WorldWideScience

Sample records for justice screening method

  1. School Locations and Traffic Emissions — Environmental (InJustice Findings Using a New Screening Method

    Directory of Open Access Journals (Sweden)

    Philine Gaffron

    2015-02-01

    Full Text Available It has been shown that the location of schools near heavily trafficked roads can have detrimental effects on the health of children attending those schools. It is therefore desirable to screen both existing school locations and potential new school sites to assess either the need for remedial measures or suitability for the intended use. Current screening tools and public guidance on school siting are either too coarse in their spatial resolution for assessing individual sites or are highly resource intensive in their execution (e.g., through dispersion modeling. We propose a new method to help bridge the gap between these two approaches. Using this method, we also examine the public K-12 schools in the Sacramento Area Council of Governments Region, California (USA from an environmental justice perspective. We find that PM2.5 emissions from road traffic affecting a school site are significantly positively correlated with the following metrics: percent share of Black, Hispanic and multi-ethnic students, percent share of students eligible for subsidized meals. The emissions metric correlates negatively with the schools’ Academic Performance Index, the share of White students and average parental education levels. Our PM2.5 metric also correlates with the traffic related, census tract level screening indicators from the California Communities Environmental Health Screening Tool and the tool’s tract level rate of asthma related emergency department visits.

  2. Environmental Justice Screening Method (EJSM) Score, San Joaquin Valley CA, 2013, Occidental College and UC Berkeley

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Cumulative Impacts (CI) screening method is jointly being developed by Manuel Pastor, Jim Sadd (Occidental College), and Rachel Morello-Frosch (UC Berkeley) ....

  3. Playing It Safe: Assessing Cumulative Impact and Social Vulnerability through an Environmental Justice Screening Method in the South Coast Air Basin, California

    Directory of Open Access Journals (Sweden)

    Justin Scoggins

    2011-05-01

    Full Text Available Regulatory agencies, including the U.S. Environmental Protection Agency (US EPA and state authorities like the California Air Resources Board (CARB, have sought to address the concerns of environmental justice (EJ advocates who argue that chemical-by-chemical and source-specific assessments of potential health risks of environmental hazards do not reflect the multiple environmental and social stressors faced by vulnerable communities. We propose an Environmental Justice Screening Method (EJSM as a relatively simple, flexible and transparent way to examine the relative rank of cumulative impacts and social vulnerability within metropolitan regions and determine environmental justice areas based on more than simply the demographics of income and race. We specifically organize 23 indicator metrics into three categories: (1 hazard proximity and land use; (2 air pollution exposure and estimated health risk; and (3 social and health vulnerability. For hazard proximity, the EJSM uses GIS analysis to create a base map by intersecting land use data with census block polygons, and calculates hazard proximity measures based on locations within various buffer distances. These proximity metrics are then summarized to the census tract level where they are combined with tract centroid-based estimates of pollution exposure and health risk and socio-economic status (SES measures. The result is a cumulative impacts (CI score for ranking neighborhoods within regions that can inform diverse stakeholders seeking to identify local areas that might need targeted regulatory strategies to address environmental justice concerns.

  4. 78 FR 76860 - Contraband Screening for Criminal Justice Applications

    Science.gov (United States)

    2013-12-19

    ... for the detection of contraband. Screening technology is widely used by criminal justice practitioners...: 1. Model Number and Name of the screening system/device. 2. Technology used by the system/device for... container or bag), Plastic, Wood, Ceramic, Powder (in a small packet), and/or Paper (e.g., folded currency...

  5. Youth Justice staff attitudes towards screening for self-harm.

    Science.gov (United States)

    Knowles, Sarah E; Townsend, Ellen; Anderson, Martin P

    2012-09-01

    Young offenders are recognised as a high-risk group for suicidal behaviour. It is essential that the screening used to identify those at risk and refer them to mental health services is effective, especially in community settings where service utilisation is low. Staff attitudes towards screening for suicide and self-harm are likely to influence how a young offender engages with the screening process. Our study is the first to explore community youth justice staff attitudes towards, and perceptions of, screening for self-harmful behaviour. Eight semi-structured interviews were conducted at an English Youth Offending Team in June 2006 with staff who had used the suicide screening tool with young offenders. Data were analysed using Interpretative Phenomenological Analysis. Staff attitudes towards working within the screening system varied along two dimensions. The first 'active/passive' dimension related to perceived confidence in dealing with self-harm. The second 'positive/negative' dimension related to perceptions of the benefits of screening and the effectiveness of mental health provision for young offenders. Results indicate that barriers to effective screening must be tackled at both individual and organisational levels. The model of attitudes presented here could be used to increase understanding of how staff can be supported to engage effectively with the screening system. © 2012 Blackwell Publishing Ltd.

  6. Relevance of traditional methods of conflict resolution in the justice ...

    African Journals Online (AJOL)

    The traditional methods of African conflict resolution have long existed and are deeply rooted in the customs and traditions of the peoples of Africa. These methods are geared towards maintaining harmonious and peaceful coexistence in the community. Colonialism introduced the modern justice system, which dominated ...

  7. The Job Market for Justice: Screening and selecting candidates for the International Court of Justice

    DEFF Research Database (Denmark)

    Creamer, Cosette; Godzimirska, Zuzanna

    2017-01-01

    Over the past few decades, states have granted greater independence and authority to international courts, yet still retain their ability to control who sits on the bench. This article examines how governments use their power of judicial nomination and appointment in the context of the Internatio......Over the past few decades, states have granted greater independence and authority to international courts, yet still retain their ability to control who sits on the bench. This article examines how governments use their power of judicial nomination and appointment in the context...... of the International Court of Justice (ICJ) and assesses the relative influence of three factors on states’ vote choices for ICJ candidates: the candidates’ probability of (in)sensitivity to political considerations; their qualifications; and the role of inter-state politics. Drawing on a new dataset of candidates...... signaling a probability of insensitivity to political considerations reduce a candidate’s expected vote share. A candidate’s qualifications, on the other hand, do not appear to make a considerable difference in winning more votes. Finally, the amount of support during the nomination stage is highly...

  8. Can data science inform environmental justice and community risk screening for type 2 diabetes?

    Science.gov (United States)

    Davis, J Allen; Burgoon, Lyle D

    2015-01-01

    Having the ability to scan the entire country for potential "hotspots" with increased risk of developing chronic diseases due to various environmental, demographic, and genetic susceptibility factors may inform risk management decisions and enable better environmental public health policies. Develop an approach for community-level risk screening focused on identifying potential genetic susceptibility hotpots. Our approach combines analyses of phenotype-genotype data, genetic prevalence of single nucleotide polymorphisms, and census/geographic information to estimate census tract-level population attributable risks among various ethnicities and total population for the state of California. We estimate that the rs13266634 single nucleotide polymorphism, a type 2 diabetes susceptibility genotype, has a genetic prevalence of 56.3%, 47.4% and 37.0% in Mexican Mestizo, Caucasian, and Asian populations. Looking at the top quintile for total population attributable risk, 16 California counties have greater than 25% of their population living in hotspots of genetic susceptibility for developing type 2 diabetes due to this single genotypic susceptibility factor. This study identified counties in California where large portions of the population may bear additional type 2 diabetes risk due to increased genetic prevalence of a susceptibility genotype. This type of screening can easily be extended to include information on environmental contaminants of interest and other related diseases, and potentially enables the rapid identification of potential environmental justice communities. Other potential uses of this approach include problem formulation in support of risk assessments, land use planning, and prioritization of site cleanup and remediation actions.

  9. Methods for Cervical Cancer Screening

    Directory of Open Access Journals (Sweden)

    Tatiana Vargas-Revilla

    2014-12-01

    This article is divided in three sections: the first one focuses on the general impact of cervical cancer has hadin CostaRica, these condsection gathers information about different methodologies used around the world to detect this cancer and the third one makes reference to the current development of the screening devise in Mexico that works as a monitoring system and can used by women without external assistance.

  10. Methods for simulating turbulent phase screen

    International Nuclear Information System (INIS)

    Zhang Jianzhu; Zhang Feizhou; Wu Yi

    2012-01-01

    Some methods for simulating turbulent phase screen are summarized, and their characteristics are analyzed by calculating the phase structure function, decomposing phase screens into Zernike polynomials, and simulating laser propagation in the atmosphere. Through analyzing, it is found that, the turbulent high-frequency components are well contained by those phase screens simulated by the FFT method, but the low-frequency components are little contained. The low-frequency components are well contained by screens simulated by Zernike method, but the high-frequency components are not contained enough. The high frequency components contained will be improved by increasing the order of the Zernike polynomial, but they mainly lie in the edge-area. Compared with the two methods above, the fractal method is a better method to simulate turbulent phase screens. According to the radius of the focal spot and the variance of the focal spot jitter, there are limitations in the methods except the fractal method. Combining the FFT and Zernike method or combining the FFT method and self-similar theory to simulate turbulent phase screens is an effective and appropriate way. In general, the fractal method is probably the best way. (authors)

  11. LANL seismic screening method for existing buildings

    International Nuclear Information System (INIS)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O.

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method

  12. (Re)Envisioning Mathematics Education: Examining Equity and Social Justice in an Elementary Mathematics Methods Course

    Science.gov (United States)

    Koestler, Courtney

    2010-01-01

    In this dissertation, I present my attempts at designing an elementary mathematics methods course to support prospective teachers in developing an understanding of how to teach all students in learning powerful mathematics. To do this, I introduced them to teaching mathematics for equity and social justice by discussing ways to support students'…

  13. Genealogical series method. Hyperpolar points screen effect

    International Nuclear Information System (INIS)

    Gorbatov, A.M.

    1991-01-01

    The fundamental values of the genealogical series method -the genealogical integrals (sandwiches) have been investigated. The hyperpolar points screen effect has been found. It allows one to calculate the sandwiches for the Fermion systems with large number of particles and to ascertain the validity of the iterated-potential method as well. For the first time the genealogical-series method has been realized numerically for the central spin-independent potential

  14. Tumour screening by means of tomography methods

    International Nuclear Information System (INIS)

    Diederich, S.

    2005-01-01

    Tomography methods such as computer tomography (CT), magnetic resonance tomography (MRT), and sonography/ultrasound examinations make it possible to detect small asymptomatic tumours, thus potentially preventing their manifestation at an advanced stage and improving survival prospects for the patients concerned. There are data available on various common tumours which show that modern tomography methods are capable of detecting not only small asymptomatic tumours but also their benign precursors (e.g. polyps of the large intestine). This has been demonstrated for lung cancer, colon cancer and breast cancer. However, it has not been possible to date to show for any tomography method or any type of tumour that the systematic use of such diagnostic procedures does anything to lower the mortality rate for that tumour. For other types of tumour (pancreatic cancer, kidney cancer, ovary cancer) the above named methods are either not sufficiently sensitive or the body of data that has accumulated on their respective use is too small to judge the benefit of tomography screenings. Current technical developments make it appear probable that for many types of cancer the reliability with which small tumours can be detected will improve in future. Studies aimed at clarifying the potential of screenings for reducing mortality rates are already underway for lung cancer and would be worthwhile performing for other tumour types

  15. QSAR Methods to Screen Endocrine Disruptors

    Directory of Open Access Journals (Sweden)

    Nicola Porta

    2016-08-01

    Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.

  16. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    A new screening method for discovering antibacterial agents from filamentous fungi. ... African Journal of Biotechnology ... Keywords: Drug-resistant bacterial pathogens, novel antibiotics; screening method, filamentous fungi products ...

  17. Methods for Rapid Screening in Woody Plant Herbicide Development

    Directory of Open Access Journals (Sweden)

    William Stanley

    2014-07-01

    Full Text Available Methods for woody plant herbicide screening were assayed with the goal of reducing resources and time required to conduct preliminary screenings for new products. Rapid screening methods tested included greenhouse seedling screening, germinal screening, and seed screening. Triclopyr and eight experimental herbicides from Dow AgroSciences (DAS 313, 402, 534, 548, 602, 729, 779, and 896 were tested on black locust, loblolly pine, red maple, sweetgum, and water oak. Screening results detected differences in herbicide and species in all experiments in much less time (days to weeks than traditional field screenings and consumed significantly less resources (<500 mg acid equivalent per herbicide per screening. Using regression analysis, various rapid screening methods were linked into a system capable of rapidly and inexpensively assessing herbicide efficacy and spectrum of activity. Implementation of such a system could streamline early-stage herbicide development leading to field trials, potentially freeing resources for use in development of beneficial new herbicide products.

  18. Apparatus and method for radioactive waste screening

    Science.gov (United States)

    Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy

    2012-09-04

    An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.

  19. Relationship between Massachusetts Youth Screening Instrument-second version and psychiatric disorders in youths in welfare and juvenile justice institutions in Switzerland.

    Science.gov (United States)

    Leenarts, L E W; Dölitzsch, C; Schmeck, K; Fegert, J M; Grisso, T; Schmid, M

    2016-09-30

    There is growing evidence that it is important to have well-standardized procedures for identifying the mental health needs of youths in welfare and juvenile justice institutions. One of the most widely used tools for mental health screening in the juvenile justice system is the Massachusetts Youth Screening Instrument-second version (MAYSI-2). To contribute to the body of research examining the utility of the MAYSI-2 as a mental health screening tool; the first objective of the current study was to examine the relationship between the MAYSI-2 and the Schedule for Affective Disorders and Schizophrenia for School-Age Children, Present and Lifetime version (K-SADS-PL) in a sample of Swiss youths in welfare and juvenile justice institutions using a cross-sectional design. Secondly, as the sample was drawn from the French-, German- and Italian-speaking parts of Switzerland, the three languages were represented in the total sample and consequently differences between the language regions were analyzed as well. The third objective was to examine gender differences in this relationship. Participants were 297 boys and 149 girls (mean age = 16.2, SD = 2.5) recruited from 64 youth welfare and juvenile justice institutions in Switzerland. The MAYSI-2 was used to screen for mental health or behavioral problems that could require further evaluation. Psychiatric classification was based on the Schedule for Affective Disorders and Schizophrenia for School-Age Children, Present and Lifetime version (K-SADS-PL). Binomial logistic regression analysis was used to predict (cluster of) psychiatric disorders from MAYSI-2 scales. The regression analyses revealed that the MAYSI-2 scales generally related well to their corresponding homotypic (cluster of) psychiatric disorders. For example, the alcohol/drug use scale identified the presence of any substance use disorder and the suicide ideation scale identified youths reporting suicide ideation or suicide attempts. Several MAYSI-2

  20. A Mixed Methods Approach to Equity and Justice Research: Insights from Research on Children's Reasoning About Economic Inequality.

    Science.gov (United States)

    Mistry, Rashmita S; White, Elizabeth S; Chow, Kirby A; Griffin, Katherine M; Nenadal, Lindsey

    2016-01-01

    Mixed methods research approaches are gaining traction across various social science disciplines, including among developmental scientists. In this chapter, we discuss the utility of a mixed methods research approach in examining issues related to equity and justice. We incorporate a brief overview of quantitative and qualitative monomethod research approaches in our larger discussion of the advantages, procedures, and considerations of employing a mixed methods design to advance developmental science from an equity and justice perspective. To better illustrate the theoretical and practical significance of a mixed methods research approach, we include examples of research conducted on children and adolescents' conceptions of economic inequality as one example of developmental science research with an equity and justice frame. © 2016 Elsevier Inc. All rights reserved.

  1. Family-Centered Care in Juvenile Justice Institutions: A Mixed Methods Study Protocol.

    Science.gov (United States)

    Simons, Inge; Mulder, Eva; Rigter, Henk; Breuk, René; van der Vaart, Wander; Vermeiren, Robert

    2016-09-12

    Treatment and rehabilitation interventions in juvenile justice institutions aim to prevent criminal reoffending by adolescents and to enhance their prospects of successful social reintegration. There is evidence that these goals are best achieved when the institution adopts a family-centered approach, involving the parents of the adolescents. The Academic Workplace Forensic Care for Youth has developed two programs for family-centered care for youth detained in groups for short-term and long-term stay, respectively. The overall aim of our study is to evaluate the family-centered care program in the first two years after the first steps of its implementation in short-term stay groups of two juvenile justice institutions in the Netherlands. The current paper discusses our study design. Based on a quantitative pilot study, we opted for a study with an explanatory sequential mixed methods design. This pilot is considered the first stage of our study. The second stage of our study includes concurrent quantitative and qualitative approaches. The quantitative part of our study is a pre-post quasi-experimental comparison of family-centered care with usual care in short-term stay groups. The qualitative part of our study involves in-depth interviews with adolescents, parents, and group workers to elaborate on the preceding quantitative pilot study and to help interpret the outcomes of the quasi-experimental quantitative part of the study. We believe that our study will result in the following findings. In the quantitative comparison of usual care with family-centered care, we assume that in the latter group, parents will be more involved with their child and with the institution, and that parents and adolescents will be more motivated to take part in therapy. In addition, we expect family-centered care to improve family interactions, to decrease parenting stress, and to reduce problem behavior among the adolescents. Finally, we assume that adolescents, parents, and the

  2. Solubility tests and the peripheral blood film method for screening ...

    African Journals Online (AJOL)

    Objective. To determine the cost benefit of screening for sicklecell disease among infants at district health centres in Uganda using sickling, solubility tests and the peripheral blood film method. Methods. Pilot screening services were established at district health centres. Cost benefit analysis (CBA) was performed in four ...

  3. Transitional Justice

    DEFF Research Database (Denmark)

    Gissel, Line Engbo

    This presentation builds on an earlier published article, 'Contemporary Transitional Justice: Normalising a Politics of Exception'. It argues that the field of transitional justice has undergone a shift in conceptualisation and hence practice. Transitional justice is presently understood to be th...... to be the provision of ordinary criminal justice in contexts of exceptional political transition.......This presentation builds on an earlier published article, 'Contemporary Transitional Justice: Normalising a Politics of Exception'. It argues that the field of transitional justice has undergone a shift in conceptualisation and hence practice. Transitional justice is presently understood...

  4. High throughput screening method for assessing heterogeneity of microorganisms

    NARCIS (Netherlands)

    Ingham, C.J.; Sprenkels, A.J.; van Hylckama Vlieg, J.E.T.; Bomer, Johan G.; de Vos, W.M.; van den Berg, Albert

    2006-01-01

    The invention relates to the field of microbiology. Provided is a method which is particularly powerful for High Throughput Screening (HTS) purposes. More specific a high throughput method for determining heterogeneity or interactions of microorganisms is provided.

  5. Justice and Negotiation.

    Science.gov (United States)

    Druckman, Daniel; Wagner, Lynn M

    2016-01-01

    This review article examines the literature regarding the role played by principles of justice in negotiation. Laboratory experiments and high-stakes negotiations reveal that justice is a complex concept, both in relation to attaining just outcomes and to establishing just processes. We focus on how justice preferences guide the process and outcome of negotiated exchanges. Focusing primarily on the two types of principles that have received the most attention, distributive justice (outcomes of negotiation) and procedural justice (process of negotiation), we introduce the topic by reviewing the most relevant experimental and field or archival research on the roles played by these justice principles in negotiation. A discussion of the methods used in these studies precedes a review organized in terms of a framework that highlights the concept of negotiating stages. We also develop hypotheses based on the existing literature to point the way forward for further research on this topic.

  6. The Environmental Protection Agency's Community-Focused Exposure and Risk Screening Tool (C-FERST) and its potential use for environmental justice efforts.

    Science.gov (United States)

    Zartarian, Valerie G; Schultz, Bradley D; Barzyk, Timothy M; Smuts, Marybeth; Hammond, Davyda M; Medina-Vera, Myriam; Geller, Andrew M

    2011-12-01

    Our primary objective was to provide higher quality, more accessible science to address challenges of characterizing local-scale exposures and risks for enhanced community-based assessments and environmental decision-making. After identifying community needs, priority environmental issues, and current tools, we designed and populated the Community-Focused Exposure and Risk Screening Tool (C-FERST) in collaboration with stakeholders, following a set of defined principles, and considered it in the context of environmental justice. C-FERST is a geographic information system and resource access Web tool under development for supporting multimedia community assessments. Community-level exposure and risk research is being conducted to address specific local issues through case studies. C-FERST can be applied to support environmental justice efforts. It incorporates research to develop community-level data and modeled estimates for priority environmental issues, and other relevant information identified by communities. Initial case studies are under way to refine and test the tool to expand its applicability and transferability. Opportunities exist for scientists to address the many research needs in characterizing local cumulative exposures and risks and for community partners to apply and refine C-FERST.

  7. A new screening method for selection of desired recombinant ...

    African Journals Online (AJOL)

    A new screening method for selection of desired recombinant plasmids in molecular cloning. ... African Journal of Biotechnology ... Regarding the facts of this study, after digestion process, the products directly were subjected to ligation. Due to ...

  8. The evolving role of new imaging methods in breast screening.

    Science.gov (United States)

    Houssami, Nehmat; Ciatto, Stefano

    2011-09-01

    The potential to avert breast cancer deaths through screening means that efforts continue to identify methods which may enhance early detection. While the role of most new imaging technologies remains in adjunct screening or in the work-up of mammography-detected abnormalities, some of the new breast imaging tests (such as MRI) have roles in screening groups of women defined by increased cancer risk. This paper highlights the evidence and the current role of new breast imaging technologies in screening, focusing on those that have broader application in population screening, including digital mammography, breast ultrasound in women with dense breasts, and computer-aided detection. It highlights that evidence on new imaging in screening comes mostly from non-randomised studies that have quantified test detection capability as adjunct to mammography, or have compared measures of screening performance for new technologies with that of conventional mammography. Two RCTs have provided high-quality evidence on the equivalence of digital and conventional mammography and on outcomes of screen-reading complemented by CAD. Many of these imaging technologies enhance cancer detection but also increase recall and false positives in screening. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. An alternative green screen keying method for film visual effects

    OpenAIRE

    Zhi, Jin

    2015-01-01

    This study focuses on a green screen keying method developed especially for film visual effects. There are a series of ways of using existing tools for creating mattes from green or blue screen plates. However, it is still a time-consuming process, and the results vary especially when it comes to retaining tiny details, such as hair and fur. This paper introduces an alternative concept and method for retaining edge details of characters on a green screen plate, also, a number of connected mat...

  10. The Comparative Impacts of Social Justice Educational Methods on Political Participation, Civic Engagement, and Multicultural Activism

    Science.gov (United States)

    Krings, Amy; Austic, Elizabeth A.; Gutiérrez, Lorraine M.; Dirksen, Kaleigh E.

    2015-01-01

    This cross-sectional, repeated measures, quasi-experimental study evaluates changes in college students' commitment toward, and confidence in, political participation, civic engagement, and multicultural activism. Our sample (n = 653) consisted of college students in a Midwestern university who participated in one of three social justice education…

  11. Statistical methods for determining the effect of mammography screening

    DEFF Research Database (Denmark)

    Lophaven, Søren

    2016-01-01

    In an overview of five randomised controlled trials from Sweden, a reduction of 29% was found in breast cancer mortality in women aged 50-69 at randomisation after a follow up of 5-13 years. Organised, population based, mammography service screening was introduced on the basis of these resultsin...... in 2007-2008. Women aged 50-69 were invited to screening every second year. Taking advantage of the registers of population and health, we present statistical methods for evaluating the effect of mammography screening on breast cancer mortality (Olsen et al. 2005, Njor et al. 2015 and Weedon-Fekjær etal...

  12. SCREENING METHODS FOR THE DETECTION OF CARTELS

    Directory of Open Access Journals (Sweden)

    Mihail BUŞU

    2014-06-01

    Full Text Available During their everyday activities, the economic operators conclude a multitude of agreements in tacit or written form, such as: contracts or conventions. Some of these arrangements are absolutely necessary for the development of their current activities. These are agreements which, by respecting the rules of competition, are able to bring benefits to consumers and to the entire economy, as a whole. On the other hand, the economic operators often conclude agreements which are harmful to the economy as well as to the consumers, violating the competition rules. Some examples in this respect are: operators’ agreements on price fixing, on market or customers sharing. Before investigating the violation of competition rules, the relevant authorities should identify the possibility of the existence of such illegalities. The theoretical models for detecting the cartels do represent a proactive tool concerning the antitrust activity of competition authorities. The present paper furnishes a review of the methods for detecting cartels as well as a part of their practical application.

  13. A screening method for banana weevil ( Cosmopolites sordidus ...

    African Journals Online (AJOL)

    The banana weevil (Cosmopolites sordidus Germar) is a serious pest in most banana-growing areas of the world. Host-plant resistance is considered to be the most feasible and sustainable method for its control. However, a quick and effective method for screening banana genotypes for resistance against the banana ...

  14. Screening-Level Ecological Risk Assessment Methods, Revision 3

    Energy Technology Data Exchange (ETDEWEB)

    Mirenda, Richard J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2012-08-16

    This document provides guidance for screening-level assessments of potential adverse impacts to ecological resources from release of environmental contaminants at the Los Alamos National Laboratory (LANL or the Laboratory). The methods presented are based on two objectives, namely: to provide a basis for reaching consensus with regulators, managers, and other interested parties on how to conduct screening-level ecological risk investigations at the Laboratory; and to provide guidance for ecological risk assessors under the Environmental Programs (EP) Directorate. This guidance promotes consistency, rigor, and defensibility in ecological screening investigations and in reporting those investigation results. The purpose of the screening assessment is to provide information to the risk managers so informed riskmanagement decisions can be made. This document provides examples of recommendations and possible risk-management strategies.

  15. Down syndrome screening methods in Iranian pregnant women

    Directory of Open Access Journals (Sweden)

    Azizeh Farshbaf Khalili

    2012-08-01

    Full Text Available Introduction: Down syndrome is one of the most prevalent genetic diseases. Screening methods for this syndrome are easy and safe and are recommended to all pregnant wom-en particularly mothers over 35 years of age. This study aimed to review the status of Down syndrome screening and related factors in Iranian pregnant women. Methods: This descriptive analytical study was carried out in 2011. It included 400 women who were randomly selected from those referring to Alzahra Hospital (Tabriz, Iran during their third trimester of pregnancy. Data was collected through a question-naire whose reliability and validity have been approved. The data was analyzed by chi-square test in SPSS13. Results: The results showed that while 28 and 26 women imple-mented screening tests during the first and second trimesters, respectively, only 5 sub-jects benefited from both (integrated test. Chi-square test showed significant correla-tions between the implementation of screening methods and age, education level, in-come, and the location of prenatal care (p < 0.05. Conclusion: The findings of the present study showed women to poorly implement Down syndrome screening methods. Therefore, the necessity of providing appropriate educational programs for health staff and mothers seems undeniable. Moreover, paying attention to the related factors such as income, educational level, and adequate training of mothers during pregnancy is essential.

  16. LC-MS (/MS) in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Hochstrasser, Denis; Fathi, Marc

    2012-01-01

    Toxicological screening is the analysis of biological samples to detect and identify unknown compounds. The high selectivity and sensitivity of liquid chromatography (LC) coupled to mass spectrometry (MS) or tandem mass spectrometry (MS/MS) technology provide an attractive alternative to the current methods (LC-UV, GC/MS, etc.). For these reasons, an increasing number of applications are being published. This paper is a brief overview of LC-MS(/MS) screening methods developed for clinical toxicology in recent years. Various sample treatments, chromatographic separations and detection by mass spectrometry can be combined to obtain screening methods adapted to the constraints and needs of clinical toxicology laboratories. Currently the techniques are in the hands of specialists, mainly in academic institutions. However, the evolution in technology should allow application of these techniques as a tool in toxicology laboratories, thus allowing a more widespread exploitation of their potential.

  17. Experiencing Restorative Justice Practices within the Context of an Academic Course--A Phenomenological Mixed Methods Study

    Science.gov (United States)

    Dedinsky, Paul C.

    2012-01-01

    This study explored restorative justice arising in the context of an academic high school course in which students learned restorative justice principles and strategies. Given that the literature provided limited guidance of restorative justice in this context, these novel circumstances presented a unique opportunity for study. The central…

  18. Using the Screened Coulomb Potential to Illustrate the Variational Method

    Science.gov (United States)

    Zuniga, Jose; Bastida, Adolfo; Requena, Alberto

    2012-01-01

    The screened Coulomb potential, or Yukawa potential, is used to illustrate the application of the single and linear variational methods. The trial variational functions are expressed in terms of Slater-type functions, for which the integrals needed to carry out the variational calculations are easily evaluated in closed form. The variational…

  19. Efficacy of screening methods used in breeding for black pod ...

    African Journals Online (AJOL)

    The disease affects the pods, beans, flower cushions, leaves, stems and roots. The objective of this study was to evaluate the efficacy of resistance screening methods used in breeding black pod disease resistance in cocoa. The resistance of cocoa leaves and pods to Phytophthora palmivora was investigated in twenty five ...

  20. In vitro screening methods for assessing plant disease resistance

    International Nuclear Information System (INIS)

    Lebeda, A.; Svabova, L.

    2010-01-01

    A combination of biotechnological and phytopathological techniques provides an alternative approach to classical resistance breeding methods. Such techniques have been increasingly used since the 1980s, in parallel with the progress in plant biotechnology. In the approach of resistance screening and selection in vitro, both experimental objects, i.e., the plant and the pathogen, must first be transferred to in vitro conditions, and finally, the plant material must be transferred back to in vivo conditions and adapted to the outside settings. Specific attention must be paid to the methods of pathogen preparation for use in screening and selection in vitro. The selection agents are classified according to their origin, the methods of preparation, nature and content of active substances, and effective utilisation for screening or selection in vitro. Basic principles and methodological aspects of the in vitro work (explant cultures, sources of in vitro variability, screening and selection methods, types of selection agents) as well as examples of practical applications in the breeding of different crops are critically reviewed in this chapter. (author)

  1. Organizational Justice

    Science.gov (United States)

    Burns, Travis

    2013-01-01

    Helping principals understand the importance of organizational justice is the first step in enhancing learning outcomes for all learners, regardless of their social class, race, abilities, sex, or gender. In schools, organizational justice may be defined as teachers' perceptions of fairness, respect, and equity that relate to their interactions…

  2. Justice Globalism

    NARCIS (Netherlands)

    Wilson, Erin; Steger, Manfred; Siracusa, Joseph; Battersby, Paul

    2014-01-01

    The pursuit of a global order founded on universal rules extends beyond economics into the normative spheres of law, politics and justice. Justice globalists claim universal principles applicable to all societies irrespective of religion or ideology. This view privileges human rights, democracy and

  3. DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS

    International Nuclear Information System (INIS)

    HIGGINS, J.C.; O'HARA, J.M.; LEWIS, P.M.; PERSENSKY, J.; BONGARRA, J.

    2002-01-01

    DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS. THE U.S. NUCLEAR REGULATORY COMMISSION (NRC) REVIEWS THE HUMAN FACTORS ASPECTS OF PROPOSED LICENSE AMENDMENTS THAT IMPACT HUMAN ACTIONS THAT ARE CREDITED IN A PLANTS SAFETY ANALYSIS. THE STAFF IS COMMITTED TO A GRADED APPROACH TO THESE REVIEWS THAT FOCUS RESOURCES ON THE MOST RISK IMPORTANT CHANGES. THEREFORE, A RISK INFORMED SCREENING METHOD WAS DEVELOPED BASED ON AN ADAPTATION OF EXISTING GUIDANCE FOR RISK INFORMED REGULATION AND HUMAN FACTORS. THE METHOD USES BOTH QUANTITATIVE AND QUALITATIVE INFORMATION TO DIVIDE THE AMENDMENT REQUESTS INTO DIFFERENT LEVELS OF REVIEW. THE METHOD WAS EVALUATED USING A VARIETY OF TESTS. THIS PAPER WILL SUMMARIZE THE DEVELOPMENT OF THE METHODOLOGY AND THE EVALUATIONS THAT WERE PERFORMED TO VERIFY ITS USEFULNESS

  4. A deep learning method for early screening of lung cancer

    Science.gov (United States)

    Zhang, Kunpeng; Jiang, Huiqin; Ma, Ling; Gao, Jianbo; Yang, Xiaopeng

    2018-04-01

    Lung cancer is the leading cause of cancer-related deaths among men. In this paper, we propose a pulmonary nodule detection method for early screening of lung cancer based on the improved AlexNet model. In order to maintain the same image quality as the existing B/S architecture PACS system, we convert the original CT image into JPEG format image by analyzing the DICOM file firstly. Secondly, in view of the large size and complex background of CT chest images, we design the convolution neural network on basis of AlexNet model and sparse convolution structure. At last we train our models on the software named DIGITS which is provided by NVIDIA. The main contribution of this paper is to apply the convolutional neural network for the early screening of lung cancer and improve the screening accuracy by combining the AlexNet model with the sparse convolution structure. We make a series of experiments on the chest CT images using the proposed method, of which the sensitivity and specificity indicates that the method presented in this paper can effectively improve the accuracy of early screening of lung cancer and it has certain clinical significance at the same time.

  5. A novel test tube method of screening for hemoglobin E.

    Science.gov (United States)

    Tatu, T; Kasinrerk, W

    2012-02-01

    Hemoglobin (Hb) E is a β-structural variant common worldwide. This Hb disorder can form a compound heterozygous state with the β-thalassemia gene, leading to life-threatening hereditary hemolytic anemia, HbE/β-thalassemia. Screening of HbE has proven to be a challenging practice in prevention and control of the HbE/β-thalassemia. A novel test tube method for HbE screening using diethyl aminoethyl (DEAE)-cellulose resin was described. With the developed system, HbE/A(2) did not bind to the resin and remained dissolved in the supernatant, whereas other Hbs completely bound to the resin. The red color of the supernatant observed in the test tube indicated the presence of HbE. Colorless or markedly pale color of the supernatant indicates the absence of HbE. Accuracy and efficiency of the established method in detecting HbE was comparable with the standard cellulose acetate electrophoresis method. The developed method is cheap and simple with no requirement of sophisticated equipment. The reagent could be stored at 4 °C for up to 5 months. Hemolysate samples aged up to 5 months were still suitable for this test. The described novel test tube method could be an alternative method of mass population screening for HbE, particularly in small health care facilities. © 2011 Blackwell Publishing Ltd.

  6. Evaluating two methods of digital photography in retinopathy screening

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-02-01

    Full Text Available AIM:To evaluate the advantages of non-mydriatic fundus photography(NMFCSand mydriatic fundus photography(MFCSas eye-bottom screening and diagnosis methods in compared with gold standard fluorescein fundus angiography(FFA. METHODS: A total of 276 patients which involved in Chronic Diabetes Management Achieves within 4 streets of Pudong District Shanghai, were enrolled for diabetic retinopathy(DRexamination including NMFCS, MFCS and FFA. These DR examinations were proceeded after vision, slit-lamp and dioptroscopy tests, and reported by professionals. For those with suspicious fundus diseases, we would make appointments with specialist for further treatment. RESULTS: A total of 1104 colorful fundus images, and 1056 images(95.65%could be used to analyze. There were 408 appreciable images, 116 basically appreciable images and 28 unusable images in 552 NMFCS images. In addition, there were 432 appreciable images, 100 basically appreciable images and 20 unusable images in 552 MFCS images. There was no significant differences between NMFCS and MFCS(P>0.05. Compared with FFA with DRⅠ as the critical value, the specificity of digital photography for NMFCS was 95.71%, the sensitivity was 93.56%; however, MFCS are 95.43% and 98.02%. There was no statistically significant difference between the two screening methods(P>0.05. Compared with FFA with DRⅡ as the critical value, the specificity of digital photography for NMFCS was 95.35% and the sensitivity was 93.44%; however, for MFCS were 95.81% and 98.36%. There was no statistically significant difference between the two screening methods(P>0.05. CONCLUSION: Both NMFCS and MFCS could be used for the diagnosis and screening for eye diseases. NMFCS is easier and faster for digital photography, which is suitable for mass screening. MFCS is more likely to provide detailed information about the follow-up of the disease.

  7. Automatic teleaudiometry: a low cost method to auditory screening

    Directory of Open Access Journals (Sweden)

    Campelo, Victor Eulálio Sousa

    2010-03-01

    Full Text Available Introduction: The auditory screening' benefits has been demonstrated, however these programs has been restricted to the big centers. Objectives: (a Developing a auditory screening method to distance; (b Testing its accuracy and comparing to the screening audiometry test (AV. Method: The teleaudiometry (TA, consists in a developed software, installed in a computer with phone TDH39. It was realized a study in series in 73 individuals between 17 and 50 years, being 57,%% of the female sex, they were randomly selected between patients and companions of the Hospital das Clínicas. Before were subjected to a symptom questionnaire and otoscopy, the individuals realized the tests of TA AV, with scanning in 20dB in the frequencies of 1,2 and 4kHz following the ASHA (1997 protocol and to the gold standard test of audiometry of pure tones in soundproof booth in aleatory order. Results: the TA has lasted average 125+11s and the AV 65+18s. 69 individuals (94,5% declaring to be found difficult or very easy to performing the TA and 61 (83,6% have considered easy or very easy the AV. The accuracy results of TA and AV were respectively: sensibility (86,7% / 86,7%, specificity (75,9%/ 72,4% and negative predictive value (95,7% / 95,5%, positive predictive value (48,1% / 55,2%. Conclusion: The teleaudiometry has showed a good option as an auditory screening method, presenting accuracy next to screening audiometry. In comparison with this method, the teleaudiometry has presented a similar sensibility, major specificity, negative predictive value and endurance time and, under positive predictive value.

  8. [Screening methods for mild cognitive impairment in primary care].

    Science.gov (United States)

    Freire Pérez, Alberto

    2017-06-01

    Diagnosis of mild cognitive impairment (MCI) is always clinical and screening methods only indicate that the patient has a higher risk of this condition. In MCI, there is a slight decline in some cognitive abilities that does not affect activities of daily living and therefore does not produce social or occupational disability. The definitive diagnosis of MCI requires a considerable time investment that is very rarely possible to provide in primary care (PC) consultations. Hence the need for PC physicians to employ rapid and simple screening methods (brief cognitive assessment -BCA-) that allow objective identification of patients likely to have MCI in a few minutes. This article reviews the BCA tools that can truly be applied in less than 10 minutes. The phototest is a brief screening tool that is easy to use and interpret by physicians and is well accepted by patients. Consequently, it is one of the most useful tests in PC for screening of both MCI and dementia. In addition to BCA, instrumental activities of daily living scales should also be applied to differentiate MCI from dementia. Copyright © 2017 Sociedad Española de Geriatría y Gerontología. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Intravenous DSA as a screening method for cerebral aneurysms

    International Nuclear Information System (INIS)

    Fukaya, Hiroyuki; Sunami, Kaneo; Hoshi, Seiichiro; Komiya, Hirokazu; Saeki, Naokatsu.

