermediate doses. The results varied with recent use of target chamber. Induced radioactivity in the window foil was shown to have an effect on product composition. The effect of dissolved oxygen and certain additives (ethanol, ascorbic acid, formic acid, and ammonia) were investigated. In the absence of dissolved oxygen, or in the presence of ethanol, formic acid or ascorbic acid, almost pure 13 NH 3 could be produced at doses up to 2μAh. The data are explained by postulating the initial production of 13 NH 3 by successive abstraction of H atoms by the 13 NH 3 to HNO 2 and HNO 3

  17. Measurement of the x-ray mass attenuation coefficient and determination of the imaginary component of the atomic form factor of molybdenum over the 13.5-41.5-keV energy range

    International Nuclear Information System (INIS)

    Jonge, Martin D. de; Tran, Chanh Q.; Chantler, Christopher T.; Barnea, Zwi; Dhal, Bipin B.; Cookson, David J.; Lee, Wah-Keat; Mashayekhi, Ali

    2005-01-01

    We use the x-ray extended-range technique (XERT) [Chantler et al., Phys. Rev. A 64, 062506 (2001)] to measure the mass attenuation coefficients of molybdenum in the x-ray energy range of 13.5-41.5 keV to 0.02-0.15 % accuracy. Measurements made over an extended range of the measurement parameter space are critically examined to identify, quantify, and correct where necessary a number of experimental systematic errors. These results represent the most extensive experimental data set for molybdenum and include absolute mass attenuation coefficients in the regions of the x-ray absorption fine structure (XAFS) and x-ray-absorption near-edge structure (XANES). The imaginary component of the atomic form-factor f 2 is derived from the photoelectric absorption after subtracting calculated Rayleigh and Compton scattering cross sections from the total attenuation. Comparison of the result with tabulations of calculated photoelectric absorption coefficients indicates that differences of 1-15 % persist between the calculated and observed values

  18. Null-plane Bethe-Salpeter dynamics: Mass spectra, decay constants of pseudoscalar mesons, and the pion form factor

    International Nuclear Information System (INIS)

    Gupta, K.K.; Mitra, A.N.; Singh, N.N.

    1990-01-01

    A new relativistic definition of the reduced mass (μ 12 ) of a q bar q pair, so as to be in conformity with the standard Wightman-Garding definition of its relative four-momenta q μ , is introduced into the kernel of an ongoing Bethe-Salpeter (BS) program on a two-tier basis. The new definition of μ 12 (involving the hadron mass M) is found to produce a natural Regge asymptotic behavior (M 2 ∼N) in the hadron mass spectra, while retaining the property of an asymptotically linear (∼r) confinement in the three-dimensional structure of the BS kernel. The relativistic structure of μ 12 is responsible for a significant improvement in the fits to the ground-state masses of q bar q and Q bar q mesons as compared to its nonrelativistic definition m 1 m 2 /(m 1 +m 2 ). The leptonic decay constants f p and the charge radii thus calculated are also in excellent agreement with data (π,k) where available, while f p predictions for Q bar q mesons have good overlap with recent lattice predictions. Further, the scaling property (∼k μ -2 ) of the hadron's electromagnetic form factor at large k 2 is a consequence of the ''on-shell'' form of its null-plane wave function. All these results (which are indicated in the barest outline) are preceded by a perspective summary of the theoretical premises and practical working of the BS equation with a four-fermion interaction kernel as a necessary background on a two-tier basis

  19. Relativistic form factors for clusters with nonrelativistic wave functions

    International Nuclear Information System (INIS)

    Mitra, A.N.; Kumari, I.

    1977-01-01

    Using a simple variant of an argument employed by Licht and Pagnamenta (LP) on the effect of Lorentz contraction on the elastic form factors of clusters with nonrelativistic wave functions, it is shown how their result can be generalized to inelastic form factors so as to produce (i) a symmetrical appearance of Lorentz contraction effects in the initial and final states, and (ii) asymptotic behavior in accord with dimensional scaling theories. A comparison of this result with a closely analogous parametric form obtained by Brodsky and Chertok from a propagator chain model leads, with plausible arguments, to the conclusion of an effective mass M for the cluster, with M 2 varying as the number n of the quark constituents, instead of as n 2 . A further generalization of the LP formula is obtained for an arbitrary duality-diagram vertex, again with asymptotic behavior in conformity with dimensional scaling. The practical usefulness of this approach is emphasized as a complementary tool to those of high-energy physics for phenomenological fits to data up to moderate values of q 2

  20. Overview of factors affecting the leachability of nuclear waste forms

    International Nuclear Information System (INIS)

    Stone, J.A.

    1980-01-01

    An overview of various factors that affect the leachability of nuclear waste forms is presented. The factors affect primarily the leaching system (temperature, for example), the leachant (pH, for example), or the solid being leached (surface condition, for example). A qualitative understanding exists of the major factors affecting leaching, but further studies are needed to establish leaching mechanisms and develop predictive models. 67 refs

  1. Experimental determination of the beam quality dependence factors, kQ, for ionization chambers used in photon and electron dosimetry

    International Nuclear Information System (INIS)

    Guerra, A.S.; Laitano, R.F.; Pimpinella, M.

    1995-01-01

    Dosimetry in radiotherapy with ionization chambers calibrated in 60 Co gamma beams in terms of absorbed dose to water, D W , can be performed if a factor conventionally denoted as k Q is known. The factor k Q depends on the beam quality and the chamber characteristics. Calculated values of the k Q factors for many types of ionization chamber have been recently published. In this work the experimental determination of the k Q factors for various ionization chambers was performed for 6 MV and 15 MV photon beams and for a 14 MeV electron beam. The k Q factors were determined by a procedure based on relative measurements performed with the ionization chamber and ferrous sulphate solution in 60 Co gamma radiation and accelerator beams, respectively. The experimental k Q values are compared with the calculated values so far published. Theoretical and experimental k Q values are in fairly good agreement. The uncertainty in the experimental k Q factors determined in this work is less than about 1%, that is, appreciably smaller than the uncertainty of about 1.5% reported for the calculated values. (Author)

  2. Virtuality Distributions in application to gamma gamma* to pi^0 Transition Form Factor at Handbag Level

    Energy Technology Data Exchange (ETDEWEB)

    Radyushkin, Anatoly V. [ODU, JLAB

    2014-07-01

    We outline basics of a new approach to transverse momentum dependence in hard processes. As an illustration, we consider hard exclusive transition process gamma*gamma -> to pi^0 at the handbag level. Our starting point is coordinate representation for matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p. Treated as functions of (pz) and z^2, they are parametrized through a virtuality distribution amplitude (VDA) Phi (x, sigma), with x being Fourier-conjugate to (pz) and sigma Laplace-conjugate to z^2. For intervals with z^+=0, we introduce transverse momentum distribution amplitude (TMDA) Psi (x, k_\\perp), and write it in terms of VDA Phi (x, \\sigma). The results of covariant calculations, written in terms of Phi (x sigma) are converted into expressions involving Psi (x, k_\\perp. Starting with scalar toy models, we extend the analysis onto the case of spin-1/2 quarks and QCD. We propose simple models for soft VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data on the pion transition form factor. We also discuss how one can generate high-k_\\perp tails from primordial soft distributions.

  3. MicroRNAs control transcription factor NF-kB (p65) expression in human ovarian cells.

    Science.gov (United States)

    Sirotkin, Alexander V; Alexa, Richard; Kišová, Gabriela; Harrath, Abdel Halim; Alwasel, Saleh; Ovcharenko, Dmitriy; Mlynček, Miloš

    2015-05-01

    MicroRNAs (miRNAs) are known to influence ovarian cell proliferation, apoptosis and hormone release, but it remains unknown whether miRNAs affect ovarian functions via transcription factors. We examined the effect of miRNAs on nuclear factor-κappaB (NF-kB) (p65) expression in human ovarian luteinized granulosa cells. We transfected cultured primary human ovarian luteinized granulosa cells with 80 different constructs encoding human pre-miRNAs and then evaluated NF-kB (p65) expression (percentage of cells containing p65) by immunocytochemistry. We found that 21 of the constructs stimulated NF-kB (p65) expression and 18 of the constructs inhibited NF-kB (p65) expression. This is the first direct demonstration that miRNAs affect NF-kB (p65) expression and the first genome-scale miRNA screen to identify upregulation and downregulation of NF-kB accumulation by miRNAs in the ovary. Novel miRNAs that affect the NF-kB signalling pathway could be useful for the control of NF-kB-dependent reproductive processes and the treatment of NF-kB-dependent reproductive disorders.

  4. Form factors in quantum integrable models with GL(3)-invariant R-matrix

    Energy Technology Data Exchange (ETDEWEB)

    Pakuliak, S., E-mail: pakuliak@theor.jinr.ru [Laboratory of Theoretical Physics, JINR, 141980 Dubna, Moscow Reg. (Russian Federation); Moscow Institute of Physics and Technology, 141700 Dolgoprudny, Moscow Reg. (Russian Federation); Institute of Theoretical and Experimental Physics, 117259 Moscow (Russian Federation); Ragoucy, E., E-mail: eric.ragoucy@lapth.cnrs.fr [Laboratoire de Physique Théorique LAPTH, CNRS and Université de Savoie, BP 110, 74941 Annecy-le-Vieux Cedex (France); Slavnov, N.A., E-mail: nslavnov@mi.ras.ru [Steklov Mathematical Institute, Moscow (Russian Federation)

    2014-04-15

    We study integrable models solvable by the nested algebraic Bethe ansatz and possessing GL(3)-invariant R-matrix. We obtain determinant representations for form factors of off-diagonal entries of the monodromy matrix. These representations can be used for the calculation of form factors and correlation functions of the XXX SU(3)-invariant Heisenberg chain.

  5. Measurement of the Residual Resistivity Ratio of the busbars copper stabilizer of the 13kA circuits of the LHC

    CERN Document Server

    Apollonio, A; Solfaroli, M; Schmidt, R; Verweij, A

    2012-01-01

    After the incident of September 2008, the operational beam energy of the LHC has been set to 3.5 TeV, since not all joints of the superconducting busbars between magnets have the required quality for 7 TeV operation. This choice is based on simulations to determine the safe current in the main dipole and quadrupole magnets, reproducing the thermal behavior of a quenched superconducting joint by taking into account all relevant factors that affect a possible thermal runaway. One important parameter of the simulation is the RRR (Residual Resistivity Ratio) of the copper stabilizer of the busbar connecting superconducting magnets. A dedicated campaign to measure this quantity for the main 13kA circuits of the LHC on all sectors was performed during the Christmas stop in December 2010 and January 2011. The measurement method as well as the data analysis and results are presented in this note.