    1990-01-01

    Intravenous DSA (IVDSA) was evaluated as a screening method for cerebral aneurysms. It was performed 390 times in 372 cases. Clinically useful images were obtained in 94.1% in all examinations. Nineteen aneurysms were visualized in cerebral angiography among 21 cases with SAH or 3rd nerve palsy, whereas in IVDSA 15 aneurysms were noted. Aneurysms not visualized in IVDSA were all 4 mm or less in size. Therefore, aneurysms, more than 4 mm in size, which have higher risks for rupture, were detectable in IVDSA. Based on these findings, IVDSA is considered to be clinically useful in screening for aneurysms. In all 372 cases, 33 aneurysms were suspected in IVDSA findings, whereas in cerebral angiography 21 of them turned to be aneurysms. Such 12 false positive cases were distributed mainly at anterior communicating and middle cerebral arteries. Improvement of image resolution, avoidance of vessel overlapping and proper selection of screened cases should be investigated for further development of this screening method. (author)

  10. Modeling granular phosphor screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, Panagiotis F.; Kandarakis, Ioannis S.; Cavouras, Dionisis A.; Delis, Harry B.; Panayiotakis, George S.

    2006-01-01

    The intrinsic phosphor properties are of significant importance for the performance of phosphor screens used in medical imaging systems. In previous analytical-theoretical and Monte Carlo studies on granular phosphor materials, values of optical properties, and light interaction cross sections were found by fitting to experimental data. These values were then employed for the assessment of phosphor screen imaging performance. However, it was found that, depending on the experimental technique and fitting methodology, the optical parameters of a specific phosphor material varied within a wide range of values, i.e., variations of light scattering with respect to light absorption coefficients were often observed for the same phosphor material. In this study, x-ray and light transport within granular phosphor materials was studied by developing a computational model using Monte Carlo methods. The model was based on the intrinsic physical characteristics of the phosphor. Input values required to feed the model can be easily obtained from tabulated data. The complex refractive index was introduced and microscopic probabilities for light interactions were produced, using Mie scattering theory. Model validation was carried out by comparing model results on x-ray and light parameters (x-ray absorption, statistical fluctuations in the x-ray to light conversion process, number of emitted light photons, output light spatial distribution) with previous published experimental data on Gd 2 O 2 S:Tb phosphor material (Kodak Min-R screen). Results showed the dependence of the modulation transfer function (MTF) on phosphor grain size and material packing density. It was predicted that granular Gd 2 O 2 S:Tb screens of high packing density and small grain size may exhibit considerably better resolution and light emission properties than the conventional Gd 2 O 2 S:Tb screens, under similar conditions (x-ray incident energy, screen thickness)

  11. Simple Screening Methods for Drought and Heat Tolerance in Cowpea

    International Nuclear Information System (INIS)

    Singh, B. B.

    2000-10-01

    Success in breeding for drought tolerance has not been as pronounced as for other traits. This is partly due to lack of simple, cheap and reliable screening methods to select drought tolerant plants/progenies from the segregating populations and partly due to complexity of factors involved in drought tolerance. Measuring drought tolerance through physiological parameters is expensive, time consuming and difficult to use for screening large numbers of lines and segregating populations. Since several factors/mechanisms (in shoot and root) operate independently and/or jointly to enable plants to cope with drought stress, drought tolerance appears as a complex trait. However, if these factors/mechanisms can be separated and studied individually, the components leading to drought tolerance will appear less complex and may be easy to manipulate by breeders. We have developed a simple box screening method for shoot drought tolerance in cowpea, which eliminates the effects of roots and permits non-destructive visual identification of shoot dehydration tolerance. We have also developed a 'root-box pin-board' method to study two dimensional root architecture of individual plants. Using these methods, we have identified two mechanisms of shoot drought tolerance in cowpea which are controlled by single dominant genes and major difference for root architecture among cowpea varieties. Combining deep and dense root system with shoot dehydration tolerance results into highly drought tolerant plants

  12. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    -based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...... of cervical precancerous lesions with liquid-based cytology. Follow-up histology showed no increase of false positive tests, whilst the share of tests which were "unsatisfactory for evaluation" decreased significantly. Overall, the liquid-based technique would seem to have several advantages compared...

  13. Juvenile Justice

    OpenAIRE

    International Child Development Centre

    1998-01-01

    The third Innocenti Digest deals with the main issues connected with children and young people coming into conflict with the law and contact with the justice system. It looks at standards and problems from arrest through to the court hearing and sentencing, use of custodial measures and ways of avoiding the child’s unnecessary and counter-productive involvement with the formal justice system. It also covers prevention questions. Like previous publications in the series, it contains practical ...

  14. A novel accelerated oxidative stability screening method for pharmaceutical solids.

    Science.gov (United States)

    Zhu, Donghua Alan; Zhang, Geoff G Z; George, Karen L S T; Zhou, Deliang

    2011-08-01

    Despite the fact that oxidation is the second most frequent degradation pathway for pharmaceuticals, means of evaluating the oxidative stability of pharmaceutical solids, especially effective stress testing, are still lacking. This paper describes a novel experimental method for peroxide-mediated oxidative stress testing on pharmaceutical solids. The method utilizes urea-hydrogen peroxide, a molecular complex that undergoes solid-state decomposition and releases hydrogen peroxide vapor at elevated temperatures (e.g., 30°C), as a source of peroxide. The experimental setting for this method is simple, convenient, and can be operated routinely in most laboratories. The fundamental parameter of the system, that is, hydrogen peroxide vapor pressure, was determined using a modified spectrophotometric method. The feasibility and utility of the proposed method in solid form selection have been demonstrated using various solid forms of ephedrine. No degradation was detected for ephedrine hydrochloride after exposure to the hydrogen peroxide vapor for 2 weeks, whereas both anhydrate and hemihydrate free base forms degraded rapidly under the test conditions. In addition, both the anhydrate and the hemihydrate free base degraded faster when exposed to hydrogen peroxide vapor at 30°C under dry condition than at 30°C/75% relative humidity (RH). A new degradation product was also observed under the drier condition. The proposed method provides more relevant screening conditions for solid dosage forms, and is useful in selecting optimal solid form(s), determining potential degradation products, and formulation screening during development. Copyright © 2011 Wiley-Liss, Inc.

  15. Circling motion and screen edges as an alternative input method for on-screen target manipulation.

    Science.gov (United States)

    Ka, Hyun W; Simpson, Richard C

    2017-04-01

    To investigate a new alternative interaction method, called circling interface, for manipulating on-screen objects. To specify a target, the user makes a circling motion around the target. To specify a desired pointing command with the circling interface, each edge of the screen is used. The user selects a command before circling the target. To evaluate the circling interface, we conducted an experiment with 16 participants, comparing the performance on pointing tasks with different combinations of selection method (circling interface, physical mouse and dwelling interface) and input device (normal computer mouse, head pointer and joystick mouse emulator). A circling interface is compatible with many types of pointing devices, not requiring physical activation of mouse buttons, and is more efficient than dwell-clicking. Across all common pointing operations, the circling interface had a tendency to produce faster performance with a head-mounted mouse emulator than with a joystick mouse. The performance accuracy of the circling interface outperformed the dwelling interface. It was demonstrated that the circling interface has the potential as another alternative pointing method for selecting and manipulating objects in a graphical user interface. Implications for Rehabilitation A circling interface will improve clinical practice by providing an alternative pointing method that does not require physically activating mouse buttons and is more efficient than dwell-clicking. The Circling interface can also work with AAC devices.

  16. Trojan Horse Method: A tool to explore electron screening effect

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R G; Spitaleri, C; Cherubini, S; Cognata, M La; Lamia, L; Romano, S; Sergi, M L [Laboratori Nazionali del Sud-INFN, Catania (Italy) and Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Rolfs, C; Strieder, F [Ruhr Universitaet Bochum (Germany); Burjan, V; Kroha, V; Mrazek, J [Cyclotron Institute, Academy of Science, Rez (Czech Republic); Li, C; Wen, Q; Zhou, S [CIAE, Beijing (China); Tumino, A, E-mail: rgpizzone@lns.infn.i [Universita Kore, Erma (Italy)

    2010-01-01

    Owing the presence of the Coulomb barrier at astrophysically relevant energies, it is very difficult, or sometimes impossible to measure reaction rates for charged particle induced reactions. Moreover due to the presence of the electron screening effect in direct measurements, the relevant nuclear input for astrophysics, i.e. the bare nucleus S(E)-factor, can hardly be extracted. This is why different indirect techniques are being used along with direct measurements. The THM is an unique: indirect technique which allows one to measure reactions cross sections of astrophysical interest down the thermal energies typical of the different scenarios. The basic principle and a review of the main applications of the Trojan Horse Method are given. The applications aiming at the extraction of the bare S{sub b}(E) astrophysical factor and electron screening potentials U{sub e} for several two body processes are discussed.

  17. A Novel Environmental Justice Indicator for Managing Local Air Pollution.

    Science.gov (United States)

    Zhao, Jing; Gladson, Laura; Cromar, Kevin

    2018-06-14

    Environmental justice efforts in the United States seek to provide equal protection from environmental hazards, such as air pollution, to all groups, particularly among traditionally disadvantaged populations. To accomplish this objective, the U.S. EPA has previously required states to use an environmental justice screening tool as part of air quality planning decision-making. The generally utilized approach to assess potential areas of environmental justice concern relies on static comparisons of environmental and demographic information to identify areas where minority and low income populations experience elevated environmental exposures, but does not include any additional information that may inform the trade-offs that sub-populations of varying socio-demographic groups make when choosing where to reside in cities. In order to address this limitation, job accessibility (measured by a mobility index defining the number of jobs available within a set commuting time) was developed as a novel environmental justice indicator of environmental justice priority areas at the local level. This approach is modeled using real-world data in Allegheny County, PA (USA), and identifies areas with relatively high levels of outdoor air pollution and low access to jobs. While traditional tools tend to flag the poorest neighborhoods for environmental justice concerns, this new method offers a more refined analysis, targeting populations suffering from the highest environmental burden without the associated benefits of urban living.

  18. A Novel Environmental Justice Indicator for Managing Local Air Pollution

    Directory of Open Access Journals (Sweden)

    Jing Zhao

    2018-06-01

    Full Text Available Environmental justice efforts in the United States seek to provide equal protection from environmental hazards, such as air pollution, to all groups, particularly among traditionally disadvantaged populations. To accomplish this objective, the U.S. EPA has previously required states to use an environmental justice screening tool as part of air quality planning decision-making. The generally utilized approach to assess potential areas of environmental justice concern relies on static comparisons of environmental and demographic information to identify areas where minority and low income populations experience elevated environmental exposures, but does not include any additional information that may inform the trade-offs that sub-populations of varying socio-demographic groups make when choosing where to reside in cities. In order to address this limitation, job accessibility (measured by a mobility index defining the number of jobs available within a set commuting time was developed as a novel environmental justice indicator of environmental justice priority areas at the local level. This approach is modeled using real-world data in Allegheny County, PA (USA, and identifies areas with relatively high levels of outdoor air pollution and low access to jobs. While traditional tools tend to flag the poorest neighborhoods for environmental justice concerns, this new method offers a more refined analysis, targeting populations suffering from the highest environmental burden without the associated benefits of urban living.

  19. Screens

    OpenAIRE

    2016-01-01

    This Sixth volume in the series The Key Debates. Mutations and Appropriations in European Film Studies investigates the question of screens in the context both of the dematerialization due to digitalization and the multiplication of media screens. Scholars offer various infomations and theories of topics such as the archeology of screen, film and media theories, contemporary art, pragmatics of new ways of screening (from home video to street screening).

  20. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    International Nuclear Information System (INIS)

    Ravindra, M.K.; Banon, H.

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described

  1. Method for in vitro screening of aquatic fungicides

    Science.gov (United States)

    Bailey, T.A.

    1983-01-01

    Methods were developed for in vitro screening of candidate aquatic fungicides for efficacy against Achlya fiagellata, A. racemosa, Saprolegnia hypogyna and S. megasperma. Agar plugs containing fungal hyphae, removed from the edge of actively growing colonies, were placed in the depressions of spot plates containing 1a??0, 10a??0 and 100 mg/I of the candidate compounds for 15 or 60 min. After exposure, the plugs were transferred on to filter papers (0a??45-A?m pore) in a holder, rinsed, and then placed on cornmeal agar medium in tri-petri dishes. The plates were checked for mycelial growth after 48, 96 and 168 h of incubation in a lighted (400-800 A?m) environmental control chamber at 20A?2A?C. Criteria for the acceptance or rejection of candidate aquatic fungicides for further study were based on the antifungal spectrum index (ASI) comparisons between respective compounds and malachite green after 48 h and the concentration level producing complete growth inhibition. Candidate compounds whose ASI was less than 50% that of malachite green after 48 h or did not inhibit growth at levels less than 100 mg/l were rejected. This method provides a base from which in vivo and definitive test regimens can be developed. Preliminary in vitro screening of candidate fungicides reduces the need for costly in vivo tests on compounds that have low antifungal activity.

  2. The prevalence and screening methods of postpartum depression

    Directory of Open Access Journals (Sweden)

    Özgür Erdem

    2012-09-01

    Full Text Available Postpartum Depression is the most common complicationof the delivery and affects approximately 10%-15% ofwomen who had just gave birth. During a period in whichwomen believe that they should be happy, the depressivemood experienced by most women leads to feelings ofguilt, hiding the symptoms, and postpartum depressionto be overlooked. Although the incidence of serious psychiatricdisorders during pregnancy is low, it is reportedthat the incidence shows a dramatic increase during thepostpartum period and this risky period may continue upto six months, one year or even two years.As the onset of postpartum depression is insidious it caneasily be overlooked if the patient’s seeking help is notsupported, especially when the severity of postpartum depressionis mild or moderate. In these cases, postpartumdepression may persist for a long time and at last it can beso severe that hospitalization would be needed. Therefore,early diagnose is very important and primary carephysicians and other health care workers should be alert.Postpartum Depression should be diagnosed using reliabledescriptive methods in puerperant women. Thescales such as Postnatal Depression Screening Scale,Beck Depression Inventory, Edinburgh Postnatal DepressionScale and State-Trait Anxiety Inventory, all of whichwere tested for validity and reliability in our country can beused during follow-up of pregnant and puerperal women.Key words: Postpartum depression, screening methods,primary health care professionals

  3. Water Justice

    NARCIS (Netherlands)

    Boelens, R.A.; Perreault, T.; Vos, J.M.C.

    2018-01-01

    Water justice is becoming an ever-more pressing issue in times of increasing water-based inequalities and discrimination. Megacities, mining, forestry, industry and agribusiness claim an increasingly large share of available surface and groundwater reserves. Water grabbing and pollution generate

  4. Enviromental Justice (EJSCREEN) Block Group Data (USEPA)

    Data.gov (United States)

    U.S. Environmental Protection Agency — EJSCREEN is an environmental justice (EJ) screening and mapping tool that provides EPA with a nationally consistent dataset and methodology for calculating "EJ...

  5. Environmental Justice (EJSCREEN) Block Group Data (USEPA)

    Data.gov (United States)

    U.S. Environmental Protection Agency — EJSCREEN is an environmental justice (EJ) screening and mapping tool that provides EPA with a nationally consistent dataset and methodology for calculating "EJ...

  6. A Desktop Screen Sharing System based on Various Connection Methods

    Science.gov (United States)

    Negishi, Yuya; Kawaguchi, Nobuo

    Recently it became very common to use information devices such as PCs during presentations and discussions. In these situations, a need arises for techniques that allow a smooth switch of presenters without changing cables, or an easy screen sharing in case of remote videoconferences. In this paper, we propose a desktop screen sharing system that can be used for such purposes and situations. For that, we designed an automatic control of connections in the VNC system that can be operated remotely over the network. We also suggested an interface that assigns a role such as “Screen sender" or “Screen receiver" to each terminal. In the proposed system, while sharing a screen between multiple terminals, one can easily display and browse the screen without having to understand how the others are connected. We also implemented a “role card" using contactless IC card, where roles are assigned only by placing the card in the IC reader.

  7. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  8. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, Kyung Ha; Hwang, Il Soon; Lee, Na Young; Oh, Young Jin; Kim, Ji Hyun; Park, Jin Ho; Sohn, Chang Ho

    2008-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by direct current potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by ultrasound technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts

  9. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, K.H.; Hwang, I.S.; Lee, N.Y.; Oh, Y.J.; Park, J.H.; Sohn, C.H.

    2007-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted in its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by a Direct Current Potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by Ultrasonic Technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts. (author)

  10. A novel method for screening the glutathione transferase inhibitors

    Directory of Open Access Journals (Sweden)

    Węgrzyn Grzegorz

    2009-03-01

    Full Text Available Abstract Background Glutathione transferases (GSTs belong to the family of Phase II detoxification enzymes. GSTs catalyze the conjugation of glutathione to different endogenous and exogenous electrophilic compounds. Over-expression of GSTs was demonstrated in a number of different human cancer cells. It has been found that the resistance to many anticancer chemotherapeutics is directly correlated with the over-expression of GSTs. Therefore, it appears to be important to find new GST inhibitors to prevent the resistance of cells to anticancer drugs. In order to search for glutathione transferase (GST inhibitors, a novel method was designed. Results Our results showed that two fragments of GST, named F1 peptide (GYWKIKGLV and F2 peptide (KWRNKKFELGLEFPNL, can significantly inhibit the GST activity. When these two fragments were compared with several known potent GST inhibitors, the order of inhibition efficiency (measured in reactions with 2,4-dinitrochlorobenzene (CDNB and glutathione as substrates was determined as follows: tannic acid > cibacron blue > F2 peptide > hematin > F1 peptide > ethacrynic acid. Moreover, the F1 peptide appeared to be a noncompetitive inhibitor of the GST-catalyzed reaction, while the F2 peptide was determined as a competitive inhibitor of this reaction. Conclusion It appears that the F2 peptide can be used as a new potent specific GST inhibitor. It is proposed that the novel method, described in this report, might be useful for screening the inhibitors of not only GST but also other enzymes.

  11. Display methods of electronic patient record screens: patient privacy concerns.

    Science.gov (United States)

    Niimi, Yukari; Ota, Katsumasa

    2013-01-01

    To provide adequate care, medical professionals have to collect not only medical information but also information that may be related to private aspects of the patient's life. With patients' increasing awareness of information privacy, healthcare providers have to pay attention to the patients' right of privacy. This study aimed to clarify the requirements of the display method of electronic patient record (EPR) screens in consideration of both patients' information privacy concerns and health professionals' information needs. For this purpose, semi-structured group interviews were conducted of 78 medical professionals. They pointed out that partial concealment of information to meet patients' requests for privacy could result in challenges in (1) safety in healthcare, (2) information sharing, (3) collaboration, (4) hospital management, and (5) communication. They believed that EPRs should (1) meet the requirements of the therapeutic process, (2) have restricted access, (3) provide convenient access to necessary information, and (4) facilitate interprofessional collaboration. This study provides direction for the development of display methods that balance the sharing of vital information and protection of patient privacy.

  12. [Use of Plusoptix as a screening method for refractive ambliopia].

    Science.gov (United States)

    Bogdănici, T; Tone, Silvia; Miron, Mihaela; Boboc, Mihaela; Bogdănici, Camelia

    2012-01-01

    Highlighting the differences in the objective refraction using the Plusoptix AO9 comparing them with the refraction performed with TOPCON KR-8900 autorefractor. Prospective study for 3 months held in the Ophthalmology Clinic in Iasi, Hospital Sf. Spiridon on a total of 39 children (21 girls and 18 boys) with mean age of 10.61 +/- 5.67 years. Clinical parameters: sex, age, objective refraction obtained with Plusoptix and with autorefractor corrected visual acuity (with different methods depending on each patient age), ortoptic examination (strabic deviation, binocular vision), the presence of symetry/asymetry while measuring with Plusoptix. The results were statistically processed by F-TEST calculating the correlation coefficient, standard deviation, significance level (using the spherical equivalent of the obtained values). Age limits of the studied cases ranged between 2-23 years. Visual acuity of children who had cooperate was between 0.2-1 with correction, achieving best values on right eye than left eye. 8 cases (20.51%) had large differences between measurements made with Plusoptix and autorefractor, half of that (4 cases) had strabismus. Three of these cases were with small hypermetropia and one with small myopia (Plusoptix shows a lower value). In 2 cases occurred higher differences (about 2-2,5D) between the 2 measurements, in patients with average hypermetropia. Plusoptix refraction was not possible at high hypermetropia or high myopia. This type of determining objective refraction using Plusoptix is a useful method of screening for discovery of refractive errors that can cause refractive amblyopia in young children and in those cases with a difficult collaboration. Because there are differences betweeti this 2 methods, for children with refractive errors are recommended further exploration to determine the appropriate optical correction. Plusoptix is a limited method because it cannot detect the exact values in those cases with high hypermetropia or high

  13. Retributive and restorative justice.

    Science.gov (United States)

    Wenzel, Michael; Okimoto, Tyler G; Feather, Norman T; Platow, Michael J

    2008-10-01

    The emergence of restorative justice as an alternative model to Western, court-based criminal justice may have important implications for the psychology of justice. It is proposed that two different notions of justice affect responses to rule-breaking: restorative and retributive justice. Retributive justice essentially refers to the repair of justice through unilateral imposition of punishment, whereas restorative justice means the repair of justice through reaffirming a shared value-consensus in a bilateral process. Among the symbolic implications of transgressions, concerns about status and power are primarily related to retributive justice and concerns about shared values are primarily related to restorative justice. At the core of these processes, however, lies the parties' construal of their identity relation, specifically whether or not respondents perceive to share an identity with the offender. The specific case of intergroup transgressions is discussed, as are implications for future research on restoring a sense of justice after rule-breaking.

  14. Justice Is the Missing Link in One Health: Results of a Mixed Methods Study in an Urban City State.

    Directory of Open Access Journals (Sweden)

    Tamra Lysaght

    Full Text Available One Health (OH is an interdisciplinary collaborative approach to human and animal health that aims to break down conventional research and policy 'silos'. OH has been used to develop strategies for zoonotic Emerging Infectious Diseases (EID. However, the ethical case for OH as an alternative to more traditional public health approaches is largely absent from the discourse. To study the ethics of OH, we examined perceptions of the human health and ecological priorities for the management of zoonotic EID in the Southeast Asia country of Singapore.We conducted a mixed methods study using a modified Delphi technique with a panel of 32 opinion leaders and 11 semi-structured interviews with a sub-set of those experts in Singapore. Panellists rated concepts of OH and priorities for zoonotic EID preparedness planning using a series of scenarios developed through the study. Interview data were examined qualitatively using thematic analysis.We found that panellists agreed that OH is a cross-disciplinary collaboration among the veterinary, medical, and ecological sciences, as well as relevant government agencies encompassing animal, human, and environmental health. Although human health was often framed as the most important priority in zoonotic EID planning, our qualitative analysis suggested that consideration of non-human animal health and welfare was also important for an effective and ethical response. The panellists also suggested that effective pandemic planning demands regional leadership and investment from wealthier countries to better enable international cooperation.We argue that EID planning under an OH approach would benefit greatly from an ethical ecological framework that accounts for justice in human, animal, and environmental health.

  15. Justice Is the Missing Link in One Health: Results of a Mixed Methods Study in an Urban City State.

    Science.gov (United States)

    Lysaght, Tamra; Capps, Benjamin; Bailey, Michele; Bickford, David; Coker, Richard; Lederman, Zohar; Watson, Sangeetha; Tambyah, Paul Anantharajah

    2017-01-01

    One Health (OH) is an interdisciplinary collaborative approach to human and animal health that aims to break down conventional research and policy 'silos'. OH has been used to develop strategies for zoonotic Emerging Infectious Diseases (EID). However, the ethical case for OH as an alternative to more traditional public health approaches is largely absent from the discourse. To study the ethics of OH, we examined perceptions of the human health and ecological priorities for the management of zoonotic EID in the Southeast Asia country of Singapore. We conducted a mixed methods study using a modified Delphi technique with a panel of 32 opinion leaders and 11 semi-structured interviews with a sub-set of those experts in Singapore. Panellists rated concepts of OH and priorities for zoonotic EID preparedness planning using a series of scenarios developed through the study. Interview data were examined qualitatively using thematic analysis. We found that panellists agreed that OH is a cross-disciplinary collaboration among the veterinary, medical, and ecological sciences, as well as relevant government agencies encompassing animal, human, and environmental health. Although human health was often framed as the most important priority in zoonotic EID planning, our qualitative analysis suggested that consideration of non-human animal health and welfare was also important for an effective and ethical response. The panellists also suggested that effective pandemic planning demands regional leadership and investment from wealthier countries to better enable international cooperation. We argue that EID planning under an OH approach would benefit greatly from an ethical ecological framework that accounts for justice in human, animal, and environmental health.

  16. A screening method for cardiovascular active compounds in marine algae.

    Science.gov (United States)

    Agatonovic-Kustrin, S; Kustrin, E; Angove, M J; Morton, D W

    2018-05-18

    The interaction of bioactive compounds from ethanolic extracts of selected marine algae samples, separated on chromatographic plates, with nitric/nitrous acid was investigated. The nature of bioactive compounds in the marine algae extracts was characterised using UV absorption spectra before and after reaction with diluted nitric acid, and from the characteristic colour reaction after derivatization with anisaldehyde. It was found that diterpenes from Dictyota dichotoma, an edible brown algae, and sterols from green algae Caulerpa brachypus, bind nitric oxide and may act as a nitric oxide carrier. Although the carotenoid fucoxanthin, found in all brown marine algae also binds nitric oxide, the bonds between nitrogen and the fucoxanthin molecule are much stronger. Further studies are required to evaluate the effects of diterpenes from Dictyota dichotoma and sterols from green algae Caulerpa brachypus to see if they have beneficial cardiovascular effects. The method reported here should prove useful in screening large numbers of algae species for compounds with cardiovascular activity. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Rapid screening method for plutonium in mixed waste samples

    International Nuclear Information System (INIS)

    Somers, W.; Culp, T.; Miller, R.

    1987-01-01

    A waste stream sampling program was undertaken to determine those waste streams which contained hazardous constituents, and would therefore be regulated as a hazardous waste under the Resource Conservation and Recovery Act. The waste streams also had the potential of containing radioactive material, either plutonium, americium, or depleted uranium. Because of the potential for contamination with radioactive material, a method of rapidly screening the liquid samples for radioactive material was required. A counting technique was devised to count a small aliquot of a sample, determine plutonium concentration, and allow the sample to be shipped the same day they were collected. This technique utilized the low energy photons (x-rays) that accompany α decay. This direct, non-destructive x-ray analysis was applied to quantitatively determine Pu-239 concentrations in industrial samples. Samples contained a Pu-239, Am-241 mixture; the ratio and/or concentrations of these two radionuclides was not constant. A computer program was designed and implemented to calculate Pu-239 activity and concentration (g/ml) using the 59.5 keV Am-241 peak to determine Am-241's contribution to the 17 keV region. Am's contribution was subtracted, yielding net counts in the 17 keV region due to Pu. 2 figs., 1 tab

  18. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  19. Establishment of screening method for effective vaccination using radiolabelled probe

    International Nuclear Information System (INIS)

    Nomaguchi, Hiroko; Yogi, Yasuko

    1998-01-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/ + and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, γ-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce γ-IFN in response to IL-12 were extremely limited in the nude mouse. On the contrary, for IL-18, γ-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of γ-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  20. Establishment of screening method for effective vaccination using radiolabelled probe

    Energy Technology Data Exchange (ETDEWEB)

    Nomaguchi, Hiroko; Yogi, Yasuko [National Inst. of Infectious Deseases, Tokyo (Japan)

    1998-02-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/{sup +} and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, {gamma}-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce {gamma}-IFN in response to IL-12 were extremely limited in the nude mouse. On the contray, for IL-18, {gamma}-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of {gamma}-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  1. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  2. Challenging Perceptions of Academic Research as Bias Free: Promoting a Social Justice Framework in Social Work Research Methods Courses

    Science.gov (United States)

    Nicotera, Nicole; Walls, N. Eugene

    2010-01-01

    The required research courses in social work education are, perhaps, one of the more difficult content areas in which to infuse direct teaching and knowledge acquisition of multiculturalism. The study presented in this article examines the outcomes of systematically addressing social justice within a required master's level social work research…

  3. Achieving Child Friendly Justice through Child Friendly Methods: Let’s Start with the Right to Information

    Directory of Open Access Journals (Sweden)

    Helen Stalford

    2017-09-01

    Full Text Available Making the justice process ‘child friendly’ is a key priority for the children’s rights community. An abundance of commentary has been produced by the UN Committee on the Rights of the Child to highlight how justice proceedings can be made more accessible for children and, in 2010, the Council of Europe issued its comprehensive ‘Guidelines on Child Friendly Justice’. Despite these efforts, children remain ill-informed, not just about the nature of justice proceedings in which they may be implicated, but about the very existence and scope of their rights and how to enforce them. Despite unequivocal acknowledgement that the availability and accessibility of information is the crucial starting point in a children’s rights-based approach to dispensing justice, there has been surprisingly little attempt to scrutinise the availability, quality and accessibility of information about laws and policies affecting children. This article takes a closer look at what, exactly, ‘child friendly’ information means in practice. In doing so, we argue that attempts to develop child friendly information have yet to progress beyond adult-driven, largely tokenistic and superficial re-branding exercises. As such, efforts to develop child friendly resources are often of limited value in empowering young people to develop their legal literacy and realise their rights in practice. We reflect on our attempt to develop an explicitly children’s rights-based approach to the development of child friendly resources with a view to enhancing their purchase. This took place in the context of a pilot project, commissioned by the Council of Europe in June 2014, to create a child friendly version of their Child Friendly Justice Guidelines.

  4. Virtual screening methods as tools for drug lead discovery from large chemical libraries.

    Science.gov (United States)

    Ma, X H; Zhu, F; Liu, X; Shi, Z; Zhang, J X; Yang, S Y; Wei, Y Q; Chen, Y Z

    2012-01-01

    Virtual screening methods have been developed and explored as useful tools for searching drug lead compounds from chemical libraries, including large libraries that have become publically available. In this review, we discussed the new developments in exploring virtual screening methods for enhanced performance in searching large chemical libraries, their applications in screening libraries of ~ 1 million or more compounds in the last five years, the difficulties in their applications, and the strategies for further improving these methods.

  5. Evaluation of Screening Methods for the Detection of Urinary Tract ...

    African Journals Online (AJOL)

    2000-05-30

    screening testsfor urinary tract infection was donefrom March 20 to May 30, 2000. A cross sectional study ... the diagnosis of urinary tract infection on the basis of pyuria alone. The minimum number of ..... infection Complicating. Pregnancy J.

  6. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  7. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  8. 77 FR 4544 - CPSC Symposium on Phthalates Screening and Testing Methods

    Science.gov (United States)

    2012-01-30

    ... Screening and Testing Methods AGENCY: Consumer Product Safety Commission. ACTION: Notice. SUMMARY: The... symposium on phthalates screening and testing methods. The symposium will be held at the CPSC's National... submit comments, identified by Docket No. CPSC-2012-0008, by any of the following methods: Electronic...

  9. Barriers to Breast and Cervical Cancer Screening in Singapore: a Mixed Methods Analysis.

    Science.gov (United States)

    Malhotra, Chetna; Bilger, Marcel; Liu, Joy; Finkelstein, Eric

    2016-01-01

    In order to increase breast and cervical cancer screening uptake in Singapore, women's perceived barriers to screening need to be identified and overcome. Using data from both focus groups and surveys, we aimed to assess perceived barriers and motivations for breast and cervical cancer screening. We conducted 8 focus groups with 64 women, using thematic analysis to identify overarching themes related to women's attitudes towards screening. Based on recurring themes from focus groups, several hypotheses regarding potential barriers and motivations to screen were generated and tested through a national survey of 801 women aged 25-64. Focus group participants had misconceptions related to screening, believing that the procedures were painful. Cost was an issue, as well as efficacy and fatalism. By identifying barriers to and motivators for screening through a mixed-method design that has both nuance and external validity, this study offers valuable suggestions to policymakers to improve breast and cervical cancer screening uptake in Singapore.

  10. The Value Of Justice In Child Criminal Justice System A Review Of Indonesian Criminal Law

    Directory of Open Access Journals (Sweden)

    Andi Sofyan

    2015-08-01

    Full Text Available The value of justice in Act No. 11 of 2012 concerns the Child Criminal Justice System Act No. SPPA confirms the Restorative Justice Approach as a method of disputes resolution. The method of research used was normative-legal research with philosophical approach. The results showed that the value of restorative justice through diversion contained in Act SPPA but the diversion limit for certain types of criminal acts and threats of punishment under seven 7 years and not a repetition criminal recidivists. This indicates that Act SPPA still contained a retributive justice not promote the interests of protection for child.

  11. Development of thermal stress screening method. Application of green function method

    International Nuclear Information System (INIS)

    Furuhashi, Ichiro; Shibamoto, Hiroshi; Kasahara, Naoto

    2004-01-01

    This work was achieved for the development of the screening method of thermal transient stresses in FBR components. We proposed an approximation method for evaluations of thermal stress under variable heat transfer coefficients (non-linear problems) using the Green functions of thermal stresses with constant heat transfer coefficients (linear problems). Detailed thermal stress analyses provided Green functions for a skirt structure and a tube-sheet of Intermediate Heat Exchanger. The upper bound Green functions were obtained by the analyses using those upper bound heat transfer coefficients. The medium and the lower bound Green functions were got by the analyses of those under medium and the lower bound heat transfer coefficients. Conventional evaluations utilized the upper bound Green functions. On the other hand, we proposed a new evaluation method by using the upper bound, medium and the lower bound Green functions. The comparison of above results gave the results as follows. The conventional evaluations were conservative and appropriate for the cases under one fluid thermal transient structure such as the skirt. The conventional evaluations were generally conservative for the complicated structures under two or more fluids thermal transients such as the tube-sheet. But the danger locations could exists for the complicated structures under two or more fluids transients, namely the conventional evaluations were non-conservative. The proposed evaluations gave good estimations for these complicated structures. Though above results, we have made the basic documents of the screening method of thermal transient stresses using the conventional method and the new method. (author)

  12. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23)

    DEFF Research Database (Denmark)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe

    2018-01-01

    arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. ANALYSES: The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study......INTRODUCTION: The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could...... vaccination as girls. METHODS: Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme...

  13. Screening of Potential Remediation Methods for the 200-ZP-1 Operable Unit at the Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Truex, Michael J.; Nimmons, Michael J.; Johnson, Christian D.; Dresel, P EVAN.; Murray, Christopher J.

    2006-08-07

    A screening-level evaluation of potential remediation methods for application to the contaminants of concern (COC) in the 200-ZP-1 Operable Unit at the Hanford Site was conducted based on the methods outlined in the Guidance for Conducting Remedial Investigations and Feasibility Studies under CERCLA Interim Final. The scope of this screening was to identify the most promising remediation methods for use in the more detailed analysis of remediation alternatives that will be conducted as part of the full feasibility study. The screening evaluation was conducted for the primary COC (potential major risk drivers). COC with similar properties were grouped for the screening evaluation. The screening evaluation was conducted in two primary steps. The initial screening step evaluated potential remediation methods based on whether they can be effectively applied within the environmental setting of the 200-ZP-1 Operable Unit for the specified contaminants. In the second step, potential remediation methods were screened using scoping calculations to estimate the scale of infrastructure, overall quantities of reagents, and conceptual approach for applying the method for each defined grouping of COC. Based on these estimates, each method was screened with respect to effectiveness, implementability, and relative cost categories of the CERCLA feasibility study screening process defined in EPA guidance.

  14. A comparison of two psychological screening methods currently used for inpatients in a UK burns service.

    Science.gov (United States)

    Shepherd, Laura; Tew, Victoria; Rai, Lovedeep

    2017-12-01

    Various types of psychological screening are currently used in the UK to identify burn patients who are experiencing psychological distress and may need additional support and intervention during their hospital admission. This audit compared two types of psychological screening in 40 burn inpatients. One screening method was an unpublished questionnaire designed to explore multiple areas of potential distress for those who have experienced burns. The other method was an indirect psychological screen via discussions within multi-disciplinary team (MDT) meetings where a Clinical Psychologist was present to guide and prompt psychological discussions. Data was collected between November 2012 and September 2016. Results suggested that both screening methods were similar in identifying patients who benefit from more formal psychological assessment. Indeed, statistical analysis reported no difference between the two screening methods (N=40, p=.424, two-tailed). In conclusion, measuring distress in burns inpatients using a burns-specific questionnaire and psychological discussions within MDT meetings are similar in their ability to identify patients in need of more thorough psychological assessment. However, both screening methods identified patients who were in need of psychological input when the other did not. This suggests that psychological screening of burns inpatients, and the psychological difficulties that they can present with, is complex. The advantages and disadvantages of both methods of screening are discussed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  15. A new promising screening method for cognitive functioning in elderly patients

    NARCIS (Netherlands)

    Kuin, Y.; Nijsten, J.M.H.; Stok-Koch, E.G.H.J.; Jansen, R.W.M.M.

    1996-01-01

    The Mini Mental State Examination (MMSE) is frequently used as a screening method to detect cognitive dysfunctioning. However, the MMSE has limited sensitivity to detect mild impairment. We aimed to develop a new screening method to discriminate between normal and mild cognitive functioning in older

  16. MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD

    Science.gov (United States)

    2017-06-01

    MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD ECBC-TR...TITLE AND SUBTITLE Mass Spectrometry Proteomics Method as a Rapid Screening Tool for Bacterial Contamination of Food 5a. CONTRACT NUMBER 5b...the MSPM to correctly classify whether or not food samples were contaminated with Salmonella enterica serotype Newport in this blinded pilot study

  17. A simple method to estimate the episode and programme sensitivity of breast cancer screening programmes.

    Science.gov (United States)

    Zorzi, Manuel; Guzzinati, Stefano; Puliti, Donella; Paci, Eugenio

    2010-01-01

    The estimation of breast cancer screening sensitivity is a major aim in the quality assessment of screening programmes. The proportional incidence method for the estimation of the sensitivity of breast cancer screening programmes is rarely used to estimate the underlying incidence rates. We present a method to estimate episode and programme sensitivity of screening programmes, based solely on cancers detected within screening cycles (excluding breast cancer cases at prevalent screening round) and on the number of incident cases in the total target population (steady state). The assumptions, strengths and limitations of the method are discussed. An example of calculation of episode and programme sensitivities is given, on the basis of the data from the IMPACT study, a large observational study of breast cancer screening programmes in Italy. The programme sensitivity from the fifth year of screening onwards ranged between 41% and 48% of the total number of cases in the target population. At steady state episode sensitivity was 0.70, with a trend across age groups, with lowest values in women aged 50-54 years (0.52) and highest in those 65-69 (0.77). The method is a very serviceable tool for estimating sensitivity in service screening programmes, and the results are comparable with those of other methods of estimation.