  6. Single-Spin Polarization Effects and the Determination of Timelike Proton Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, S

    2003-10-24

    We show that measurements of the proton's polarization in e{sup +}e{sup -} {yields} p{bar p} strongly discriminate between analytic forms of models which fit the proton form factors in the spacelike region. In particular, the single-spin asymmetry normal to the scattering plane measures the relative phase difference between the timelike G{sub E} and G{sub M} form factors. The expected proton polarization in the timelike region is large, of order of several tens of percent.

  7. Electromagnetic Transition Form Factor of the η meson with WASA-at-COSY

    Science.gov (United States)

    Goswami, A.

    2016-11-01

    In this work we present a study of the Dalitz decay η → γe+e-. The aim of this work is to measure the transition form factor of the η meson. The transition form factor of the η meson describes the electromagnetic structure of the meson. The study of the Dalitz decay helps to calculate the transition form factor of the η meson. When a particle is point-like it's decay rate can be calculated within QED. However, the complex structure of the meson modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. For this study data on proton-proton reaction at a beam energy of 1.4 GeV has been collected with WASA-at-COSY detector at Forschungszentrum Juelich, Germany. In the higher invariant mass region recent theoretical calculations slightly deviate from the fit to the data. We expect better results in the higher invariant mass region than previous measurements. The preliminary results of the analysis will be presented.

  8. Electromagnetic Transition Form Factor of the η meson with WASA-at-COSY

    Directory of Open Access Journals (Sweden)

    Goswami A.

    2016-01-01

    Full Text Available In this work we present a study of the Dalitz decay η → γe+e−. The aim of this work is to measure the transition form factor of the η meson. The transition form factor of the η meson describes the electromagnetic structure of the meson. The study of the Dalitz decay helps to calculate the transition form factor of the η meson. When a particle is point-like it’s decay rate can be calculated within QED. However, the complex structure of the meson modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. For this study data on proton-proton reaction at a beam energy of 1.4 GeV has been collected with WASA-at-COSY detector at Forschungszentrum Juelich, Germany. In the higher invariant mass region recent theoretical calculations slightly deviate from the fit to the data. We expect better results in the higher invariant mass region than previous measurements. The preliminary results of the analysis will be presented.

  9. Electromagnetic transition form factor of the η meson with WASA-at-COSY

    Energy Technology Data Exchange (ETDEWEB)

    Goswami, Ankita [Indian Institute of Technology Indore, Indore (India); Collaboration: WASA-at-COSY-Collaboration

    2015-07-01

    The aim of this work is to measure the transition form factor of the η meson. The transition form factor describes the internal structure of a particle. The precise determination of the transition form factor of the η meson is possible through the η→γe{sup +} e{sup -} Dalitz decay. When a particle is point-like then its decay rate can be calculated within QED. However, the complex structure of the particle modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. η mesons are produced using the reaction pp→ppη at a beam kinetic energy of 1.4 GeV at the COSY accelerator of Forschungszentrum Juelich and decay particles of the η meson are detected with the WASA detector. In the higher invariant mass region recent theoretical calculations slightly deviate from the the data. With the high statistics dataset we expect precise results in the higher invariant mass region. The status of the analysis is reported.

  10. Sine-Gordon breather form factors and quantum field equations

    International Nuclear Information System (INIS)

    Babujian, H; Karowski, M

    2002-01-01

    Using the results of previous investigations on sine-Gordon form factors, exact expressions of all breather matrix elements are obtained for several operators: all powers of the fundamental Bose field, general exponentials of it, the energy-momentum tensor and all higher currents. Formulae for the asymptotic behaviour of bosonic form factors are presented which are motivated by Weinberg's power counting theorem in perturbation theory. It is found that the quantum sine-Gordon field equation holds, and an exact relation between the 'bare' mass and the renormalized mass is obtained. Also a quantum version of a classical relation for the trace of the energy-momentum is proved. The eigenvalue problem for all higher conserved charges is solved. All results are compared with perturbative Feynman graph expansions and full agreement is found

  11. New large-Nc relations for the electromagnetic nucleon-to-Δ form factors

    International Nuclear Information System (INIS)

    Vladimir Pascalutsa; Marc Vanderhaeghen

    2006-01-01

    We establish relations which express the three N → Δ transition form factors in terms of the nucleon form factors. These relations are based on the known large-N c relation between the N → Δ electric quadrupole moment and the neutron charge radius, and a newly derived large-N c relation between the electric quadrupole (E2) and Coulomb quadrupole (C2) transitions. Namely, in the large-N c limit we find C2=E2. We show that these relations provide predictions for the N → Δ electromagnetic form factors which are found to be in very good agreement with experiment for moderate momentum transfers. They also provide constraints for the N → Δ GPDs

  12. Extrapolation of π-meson form factor, zeros in the analyticity domain

    International Nuclear Information System (INIS)

    Morozov, P.T.

    1978-01-01

    The problem of a stable extrapolation from the cut to an arbitrary interior of the analyticity domain for the pion form factor is formulated and solved. As it is shown a stable solution can be derived if module representations with the Karleman weight function are used as the analyticity conditions. The case when the form factor has zeros is discussed. If there are zeros in the complex plane they must be taken into account when determining the extrapolation function

  13. Me saame USA lubadustesse uskuda: Lennart Meri kõne [Ameerika Ühendriikide asepresidendi Albert Gore'i visiidi ajal] Raekoja platsil 13. märtsil 1995 / Lennart Meri

    Index Scriptorium Estoniae

    Meri, Lennart, 1929-2006

    1995-01-01

    Kõne Raekoja platsil. Ilmunud ka: Päevaleht, 14. märts 1995, lk. 1, pealkiri: Lennart Meri kõne Raekoja platsil 13. märtsil 1995 ; Vaba Eestlane, 16. märts, lk. 3, 5, pealkiri: Vabariigi Presidendi Lennart Meri kõne Raekoja platsil 13. märtsil 1995. a. ; Meie Kodu, 29. märts, lk. 1

  14. Numerical study of the lattice meson form factor

    International Nuclear Information System (INIS)

    Woloshyn, R.M.; Kobos, A.M.

    1986-01-01

    The electric form factor of the pseudo-Goldstone meson (the generic pion) is calculated in quenched lattice quantum chromodynamics with SU(2) color. Charge radii are calculated for different values of the bare-quark mass. The results are in agreement with the physically reasonable expectation that heavier quarks have distributions of smaller radius

  15. Electric form factors of the octet baryons from lattice QCD and chiral extrapolation

    International Nuclear Information System (INIS)

    Shanahan, P.E.; Thomas, A.W.; Young, R.D.; Zanotti, J.M.; Pleiter, D.; Stueben, H.

    2014-03-01

    We apply a formalism inspired by heavy baryon chiral perturbation theory with finite-range regularization to dynamical 2+1-flavor CSSM/QCDSF/UKQCD Collaboration lattice QCD simulation results for the electric form factors of the octet baryons. The electric form factor of each octet baryon is extrapolated to the physical pseudoscalar masses, after finite-volume corrections have been applied, at six fixed values of Q 2 in the range 0.2-1.3 GeV 2 . The extrapolated lattice results accurately reproduce the experimental form factors of the nucleon at the physical point, indicating that omitted disconnected quark loop contributions are small. Furthermore, using the results of a recent lattice study of the magnetic form factors, we determine the ratio μ p G E p /G M p . This quantity decreases with Q 2 in a way qualitatively consistent with recent experimental results.

  16. High energy approximations for nuclear knockout form factors at small momentum transfer

    International Nuclear Information System (INIS)

    Amado, R.D.; Cannata, F.; Dedonder, J.P.

    1985-01-01

    We obtain an explicit approximate expression for the nucleon knockout form factor at small momentum transfer induced by a scalar probe in a single particle model in terms of the momentum space bound state wave function. Our form preserves the orthogonality constraint without using explicitly the final state scattering wave function. We examine the leading large momentum behavior of the momentum space wave function and of correction terms to our expression for the form factor in the case where the bound state is an s state

  17. Revisiting the pion's scalar form factor in chiral perturbation theory

    CERN Document Server

    Juttner, Andreas

    2012-01-01

    The quark-connected and the quark-disconnected Wick contractions contributing to the pion's scalar form factor are computed in the two and in the three flavour chiral effective theory at next-to-leading order. While the quark-disconnected contribution to the form factor itself turns out to be power-counting suppressed its contribution to the scalar radius is of the same order of magnitude as the one of the quark-connected contribution. This result underlines that neglecting quark-disconnected contributions in simulations of lattice QCD can cause significant systematic effects. The technique used to derive these predictions can be applied to a large class of observables relevant for QCD-phenomenology.

  18. The g-factor of the K=25 isomer in sup 182 Os

    Energy Technology Data Exchange (ETDEWEB)

    Alderson, A.; Fallon, P.; Goldring, G.; Roberts, J.; Sharpey-Schafer, J.; Twin P. (Liverpool Univ. (UK). Oliver Lodge Lab.); Bentley, M.; Bruce, A. (Science and Engineering Research Council, Daresbury (UK). Daresbury Lab.); Broude, C. (Weizmann Inst. of Science, Rehovoth (Israel). Dept. of Nuclear Physics); Dafni, E. (Rochester Univ., NY (USA). Nuclear Structure Research Lab.); Hass, M. (Argonne National Lab. (USA)); Nyberg, J.; Sletten, G. (Niels Bohr Inst., Roskilde (Denmark))

    1989-09-28

    The g-factor of the K=I=25 isomer in {sup 182}Os has been measured by observing the angular precession of the decay {gamma}-ray angular distribution in an external magnetic field as g=+0.425(8). This result is compared with predictions based on experimental g-factors of single-particle Nilsson orbitals in this mass region. (orig.).

  19. Murine K2P5.1 Deficiency Has No Impact on Autoimmune Neuroinflammation due to Compensatory K2P3.1- and KV1.3-Dependent Mechanisms

    Directory of Open Access Journals (Sweden)

    Stefan Bittner

    2015-07-01

    Full Text Available Lymphocytes express potassium channels that regulate physiological cell functions, such as activation, proliferation and migration. Expression levels of K2P5.1 (TASK2; KCNK5 channels belonging to the family of two-pore domain potassium channels have previously been correlated to the activity of autoreactive T lymphocytes in patients with multiple sclerosis and rheumatoid arthritis. In humans, K2P5.1 channels are upregulated upon T cell stimulation and influence T cell effector functions. However, a further clinical translation of targeting K2P5.1 is currently hampered by a lack of highly selective inhibitors, making it necessary to evaluate the impact of KCNK5 in established preclinical animal disease models. We here demonstrate that K2P5.1 knockout (K2P5.1−/− mice display no significant alterations concerning T cell cytokine production, proliferation rates, surface marker molecules or signaling pathways. In an experimental model of autoimmune neuroinflammation, K2P5.1−/− mice show a comparable disease course to wild-type animals and no major changes in the peripheral immune system or CNS compartment. A compensatory upregulation of the potassium channels K2P3.1 and KV1.3 seems to counterbalance the deletion of K2P5.1. As an alternative model mimicking autoimmune neuroinflammation, experimental autoimmune encephalomyelitis in the common marmoset has been proposed, especially for testing the efficacy of new potential drugs. Initial experiments show that K2P5.1 is functionally expressed on marmoset T lymphocytes, opening up the possibility for assessing future K2P5.1-targeting drugs.