  18. Three screening methods for cognitive dysfunction using the Mini-Mental State Examination and Korean Dementia Screening Questionnaire.

    Science.gov (United States)

    Choi, Seong Hye; Park, Moon Ho

    2016-02-01

    To screen for and determine cognitive dysfunction, cognitive tests and/or informant reports are commonly used. However, these cognitive tests and informant reports are not always available. The present study investigated three screening methods using the Mini-Mental State Examination (MMSE) as the cognitive test, and the Korean dementia screening questionnaire (KDSQ) as the informant report. Participants were recruited from the Korea Clinical Research Center for Dementia of South Korea, and included 2861 patients with Alzheimer's disease (dementia), 3519 patients with mild cognitive impairment and 1375 controls with no cognitive dysfunction. Three screening methods were tested: (i) MMSE alone (MMSE(cut-off) ); (ii) a conventional combination of MMSE and KDSQ (MMSE+KDSQ(cut-off) ); and (iii) a decision tree with MMSE and KDSQ (MMSE+KDSQ(decision tree) ). For discriminating any cognitive dysfunction from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.784). For discriminating dementia from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.899). For discriminating mild cognitive impairment from controls, MMSE(cut-off) had the highest area under the receiver operating characteristic curve (0.683). MMSE+KDSQ(decision tree) showed the highest sensitivity for all discriminations. For overall classification accuracy, MMSE+KDSQ(decision tree) had the highest value (70.0%). These three methods had different advantageous properties for screening and staging cognitive dysfunction. As there might be different availability across clinical settings, these three methods can be selected and used according to situational needs. © 2015 Japan Geriatrics Society.

  19. A method for calculating effective lifetime risk of radiation-induced cancer from screening mammography

    International Nuclear Information System (INIS)

    Ali, R.M.; England, A.; McEntee, M.F.; Hogg, P.

    2015-01-01

    Purpose: To propose a method for evaluating the effective lifetime risk of radiation-induced cancer from screening mammography and to present initial data for the UK National Breast Screening Programme. Material and methods: The imaging was undertaken using a Hologic Selenia full field digital mammographic unit. The proposed method utilises an ATOM phantom containing thermoluminescent dosimeters and a perspex-polyethylene breast phantom to measure organ doses during a standard four view screening mammogram. Effective dose was calculated and effective risk was modelled for a range of client ages. The total lifetime effective risk was then calculated for the UK national screening programme. Calculation of effective risk includes the radiation dose to examined and contralateral breasts in addition to other body organs; this is an advantage over the mean glandular dose. Results: The contralateral breast, thyroid, thymus, brain, lung, salivary glands, and bone marrow all receive more than 1 μGy radiation dose during screening mammography. A major difference exists for total effective lifetime risk of radiation-induced cancer between clients with average and high breast cancer risk. Differences are attributed to the commencement age of screening and time interval between screens. Conclusion: This study proposes a method to evaluate effective lifetime risk of radiation-induced cancer from screening mammography in order to compare different mammography screening programmes. - Highlights: • We proposed a method for the calculation of radiation-induced cancer from screening mammography. • We measured the radiation absorbed dose of different organs during screening mammography. • There are major differences between mammography screening programme categories with regard to radiation effective risk.

  20. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  1. Performance of machine learning methods for ligand-based virtual screening.

    Science.gov (United States)

    Plewczynski, Dariusz; Spieser, Stéphane A H; Koch, Uwe

    2009-05-01

    Computational screening of compound databases has become increasingly popular in pharmaceutical research. This review focuses on the evaluation of ligand-based virtual screening using active compounds as templates in the context of drug discovery. Ligand-based screening techniques are based on comparative molecular similarity analysis of compounds with known and unknown activity. We provide an overview of publications that have evaluated different machine learning methods, such as support vector machines, decision trees, ensemble methods such as boosting, bagging and random forests, clustering methods, neuronal networks, naïve Bayesian, data fusion methods and others.

  2. High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

    Science.gov (United States)

    Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

    2012-01-31

    An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

  3. Evaluation of Quantitative Environmental Stress Screening (ESS) Methods. Volume 1

    Science.gov (United States)

    1991-11-01

    required information on screening strength from the curvefitting parameters. The underlying theory and approach taken are discussed in Appendix A. To...in field 1020 arm St.,Vas AJ Ptr 0.4i Currpnt. c- ugt ~ing DU?/SYS 2.7264 Wll/IY.3 at Factory Stress- NaxiLMw outgoing W?is’ys 0.288 DrW/5?S at Field...182 125 K.W.Fertig and V.X. Murthy, Models for Reliability Growth During Burn-in: Theory and Applicat’ons,Proceedings 1978 Annual Reliability and

  4. Comparative analysis of machine learning methods in ligand-based virtual screening of large compound libraries.

    Science.gov (United States)

    Ma, Xiao H; Jia, Jia; Zhu, Feng; Xue, Ying; Li, Ze R; Chen, Yu Z

    2009-05-01

    Machine learning methods have been explored as ligand-based virtual screening tools for facilitating drug lead discovery. These methods predict compounds of specific pharmacodynamic, pharmacokinetic or toxicological properties based on their structure-derived structural and physicochemical properties. Increasing attention has been directed at these methods because of their capability in predicting compounds of diverse structures and complex structure-activity relationships without requiring the knowledge of target 3D structure. This article reviews current progresses in using machine learning methods for virtual screening of pharmacodynamically active compounds from large compound libraries, and analyzes and compares the reported performances of machine learning tools with those of structure-based and other ligand-based (such as pharmacophore and clustering) virtual screening methods. The feasibility to improve the performance of machine learning methods in screening large libraries is discussed.

  5. Time-resolved luminescence screening method for enrofloxacin in beef serum

    Science.gov (United States)

    Enrofloxacin is one of only two fluoroquinolone antibiotics approved for use in cattle in the U.S. Microbial screening methods currently used in the U.S. for monitoring veterinary drug residues are not sensitive or selective for fluoroquinolones. In this work, a luminescence-based screening assay ...

  6. Comparison of screening methods for anaemia in pregnant women in Awassa, Ethiopia

    NARCIS (Netherlands)

    Gies, S.; Brabin, B. J.; Yassin, M. A.; Cuevas, L. E.

    2003-01-01

    Screening for anaemia in pregnancy is essential for implementing and monitoring effective antenatal programmes. We compared the diagnostic accuracy of invasive and non-invasive screening methods in a cross-sectional survey of 403 pregnant women attending an urban health centre in Awassa, southern

  7. Optical method for the screening of doping substances

    Science.gov (United States)

    Lademann, J.; Shevtsova, J.; Patzelt, A.; Richter, H.; Gladkowa, N. D.; Gelikonov, V. M.; Gonchukov, S. A.; Sterry, W.; Blume-Peytavi, U.

    2008-12-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients.

  8. Optical method for the screening of doping substances

    International Nuclear Information System (INIS)

    Lademann, J; Patzelt, A; Richter, H; Sterry, W; Shevtsova, J; Gladkowa, N D; Gelikonov, V M; Gonchukov, S A; Blume-Peytavi, U

    2008-01-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients

  9. Method for screening inhibitors of the toxicity of Bacillus anthracis

    Science.gov (United States)

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  10. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Science.gov (United States)

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities), calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR) of 0.48 (Confidence Interval (CI) 0.38 – 0.58; X2: 72.227; p.value learning disabilities. Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities. PMID:18218106

  11. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman; Ba Alawi, Wail; Afeef, Moataz A.; Essack, Magbubah; Kalnis, Panos; Bajic, Vladimir B.

    2016-01-01

    Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods

  12. Justice and medical ethics.

    Science.gov (United States)

    Gillon, R

    1985-07-20

    Justice, in the sense of fair adjudication between conflicting claims, is held to be relevant to a wide range of issues in medical ethics. Several differing concepts of justice are briefly described, including Aristotle's formal principle of justice, libertarian theories, utilitarian theories, Marxist theories, the theory of John Rawls, and the view--held, for example, by W.D. Ross--that justice is essentially a matter of reward for individual merit.

  13. Method of evaluation of structural (screen) and quantum graininess of X-ray pictures

    Energy Technology Data Exchange (ETDEWEB)

    Gurvich, A M; Shamanov, A A; Erofeeva, N D [Nauchno-Issledovatel' skij Inst. Rentgenologii i Radiologii, Moscow (USSR)

    1979-03-01

    Proposed is a method for quantitative determination of graininess of X-ray pictures (gamma-ray images), the graininess being conditioned by the structure of amplifying screens and quantum fluctuations. The method is based on the determination of threshold brightness at which the picture graininess becomes obvious. It is shown that at low effective quantum energy (Esub(eff.) <= 50 keV) the graininess observed is for the most part structural (screen). Its growth is connected with quantum fluctuations when increasing Esub(eff.) up to 150 keV and using screens with high output values of X-ray luminescence and the coefficient of spectral accordance to the film.

  14. Development and evaluation of nursing user interface screens using multiple methods.

    Science.gov (United States)

    Hyun, Sookyung; Johnson, Stephen B; Stetson, Peter D; Bakken, Suzanne

    2009-12-01

    Building upon the foundation of the Structured Narrative Electronic Health Record (EHR) model, we applied theory-based (combined Technology Acceptance Model and Task-Technology Fit Model) and user-centered methods to explore nurses' perceptions of functional requirements for an electronic nursing documentation system, design user interface screens reflective of the nurses' perspectives, and assess nurses' perceptions of the usability of the prototype user interface screens. The methods resulted in user interface screens that were perceived to be easy to use, potentially useful, and well-matched to nursing documentation tasks associated with Nursing Admission Assessment, Blood Administration, and Nursing Discharge Summary. The methods applied in this research may serve as a guide for others wishing to implement user-centered processes to develop or extend EHR systems. In addition, some of the insights obtained in this study may be informative to the development of safe and efficient user interface screens for nursing document templates in EHRs.

  15. An efficient method for qualitative screening of phosphate-solubilizing bacteria.

    Science.gov (United States)

    Mehta, S; Nautiyal, C S

    2001-07-01

    An efficient protocol was developed for qualitative screening of phosphate-solubilizing bacteria, based upon visual observation. Our results indicate that, by using our formulation containing bromophenol blue, it is possible to quickly screen on a qualitative basis the phosphate-solubilizing bacteria. Qualitative analysis of the phosphate solubilized by various groups correlated well with grouping based upon quantitative analysis of bacteria isolated from soil, effect of carbon, nitrogen, salts, and phosphate solubilization-defective transposon mutants. However, unlike quantitative analysis methods that involve time-consuming biochemical procedures, the time for screening phosphate-solubilizing bacteria is significantly reduced by using our simple protocol. Therefore, it is envisaged that usage of this formulation based upon qualitative analysis will be salutary for the quick screening of phosphate-solubilizing bacteria. Our results indicate that the formulation can also be used as a quality control test for expeditiously screening the commercial bioinoculant preparations, based on phosphate solubilizers.

  16. Methods of quantification by means of spectroscopy of nuclear magnetic resonance and gas chromatography of the active principles of Justice pectoralis Jacq. Acanthaceae and Lippia alba (Mill.) N.E.Brownw ex Brit and Wils Verbenaceae

    International Nuclear Information System (INIS)

    Medina Lopez, Ligia de los Angeles

    2008-01-01

    The quality control of the vegetable material, presence and concentration of the active principles of Justice pectoralis and Lippia alba were studied for the use and marketing as herbal products. The method of analysis of the Justice pectoralis and Lippia alba was carried out by means of proton nuclear magnetic resonance spectroscopy and the gas chromatography. Coumarin and essential oils were determinate in the plants extracts. Different samples were collected throughout one year to evaluate the variation of concentration of the active principles of the plant and there was evaluated a method of extraction of solvents [es

  17. Analysis of the Possibilities for Discussing Questions of Global Justice in Geography Classes on the Use of Methods of Empirical Social Research When Analyzing the Teaching of Geography in Class

    Science.gov (United States)

    Applis, Stefan

    2015-01-01

    This study examines students' orientations with regard to questions on the implementation of justice in production structures of the global textile industry. The students worked with the Mystery Method from the Thinking Through Geography approach by David Leat and with Lawrence Kohlberg's Method of Dilemma Discussion. During this process, the…

  18. ECONOMIC EQUALITY OR JUSTICE

    Directory of Open Access Journals (Sweden)

    Ekrem Tufan

    2017-12-01

    Full Text Available From the beginning of economic life, equality has been a matter for human. Intrinsically human has two legs: Selfish and Groupish. Our selfish side does not care equality while Groupish side cares. What about the justice? Does human wants justice more than equalities in economic life? In this research, we have applied a questionnaire to find these two questions answer. As a result we can report that respondents prefer equality rather than justice in negative outcomes. On the other hand, they tend to prefer justice if there is possibility for positive outcomes. We cannot give evidence about gender, education and age differences effect on equality and justice preference.

  19. Mathematics education for social justice

    Science.gov (United States)

    Suhendra

    2016-02-01

    Mathematics often perceived as a difficult subject with many students failing to understand why they learn mathematics. This situation has been further aggravated by the teaching and learning processes used, which is mechanistic without considering students' needs. The learning of mathematics tends to be just a compulsory subject, in which all students have to attend its classes. Social justice framework facilitates individuals or groups as a whole and provides equitable approaches to achieving equitable outcomes by recognising disadvantage. Applying social justice principles in educational context is related to how the teachers treat their students, dictates that all students the right to equal treatment regardless of their background and completed with applying social justice issues integrated with the content of the subject in order to internalise the principles of social justice simultaneously the concepts of the subject. The study examined the usefulness of implementing the social justice framework as a means of improving the quality of mathematics teaching in Indonesia involved four teacher-participants and their mathematics classes. The study used action research as the research methodology in which the teachers implemented and evaluated their use of social justice framework in their teaching. The data were collected using multiple research methods while analysis and interpretation of the data were carried out throughout the study. The findings of the study indicated that there were a number of challengesrelated to the implementation of the social justice framework. The findings also indicated that, the teachers were provided with a comprehensive guide that they could draw on to make decisions about how they could improve their lessons. The interactions among students and between the teachers and the students improved, they became more involved in teaching and learning process. Using social justice framework helped the teachers to make mathematics more

  20. Potential Environmental Justice Areas - (EJSCREEN) Block Group Data

    Data.gov (United States)

    U.S. Environmental Protection Agency — These data are from EJSCREEN, an environmental justice (EJ) screening and mapping tool that provides EPA with a nationally consistent dataset and methodology for...

  1. Who Gets the Job? First-Generation College Students' Perceptions of Employer Screening Methods

    Science.gov (United States)

    Parks-Yancy, Rochelle; Cooley, Delonia

    2018-01-01

    What are first-generation college students' (FGCS) perspectives of employment screening methods? The authors investigate which methods FGCS believe are likely to cause an employer to extend a job offer and which methods yield the best pool of job applicants. Survey data were collected from undergraduate business majors. They were analyzed using…

  2. A simple method of screening for metabolic bone disease

    International Nuclear Information System (INIS)

    Broughton, R.B.K.; Evans, W.D.

    1982-01-01

    The purpose of this investigation was to find a simple method -to be used as an adjunct to the conventional bone scintigram- that could differentiate between decreased bone metabolism or mass, i.e., osteoporosis -normal bone- and the group of conditions of increased bone metabolism or mass namely, osteomalacia, renal osteodystrophy, hyperparathyroidism and Paget's disease. The Fogelman's method using the bone to soft tissue ratios from region of interest analysis at 4 hours post injection, was adopted. An initial experience in measuring a value for the count rate density in lumbar vertebrae at 1 hr post injection during conventional bone scintigraphy appears to give a clear indication of the overall rate of bone metabolism. The advantage over whole body retention methods is that the scan performed at the end of the metabolic study will reveal localized bone disease that may otherwise not be anticipated

  3. High throughput screening method for identification of new lipofection reagents.

    Science.gov (United States)

    Regelin, A E; Fernholz, E; Krug, H F; Massing, U

    2001-08-01

    Lipofection, the transfer of genetic material into cells by means of cationic lipids, is of growing interest for in vitro and in vivo approaches. In order to identify ideal lipofection reagents in a HTS, we have developed an automated lipofection method for the transfer of reporter genes into cells and for determination of the lipofection results. The method has specifically been designed and optimized for 96-well microtiter plates and can successfully be carried out by a pipetting robot with accessory equipment. It consists of two separate parts: (1) pretransfection (preparation of liposomes, formation of lipoplexes, and lipoplex transfer to the cells) and (2) posttransfection (determination of the reporter enzyme activity and the protein content of the transfected cells). Individual steps of the lipofection method were specifically optimized - for example, lipoplex formation and incubation time as well as cell lysis, cell cultivating, and the reporter gene assay. The HTS method facilitates characterization of the transfection properties (efficiency and cytotoxicity) of large numbers of (cationic) lipids in various adherent cell types.

  4. efficacy of screening methods used in breeding for black pod

    African Journals Online (AJOL)

    Administrator

    inoculation necessitates waiting until a tree bears pods before its level of resistance to black pod infection can be determined. These methods, therefore, do not offer a quick means of breeding for resistance. Consequently, tests at the seedling stage that provide information about pod resistance are earnestly needed to save ...

  5. METHOD FOR NUMERICAL MODELING OF UNSTEADY SEPARATED FLOW AROUND AIRFOILS MOVING CLOSE TO FLAT SCREEN

    Directory of Open Access Journals (Sweden)

    V. Pogrebnaya Tamara

    2017-01-01

    Full Text Available In this article an attempt is made to explain the nature of differences in measurements of forces and moments, which influence an aircraft at take-off and landing when testing on different types of stands. An algorithm for numerical simulation of unsteady separated flow around airfoil is given. The algorithm is based on the combination of discrete vortex method and turbulent boundary layer equations. An unsteady flow separation modeling has been used. At each interval vortex method was used to calculate the potential flow around airfoils located near a screen. Calculated pressures and velocities were then used in boundary layer calculations to determine flow separation points and separated vortex in- tensities. After that calculation were made to determine free vortex positions to next time step and the process was fulfilled for next time step. The proposed algorithm allows using numeric visualization to understand physical picture of flow around airfoil moving close to screen. Three different ways of flow modeling (mirror method, fixed or movable screens were tested. In each case the flow separation process, which determines pressure distribution over airfoil surface and influ- ences aerodynamic performance, was viewed. The results of the calculations showed that at low atitudes of airfoil over screen mirror method over predicts lift force compared with movable screen, while fixed screen under predicts it. The data obtained can be used when designing equipment for testing in wind tunnels.

  6. Pi sampling: a methodical and flexible approach to initial macromolecular crystallization screening

    International Nuclear Information System (INIS)

    Gorrec, Fabrice; Palmer, Colin M.; Lebon, Guillaume; Warne, Tony

    2011-01-01

    Pi sampling, derived from the incomplete factorial approach, is an effort to maximize the diversity of macromolecular crystallization conditions and to facilitate the preparation of 96-condition initial screens. The Pi sampling method is derived from the incomplete factorial approach to macromolecular crystallization screen design. The resulting ‘Pi screens’ have a modular distribution of a given set of up to 36 stock solutions. Maximally diverse conditions can be produced by taking into account the properties of the chemicals used in the formulation and the concentrations of the corresponding solutions. The Pi sampling method has been implemented in a web-based application that generates screen formulations and recipes. It is particularly adapted to screens consisting of 96 different conditions. The flexibility and efficiency of Pi sampling is demonstrated by the crystallization of soluble proteins and of an integral membrane-protein sample

  7. Methods for Factor Screening in Computer Simulation Experiments

    Science.gov (United States)

    1979-03-01

    of the dat-a In a-space, impacto the variable selection problem s ign if Lrast ly. S-arch-type variable selection methods include the all-po"sible...i.iv 41.1 ti * n wt- -iu’pt-v c C it st’vt’re mu It ico11 inear it v is pro-crtnt Lind. , ii;.qt4pai tlv * Iti’lt- c- j c. tic j icivnt, art, verv

  8. PATHOS: a quick screening method for assessing sexual addiction.

    Science.gov (United States)

    Johnson, Pennie; Cashwell, Craig S; Cress, Jim; Barber, Tim; Dunn, Mary Clayton

    2013-01-01

    Pastors may understand that sex addiction exists and are frequently faced with people who need non-clinical and clinical services for the addiction. However, the pastoral counselors have no quick reliable method of assessing them. The purpose of this article is to define sexual addiction and provide information about a tool called PATHOS that can be used in clinical and non-clinical settings to identify potential sex addicts.

  9. Studying Knowledge, Attitude and Behavior of Breast Cancer Screening Methods among Behshahr Dwelling Women

    Directory of Open Access Journals (Sweden)

    Abdolhasan Naghibi

    2013-09-01

    Full Text Available Background and purpose: Breast cancer is the most prevalent cancer among all widespread cancers worldwide. After lung cancer, breast cancer is the main cause of death among women. One of the best ways to detect this disease early is to do screening. This study has been done to analyze the knowledge, attitude, and behavior of women regarding the breast cancer screening methods. Materials & Methods: The study is of cross-sectional descriptive type. The participants were 500 Behshahr dwelling women above 20 years old selected based on cluster sampling. The instrument used was a 34-item questionnaire to investigate the knowledge, attitude, and behavior of the women. The data has been analyzed through inferential statistical methods. Results: The participants' age mean was 35.16. The average knowledge score of the disease and screening methods was 1.3 and 54.6. The average attitude score of was 82.5. Regarding behavior, 13.1 percent do regular self-examination, and 15.2 percent do regular clinical examination. 16.7 percent of women have one experience of doing mammography. In the present study, there was a significant relation among knowledge, attitude and behavior. Conclusion: Since the knowledge of women was at average level and the behavior of using the screening methods was weak, planning to enable and motivate women to use the screening methods is highly emphasized.

  10. Gastric Cancer Screening by Combined Determination of Serum Helicobacter pylori Antibody and Pepsinogen Concentrations: ABC Method for Gastric Cancer Screening.

    Science.gov (United States)

    Chen, Xian-Zhe; Huang, Cheng-Zhi; Hu, Wei-Xian; Liu, Ying; Yao, Xue-Qing

    2018-05-20

    Gastroscopy combined with gastric mucosa biopsies is currently regarded as a gold standard for diagnosis of gastric cancer. However, its application is restricted in clinical practice due to its invasive property. A new noninvasive population screening process combining the assay of anti-Helicobacter pylori antibody and serum pepsinogen (PG) (ABC method) is adopted to recognize the high-risk patients for further endoscopy examination, avoiding the unnecessary gastroscopy for most population and saving the cost consumption for mass screening annually. Nevertheless, controversies exist for the grouping of ABC method and the intervals of gastroscopy surveillance for each group. In this review, we summarized these popular concerned topics for providing useful references to the healthcare practitioner in clinical practice. The PubMed databases were systematically searched from the inception dates to November 22, 2017, using the keywords "Helicobacter pylori," "Pepsinogens," and "Stomach Neoplasms." Original articles and reviews on the topics were selected. Anti-H. pylori antibody and serum PG concentration showed significant changes under the different status of H. pylori infection and the progression of atrophic gastritis, which can be used for risk stratification of gastric cancer in clinic. In addition, anti-H. pylori antibody titer can be used for further risk stratification of gastric cancer contributing to determine better endoscopy surveillance interval. The early detection and diagnosis of gastric cancer benefit from the risk stratification, but the cutoff values for H. pylori antibody and serum PG concentration require further modification.

  11. Environmental justice and U.S. Forest Service hazardous fuels reduction: A spatial method for impact assessment of federal resource management actions

    Science.gov (United States)

    Mark D.O. Adams; Susan Charnley

    2018-01-01

    Natural resource managers of federal lands in the USA are often tasked with various forms of social and economic impact analysis. Federal agencies in the USA also have a mandate to analyze the potential environmental justice consequences of their activities. Relatively little is known about the environmental justice impacts of natural resource management in rural areas...

  12. Novel method for screening of enteric film coatings properties with magnetic resonance imaging.

    Science.gov (United States)

    Dorożyński, Przemysław; Jamróz, Witold; Niwiński, Krzysztof; Kurek, Mateusz; Węglarz, Władysław P; Jachowicz, Renata; Kulinowski, Piotr

    2013-11-18

    The aim of the study is to present the concept of novel method for fast screening of enteric coating compositions properties without the need of preparation of tablets batches for fluid bed coating. Proposed method involves evaluation of enteric coated model tablets in specially designed testing cell with application of MRI technique. The results obtained in the testing cell were compared with results of dissolution studies of mini-tablets coated in fluid bed apparatus. The method could be useful in early stage of formulation development for screening of film coating properties that will shorten and simplify the development works. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. A virtual screening method for inhibitory peptides of Angiotensin I-converting enzyme.

    Science.gov (United States)

    Wu, Hongxi; Liu, Yalan; Guo, Mingrong; Xie, Jingli; Jiang, XiaMin

    2014-09-01

    Natural small peptides from foods have been proven to be efficient inhibitors of Angiotensin I-converting enzyme (ACE) for the regulation of blood pressure. The traditional ACE inhibitory peptides screening method is both time consuming and money costing, to the contrary, virtual screening method by computation can break these limitations. We establish a virtual screening method to obtain ACE inhibitory peptides with the help of Libdock module of Discovery Studio 3.5 software. A significant relationship between Libdock score and experimental IC(50) was found, Libdock score = 10.063 log(1/IC(50)) + 68.08 (R(2) = 0.62). The credibility of the relationship was confirmed by testing the coincidence of the estimated log(1/IC(50)) and measured log(1/IC(50)) (IC(50) is 50% inhibitory concentration toward ACE, in μmol/L) of 5 synthetic ACE inhibitory peptides, which was virtual hydrolyzed and screened from a kind of seafood, Phascolosoma esculenta. Accordingly, Libdock method is a valid IC(50) estimation tool and virtual screening method for small ACE inhibitory peptides. © 2014 Institute of Food Technologists®

  14. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Directory of Open Access Journals (Sweden)

    Stanistreet Debbi

    2008-01-01

    Full Text Available Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities, calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR of 0.48 (Confidence Interval (CI 0.38 – 0.58; X2: 72.227; p.value X2: 24.236; p.value X2: 286.341; p.value Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities.

  15. Ionic Liquids for Absorption and Separation of Gases: An Extensive Database and a Systematic Screening Method

    DEFF Research Database (Denmark)

    Zhao, Yongsheng; Gani, Rafiqul; Afzal, Raja Muhammad

    2017-01-01

    requirements remains a challenging task. In this study, an extensive database of estimated Henry's law constants of twelve gases in more than ten thousand ILs at 313.15 K is established using the COSMO-RS method. Based on the database, a new systematic and efficient screening method for IL selection...

  16. Microbial screening methods for detection of antibiotic residues in slaughter animals

    NARCIS (Netherlands)

    Pikkemaat, M.G.

    2009-01-01

    Monitoring of food products from animal origin for the presence of antimicrobial residues is preferably done using microbial screening methods because of their high cost-effectiveness. Traditionally applied methods fail to detect the maximum residue limits which were established when EU Council

  17. Band structure engineering in van der Waals heterostructures via dielectric screening: the GΔW method

    DEFF Research Database (Denmark)

    Winther, Kirsten Trøstrup; Thygesen, Kristian Sommer

    2017-01-01

    precise magnitude is non-trivial to predict because of the non-local nature of the screening in quasi-2D crystals. Moreover, the effect is not captured by effective single-particle methods such as density functional theory. Here we present an efficient and general method for calculating the band gap...

  18. Comparison of a fluoroquinolone surface plasmon resonance biosensor screening assay with established methods

    NARCIS (Netherlands)

    Weigel, S.; Pikkemaat, M.G.; Elferink, J.W.A.; Mulder, P.P.J.; Huet, A.C.; Delahaut, P.; Schittko, S.; Flerus, R.; Nielen, M.W.F.

    2009-01-01

    The performance of a previously developed immunochemical biosensor screening method for fluoroquinolone (FQ) antibiotics in poultry muscle, fish and egg was compared with established methods. Blank sample material of the target matrices was individually spiked with the FQs at half maximum residue

  19. Screening of Plant Extracts for Antioxidant Activity: a Comparative Study on Three Testing Methods

    NARCIS (Netherlands)

    Koleva, I.; Beek, van T.A.; Linssen, J.P.H.; Groot, de Æ.; Evstatieva, L.N.

    2002-01-01

    Three methods widely employed in the evaluation of antioxidant activity, namely 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method, static headspace gas chromatography (HS-GC) and -carotene bleaching test (BCBT), have been compared with regard to their application in the screening of

  20. Application of EU guidelines for the validation of screening methods for veterinary drugs

    NARCIS (Netherlands)

    Stolker, A.A.M.

    2012-01-01

    Commission Decision (CD) 2002/657/EC describes detailed rules for method validation within the framework of residue monitoring programmes. The approach described in this CD is based on criteria. For (qualitative) screening methods, the most important criteria is that the CCß has to be below any

  1. Contemporary Transitional Justice

    DEFF Research Database (Denmark)

    Gissel, Line Engbo

    2017-01-01

    This article studies the contemporary expression of transitional justice, a field of practice through which global governance is exercised. It argues that transitional justice is being normalised, given the normative and empirical de-legitimisation of its premise of exceptionalism. The article...... theorises exceptionalism and normalcy in transitional justice and identifies three macro-level causes of normalisation: the legalisation, internationalisation, and professionalization of the field. This argument is illustrated by a study of Uganda’s trajectory of transitional justice since 1986. Across five...... phases of transitional justice, processes of legalisation, internationalisation, and professionalization have contributed to the gradual dismantling of the country’s exceptional justice. The case demonstrates, further, that normalization is a contested and incomplete process....

  2. Method for screening the Nevada Test Site and contiguous areas for nuclear waste repository locations

    International Nuclear Information System (INIS)

    Sinnock, S.; Fernandez, J.A.; Neal, J.T.; Stephens, H.P.; Hartway, B.L.; Los Alamos Technical Associates, Inc., NM)

    1982-01-01

    This paper outlines the general concepts of a technical method for systematic screening of the Nevada Test Site (NTS), Nye County, Nevada, for potentially suitable nuclear waste repository locations. After a general discussion of the organization and the purpose of the current screening activity, the paper addresses the steps of the screening method. These steps include: hierarchically organizing technical objectives for repository performance (an objectives tree); identifying and mapping pertinent physical characteristics of a site and its setting (physical attributes); relating the physical conditions to the objectives (favorability curves); identifying alternative locations and numerically evaluating their relative merits; investigating the effects of subjective judgments on the evaluations (sensitivity analyses); documenting the assumptions, logic, and results of the method. 19 references, 10 figures

  3. Psychology and criminal justice

    OpenAIRE

    Adler, Joanna R.

    2013-01-01

    This chapter is designed to give the reader a flavour of a few areas in which psychology has been applied to criminal justice. It begins by providing some historical context and showing the development of some applications of psychology to criminal justice. The chapter is broadly split into 3 sections: Pre Trial; Trial; and Post Trial. In most of this chapter, the areas considered assess how psychology has had an influence on the law and how psychologists work within criminal justice settings...

  4. Validity and cost-effectiveness of methods for screening of primary open angle glaucoma

    Directory of Open Access Journals (Sweden)

    Fröschl, Barbara

    2007-02-01

    Full Text Available Health political background: About 950,000 people are affected by glaucoma in Germany, about 50% of which are undiagnosed. The German Ophthalmological Society and the German Association of Ophthalmologists recommend a screening for glaucoma according to their guidelines. The Federal Joint Committee disapproved a glaucoma-screening program on expense of the compulsory health insurance in 2004. Scientific background: Primary open angle glaucoma is diagnosed by evaluation of the optic disc, the retinal fibre layer and the visual field. The main examinations are ophthalmoscopy, scanning laser polarimetry, confocal scanning laser ophthalmoscopy, retinal thickness analysis and optical coherence tomography. Scotomas are diagnosed by perimetry (standard automated perimetry, short wavelength automated perimetry and frequency doubling perimetry. The intraocular pressure is the most important treatable risk factor and is measured by (contact or non-contact tonometry. Research questions: The aim of this HTA-report is to investigate the diagnostic validity and cost effectiveness of diagnostic techniques or combinations of these methods with respect to the use in a screening setting in Germany. Methods: A systematic literature research was performed in 35 international databases and yielded 2602 articles. Overall 57 publications were included for assessment, according to predefined selection criteria. Results: The 55 medical articles deal mainly with frequency doubling perimetry, confocal scanning laser ophthalmoscopy and scanning laser polarimetry. Few articles cover short wavelength automated perimetry, tonometry and ophalmocopic evaluations by ophthalmologists. The quality of the papers is generally low, as far as the evidence in respect of screening is concerned. No single method exists with both, high sensitivity and high specificity for screening purpose. Data are also not sufficient to recommend combinations of methods. Only two economic models on cost

  5. Reverse screening methods to search for the protein targets of chemopreventive compounds

    Science.gov (United States)

    Huang, Hongbin; Zhang, Guigui; Zhou, Yuquan; Lin, Chenru; Chen, Suling; Lin, Yutong; Mai, Shangkang; Huang, Zunnan

    2018-05-01

    This article is a systematic review of reverse screening methods used to search for the protein targets of chemopreventive compounds or drugs. Typical chemopreventive compounds include components of traditional Chinese medicine, natural compounds and Food and Drug Administration (FDA)-approved drugs. Such compounds are somewhat selective but are predisposed to bind multiple protein targets distributed throughout diverse signaling pathways in human cells. In contrast to conventional virtual screening, which identifies the ligands of a targeted protein from a compound database, reverse screening is used to identify the potential targets or unintended targets of a given compound from a large number of receptors by examining their known ligands or crystal structures. This method, also known as in silico or computational target fishing, is highly valuable for discovering the target receptors of query molecules from terrestrial or marine natural products, exploring the molecular mechanisms of chemopreventive compounds, finding alternative indications of existing drugs by drug repositioning, and detecting adverse drug reactions and drug toxicity. Reverse screening can be divided into three major groups: shape screening, pharmacophore screening and reverse docking. Several large software packages, such as Schrödinger and Discovery Studio; typical software/network services such as ChemMapper, PharmMapper, idTarget and INVDOCK; and practical databases of known target ligands and receptor crystal structures, such as ChEMBL, BindingDB and the Protein Data Bank (PDB), are available for use in these computational methods. Different programs, online services and databases have different applications and constraints. Here, we conducted a systematic analysis and multilevel classification of the computational programs, online services and compound libraries available for shape screening, pharmacophore screening and reverse docking to enable non-specialist users to quickly learn and

  6. Screening methods for post-stroke visual impairment: a systematic review.

    Science.gov (United States)

    Hanna, Kerry Louise; Hepworth, Lauren Rachel; Rowe, Fiona

    2017-12-01

    assess all potential post-stroke visual impairments. The current tools screen for only a number of potential stroke-related impairments, which means many visual defects may be missed. The sensitivity of those which screen for all impairments is significantly lowered when patients are unable to report their visual symptoms. Future research is required to develop a tool capable of assessing stroke patients which encompasses all potential visual deficits and can also be easily performed by both the patients and administered by health care professionals in order to ensure all stroke survivors with visual impairment are accurately identified and managed. Implications for Rehabilitation Over 65% of stroke survivors will suffer from a visual impairment, whereas 45% of stroke units do not assess vision. Visual impairment significantly reduces the quality of life, such as being unable to return to work, driving and depression. This review outlines the available screening methods to accurately identify stroke survivors with visual impairments. Identifying visual impairment after stroke can aid general rehabilitation and thus, improve the quality of life for these patients.

  7. Proposal of Screening Method of Sleep Disordered Breathing Using Fiber Grating Vision Sensor

    Science.gov (United States)

    Aoki, Hirooki; Nakamura, Hidetoshi; Nakajima, Masato

    Every conventional respiration monitoring technique requires at least one sensor to be attached to the body of the subject during measurement, thereby imposing a sense of restraint that results in aversion against measurements that would last over consecutive days. To solve this problem, we developed a respiration monitoring system for sleepers, and it uses a fiber-grating vision sensor, which is a type of active image sensor to achieve non-contact respiration monitoring. In this paper, we verified the effectiveness of the system, and proposed screening method of the sleep disordered breathing. It was shown that our system could equivalently measure the respiration with thermistor and accelerograph. And, the respiratory condition of sleepers can be grasped by our screening method in one look, and it seems to be useful for the support of the screening of sleep disordered breathing.

  8. Concurrent Driving Method with Fast Scan Rate for Large Mutual Capacitance Touch Screens

    Directory of Open Access Journals (Sweden)

    Mohamed Gamal Ahmed Mohamed

    2015-01-01

    Full Text Available A novel touch screen control technique is introduced, which scans each frame in two steps of concurrent multichannel driving and differential sensing. The proposed technique substantially increases the scan rate and reduces the ambient noise effectively. It is also extended to a multichip architecture to support excessively large touch screens with great scan rate improvement. The proposed method has been implemented using 0.18 μm CMOS TowerJazz process and tested with FPGA and AFE board connecting a 23-inch touch screen. Experimental results show a scan rate improvement of up to 23.8 times and an SNR improvement of 24.6 dB over the conventional method.

  9. A new screening method for amphetamine and methamphetamine using dansyl chloride derivatization and cartridge fluorescence.

    Science.gov (United States)

    Yamada, H; Ikeda-Wada, S; Oguri, K

    1998-07-01

    A new screening method for amphetamines was developed. It consists of derivatization with dansyl chloride, extraction of the derivative using a Sep-Pak C18 or a Bond Elut C18, solid phase extraction columns, and visualization of the fluorescence of the cartridge. A control test using drug-free urine showed no fluorescence. Amphetamine, methamphetamine and the methylenedioxy derivatives exhibited strong fluorescence, while related compounds, such as N-ethylamphetamine and fenetylline, were negative or weakly positive. The disadvantage of the present method is that it is a multi-step procedure and 20-30 min is required for screening. However, since it has a different specificity from the widely used immunochemical technique, it is suggested to be a useful screen for amphetamines.

  10. Environmental assessment and social justice

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, B.M.; Sorensen, J.H. [Oak Ridge National Lab., TN (United States); Hardee, H. [Tennessee Univ., Knoxville, TN (United States)

    1995-03-01

    The purpose of this document is to describe an approach to assessing environmental justice issues at the start of proposed project. It is a structural approach to screening using readily available census data and commercial products that emphasizes the ability to replicate results and provide systematic data that can be used to identify spatial inequities. While our discussion of the methodology addresses only public health and safety issues related to certain minority and cohort sub-groups, systematic use of methodology could provide a valuable screening tool for identifying impacts particular to low-income groups. While the assumptions can be questioned as to applicability, they are based both on theory and practical knowledge.

  11. Current role of liquid chromatography coupled to mass spectrometry in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Fathi, Marc; Rudaz, Serge; Hochstrasser, Denis; Veuthey, Jean-Luc

    2011-07-01

    Abstract Toxicological screening is the analysis of a biological specimen to detect and identify compounds in patients admitted to the hospital with acute intoxication of unknown origin. The screening of a wide range of toxicologically relevant compounds in biological samples is a serious challenge for clinical laboratories. The high selectivity and sensitivity of liquid chromatography coupled to mass spectrometry or tandem mass spectrometry technology provides an attractive alternative to the current methods. For these reasons, an increasing number of applications for multi-target screening or general screening of unknown compounds in biological matrices are being published. This paper is an overview of sample clean-up, chromatographic separation and mass spectrometry detection procedures which can be combined to obtain screening methods adapted to the constraints and needs of various laboratories, and none specifically in clinical toxicology. Currently the techniques are in the hands of specialists, principally in academic institutes. However, the evolution in technology should allow application of the techniques as a tool in toxicology laboratories and thus more widespread exploitation of their potential.

  12. Restorative justice and victimology

    African Journals Online (AJOL)

    The growth of restorative justice has sparked debate over the future of the criminal justice system, which has historically adopted a retributive, punitive philosophy and advocated for an individualistic, treatment-orientated approach. This approach has over time failed to address the needs of crime victims, communities and.

  13. Military Justice Study Guide

    Science.gov (United States)

    1990-07-01

    statute within the military system, persons unfamiliar with the military justice system may find the procedure something of a paradox at first blush...Manual for Courts-Martial) Is RM Nemitafinuestlitimelf.(er- V. GRAD*: c. ORGANIZATION dDT FRPR ast eiRO t: fII) EPR LCDR/ Naval Justice School

  14. Justice as Europe's Signifier

    NARCIS (Netherlands)

    Roy, Suryapratim; Kochenov, Dimitry; de Burca, Grainne; Williams, Andrew

    2015-01-01

    Drawing on the fact that justice is never explained in European legal discourse, but is used in conjunction with other principles and institutional decisions, this contribution argues that justice is used as a rhetorical tool to provide legitimacy to such principles and decisions. An analogous

  15. Rapid in vivo screening method for the evaluation of new anti ...

    African Journals Online (AJOL)

    Rapid in vivo screening method for the evaluation of new anti helicobacter ... Six to eight week-old mice pre-treated (7 days) with Amoxicillin/Metronidazole (25 ... These findings were used as a mouse model of Helicobacter pylori infection to ...

  16. Development of automatic image analysis methods for high-throughput and high-content screening

    NARCIS (Netherlands)

    Di, Zi

    2013-01-01

    This thesis focuses on the development of image analysis methods for ultra-high content analysis of high-throughput screens where cellular phenotype responses to various genetic or chemical perturbations that are under investigation. Our primary goal is to deliver efficient and robust image analysis

  17. Estimation of effectiveness of interventions for malaria control in pregnancy using the screening method

    NARCIS (Netherlands)

    Msyamboza, K.; Senga, E.; Tetteh-Ashong, E.; Kazembe, P.; Brabin, B. J.

    2007-01-01

    BACKGROUND: The evaluation of the effectiveness of antimalarial drugs and bed net use in pregnant women is an important aspect of monitoring and surveillance of malaria control in pregnancy. In principle the screening method for assessing vaccine efficacy can be applied in non-vaccine settings for

  18. Validation of cervical cancer screening methods in HIV positive women from Johannesburg South Africa.

    Directory of Open Access Journals (Sweden)

    Cynthia Firnhaber

    Full Text Available HIV-infected women are at increased risk for developing cervical cancer. Women living in resource-limited countries are especially at risk due to poor access to cervical cancer screening and treatment. We evaluated three cervical cancer screening methods to detect cervical intraepithelial neoplasia grade 2 and above (CIN 2+ in HIV-infected women in South Africa; Pap smear, visual inspection with 5% acetic acid (VIA and human papillomavirus detection (HPV.HIV-infected women aged 18-65 were recruited in Johannesburg. A cross-sectional study evaluating three screening methods for the detection of the histologically-defined gold standard CIN-2 + was performed. Women were screened for cervical abnormalities with the Digene HC2 assay (HPV, Pap smear and VIA. VIA was performed by clinic nurses, digital photographs taken and then later reviewed by specialist physicians. The sensitivity, specificity and predictive valves for CIN-2 + were calculated using maximum likelihood estimators.1,202 HIV-infected women participated, with a median age of 38 years and CD4 counts of 394 cells/mm(3. One third of women had a high grade lesion on cytology. VIA and HPV were positive in 45% and 61% of women respectively. Estimated sensitivity/specificity for HPV, Pap smear and VIA for CIN 2+ was 92%/51.4%, 75.8%/83.4% and 65.4/68.5% (nurse reading, respectively. Sensitivities were similar, and specificities appeared significantly lower for the HPV test, cytology and VIA among women with CD4 counts ≤200 cells/mm(3 as compared to CD4 counts >350 cells/mm(3.Although HPV was the most sensitive screening method for detecting CIN 2+, it was less specific than conventional cytology and VIA with digital imaging review. Screening programs may need to be individualized in context of the resources and capacity in each area.

  19. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Science.gov (United States)

    Vaiman, Michael; Eviatar, Ephraim

    2009-01-01

    Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG) to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007) and EMBASE (1975–2007). Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles), the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water) are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia. PMID:19232090

  20. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    Directory of Open Access Journals (Sweden)

    Cristina Portalés

    2017-06-01

    Full Text Available The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, where a sample is shown for a virtual reality Formula 1 simulator that has a cylindrical screen. The proposed method results from the combination of surveying, photogrammetry and image processing approaches, and has been designed by considering the spatial restrictions of virtual reality simulators. The method has been validated from a mathematical point of view, and the complete system—which is currently installed in a shopping mall in Spain—has been tested by different users.

  1. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  2. Study on a noninvasive method for rapid screening Human Serum albumin injectables by Raman spectroscopy

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2017-01-01

    Full Text Available Human serum albumin (HSA injectable product is a severely afflicted area on drug safety due to its high price and restricted supply. Raman spectroscopy performances high specificity on HSA detection and it is even possible to determine HSA injectable products noninvasively. In this study, we developed a noninvasive rapid screening method for of HSA injectable products by using portable Raman spectrometer. Qualitative models were established by using principal component analysis combined with classical least squares (PCA-CLS algorithm, while quantitative model was established by using partial least squares (PLS algorithm. Model transfer in different instruments of both the same and different apparatus modules was further discussed in this paper. A total of 34 HSA injectable samples collected from markets were used for verification. The identification results showed 100% accuracy and the predicted concentrations of those identified as true HSA were consistent with their labeled concentrations. The quantitative results also indicated that model transfer was excellent in the same apparatus modules of Raman spectrometer at all concentration levels, and still good enough in the different apparatus modules although the relative standard deviation (RSD value showed a little increasing trend at low HSA concentration level. In conclusion, the method was proved to be feasible and efficient for screening HSA injections, especially on its screening speed and the consideration of glass containers. Moreover, with inspiring results on the model transfer, the method could be used as a universal screening mean to different Raman instruments.

  3. The effectiveness of scoliosis screening programs: methods for systematic review and expert panel recommendations formulation

    Science.gov (United States)

    2013-01-01

    Background Literature on scoliosis screening is vast, however because of the observational nature of available data and methodological flaws, data interpretation is often complex, leading to incomplete and sometimes, somewhat misleading conclusions. The need to propose a set of methods for critical appraisal of the literature about scoliosis screening, a comprehensive summary and rating of the available evidence appeared essential. Methods To address these gaps, the study aims were: i) To propose a framework for the assessment of published studies on scoliosis screening effectiveness; ii) To suggest specific questions to be answered on screening effectiveness instead of trying to reach a global position for or against the programs; iii) To contextualize the knowledge through expert panel consultation and meaningful recommendations. The general methodological approach proceeds through the following steps: Elaboration of the conceptual framework; Formulation of the review questions; Identification of the criteria for the review; Selection of the studies; Critical assessment of the studies; Results synthesis; Formulation and grading of recommendations in response to the questions. This plan follows at best GRADE Group (Grades of Recommendation, Assessment, Development and Evaluation) requirements for systematic reviews, assessing quality of evidence and grading the strength of recommendations. Conclusions In this article, the methods developed in support of this work are presented since they may be of some interest for similar reviews in scoliosis and orthopaedic fields. PMID:23883346

  4. Screening, sensitivity, and uncertainty for the CREAM method of Human Reliability Analysis

    International Nuclear Information System (INIS)

    Bedford, Tim; Bayley, Clare; Revie, Matthew

    2013-01-01

    This paper reports a sensitivity analysis of the Cognitive Reliability and Error Analysis Method for Human Reliability Analysis. We consider three different aspects: the difference between the outputs of the Basic and Extended methods, on the same HRA scenario; the variability in outputs through the choices made for common performance conditions (CPCs); and the variability in outputs through the assignment of choices for cognitive function failures (CFFs). We discuss the problem of interpreting categories when applying the method, compare its quantitative structure to that of first generation methods and discuss also how dependence is modelled with the approach. We show that the control mode intervals used in the Basic method are too narrow to be consistent with the Extended method. This motivates a new screening method that gives improved accuracy with respect to the Basic method, in the sense that (on average) halves the uncertainty associated with the Basic method. We make some observations on the design of a screening method that are generally applicable in Risk Analysis. Finally, we propose a new method of combining CPC weights with nominal probabilities so that the calculated probabilities are always in range (i.e. between 0 and 1), while satisfying sensible properties that are consistent with the overall CREAM method

  5. Development of methods for screening pesticide residues in plant matrices in Ghana

    International Nuclear Information System (INIS)

    Lowor, Samuel Tetteh

    1999-12-01

    TLC has been used in combination with micro-extraction and clean-up methods to provide an alternative cost effective analytical procedure for screening pesticide residues in plant matrices. Thirty-five (35) agrochemicals, which are used in priority crops in Ghana, were used in this study. Ethylacetate extraction in the presence of anhydrous sodium sulphate, followed by gel permeation chromatographic clean up and additional purification on silica gel cartridges provided clean extracts enabling the application of 300mg sample equivalent on the TLC plates. Detection method involving the use of O-tolidine was found to be suitable for general screening of residues, having medium sensitivity for several compounds. The method involving the use of silver nitrate was the only one found to be most suitable for detecting the organo chlorine pesticides. Lindane was the most sensitive to this reagent and had a Minimum Detectable Quantity (MDQ) value of 5ng/5 uL. This method was suitable for use on only alumina plates and detection was also possible even under sunlight. The enzyme inhibition methods were very sensitive to the carbamate and phosphoric acid type insecticides with MDQ values between 0.2 and 2000ng. Other detection methods involving p-nitrobenzene, p-dimethylaminobenzaldehyde and photosynthesis inhibition were also tried and discussed. The database developed has been successfully used for screening and semiquantitative determination of some ranges of pesticide residue in soil and plant matrices. (au)

  6. Cost and effectiveness comparison of two methods for screening potential blood donors for anaemia in Vietnam.

    Science.gov (United States)

    Tyrrell, A; Worrall, E; Que, T N; Bates, I

    2011-06-01

    To compare the cost and effectiveness of Copper Sulphate (CS) and HemoCue (HC) methods for screening blood donors for anaemia. Robust information from developing countries about cost and effectiveness of anaemia screening methods for blood donors is scarce. In such countries there are widespread shortages of blood, so the most cost-effective method should maximise blood supply without compromising donor safety. Economic data (e.g. staff time, equipment and buildings) were collected from direct observation of procedures and purchase data from Hanoi's Central Blood Bank administrative department. A framework for comparing the cost and effectiveness of anaemia screening methods was developed and a cost per effective (i.e. usable and accurate) test was generated for each method. Samples from 100 potential donors from the Hanoi Central Blood Bank (static) and 198 from two mobile units were tested. The mean probability of an ineffective anaemia test was 0·1 (0·05-0·2). The average cost of an HC test was $0·75 (static $0·61 and mobile $0·89) and a CS test was $0·31 (static $0·17 and mobile $0·45). The difference between static and mobile units was predominantly due to transport costs; the difference between the two methods was predominantly due to the HC microcuvettes. In this setting the CS yields greater value for money than the HC method for screening blood donors. The relative cost and effectiveness of CS and HC may be different in places with higher staff turnover, lower test accuracy, higher anaemia prevalence or lower workload than in Vietnam. © 2010 Liverpool School of Tropical Medicine. Transfusion Medicine © 2010 British Blood Transfusion Society.

  7. A sensitive immunoblotting method for screening of microalbuminuria in diabetic patient's urine

    International Nuclear Information System (INIS)

    Abdolkhaleg, D.; Behrooz, S.

    2005-01-01

    Urinary albumin excretion is a useful marker in the prognosis of diabetic nephropathy and microvascular diseases. Methods such as enzyme linked immunosorbent assay (ELISA), radio immunoassay(RIA), radial immunodiffusion, albu screen, micro bumin and micral test are usually used for detection and screening of microalbuminuria in these patients. With consideration to the cost of an assay, methods such as ELISA and RIA are not suitable methods for screening purpose. Therefore, the aim of this work is to set a dot immunoblotting method for the measurement and screening of microalbumin in urine samples. The study was conducted during the period August 2001 to June 2003 at the National Research Center for Genetic Engineering and Biotechnology (NRCGEB) and Pars Hospital Laboratory of Tehran, Iran on 96 diabetic patients urine samples. First, anti human albumin antibodies (Abs) were produced in rabbit and immunoglobulin G (IgG) fraction was purified by protein-A affinity chromatography. Titer of Abs and optimum incubation conditions were tested by direct ELISA. Then different concentration of human albumin (0-300 mg/l) was loaded to nitrocellulose membranes and was assayed by dot immunoblotting method. The specificity and cross reactivity of Abs was tested by SDS-PAGE electrophoresis and western immunoblotting. The sensitivity of the method was calculated from human albumin calibration curve and compared with commercial immunoturbidimetric assays. Our results indicates that in using IgG with the concentrations 0.5-1 ug/ml (2 x 10-5 to 10-4 dilutions) the intensity of color directly increased with the increase of human albumin standards in blots. Western immunoblotting of urine samples did not show any cross reactivity with other urine proteins. Comparison of results of this method by commercial immunoturbidimetric methods indicates the correlation regression of approximately 0.979. The sensitivity of the method was approximately 5 mg/L of human albumin. This simple

  8. A new screening method to identify inhibitors of the Lol (localization of lipoproteins) system, a novel antibacterial target.

    Science.gov (United States)

    Ito, Hideaki; Ura, Atsushi; Oyamada, Yoshihiro; Yoshida, Hiroaki; Yamagishi, Jun-Ichi; Narita, Shin-Ichiro; Matsuyama, Shin-Ichi; Tokuda, Hajime

    2007-01-01

    As the Lol system, which is involved in localization of lipoproteins, is essential for Escherichia coli growth and widely conserved among gram-negative bacteria, it is considered to be a promising target for the development of anti-gram-negative bacterial agents. However, no high-throughput screening method has so far been developed to screen for Lol system inhibitors. By combining three assay systems (anucleate cell blue assay, Lpp assay, and LolA-dependent release inhibition assay) and a drug susceptibility test, we have successfully developed a new screening method for identification of compounds that inhibit the Lol system. Using this new screening method, we screened 23,600 in-house chemical compounds and found 2 Lol system inhibitors. We therefore conclude that our new screening method can efficiently identify new antibacterial agents that target the Lol system.

  9. A method to screen obstructive sleep apnea using multi-variable non-intrusive measurements

    International Nuclear Information System (INIS)

    De Silva, S; Abeyratne, U R; Hukins, C

    2011-01-01

    Obstructive sleep apnea (OSA) is a serious sleep disorder. The current standard OSA diagnosis method is polysomnography (PSG) testing. PSG requires an overnight hospital stay while physically connected to 10–15 channels of measurement. PSG is expensive, inconvenient and requires the extensive involvement of a sleep technologist. As such, it is not suitable for community screening. OSA is a widespread disease and more than 80% of sufferers remain undiagnosed. Simplified, unattended and cheap OSA screening methods are urgently needed. Snoring is commonly associated with OSA but is not fully utilized in clinical diagnosis. Snoring contains pseudo-periodic packets of energy that produce characteristic vibrating sounds familiar to humans. In this paper, we propose a multi-feature vector that represents pitch information, formant information, a measure of periodic structure existence in snore episodes and the neck circumference of the subject to characterize OSA condition. Snore features were estimated from snore signals recorded in a sleep laboratory. The multi-feature vector was applied to a neural network for OSA/non-OSA classification and K-fold cross-validated using a random sub-sampling technique. We also propose a simple method to remove a specific class of background interference. Our method resulted in a sensitivity of 91 ± 6% and a specificity of 89 ± 5% for test data for AHI THRESHOLD = 15 for a database consisting of 51 subjects. This method has the potential as a non-intrusive, unattended technique to screen OSA using snore sound as the primary signal

  10. Rapid screening of guar gum using portable Raman spectral identification methods.

    Science.gov (United States)

    Srivastava, Hirsch K; Wolfgang, Steven; Rodriguez, Jason D

    2016-01-25

    Guar gum is a well-known inactive ingredient (excipient) used in a variety of oral pharmaceutical dosage forms as a thickener and stabilizer of suspensions and as a binder of powders. It is also widely used as a food ingredient in which case alternatives with similar properties, including chemically similar gums, are readily available. Recent supply shortages and price fluctuations have caused guar gum to come under increasing scrutiny for possible adulteration by substitution of cheaper alternatives. One way that the U.S. FDA is attempting to screen pharmaceutical ingredients at risk for adulteration or substitution is through field-deployable spectroscopic screening. Here we report a comprehensive approach to evaluate two field-deployable Raman methods--spectral correlation and principal component analysis--to differentiate guar gum from other gums. We report a comparison of the sensitivity of the spectroscopic screening methods with current compendial identification tests. The ability of the spectroscopic methods to perform unambiguous identification of guar gum compared to other gums makes them an enhanced surveillance alternative to the current compendial identification tests, which are largely subjective in nature. Our findings indicate that Raman spectral identification methods perform better than compendial identification methods and are able to distinguish guar gum from other gums with 100% accuracy for samples tested by spectral correlation and principal component analysis. Published by Elsevier B.V.

  11. Abdominal ultrasound-scanning versus non-contrast computed tomography as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Liisberg, Mads; Diederichsen, Axel C.; Lindholt, Jes S.

    2017-01-01

    Background: Validating non-contrast-enhanced computed tomography (nCT) compared to ultrasound sonography (US) as screening method for abdominal aortic aneurysm (AAA) screening. Methods: Consecutively attending men (n = 566) from the pilot study of the randomized Danish CardioVascular Screening......CT seems superior to US concerning sensitivity, and is able to detect aneurysmal lesions not detectable with US. Finally, the prevalence of AAA in Denmark seems to remain relatively high, in this small pilot study group....

  12. SCREENING METHODS FOR SELECTION OF SURFACTANT FORMULATIONS FOR IOR FROM FRACTURED CARBONATE RESERVOIRS

    Energy Technology Data Exchange (ETDEWEB)

    William A. Goddard III; Yongchun Tang; Patrick Shuler; Mario Blanco; Yongfu Wu; Seung Soon Jang

    2005-07-01

    This topical report presents details of the laboratory work performed to complete Task 1 of this project; developing rapid screening methods to assess surfactant performance for IOR (Improved Oil Recovery) from fractured carbonate reservoirs. The desired outcome is to identify surfactant formulations that increase the rate and amount of aqueous phase imbibition into oil-rich, oil-wet carbonate reservoir rock. Changing the wettability from oil-wet to water-wet is one key to enhancing this water-phase imbibition process that in turn recovers additional oil from the matrix portion of a carbonate reservoir. The common laboratory test to evaluate candidate surfactant formulations is to measure directly the aqueous imbibition rate and oil recovery from small outcrop or reservoir cores, but this procedure typically requires several weeks. Two methods are presented here for the rapid screening of candidate surfactant formulations for their potential IOR performance in carbonate reservoirs. One promising surfactant screening protocol is based on the ability of a surfactant solution to remove aged crude oil that coats a clear calcite crystal (Iceland Spar). Good surfactant candidate solutions remove the most oil the quickest from the chips, plus change the apparent contact angle of the remaining oil droplets on the surface that thereby indicate increased water-wetting. The other fast surfactant screening method is based on the flotation behavior of powdered calcite in water. In this test protocol, first the calcite power is pre-treated to make the surface oil-wet. The next step is to add the pre-treated powder to a test tube and add a candidate aqueous surfactant formulation; the greater the percentage of the calcite that now sinks to the bottom rather than floats, the more effective the surfactant is in changing the solids to become now preferentially water-wet. Results from the screening test generally are consistent with surfactant performance reported in the literature.

  13. Crippling Sexual Justice

    DEFF Research Database (Denmark)

    Stormhøj, Christel

    2015-01-01

    Exploring homosexuals' citizenship in Denmark from a justice perspective, this article critically interrogates society's supposed gay-friendliness by asking how far it has moved in achieving sexual justice, and inquiring into the gains and pains of the existing modes of achieving this end...... and representation within family law, civil society, and in the labour market. In conclusion, I suggest the possibility of different evaluations of the level of sexual justice reached, a mainly positive, partially negative one. Additionally, I discuss the gains and pains of the existing normalizing politics....

  14. Real-time and online screening method for materials emitting volatile organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Changhyuk [University of Minnesota, Department of Mechanical Engineering (United States); Sul, Yong Tae [Hoseo University (Korea, Republic of); Pui, David Y. H., E-mail: dyhpui@umn.edu [University of Minnesota, Department of Mechanical Engineering (United States)

    2016-09-15

    In the semiconductor industry, volatile organic compounds (VOCs) in the cleanroom air work as airborne molecular contamination, which reduce the production yield of semiconductor chips by forming nanoparticles and haze on silicon wafers and photomasks under ultraviolet irradiation during photolithography processes. Even though VOCs in outdoor air are removed by gas filters, VOCs can be emitted from many kinds of materials used in cleanrooms, such as organic solvents and construction materials (e.g., adhesives, flame retardants and sealants), threatening the production of semiconductors. Therefore, finding new replacements that emit lower VOCs is now essential in the semiconductor industry. In this study, we developed a real-time and online method to screen materials for developing the replacements by converting VOCs into nanoparticles under soft X-ray irradiation. This screening method was applied to measure VOCs emitted from different kinds of organic solvents and adhesives. Our results showed good repeatability and high sensitivity for VOCs, which come from aromatic compounds, some alcohols and all tested adhesives (Super glue and cleanroom-use adhesives). In addition, the overall trend of measured VOCs from cleanroom-use adhesives was well matched with those measured by a commercial thermal desorption–gas chromatography–mass spectrometry, which is a widely used off-line method for analyzing VOCs. Based on the results, this screening method can help accelerate the developing process for reducing VOCs in cleanrooms.

  15. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    Energy Technology Data Exchange (ETDEWEB)

    Li, Juan, E-mail: lijuan@craes.org.cn [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Yang, Yang [College of Environment, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Huan, Huan; Li, Mingxiao [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Xi, Beidou, E-mail: xibd413@yeah.net [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Lanzhou Jiaotong University, Lanzhou 730070 (China); Lv, Ningqing [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Wu, Yi [Guizhou Academy of Environmental Science and Designing, Guizhou 550000 (China); Xie, Yiwen, E-mail: qin3201@126.com [School of Chemical and Environmental Engineering, Dongguan University of Technology, Dongguan, 523808 (China); Li, Xiang; Yang, Jinjin [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China)

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  16. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    International Nuclear Information System (INIS)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-01-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  17. HIGH THROUGHPUT SCREENING METHOD AND APPARATUS FOR ANALYSING INTERACTIONS BETWEEN SURFACES WITH DIFFERENT TOPOGRAPHY AND THE ENVIRONMENT

    NARCIS (Netherlands)

    de Boer, Jan; van Blitterswijk, Clemens; Unadkat, H.V.; Stamatialis, Dimitrios; Papenburg, B.J.; Wessling, Matthias

    2009-01-01

    The invention is directed to a high throughput screening method for analysing and interaction between a surface of a material and an environment. The screening method of the invention comprises: providing a micro-array comprising said material and having a multitude of units at least part of which

  18. Optimal Methods to Screen Men and Women for Intimate Partner Violence: Results from an Internal Medicine Residency Continuity Clinic

    Science.gov (United States)

    Kapur, Nitin A.; Windish, Donna M.

    2011-01-01

    Contradictory data exist regarding optimal methods and instruments for intimate partner violence (IPV) screening in primary care settings. The purpose of this study was to determine the optimal method and screening instrument for IPV among men and women in a primary-care resident clinic. We conducted a cross-sectional study at an urban, academic,…

  19. A novel two-step method for screening shade tolerant mutant plants via dwarfism

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-10-01

    Full Text Available When subjected to shade, plants undergo rapid shoot elongation, which often makes them more prone to disease and mechanical damage. Shade-tolerant plants can be difficult to breed; however, they offer a substantial benefit over other varieties in low-light areas. Although perennial ryegrass (Lolium perenne L. is a popular species of turf grasses because of their good appearance and fast establishment, the plant normally does not perform well under shade conditions. It has been reported that, in turfgrass, induced dwarfism can enhance shade tolerance. Here we describe a two-step procedure for isolating shade tolerant mutants of perennial ryegrass by first screening for dominant dwarf mutants, and then screening dwarf plants for shade tolerance. The two-step screening process to isolate shade tolerant mutants can be done efficiently with limited space at early seedling stages, which enables quick and efficient isolation of shade tolerant mutants, and thus facilitates development of shade tolerant new cultivars of turfgrasses. Using the method, we isolated 136 dwarf mutants from 300,000 mutagenized seeds, with 65 being shade tolerant (0.022%. When screened directly for shade tolerance, we recovered only four mutants from a population of 150,000 (0.003% mutagenized seeds. One shade tolerant mutant, shadow-1, was characterized in detail. In addition to dwarfism, shadow-1 and its sexual progeny displayed high degrees of tolerance to both natural and artificial shade. We showed that endogenous gibberellin (GA content in shadow-1 was higher than wild-type controls, and shadow-1 was also partially GA insensitive. Our novel, simple and effective two-step screening method should be applicable to breeding shade tolerant cultivars of turfgrasses, ground covers, and other economically important crop plants that can be used under canopies of existing vegetation to increase productivity per unit area of land.

  20. Using stable isotopes to monitor forms of sulfur during desulfurization processes: A quick screening method

    Science.gov (United States)

    Liu, Chao-Li; Hackley, Keith C.; Coleman, D.D.; Kruse, C.W.

    1987-01-01

    A method using stable isotope ratio analysis to monitor the reactivity of sulfur forms in coal during thermal and chemical desulfurization processes has been developed at the Illinois State Geological Survey. The method is based upon the fact that a significant difference exists in some coals between the 34S/32S ratios of the pyritic and organic sulfur. A screening method for determining the suitability of coal samples for use in isotope ratio analysis is described. Making these special coals available from coal sample programs would assist research groups in sorting out the complex sulfur chemistry which accompanies thermal and chemical processing of high sulfur coals. ?? 1987.

  1. Ultra-high-throughput screening method for the directed evolution of glucose oxidase.

    Science.gov (United States)

    Ostafe, Raluca; Prodanovic, Radivoje; Nazor, Jovana; Fischer, Rainer

    2014-03-20

    Glucose oxidase (GOx) is used in many industrial processes that could benefit from improved versions of the enzyme. Some improvements like higher activity under physiological conditions and thermal stability could be useful for GOx applications in biosensors and biofuel cells. Directed evolution is one of the currently available methods to engineer improved GOx variants. Here, we describe an ultra-high-throughput screening system for sorting the best enzyme variants generated by directed evolution that incorporates several methodological refinements: flow cytometry, in vitro compartmentalization, yeast surface display, fluorescent labeling of the expressed enzyme, delivery of glucose substrate to the reaction mixture through the oil phase, and covalent labeling of the cells with fluorescein-tyramide. The method enables quantitative screening of gene libraries to identify clones with improved activity and it also allows cells to be selected based not only on the overall activity but also on the specific activity of the enzyme. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Methods for efficient high-throughput screening of protein expression in recombinant Pichia pastoris strains.

    Science.gov (United States)

    Camattari, Andrea; Weinhandl, Katrin; Gudiminchi, Rama K

    2014-01-01

    The methylotrophic yeast Pichia pastoris is becoming one of the favorite industrial workhorses for protein expression. Due to the widespread use of integration vectors, which generates significant clonal variability, screening methods allowing assaying hundreds of individual clones are of particular importance. Here we describe methods to detect and analyze protein expression, developed in a 96-well format for high-throughput screening of recombinant P. pastoris strains. The chapter covers essentially three common scenarios: (1) an enzymatic assay for proteins expressed in the cell cytoplasm, requiring cell lysis; (2) a whole-cell assay for a fungal cytochrome P450; and (3) a nonenzymatic assay for detection and quantification of tagged protein secreted into the supernatant.

  3. A method of measuring and correcting tilt of anti - vibration wind turbines based on screening algorithm

    Science.gov (United States)

    Xiao, Zhongxiu

    2018-04-01

    A Method of Measuring and Correcting Tilt of Anti - vibration Wind Turbines Based on Screening Algorithm is proposed in this paper. First of all, we design a device which the core is the acceleration sensor ADXL203, the inclination is measured by installing it on the tower of the wind turbine as well as the engine room. Next using the Kalman filter algorithm to filter effectively by establishing a state space model for signal and noise. Then we use matlab for simulation. Considering the impact of the tower and nacelle vibration on the collected data, the original data and the filtering data are classified and stored by the Screening algorithm, then filter the filtering data to make the output data more accurate. Finally, we eliminate installation errors by using algorithm to achieve the tilt correction. The device based on this method has high precision, low cost and anti-vibration advantages. It has a wide range of application and promotion value.

  4. Application of NMR Screening Methods with 19F Detection to Fluorinated Compounds Bound to Proteins

    Directory of Open Access Journals (Sweden)

    Kazuo Furihata

    2017-12-01

    Full Text Available The combinational use of one-dimensional (1D NMR-based screening techniques with 1H and 19F detections were applied to a human serum albumin–diflunisal complex. Since most NMR screening methods observe 1H spectra, the overlapped 1H signals were unavailable in the binding epitope mapping. However, the NMR experiments with 19F detection can be used as an effective complementary method. For the purpose of identifying the 1H and 19F binding epitopes of diflunisal, this paper carries out a combinatorial analysis using 1H{1H} and 19F{1H} saturation transfer difference experiments. The differences of the 1H-inversion recovery rates with and without target irradiation are also analyzed for a comprehensive interpretation of binding epitope mapping.

  5. Use of the blue cotton screen method with endoscopy to detect occult esophageal foreign bodies.

    Science.gov (United States)

    Xia, Yan; Zhang, Fan; Xu, Hong; Xu, Weiran

    2017-12-01

    More than 20,000 cases of upper gastrointestinal foreign bodies (FBs) have been reported in the last 5 years in China. Early detection and treatment is vital in these patients. Differential diagnosis of esophageal injury and occult esophageal foreign bodies is challenging, particularly in the case of non-radio-opaque foreign bodies. A diagnostic technique with high accuracy and low risk is needed for clinical practice. We describe successful use of the "blue cotton screen method" to detect esophageal foreign bodies in 2 patients. The advantages and disadvantages of various diagnostic modalities in the management of patients with foreign body ingestion are presented. This technique is safer and more effective than traditional methods for foreign body impaction in the esophageal cavity. It could be applied for screening and in the differential diagnosis of esophageal injury and FBs in the esophageal lumen.

  6. A study on asymptomatic bacteriuria in pregnancy: prevalence, etiology and comparison of screening methods

    OpenAIRE

    Kheya Mukherjee; Saroj Golia; Vasudha CL; Babita; Debojyoti Bhattacharjee; Goutam Chakroborti

    2014-01-01

    Background: Asymptomatic bacteriuria is common in women with prevalence of 4-7% in pregnancy. The traditional reference test for bacteriuria is quantitative culture of urine which is relatively expensive time consuming and laborious. The aim of this study was to know the prevalence of asymptomatic bacteriuria in pregnancy, to identify pathogens and their antibiotic susceptibility patterns and to device a single or combined rapid screening method as an acceptable alternative to urine culture. ...

  7. A rapid colorimetric screening method for vanillic acid and vanillin-producing bacterial strains.

    Science.gov (United States)

    Zamzuri, N A; Abd-Aziz, S; Rahim, R A; Phang, L Y; Alitheen, N B; Maeda, T

    2014-04-01

    To isolate a bacterial strain capable of biotransforming ferulic acid, a major component of lignin, into vanillin and vanillic acid by a rapid colorimetric screening method. For the production of vanillin, a natural aroma compound, we attempted to isolate a potential strain using a simple screening method based on pH change resulting from the degradation of ferulic acid. The strain Pseudomonas sp. AZ10 UPM exhibited a significant result because of colour changes observed on the assay plate on day 1 with a high intensity of yellow colour. The biotransformation of ferulic acid into vanillic acid by the AZ10 strain provided the yield (Yp/s ) and productivity (Pr ) of 1·08 mg mg(-1) and 53·1 mg L(-1) h(-1) , respectively. In fact, new investigations regarding lignin degradation revealed that the strain was not able to produce vanillin and vanillic acid directly from lignin; however, partially digested lignin by mixed enzymatic treatment allowed the strain to produce 30·7 mg l(-1) and 1·94 mg l(-1) of vanillic acid and biovanillin, respectively. (i) The rapid colorimetric screening method allowed the isolation of a biovanillin producer using ferulic acid as the sole carbon source. (ii) Enzymatic treatment partially digested lignin, which could then be utilized by the strain to produce biovanillin and vanillic acid. To the best of our knowledge, this is the first study reporting the use of a rapid colorimetric screening method for bacterial strains producing vanillin and vanillic acid from ferulic acid. © 2013 The Society for Applied Microbiology.

  8. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment.

    Science.gov (United States)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. Copyright © 2015

  9. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    International Nuclear Information System (INIS)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan; Durmus, Naside Gozde

    2011-01-01

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  10. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    Energy Technology Data Exchange (ETDEWEB)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan [Department of Medicine, Demirci Bio-Acoustic-MEMS in Medicine (BAMM) Laboratory, Center for Biomedical Engineering, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Durmus, Naside Gozde, E-mail: udemirci@rics.bwh.harvard.edu [School of Engineering and Division of Biology and Medicine, Brown University, Providence, RI (United States)

    2011-09-15

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  11. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  12. Comparison of different screening methods for blood pressure disorders in children and adolescents

    Directory of Open Access Journals (Sweden)

    Felipe Alves Mourato

    2015-06-01

    Full Text Available OBJECTIVE: To compare different methods of screening for blood pressure disorders in children and adolescents. METHOD: A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. RESULTS: The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. CONCLUSION: Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables.

  13. Comparison of three noninvasive methods for hemoglobin screening of blood donors.

    Science.gov (United States)

    Ardin, Sergey; Störmer, Melanie; Radojska, Stela; Oustianskaia, Larissa; Hahn, Moritz; Gathof, Birgit S

    2015-02-01

    To prevent phlebotomy of anemic individuals and to ensure hemoglobin (Hb) content of the blood units, Hb screening of blood donors before donation is essential. Hb values are mostly evaluated by measurement of capillary blood obtained from fingerstick. Rapid noninvasive methods have recently become available and may be preferred by donors and staff. The aim of this study was to evaluate for the first time all different noninvasive methods for Hb screening. Blood donors were screened for Hb levels in three different trials using three different noninvasive methods (Haemospect [MBR Optical Systems GmbH & Co. KG], NBM 200 [LMB Technology GmbH], Pronto-7 [Masimo Europe Ltd]) in comparison to the established fingerstick method (CompoLab Hb [Fresenius Kabi GmbH]) and to levels obtained from venous samples on a cell counter (Sysmex [Sysmex Europe GmbH]) as reference. The usability of the noninvasive methods was assessed with an especially developed survey. Technical failures occurred by using the Pronto-7 due to nail polish, skin color, or ambient light. The NBM 200 also showed a high sensitivity to ambient light and noticeably lower Hb levels for women than obtained from the Sysmex. The statistical analysis showed the following bias and standard deviation of differences of all methods in comparison to the venous results: Haemospect, -0.22 ± 1.24; NBM, 200 -0.12 ± 1.14; Pronto-7, -0.50 ± 0.99; and CompoLab Hb, -0.53 ± 0.81. Noninvasive Hb tests represent an attractive alternative by eliminating pain and reducing risks of blood contamination. The main problem for generating reliable results seems to be preanalytical variability in sampling. Despite the sensitivity to environmental stress, all methods are suitable for Hb measurement. © 2014 AABB.

  14. Performance Evaluation of a Novel Chemiluminescence Assay Detecting Treponema Pallidum Antibody as a Syphilis Screening Method.

    Science.gov (United States)

    Chen, Qixia; An, Jingna; Rao, Chenli; Wang, Tingting; Li, Dongdong; Feng, Shu; Tao, Chuanmin

    2016-01-01

    Syphilis is a major concern to global public health with increasing incidence. So its screening test should have sufficient sensitivity and specificity. We evaluated the performance of the Lumipulse G TP-N assay detection for syphilis screening and compared it with the InTec ELISA test kit for TP, which is widely used. Samples of several patient groups including 133 clinical and serologically characterized syphilitic sera, 175 samples containing potentially interfering agents, and 2290 unselected samples submitted for routine screening were detected by both the Lumipulse G TP-N assay and the InTec ELISA test kit for TP. Inconsistent samples were confirmed by RecomLine Treponema IgG, IgM immunoblot. Coefficient of variations of the Lumipulseo G TP-N assay at both levels were below 5% and of the InTec ELISA test kit for TP both over 5%. The sensitivity of the Lumipulse G TP-N assay and the InTec ELISA test kit for TP were 100% for all stages of syphilis. The two methods had consistent analytical specificity of 100% (95% CI: 97.21 - 100.00), while the clinical specificity was 100% (95% CI: 99.79 - 100.00) and 99.82% (95% CI: 99.51 - 99.94), respectively. Between them, Spearman's correlation coefficient was 0.455 and kappa value was 0.986. The overall sensitivity and specificity of the Lumipulse G TP-N assay was higher than the InTec ELISA test kit for TP (sensitivity: 100.0 versus 99.5, specificity: 100.0 versus 99.8). The automated Lumipulse G TP-N assay demonstrated excellent diagnostic sensitivity and specificity when evaluated as a screening test for syphilis. Thus, it can be an alternative to the treponemal screening test.