  20. Analytical and unitary approach in mesons electromagnetic form factor applications

    International Nuclear Information System (INIS)

    Liptaj, A.

    2010-07-01

    In the dissertation thesis we address several topics related to the domain of particle physics. All of them represent interesting open problems that can be connected to the elastic or transition electromagnetic form factors of mesons, the form factors being the main objects of our interest. Our ambition is to contribute to the solution of these problems and use for that purpose known analytic properties of the form factors and the unitarity condition. These two tools are very powerful in the low energy domain (such as bound states of partons), where the perturbative QCD looses its validity. This is the motivation for construction of the unitary and analytic (U and A) models of studied form factors, that enable us to get the majority of our results. We use the U and A model to evaluate the contribution of the processes e"+e"- → Pγ, P = π"0, η, η to the muon magnetic anomaly a_μ in the lowest order of the hadronic vacuum polarization. For the contribution a_μ"h"a"d","L"O (π"+π"-) we demonstrate, that the use of the model leads to a dramatic error reduction with respect to the results of other authors. We also get a shift in the central value in the 'correct' direction, that brings the theoretical value closer to the experimental one. This results encourages us to use the model also for the evaluation of a_μ"h"a"d","L"O (P_γ). These contributions are smaller, however the precision of the experiment makes their evaluation necessary. We further use the U and A model of the transition form factors of π"0, η and η"' mesons to predict the partial decay widths of these particles Γ_π_"0_→_γ_γ and Γ_η_→_γ_γ and Γ_η_"'_→_γ_γ. In this way we make an independent cross check of the PDG table values. We find an agreement in the case of Γ_η_→_γ_γ and Γ_η_"'_→_γ_γ, even a smaller uncertainty for Γ_η_"'_→_γ_γ. In the case of Γ_π_"0_→_γ_γ we find a disagreement that points to an interesting problem. We wonder whether it could be

  1. Relativistic two-fermion equations with form factors and anomalous magnetic moment interactions

    International Nuclear Information System (INIS)

    Ahmed, S.

    1977-04-01

    Relativistic equations for two-fermion systems are derived from quantum field theory taking into account the form factors of the particles. When the q 2 dependence of the form factors is disregarded, in the static approximation, the two-fermion equations with Coulomb and anomalous magnetic moment interactions are obtained. Separating the angular variables, a sixteen-component relativistic radial equation are finally given

  2. Holographic estimate of the meson cloud contribution to nucleon axial form factor

    Science.gov (United States)

    Ramalho, G.

    2018-04-01

    We use light-front holography to estimate the valence quark and the meson cloud contributions to the nucleon axial form factor. The free couplings of the holographic model are determined by the empirical data and by the information extracted from lattice QCD. The holographic model provides a good description of the empirical data when we consider a meson cloud mixture of about 30% in the physical nucleon state. The estimate of the valence quark contribution to the nucleon axial form factor compares well with the lattice QCD data for small pion masses. Our estimate of the meson cloud contribution to the nucleon axial form factor has a slower falloff with the square momentum transfer compared to typical estimates from quark models with meson cloud dressing.

  3. AtCHX13 is a plasma membrane K(+) transporter

    Science.gov (United States)

    Potassium (K+) homeostasis is essential for diverse cellular processes, although how various cation transporters collaborate to maintain a suitable K(+) required for growth and development is poorly understood. The Arabidopsis ("Arabidopsis thaliana") genome contains numerous cation:proton antiporte...

  4. AtCHX13 is a plasma membrane K+ transporter

    Science.gov (United States)

    Potassium (K+) homeostasis is essential for diverse cellular processes, although how various cation transporters collaborate to maintain a suitable K+ required for growth and development is poorly understood. The Arabidopsis (Arabidopsis thaliana) genome contains numerous cation:proton antiporters (...

  5. Electric form factors of the octet baryons from lattice QCD and chiral extrapolation

    Energy Technology Data Exchange (ETDEWEB)

    Shanahan, P.E.; Thomas, A.W.; Young, R.D.; Zanotti, J.M. [Adelaide Univ., SA (Australia). ARC Centre of Excellence in Particle Physics at the Terascale and CSSM; Horsley, R. [Edinburgh Univ. (United Kingdom). School of Physics and Astronomy; Nakamura, Y. [RIKEN Advanced Institute for Computational Science, Kobe, Hyogo (Japan); Pleiter, D. [Forschungszentrum Juelich (Germany). JSC; Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Rakow, P.E.L. [Liverpool Univ. (United Kingdom). Theoretical Physics Div.; Schierholz, G. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Stueben, H. [Hamburg Univ. (Germany). Regionales Rechenzentrum; Collaboration: CSSM and QCDSF/UKQCD Collaborations

    2014-03-15

    We apply a formalism inspired by heavy baryon chiral perturbation theory with finite-range regularization to dynamical 2+1-flavor CSSM/QCDSF/UKQCD Collaboration lattice QCD simulation results for the electric form factors of the octet baryons. The electric form factor of each octet baryon is extrapolated to the physical pseudoscalar masses, after finite-volume corrections have been applied, at six fixed values of Q{sup 2} in the range 0.2-1.3 GeV{sup 2}. The extrapolated lattice results accurately reproduce the experimental form factors of the nucleon at the physical point, indicating that omitted disconnected quark loop contributions are small. Furthermore, using the results of a recent lattice study of the magnetic form factors, we determine the ratio μ{sub p}G{sub E}{sup p}/G{sub M}{sup p}. This quantity decreases with Q{sup 2} in a way qualitatively consistent with recent experimental results.

  6. A single, specific thymine mutation in the ComK-Binding site severely decreases binding and transcription activation by the competence transcription factor ComK of Bacillus subtilis

    NARCIS (Netherlands)

    Susanna, Kim A.; Mironczuk, Aleksandra M.; Smits, Wiep Klaas; Hamoen, Leendert W.; Kuipers, Oscar P.

    The competence transcription factor ComK plays a central role in competence development in Bacillus subtilis by activating the transcription of the K regulon. ComK-activated genes are characterized by the presence of a specific sequence to which ComK binds, a K-box, in their upstream DNA region.

  7. Measurement of the pion form factor at higher energies

    Energy Technology Data Exchange (ETDEWEB)

    Mack, D.J. [CEBAF, Newport News, VA (United States)

    1994-04-01

    One of the strongest arguments for increasing the nominal CEBAF beam energy to equal or exceed 6 GeV is that one would be able to make quality high Q{sup 2} measurements of the charged pion form factor.

  8. Influence of cooling rate on phase formation in spray-formed H13 tool steel

    Energy Technology Data Exchange (ETDEWEB)

    McHugh, K.M. [Industrial Technology Department, Idaho National Laboratory, Idaho Falls, ID 83415-2050 (United States)], E-mail: kevin.mchugh@inl.gov; Lin, Y.; Zhou, Y.; Lavernia, E.J. [Department of Chemical Engineering and Materials Science, University of California, Davis, CA 95616 (United States)

    2008-03-25

    Spray forming is an effective way to process many tool steels into near-net-shape molds, dies, and related tooling. The general approach involves depositing atomized droplets onto a refractory pattern in order to image the pattern's features. The pattern is removed and the die insert is mounted in a standard mold base or holding block. This approach results in significant cost and lead-time savings compared to conventional machining. Spray-formed dies perform well in many industrial forming operations, oftentimes exhibiting extended die life compared to conventional dies of the same material and design. Care must be exercised when spray forming tool steel dies to minimize porosity and control the nature and distribution of phases and residual stresses. Selection of post-deposition heat treatment is important to tailor the die's properties (hardness, strength, impact energy, etc.) for a particular application. This paper examines how the cooling rate during spray processing and heat treatment of H13 tool steel influences phase formation. Porosity and hardness were evaluated over a range of deposit cooling rates and residual stresses were evaluated for a die in the as-deposited condition. Finally, the performance of spray-formed dies during production runs in forging, extrusion, and die casting is described.

  9. Influence of cooling rate on phase formation in spray-formed H13 tool steel

    International Nuclear Information System (INIS)

    McHugh, K.M.; Lin, Y.; Zhou, Y.; Lavernia, E.J.

    2008-01-01

    Spray forming is an effective way to process many tool steels into near-net-shape molds, dies, and related tooling. The general approach involves depositing atomized droplets onto a refractory pattern in order to image the pattern's features. The pattern is removed and the die insert is mounted in a standard mold base or holding block. This approach results in significant cost and lead-time savings compared to conventional machining. Spray-formed dies perform well in many industrial forming operations, oftentimes exhibiting extended die life compared to conventional dies of the same material and design. Care must be exercised when spray forming tool steel dies to minimize porosity and control the nature and distribution of phases and residual stresses. Selection of post-deposition heat treatment is important to tailor the die's properties (hardness, strength, impact energy, etc.) for a particular application. This paper examines how the cooling rate during spray processing and heat treatment of H13 tool steel influences phase formation. Porosity and hardness were evaluated over a range of deposit cooling rates and residual stresses were evaluated for a die in the as-deposited condition. Finally, the performance of spray-formed dies during production runs in forging, extrusion, and die casting is described

  10. The scalar and electromagnetic form factors of the nucleon in dispersively improved Chiral EFT

    Energy Technology Data Exchange (ETDEWEB)

    Alarcon, Jose Manuel [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2018-04-01

    We present a method for calculating the nucleon form factors of G-parity-even operators. This method combines chiral effective field theory (χEFT) and dispersion theory. Through unitarity we factorize the imaginary part of the form factors into a perturbative part, calculable with χEFT, and a non-perturbative part, obtained through other methods. We consider the scalar and electromagnetic (EM) form factors of the nucleon. The results show an important improvement compared to standard chiral calculations, and can be used in analysis of the low-energy properties of the nucleon.

  11. Neutral π decay and transition form-factor in the light-cone

    International Nuclear Information System (INIS)

    Tomio, L.; Melo, J.P.B.C. De; Frederico, T.