  15. Evaluation of a fluorescence-based method for antibabesial drug screening.

    Science.gov (United States)

    Guswanto, Azirwan; Sivakumar, Thillaiampalam; Rizk, Mohamed Abdo; Elsayed, Shimaa Abd Elsalam; Youssef, Mohamed Ahmed; ElSaid, ElSaid El Shirbini; Yokoyama, Naoaki; Igarashi, Ikuo

    2014-08-01

    In vitro evaluation of chemotherapeutic agents against Babesia and Theileria parasites has become routine, and the effectiveness of these chemicals is usually determined by comparing the parasitemia dynamics of untreated and treated parasites. Although microscopy is widely used to calculate parasitemia, several disadvantages are associated with this technique. The present study evaluated a fluorescence-based method using SYBR green I stain (SG I) to screen antibabesial agents in in vitro cultures of Babesia bovis. The linearity between relative fluorescence units (RFU) and parasitemia was found to be well correlated with a 0.9944 goodness-of-fit (r(2)) value. Subsequently, 50% inhibitory concentration (IC50) values were calculated for 3 antiprotozoan agents, diminazene aceturate, nimbolide, and gedunin, by this method. For diminazene aceturate and nimbolide, the IC(50)s determined by the fluorescence-based method (408 nM and 8.13 μM, respectively) and microscopy (400.3 nM and 9.4 μM, respectively) were in agreement. Furthermore, the IC50 of gedunin determined by the fluorescence-based method (19 μM) was similar to the recently described microscopy-based value (21.7 μM) for B. bovis. Additionally, the Z' factor (0.80 to 0.90), signal-to-noise (S/N) ratio (44.15 to 87.64), coefficient of variation at the maximum signal (%CVmax) (0.50 to 2.85), and coefficient of variation at the minimum signal (%CVmin) (1.23 to 2.21) calculated for the fluorescence method using diminazene aceturate were comparable to those previously determined in malaria research for this assay. These findings suggest that the fluorescence-based method might be useful for antibabesial drug screening and may have potential to be developed into a high-throughput screening (HTS) assay. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. Benchmarking Data Sets for the Evaluation of Virtual Ligand Screening Methods: Review and Perspectives.

    Science.gov (United States)

    Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu

    2015-07-27

    Virtual screening methods are commonly used nowadays in drug discovery processes. However, to ensure their reliability, they have to be carefully evaluated. The evaluation of these methods is often realized in a retrospective way, notably by studying the enrichment of benchmarking data sets. To this purpose, numerous benchmarking data sets were developed over the years, and the resulting improvements led to the availability of high quality benchmarking data sets. However, some points still have to be considered in the selection of the active compounds, decoys, and protein structures to obtain optimal benchmarking data sets.

  17. Development of nondestructive screening methods for single kernel characterization of wheat

    DEFF Research Database (Denmark)

    Nielsen, J.P.; Pedersen, D.K.; Munck, L.

    2003-01-01

    predictability. However, by applying an averaging approach, in which single seed replicate measurements are mathematically simulated, a very good NIT prediction model was achieved. This suggests that the single seed NIT spectra contain hardness information, but that a single seed hardness method with higher......The development of nondestructive screening methods for single seed protein, vitreousness, density, and hardness index has been studied for single kernels of European wheat. A single kernel procedure was applied involving, image analysis, near-infrared transmittance (NIT) spectroscopy, laboratory...

  18. Comparison of different screening methods for blood pressure disorders in children and adolescents.

    Science.gov (United States)

    Mourato, Felipe Alves; Lima Filho, José Luiz; Mattos, Sandra da Silva

    2015-01-01

    To compare different methods of screening for blood pressure disorders in children and adolescents. A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  19. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  20. Survey of the Role of Combined Screening Method with Ultrasonography in the Diagnosis of Breast Cancer

    Directory of Open Access Journals (Sweden)

    F. Gharekhanloo

    2011-01-01

    Full Text Available Introduction & Objective: The breast cancer is the most common malignancy in women and in recent years it is seen in younger ages. Because of dense breast tissue in these ages, the mammography sensitivity for breast cancer detection is reduced, so high quality ultrasonography (US as a combined screening method is effective. The aim of this study is the evaluation of the mammographic finding with the positive finding of ultrasonogarphy.Materials & Methods: In this cross-sectional study 300 cases were referred to the Mehr Medical Imaging Center for breast US and sonography of breast and axilla was performed. Mammography before or after US was also performed by another radiologist. All suspicious patients were referred for biopsy or surgery.Results: Mean age of patients was 46 y/o with the range of 32-76 y/o. Pathologic specimens approved malignancy in 21 patients and abscess in 1 patient. The most frequent symptom was palpable breast mass with mean diameter of 29 mm. Mean diameter of lymph nodes was 17.3 mm. Positive mammographic findings were seen in 85.7%and negative findings or only an asymmetric density in 14.3%.Conclusion: According to dense breast tissue especially in young women sensitivity of single screening by mammography is reduced in breast cancer detection, so combined screening with sonography and mammography especially in younger women improves the detection rate of breast carcinoma. (Sci J Hamadan Univ Med Sci 2011;17(4:57-60

  1. Non-destructive screening method for radiation hardened performance of large scale integration

    International Nuclear Information System (INIS)

    Zhou Dong; Xi Shanbin; Guo Qi; Ren Diyuan; Li Yudong; Sun Jing; Wen Lin

    2013-01-01

    The space radiation environment could induce radiation damage on the electronic devices. As the performance of commercial devices is generally superior to that of radiation hardened devices, it is necessary to screen out the devices with good radiation hardened performance from the commercial devices and applying these devices to space systems could improve the reliability of the systems. Combining the mathematical regression analysis with the different physical stressing experiments, we investigated the non-destructive screening method for radiation hardened performance of the integrated circuit. The relationship between the change of typical parameters and the radiation performance of the circuit was discussed. The irradiation-sensitive parameters were confirmed. The pluralistic linear regression equation toward the prediction of the radiation performance was established. Finally, the regression equations under stress conditions were verified by practical irradiation. The results show that the reliability and accuracy of the non-destructive screening method can be elevated by combining the mathematical regression analysis with the practical stressing experiment. (authors)

  2. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  3. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome.

    Science.gov (United States)

    Gourgari, Evgenia; Spanakis, Elias; Dobs, Adrian Sandra

    2016-01-01

    Polycystic ovary syndrome (PCOS) is a syndrome associated with insulin resistance (IR), obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have.

  4. Seeking to improve spatial justice - the case of rationalising the district court areas in South Africa - utilising several spatial analysis methods.

    CSIR Research Space (South Africa)

    Maritz, J

    2015-08-01

    Full Text Available for the Department of Justice and Constitutional Development during 2014 to assist the process to rationalise magisterial districts. In order to determine access to courts, some form of impact assessment is required – this paper outlines the accessibility analysis...

  5. From Classical to High Throughput Screening Methods for Feruloyl Esterases: A Review.

    Science.gov (United States)

    Ramírez-Velasco, Lorena; Armendáriz-Ruiz, Mariana; Rodríguez-González, Jorge Alberto; Müller-Santos, Marcelo; Asaff-Torres, Ali; Mateos-Díaz, Juan Carlos

    2016-01-01

    Feruloyl esterases (FAEs) are a diverse group of hydrolases widely distributed in plants and microorganisms which catalyzes the cleavage and formation of ester bonds between plant cell wall polysaccharides and phenolic acids. FAEs have gained importance in biofuel, medicine and food industries due to their capability of acting on a large range of substrates for cleaving ester bonds and synthesizing highadded value molecules through esterification and transesterification reactions. During the past two decades extensive studies have been carried out on the production, characterization and classification of FAEs, however only a few reports of suitable High Throughput Screening assays for this kind of enzymes have been reported. This review is focused on a concise but complete revision of classical to High Throughput Screening methods for FAEs, highlighting its advantages and disadvantages, and finally suggesting future perspectives for this important research field.

  6. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23): a study protocol.

    Science.gov (United States)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe; Christensen, Jette; Johansen, Tonje; Hariri, Jalil; Christiansen, Sanne; Rygaard, Carsten; Lynge, Elsebeth

    2018-05-26

    The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could therefore be offered less intensive screening. Primary HPV testing is more sensitive than cytology, allowing for a longer screening interval. The aim of Trial23 is to investigate if primary HPV testing with cytology triage of HPV positive samples is a reasonable screening scheme for women offered HPV vaccination as girls. Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study including intention-to-treat and per-protocol analyses. The potential effect of primary HPV screening with a 6-year interval will be calculated from the observed data. The study protocol has been submitted to the ethical committee and deemed a method study. All women are screened according to routine guidelines. The study will contribute new evidence on the future screening of HPV vaccinated birth cohorts of women. All results will be published in open-access journal. NCT03049553; Pre-results. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  7. Survey of South African fruit juices using a fast screening HILIC-MS method.

    Science.gov (United States)

    Stander, Marietjie A; Kühn, Wernich; Hiten, Nicholas F

    2013-01-01

    Adulteration of fruit juices--by the addition of sugar or other less expensive fruit juices as well as preservatives, artificial sweeteners and colours--was tested for by using a developed screening method. The method employs hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS) using electrospray ionisation in the negative mode and ultraviolet light detection. Different fruit juices can be differentiated by the content of marker compounds like sorbitol, certain phenolic molecules and their saccharide profile. This method was used to test 46 fruit juice samples from the retail market as well as 12 control samples. The study focused on the main types of fruit juices consumed on the South African market including apple, orange, grape and blends of these juices with other fruits like mango, pear and guava. Overall, the 46 samples tested mostly agreed with label claims. One grape juice sample was adulterated, probably with apple juice. Natamycin above the legal limits was found in two samples. In addition, two samples contained natamycin and one sample benzoate without it being indicated on the label. The method is well suited as a quick screening method for fruit juice adulteration and if used routinely would reduce fruit juice adulteration without the cost of the current array of tests needed for authenticity testing.

  8. Screening of groundwater remedial alternatives for brownfield sites: a comprehensive method integrated MCDA with numerical simulation.

    Science.gov (United States)

    Li, Wei; Zhang, Min; Wang, Mingyu; Han, Zhantao; Liu, Jiankai; Chen, Zhezhou; Liu, Bo; Yan, Yan; Liu, Zhu

    2018-06-01

    Brownfield sites pollution and remediation is an urgent environmental issue worldwide. The screening and assessment of remedial alternatives is especially complex owing to its multiple criteria that involves technique, economy, and policy. To help the decision-makers selecting the remedial alternatives efficiently, the criteria framework conducted by the U.S. EPA is improved and a comprehensive method that integrates multiple criteria decision analysis (MCDA) with numerical simulation is conducted in this paper. The criteria framework is modified and classified into three categories: qualitative, semi-quantitative, and quantitative criteria, MCDA method, AHP-PROMETHEE (analytical hierarchy process-preference ranking organization method for enrichment evaluation) is used to determine the priority ranking of the remedial alternatives and the solute transport simulation is conducted to assess the remedial efficiency. A case study was present to demonstrate the screening method in a brownfield site in Cangzhou, northern China. The results show that the systematic method provides a reliable way to quantify the priority of the remedial alternatives.

  9. Spectroscopic and Spectrometric Methods Used for the Screening of Certain Herbal Food Supplements Suspected of Adulteration.

    Science.gov (United States)

    Mateescu, Cristina; Popescu, Anca Mihaela; Radu, Gabriel Lucian; Onisei, Tatiana; Raducanu, Adina Elena

    2017-06-01

    Purpose: This study was carried out in order to find a reliable method for the fast detection of adulterated herbal food supplements with sexual enhancement claims. As some herbal products are advertised as "all natural", their "efficiency" is often increased by addition of active pharmaceutical ingredients such as PDE-5 inhibitors, which can be a real health threat for the consumer. Methodes: Adulterants, potentially present in 50 herbal food supplements with sexual improvement claims, were detected using 2 spectroscopic methods - Raman and Fourier Transform Infrared - known for reliability, reproductibility, and an easy sample preparation. GC-MS technique was used to confirm the potential adulterants spectra. Results: About 22% (11 out of 50 samples) of herbal food supplements with sexual enhancement claims analyzed by spectroscopic and spectrometric methods proved to be "enriched" with active pharmaceutical compounds such as: sildenafil and two of its analogues, tadalafil and phenolphthalein. The occurence of phenolphthalein could be the reason for the non-relevant results obtained by FTIR method in some samples. 91% of the adulterated herbal food supplements were originating from China. Conclusion: The results of this screening highlighted the necessity for an accurate analysis of all alleged herbal aphrodisiacs on the Romanian market. This is a first such a screening analysis carried out on herbal food supplements with sexual enhancement claims.

  10. A Rapid and Efficient Screening Method for Antibacterial Compound-Producing Bacteria.

    Science.gov (United States)

    Hettiarachchi, Sachithra; Lee, Su-Jin; Lee, Youngdeuk; Kwon, Young-Kyung; De Zoysa, Mahanama; Moon, Song; Jo, Eunyoung; Kim, Taeho; Kang, Do-Hyung; Heo, Soo-Jin; Oh, Chulhong

    2017-08-28

    Antibacterial compounds are widely used in the treatment of human and animal diseases. The overuse of antibiotics has led to a rapid rise in the prevalence of drug-resistant bacteria, making the development of new antibacterial compounds essential. This study focused on developing a fast and easy method for identifying marine bacteria that produce antibiotic compounds. Eight randomly selected marine target bacterial species ( Agrococcus terreus, Bacillus algicola, Mesoflavibacter zeaxanthinifaciens, Pseudoalteromonas flavipulchra, P. peptidolytica, P. piscicida, P. rubra , and Zunongwangia atlantica ) were tested for production of antibacterial compounds against four strains of test bacteria ( B. cereus, B. subtilis, Halomonas smyrnensis , and Vibrio alginolyticus ). Colony picking was used as the primary screening method. Clear zones were observed around colonies of P. flavipulchra, P. peptidolytica, P. piscicida , and P. rubra tested against B. cereus, B. subtilis , and H. smyrnensis . The efficiency of colony scraping and broth culture methods for antimicrobial compound extraction was also compared using a disk diffusion assay. P. peptidolytica, P. piscicida , and P. rubra showed antagonistic activity against H. smyrnensis, B. cereus , and B. subtilis , respectively, only in the colony scraping method. Our results show that colony picking and colony scraping are effective, quick, and easy methods of screening for antibacterial compound-producing bacteria.

  11. PERUSAHAAN TIDAK ADIL KEPADA SAYA! : GAMBARAN PERCEIVED JUSTICE PADA SITUASI PERUBAHAN

    Directory of Open Access Journals (Sweden)

    Vera Elisabeth

    2017-06-01

    Full Text Available Employees perceive the fairness of organization’s systems and procedure is called perceived justice. Some studies indicated that perceived justice affects many organizational attitudes and behaviors, such as job satisfaction, absenteeism, counterproductive behavior, and turnover. Therefore, organization needs to give attention on employees’ perceived justice. This study was taken in PT. EFG, where its employees have been complaining about  many changes happened. This study was conducted with mixed method approach. Quantiative data was collected through 114 online questionnaires. The questionnaire measures three dimensions which are distributive justice, procedural justice, and interactional justice. Qualitative data was collected through interview to five participants with high and low intensity of perceived justice. The findings show that supervisor play an important role in  determining other employees’ procedural and interactional justice. Other factors such as characteristics, previous experiences, perception about change and coworkers also affect employees’ perceived justice

  12. Environmental justice: a criminological perspective

    Science.gov (United States)

    Lynch, Michael J.; Stretesky, Paul B.; Long, Michael A.

    2015-08-01

    This article examines studies related to environmental justice in the criminological literature and from a criminological perspective. Criminologists have long been concerned with injustices in the criminal justice system related to the enforcement of criminal law. In the 1990s, following the emergence of green criminology, a handful of criminologists have drawn attention to environmental justice as an extension of more traditional criminological studies of justice and injustice. Relevant criminological studies of environmental justice are reviewed, and suggestions for future environmental justice research are offered.

  13. Combining Pathway Identification and Breast Cancer Survival Prediction via Screening-Network Methods

    Directory of Open Access Journals (Sweden)

    Antonella Iuliano

    2018-06-01

    Full Text Available Breast cancer is one of the most common invasive tumors causing high mortality among women. It is characterized by high heterogeneity regarding its biological and clinical characteristics. Several high-throughput assays have been used to collect genome-wide information for many patients in large collaborative studies. This knowledge has improved our understanding of its biology and led to new methods of diagnosing and treating the disease. In particular, system biology has become a valid approach to obtain better insights into breast cancer biological mechanisms. A crucial component of current research lies in identifying novel biomarkers that can be predictive for breast cancer patient prognosis on the basis of the molecular signature of the tumor sample. However, the high dimension and low sample size of data greatly increase the difficulty of cancer survival analysis demanding for the development of ad-hoc statistical methods. In this work, we propose novel screening-network methods that predict patient survival outcome by screening key survival-related genes and we assess the capability of the proposed approaches using METABRIC dataset. In particular, we first identify a subset of genes by using variable screening techniques on gene expression data. Then, we perform Cox regression analysis by incorporating network information associated with the selected subset of genes. The novelty of this work consists in the improved prediction of survival responses due to the different types of screenings (i.e., a biomedical-driven, data-driven and a combination of the two before building the network-penalized model. Indeed, the combination of the two screening approaches allows us to use the available biological knowledge on breast cancer and complement it with additional information emerging from the data used for the analysis. Moreover, we also illustrate how to extend the proposed approaches to integrate an additional omic layer, such as copy number

  14. Development of a first-principles code based on the screened KKR method for large super-cells

    International Nuclear Information System (INIS)

    Doi, S; Ogura, M; Akai, H

    2013-01-01

    The procedures of performing first-principles electronic structure calculation using the Korringa-Kohn-Rostoker (KKR) and the screened KKR methods are reviewed with an emphasis put on their numerical efficiency. It is shown that an iterative matrix inversion combined with a suitable preconditioning greatly improves the computational time of screened KKR method. The method is well parallelized and also has an O(N) scaling property

  15. The minisequencing method: a simple strategy for genetic screening of MEN 2 families

    Directory of Open Access Journals (Sweden)

    Domingues Rita

    2002-05-01

    Full Text Available Abstract Background Multiple endocrine neoplasia type 2 is an autosomal dominant disorder. MEN 2A is characterized by medullary thyroid carcinoma, pheochromocytoma and hyperparathyroidism; MEN 2B by medullary thyroid carcinoma, pheochromocytoma and characteristic stigmata. Activating germline mutations of the RET proto oncogene are responsible for this hereditary syndrome. Codon 634 mutations are the most common mutations occurring in MEN 2A families whereas a specific mutation at codon 918 is observed in the great majority of MEN 2B families. Analysis of these codons will provide a final diagnosis in the great majority of affected families making unnecessary further studies. To specifically study the codons 634 and 918 we used a minisequencing method as an alternative method to complete sequencing. Results Using this mutation detection method we were able to reproduce in all cases, representative of 7 families, the information previously obtained by direct sequencing of PCR products. Depending on the number of primers used in the minisequencing reaction, we were able to interrogate either only one nucleotide of the target codon or the three nucleotides simultaneously. Conclusions This technique appears as a simple, rapid and efficient method for genetic screening of MEN 2 families. It can be utilized to seek for unknown mutations at specific codons or to screen for previously identified mutations and is therefore of interest to study index cases or individuals at risk. Results suggest that complete sequencing is unnecessary.

  16. Method for rapid screening analysis of Sr-90 in edible plant samples collected near Fukushima, Japan

    International Nuclear Information System (INIS)

    Amano, Hikaru; Sakamoto, Hideaki; Shiga, Norikatsu; Suzuki, Kaori

    2016-01-01

    A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. The dissolved oxalate precipitate was loaded on an extraction chromatography resin, and the 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. 90 Sr ( 90 Y) concentration was determined in plant samples collected near the damaged Fukushima Daiichi Nuclear Power Plants with this method. - Highlights: • A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. • 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. • The dissolved oxalate precipitate was loaded on an extraction chromatography resin. • 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. • 90 Sr ( 90 Y) concentration was determined in edible plant samples collected near the damaged Fukushima Daiichi NPPs with this method.

  17. Colorimetric method for enzymatic screening assay of ATP using Fe(III)-xylenol orange complex formation.

    Science.gov (United States)

    Ishida, Akihiko; Yamada, Yasuko; Kamidate, Tamio

    2008-11-01

    In hygiene management, recently there has been a significant need for screening methods for microbial contamination by visual observation or with commonly used colorimetric apparatus. The amount of adenosine triphosphate (ATP) can serve as the index of a microorganism. This paper describes the development of a colorimetric method for the assay of ATP, using enzymatic cycling and Fe(III)-xylenol orange (XO) complex formation. The color characteristics of the Fe(III)-XO complexes, which show a distinct color change from yellow to purple, assist the visual observation in screening work. In this method, a trace amount of ATP was converted to pyruvate, which was further amplified exponentially with coupled enzymatic reactions. Eventually, pyruvate was converted to the Fe(III)-XO complexes through pyruvate oxidase reaction and Fe(II) oxidation. As the assay result, yellow or purple color was observed: A yellow color indicates that the ATP concentration is lower than the criterion of the test, and a purple color indicates that the ATP concentration is higher than the criterion. The method was applied to the assay of ATP extracted from Escherichia coli cells added to cow milk.

  18. Carbamazepine-Fumaric Acid Co-Crystal Screening Using Solution Based Method

    Directory of Open Access Journals (Sweden)

    Abd Rahim Syarifah

    2016-01-01

    Full Text Available Co-crystals is a multi-component system which connected by non-covalent interactions, present physically as a solid form under ambient conditions. Nowadays, co-crystal has becoming as an alternative approach to improve the bioavailability of poor water soluble drugs especially for a weakly ionisable groups or neutral compounds. In this study the co-crystal screening was carried out for carbamazepine (CBZ and fumaric acid (FUM co-crystal former (CCF using non-stoichiometric method (addition of CBZ to CCF saturated solution and stoichiometric method (evaporation of 1:1 molar ratio of CBZ to CCF in acetonitrile, ethyl acetate, propanol, ethanol and formic acid solvent systems. The crystals produced from the screening were characterized using Powder X-ray Diffraction (PXRD, Differential Scanning Calorimetry (DSC and Fourier Transform Infrared (FT-IR. The PXRD analysis had confirmed that the co-crystal was successfully formed in both methods for all of the solvent system studied with an exception to formic acid in the stoichiometric method where no crystal was found precipitate. The findings from this study revealed that Form A and Form B of CBZ-FUM co-crystal had been successfully formed from different solvent systems.

  19. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  20. High prevalence of bacteriuria in pregnancy and its screening methods in north India.

    Science.gov (United States)

    Bandyopadhyay, Sutapa; Thakur, J S; Ray, Pallab; Kumar, Rajesh

    2005-05-01

    The study aims at finding out the prevalence of bacteruria in pregnancy in an urban setting and ascertaining methods to screen them in primary care clinics. A total of 1 61 pregnant ladies visiting a primary care clinic were screened for bacteriuria based on the symptomatology. Urine culture was done to know the prevalence of bacteriuria. Sensitivities and specificities were calculated for each symptom and risk assessment. A score card was developed based on combination of positive risk assessment and constellation of symptoms. Prevalence of symptomatic and asymptomatic bacteriuria was found to be 19.87% and 4.34% respectively. Prevalence of bacteriuria was significantly high among those who had intercourse more frequently and those with less water intake. Those with a score of more than or equal to 4, as per score card were 60% more likely to suffer from bacteriuria. When combined with microscopic examination for leucocytes on positively screened, the positive predictive value was found to be 89%. It is concluded that prevalence of symptomatic bacteriuria is common among pregnant women. Syndromic management of cases on the basis of score card is helpful in resource constraint areas. This may be combined with microscopic examination of urine to entail rational use of antibiotics.

  1. Trojan Horse Method: a useful tool for electron screening effect investigation

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R.G.; Spitaleri, C.; Cherubini, S.; La Cognata, M.; Lamia, L.; Romano, S.; Sergi, M.L. [Laboratori Nazionali del Sud-INFN and DMFCI Universita di Catania, Catania (Italy); Tumino, A. [Universita Kore, Enna (Italy); Li, C.; Wen, Q.; Zhou, S. [Department of Nuclear Physics, CIAE, Beijing (China); Burjan, V.; Kroha, V.; Mrazek, J. [Cyclotron Institute, Academy of Science, Rez, Czech Rep. (Czech Republic); Carlin, N.; Gimenez del Santo, M.; Szanto de Toledo, A. [Departamento de Fisica, Universidad de Sao Paulo (Brazil); Kubono, S.; Wakabayashi, T.; Yamaguchi, H. [CNS, University of Tokyo, Wako (Japan)

    2010-03-01

    Direct measurements in the last decades have highlighted a new problem related to the lowering of the Coulomb barrier between the interacting nuclei due to the presence of the 'electron screening' in the laboratory measurements. It was systematically observed that the presence of the electronic cloud around the interacting ions in measurements of nuclear reactions cross sections at astrophysical energies gives rise to an enhancement of the astrophysical S(E)-factor as lower and lower energies are explored [H. Assenbaum, K. Langanke, C. Rolfs, Z. Phys. 327 (1987) 461]. Moreover, at present such an effect is not well understood as the value of the potential for screening extracted from these measurements is higher than the upper limit of theoretical predictions (adiabatic limit). On the other hand, the electron screening potential in laboratory measurement is different from that occurring in stellar plasmas thus the quantity of interest in astrophysics is the so-called 'bare nucleus cross section'. This quantity can only be extrapolated in direct measurements. These are the reasons that led to a considerable growth on interest in indirect measurement techniques and in particular the Trojan Horse Method (THM) [G. Baur, Phys. Lett. B 178, (1986) 135; S. Cherubini et al. Ap. J. 457, (1996) 855] Results concerning the bare nucleus cross sections measurements will be shown in several cases of astrophysical interest. In those cases the screening potential evaluated by means of the THM will be compared with the adiabatic limit and results arising from extrapolation in direct measurements.

  2. Measuring Intergenerational Justice

    Directory of Open Access Journals (Sweden)

    Laurence J. Kotlikoff

    2017-12-01

    Full Text Available Concern with intergenerational justice has long been a focus of economics. This essay considers the effort, over the last three decades, to quantify generational fiscal burdens using label-free fiscal gap and generational accounting. It also points out that government debt -- the conventional metric for assessing generational fiscal justice,– has no grounding in economic theory. Instead, official debt is the result of economically arbitrary government labelling decisions: whether to call receipts “taxes” rather than “borrowing” and whether to call payments “transfer payments” rather than “debt service”. Via their choice of words, governments decide which obligations to put on, and which to keep off, the books. The essay also looks to the future of generational fiscal-justice analysis. Rapid computational advances are permitting economists to understand not just direct government intergenerational redistribution, but also how such policies impact the economy that future generations will inherit.

  3. Cost-effectiveness of lung cancer screening and treatment methods: a systematic review of systematic reviews.

    Science.gov (United States)

    Azar, Farbod Ebadifard; Azami-Aghdash, Saber; Pournaghi-Azar, Fatemeh; Mazdaki, Alireza; Rezapour, Aziz; Ebrahimi, Parvin; Yousefzadeh, Negar

    2017-06-19

    Due to extensive literature in the field of lung cancer and their heterogeneous results, the aim of this study was to systematically review of systematic reviews studies which reviewed the cost-effectiveness of various lung cancer screening and treatment methods. In this systematic review of systematic reviews study, required data were collected searching the following key words which selected from Mesh: "lung cancer", "lung oncology", "lung Carcinoma", "lung neoplasm", "lung tumors", "cost- effectiveness", "systematic review" and "Meta-analysis". The following databases were searched: PubMed, Cochrane Library electronic databases, Google Scholar, and Scopus. Two reviewers (RA and A-AS) evaluated the articles according to the checklist of "assessment of multiple systematic reviews" (AMSTAR) tool. Overall, information of 110 papers was discussed in eight systematic reviews. Authors focused on cost-effectiveness of lung cancer treatments in five systematic reviews. Targeted therapy options (bevacizumab, Erlotinib and Crizotinib) show an acceptable cost-effectiveness. Results of three studies failed to show cost-effectiveness of screening methods. None of the studies had used the meta-analysis method. The Quality of Health Economic Studies (QHES) tool and Drummond checklist were mostly used in assessing the quality of articles. Most perspective was related to the Payer (64 times) and the lowest was related to Social (11times). Most cases referred to Incremental analysis (82%) and also the lowest point of referral was related to Discounting (in 49% of the cases). The average quality score of included studies was calculated 9.2% from 11. Targeted therapy can be an option for the treatment of lung cancer. Evaluation of the cost-effectiveness of computerized tomographic colonography (CTC) in lung cancer screening is recommended. The perspective of the community should be more taken into consideration in studies of cost-effectiveness. Paying more attention to the topic of

  4. Non invasive diagnostic methods for better screening of peripheral arterial disease.

    Science.gov (United States)

    Nirala, Neelamshobha; Periyasamy, R; Kumar, Awanish

    2018-05-16

    Peripheral arterial disease (PAD) is a common circulatory problem in which narrowed arteries reduce blood flow to extremities usually legs. It does not receive enough blood flow to keep up with demand. This causes symptoms, most notably leg pain while walking which is known as claudication. It is a common manifestation of type II Diabetes, but the relationship between other vascular diseases and lower limb (LL)-PAD has been poorly understood and investigated. When assessing a patient with clinically LLPAD, two questions are in order to establish a diagnosis: one is non-invasive testing and other is invasive. Invasive methods are painful and get so bad that some people need to have a leg surgery. People with Diabetes are at increased risk for amputation and it is used only when the damage is very severe. Diagnosis of LLPAD begins with a physical examination, patient history, certain questionnaire and non invasive mode of diagnosis is started for the screening of patients. Clinicians check for weak pulses in the legs and then decide for further diagnosis. Paper discusses the prevalence of LLPAD worldwide and in India along with the clinical effectiveness and limitations of these methods in case of Diabetes. The focus of this review is to discuss only those non invasive methods which are widely used for screening of LLPAD like Ankle brachial index (ABI), Toe brachial Index (TBI), and use of photoplethysmogram (PPG) specially in case of Diabetic patients. Also, this paper gives an overview of the work done using ABI, TBI, and PPG for detection of LLPAD. These tests are not painful and could be performed in a cost-effective manner to avoid delays in screening/diagnosis and also reduce costs. Copyright © 2018. Published by Elsevier Inc.

  5. Civilisation of Criminal Justice: Restorative Justice amongst other strategies

    NARCIS (Netherlands)

    J.R. Blad (John)

    2013-01-01

    markdownabstract__Abstract__ Is criminal justice becoming more and uncivilised if so, how could this be explained? Could Is criminal justice becoming more and uncivilised if so, how could this be explained? Could Is criminal justice becoming more and uncivilised if so, how could this be

  6. Special Justice for Peace: A Transitional Justice Model According to Modern Tendencies and Orientations of Law and Justice

    Directory of Open Access Journals (Sweden)

    Carlos Arturo Gómez Pavajeau

    2016-06-01

    Full Text Available The article analyses the constitutional implications of the peace agreement about Colombia’s armed conflict. It examines constitutional rules and international instruments about human rights, confronting the agreement with justice criteria in the national and international context, to underline the role of justice for the definitive solution of the conflict. By using the methodology of opposing concepts, it reviews the implications of formal justice and material justice, to establish the superiority of the last one and it’s relation with social justice; it analyses the differences between individual justice and global justice, to demonstrate the need to obtain an integral justice; it contrasts alternative justice and traditional justice, to propose an integrated justice; it explains that justice based upon the formal syllogism should be overcome by a justice based upon equity, to obtain a justice anchored in the Constitution, universal and concentrated in the human rights; it hypothesizes that justice supported in the atonement and retribution should be overcome by a justice that is preventive and restorative, that allows the construction of a justice focused in the future, without ignoring the past; it clarifies that justice with one jurisdiction and special justice are the components of a integrative transitional justice; it explains the presence of justice in different institutions with different functions and justice concentrated in one institution, although with different functions, because there is a search for an integrative justice; it exposes the search for a constitutional and political justice, discussing the vision of justice as a triumph of the force or the scandalous concession of benefits; it exalts that it is a justice in search of a positive discrimination, not a negative discrimination, overcoming the discussion between justice for the powerful and justice for the weak; finally, it considers that it is a justice

  7. Empowering Energy Justice

    Science.gov (United States)

    Finley-Brook, Mary; Holloman, Erica L.

    2016-01-01

    The U.S. is experiencing unprecedented movement away from coal and, to a lesser degree, oil. Burdened low-income communities and people of color could experience health benefits from reductions in air and water pollution, yet these same groups could suffer harm if transitions lack broad public input or if policies prioritize elite or corporate interests. This paper highlights how U.S. energy transitions build from, and contribute to, environmental injustices. Energy justice requires not only ending disproportionate harm, it also entails involvement in the design of solutions and fair distribution of benefits, such as green jobs and clean air. To what extent does the confluence of state, civic, and market processes assure “just” transitions to clean, low-carbon energy production involving equitable distribution of costs, benefits, and decision-making power? To explore this question we assess trends with (1) fossil fuel divestment; (2) carbon taxes and social cost of carbon measurements; (3) cap-and-trade; (4) renewable energy; and (5) energy efficiency. Current research demonstrates opportunities and pitfalls in each area with mixed or partial energy justice consequences, leading to our call for greater attention to the specifics of distributive justice, procedural justice, and recognition justice in research, policy, and action. Illustrative energy transition case studies suggest the feasibility and benefit of empowering approaches, but also indicate there can be conflict between “green” and “just”, as evident though stark inequities in clean energy initiatives. To identify positive pathways forward, we compile priorities for an energy justice research agenda based on interactive and participatory practices aligning advocacy, activism, and academics. PMID:27657101

  8. Empowering Energy Justice

    Directory of Open Access Journals (Sweden)

    Mary Finley-Brook

    2016-09-01

    Full Text Available The U.S. is experiencing unprecedented movement away from coal and, to a lesser degree, oil. Burdened low-income communities and people of color could experience health benefits from reductions in air and water pollution, yet these same groups could suffer harm if transitions lack broad public input or if policies prioritize elite or corporate interests. This paper highlights how U.S. energy transitions build from, and contribute to, environmental injustices. Energy justice requires not only ending disproportionate harm, it also entails involvement in the design of solutions and fair distribution of benefits, such as green jobs and clean air. To what extent does the confluence of state, civic, and market processes assure “just” transitions to clean, low-carbon energy production involving equitable distribution of costs, benefits, and decision-making power? To explore this question we assess trends with (1 fossil fuel divestment; (2 carbon taxes and social cost of carbon measurements; (3 cap-and-trade; (4 renewable energy; and (5 energy efficiency. Current research demonstrates opportunities and pitfalls in each area with mixed or partial energy justice consequences, leading to our call for greater attention to the specifics of distributive justice, procedural justice, and recognition justice in research, policy, and action. Illustrative energy transition case studies suggest the feasibility and benefit of empowering approaches, but also indicate there can be conflict between “green” and “just”, as evident though stark inequities in clean energy initiatives. To identify positive pathways forward, we compile priorities for an energy justice research agenda based on interactive and participatory practices aligning advocacy, activism, and academics.

  9. Screening method for Staphylococcus aureus identification in subclinical bovine mastitis from dairy farms

    Directory of Open Access Journals (Sweden)

    Natapol Pumipuntu

    2017-07-01

    Full Text Available Background: Staphylococcus aureus is one of the most important contagious bacteria causing subclinical bovine mastitis. This bacterial infection is commonly identified by determine the pathogen in bovine milk samples through conventional technique including coagulase test. However, this test has several disadvantages as low sensitivity, risk of biohazard, cost expensive, and limited preparation especially in local area. Aim: Aim of this study was to compare and assess the screening method, Mannitol fermentation test (Mannitol salt agar [MSA], and deoxyribonuclease (DNase test, for S. aureus identification in milk samples. Materials and Methods: A total of 224 subclinical bovine mastitis milk samples were collected from four provinces of Thailand and determined S. aureus using conventional method and also subjected to the screening test, MSA and DNase test. The sensitivity, specificity, positive predictive value (PPV, and negative predictive value (NPV among both tests were analyzed and compared to the tube coagulase test (TCT, as reference method. Immunological test by latex agglutination and molecular assay by determined spa gene were also used to identify and differentiate S. aureus. Results: A total of 130 staphylococci were isolated by selective media, Gram-stain, and catalase test. The number of S. aureus which identified using TCT, MSA and DNase test were 32, 102, and 74 isolates, respectively. All TCT results were correlated to results of latex agglutination and spa gene which were 32 S. aureus. MSA showed 100% sensitivity, 28.57% specificity, 31.37% PPV, and 100% NPV, whereas DNase showed 53.13% sensitivity, 41.84% specificity, 22.97% PPV, and 73.21% NPV. DNase test showed higher specificity value than MSA but the test presented 26.79% false negative results whereas no false-negative result from MSA when comparing to TCT. Conclusion: MSA had a tendency to be a good preference for screening S. aureus because of its high sensitivity and

  10. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  11. Gravimetric screening method for fungal decay of paper: inoculation with Trametes versicolor.

    Science.gov (United States)

    Råberg, Ulrika; Hafrén, Jonas

    2009-10-01

    The European standard test EN 113 for fungal degradation of solid wood has been adapted for degradation of paper by white rot fungus (Trametes versicolor). Fungal degradation of paper sheets may potentially be used for screening different wood preservatives on paper instead of solid wood. The paper samples showed higher relative mass losses compared to wood, and samples pretreated with boric acid, copper sulfate and polymerized linseed oil were successfully tested for biodegradation using the paper sheet method. The results on paper degradation were compared with wood, both as wood blocks (according to standard test) and wood cut in sections forming layered structures mimicking paper layers.

  12. The validity of ultrasonographic scanning as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Lindholt, Jes Sanddal; Vammen, Sten; Juul, Søren

    1999-01-01

    the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs.......the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs....

  13. Review of Dosimetric Methods for Mammography in the UK Breast Screening Programme

    International Nuclear Information System (INIS)

    Young, K.C.; Ramsdale, M.L.; Bignell, F.

    1998-01-01

    The two methods used to monitor dose in mammography in the UK Breast Screening Programme are reviewed. The first is the measurement of mean glandular dose to a standard breast. The second is the estimation of mean glandular dose for individual women using the X ray exposure factors. Neither method takes account of variations in breast composition and the effect of this on estimates of glandular dose are reported. Applying the standard breast model using PMMA resulted in substantial overestimates of breast doses for women with large compressed breast thicknesses because they tend to have low glandular content. Conversely the use of post-exposure data to estimate the MGDs in women attending screening with large breasts resulted in underestimates of their doses unless the relatively low levels of glandularity were taken into account. When estimating the MGDs for breasts of different sizes, it is important that the models and methods used take account of the strong variation in breast composition with compressed thickness. (author)

  14. Materials and methods for higher performance screen-printed flexible MRI receive coils.

    Science.gov (United States)

    Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C

    2017-08-01

    To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  15. The novel measuring method for screening and assessing chromium content in clothes and shoes materials

    Science.gov (United States)

    Salerno-Kochan, R.