    2001-01-01

    Full text: Considering phenomenological wave-functions in the light-cone, we obtain the neutral pion (π 0 ) decay and the electromagnetic transition form-factor. The form-factor is obtained from the one-loop quark-diagrams projected on the null plane. By studying different models for the π 0 → γ * γ process, it is found out a strong model sensitivity of the π 0 width. This result suggests that such observable should be used as an important constraint to the model wave function. The relativistic approach to the wave-function based only on constituents quarks is possible in the light-cone due to the suppression of pair creation process. This property arises from the particular choice of the light-cone coordinates. Also the center of mass coordinate is easily separated. In specific processes involving a bound-state, the internal loop-momentum is integrated first in the light-cone energy, then the wave-function of the bound-state appears naturally. This procedure is the essence of the diagrammatic approach that was applied to obtain the weak decay constant and electromagnetic form-factor of the charged pion. In this reference, it was used one-loop dia- grams, the triangle diagram for the form-factor and the bubble diagram which expresses the Partial Conservation of the Axial Current (PCAC). The integration over the light-cone energy in the triangle diagram is per- formed and the asymptotic wave-function of the bound quark-antiquark pair is replaced by phenomenological pion wave-functions. We use three distinct model wave-functions: the Gaussian; the hydrogen-atom; and the wave-function model. This last model has the two characteristics that one believes belongs to Quantum Chromodynamics, i.e., confinement and short distance one gluon exchange. The Gaussian model has only the property of confinement and the Hydrogen model mimics the one gluon exchange at short distances. It is observed that the neutral pion radius presents a correlation with the quark mass. The

  12. Generation of truncated recombinant form of tumor necrosis factor ...

    African Journals Online (AJOL)

    7. Original Research Article. Generation of truncated recombinant form of tumor necrosis factor ... as 6×His tagged using E.coli BL21 (DE3) expression system. The protein was ... proapoptotic signaling cascade through TNFR1. [5] which is ...

  13. Delta and Omega electromagnetic form factors in a Dyson-Schwinger/Bethe-Salpeter approach

    Energy Technology Data Exchange (ETDEWEB)

    Diana Nicmorus, Gernot Eichmann, Reinhard Alkofer

    2010-12-01

    We investigate the electromagnetic form factors of the Delta and the Omega baryons within the Poincare-covariant framework of Dyson-Schwinger and Bethe-Salpeter equations. The three-quark core contributions of the form factors are evaluated by employing a quark-diquark approximation. We use a consistent setup for the quark-gluon dressing, the quark-quark bound-state kernel and the quark-photon interaction. Our predictions for the multipole form factors are compatible with available experimental data and quark-model estimates. The current-quark mass evolution of the static electromagnetic properties agrees with results provided by lattice calculations.

  14. Meson Transition Form Factors in Light-Front Holographic QCD

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, Stanley J.; /SLAC; Cao, Fu-Guang; /Massey U.; de Teramond, Guy F.; /Costa Rica U.

    2011-06-22

    We study the photon-to-meson transition form factors (TFFs) F{sub M{gamma}}(Q{sup 2}) for {gamma}{gamma}* {yields} M using light-front holographic methods. The Chern-Simons action, which is a natural form in 5-dimensional anti-de Sitter (AdS) space, leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the q{bar q} component of the pion wavefunction, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0} {yields} {gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the q{bar q} component of the pion wavefunction P{sub q{bar q}} = 0.5 is required; thus giving indication that the contributions from higher Fock states in the pion light-front wavefunction need to be included in the analysis. The probability for the Fock state containing four quarks (anti-quarks) which follows from analyzing the hadron matrix elements, P{sub q{bar q}q{bar q}} {approx} 10%, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wavefunction. The results for the TFFs for the {eta} and {eta}{prime} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{prime} TFFs.

  15. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  16. The Bacterial Actin MamK

    Science.gov (United States)

    Ozyamak, Ertan; Kollman, Justin; Agard, David A.; Komeili, Arash

    2013-01-01

    It is now recognized that actin-like proteins are widespread in bacteria and, in contrast to eukaryotic actins, are highly diverse in sequence and function. The bacterial actin, MamK, represents a clade, primarily found in magnetotactic bacteria, that is involved in the proper organization of subcellular organelles, termed magnetosomes. We have previously shown that MamK from Magnetospirillum magneticum AMB-1 (AMB-1) forms dynamic filaments in vivo. To gain further insights into the molecular mechanisms that underlie MamK dynamics and function, we have now studied the in vitro properties of MamK. We demonstrate that MamK is an ATPase that, in the presence of ATP, assembles rapidly into filaments that disassemble once ATP is depleted. The mutation of a conserved active site residue (E143A) abolishes ATPase activity of MamK but not its ability to form filaments. Filament disassembly depends on both ATPase activity and potassium levels, the latter of which results in the organization of MamK filaments into bundles. These data are consistent with observations indicating that accessory factors are required to promote filament disassembly and for spatial organization of filaments in vivo. We also used cryo-electron microscopy to obtain a high resolution structure of MamK filaments. MamK adopts a two-stranded helical filament architecture, but unlike eukaryotic actin and other actin-like filaments, subunits in MamK strands are unstaggered giving rise to a unique filament architecture. Beyond extending our knowledge of the properties and function of MamK in magnetotactic bacteria, this study emphasizes the functional and structural diversity of bacterial actins in general. PMID:23204522

  17. Vickers Microhardness and Hyperfine Magnetic Field Variations of Heat Treated Amorphous Fe{sub 78}Si{sub 9}B{sub 13} Alloy Ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Cabral-Prieto, A., E-mail: acpr@nuclear.inin.mx [Instituto Nacional de Investigaciones Nucleares, Department of Chemistry (Mexico); Garcia-Santibanez, F.; Lopez, A.; Lopez-Castanares, R.; Olea Cardoso, O. [Universidad Autonoma del Estado de Mexico, El Cerrillo Piedras Blancas, Facultad de Ciencias (Mexico)

    2005-02-15

    Amorphous Fe{sub 78}Si{sub 9}B{sub 13} alloy ribbons were heat treated between 296 and 763 K, using heating rates between 1 and 4.5 K/min. Whereas one ribbon partially crystallized at T{sub x} = 722 K, the other one partially crystallized at T{sub x} = 763 K. The partially crystallized ribbon at 722 K, heat treated using a triangular form for the heating and cooling rates, was substantially less fragile than the partially crystallized at 763 K where a tooth saw form for the heating and cooling rates was used. Vickers microhardness and hyperfine magnetic field values behaved almost concomitantly between 296 and 673 K. The Moessbauer spectral line widths of the heat-treated ribbons decreased continuously from 296 to 500 K, suggesting stress relief in this temperature range where the Vickers microhardness did not increase. At 523 K the line width decreased further but the microhardness increased substantially. After 523 K the line width behave in an oscillating form as well as the microhardness, indicating other structural changes in addition to the stress relief. Finally, positron lifetime data showed that both inner part and surface of Fe{sub 78}Si{sub 9}B{sub 13} alloy ribbons were affected distinctly. Variations on the surface may be the cause of some of the high Vickers microhardness values measured in the amorphous state.

  18. Improved USLE-K factor prediction: A case study on water erosion areas in China

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2016-09-01

    Full Text Available Soil erodibility (K-factor is an essential factor in soil erosion prediction and conservation practises. The major obstacles to any accurate, large-scale soil erodibility estimation are the lack of necessary data on soil characteristics and the misuse of variable K-factor calculators. In this study, we assessed the performance of available erodibility estimators Universal Soil Loss Equation (USLE, Revised Universal Soil Loss Equation (RUSLE, Erosion Productivity Impact Calculator (EPIC and the Geometric Mean Diameter based (Dg model for different geographic regions based on the Chinese soil erodibility database (CSED. Results showed that previous estimators overestimated almost all K-values. Furthermore, only the USLE and Dg approaches could be directly and reliably applicable to black and loess soil regions. Based on the nonlinear best fitting techniques, we improved soil erodibility prediction by combining Dg and soil organic matter (SOM. The NSE, R2 and RE values were 0.94, 0.67 and 9.5% after calibrating the results independently; similar model performance was showed for the validation process. The results obtained via the proposed approach were more accurate that the former K-value predictions. Moreover, those improvements allowed us to effectively establish a regional soil erodibility map (1:250,000 scale of water erosion areas in China. The mean K-value of Chinese water erosion regions was 0.0321 (t ha h·(ha MJ mm−1 with a standard deviation of 0.0107 (t ha h·(ha MJ mm−1; K-values present a decreasing trend from North to South in water erosion areas in China. The yield soil erodibility dataset also satisfactorily corresponded to former K-values from different scales (local, regional, and national.

  19. Nucleon form factors on the lattice with light dynamical fermions

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.

    2007-09-01

    The electromagnetic form factors provide important insight into the internal structure of the nucleon and continue to be of major interest for experiment and phenomenology. For an intermediate range of momenta the form factors can be calculated on the lattice. However, the reliability of the results is limited by systematic errors mostly due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet inaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with dynamical N f =2, non-perturbatively O(a)-improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  20. Nucleon form factors on the lattice with light dynamical fermions

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Inst. fuer Theoretische Physik T39; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)

    2007-09-15

    The electromagnetic form factors provide important insight into the internal structure of the nucleon and continue to be of major interest for experiment and phenomenology. For an intermediate range of momenta the form factors can be calculated on the lattice. However, the reliability of the results is limited by systematic errors mostly due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet inaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with dynamical N{sub f}=2, non-perturbatively O(a)-improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  1. Form factors of ηc in light-front quark model

    International Nuclear Information System (INIS)

    Geng, Chao-Qiang; Lih, Chong-Chung

    2013-01-01

    We study the form factors of the η c meson in the light-front quark model. We explicitly show that the transition form factor of η c → γ * γ as a function of the momentum transfer is consistent with the experimental data by the BaBar collaboration, while the decay constant of η c is found to be f η c = 230.5 +52.2 -61.0 and 303.6 +115.2 -116.4 MeV for η c ∝ c anti c by using two η c → γγ decay widths of 5.3 ± 0.5 and 7.2 ± 2.1 keV, given by Particle Data Group and Lattice QCD calculation, respectively. (orig.)

  2. Applicability of perturbative QCD and NLO power corrections for the pion form factor

    International Nuclear Information System (INIS)

    Yeh Tsungwen

    2002-01-01

    As is well recognized, the asymptotic of the perturbative QCD prediction for the pion form factor is much smaller than the upper end of the data. We investigate this problem. We first evaluate the next-to-leading-order (NLO) power correction for the pion form factor. The corrected form factor contains nonperturbative parameters which are determined from a χ 2 fit to the data. Interpreting these parameters leads to the fact that the involved strong interaction coupling constant should be identified as an effective coupling constant under a nonperturbative QCD vacuum. If the scale associated with the effective coupling constant is identified as 2 Q 2 , then Q 2 , the momentum transfer square for the pion form factor to be measured, can have a value about 1 GeV 2 , and , the averaged momentum fraction variable, can locate around 0.5. This circumstance is consistent with the asymptotic model for the pion wave function

  3. Evaluation and measurement of prompt k0-factors to use in prompt gamma-ray neutron activation analysis

    International Nuclear Information System (INIS)

    Goswami, A.; Nair, A.G.C.; Acharya, R.N.; Sudarshan, K.; Scindia, Y.M.; Reddy, A.V.R.; Manohar, S.B.