    2017-10-01

    The aim of this paper is to propose the bioindicative measuring method for screening and assessing the safety of textile and leather materials in relation to chemical threats. This method is based on toxicological assay in which Tetrahymena pyriformis, unicellular organism belonging to protozoans, is used as a test organism. For the realization of the research goal the sensitivity threshold of test organisms to chromium(VI) solutions was identified. The changes in cell development of test organisms in chromium solutions were registered by colorimetric measurements in the presence of alamarBlue® cell viability reagent. Empirical data enabled to fit logistic curves on the base of which the level of chromium toxicity was estimated. In the second step, harmfulness of aqueous extracts obtained from textile and leather samples containing chromium in relation to test organisms was evaluated. The performed research confirmed the high efficiency of the proposed method in screening and assessing chromium content in clothes and shoes materials and showed possibilities of using it in safety assessment of products with regard to chemical risks.

  16. Juvenile Justice in Mexico

    Directory of Open Access Journals (Sweden)

    Martha Frías Armenta

    2014-08-01

    Full Text Available The first tribunal in Mexico was established in the central state of San Luis Potosi in 1926. The Law Regarding Social Prevention and Juvenile Delinquency for the Federal District and Mexican territories was promulgated in 1928. In 2005, Article 18 of the Mexican Constitution was modified to establish a comprehensive system (“Sistema Integral de justicia” in Spanish of justice for juveniles between 12 and 18 years old who had committed a crime punishable under criminal law. Its objective was to guarantee juveniles all the due process rights established for adults, in addition to the special ones recognized for minors. The constitutional reform also provides a framework that includes special tribunals as well as alternative justice options for juveniles. With these reforms, institutionalization of minors was to be considered an extreme measure applicable only to felonies and to juveniles older than 14. In 2006, all states within the Mexican federation enacted the “Law of justice for adolescents”. This system, at both the federal and state levels, formalizes a new global paradigm with regard to the triangular relationship between children, the State and the Law. It recognizes that children are also bearers of the inherent human rights recognized for all individuals, instead of simply objects in need of protection. However, despite formally aligning Mexican juvenile justice law with the Convention on the Rights of the Child (CRC, issues of actual substantive rights remained and new ones have appeared. For example, juveniles younger than 14 who have not committed a felony are released from institutions without any rehabilitation or treatment options, and alternative forms of justice were included without evaluating their possibilities of application or their conditions for success. In addition, the economic status of most juvenile detainees continues to be one of the most important determining factors in the administration of justice

  17. Reflexivity and social justice

    DEFF Research Database (Denmark)

    Maksimovic, Tijana; Jakobsen, Helle Nordentoft

    2017-01-01

    Career practitioners’ reflexive understanding of their professional role as change agents in career guidance and counselling practices has a major impact on how social justice can be achieved. This entitles an awareness of the way in which guidance and counselling practices are embedded in the co......Career practitioners’ reflexive understanding of their professional role as change agents in career guidance and counselling practices has a major impact on how social justice can be achieved. This entitles an awareness of the way in which guidance and counselling practices are embedded...

  18. Intelligent screening of electrofusion-polyethylene joints based on a thermal NDT method

    Science.gov (United States)

    Doaei, Marjan; Tavallali, M. Sadegh

    2018-05-01

    The combinations of infrared thermal images and artificial intelligence methods have opened new avenues for pushing the boundaries of available testing methods. Hence, in the current study, a novel thermal non-destructive testing method for polyethylene electrofusion joints was combined with k-means clustering algorithms as an intelligent screening tool. The experiments focused on ovality of pipes in the coupler, as well as misalignment of pipes-couplers in 25 mm diameter joints. The temperature responses of each joint to an internal heat pulse were recorded by an IR thermal camera, and further processed to identify the faulty joints. The results represented clustering accuracy of 92%, as well as more than 90% abnormality detection capabilities.

  19. Social Justice Advocacy among Graduate Students: An Empirical Investigation

    Science.gov (United States)

    Linnemeyer, Rachel McQuown

    2009-01-01

    Although social justice advocacy has increasingly been acknowledged as important in the field of psychology (e.g., Goodman et al., 2004; Toporek et al., 2006a, Vera & Speight, 2003), there is a dearth of empirical research examining social justice advocacy across graduate psychology students. This mixed-methods study examined demographic and…

  20. Bringing Social Justice Principles to Practice: New Practitioners Speak

    Science.gov (United States)

    Jenkins, Kisha V.; Shriberg, David; Conway, Devyn; Ruecker, Dana; Jones, Haley

    2018-01-01

    Using consensual qualitative research methods, this qualitative study explored how nine recent graduates, all graduating within the past 7 years from an overtly social justice-oriented school psychology program, were experiencing social justice in practice. Semistructured interviews were conducted covering the following three theme areas: defining…

  1. Validity of a method for the self-screening of cardiovascular risk

    Directory of Open Access Journals (Sweden)

    Barroso M

    2018-05-01

    Full Text Available María Barroso,1–3 Silvia Pérez-Fernández,1,4 M Mar Vila,1,4,5 M Dolors Zomeño,6,7 Ruth Martí-Lluch,8 Ferran Cordon,9 Rafel Ramos,8,10,11 Roberto Elosua,1,4 Irene R Degano,1,4 Montse Fitó,5,12 Carmen Cabezas,13 Gemma Salvador,13 Conxa Castell,13 María Grau1,4,14 1Cardiovascular Epidemiology and Genetics Research Group, IMIM-Hospital del Mar Research Institute, 2Centre d’Atenció Primària La Marina, Direcció d’Atenció Primària Barcelona, Institut Català de la Salut, 3Department of Pediatrics, Obstetrics, Gynecology and Preventive Medicine, School of Medicine, Autonomous University of Barcelona, 4Consortium for Biomedical Research in Cardiovascular Disease (CIBERCV, 5Department of Mathematics and Computer Science, University of Barcelona, 6Cardiovascular Risk and Nutrition, IMIM-Hospital del Mar Research Institute, 7School of Health Sciences, Blanquerna-Ramon Llull University, Barcelona, Spain; 8Unitat de Suport a la Recerca de Girona, Institut Universitari d’Investigació en Atenció Primària Jordi Gol, 9Centre d’Atenció Primària Montilivi, Direcció d’Atenció Primària Girona, Institut Català de la Salut, 10Department of Medical Sciences, School of Medicine, University of Girona, 11Girona Biomedical Research Institute, Girona, Spain; 12Consortium for Biomedical Research in Obesity and Nutrition (CIBEROBN, 13Catalan Agency of Public Health, 14Department of Medicine, University of Barcelona, Barcelona, Spain Background: The validity of a cardiovascular risk self-screening method was assessed. The results obtained for self-measurement of blood pressure, a point-of-care system’s assessment of lipid profile and glycated hemoglobin, and a self-administered questionnaire (sex, age, diabetes, tobacco consumption were compared with the standard screening (gold standard conducted by a health professional. Methods: Crossover clinical trial on a population-based sample from Girona (north-eastern Spain, aged 35–74, with no

  2. Corrective justice and contract law

    Directory of Open Access Journals (Sweden)

    Martín Hevia

    2010-06-01

    Full Text Available This article suggests that the central aspects of contract law in various jurisdictions can be explained within the idea of corrective justice. The article is divided into three parts. The first part distinguishes between corrective justice and distributive justice. The second part describes contract law. The third part focuses on actions for breach of contract and within that context reflects upon the idea of corrective justice.

  3. Corrective justice and contract law

    OpenAIRE

    Martín Hevia

    2010-01-01

    This article suggests that the central aspects of contract law in various jurisdictions can be explained within the idea of corrective justice. The article is divided into three parts. The first part distinguishes between corrective justice and distributive justice. The second part describes contract law. The third part focuses on actions for breach of contract and within that context reflects upon the idea of corrective justice.

  4. Chronic kidney disease screening methods and its implication for Malaysia: an in depth review.

    Science.gov (United States)

    Almualm, Yasmin; Zaman Huri, Hasniza

    2015-01-01

    Chronic Kidney Disease has become a public health problem, imposing heath, social and human cost on societies worldwide. Chronic Kidney Disease remains asymptomatic till late stage when intervention cannot stop the progression of the disease. Therefore, there is an urgent need to detect the disease early. Despite the high prevalence of Chronic Kidney Disease in Malaysia, screening is still lacking behind. This review discusses the strengths and limitations of current screening methods for Chronic Kidney Disease from a Malaysian point of view. Diabetic Kidney Disease was chosen as focal point as Diabetes is the leading cause of Chronic Kidney Disease in Malaysia. Screening for Chronic Kidney Disease in Malaysia includes a urine test for albuminuria and a blood test for serum creatinine. Recent literature indicates that albuminuria is not always present in Diabetic Kidney Disease patients and serum creatinine is only raised after substantial kidney damage has occurred.  Recently, cystatin C was proposed as a potential marker for kidney disease but this has not been studied thoroughly in Malaysia.  Glomerular Filtration Rate is the best method for measuring kidney function and is widely estimated using the Modification of Diet for Renal Disease equation. Another equation, the Chronic Kidney Disease Epidemiology Collaboration Creatinine equation was introduced in 2009. The new equation retained the precision and accuracy of the Modification of Diet for Renal Disease equation at GFR 60ml/min/1.73m2. In Asian countries, adding an ethnic coefficient to the equation enhanced its performance. In Malaysia, a multi-ethnic Asian population, the Chronic Kidney Disease Epidemiology Collaboration equation should be validated and the Glomerular Filtration Rate should be reported whenever serum creatinine is ordered. Reporting estimated Glomerular Filtration Rate will help diagnose patients who would have been otherwise missed if only albuminuria and serum creatinine are measured.

  5. A Study of Applications of Machine Learning Based Classification Methods for Virtual Screening of Lead Molecules.

    Science.gov (United States)

    Vyas, Renu; Bapat, Sanket; Jain, Esha; Tambe, Sanjeev S; Karthikeyan, Muthukumarasamy; Kulkarni, Bhaskar D

    2015-01-01

    The ligand-based virtual screening of combinatorial libraries employs a number of statistical modeling and machine learning methods. A comprehensive analysis of the application of these methods for the diversity oriented virtual screening of biological targets/drug classes is presented here. A number of classification models have been built using three types of inputs namely structure based descriptors, molecular fingerprints and therapeutic category for performing virtual screening. The activity and affinity descriptors of a set of inhibitors of four target classes DHFR, COX, LOX and NMDA have been utilized to train a total of six classifiers viz. Artificial Neural Network (ANN), k nearest neighbor (k-NN), Support Vector Machine (SVM), Naïve Bayes (NB), Decision Tree--(DT) and Random Forest--(RF). Among these classifiers, the ANN was found as the best classifier with an AUC of 0.9 irrespective of the target. New molecular fingerprints based on pharmacophore, toxicophore and chemophore (PTC), were used to build the ANN models for each dataset. A good accuracy of 87.27% was obtained using 296 chemophoric binary fingerprints for the COX-LOX inhibitors compared to pharmacophoric (67.82%) and toxicophoric (70.64%). The methodology was validated on the classical Ames mutagenecity dataset of 4337 molecules. To evaluate it further, selectivity and promiscuity of molecules from five drug classes viz. anti-anginal, anti-convulsant, anti-depressant, anti-arrhythmic and anti-diabetic were studied. The TPC fingerprints computed for each category were able to capture the drug-class specific features using the k-NN classifier. These models can be useful for selecting optimal molecules for drug design.

  6. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  7. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Gourgari E

    2016-08-01

    Full Text Available Evgenia Gourgari,1 Elias Spanakis,2 Adrian Sandra Dobs3 1Division of Pediatric Endocrinology, Georgetown University School of Medicine, Washington, DC, 2Division of Endocrinology, University of Maryland School of Medicine, 3Department of Endocrinology, Johns Hopkins University School of Medicine, Baltimore, MD, USA Abstract: Polycystic ovary syndrome (PCOS is a syndrome associated with insulin resistance (IR, obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have. Keywords: IR, OGTT, obesity, hyperandrogenism, anovulation, BMI, insulin resistance, PCOS

  8. Understanding Education for Social Justice

    Science.gov (United States)

    Hytten, Kathy; Bettez, Silvia C.

    2011-01-01

    It has become increasingly common for education scholars to claim a social justice orientation in their work. At the same time, education programs seem to be adding statements about the importance of social justice to their mission, and a growing number of teacher education programs are fundamentally oriented around a vision of social justice.…

  9. Corrective Justice vs. Social Justice in the Aftermath of War

    Directory of Open Access Journals (Sweden)

    Pablo Kalmanovitz

    2010-11-01

    Full Text Available How do we justify the practice of corrective justice for losses suffered during armed conflicts? This article seeks to show the force and relevance of this question, and to argue that, in cases of massively destructive wars, social justice should gain priority over corrective justice. Starting from a liberal Rawlsian conception of the relationship between corrective and social justice, it is argued that, paradoxically, the more destructive a war is, the less normative force corrective rights have and the higher priority policies of social justice, which guarantee basic rights to all citizens, should have.

  10. Development of Efficient Screening Methods for Resistant Cucumber Plants to Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Sung Min Hwang

    2014-06-01

    Full Text Available Root-knot nematodes represent a significant problem in cucumber, causing reduction in yield and quality. To develop screening methods for resistance of cucumber to root-knot nematode Meloidogyne incognita, development of root-knot nematode of four cucumber cultivars (‘Dragonsamchuk’, ‘Asiastrike’, ‘Nebakja’ and ‘Hanelbakdadaki’ according to several conditions such as inoculum concentration, plant growth stage and transplanting period was investigated by the number of galls and egg masses produced in each seedling 45 days after inoculation. There was no difference in galls and egg masses according to the tested condition except for inoculum concentration. Reproduction of the nematode on all the tested cultivars according to inoculum concentration increased in a dose-dependent manner. On the basis of the result, the optimum conditions for root-knot development on the cultivars is to transplant period of 1 week, inoculum concentration of 5,000 eggs/plant and plant growth stage of 3-week-old in a greenhouse (25 ± 5°C. In addition, under optimum conditions, resistance of 45 commercial cucumber cultivars was evaluated. One rootstock cultivar, Union was moderately resistant to the root-knot nematode. However, no significant difference was in the resistance of the others cultivar. According to the result, we suggest an efficient screening method for new resistant cucumber to the root-knot nematode, M. incognita.

  11. Prospective memory tasks: a more sensitive method for screening cognitive impairment in ALS?

    Directory of Open Access Journals (Sweden)

    Ji Ying

    2012-11-01

    Full Text Available Abstract Background Cognitive change is prevalent in patients with amyotrophic lateral sclerosis (ALS, but still lack a widely accepted and sensitive screening method. In this study, we try to find a sensitive screening battery for detecting subtle cognitive deficits in patients with ALS. Methods Eighty consecutive ALS patients and 57 matched normal controls underwent the Mini-Mental Status Examination (MMSE, the verbal fluency test (VFT, the Stroop Color Word Interference Test (CWT, and the prospective memory (PM tests, including event-based (EBPM and time-based (TBPM. Results The patients did not differ from the controls in the MMSE, the VFT and the CWT. By contrast, statistically significant differences were found in the PM tests (EBPM: P=0.043; TBPM: P Conclusions Prefrontal lobar dysfunction does exist among ALS patients and may spread from the medial to the lateral region. The PM tests seem more sensitive in ALS patients with frontotemporal dysfunction than are the classical cognitive measures.

  12. Agreement Between Visual Inspection with Acetic Acid and Papanicolaous Smear as Screening Methods for Cervical Cancer

    International Nuclear Information System (INIS)

    Naz, U.; Hanif, S.

    2014-01-01

    Objective: To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaous (Pap) smear as screening methods for cervical cancer. Study Design: A cross-sectional study. Place and Duration of Study: Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Methodology: Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaous smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Results: Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. Conclusion: There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings. (author)

  13. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  14. Robust Microplate-Based Methods for Culturing and in Vivo Phenotypic Screening of Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Timothy C. Haire

    2018-03-01

    Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.

  15. Criminal Justice in America.

    Science.gov (United States)

    Croddy, Marshall; And Others

    An introduction to criminal law, processes, and justice is provided in this high school level text. Content is divided into six chapters, each treating a particular aspect of criminal procedure and the social and political issues surrounding it. Chapter 1 considers the criminal, the effects of crime on its victims, and legislation to aid victims.…

  16. The Social Justice Perspective

    Science.gov (United States)

    Loewen, Gladys; Pollard, William

    2010-01-01

    This article shines an important light on the continuing struggle of disabled people for dignity, citizenship rights, and access to the marketplace. Common threads bind the struggle for basic human rights among disenfranchised groups, offer experience and approaches to facilitate change, and move society towards social justice. The philosophy…

  17. Criminal Justice Web Sites.

    Science.gov (United States)

    Dodge, Timothy

    1998-01-01

    Evaluates 15 criminal justice Web sites that have been selected according to the following criteria: authority, currency, purpose, objectivity, and potential usefulness to researchers. The sites provide narrative and statistical information concerning crime, law enforcement, the judicial system, and corrections. Searching techniques are also…

  18. Publicity and Egalitarian Justice

    DEFF Research Database (Denmark)

    Lippert-Rasmussen, Kasper

    2008-01-01

    Recently, the issue of publicity has surfaced in discussions of the correct interpretation of the Rawlsian principles of justice. In an intriguing critique of G.A. Cohen's preferred interpretation of the difference principle as a principle that is incompatible with incentive-based inequalities...

  19. The Child Justice Act

    African Journals Online (AJOL)

    Stephan

    1995-06-16

    Jun 16, 1995 ... Gallinetti "Child Justice" 648; Le Roux-Kemp 2008 Annual Survey of South African Law 298 (the. Act contains a "separate, but parallel, ... The various aspects of section 68 are then evaluated. The greatest challenges lie in the ... See also, eg, Picardi Hotels v Thekwini. Properties 2009 1 SA 493 (SCA) para ...

  20. Pharmacy diabetes care program: analysis of two screening methods for undiagnosed type 2 diabetes in Australian community pharmacy.

    Science.gov (United States)

    Krass, I; Mitchell, B; Clarke, P; Brillant, M; Dienaar, R; Hughes, J; Lau, P; Peterson, G; Stewart, K; Taylor, S; Wilkinson, J; Armour, C

    2007-03-01

    To compare the efficacy and cost-effectiveness of two methods of screening for undiagnosed type 2 diabetes in Australian community pharmacy. A random sample of 30 pharmacies were allocated into two groups: (i) tick test only (TTO); or (ii) sequential screening (SS) method. Both methods used the same initial risk assessment for type 2 diabetes. Subjects with one or more risk factors in the TTO group were offered a referral to their general practitioner (GP). Under the SS method, patients with risk factors were offered a capillary blood glucose test and those identified as being at risk referred to a GP. The effectiveness and cost-effectiveness of these approaches was assessed. A total of 1286 people were screened over a period of 3 months. The rate of diagnosis of diabetes was significantly higher for SS compared with the TTO method (1.7% versus 0.2%; p=0.008). The SS method resulted in fewer referrals to the GP and a higher uptake of referrals than the TTO method and so was the more cost-effective screening method. SS is the superior method from a cost and efficacy perspective. It should be considered as the preferred option for screening by community based pharmacists in Australia.

  1. A rapid screening method for heavy metals in biological materials by emission spectroscopy.

    Science.gov (United States)

    Blacklock, E C; Sadler, P A

    1981-06-02

    A semi-quantitative screening method for heavy metals in biological material is described. The metals are complexed with ammonium pyrrolidine dithiocarbamate, sodium diethyl dithiocarbamate and potassium sodium tartrate. The solutions are adjusted to pH 4 and then extracted into chloroform. The chloroform phase is evaporated onto a matrix mixture of lithium fluoride and graphite. The sample is analysed by direct current arc emission spectroscopy using a 3 metre grating spectrograph. The spectra are recorded on a photographic plate. The method is developed on aqueous and spiked samples and then applied to in vivo samples containing toxic levels of heavy metals. Atomic absorption spectroscopy is used to check standard concentrations and to monitor the efficiency of the extraction procedure.

  2. Research on atmospheric transmission distortion of Gauss laser using multiple phase screen method

    Science.gov (United States)

    Zhang, Yizhuo; Wang, Qiushi; Gu, Haidong

    2018-02-01

    The laser beam is attenuated, broadened, defocused and may even be deflected from its initial propagation direction as it propagates through the atmosphere. It leads to the decrease of the laser intensity of the receiving surface. Gauss beam is the fundamental components of all possible laser waveforms. Therefore, research on the transmission of the Gauss laser has far-reaching consequences in optical communication, weaponry, target designation, ranging, remote sensing and other applications that require transmission of laser beams through the atmosphere. In this paper, we propose a laboratory simulation method using multi-phase screen to calculate the effects of atmospheric turbulence. Theoretical analysis of Gauss laser transmission in the atmosphere is given. By calculating the propagation of the Gauss beam TEM00, the far field intensity and phase distribution is shown. By the given method, the optical setup is presented and used for optimizing the adaptive optics algorithm.

  3. Qualitative screening method for pesticide residues detection in fruits and vegetables

    Directory of Open Access Journals (Sweden)

    Iván Mauricio Huérfano Barco

    2018-01-01

    Full Text Available Because of the importance of developing methodologies that allow agricultural residues analysis, a rapid screening qualitative method for the determination of pesticides residues in fruits and vegetables was validated. The methodology was based on the European QuEChERS extraction method with an additional cleaning step by gel permeation chromatography (GPC, which helped to reduce the number of matrix components in the final extract. The analysis was carried out by gas chromatography coupled to mass spectrometry with a single quadrupole analyzer. The methodology was appropriate for the qualitative analysis of 31 pesticides at their respective maximum residue limits. Consistent results were obtained with respect to a quantitative routine methodology in the analysis of real samples, hence the methodology was proven to be a good alternative for the fast analysis of these contaminants in fruits and vegetables.

  4. Evaluation of Dried Urine Spot Method to Screen Cotinine among Tobacco Dependents: An Exploratory Study.

    Science.gov (United States)

    Jain, Raka; Quraishi, Rizwana; Verma, Arpita

    2017-01-01

    Assessment of cotinine, a metabolite of nicotine in body fluids, is an important approach for validating the self-report among tobacco users. Adaptation of assays on dried urine spots (DUSs) has advantages of ease of collection, transportation, minimal invasiveness, and requirement of small volume. The aim of the present study was to develop an efficient method for testing cotinine in DUSs and evaluating its clinical applicability. This involved optimization of conditions for detection, recovery, and stability of cotinine from dried urine, spotted on filter paper. Enzyme-linked immunosorbent assay was used for screening, whereas confirmation was done by gas chromatography. For clinical applicability, urine samples of tobacco users were tested. Water was found to be a suitable extracting solvent as compared to carbonate-bicarbonate buffer (pH 9.2) and saline. Screening was achieved by two punches taken from a 20 μl (diameter 1.3 cm) spotted urine samples, and confirmation was achieved by five complete circles each of 20 μl sample volume. The recovery was found to be 97% in water. Limit of detection for the method was found to be 100 ng/ml. No signs of significant degradation were found under all storage conditions. All the urine samples of tobacco users were found to be positive by a conventional method as well as DUSs, and the method proved to be efficient. DUS samples are a useful alternative for biological monitoring of recent nicotine use, especially in developing countries where sample logistics could be an important concern.

  5. Ultrasound surface probe as a screening method for evaluating the patients with blunt abdominal trauma

    Directory of Open Access Journals (Sweden)

    Mohammad Nasr-Esfahani

    2014-01-01

    Full Text Available Background: Blunt abdominal trauma is one of the causes of mortality in emergency department. Free fluid in the abdomen due to intra-abdominal blunt trauma can be determined by the surface probe of ultrasound. Since the importance of this free fluid in hemodynamic stable patients with blunt trauma is associated with the unknown outcome for surgeons, this study was performed to evaluate the role of ultrasound surface probe as a screening method in evaluating the patients with blunt abdominal trauma. Materials and Methods: A descriptive-analytical study was done on 45 patients with blunt abdominal trauma and hemodynamic stability. The patients were evaluated twice during the three-hours, including repeated ultrasound surface probe and clinical examinations. Computerized tomography was also performed. The patients were divided based on the amount of the free fluid in the abdomen during the evaluations into two groups: Fixed or increased, and decreased free fluid. The results of the different evaluated methods were compared using the sensitivity and specificity. Results: From 17 patients with CT abnormalities, free fluid increased in 14 patients (82.4%. Free fluid was decreased in three patients who were discharged well from the surgery service without any complication. Surface probe in prognosis detection had a sensitivity of 82.4% and specificity of 92.9%. The percentage of false positive and negative ultrasound compared with CT scan was 7.1% and 17.6%. Also, positive and negative predictive value of the ultrasound with surface probe was 87.5% and 89.7% respectively. Conclusion: The use of the ultrasound with surface probe in the diagnosis of free fluid in blunt abdominal trauma in hemodynamic stable patients can be considered as a useful screening method.

  6. Transitional Justice as Elite Justice? Compromise Justice and Transition in Tunisia

    NARCIS (Netherlands)

    Lamont, Christopher; Pannwitz, Hannah

    2016-01-01

    This article reflects upon the ways in which transitional justice debates and processes impacted Tunisia's transition. It explores key questions such as what demands for justice emerged in the aftermath of the Tunisian revolution? Did Tunisia's transitional justice process reflect these demands?

  7. Setting standards of restorative justice

    Directory of Open Access Journals (Sweden)

    Kostić Miomira

    2007-01-01

    Full Text Available In the article the author deals with the basic theoretical statements and discussions about the practical use of restorative justice. She discusses the questions of introducing and application of restorative justice in order to reach the balance of interests between a victim, society and a delinquent. There is no unique statement about the restorative justice concept, so the authors make this concept by listing certain activities with rispect of standards and principles. Also she emphasizes the values of restorative justice process. A part of the article is dedicated to the standards for restorative justice that are harmonized with the international documents of human rights. .

  8. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-11-10

    Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemann–Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between existing

  9. The Relationship between Organizational Justice and Turnover Intention: A Survey on Hospital Nurses

    Directory of Open Access Journals (Sweden)

    Mobin Sokhanvar

    2016-04-01

    Full Text Available Introduction: High organizational justice and its factors are associated with reduced turnover intention. Therefore, in this study, we aimed to examine the relationship between organizational justice and turnover intention among hospital nurses. Materials and Methods: This descriptive, analytical study was conducted on 135 nurses working in Labafi Nejad Hospital in Tehran, Iran, 2015. The data were collected using Beugre's (1998 questionnaire of organizational justice questionnaire. To analyze the data, Pearson’s correlation and ANOVA tests were performed using SPSS, version 20. Results: Mean organizational justice and turnover intention scores were 68.85±7.67 and 47.8±12.47, respectively. Among the different types of organizational justice, the highest mean score was pertinent to interactional justice (75.24±16.68. A significant inverse correlation was observed between turnover intention and organizational justice (r=-0.36, interactional justice (r=-0.38, and procedural justice (r=-0.36, while no association was noted between turnover intention and systemic and distributive types of justice. Furthermore, there was no link between demographic variables, organizational justice, and turnover intention. Conclusion: Considering the prominent role of organizational justice in personnel’s intention to leave their job, and given high costs of recruiting and training new staff, managers should pay especial attention to promoting justice and employees’ satisfaction and enhancing stability in their organizations by reinforcing positive attitudes in the employees.

  10. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D.; Smirnakis, Stelios; Aslanides, Ioannis M.

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  11. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D; Smirnakis, Stelios; Aslanides, Ioannis M

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  12. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Directory of Open Access Journals (Sweden)

    Ioannis Smyrnakis

    Full Text Available Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6% and 30 out of 32 readers with dyslexia (sensitivity 93.8% were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a

  13. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  14. An effective method to screen sodium-based layered materials for sodium ion batteries

    Science.gov (United States)

    Zhang, Xu; Zhang, Zihe; Yao, Sai; Chen, An; Zhao, Xudong; Zhou, Zhen

    2018-03-01

    Due to the high cost and insufficient resource of lithium, sodium-ion batteries are widely investigated for large-scale applications. Typically, insertion-type materials possess better cyclic stability than alloy-type and conversion-type ones. Therefore, in this work, we proposed a facile and effective method to screen sodium-based layered materials based on Materials Project database as potential candidate insertion-type materials for sodium ion batteries. The obtained Na-based layered materials contains 38 kinds of space group, which reveals that the credibility of our screening approach would not be affected by the space group. Then, some important indexes of the representative materials, including the average voltage, volume change and sodium ion mobility, were further studied by means of density functional theory computations. Some materials with extremely low volume changes and Na diffusion barriers are promising candidates for sodium ion batteries. We believe that our classification algorithm could also be used to search for other alkali and multivalent ion-based layered materials, to accelerate the development of battery materials.

  15. Benchmarking Methods and Data Sets for Ligand Enrichment Assessment in Virtual Screening

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2014-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. “analogue bias”, “artificial enrichment” and “false negative”. In addition, we introduced our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylase (HDAC) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The Leave-One-Out Cross-Validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased in terms of property matching, ROC curves and AUCs. PMID:25481478

  16. Benchmarking methods and data sets for ligand enrichment assessment in virtual screening.

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. "analogue bias", "artificial enrichment" and "false negative". In addition, we introduce our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylases (HDACs) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The leave-one-out cross-validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased as measured by property matching, ROC curves and AUCs. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. The impact of training interventions on organizational readiness to support innovations in juvenile justice offices.

    Science.gov (United States)

    Taxman, Faye S; Henderson, Craig; Young, Doug; Farrell, Jill

    2014-03-01

    Clinical trials on technology transfer models are rare, even with the interest in advancing the uptake of evidence-based practices in social service agencies. This article presents the results from a trial examining different transfer strategies to assist juvenile justice caseworkers in using screening, assessment, and case planning practices to address mental health and substance use needs. Study findings examine factors that promote organizational readiness. A clinical trial was conducted examining the impact of three post-training strategies: an external coach to build the social network of the justice office (build social climate), an external coach to educate staff (build skills and knowledge), and a control condition consisting of traditional management directives (directives to staff of agency priorities). All groups were exposed to a 1 day refresher course in motivational interviewing. The social network and skill building groups also attended an intensive 3-day training followed by three on-site booster sessions over a 12 month period of time. Twelve juvenile justice offices (with their 231 juvenile justice staff) were assigned to one of three conditions. The study examined the impact of different transfer conditions on organizational readiness to implement the innovation of screening, assessment, and referral strategies. External coaching targeting the social climate of the justice office to support innovations improved organizational readiness to change, regardless of office size. Coaching that targeted either the social climate or staff knowledge and skills both improved organizational readiness for change compared to management directives, but social climate coaching resulted in greater improvements in receptivity to change. No individual level features of case workers (e.g., age, gender, years of experience) significantly predicted organizational readiness to change. Unexpectedly, the skill and knowledge building approach did not perform any better

  18. Statistical methods for the analysis of a screening test for chronic beryllium disease

    Energy Technology Data Exchange (ETDEWEB)

    Frome, E.L.; Neubert, R.L. [Oak Ridge National Lab., TN (United States). Mathematical Sciences Section; Smith, M.H.; Littlefield, L.G.; Colyer, S.P. [Oak Ridge Inst. for Science and Education, TN (United States). Medical Sciences Div.

    1994-10-01

    The lymphocyte proliferation test (LPT) is a noninvasive screening procedure used to identify persons who may have chronic beryllium disease. A practical problem in the analysis of LPT well counts is the occurrence of outlying data values (approximately 7% of the time). A log-linear regression model is used to describe the expected well counts for each set of test conditions. The variance of the well counts is proportional to the square of the expected counts, and two resistant regression methods are used to estimate the parameters of interest. The first approach uses least absolute values (LAV) on the log of the well counts to estimate beryllium stimulation indices (SIs) and the coefficient of variation. The second approach uses a resistant regression version of maximum quasi-likelihood estimation. A major advantage of the resistant regression methods is that it is not necessary to identify and delete outliers. These two new methods for the statistical analysis of the LPT data and the outlier rejection method that is currently being used are applied to 173 LPT assays. The authors strongly recommend the LAV method for routine analysis of the LPT.

  19. A cost-effective screening method for pesticide residue analysis in fruits, vegetables, and cereal grains.

    Science.gov (United States)

    Ambrus, A; Füzesi, I; Susán, M; Dobi, D; Lantos, J; Zakar, F; Korsós, I; Oláh, J; Beke, B B; Katavics, L

    2005-01-01

    This paper reports the results of studies performed to investigate the potential of applying thin layer chromatography (TLC) detection in combination with selected extraction and cleanup methods, for providing an alternative cost-effective analytical procedure for screening and confirmation of pesticide residues in plant commodities. The extraction was carried out with ethyl acetate and an on-line extraction method applying an acetone-dichloromethane mixture. The extracts were cleaned up with SX-3 gel, an adsorbent mixture of active carbon, magnesia, and diatomaceous earth, and on silica micro cartridges. The Rf values of 118 pesticides were tested in eleven elution systems with UV, and eight biotest methods and chemical detection reagents. Cabbage, green peas, orange, and tomatoes were selected as representative sample matrices for fruits and vegetables, while maize, rice, and wheat represented cereal grains. As an internal quality control measure, marker compounds were applied on each plate to verify the proper elution and detection conditions. The Rf values varied in the different elution systems. The best separation (widest Rf range) was achieved with silica gel (SG)--ethyl acetate (0.05-0.7), SG--benzene, (0.02-0.7) and reverse phase RP-18 F-254S layer with acetone: methanol: water/30:30:30 (v/v) (0.1-0.8). The relative standard deviation of Rf values (CV(Rf)) within laboratory reproducibility was generally less than 20%, except below 0.2 Rf, where the CVRf rapidly increased with decreasing Rf values. The fungi spore inhibition, chloroplast inhibition, and enzyme inhibition were found most suitable for detection of pesticides primarily for confirming their identity or screening for known substances. Their use for determination of pesticide residues in samples of unknown origin is not recommended.

  20. An Improved Method for P2X7R Antagonist Screening.

    Directory of Open Access Journals (Sweden)

    Rômulo José Soares-Bezerra

    Full Text Available ATP physiologically activates the P2X7 receptor (P2X7R, a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites, this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG and oxidized ATP (OATP. The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  1. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  2. The use of graph theory in the sensitivity analysis of the model output: a second order screening method

    International Nuclear Information System (INIS)

    Campolongo, Francesca; Braddock, Roger

    1999-01-01

    Sensitivity analysis screening methods aim to isolate the most important factors in experiments involving a large number of significant factors and interactions. This paper extends the one-factor-at-a-time screening method proposed by Morris. The new method, in addition to the 'overall' sensitivity measures already provided by the traditional Morris method, offers estimates of the two-factor interaction effects. The number of model evaluations required is O(k 2 ), where k is the number of model input factors. The efficient sampling strategy in the parameter space is based on concepts of graph theory and on the solution of the 'handcuffed prisoner problem'

  3. Making Commitments to Racial Justice Actionable

    Science.gov (United States)

    Diab, Rasha; Ferrel, Thomas; Godbee, Beth; Simpkins, Neil

    2013-01-01

    In this article, we articulate a framework for making our commitments to racial justice actionable, a framework that moves from narrating confessional accounts to articulating our commitments and then acting on them through both self-work and work-with-others, a dialectic possibility we identify and explore. We model a method for moving beyond…

  4. Restorative Justice for Discipline with Respect

    Science.gov (United States)

    Chmelynski, Carol

    2005-01-01

    Expulsion is commonly schools' last resort to maintain discipline and keep schools safe. But increasingly, educators are turning to "restorative justice"--an alternative method from the field of criminology--with promising results. According to Randall Comfort, assistant upper-school director, Mounds Park Academy, St. Paul, Minnesota, using this…

  5. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Avonto, Cristina; Chittiboyina, Amar G. [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Rua, Diego [The Center for Food Safety and Applied Nutrition, US Food and Drug Administration, College Park, MD 20740 (United States); Khan, Ikhlas A., E-mail: ikhan@olemiss.edu [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Division of Pharmacognosy, Department of BioMolecular Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States)

    2015-12-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  6. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    International Nuclear Information System (INIS)

    Avonto, Cristina; Chittiboyina, Amar G.; Rua, Diego; Khan, Ikhlas A.

    2015-01-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  7. Toxic torts: science, law, and the possibility of justice

    National Research Council Canada - National Science Library

    Cranor, Carl F

    2006-01-01

    ..., lower deterrence for wrongful conduct and harmful products, and decrease the possibility of justice for citizens injured by toxic substances. Even if courts review evidence well, greater judicial scrutiny increases litigation costs and attorney screening of clients and decreases citizens' access to the law. This book introduces these issues, reveals ...

  8. Equality in the Framework of Justice

    OpenAIRE

    Aşik, Kübra

    2015-01-01

    This thesis assesses the relation between equality and justice by exploring and identifying the relation between equality and justice in Rawls's theory of justice, Sandel's communitarian account of Justice and Sen's capability approach. And these accounts of justice are evaluated from an egalitarian point of view. The main argument defended in the thesis is that justice requires equality. Accordingly, these three accounts of justice are evaluated by taking their understanding of equality into...

  9. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A.

    Science.gov (United States)

    Wu, Lin; Li, Huijun; Tang, Tianle

    2017-01-24

    Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence) protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21) and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris . Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C), induction time (4 h, 5 h, 6 h and 7 h) and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L). The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very suitable for

  10. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A

    Directory of Open Access Journals (Sweden)

    Lin Wu

    2017-01-01

    Full Text Available Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21 and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris. Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C, induction time (4 h, 5 h, 6 h and 7 h and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L. The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very

  11. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust

    International Nuclear Information System (INIS)

    Rosati, Jacky A.; Bern, Amy M.; Willis, Robert D.; Blanchard, Fredrick T.; Conner, Teri L.; Kahn, Henry D.; Friedman, David

    2008-01-01

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation

  12. Reconstruction of on-axis lensless Fourier transform digital hologram with the screen division method

    Science.gov (United States)

    Jiang, Hongzhen; Liu, Xu; Liu, Yong; Li, Dong; Chen, Zhu; Zheng, Fanglan; Yu, Deqiang

    2017-10-01

    An effective approach for reconstructing on-axis lensless Fourier Transform digital hologram by using the screen division method is proposed. Firstly, the on-axis Fourier Transform digital hologram is divided into sub-holograms. Then the reconstruction result of every sub-hologram is obtained according to the position of corresponding sub-hologram in the hologram reconstruction plane with Fourier transform operation. Finally, the reconstruction image of on-axis Fourier Transform digital hologram can be acquired by the superposition of the reconstruction result of sub-holograms. Compared with the traditional reconstruction method with the phase shifting technology, in which multiple digital holograms are required to record for obtaining the reconstruction image, this method can obtain the reconstruction image with only one digital hologram and therefore greatly simplify the recording and reconstruction process of on-axis lensless Fourier Transform digital holography. The effectiveness of the proposed method is well proved with the experimental results and it will have potential application foreground in the holographic measurement and display field.