    2000-01-01

    The determination of experimental k 0 -factors is important due to uncertainties on absolute values of cross sections and prompt gamma-ray intensities. Determination of absolute full-energy peak detection efficiency and elemental sensitivity are required to obtain experimental k 0 -factor

  4. Cutting through form factors and cross sections of non-protected operators in N=4 SYM

    International Nuclear Information System (INIS)

    Nandan, Dhritiman; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

    2015-01-01

    We study the form factors of the Konishi operator, the prime example of non-protected operators in N=4 SYM theory, via the on-shell unitarity method. Since the Konishi operator is not protected by supersymmetry, its form factors share many features with amplitudes in QCD, such as the occurrence of rational terms and of UV divergences that require renormalization. A subtle point is that this operator depends on the spacetime dimension. This requires a modification when calculating its form factors via the on-shell unitarity method. We derive a rigorous prescription that implements this modification to all loop orders and obtain the two-point form factor up to two-loop order and the three-point form factor to one-loop order. From these form factors, we construct an IR-finite cross-section-type quantity, namely the inclusive decay rate of the (off-shell) Konishi operator to any final (on-shell) state. Via the optical theorem, it is connected to the imaginary part of the two-point correlation function. We extract the Konishi anomalous dimension up to two-loop order from it.

  5. Redefining the MED13L syndrome.

    Science.gov (United States)

    Adegbola, Abidemi; Musante, Luciana; Callewaert, Bert; Maciel, Patricia; Hu, Hao; Isidor, Bertrand; Picker-Minh, Sylvie; Le Caignec, Cedric; Delle Chiaie, Barbara; Vanakker, Olivier; Menten, Björn; Dheedene, Annelies; Bockaert, Nele; Roelens, Filip; Decaestecker, Karin; Silva, João; Soares, Gabriela; Lopes, Fátima; Najmabadi, Hossein; Kahrizi, Kimia; Cox, Gerald F; Angus, Steven P; Staropoli, John F; Fischer, Ute; Suckow, Vanessa; Bartsch, Oliver; Chess, Andrew; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Kaindl, Angela M; Kalscheuer, Vera M

    2015-10-01

    Congenital cardiac and neurodevelopmental deficits have been recently linked to the mediator complex subunit 13-like protein MED13L, a subunit of the CDK8-associated mediator complex that functions in transcriptional regulation through DNA-binding transcription factors and RNA polymerase II. Heterozygous MED13L variants cause transposition of the great arteries and intellectual disability (ID). Here, we report eight patients with predominantly novel MED13L variants who lack such complex congenital heart malformations. Rather, they depict a syndromic form of ID characterized by facial dysmorphism, ID, speech impairment, motor developmental delay with muscular hypotonia and behavioral difficulties. We thereby define a novel syndrome and significantly broaden the clinical spectrum associated with MED13L variants. A prominent feature of the MED13L neurocognitive presentation is profound language impairment, often in combination with articulatory deficits.

  6. Redefining the MED13L syndrome

    Science.gov (United States)

    Adegbola, Abidemi; Musante, Luciana; Callewaert, Bert; Maciel, Patricia; Hu, Hao; Isidor, Bertrand; Picker-Minh, Sylvie; Le Caignec, Cedric; Delle Chiaie, Barbara; Vanakker, Olivier; Menten, Björn; Dheedene, Annelies; Bockaert, Nele; Roelens, Filip; Decaestecker, Karin; Silva, João; Soares, Gabriela; Lopes, Fátima; Najmabadi, Hossein; Kahrizi, Kimia; Cox, Gerald F; Angus, Steven P; Staropoli, John F; Fischer, Ute; Suckow, Vanessa; Bartsch, Oliver; Chess, Andrew; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Kaindl, Angela M; Kalscheuer, Vera M

    2015-01-01

    Congenital cardiac and neurodevelopmental deficits have been recently linked to the mediator complex subunit 13-like protein MED13L, a subunit of the CDK8-associated mediator complex that functions in transcriptional regulation through DNA-binding transcription factors and RNA polymerase II. Heterozygous MED13L variants cause transposition of the great arteries and intellectual disability (ID). Here, we report eight patients with predominantly novel MED13L variants who lack such complex congenital heart malformations. Rather, they depict a syndromic form of ID characterized by facial dysmorphism, ID, speech impairment, motor developmental delay with muscular hypotonia and behavioral difficulties. We thereby define a novel syndrome and significantly broaden the clinical spectrum associated with MED13L variants. A prominent feature of the MED13L neurocognitive presentation is profound language impairment, often in combination with articulatory deficits. PMID:25758992

  7. 4-13 kA DC current transducers enabling accurate in-situ calibration for a new particle accelerator project, LHC

    CERN Document Server

    Hudson, G

    2005-01-01

    CERN's next generation particle accelerator, the large hadron collider (LHC) requires accurate current measurement up to 13 kA to enable current tracking between individual power converters. DC current transducers (DCCTs) have been developed to allow in-situ calibrations to 10/sup -6/ uncertainty. This paper describes the principle, design and initial evaluations.

  8. Measurement of the Residual Resistivity Ratio of the Bus Bars Copper Stabilizer of the 13 kA Circuits of the LHC

    CERN Document Server

    Apollonio, A; Solfaroli Camillocci, M; Schmidt, R; Verweij, A; Siemko, A; Claudet, S; Steckert, J; Thiesen, H

    2012-01-01

    After the incident of September 2008, the operational beam energy of the LHC has been set to 3.5 TeV, since not all joints of the superconducting (SC) bus bars between magnets have the required quality for 7 TeV operation. This decision is based on simulations to determine the safe current in the main dipole and quadrupole circuits, reproducing the thermal behaviour of a quenched superconducting joint by taking into account all relevant factors that affect a possible thermal runaway. One important parameter is the Residual Resistivity Ratio (RRR) of the copper stabilizer of the bus bar connecting the superconducting magnets. A dedicated campaign to measure the RRR for the main 13 kA circuits of the LHC in all sectors was performed during the Christmas stop in December 2010 and January 2011. The measurement method as well as the data analysis and results are presented in this paper.

  9. Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

    Science.gov (United States)

    Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

    2003-03-01

    Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

  10. Forms and factors of peer violence and victimisation

    Directory of Open Access Journals (Sweden)

    Dinić Bojana

    2014-01-01

    Full Text Available The main aim of this study was to explore the latent structure of violence and victimisation based on the factor analysis of the Peer Violence and Victimisation Questionnaire (PVVQ, as well as to examine the correlates of violence and victimisation. The sample included 649 secondary school students (61.8% male from the urban area. Besides the PVVQ, the Aggressiveness questionnaire AVDH was administered. Based on parallel analysis, three factors were extracted in the violence domain, as well as in the victimisation domain of the PVVQ. The factors were interpreted as a physical, verbal and relational form of violence and victimisation, which is in line with common classifications. The correlations of those forms with the aggressiveness dimensions were positive. The relationships with gender, school grade and school achievement referred to the importance of interaction effects between the mentioned characteristics of students and the tendency towards violence or being exposed to it. The main result is that boys from lower school grades and students with lower school achievement in general, are more prone to manifesting physical violence and more often are the target of physical violence. These groups of students are the target groups for preventive programs. The resulting effects indicated the complexity of the violence phenomenon and pointed to the need to consider the wider context of student’s characteristics in the determination of violence. [Projekat Ministarstva nauke Republike Srbije, br. 179037 i br. 179053

  11. On form factors of the conjugated field in the non-linear Schroedinger model

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.K.

    2011-05-15

    Izergin-Korepin's lattice discretization of the non-linear Schroedinger model along with Oota's inverse problem provides one with determinant representations for the form factors of the lattice discretized conjugated field operator. We prove that these form factors converge, in the zero lattice spacing limit, to those of the conjugated field operator in the continuous model. We also compute the large-volume asymptotic behavior of such form factors in the continuous model. These are in particular characterized by Fredholm determinants of operators acting on closed contours. We provide a way of defining these Fredholm determinants in the case of generic paramaters. (orig.)

  12. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development of...

  13. Rare decay modes of K*(1420) and K*(892)

    International Nuclear Information System (INIS)

    Jongejans, B.; Blokjijl, R.; Kluyver, J.C.; Massaro, G.G.G.; Voorthuis, H.; Engelen, J.J.; Metzger, W.J.; Pols, C.L.A.; Foster, B.; McDowell, L.; Wells, J.

    1978-01-01

    A 2.5 standard deviation signal is observed for the decay K* - (1420) → K* - (892)π + π - . From this signal a partial width of 13.0 +- 5.0 MeV for the decay mode K*(1420) → K*(892)ππ is deduced under the assumption that the ππ system is in an I = 1 state. For the rare decay mode K*(892) → Kππ no signal is observed. The following upper limits can be given for the decay widths: GAMMAsub(K* - (892) → K - π + π - ) - (892) → anti K 0 π - π 0 ) 0 (892) → anti K 0 π + π - ) < 35 keV. (Auth.)

  14. Interaction between droplets in a ternary microemulsion evaluated by the relative form factor method

    International Nuclear Information System (INIS)

    Nagao, Michihiro; Seto, Hideki; Yamada, Norifumi L.

    2007-01-01

    This paper describes the concentration dependence of the interaction between water droplets coated by a surfactant monolayer using the contrast variation small-angle neutron scattering technique. In the first part, we explain the idea of how to extract a relatively model free structure factor from the scattering data, which is called the relative form factor method. In the second part, the experimental results for the shape of the droplets (form factor) are described. In the third part the relatively model free structure factor is shown, and finally the concentration dependence of the interaction potential between droplets is discussed. The result indicates the validity of the relative form factor method, and the importance of the estimation of the model free structure factor to discuss the nature of structure formation in microemulsion systems

  15. B→ππ form factors from light-cone sum rules with B-meson distribution amplitudes

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Shan; Khodjamirian, Alexander [Theoretische Physik 1, Naturwissenschaftlich-Technische Fakultät,Department Physik, Universität Siegen,Walter-Flex-Strasse 3, 57068 Siegen (Germany); Virto, Javier [Albert Einstein Center for Fundamental Physics,Institute for Theoretical Physics, University of Bern,Sidlerstrasse 5, CH-3012 Bern (Switzerland)

    2017-05-30

    We study B→ππ form factors using QCD light-cone sum rules with B-meson distribution amplitudes. These form factors describe the semileptonic decay B→ππℓν̄{sub ℓ}, and constitute an essential input in B→ππℓ{sup +}ℓ{sup −} and B→πππ decays. We employ the correlation functions where a dipion isospin-one state is interpolated by the vector light-quark current. We obtain sum rules where convolutions of the P-wave B̄{sup 0}→π{sup +}π{sup 0} form factors with the timelike pion vector form factor are related to universal B-meson distribution amplitudes. These sum rules are valid in the kinematic regime where the dipion state has a large energy and a low invariant mass, and reproduce analytically the known light-cone sum rules for B→ρ form factors in the limit of ρ-dominance and zero width, thus providing a systematics for so far unaccounted corrections to B→ρ transitions. Using data for the pion vector form factor, we estimate finite-width effects and the contribution of excited ρ-resonances to the B→ππ form factors. We find that these contributions amount up to ∼20% in the small dipion mass region where they can be effectively regarded as a nonresonant (P-wave) background to the B→ρ transition.

  16. Electromagnetic and Scalar Pion form factor in the Kroll-Lee-Zumino model

    International Nuclear Information System (INIS)

    Dominguez, C.A.; Jottar, J.I.; Loewe, M.; Willers, B.

    2009-01-01

    The renormalizable Abelian quantum field theory model of Kroll, Lee, and Zumino is used at the one loop level to compute vertex corrections to the tree-level, Vector Meson Dominance (VMD) electromagnetic pion form factor. These corrections, together with the one-loop vacuum polarization contribution, imply a resulting electromagnetic pion form factor in excellent agreement with data in the whole range of accessible momentum transfers in the space-like region. The time-like form factor, which reproduces the Gounaris-Sakurai formula at and near the rho-meson peak, is unaffected by the vertex correction at order O(g 2 ). The KLZ model is also used to compute the scalar radius of the pion at the one loop level, finding π 2 > S =0.40fm 2 . This value implies for the low energy constant of chiral perturbation theory l-bar 4 =3.4

  17. Genome-wide profiling of H3K56 acetylation and transcription factor binding sites in human adipocytes.

    Directory of Open Access Journals (Sweden)

    Kinyui Alice Lo

    Full Text Available The growing epidemic of obesity and metabolic diseases calls for a better understanding of adipocyte biology. The regulation of transcription in adipocytes is particularly important, as it is a target for several therapeutic approaches. Transcriptional outcomes are influenced by both histone modifications and transcription factor binding. Although the epigenetic states and binding sites of several important transcription factors have been profiled in the mouse 3T3-L1 cell line, such data are lacking in human adipocytes. In this study, we identified H3K56 acetylation sites in human adipocytes derived from mesenchymal stem cells. H3K56 is acetylated by CBP and p300, and deacetylated by SIRT1, all are proteins with important roles in diabetes and insulin signaling. We found that while almost half of the genome shows signs of H3K56 acetylation, the highest level of H3K56 acetylation is associated with transcription factors and proteins in the adipokine signaling and Type II Diabetes pathways. In order to discover the transcription factors that recruit acetyltransferases and deacetylases to sites of H3K56 acetylation, we analyzed DNA sequences near H3K56 acetylated regions and found that the E2F recognition sequence was enriched. Using chromatin immunoprecipitation followed by high-throughput sequencing, we confirmed that genes bound by E2F4, as well as those by HSF-1 and C/EBPα, have higher than expected levels of H3K56 acetylation, and that the transcription factor binding sites and acetylation sites are often adjacent but rarely overlap. We also discovered a significant difference between bound targets of C/EBPα in 3T3-L1 and human adipocytes, highlighting the need to construct species-specific epigenetic and transcription factor binding site maps. This is the first genome-wide profile of H3K56 acetylation, E2F4, C/EBPα and HSF-1 binding in human adipocytes, and will serve as an important resource for better understanding adipocyte

  18. Sudakov resummation for subleading SCET currents and heavy-to-light form factors

    International Nuclear Information System (INIS)

    Hill, Richard J.; Becher, Thomas; Lee, Seung J.; Neubert, Matthias

    2004-01-01

    The hard-scattering contributions to heavy-to-light form factors at large recoil are studied systematically in soft-collinear effective theory (SCET). Large logarithms arising from multiple energy scales are re-summed by matching QCD onto SCET in two stages via an intermediate effective theory. Anomalous dimensions in the intermediate theory are computed, and their form is shown to be constrained by conformal symmetry. Renormalization-group evolution equations are solved to give a complete leading-order analysis of the hard-scattering contributions, in which all single and double logarithms are re-summed. In two cases, spin-symmetry relations for the soft-overlap contributions to form factors are shown not to be broken at any order in perturbation theory by hard-scattering corrections. One-loop matching calculations in the two effective theories are performed in sample cases, for which the relative importance of renormalization-group evolution and matching corrections is investigated. The asymptotic behavior of Sudakov logarithms appearing in the coefficient functions of the soft-overlap and hard-scattering contributions to form factors is analyzed. (author)

  19. Locally formed dopamine inhibits Na sup + -K sup + -ATPase activity in rat renal cortical tubule cells

    Energy Technology Data Exchange (ETDEWEB)

    Seri, I.; Kone, B.C.; Gullans, S.R.; Aperia, A.; Brenner, B.M.; Ballermann, B.J. (Harvard Medical School, Boston, MA (USA) Karolinska Institute, Stockholm (Sweden))

    1988-10-01

    Dopamine, generated locally from L-dopa, inhibits Na{sup +}-K{sup +}-ATPase in permeabilized rat proximal tubules under maximum transport rate conditions for sodium. To determine whether locally formed dopamine inhibits Na{sup +}-K{sup +}-ATPase activity in intact cortical tubule cells we studied the effect of L-dopa on ouabain-sensitive oxygen consumption rate ({dot Q}o{sub 2}) and {sup 86}Rb uptake in renal cortical tubule cell suspensions. L-Dopa did not affect ouabain-insensitive {dot Q}o{sub 2} or mitochondrial respiration. However, L-dopa inhibited ouabain-sensitive {dot Q}o{sub 2} in a concentration-dependent manner, with half-maximal inhibition (K{sub 0.5}) of 5 {times} 10{sup {minus}7} M and a maximal inhibition of 14.1 {plus minus} 1.5% at 10{sup {minus}4}M. L-Dopa also blunted the nystatin-stimulated {dot Q}o{sub 2} in a concentration-dependent manner, indicating the L-dopa directly inhibits Na{sup +}-K{sup +}-ATPase activity and not sodium entry. Ouabain-sensitive {sup 86}Rb uptake was also inhibited by L-dopa. Carbidopa, an inhibitor of the conversion of L-dopa to dopamine, eliminated the effect of L-dopa on ouabain-sensitive {dot Q}o{sub 2} and {sup 86}Rb uptake, indicating that dopamine rather than L-dopa was the active agent. The finding that the L-dopa concentration-response curve was shifted to the left by one order of magnitude in the presence of nystatin suggests that the inhibitory effect is enhanced when the intracellular sodium concentration is increased. By studying the effect of L-dopa on ouabain-sensitive {dot Q}o{sub 2} at increasing extracellular sodium concentrations in the presence of nystatin, the authors demonstrated that the inhibitory effect of locally formed dopamine on the Na{sup +}-K{sup +}-ATPase is indeed dependent on the sodium available for the enzyme and occurs in an uncompetitive manner.

  20. Spontaneous magnetization of quantum XY-chain from finite chain form-factor

    International Nuclear Information System (INIS)

    Iorgov, N.Z.

    2010-01-01

    Using the explicit factorized formulas for matrix elements (form-factors) of the spin operators between vectors of the Hamiltonian of a finite quantum XY-chain in a transverse field, the spontaneous magnetization for σ x and σ y is re-derived in a simple way.

  1. Measurement of the proton form factor ratio at low momentum transfer

    Energy Technology Data Exchange (ETDEWEB)

    Friedman, Moshe [Hebrew Univ. of Jerusalem (Israel)

    2016-08-01

    Experiment E08-007-II measured the proton elastic form factor ratio μGE=GM in the momentum transfer range of Q2 ~ 0.02 - 0.08 GeV2, the lowest ever measured by polarization transfer techniques. The experiment was performed at the Thomas Jefferson National Accelerator Facility in Newport News, Virginia, USA during 2012. A polarized electron beam with energies of 1.1, 1.7, and 2.2 GeV was elastically scattered off a polarized solid NH3 target. The asymmetries between the cross section of positive and negative helicity states of the beam were determined. These asymmetries can be used to determine the form factor ratio. In this thesis, we present the asymmetry analysis of the experiment, discuss the main challenges and show preliminary results for part of the data. Preliminary asymmetries indicate an increase in the form factor ratio above unity. However, a complete analysis is required before any conclusion can be made. Further analysis is ongoing, and final asymmetry results and form factor extraction is expected during 2017. We also present first results for 14N asymmetries for elastic and quasi-elastic scattering. The measured asymmetries are in agreement with the shell model approximation, within the low accuracy of the measurement. A change in the asymmetry sign between the elastic and the quasi-elastic processes is seen, and should motivate further theoretical studies. These experimental asymmetries will also be useful for systematic studies of other experiments using polarized NH3 targets.

  2. A Novel Saccharomyces cerevisiae Killer Strain Secreting the X Factor Related to Killer Activity and Inhibition of S. cerevisiae K1, K2 and K28 Killer Toxins.

    Science.gov (United States)

    Melvydas, Vytautas; Bružauskaitė, Ieva; Gedminienė, Genovaitė; Šiekštelė, Rimantas

    2016-09-01

    It was determined that Kx strains secrete an X factor which can inhibit all known Saccharomyces cerevisiae killer toxins (K1, K2, K28) and some toxins of other yeast species-the phenomenon not yet described in the scientific literature. It was shown that Kx type yeast strains posess a killer phenotype producing small but clear lysis zones not only on the sensitive strain α'1 but also on the lawn of S. cerevisiae K1, K2 and K28 type killer strains at temperatures between 20 and 30 °C. The pH at which killer/antikiller effect of Kx strain reaches its maximum is about 5.0-5.2. The Kx yeast were identified as to belong to S. cerevisiae species. Another newly identified S. cerevisiae killer strain N1 has killer activity but shows no antikilller properties against standard K1, K2 and K28 killer toxins. The genetic basis for Kx killer/antikiller phenotype was associated with the presence of M-dsRNA which is bigger than M-dsRNA of standard S. cerevisiae K1, K2, K28 type killer strains. Killer and antikiller features should be encoded by dsRNA. The phenomenon of antikiller (inhibition) properties was observed against some killer toxins of other yeast species. The molecular weight of newly identified killer toxins which produces Kx type strains might be about 45 kDa.