  13. Establishment of cocrystal cocktail grinding method for rational screening of pharmaceutical cocrystals.

    Science.gov (United States)

    Yamamoto, Katsuhiko; Tsutsumi, Shunichirou; Ikeda, Yukihiro

    2012-11-01

    Cocrystals (CCs) used in the pharmaceutical industry are defined as complex crystals formed by reaction between an API and a cocrystal former (CCF); unlike salts, CCs do not show proton transfer. Recently, pharmaceutical CCs have been used to improve the drug-likeness of APIs, such as solubility and stability. Grinding is more effective for CC synthesis than crystallization from solution because in the former case, the API can predominantly interact with the CCF without being affected by solvents. However, this method is tedious because the API is ground with only one CCF at a time. We developed a cocktail cocrystal grinding (CCG) method, in which a mixture of CCFs having the same functional group was used. No false negatives/positives were observed in CCG when carbamazepine was used as the model compound. This method could be used to obtain CCs of piroxicam and spironolactone. False negatives were observed for only one compound from among three model compounds, indicating that CCG facilitates efficient CC detection and that it has higher throughput than does the conventional method. Further, CCG is fast and suitable for rational CC screening, and it helps identify the partial structure of CCFs that forms synthons with an API. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Gas evolution as a rapid screening method for detection of irradiated foods

    International Nuclear Information System (INIS)

    Roberts, P.B.; Chambers, D.M.; Brailsford, G.W.

    1996-01-01

    A number of detection methods for irradiated foods are in advanced state of development. No single method is likely to be universally applicable but a battery of tests such as thermoluminescence, electron spin resonance and analysis of lipid radiolytic products may soon be available for most foods and technical uses of irradiation. Most of these proposed tests require relatively sophisticated equipment or technical skills and are often time consuming and costly. There would be value in relatively simple tests which could be used as a rapid screening system or confirmatory method. The literature on the use of radiolytic gases as a detection method is limited and this paper extends the above studies. In particular, it extends the work to frozen shellfish, for which irradiation has been used as a commercial decontaminant technique for many years, and considers the effect of storage temperature. Work on poultry is also reported as a cross-reference to earlier work and because irradiated poultry has recently been released into the US retail trade. (author)

  15. A method for screening for the risk of chronic effects of surface water pollution.

    Science.gov (United States)

    Soldán, Přemysl; Badurová, Jana

    2013-01-01

    The article describes a method for screening for the risk of chronic surface water pollution which was developed at the T. G. Masaryk Water Research Institute. The approach, which is based on exotoxicological analyses, can be classed as a rapid method of assessment. The degree of risk of chronic effects surface water pollution is determined from an evaluation of two major parameters-toxicity and genotoxicity. As the method utilizes relative simple procedures for sample collection, pretreatment of the sample, chemical analyses, bioassays and results assessment, this approach is suitable for widespread practical use. Extensive utilization of this approach for assessing river basins in the Czech Republic has proved its suitability for a more sophisticated detection of the biological impact of surface water pollution. This is documented in the article where the method is used in a study of the Bílina River, and in the overview of the results of the risk assessment of chronic effects of surface water pollution in selected sections of three international river basins in the Czech Republic.

  16. Quick screening for new flux pinning materials in YBCO films with the combinatorial-PLD method

    International Nuclear Information System (INIS)

    Yoshimura, T.; Ichino, Y.; Yoshida, Y.; Takai, Y.; Kita, R.; Suzuki, K.; Takeuchi, T.

    2011-01-01

    An effective way to improve the superconducting properties in REBa 2 Cu 3 O y (REBCO) films under a magnetic field is to dope artificial pinning centers (APC). The pinning performance depends on the content of the APC materials. Usually, the optimal APC content is explored by preparing films one at a time from the REBCO target using different APC material content, which is an extremely time-consuming process. The combinatorial-PLD (C-PLD) method allowed us to prepare films that continuously changed in composition across a single substrate. In this study, we used the C-PLD method to prepare BaSnO 3 (BSO)-doped YBCO films. The films were deposited on SrTiO 3 substrate using a fourth-harmonic Nd:YAG laser. From the results of the J c -B curves at 77 K and B//c, the film that contained 3.2 vol.% of BSO exhibited the best pinning performance in this study. We showed that the C-PLD method was efficient for quick screening of the optimal APC content with only one deposition. We also used the C-PLD method to explore new APC materials, and proved that it can quickly evaluate the new APC materials Ba 3 Cu 3 In 4 O 12 and BaTbO 3 .

  17. Infrared thermography based on artificial intelligence as a screening method for carpal tunnel syndrome diagnosis.

    Science.gov (United States)

    Jesensek Papez, B; Palfy, M; Mertik, M; Turk, Z

    2009-01-01

    This study further evaluated a computer-based infrared thermography (IRT) system, which employs artificial neural networks for the diagnosis of carpal tunnel syndrome (CTS) using a large database of 502 thermal images of the dorsal and palmar side of 132 healthy and 119 pathological hands. It confirmed the hypothesis that the dorsal side of the hand is of greater importance than the palmar side when diagnosing CTS thermographically. Using this method it was possible correctly to classify 72.2% of all hands (healthy and pathological) based on dorsal images and > 80% of hands when only severely affected and healthy hands were considered. Compared with the gold standard electromyographic diagnosis of CTS, IRT cannot be recommended as an adequate diagnostic tool when exact severity level diagnosis is required, however we conclude that IRT could be used as a screening tool for severe cases in populations with high ergonomic risk factors of CTS.

  18. Fast method and ultra fast screening for determination of 90Sr in milk and dairy products

    International Nuclear Information System (INIS)

    Kabai, E.; Hornung, L.; Savkin, B.T.; Poppitz-Spuhler, A.; Hiersche, L.

    2011-01-01

    In emergency situation or in case of defence against nuclear hazards, the rapid analysis of radioisotopes in food products is essential. Radiostrontium is one of the most interesting isotopes in case of emergency. The determination of radiostrontium in milk and dairy products plays an important role especially for infants. The procedures described here were tested for fast determination of 90 Sr. The typical chemical recovery of the proposed fast procedure for determination of strontium from milk and dairy products was 90% and the time needed for analysis was one working day. The achieved detection limit for milk is 0.8 Bq/l. An ultra fast screening method allows the determination of radiostrontium with quantitative recovery within 1 hour. The minimum detectable activity in this case is 230 Bq/l.

  19. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  20. Noninvasive Assessment of Excessive Erythrocytosis as a Screening Method for Chronic Mountain Sickness at High Altitude.

    Science.gov (United States)

    Vyas, Kaetan J; Danz, David; Gilman, Robert H; Wise, Robert A; León-Velarde, Fabiola; Miranda, J Jaime; Checkley, William

    2015-06-01

    Vyas, Kaetan J., David Danz, Robert H. Gilman, Robert A. Wise, Fabiola León-Velarde, J. Jaime Miranda, and William Checkley. Noninvasive assessment of excessive erythrocytosis as a screening method for chronic mountain sickness at high altitude. High Alt Med Biol 16:162-168, 2015.--Globally, over 140 million people are at risk of developing chronic mountain sickness, a common maladaptation to life at high altitude (>2500 meters above sea level). The diagnosis is contingent upon the identification of excessive erythrocytosis (EE). Current best practices to identify EE require a venous blood draw, which is cumbersome for large-scale surveillance. We evaluated two point-of-care biomarkers to screen for EE: noninvasive spot-check tests of total hemoglobin and oxyhemoglobin saturation (Pronto-7, Masimo Corporation). We conducted paired evaluations of total serum hemoglobin from a venous blood draw and noninvasive, spot-check testing of total hemoglobin and oxyhemoglobin saturation with the Pronto-7 in 382 adults aged ≥35 years living in Puno, Peru (3825 meters above sea level). We used the Bland-Altman method to measure agreement between the noninvasive hemoglobin assessment and the gold standard lab hemoglobin analyzer. Mean age was 58.8 years and 47% were male. The Pronto-7 test was unsuccessful in 21 (5%) participants. Limits of agreement between total hemoglobin measured via venous blood draw and the noninvasive, spot-check test ranged from -2.8 g/dL (95% CI -3.0 to -2.5) to 2.5 g/dL (95% CI 2.2 to 2.7), with a bias of -0.2 g/dL (95% CI -0.3 to -0.02) for the difference between total hemoglobin and noninvasive hemoglobin concentrations. Overall, the noninvasive spot-check test of total hemoglobin had a better area under the receiver operating characteristic curve compared to oxyhemoglobin saturation for the identification of EE as measured by a gold standard laboratory hemoglobin analyzer (0.96 vs. 0.82; p<0.001). Best cut-off values to screen for EE with

  1. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    Science.gov (United States)

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

  2. Genetics and Justice: Must One Theory Fit All Contexts?

    Science.gov (United States)

    Gunson, Darryl

    2018-04-01

    Appeals to social justice that argue medicine and healthcare should have certain priorities and not others are common. It is an obvious question to ask: What does social justice demand of the new genetic technologies? However, it is important to note that there are many theories and sub-theories of justice. There are utilitarian theories, libertarian theories, and egalitarian theories. There are so-called luck egalitarians, equality-as-fairness thinkers, and capability theorists, with each having his or her own distinctive approach to the distribution of medical goods and technologies, and to healthcare priorities. This article argues that the discussion surrounding this question is potentially hampered by an implicit assumption that if one theory of justice is applicable in one context, then it must also be applicable in others. Instead, it is proposed that one adopt the stance, influenced by Michael Waltzer, that different theories with their opposing principles may be applicable to different questions regarding justice and genetics. The specific view advanced is that to answer questions about what justice requires regarding the therapeutic and enhancement use of genetic techniques, a method of reflective equilibrium can show how intuitions, in context, may support different theories of justice. When particular pre-theoretic ethical judgments are balanced against the theories that might explain or justify them, and are in accord with what seems emotionally acceptable, then it can be seen how different general theories may be applicable in the different contexts in which questions of justice and genetics arise.

  3. Choosing children: intergenerational justice?

    Science.gov (United States)

    Doyal, Len; McLean, Sheila

    2005-03-01

    In this discussion, we argue that the concept of intergenerational justice, usually used in environmental matters, is applicable to reproductive decisions also. Additionally, we propose that this permits certain reproductive choices to be made prior to conception or during the pregnancy, and that these choices should not be confined to clinical concerns. In particular, we argue that consideration of the interests of future children should be viewed from the perspective of objective well-being. That being the case, decisions about the sex of future offspring can, in terms of intergenerational justice, be legitimate. We do not argue that every reproductive choice is legitimate; for example it would not be legitimate deliberately to choose characteristics that prevent future children from potentially successful participation in social life.

  4. Rapid, convenient method for screening imidazole-containing compounds for heme oxygenase inhibition.

    Science.gov (United States)

    Vlahakis, Jason Z; Rahman, Mona N; Roman, Gheorghe; Jia, Zongchao; Nakatsu, Kanji; Szarek, Walter A

    2011-01-01

    Sensitive assays for measuring heme oxygenase activity have been based on the gas-chromatographic detection of carbon monoxide using elaborate, expensive equipment. The present study describes a rapid and convenient method for screening imidazole-containing candidates for inhibitory activity against heme oxygenase using a plate reader, based on the spectroscopic evaluation of heme degradation. A PowerWave XS plate reader was used to monitor the absorbance (as a function of time) of heme bound to purified truncated human heme oxygenase-1 (hHO-1) in the individual wells of a standard 96-well plate (with or without the addition of a test compound). The degradation of heme by heme oxygenase-1 was initiated using l-ascorbic acid, and the collected relevant absorbance data were analyzed by three different methods to calculate the percent control activity occurring in wells containing test compounds relative to that occurring in control wells with no test compound present. In the cases of wells containing inhibitory compounds, significant shifts in λ(max) from 404 to near 412 nm were observed as well as a decrease in the rate of heme degradation relative to that of the control. Each of the three methods of data processing (overall percent drop in absorbance over 1.5h, initial rate of reaction determined over the first 5 min, and estimated pseudo first-order reaction rate constant determined over 1.5h) gave similar and reproducible results for percent control activity. The fastest and easiest method of data analysis was determined to be that using initial rates, involving data acquisition for only 5 min once reactions have been initiated using l-ascorbic acid. The results of the study demonstrate that this simple assay based on the spectroscopic detection of heme represents a rapid, convenient method to determine the relative inhibitory activity of candidate compounds, and is useful in quickly screening a series or library of compounds for heme oxygenase inhibition

  5. Criminal Justice Transitions

    OpenAIRE

    McAra, Lesley; McVie, Susan

    2007-01-01

    This report explores transitions into the adult criminal justice system amongst a large cohort of young people who were involved in the Edinburgh Study of Youth Transitions and Crime. It includes: a description of patterns of criminal convictions and disposals for young people up to age 19 (on average); an examination of the characteristics and institutional histories of cohort members with a criminal record as compared with youngsters with no such record; and an exploration of the profile of...

  6. Climate Change Justice

    OpenAIRE

    Sunstein, Cass R.; Posner, Eric A.

    2007-01-01

    Greenhouse gas reductions would cost some nations much more than others and benefit some nations far less than others. Significant reductions would impose especially large costs on the United States, and recent projections suggest that the United States has relatively less to lose from climate change. In these circumstances, what does justice require the United States to do? Many people believe that the United States is required to reduce its greenhouse gas emissions beyond the point that is ...

  7. Development and exploitation of the slit method for the characterization of x-ray screen-film combinations

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    For the determination of the modulation transfer function (MTF) of screen-film combinations which are used in medical x-ray diagnostics a measuring method has been developed: the screen-film combination is exposed to x-rays behind a thin slit and the modulation transfer function is calculated from the resulting rather broad slit images on the film. After solving many technical and photographic problems, the slit method provides high precision in the MTF determination. The only objection against this method is the necessary high dose variation which has to be provided by the x-ray machine

  8. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  9. Screening possible solid electrolytes by calculating the conduction pathways using Bond Valence method

    Science.gov (United States)

    Gao, Jian; Chu, Geng; He, Meng; Zhang, Shu; Xiao, RuiJuan; Li, Hong; Chen, LiQuan

    2014-08-01

    Inorganic solid electrolytes have distinguished advantages in terms of safety and stability, and are promising to substitute for conventional organic liquid electrolytes. However, low ionic conductivity of typical candidates is the key problem. As connective diffusion path is the prerequisite for high performance, we screen for possible solid electrolytes from the 2004 International Centre for Diffraction Data (ICDD) database by calculating conduction pathways using Bond Valence (BV) method. There are 109846 inorganic crystals in the 2004 ICDD database, and 5295 of them contain lithium. Except for those with toxic, radioactive, rare, or variable valence elements, 1380 materials are candidates for solid electrolytes. The rationality of the BV method is approved by comparing the existing solid electrolytes' conduction pathways we had calculated with those from experiments or first principle calculations. The implication for doping and substitution, two important ways to improve the conductivity, is also discussed. Among them Li2CO3 is selected for a detailed comparison, and the pathway is reproduced well with that based on the density functional studies. To reveal the correlation between connectivity of pathways and conductivity, α/ γ-LiAlO2 and Li2CO3 are investigated by the impedance spectrum as an example, and many experimental and theoretical studies are in process to indicate the relationship between property and structure. The BV method can calculate one material within a few minutes, providing an efficient way to lock onto targets from abundant data, and to investigate the structure-property relationship systematically.

  10. Screening of alternative methods for the disposal of low-level radioactive wastes

    International Nuclear Information System (INIS)

    Macbeth, P.J.; Thamer, B.J.; Christensen, D.E.; Wehmann, G.

    1978-10-01

    A systematic method for categorizing these disposal alternatives which provides assurance that no viable alternatives are overlooked is reported. Alternatives are categorized by (1) the general media in which disposal occurs, (2) by whether the disposal method can be considered as dispersal, containment or elimination of the wastes, and (3) by the applicability of the disposal method to the possible physical waste forms. A literature survey was performed and pertinent references listed for the various alternatives discussed. A bibliography is given which provides coverage of published information on low-level radioactive waste management options. The extensive list of disposal alternatives identified was screened and the most viable choices were selected for further evaluation. A Technical Advisory Panel met and reviewed the results. Suggestions from that meeting and other comments are discussed. The most viable options selected for further evaluation are: (1) improving present shallow land burial practices; (2) deeper depth burial; (3) disposal in cavities; (4) disposal in exposed or buried structures; and (5) ocean disposal. 42 references

  11. Screening natural antioxidants in peanut shell using DPPH-HPLC-DAD-TOF/MS methods.

    Science.gov (United States)

    Qiu, Jiying; Chen, Leilei; Zhu, Qingjun; Wang, Daijie; Wang, Wenliang; Sun, Xin; Liu, Xiaoyong; Du, Fangling

    2012-12-15

    Peanut shell, a byproduct in oil production, is rich in natural antioxidants. Here, a rapid and efficient method using DPPH-HPLC-DAD-TOF/MS was used for the first time to screen antioxidants in peanut shell. The method is based on the hypothesis that upon reaction with 1, 1-diphenyl-2-picrylhydrazyl (DPPH), the peak areas of compounds with potential antioxidant activities in the HPLC chromatogram will be significantly reduced or disappeared, and the identity confirmation could be achieved by HPLC-DAD-TOF/MS technique. With this method, three compounds possessing potential antioxidant activities were found abundantly in the methanolic extract of peanut shell. They were identified as 5,7-dihydroxychromone, eriodictyol, and luteolin. The contents of these compounds were 0.59, 0.92, and 2.36 mg/g, respectively, and luteolin possessed the strongest radical scavenging capacity. DPPH-HPLC-DAD-TOF/MS assay facilitated rapid identification and determination of natural antioxidants in peanut shell, which may be helpful for value-added utilization of peanut processing byproducts. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. A human reliability assessment screening method for the NRU upgrade project

    International Nuclear Information System (INIS)

    Bremner, F.M.; Alsop, C.J.

    1997-01-01

    The National Research Universal (NRU) reactor is a 130MW, low pressure, heavy water cooled and moderated research reactor. The reactor is used for research, both in support of Canada's CANDU development program, and for a wide variety of other research applications. In addition, NRU plays an important part in the production of medical isotopes, e.g., generating 80% of worldwide supplies of Molybdenum-99. NRU is owned and operated by Atomic Energy of Canada Ltd. (AECL), and is currently undergoing upgrading as part of AECL's continuing commitment to operate their facilities in a safe manner. As part of these upgrades both deterministic and probabilistic safety assessments are being carried out. It was recognized that the assignment of Human Error Probabilities (HEPs) is an important part of the Probabilistic Safety Assessment (PSA) studies, particularly for a facility whose design predates modern ergonomic practices, and which will undergo a series of backfitted modifications whilst continuing to operate. A simple Human Reliability Assessment (HRA) screening method, looking at both pre- and post-accident errors, was used in the initial safety studies. However, following review of this method within AECL and externally by the regulator, it was judged that benefits could be gained for future error reduction by including additional features, as later described in this document. The HRA development project consisted of several stages; needs analysis, literature review, development of method (including testing and evaluation), and implementation. This paper discusses each of these stages in further detail. (author)

  13. Confidence from uncertainty - A multi-target drug screening method from robust control theory

    Directory of Open Access Journals (Sweden)

    Petzold Linda R

    2010-11-01

    Full Text Available Abstract Background Robustness is a recognized feature of biological systems that evolved as a defence to environmental variability. Complex diseases such as diabetes, cancer, bacterial and viral infections, exploit the same mechanisms that allow for robust behaviour in healthy conditions to ensure their own continuance. Single drug therapies, while generally potent regulators of their specific protein/gene targets, often fail to counter the robustness of the disease in question. Multi-drug therapies offer a powerful means to restore disrupted biological networks, by targeting the subsystem of interest while preventing the diseased network from reconciling through available, redundant mechanisms. Modelling techniques are needed to manage the high number of combinatorial possibilities arising in multi-drug therapeutic design, and identify synergistic targets that are robust to system uncertainty. Results We present the application of a method from robust control theory, Structured Singular Value or μ- analysis, to identify highly effective multi-drug therapies by using robustness in the face of uncertainty as a new means of target discrimination. We illustrate the method by means of a case study of a negative feedback network motif subject to parametric uncertainty. Conclusions The paper contributes to the development of effective methods for drug screening in the context of network modelling affected by parametric uncertainty. The results have wide applicability for the analysis of different sources of uncertainty like noise experienced in the data, neglected dynamics, or intrinsic biological variability.

  14. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Science.gov (United States)

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  15. Screening method for the detection of a range of nitrofurans in avian eyes by optical biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Colin S., E-mail: colin.thompson@afbini.gov.uk [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom); Traynor, Imelda M.; Fodey, Terence L.; Crooks, Steven R.H.; Kennedy, D. Glenn [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom)

    2011-08-26

    An immunobiosensor assay was developed for the multi-residue screening of a range of nitrofuran compounds in avian eyes. A polyclonal antibody which binds at least 5 of the major parent nitrofurans was raised in a rabbit after inoculation with a nitrofuran mimic-protein conjugate. Sample homogenates were extracted into 0.1 M hydrochloric acid and subjected to clean-up by solid phase extraction and micro-centrifugation prior to biosensor analysis. Validation data obtained from the analysis of 21 fortified samples has shown that the method has a detection capability (CC{beta}) of less than 1 ng eye{sup -1} for nitrofurazone (NFZ). In addition, cross-reactivity data and the analysis of a smaller number of fortified samples have shown that the method will also detect a range of other major parent nitrofurans including furazolidone (FZD), furaltadone (FTD), nitrofurantoin (NFA) and nifursol (NFS). Intra-assay variation (n = 10) was calculated at 12.9% and 10.1% at concentrations of 1 ng eye{sup -1} and 2 ng eye{sup -1} NFZ respectively. Inter-assay variation (n = 3) was determined to be 10.8% and 4.7% at the same NFZ concentrations respectively. The cross-reactivity profile and validation data for the detection of these nitrofurans are presented together with the results obtained following the analysis of a small number of incurred samples using the developed method.

  16. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM-IV Diagnoses Using CBCL Data

    Science.gov (United States)

    Krol, Nicole P. C. M.; De Bruyn, Eric E. J.; Coolen, Jolanda C.; van Aarle, Edward J. M.

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input data directly into DSM-IV symptom criteria. The…

  17. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM–IV Diagnoses Using CBCL Data

    NARCIS (Netherlands)

    Krol, N.P.C.M.; Bruyn, E.E.J. De; Coolen, J.C.; Aarle, E.J.M. van

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input

  18. Screening for Microalbuminuria in the early detection of diabetic nephropathy: A cheap and simple method

    Directory of Open Access Journals (Sweden)

    "Larijani B

    2002-06-01

    Full Text Available Prompt detection of renal involvement through evaluation of microalbuminuria can both reduce mortality in diabetic patients and significantly reduce the cost of managing these patients. To this end, Micral test strips have been used as a screeing tool in this group of patients though not yet in our country. The present study aimed to evaluate this test and to abtain a simpler and less expensive method of screening for microlbuminuria. In this study, 200 type 1 and type 2 diabetic patients referred to the Endocrine & Metabolims Research Center of the Tehran university of medical Sciences were evaluated for microabluminuria. Entry criteria consisted of a history of recognized diabetes longer than or equal to 5 years. Exclusion criteria included development of urinary tract infection, pyrexia, and a history of uncontrolled hypertension. Every patient first completed a data questionnaire and then provided a first-void urine sample, which was tested for microalbuminuria with a urinary protein test strip (an Iranian-made Uri-Yab and a German-made BM-test-GP strip and the sulphasalicylic acid chemical method. Negative samples were tested further using Micral test strips (based on gold-lable immunochromatograpy and the microalbumin measurement kit manufactured by Dako. Germany (based on turbidometry using a Hitachi autoanalyser. 126 women and 74 men were recruited into the study. The average age of the sample was 40.7 years (range=16 to 63 years; 17 patients had IDDM and 173, NIDDM. Average duration of recognized diabetes was 8.75 years. Based on results obtained using chemical analysis and foreign-made tests strips, 46 patients (23% had macroalbuminuria, though the detection rate using Iranian-made test strips was 18 percent (36 patients. A further 16.2 percent of patients had microalbuminuria, with an average urinary albumin excertion of 28.7 mg per liter. Compared with colorimetric methos, the Micral test yieled a sensitivity of 93% and a specificity

  19. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    OpenAIRE

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning ...

  20. How to benchmark methods for structure-based virtual screening of large compound libraries.

    Science.gov (United States)

    Christofferson, Andrew J; Huang, Niu

    2012-01-01

    Structure-based virtual screening is a useful computational technique for ligand discovery. To systematically evaluate different docking approaches, it is important to have a consistent benchmarking protocol that is both relevant and unbiased. Here, we describe the designing of a benchmarking data set for docking screen assessment, a standard docking screening process, and the analysis and presentation of the enrichment of annotated ligands among a background decoy database.

  1. THE RELATIONSHIP BETWEEN ORGANIZATIONAL JUSTICE AND TURNOVER INTENTION OF HOSPITAL NURSES IN IRAN

    Science.gov (United States)

    Tourani, Sogand; Khosravizadeh, Omid; Omrani, Amir; Sokhanvar, Mobin; Kakemam, Edris; Najafi, Behnam

    2016-01-01

    Background: Despite advances in science and technology, human resources are of the major capital for organizations. Workforce retention is required to improve organizational efficiencies. Objective: Therefore, in this study, the relationship between organizational justice (as one of the most influential factors) and turnover intention was investigated. Methods: This descriptive-analytic study was done in the Comprehensive Jame Women’s Hospital of Tehran in 2015. The statistical sample consisted of 135 nursing staff members. The data were collected using a questionnaire of Beugre’s organizational justice and analyzed by the use of Spearman’s and Anova statistical tests. Results: Averages of organizational justice was obtained to be 68.85 ± 7.67 . Among different sorts of organizational justice, the highest average score of 75.24 ± 16.68 was achieved relevant to interactional justice. A significant relationship was observed between organizational justice (r = -0.36), interactional justice (r = -0.38), and procedural justice (r = -0.36) and turnover intention, but no relation was found between turnover intention and systemic and distributive justice. Furthermore, there was no relationship between demographic variables, organizational justice, and turnover intention. Conclusion: Considering the prominent role of organizational justice in the personnel’s intention to stay or leave and due to the high costs of recruiting and training new staff, managers should pay especial attention to justice and provide their employees’ satisfaction and stability in their organizations by creating a positive mindset in them. PMID:27482163

  2. Transitional Justice in Syria: Scenarios and Options | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and there has been widespread destruction to property and physical infrastructure. Syria's ... The project will provide research on key transitional justice issues, including methods to ... Syrian Center for Political and Strategic Studies SCPSS.

  3. Assessment of Sediment Heavy Metals Pollution Using Screening Methods (XRF, TGA/MS, XRPD and Earthworms Bioassay)

    Science.gov (United States)

    Findoráková, Lenka; Šestinová, Ol'ga; Hančul'ák, Jozef; Fedorová, Erika; Zorkovská, Anna

    2016-10-01

    The aim of this study is focused on the use of screening methods (TG/DTA coupled with MS, XRF, AAS, XRPD and earthworm bioassay) for sediments pollution assessing by heavy metals (Cu, Zn, Pb, Hg) coming from the former mining workloads in the central Spis, Eastern Slovakia. The screening methods (XRF, AAS) indicated pollution of studied sediments by Cu, Zn, Pb, Hg. The earthworms Dendrobaena veneta caused in some studied samples decrease of heavy metals concentration after their 7 days’ exposure in sediments. The other screening methods such as thermal analysis and XRPD analysis, does not confirm the specifically changes in physicochemical properties comparing the properties before and after 7 days’ earthworm's exposure.

  4. Developing the clinical components of a complex intervention for a glaucoma screening trial: a mixed methods study

    Directory of Open Access Journals (Sweden)

    2011-04-01

    Full Text Available Abstract Background Glaucoma is a leading cause of avoidable blindness worldwide. Open angle glaucoma is the most common type of glaucoma. No randomised controlled trials have been conducted evaluating the effectiveness of glaucoma screening for reducing sight loss. It is unclear what the most appropriate intervention to be evaluated in any glaucoma screening trial would be. The purpose of this study was to develop the clinical components of an intervention for evaluation in a glaucoma (open angle screening trial that would be feasible and acceptable in a UK eye-care service. Methods A mixed-methods study, based on the Medical Research Council (MRC framework for complex interventions, integrating qualitative (semi-structured interviews with 46 UK eye-care providers, policy makers and health service commissioners, and quantitative (economic modelling methods. Interview data were synthesised and used to revise the screening interventions compared within an existing economic model. Results The qualitative data indicated broad based support for a glaucoma screening trial to take place in primary care, using ophthalmic trained technical assistants supported by optometry input. The precise location should be tailored to local circumstances. There was variability in opinion around the choice of screening test and target population. Integrating the interview findings with cost-effectiveness criteria reduced 189 potential components to a two test intervention including either optic nerve photography or screening mode perimetry (a measure of visual field sensitivity with or without tonometry (a measure of intraocular pressure. It would be more cost-effective, and thus acceptable in a policy context, to target screening for open angle glaucoma to those at highest risk but for both practicality and equity arguments the optimal strategy was screening a general population cohort beginning at age forty. Conclusions Interventions for screening for open angle

  5. A screening method for the optimal selection of plate heat exchanger configurations

    Directory of Open Access Journals (Sweden)

    Pinto J.M.

    2002-01-01

    Full Text Available An optimization method for determining the best configuration(s of gasketed plate heat exchangers is presented. The objective is to select the configuration(s with the minimum heat transfer area that still satisfies constraints on the number of channels, the pressure drop of both fluids, the channel flow velocities and the exchanger thermal effectiveness. The configuration of the exchanger is defined by six parameters, which are as follows: the number of channels, the numbers of passes on each side, the fluid locations, the feed positions and the type of flow in the channels. The resulting configuration optimization problem is formulated as the minimization of the exchanger heat transfer area and a screening procedure is proposed for its solution. In this procedure, subsets of constraints are successively applied to eliminate infeasible and nonoptimal solutions. Examples show that the optimization method is able to successfully determine a set of optimal configurations with a minimum number of exchanger evaluations. Approximately 5 % of the pressure drop and channel velocity calculations and 1 % of the thermal simulations are required for the solution.

  6. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    International Nuclear Information System (INIS)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah; Lee, Sang Hoon

    2004-01-01

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding

  7. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah [Sungkyunkwan University, Seoul (Korea, Republic of); Lee, Sang Hoon [University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    2004-03-15

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding.

  8. A rapid sample screening method for authenticity control of whiskey using capillary electrophoresis with online preconcentration.

    Science.gov (United States)

    Heller, Melina; Vitali, Luciano; Oliveira, Marcone Augusto Leal; Costa, Ana Carolina O; Micke, Gustavo Amadeu

    2011-07-13

    The present study aimed to develop a methodology using capillary electrophoresis for the determination of sinapaldehyde, syringaldehyde, coniferaldehyde, and vanillin in whiskey samples. The main objective was to obtain a screening method to differentiate authentic samples from seized samples suspected of being false using the phenolic aldehydes as chemical markers. The optimized background electrolyte was composed of 20 mmol L(-1) sodium tetraborate with 10% MeOH at pH 9.3. The study examined two kinds of sample stacking, using a long-end injection mode: normal sample stacking (NSM) and sample stacking with matrix removal (SWMR). In SWMR, the optimized injection time of the samples was 42 s (SWMR42); at this time, no matrix effects were observed. Values of r were >0.99 for the both methods. The LOD and LOQ were better than 100 and 330 mg mL(-1) for NSM and better than 22 and 73 mg L(-1) for SWMR. The CE-UV reliability in the aldehyde analysis in the real sample was compared statistically with LC-MS/MS methodology, and no significant differences were found, with a 95% confidence interval between the methodologies.

  9. Social justice in pandemic preparedness.

    Science.gov (United States)

    DeBruin, Debra; Liaschenko, Joan; Marshall, Mary Faith

    2012-04-01

    Pandemic influenza planning in the United States violates the demands of social justice in 2 fundamental respects: it embraces the neutrality of procedural justice at the expense of more substantive concern with health disparities, thus perpetuating a predictable and preventable social injustice, and it fails to move beyond lament to practical planning for alleviating barriers to accessing care. A pragmatic social justice approach, addressing both health disparities and access barriers, should inform pandemic preparedness. Achieving social justice goals in pandemic response is challenging, but strategies are available to overcome the obstacles. The public engagement process of one state's pandemic ethics project influenced the development of these strategies.

  10. Spatial screening methods for evaluating environmental contaminant hazards and exposure vulnerability

    Science.gov (United States)

    Jones, D. K.

    2016-12-01

    Human and biotic communities are becoming increasingly vulnerable to sea-level rise and severe storms due to climate change. These events enhance the dispersion and concentration of natural and anthropogenic chemicals and pathogenic microorganisms, which could adversely impact the health and resilience of coastal communities and ecosystems in coming years. The U.S. Geological Survey (USGS) has developed spatial screening methods to identify and map contaminant sources and potential exposure pathways for human and ecological receptors. These methods have been applied within the northeastern U.S. to document contaminants of emerging concern, highlight vulnerable communities, and prioritize locations for future sampling campaigns. Integration of this information provides a means to better assess the baseline status of a complex system and the significance of changes in contaminant hazards due to storm-induced (episodic) and sea-level rise (incremental) disturbances. This presentation will provide an overview of a decision support tool developed by the USGS to document contaminants in the environment relative to key receptor populations and historic storm vulnerabilities. The support tool is designed to accommodate a broad array of geologic, land-use, and climatic variables and utilizes public, nationally available data sources to define contaminant sources and storm vulnerabilities. By employing a flexible and adaptable strategy built upon publicly available data, the method can readily be applied to other site selection or landscape evaluation efforts. Examples will be presented including the Sediment-bound Contaminant Resiliency and Response pilot study (see http://toxics.usgs.gov/scorr/), and investigations of endocrine disruption in the Chesapeake Bay. Key limitations and future applications will be discussed in addition to ongoing method developments to accommodate non-coastal disaster scenarios and more refined contaminant definitions.

  11. The good and bad of being fair: effects of procedural and interpersonal justice behaviors on regulatory resources.

    Science.gov (United States)

    Johnson, Russell E; Lanaj, Klodiana; Barnes, Christopher M

    2014-07-01

    The justice literature has paid considerable attention to the beneficial effects of fair behaviors for recipients of such behaviors. It is possible, however, that exhibiting fair behaviors may come at a cost for actors. In this article, we integrate ego depletion theory with organizational justice research in order to examine the consequences of justice behaviors for actors. We used an experience-sampling method in a sample of managerial employees to examine the relations of performing procedural justice and interpersonal justice behaviors with subsequent changes in actors' regulatory resources. Our results indicate that procedural justice behaviors are draining, whereas interpersonal justice behaviors are replenishing for actors. Depletion, in turn, adversely affected the performance of citizenship behavior, and depletion mediated relations of justice behavior with citizenship. Furthermore, 2 traits that impact self-regulatory skills--extraversion and neuroticism--moderated the replenishing effects of engaging in interpersonal justice behaviors. We conclude by discussing implications and avenues for future research.

  12. School-Based BMI and Body Composition Screening and Parent Notification in California: Methods and Messages

    Science.gov (United States)

    Madsen, Kristine A.; Linchey, Jennifer

    2012-01-01

    Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…

  13. Justice and feelings: Toward a new era in justice research

    NARCIS (Netherlands)

    D. de Cremer (David); K. van den Bos (Kees)

    2007-01-01

    textabstractIn this special issue, the relationship between feelings and justice and its consequences are highlighted. Five articles discuss the role that affect, feelings, and emotions play in justice processes across a variety of social settings. In the present introductory article, the position

  14. Justice and Feelings: Toward a New Era in Justice Research

    NARCIS (Netherlands)

    Cremer, D. de; Bos, K. van den

    2007-01-01

    In this special issue, the relationship between feelings and justice and its consequences are highlighted. Five articles discuss the role that affect, feelings, and emotions play in justice processes across a variety of social settings. In the present introductory article, the position of past

  15. Applying Social Justice Principles through School-Based Restorative Justice

    Science.gov (United States)

    von der Embse, Nathan; von der Embse, Daniel; von der Embse Meghan; Levine, Ian

    2009-01-01

    Social justice has recently received attention within the school psychology community. Yet, social justice is a nebulous term, as opined by Connelly (2009), who cautioned against searching for what is wrong and instead striving for the highest standards and recognizing needs of every unique child. Shriberg and colleagues (2008) have sought to…

  16. Doing justice to social justice in South African higher education ...

    African Journals Online (AJOL)

    This paper attempts to develop a conceptualisation of social justice in higher education based on a close reading of the current literature in the field. An important assumption we make is that higher education is a valuable mechanism for social justice. We set the literature against policy documents that detail South African ...

  17. Student Perceptions of Social Justice and Social Justice Activities

    Science.gov (United States)

    Torres-Harding, Susan R.; Steele, Cheronda; Schulz, Erica; Taha, Farah; Pico, Chantal

    2014-01-01

    Encouraging students to engage in activities that actively seek to promote social justice is a goal of many educators. This study analyzed college student perceptions around social justice and related activities in a medium-sized, urban university in the United States. Students' open-ended responses to questions assessing their perceptions of…

  18. Justice delayed is justice denied: Protecting Miners against ...

    African Journals Online (AJOL)

    Justice delayed is justice denied: Protecting Miners against Occupational ... of section 35 of Compensation for Occupational Injuries and Diseases Act 130 of ... of the Mankayi case for the system of occupational health and safety in South Africa. ... KEYWORDS: Occupational health; diseases; injuries; employees; protection; ...

  19. Justice on Both Sides: Transforming Education through Restorative Justice

    Science.gov (United States)

    Winn, Maisha T.

    2018-01-01

    Restorative justice represents "a paradigm shift in the way Americans conceptualize and administer punishment," says author Maisha T. Winn, from a focus on crime to a focus on harm, including the needs of both those who were harmed and those who caused it. Her book, "Justice on Both Sides," provides an urgently needed,…

  20. Current and emerging screening methods to identify post-head-emergence frost adaptation in wheat and barley.

    Science.gov (United States)

    Frederiks, T M; Christopher, J T; Harvey, G L; Sutherland, M W; Borrell, A K

    2012-09-01

    Cereal crops can suffer substantial damage if frosts occur at heading. Identification of post-head-emergence frost (PHEF) resistance in cereals poses a number of unique and difficult challenges. Many decades of research have failed to identify genotypes with PHEF resistance that could offer economically significant benefit to growers. Research and breeding gains have been limited by the available screening systems. Using traditional frost screening systems, genotypes that escape frost injury in trials due to spatial temperature differences and/or small differences in phenology can be misidentified as resistant. We believe that by improving techniques to minimize frost escapes, such 'false-positive' results can be confidently identified and eliminated. Artificial freezing chambers or manipulated natural frost treatments offer many potential advantages but are not yet at the stage where they can be reliably used for frost screening in breeding programmes. Here we describe the development of a novel photoperiod gradient method (PGM) that facilitates screening of genotypes of different phenology under natural field frosts at matched developmental stages. By identifying frost escapes and increasing the efficiency of field screening, the PGM ensures that research effort can be focused on finding genotypes with improved PHEF resistance. To maximize the likelihood of identifying PHEF resistance, we propose that the PGM form part of an integrated strategy to (i) source germplasm;(ii) facilitate high throughput screening; and (iii) permit detailed validation. PGM may also be useful in other studies where either a range of developmental stages and/or synchronized development are desired.