  3. A preliminary assessment of vitamin K1 intakes and serum undercarboxylated osteocalcin levels in 11-13 year old Irish girls.

    Science.gov (United States)

    Collins, Aoife; Cashman, Kevin D; Kiely, Máiréad

    2006-11-01

    Low vitamin K1 intakes have been associated with low bone mineral density in women and reduced bone turnover in girls. No European data exist on the relationship between vitamin K1 and serum undercarboxylated osteocalcin (ucOC), an indicator of K1 status in adolescents. The aim of the current study was to assess intakes of vitamin K1 in relation to serum ucOC status in Irish girls. A detailed dietary history method, which measured habitual intakes from a typical 14-day period, was used to estimate vitamin K1 intakes in 18 girls aged 11-13 years. Recently compiled and validated food composition data for vitamin K1 were used to determine vitamin K1 intakes. An enzyme immunoassay was used to measure ucOC in fasting serum samples. The mean (+/- SD) intake of vitamin K1 in the girls was 72.4 microg/day (SD 34.4). Vegetables (particularly broccoli, composite dishes, and lettuce) contributed 53% of total vitamin K1 intakes. Thirty-Seven percent of the girls failed to meet the current U.S. adequate intake for adolescents of 60 microg/day vitamin K1. Serum ucOC levels were inversely related to body weight-adjusted vitamin K1 intakes, controlling for energy intake (partial correlation r = -0.538; p = 0.026). The data indicate that large-scale studies to examine relationships between vitamin K1 (and green vegetable) intakes and bone growth and development in adolescents are warranted.

  4. FACTOR NUCLEAR kB (NF-kB: SIGNALOSOMA Y SU IMPORTANCIA EN ENFERMEDADES INFLAMATORIAS Y CÁNCER

    Directory of Open Access Journals (Sweden)

    Nancy P. Echeverry R.L

    2008-04-01

    Full Text Available El factor nuclear kB (NF-kB es un dímero constituido por proteínas de la familia Rel. El NF-kB se encuentra en el citoplasma unido a proteínas inhibidoras (IkB. Las IkB son fosforiladas por diferentes cinasas que hacen parte del signalosoma como las cinasas de IKKa e IKKb y el modulador esencial de NF-kB (NEMO, la proteína cinasa activadora de mitosis (MAPK o p38 y la cinasa inductora de NF-kB (NIK. Estas cinasas al ser activadas por señales dependientes de citocinas y luz ultravioleta, fosforilan las IkB provocando su ubiquitinación, su degradación por proteosoma y la subsecuente liberación y translocación al núcleo de NF-kB. Recientemente se le ha dado una gran importancia al NF-kB en la vía de señalización desencadenada por estrés oxidativo, estrés genotóxico y daño en el DNA. A diferencia de la vía denominada clásica, en esta ruta ocurre una SUMOilación de NEMO y translocación al núcleo. En el núcleo NEMO interactúa con la proteína de la ataxia telangiectasia mutada (ATM activada en respuesta a modificaciones en la cromatina y daño en el DNA. El complejo ATM/NEMO es translocado al citoplasma donde la ATM fosforila a las IKK llevando a la ubiquitinación y posterior liberación de NF-kB que es translocado al núcleo. NF-kB desencadena procesos de supervivencia incluyendo el aumento de la transcripción de enzimas antioxidantes como la superóxido dismutasa, catalasa y glutatión. Estas enzimas participan en el control de los niveles de especies reactivas de oxígeno en la célula. La sobreactivación de NF-kB se relaciona con inflamación y cáncer. En la actualidad se desarrolla una búsqueda de fármacos que actúen sobre moléculas del signalosoma de NF-kB, no sólo para el manejo de enfermedades inflamatorias sino también para el uso durante el tratamiento de tumores resistentes a radio y quimioterapia.

  5. Proton Form Factors And Related Processes in BaBar by ISR

    Energy Technology Data Exchange (ETDEWEB)

    Ferroli, R.B.; /Enrico Fermi Ctr., Rome /INFN, Rome

    2007-02-12

    BaBar has measured with unprecedented accuracy e{sup +}e{sup -} {yields} p{bar p} from the threshold up to Q{sub p{bar p}}{sup 2} {approx} 20 GeV{sup 2}/c{sup 4}, finding out an unexpected cross section, with plateaux and drops. In particular it is well established a sharp drop near threshold, where evidence for structures in multihadronic channels has also been found. Other unexpected and spectacular features of the Nucleon form factors are reminded, the behavior of space-like G{sub E}{sup p}/G{sub M}{sup p} and the neutron time-like form factors.

  6. Recent Studies of Nucleon Electromagnetic Form Factors

    International Nuclear Information System (INIS)

    Gilad, Shalev

    2010-01-01

    The electromagnetic form factors of nucleons are fundamental quantities in nucleon structure. As such, they have been studied extensively both theoretically and experimentally. Significant progress has been made with new measurements at Jlab, MAMI and MIT-Bates, with emphases on expanding the momentum-transfer range and on higher precision. In this paper, we describe the status of this field and present new results from measurements at both low and high momentum transfers. We also compare the experimental data to model predictions, and mention possible implications of the new results to other fields.

  7. Axial nucleon form factors from lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Brinet, M.; Carbonell, J.; Harraud, P. A.; Papinutto, M.; Constantinou, M.; Guichon, P.; Jansen, K.; Korzec, T.

    2011-01-01

    We present results on the nucleon axial form factors within lattice QCD using two flavors of degenerate twisted mass fermions. Volume effects are examined using simulations at two volumes of spatial length L=2.1 fm and L=2.8 fm. Cut-off effects are investigated using three different values of the lattice spacings, namely a=0.089 fm, a=0.070 fm and a=0.056 fm. The nucleon axial charge is obtained in the continuum limit and chirally extrapolated to the physical pion mass enabling comparison with experiment.

  8. Neutron charge radius and the neutron electric form factor

    International Nuclear Information System (INIS)

    Gentile, T. R.; Crawford, C. B.

    2011-01-01

    For nearly forty years, the Galster parametrization has been employed to fit existing data for the neutron electric form factor, G E n , vs the square of the four-momentum transfer, Q 2 . Typically this parametrization is constrained to be consistent with experimental data for the neutron charge radius. However, we find that the Galster form does not have sufficient freedom to accommodate reasonable values of the radius without constraining or compromising the fit. In addition, the G E n data are now at sufficient precision to motivate a two-parameter fit (or three parameters if we include thermal neutron data). Here we present a modified form of a two-dipole parametrization that allows this freedom and fits both G E n (including recent data at both low and high four-momentum transfer) and the charge radius well with simple, well-defined parameters. Analysis reveals that the Galster form is essentially a two-parameter approximation to the two-dipole form but becomes degenerate if we try to extend it naturally to three parameters.

  9. Thermodynamic limit of particle-hole form factors in the massless XXZ Heisenberg chain

    Energy Technology Data Exchange (ETDEWEB)

    Kitanine, N. [Univ. de Bourgogne (France). IMB, UMR 5584 du CNRS; Kozlowski, K.K. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Maillet, J.M.; Terras, V. [ENS Lyon (France). UMR 5672 du CNRS, Lab. de Physique; Slavnov, N.A. [Steklov Mathematical Inst., Moscow (Russian Federation)

    2011-03-15

    We study the thermodynamic limit of the particle-hole form factors of the XXZ Heisenberg chain in the massless regime. We show that, in this limit, such form factors decrease as an explicitly computed power-law in the system size. Moreover, the corresponding amplitudes can be obtained as a product of a ''smooth'' and a ''discrete'' part: the former depends continuously on the rapidities of the particles and holes, whereas the latter has an additional explicit dependence on the set of integer numbers that label each excited state in the associated logarithmic Bethe equations. We also show that special form factors corresponding to zero-energy excitations lying on the Fermi surface decrease as a power-law in the system size with the same critical exponents as in the longdistance asymptotic behavior of the related two-point correlation functions. The methods we develop in this article are rather general and can be applied to other massless integrable models associated to the six-vertex R-matrix and having determinant representations for their form factors. (orig.)

  10. Extraction of the neutron electric form factor from measurements of inclusive double spin asymmetries

    Science.gov (United States)

    Sulkosky, V.; Jin, G.; Long, E.; Zhang, Y.-W.; Mihovilovic, M.; Kelleher, A.; Anderson, B.; Higinbotham, D. W.; Širca, S.; Allada, K.; Annand, J. R. M.; Averett, T.; Bertozzi, W.; Boeglin, W.; Bradshaw, P.; Camsonne, A.; Canan, M.; Cates, G. D.; Chen, C.; Chen, J.-P.; Chudakov, E.; De Leo, R.; Deng, X.; Deur, A.; Dutta, C.; El Fassi, L.; Flay, D.; Frullani, S.; Garibaldi, F.; Gao, H.; Gilad, S.; Gilman, R.; Glamazdin, O.; Golge, S.; Gomez, J.; Hansen, J.-O.; Holmstrom, T.; Huang, J.; Ibrahim, H.; de Jager, C. W.; Jensen, E.; Jiang, X.; Jones, M.; Kang, H.; Katich, J.; Khanal, H. P.; King, P.; Korsch, W.; LeRose, J.; Lindgren, R.; Lu, H.-J.; Luo, W.; Markowitz, P.; Meekins, D.; Meziane, M.; Michaels, R.; Moffit, B.; Monaghan, P.; Muangma, N.; Nanda, S.; Norum, B. E.; Pan, K.; Parno, D.; Piasetzky, E.; Posik, M.; Punjabi, V.; Puckett, A. J. R.; Qian, X.; Qiang, Y.; Qui, X.; Riordan, S.; Saha, A.; Sawatzky, B.; Shabestari, M.; Shahinyan, A.; Shoenrock, B.; John, J. St.; Subedi, R.; Tobias, W. A.; Tireman, W.; Urciuoli, G. M.; Wang, D.; Wang, K.; Wang, Y.; Watson, J.; Wojtsekhowski, B.; Ye, Z.; Zhan, X.; Zhang, Y.; Zheng, X.; Zhao, B.; Zhu, L.; Jefferson Lab Hall A Collaboration

    2017-12-01

    Background: Measurements of the neutron charge form factor, GEn, are challenging because the neutron has no net charge. In addition, measurements of the neutron form factors must use nuclear targets which require accurately accounting for nuclear effects. Extracting GEn with different targets and techniques provides an important test of our handling of these effects. Purpose: The goal of the measurement was to use an inclusive asymmetry measurement technique to extract the neutron charge form factor at a four-momentum transfer of 1 (GeV/c ) 2 . This technique has very different systematic uncertainties than traditional exclusive measurements and thus serves as an independent check of whether nuclear effects have been taken into account correctly. Method: The inclusive quasielastic reaction 3He ⃗(e ⃗,e') was measured at Jefferson Laboratory. The neutron electric form factor, GEn, was extracted at Q2=0.98 (GeV/c ) 2 from ratios of electron-polarization asymmetries measured for two orthogonal target spin orientations. This Q2 is high enough that the sensitivity to GEn is not overwhelmed by the neutron magnetic contribution, and yet low enough that explicit neutron detection is not required to suppress pion production. Results: The neutron electric form factor, GEn, was determined to be 0.0414 ±0.0077 (stat)±0.0022 (syst) , providing the first high-precision inclusive extraction of the neutron's charge form factor. Conclusions: The use of the inclusive quasielastic 3He ⃗(e ⃗,e') with a four-momentum transfer near 1 (GeV/c ) 2 has been used to provide a unique measurement of GEn. This new result provides a systematically independent validation of the exclusive extraction technique results and implies that the nuclear corrections are understood. This is contrary to the proton form factor where asymmetry and differential cross section measurements have been shown to have large systematic differences.

  11. Determination of UTW K/sub XSi/ factors for low atomic number microanalysis: A systematic approach

    International Nuclear Information System (INIS)

    Krishnan, K.M.; Echer, C.J.

    1987-07-01

    A systematic measurement of experimental K/sub XSi/ factors, with particular emphasis on low Z microanalysis (6 ≤ 7 ≤ 32), at 200 kV for a KEVEX UTW Si(Li) detector fitted to a JEOL 200CX analytical microscope, using a variety of high purity standards has been carried out. Under normal operating conditions of a LaB 6 filament, it is shown that absorption in the specimen is very critical, particularly for heavy element matrices, and sample thicknesses need to be measured for accurate microanalysis of low Z elements (C,N,O). Using these measured K/sub XSi/ factors, quantitative UTW-EDX microanalysis has been routinely extended to carbon. 21 refs

  12. Exploratory factor analysis of Kenny Music Performance Anxiety Inventory (K-MPAI in a Brazilian musician sample

    Directory of Open Access Journals (Sweden)

    Ana Elisa Medeiros Barbar

    2015-10-01

    Full Text Available Abstract Background The Kenny Music Performance Anxiety Inventory (K-MPAI is very significant among the available instruments which measures Musical Performance Anxiety (MPA. Objective The aim of this study is to find evidence of validity of the Kenny Music Performance Anxiety Inventory (K-MPAI, in its translated and adapted Brazilian version, through the study of its factor structure. Methods A convenience sample of 230 amateur musicians completed the K-MPAI. Results The initial factor analysis yielded eight factors, explaining 62.4% of variance. However, due to the factors’ composition and internal consistency values lower than 0.50, the number of factors was later set at three, considering the internal consistency of those, the theoretical propositions and symptomatology aspects that supported the construction of scale. They were named “Worries and insecurity” (α = 0.82, “Depression and hopelessness” (α = 0.77 and “Early parental relationships” (α = 0.57. Discussion/Conclusions These results point to the scale’s construct validity, since they support the theoretical basis used for the development of the K-MPAI and the clinical manifestations of the MPA.

  13. Relativistic corrections to the form factors of Bc into P-wave orbitally excited charmonium

    Science.gov (United States)

    Zhu, Ruilin

    2018-06-01

    We investigated the form factors of the Bc meson into P-wave orbitally excited charmonium using the nonrelativistic QCD effective theory. Through the analytic computation, the next-to-leading order relativistic corrections to the form factors were obtained, and the asymptotic expressions were studied in the infinite bottom quark mass limit. Employing the general form factors, we discussed the exclusive decays of the Bc meson into P-wave orbitally excited charmonium and a light meson. We found that the relativistic corrections lead to a large correction for the form factors, which makes the branching ratios of the decay channels B (Bc ± →χcJ (hc) +π± (K±)) larger. These results are useful for the phenomenological analysis of the Bc meson decays into P-wave charmonium, which shall be tested in the LHCb experiments.

  14. Host-derived, pore-forming toxin-like protein and trefoil factor complex protects the host against microbial infection.

    Science.gov (United States)

    Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun

    2014-05-06

    Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.

  15. Determination of K shell absorption jump factors and jump ratios in the elements between Tm(Z = 69) and Os(Z = 76) by measuring K shell fluorescence parameters

    International Nuclear Information System (INIS)

    Kaya, N.; Tirasoglu, E.; Apaydin, G.

    2008-01-01

    The K shell absorption jump factors and jump ratios have been measured in the elements between Tm (Z = 69) and Os(Z = 76) without having any mass attenuation coefficient at the upper and lower energy branch of the K absorption edge. The jump factors and jump ratios for these elements have been determined by measuring K shell fluorescence parameters such as the total atomic absorption cross-sections, the K α X-ray production cross-sections, the intensity ratio of the K β and K α X-rays and the K shell fluorescence yields. We have performed the measurements for the calculations of these values in attenuation and direct excitation experimental geometry. The K X-ray photons are excited in the target using 123.6 keV gamma-rays from a strong 57 Co source, and detected with an Ultra-LEGe solid state detector with a resolution 0.15 keV at 5.9 keV. The measured values have been compared with theoretical and others' experimental values. The results have been plotted versus atomic number

  16. Determination of K shell absorption jump factors and jump ratios in the elements between Tm( Z = 69) and Os( Z = 76) by measuring K shell fluorescence parameters

    Science.gov (United States)

    Kaya, N.; Tıraşoğlu, E.; Apaydın, G.

    2008-04-01

    The K shell absorption jump factors and jump ratios have been measured in the elements between Tm ( Z = 69) and Os( Z = 76) without having any mass attenuation coefficient at the upper and lower energy branch of the K absorption edge. The jump factors and jump ratios for these elements have been determined by measuring K shell fluorescence parameters such as the total atomic absorption cross-sections, the K α X-ray production cross-sections, the intensity ratio of the K β and K α X-rays and the K shell fluorescence yields. We have performed the measurements for the calculations of these values in attenuation and direct excitation experimental geometry. The K X-ray photons are excited in the target using 123.6 keV gamma-rays from a strong 57Co source, and detected with an Ultra-LEGe solid state detector with a resolution 0.15 keV at 5.9 keV. The measured values have been compared with theoretical and others' experimental values. The results have been plotted versus atomic number.

  17. Thermochemistry of 1,3-diethylbarbituric and 1,3-diethyl-2-thiobarbituric acids: Experimental and computational study

    International Nuclear Information System (INIS)

    Notario, Rafael; Roux, María Victoria; Ros, Francisco; Emel’yanenko, Vladimir N.; Zaitsau, Dzmitry H.; Verevkin, Sergey P.

    2014-01-01

    Highlights: • Enthalpies of formation in condensed phase have been obtained. • Enthalpy of vaporization of 1,3-diethylbarbituric acid has been determined. • Enthalpy of sublimation of 1,3-diethyl-2-thiobarbituric acid has been determined. • Gas-phase enthalpies of formation have been obtained. • Gas-phase enthalpies of formation have been calculated at G3 and G4 levels. - Abstract: This paper reports an experimental and computational thermochemical study on two barbituric acid derivatives, viz. 1,3-diethylbarbituric acid and 1,3-diethyl-2-thiobarbituric acid. Values of standard molar enthalpies of formation in the gas phase at T = 298.15 K have been derived from experiment. Energies of combustion were measured by the static bomb combustion calorimetry in the case of 1,3-diethylbarbituric acid, and the rotating-bomb combustion calorimetry in the case of 1,3-diethyl-2-thiobarbituric acid. From the combustion energies, standard molar enthalpies of formation in the crystalline state at T = 298.15 K were calculated. The enthalpy of vaporization of 1,3-diethylbarbituric acid and enthalpy of sublimation of 1,3-diethyl-2-thiobarbituric acid were determined using the transpiration method. Combining calorimetric and transpiration results, values of −(611.9 ± 2.0) kJ · mol −1 and −(343.8 ± 2.2) kJ · mol −1 for the gas-phase enthalpies of formation at T = 298.15 K of 1,3-diethylbarbituric and 1,3-diethyl-2-thiobarbituric acids, respectively, were derived. Theoretical calculations at the G3 and G4 levels were performed, and a study of the molecular structure of the compounds has been carried out. Calculated enthalpies of formation were in very good agreement with the experimental values

  18. Factor XII-independent activation of the bradykinin-forming cascade

    DEFF Research Database (Denmark)

    Joseph, Kusumam; Tholanikunnel, Baby G; Bygum, Anette

    2013-01-01

    and assayed for kallikrein formation. C1-INH was removed from factor XII-deficient plasma by means of immunoadsorption. RESULTS: We demonstrate that prekallikrein-HK will activate to kallikrein in phosphate-containing buffers and that the rate is further accelerated on addition of heat shock protein 90...... the prekallikrein-HK complex to prevent HK cleavage either by prekallikrein or by prekallikrein-HK autoactivation to generate kallikrein. In patients with hereditary angioedema, kallikrein and bradykinin formation can occur without invoking factor XII activation, although the kallikrein formed can rapidly activate...

  19. Coverlayer fabrication for small form factor optical disks

    Science.gov (United States)

    Kim, Jong-Hwan; Lee, Seung-Won; Kim, Jin-Hong

    2004-09-01

    Two different coverlayers made of UV resin and coversheet were prepared for small form factor optical disks. Thin coverlayer of 10 mm and thick coverlayer of 80 mm were fabricated for flying optical head and non-flying optical head, respectively. Thickness uniformity was analyzed for both coverlayers, and new designs to diminish a ski-jump phenomenon were suggested. Mechanical properties of protective film made of UV resin were investigated.

  20. INTERACTION OF LASER RADIATION WITH MATTER. LASER PLASMA High-power EUV (13.5 nm) light source

    Science.gov (United States)

    Borisov, Vladimir M.; Borisova, Galina N.; Vinokhodov, Aleksandr Yu; Zakharov, S. V.; Ivanov, Aleksandr S.; Kiryukhin, Yurii B.; Mishchenko, Valentin A.; Prokof'ev, Aleksandr V.; Khristoforov, Oleg B.

    2010-10-01

    Characteristics of a discharge-produced plasma (DPP) light source in the spectral band 13.5±0.135 nm, developed for Extreme Ultra Violet (EUV) lithography, are presented. EUV light is generated by DPP in tin vapour formed between rotating disk electrodes. The discharge is ignited by a focused laser beam. The EUV power 1000 W/(2π sr) in the spectral band 13.5±0.135 nm was achieved with input power about of ~63 kW to the plasma at a pulse repetition rate ~7 kHz . The results of numerical simulation are compared with the experimental data.