  1. A survey on constitutional justice

    Directory of Open Access Journals (Sweden)

    Kheirollah Parvin

    2015-05-01

    Full Text Available The idea of supervising the conformity of statutory law with constitutional law, is due to necessities rooted in two essential principles: the supremacy of constitution and the hierarchy of the law. Constitution as the supreme law in the sense of status and legal value , is placed at the top of the legal pyramid of every political system and therefore requires a special organization and discipline that will act as the sanction of the principles and the main content incorporated in this legal instrument. this special organization and discipline known as Constitutional justice in legal Literature now and have studing in two main patterns. Firs pattern based on Supervision of courts on rules and other pattern is Apply by Emphasis on role of Political Institutions in Supervision on rules. This two patterns have common purpose but have different backgrounds and methods.

  2. Justice in Cyberwar

    Directory of Open Access Journals (Sweden)

    Klaus-Gerd Giesen

    2014-06-01

    Full Text Available http://dx.doi.org/10.5007/1677-2954.2014v13n1p27 The text aims at providing an ethical framework for cyber warfare. The latter is changing our understanding of war (and peace as well as the relationship between the human being and the machine. Rejecting Heidegger’s fatalistic stance towards technology it is argued that norms of international justice should be formulated in order to attempt to regulate this new military dimension. The potentially considerable destructive force of cyberweapon systems for civilian infrastructure is emphasized, especially as far as the « Internet of Things » (all physical objects connected to the Internet is concerned. In a foreseeable future cyberwar operations may kill many civilians. After defining the concept of cyberwar and explainig why it is a new and important moral issue, the paper heavily relies on just war ethics in order to reach norms for justice in cyberwar. It is shown that Immanuel Kant has not just been a philosopher of (perpetual peace, but (in the Metaphysics of Morals also a just war theorist who developed his normative framework in a fruitful dialog with Aquinas (against Vitoria and Suarez. His norms for jus ad bellum and jus in bello are carefully and critically applied to cyberwar. However, Kant’s major innovation in just war theory has been the concept of jus post bellum. The paper demonstrates how important this dimension of justice is in cyberwar, and how to apply it, including through recommendations for a treaty in international law.

  3. Restorative Justice in Children.

    Science.gov (United States)

    Riedl, Katrin; Jensen, Keith; Call, Josep; Tomasello, Michael

    2015-06-29

    An important, and perhaps uniquely human, mechanism for maintaining cooperation against free riders is third-party punishment. Our closest living relatives, chimpanzees, will not punish third parties even though they will do so when personally affected. Until recently, little attention has been paid to how punishment and a sense of justice develop in children. Children respond to norm violations. They are more likely to share with a puppet that helped another individual as opposed to one who behaved harmfully, and they show a preference for seeing a harmful doll rather than a victim punished. By 6 years of age, children will pay a cost to punish fictional and real peers, and the threat of punishment will lead preschoolers to behave more generously. However, little is known about what motivates a sense of justice in children. We gave 3- and 5-year-old children--the youngest ages yet tested--the opportunity to remove items and prevent a puppet from gaining a reward for second- and third-party violations (experiment 1), and we gave 3-year-olds the opportunity to restore items (experiment 2). Children were as likely to engage in third-party interventions as they were when personally affected, yet they did not discriminate among the different sources of harm for the victim. When given a range of options, 3-year-olds chose restoration over removal. It appears that a sense of justice centered on harm caused to victims emerges early in childhood and highlights the value of third-party interventions for human cooperation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Religious Education towards Justice: What Kind of Justice Is to Be Taught in a Christian Context?

    Directory of Open Access Journals (Sweden)

    Monika Bobbert

    2017-02-01

    Full Text Available Education is a human right. It prepares human beings for life, helps to develop individual abilities and opens up social opportunities—e.g., earning one’s own living. Religion interprets our human existence in connection to a transcendental dimension. Religion can also influence moral values and behavior. The Christian religion established a basis for social life, and thus deals with religious and moral justice. As the Christian faith is understood as the identity of the qualities of love of God, of your neighbor and even of your enemy, it has to look for justice in the world. Modern Christian ethics does unfold interpersonal and global justice for all people and tries to give good reasons for moral claims. Religious education in a Christian context has to answer the question of what kind of justice is to be taught and by what means justice, as a goal of education, can be reached within such a setting. This article will unfold, from an ethical point of view, what kind of knowledge and competence teachers must have and what kind of goals can be followed with regard to their pupils or students. The results of this reflection imply certain pedagogical methods and means and exclude others—although it is not possible to go more deeply into a pedagogical discussion.

  5. The Importance of Context in Screening in Occupational Health Interventions in Organizations: A Mixed Methods Study

    Directory of Open Access Journals (Sweden)

    Michela Vignoli

    2017-08-01

    Full Text Available In occupational health interventions, there is a debate as to whether standardized or tailored measures should be used to identify which aspects of the psychosocial work environment should be targeted in order to improve employees’ well-being. Using the Job Demands-Resources model, the main aim of the present study is to demonstrate how a mixed methods approach to conducting screening enables the identification of potential context-dependent demands and resources in the workplace, which should to be targeted by the intervention. Specifically, we used a mixed methods exploratory sequential research design. First, we conducted four focus groups (N = 37 in a sample of employees working in grocery stores in Italy. The qualitative results allowed to identify one possible context-specific job demand: the use of a work scheduling IT software, whose implementation resulted in a high rotation between different market’s departments. From the qualitative results, this context-specific demand seemed to be related to workers’ well-being. Thus, in a subsequent questionnaire survey (N = 288, we included this demand together with generic measures of social support and psychological well-being. Results confirmed that this context-specific job demand was related to emotional exhaustion. Furthermore, it was found that social support moderated the relationship between this specific job demand and emotional exhaustion showing among employees whose activities depended on the IT software, employees that perceived higher levels of social support from colleagues experienced lower levels of emotional exhaustion with respect to their colleagues who perceived lower levels of social support. The present study confirms that mixed methods approach is useful in occupational health intervention research and offers a way forward on helping organizations prioritize their intervention activities.

  6. Biomedical enhancements as justice.

    Science.gov (United States)

    Nam, Jeesoo

    2015-02-01

    Biomedical enhancements, the applications of medical technology to make better those who are neither ill nor deficient, have made great strides in the past few decades. Using Amartya Sen's capability approach as my framework, I argue in this article that far from being simply permissible, we have a prima facie moral obligation to use these new developments for the end goal of promoting social justice. In terms of both range and magnitude, the use of biomedical enhancements will mark a radical advance in how we compensate the most disadvantaged members of society. © 2013 John Wiley & Sons Ltd.

  7. Health Law as Social Justice.

    Science.gov (United States)

    Wiley, Lindsay F

    2014-01-01

    Health law is in the midst of a dramatic transformation. From a relatively narrow discipline focused on regulating relationships among individual patients, health care providers, and third-party payers, it is expanding into a far broader field with a burgeoning commitment to access to health care and assurance of healthy living conditions as matters of social justice. Through a series of incremental reform efforts stretching back decades before the Affordable Care Act and encompassing public health law as well as the law of health care financing and delivery, reducing health disparities has become a central focus of American health law and policy. This Article labels, describes, and furthers a nascent "health justice" movement by examining what it means to view health law as an instrument of social justice. Drawing on the experiences of the reproductive justice, environmental justice, and food justice movements, and on the writings of political philosophers and ethicists on health justice, I propose that health justice offers an alternative to the market competition and patient rights paradigms that currently dominate health law scholarship, advocacy, and reform. I then examine the role of law in reducing health disparities through the health justice lens. I argue that the nascent health justice framework suggests three commitments for the use of law to reduce health disparities. First, to a broader inquiry that views access to health care as one among many social determinants of health deserving of public attention and resources. Second, to probing inquiry into the effects of class, racial, and other forms of social and cultural bias on the design and implementation of measures to reduce health disparities. And third, to collective action grounded in community engagement and participatory parity. In exploring these commitments, I highlight tensions within the social justice framework and between the social justice framework and the nascent health justice movement

  8. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background......, to minimize the contribution of unpredicted recessive genetic factors present in the individual library strains. We utilize a set of strains where each contains a conditional centromere construct on one of the 16 yeast chromosomes that allows the destabilization and selectable loss of that chromosome. After...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  9. Is preimplantation genetic diagnosis the ideal embryo selection method in aneuploidy screening?

    Directory of Open Access Journals (Sweden)

    Levent Sahin

    2014-10-01

    Full Text Available To select cytogenetically normal embryos, preimplantation genetic diagnosis (PGD aneuploidy screening (AS is used in numerous centers around the world. Chromosomal abnormalities lead to developmental problems, implantation failure, and early abortion of embryos. The usefulness of PGD in identifying single-gene diseases, human leukocyte antigen typing, X-linked diseases, and specific genetic diseases is well-known. In this review, preimplantation embryo genetics, PGD research studies, and the European Society of Human Reproduction and Embryology PGD Consortium studies and reports are examined. In addition, criteria for embryo selection, technical aspects of PGD-AS, and potential noninvasive embryo selection methods are described. Indications for PGD and possible causes of discordant PGD results between the centers are discussed. The limitations of fluorescence in situ hybridization, and the advantages of the array comparative genomic hybridization are included in this review. Although PGD-AS for patients of advanced maternal age has been shown to improve in vitro fertilization outcomes in some studies, to our knowledge, there is not sufficient evidence to use advanced maternal age as the sole indication for PGD-AS. PGD-AS might be harmful and may not increase the success rates of in vitro fertilization. At the same time PGD, is not recommended for recurrent implantation failure and unexplained recurrent pregnancy loss.

  10. Photoionization study of the F2+ ion via the screening constant by unit nuclear charge method

    Science.gov (United States)

    Dieng, M.; Tine, M.; Sow, M.; Diop, B.; Guèye, M.; Faye, M.; Sakho, I.; Biaye, M.; Wagué, A.

    2014-03-01

    In this paper, we have tabulated energy resonances of the 2s22p2 (1D)nd (2L), 2s22p2 (1S)nd (2L) and 2s22p3 (3D)np Rydberg series originating from the 2s22p3(2Po) and from the 2s22p3 (2Do) metastable states of F2+. In addition, energy resonances of the 2s2p3(5So)np (4P) Rydberg series originating from the 2s22p3 (4So) ground-state of F2+are also reported. Calculations are performed using the Screening constant by unit nuclear charge (SCUNC) method. Analysis of the present data is achieved by calculating the quantum defects and the effective nuclear charges for each series. The present results agree very well with the Advanced Light Source experiments on F2+ (Aguilar et al., 2005). Upto n=30, the present quantum defects are almost constant and the effective charge decreases regularly toward the electric charge of the F3+ core ion along each series.

  11. Optimization of Biochemical Screening Methods for Volatile and Unstable Sesquiterpenoids Using HS-SPME-GC-MS

    Directory of Open Access Journals (Sweden)

    Trine Bundgaard Andersen

    2015-06-01

    Full Text Available HS-SPME-GC-MS has been suggested as a fast and robust analytical platform for the product characterization of sesquiterpene synthases. The choice of fiber and injection temperature can have a significant effect on the observed product profile, due to the chemical rearrangements that can occur on the fiber material. Here we present a systematic study on the effects of fiber choice and injection port temperature on the observed sesquiterpenoid profile of four sesquiterpene synthases expressed in Nicotiana benthamiana. We found that the absorbent material PDMS was much less likely to support acid-induced rearrangement of sesquiterpenoids when compared to the adsorbent materials PDMS/DVB, PDMS/CAR, and PDMS/CAR/DVB. Furthermore, utilizing an injection port temperature at 160 °C almost eliminated the inherent thermal instability of germacrene sesquiterpenoids. Thus, for fast screening of sesquiterpene synthases, the results suggest that PDMS fibers and an injection temperature of 160 °C provide a fast and reproducible HS-SPME GC-MS method when using H2 as carrier gas.

  12. IN SEARCH OF A FAST SCREENING METHOD FOR DETECTING THE MALINGERING OF COGNITIVE IMPAIRMENT

    Directory of Open Access Journals (Sweden)

    Amada Ampudia

    2012-07-01

    Full Text Available Forensic settings demand expedient and conclusive forensic psychological assessment. The aim of this study was to design a simple and fast, but reliable psychometric instrument for detecting the malingering of cognitive impairment. In a quasi-experimental design, 156 individuals were divided into three groups: a normal group with no cognitive impairment; a Mild Cognitive Impairment (MCI group; and a group of informed malingerers with no MCI who feigned cognitive impairment. Receiver Operating Curve (ROC analysis of the Test of Memory Malingering (TOMM, and of several subtests of the Wechsler Memory Scale (WMS-III revealed that the WMS-III was as reliable and accurate as the TOMM in discriminating malingerers from the honest. The results revealed that the diagnostic accuracy, sensitivity and specificity of the WMS-III Auditory Recognition Delayed of Verbal Paired Associates subtest was similar to the TOMM in discriminating malingering from genuine memory impairment. In conclusion, the WMS-III Recognition of Verbal Paired Associates subtest and the TOMM provide a fast, valid and reliable screening method for detecting the malingering of cognitive impairment.

  13. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  14. Screening method for detection of immediate amino acid decarboxylases--producing bacteria implicated in food poisoning.

    Science.gov (United States)

    Hussain, Husniza; Mohd Fuat, A R; Vimala, B; Ghazali, H M

    2011-08-01

    Assessment of amino acid decarboxylase activity can be conducted using tubed broth or plated agar. In this study, the test was carried out in microtitre plates containing lysine, ornithine, arginine, tyrosine, tryptophan, phenylalanine or histidine as biogenic amine precursors. Møller decarboxylase base broth (MDB) with or without 1% of a known amino acid were added to wells of a 96 well-microtitre plate. The wells were inoculated with Escherichia coli, Klebsiella pneumoniae, Acinetobacter anitratus or Staphylococcus aureus to the final concentration of 6.0 x 10(7) cfu/ml and incubated at 35ºC. The absorbance of the culture broth was read at 570 nm at 0, 1.0, 2.0, 3.0, 4.0, 5.5, 6.5 and 7.5 hour. Comparison of means of A'(570) between 0 hour and a specified incubation time was determined statistically. Positive decarboxylase activities were detected in the media inoculated with E. coli and K. pneumoniae in less than 6 hours. The current method is suitable for immediate producers of amino acid decarboxylase enzymes. It costs less as it uses less amino acid and it has the potential to be used for screening aliquots of food materials for amino acid decarboxylase activities.

  15. Robust high-throughput batch screening method in 384-well format with optical in-line resin quantification.

    Science.gov (United States)

    Kittelmann, Jörg; Ottens, Marcel; Hubbuch, Jürgen

    2015-04-15

    High-throughput batch screening technologies have become an important tool in downstream process development. Although continuative miniaturization saves time and sample consumption, there is yet no screening process described in the 384-well microplate format. Several processes are established in the 96-well dimension to investigate protein-adsorbent interactions, utilizing between 6.8 and 50 μL resin per well. However, as sample consumption scales with resin volumes and throughput scales with experiments per microplate, they are limited in costs and saved time. In this work, a new method for in-well resin quantification by optical means, applicable in the 384-well format, and resin volumes as small as 0.1 μL is introduced. A HTS batch isotherm process is described, utilizing this new method in combination with optical sample volume quantification for screening of isotherm parameters in 384-well microplates. Results are qualified by confidence bounds determined by bootstrap analysis and a comprehensive Monte Carlo study of error propagation. This new approach opens the door to a variety of screening processes in the 384-well format on HTS stations, higher quality screening data and an increase in throughput. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Portable non-destructive assay methods for screening and segregation of radioactive waste

    International Nuclear Information System (INIS)

    Simpson, Alan; Jones, Stephanie; Clapham, Martin; Lucero, Randy

    2011-01-01

    Significant cost-savings and operational efficiency may be realised by performing rapid non-destructive classification of radioactive waste at or near its point of retrieval or generation. There is often a need to quickly categorize and segregate bulk containers (drums, crates etc.) into waste streams defined at various boundary levels (based on its radioactive hazard) in order to meet disposal regulations and consignor waste acceptance criteria. Recent improvements in gamma spectroscopy technologies have provided the capability to perform rapid in-situ analysis using portable and hand-held devices such as battery-operated medium and high resolution detectors including lanthanum halide and high purity germanium (HPGe). Instruments and technologies that were previously the domain of complex lab systems are now widely available as touch-screen 'off-the-shelf' units. Despite such advances, the task of waste stream screening and segregation remains a complex exercise requiring a detailed understanding of programmatic requirements and, in particular, the capability to ensure data quality when operating in the field. This is particularly so when surveying historical waste drums and crates containing heterogeneous debris of unknown composition. The most widely used portable assay method is based upon far-field High Resolution Gamma Spectroscopy (HRGS) assay using HPGe detectors together with a well engineered deployment cart (such as the PSC TechniCART TM technology). Hand-held Sodium Iodide (NaI) detectors are often also deployed and may also be used to supplement the HPGe measurements in locating hot spots. Portable neutron slab monitors may also be utilised in cases where gamma measurements alone are not suitable. Several case histories are discussed at various sites where this equipment has been used for in-situ characterization of debris waste, sludge, soil, high activity waste, depleted and enriched uranium, heat source and weapons grade plutonium, fission products

  17. Alternative global goodness metrics and sensitivity analysis: heuristics to check the robustness of conclusions from studies comparing virtual screening methods.

    Science.gov (United States)

    Sheridan, Robert P

    2008-02-01

    We introduce two ways of testing the robustness of conclusions from studies comparing virtual screening methods: alternative "global goodness" metrics and sensitivity analysis. While the robustness tests cannot eliminate all biases in virtual screening comparisons, they are useful as a "reality check" for any given study. To illustrate this, we apply them to a set of enrichments published in McGaughey et al. (J. Chem. Inf. Model. 2007, 47, 1504-1519) where 11 target protein/ligand combinations are tested on 2D and 3D similarity methods, plus docking. The major conclusions in that paper, for instance, that ligand-based methods are better than docking methods, hold up. However, some minor conclusions, such as Glide being the best docking method, do not.

  18. Oscillometric blood pressure measurement: a simple method in screening for peripheral arterial disease

    DEFF Research Database (Denmark)

    Mehlsen, Jesper; Wiinberg, Niels; Bruce, Christopher

    2008-01-01

    Blood pressure at the ankle level is a reliable indicator of peripheral arterial disease (PAD) and the ankle brachial index (ABI) is a useful non-invasive screening tool for the early detection of atherosclerosis. In the first part of the study, systolic blood pressures obtained by oscillometry...... of PAD was sufficiently high in subjects over the age of 60 years to warrant screening. The ankle brachial index based on measurements with an oscillometric device was shown reliable in the exclusion of PAD, thereby fulfilling an important criterion for the use in screening....

  19. Social welfare and restorative justice

    OpenAIRE

    Fox, Darrell

    2009-01-01

    "This paper explores the links and connections between social work and restorative justice. After a brief description of social work, restorative justice and family group conferencing, I will explore some the complementary theoretical links and practice applications, critically examining the potential implications and opportunities for social work practitioners and academics in relation to practice." [author's abstract

  20. Educational Administration and Social Justice

    Science.gov (United States)

    Bates, Richard

    2006-01-01

    After observing that texts in educational administration have largely failed to address the problem of the justice and fairness of social and educational arrangements, this article goes on to examine the necessary relationships between ethical leadership, community and the notion of social justice. Such relationships are argued to be necessarily…

  1. Experiential Social Justice Judgment Processes

    NARCIS (Netherlands)

    Maas, M.

    2008-01-01

    Social justice can be thought of as an idea that exists within the minds of individuals and that concerns issues like what is right and wrong, what ought to be or not to be, and what is fair or unfair. This subjective quality of the justice judgment process makes it rather unpredictable how people

  2. Corporate accountability and transitional justice

    Directory of Open Access Journals (Sweden)

    Sabine Michalowski

    2015-10-01

    Full Text Available Traditionally, transitional justice processes do not address the role of corporations in dictatorships or in armed conflicts that give rise to the need for dealing with grave and systematic human rights violations. However, there is a growing awareness that in many contexts corporations contribute to these violations, often in the form of corporate complicity with the principal violators. An argument can therefore be made that to achieve the aims of transitional justice and establish a holistic narrative of the past as well as obtain justice and reparations for victims requires investigating and addressing the role of corporate actors. This article uses the example of Colombia’s Justice and Peace process to show some of the complexities, opportunities and challenges that arise if transitional justice measures focus primarily on criminal law and create a specific legal framework, outside of the ordinary justice systems, only for a limited group of primary perpetrators, in the Colombian case for members of the armed groups who demobilised. It is argued that the exclusion of corporate actors in contexts where their role is regarded as significant leads to victims seeking alternatives ways to obtain justice and that both victims and corporations would benefit if transitional justice mechanisms addressed the role of corporations.

  3. Educational Justice and Big Data

    Science.gov (United States)

    Ben Shahar, Tammy Harel

    2017-01-01

    This article examines the effects of incorporating information and communication technologies in schools in terms of distributive justice. To do so, four issues that are central to educational justice are discussed: scarcity of resources, the positional nature of education, peer effects, and biases in educational decision-making. The discussion…

  4. Gender Justice and School Education

    Science.gov (United States)

    Gao, Desheng

    2009-01-01

    Gender justice includes three basic dimensions: gender equality, respect for difference, and free choice. In reality, schools construct and reproduce the gender injustice of the social culture through multiple dimensions that include the visible and the invisible curriculum, and the teacher's behaviour. In terms of gender justice, the social…

  5. A streamlined risk screening method for managing reutilization of abandoned factories in Taiwan

    Directory of Open Access Journals (Sweden)

    I-Chun Chen

    2017-05-01

    Full Text Available An integrated management strategy that considers the competing relationships between land values and associated risks in the process of land-use conversion is needed to assess and manage the reutilization of brownfields. However, the often large number of individual brownfields renders it difficult to conduct a completed risk assessment for all sites, and a streamlined risk screening method would facilitate prioritization of the redevelopment of those factories. This methodology takes into account the spatial heterogeneity of contaminated lands and produces risk mapping that compiles complex risk-related information. Using abandoned factories in Taiwan as a case study, the method considers 40 points (50% accumulated probability as the threshold of acceptable risk. Emergency risk should be over 90% of accumulated probability. For the sustainability of brownfield reutilization in Taiwan, this research uses a risk matrix to identify the low, middle, and high risk for brownfield reutilization. It can indicate zones with a high risk level or low economic incentive as areas of concern for future decision making. In Taiwan, high-risk sites with high incentive account for only 21.3% of the sites. In contrast, the sites with the lowest incentive and low risk account for 57.6% of the sites. To avoid failure in the brownfield market, three strategies are suggested: (1 flexible land management with urban planning is a feasible option for protecting the receptor's health; (2 the government could provide the tool or brownfield funds to reduce the uncertainty of investment risk; and (3 risk monitoring and management can reduce the possible pitfalls associated with brownfield reutilization.

  6. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    Science.gov (United States)

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  7. A simple phenotypic method for screening of MCR-1-mediated colistin resistance.

    Science.gov (United States)

    Coppi, M; Cannatelli, A; Antonelli, A; Baccani, I; Di Pilato, V; Sennati, S; Giani, T; Rossolini, G M

    2018-02-01

    To evaluate a novel method, the colistin-MAC test, for phenotypic screening of acquired colistin resistance mediated by transferable mcr-1 resistance determinants, based on colistin MIC reduction in the presence of dipicolinic acid (DPA). The colistin-MAC test consists in a broth microdilution method, in which colistin MIC is tested in the absence or presence of DPA (900 μg/mL). Overall, 74 colistin-resistant strains of Enterobacteriaceae (65 Escherichia coli and nine other species), including 61 strains carrying mcr-1-like genes and 13 strains negative for mcr genes, were evaluated with the colistin-MAC test. The presence of mcr-1-like and mcr-2-like genes was assessed by real-time PCR and end-point PCR. For 20 strains, whole-genome sequencing data were also available. A ≥8-fold reduction of colistin MIC in the presence of DPA was observed with 59 mcr-1-positive strains, including 53 E. coli of clinical origin, three E. coli transconjugants carrying MCR-1-encoding plasmids, one Enterobacter cloacae complex and two Citrobacter spp. Colistin MICs were unchanged, increased or at most reduced by twofold with the 13 mcr-negative colistin-resistant strains (nine E. coli and four Klebsiella pneumoniae), but also with two mcr-1-like-positive K. pneumoniae strains. The colistin-MAC test could be a simple phenotypic test for presumptive identification of mcr-1-positive strains among isolates of colistin-resistant E. coli, based on a ≥8-fold reduction of colistin MIC in the presence of DPA. Evaluation of the test with a larger number of strains, species and mcr-type resistance determinants would be of interest. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  8. A Quantitative Method to Screen Common Bean Plants for Resistance to Bean common mosaic necrosis virus.

    Science.gov (United States)

    Strausbaugh, C A; Myers, J R; Forster, R L; McClean, P E

    2003-11-01

    ABSTRACT A quantitative method to screen common bean (Phaseolus vulgaris) plants for resistance to Bean common mosaic necrosis virus (BCMNV) is described. Four parameters were assessed in developing the quantitative method: symptoms associated with systemic virus movement, plant vigor, virus titer, and plant dry weight. Based on these parameters, two rating systems (V and VV rating) were established. Plants from 21 recombinant inbred lines (RILs) from a Sierra (susceptible) x Olathe (partially resistant) cross inoculated with the BCMNV-NL-3 K strain were used to evaluate this quantitative approach. In all, 11 RILs exhibited very susceptible reactions and 10 RILs expressed partially resistant reactions, thus fitting a 1:1 susceptible/partially resistant ratio (chi(2) = 0.048, P = 0.827) and suggesting that the response is mediated by a single gene. Using the classical qualitative approach based only on symptom expression, the RILs were difficult to separate into phenotypic groups because of a continuum of responses. By plotting mean percent reduction in either V (based on visual symptoms) or VV (based on visual symptoms and vigor) rating versus enzyme-linked immunosorbent assay (ELISA) absorbance values, RILs could be separated clearly into different phenotypic groups. The utility of this quantitative approach also was evaluated on plants from 12 cultivars or pure lines inoculated with one of three strains of BCMNV. Using the mean VV rating and ELISA absorbance values, significant differences were established not only in cultivar and pure line comparisons but also in virus strain comparisons. This quantitative system should be particularly useful for the evaluation of the independent action of bc genes, the discovery of new genes associated with partial resistance, and assessing virulence of virus strains.

  9. Electrostatic Dust Cloth: A Passive Screening Method to Assess Occupational Exposure to Organic Dust in Bakeries

    Directory of Open Access Journals (Sweden)

    Carla Viegas

    2018-02-01

    Full Text Available Organic dust is widespread in the environment including occupational settings, such as bakeries. Recently, a new collection device—the electrostatic dust cloth (EDC—has been described for the assessment of occupational exposures. The aim of this study was to investigate the suitability of EDC for identifying the distribution patterns and exposure concentrations of particulate matter and microbial contaminants such as fungi and bacteria in bakeries. Twelve bakeries were selected, and dust was allowed to settle for 13 to 16 days on EDCs (a total of 33 samples. Particle counts and size distribution (0.3 µm, 0.5 µm, 1 µm, 2.5 µm, 5 µm and 10 µm were measured with direct-reading equipment. Higher EDC mass was significantly correlated (p values < 0.05 with higher fungal load on dichloran glycerol (DG18 and with particle size distribution in the 0.3 µm, 0.5 µm, 1.0 µm and 10.0 µm range. Fungal levels on malt extract agar (MEA ranged from 0 to 2886 CFU/m2 EDC in the warehouse setting, 0 to 500 CFU/m2 EDC in the production setting, and 0 to 3135 CFU/m2 EDC in the store. Penicillium sp. (42.56% was the most frequent fungi. Total bacterial load ranged from 0 to 18,859 CFU/m2 EDC in the warehouse, 0 to 71,656 CFU/m2 EDC in production, and 0 to 21,746 CFU/m2 EDC in the store. EDC assessment provided a longer-term integrated sample of organic dust, useful for identifying critical worksites in which particulate matter and bio-burden exposures are elevated. These findings suggest that EDC can be applied as a screening method for particulate matter-exposure assessment and as a complementary method to quantify exposures in occupational environments.

  10. Comparative Supreme Justice

    Directory of Open Access Journals (Sweden)

    Ditlev Tamm

    2011-12-01

    Full Text Available This article deals with the great variety of Supreme Courts in the world today and presents some selected courts. Supreme Courts are found in most countries both as only apex courts or in a courts’ system where also supreme administrative courts or constitutional courts are found. The starting point is the variation of supreme justice in the Nordic countries where one apex court is the system of Denmark and Norway whereas administrative courts are found in Sweden and Finland. Constitutional courts stem from the European tradition and are most abundant in Europe and in countries with a civil law system but especially in Africa they are also found in common law countries. Mexico is mentioned as a specific example of a Supreme Court that has taken upon itself to be a main player in the endeavour to communicate the law to a general audience. The article is a presentation with samples of what is going to be a project on comparative supreme justice in which the position of supreme courts in the various states, the recruitment scheme and competence of the courts and other such factors will be analyzed on a global basis.

  11. Organisational justice and employee perceptions on hospital management.

    Science.gov (United States)

    Wiili-Peltola, Erja; Kivimäki, Mika; Elovainio, Marko; Virtanen, Marianna

    2007-01-01

    The purpose to clarify what kind of managerial challenges employees experience regarding organisational justice in hospitals. This exploratory study of 8,971 employees working in 14 hospitals and examines the concept of organisational justice in management with qualitative and quantitative methods. An inductive content analysis of the comments revealed five integrative frames describing challenges in hospital management at respondents' workplaces. These frames should be regarded as major managerial challenges in hospitals. These findings illustrate important antecedents of organisational justice and suggest that work units tend to share the same perceptions of justice. They also reveal that individually produced comments reflect collective experiences in organisational justice. Further, the results indicate that problems in management and policies are often experienced in a complex way, and people making justice judgements do not separate procedural and interactional factors. Although the commentators producing qualitative data represented many organisational hierarchy levels, the results should not be generalised to apply to horizontal, informal social relationships. This paper gives useful information regarding challenges in human resources management in hospitals. The paper suggests that people making fairness judgements do not make a distinction between procedural and interpersonal factors. Instead, they use any information available to judge the righteousness of the management events. This paper serves to guide hospital managers towards a better understanding of the importance of organisational justice and its collective nature.

  12. LC-ESI/MS/MS method for rapid screening and confirmation of 44 exogenous anabolic steroids in human urine.

    Science.gov (United States)

    Jeon, Byoung Wook; Yoo, Hye Hyun; Jeong, Eun Sook; Kim, Ho Jun; Jin, Changbae; Kim, Dong Hyun; Lee, Jaeick

    2011-09-01

    A sensitive and rapid method based on liquid chromatography-triple-quadrupole tandem mass spectrometry (LC-MS/MS) with electrospray ionization (ESI) has been developed and validated for the screening and confirmation of 44 exogenous anabolic steroids (29 parent steroids and 15 metabolites) in human urine. The method involves an enzymatic hydrolysis, liquid-liquid extraction, and detection by LC-MS/MS. A triple-quadrupole mass spectrometer was operated in positive ESI mode with selected reaction monitoring (SRM) mode for the screening and product ion scan mode for the confirmation. The protonated molecular ions were used as precursor ions for the SRM analysis and product ion scan. The intraday and interday precisions of the target analytes at concentrations of the minimum required performance levels for the screening were 2-14% and 2-15%, respectively. The limits of detection for the screening and confirmation method were 0.1-10 ng/mL and 0.2-10 ng/mL, respectively, for 44 steroids. This method was successfully applied to analysis of urine samples from suspected anabolic steroid abusers.

  13. A new microplate screening method for the simultaneous activity quantification of feruloyl esterases, tannases, and chlorogenate esterases.

    Science.gov (United States)

    Ramírez, L; Arrizon, J; Sandoval, G; Cardador, A; Bello-Mendoza, R; Lappe, P; Mateos-Díaz, J C

    2008-12-01

    Feruloyl, chlorogenate esterases, and tannases are enzymes useful in phenolic modifications of pharmaceutical relevance as protectors against several degenerative human diseases. Therefore, there is a growing interest in discovering new sources of these enzymes. However, traditional methods for their activity measurements are time-consuming and poorly adapted for high-throughput screening. In this study, a successful new microplate high-throughput screening method for the simultaneous quantification of all mentioned activities is demonstrated. This method allows the detection of activities as low as 1.7 mU ml(-1). Furthermore, reaction rates increased proportionally with the amount of enzyme added, and no interferences with the other commercial hydrolases tested were found. The utility of the method was demonstrated after simultaneously screening feruloyl, chlorogenate esterase, and tannase activities in solid state fermentation extracts obtained during the kinetics of production of 20 fungal strains. Among these, seven strains were positive for at least one of the esterase activities tested. This result shows the potential for the rapid routine screening assays for multiple samples of moderate low to high enzymatic levels.

  14. Justice-based social assistance

    Science.gov (United States)

    Barrientos, Armando

    2016-01-01

    What are the main objectives of social protection institutions in developing countries? What should be their scope and reach? What is the source of their legitimacy? Finding appropriate answers to these questions is essential to understanding, and shaping, the emergence of welfare institutions in low- and middle-income countries. Most available answers rely on instrumental arguments. Few make reference to normative principles. This article draws on three concepts from Rawls – social justice as regulating cooperation, the social minimum, and the need for a freestanding political notion of social justice – to develop a coherent argument for grounding social assistance on social justice. In line with this argument, it identifies some parameters for a justice-based social assistance. This article then discusses, with examples, the tensions existing between a social justice-based social minimum and ‘real’ social assistance institutions emerging in developing countries. PMID:27708544

  15. Equal Access to Justice in a Rural Western State

    Directory of Open Access Journals (Sweden)

    Monte Miller

    2004-12-01

    Full Text Available Twenty three inmates from a rural state penitentiary with mental retardation participated in a study on the differential treatment of persons with mental retardation by the criminal justice system. After obtaining informed consent, the inmates were screened for appropriateness for the study using the PPVT-R, a proxy test for IQ. The inmates were interviewed to obtain a social history and given the CAST-MR, an instrument that measures the competency of a person with mental retardation to stand trial. Results suggest participants may not have been competent to stand trial, learned most of what they knew about the criminal justice system while incarcerated, and had difficulty with interpersonal conflict and conflict with authority. The combination of these factors suggests that clients in the study may have been vulnerable to being coerced into confessing to crimes they did not commit. The presence of an advocate during criminal justice system encounters may benefit persons with mental retardation.

  16. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman

    2016-01-01

    compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training

  17. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman M.

    2016-11-23

    Drug discovery is a process that takes many years and hundreds of millions of dollars to reveal a confident conclusion about a specific treatment. Part of this sophisticated process is based on preliminary investigations to suggest a set of chemical compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training prediction models. Yet, the difficulties imposed by big expansion in data and its dimensionality are inevitable. In this thesis, I address the main challenges that come when data mining techniques are used for virtual screening. In order to achieve an efficient virtual screening using data mining, I start by addressing the problem of feature selection and provide analysis of best ways to describe a chemical compound for an enhanced screening performance. High-throughput screening (HTS) assays data used for virtual screening are characterized by a great class imbalance. To handle this problem of class imbalance, I suggest using a novel algorithm called DRAMOTE to narrow down promising candidate chemicals aimed at interaction with specific molecular targets before they are experimentally evaluated. Existing works are mostly proposed for small-scale virtual screening based on making use of few thousands of interactions. Thus, I propose enabling large-scale (or big) virtual screening through learning millions of interaction while exploiting any relevant dependency for a better accuracy. A novel solution called DRABAL that incorporates structure learning of a Bayesian Network as a step to model dependency between the HTS assays, is showed to achieve significant improvements over existing state-of-the-art approaches.

  18. Analysis of errors in the measurement of unattached fractions of radon and thoron progeny in a Canadian uranium mine using wire screen methods

    International Nuclear Information System (INIS)

    Khan, A.; Phillips, C.R.

    1987-01-01

    The unattached fraction of radon/thoron progeny in uranium mines is generally small and therefore difficult to measure accurately. The simple wire screen method provides a direct estimate of the unattached fraction from the screen count, or an indirect estimate from the difference between the reference and back-up filter counts. Wire screen method results are often difficult to analyse, especially when the unattached activity is small. Experimental data obtained in Canadian uranium mines are presented here, together with a detailed error analysis. The method consisting of counting the wire screen and the back-up filter is found to be the most precise method for unattached fraction determination. (author)

  19. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  20. CALF CIRCUMFERENCE AT BIRTH: A SCREENING METHOD FOR DETECTION OF LOW BIRTH WEIGHT

    Directory of Open Access Journals (Sweden)

    Sandip Kumar

    2012-12-01

    Full Text Available Background: Low Birth Weight (LBW babies run a higher risk of morbidity and mortality in the perinatal period. However, in our country where almost 70-80% births take place at home and peripheral hospitals, taking accurate weight is a problem due to unavailability of weighing scale and trained personnel. Hence there is a constant search for newer methods to detect LBW babies so that early interventions can be instituted. Various authors have used different surrogate anthropometric measurements from different parts of our country. In the present study, an attempt was made to validate the feasibility of using calf circumference as a predictor of LBW babies that can be used by a trained or untrained person. Objectives: To study various anthropometric measurements including calf circumference in newborns and to correlate various measurements with birth weight. Methods: The present study was conducted in the department of Social & Preventive Medicine, MLB Medical College, Jhansi (UP for a period of one year. The study included 1100 consecutively delivered neonates in the maternity ward of MLB Medical College Hospital, Jhansi (UP. The birth weight (Wt, crown heel length (CHL, crown rump length (CRL, head circumference (HC, chest circumference (CC, mid arm circumference (MAC, thigh circumference (TC and calf circumference (CC by standard techniques. All the measurements were taken by a single person throughout the study period with in 24 hours of delivery. Standard statistical methods were adopted for determination of critical limit, sensitivity, specificity and correlation coefficient of different anthropometric measurements in relation to birth weight. Results: Analysis of data indicates that out of 1100 newborns, 55.64% were low birth weight. The percentage of newborns > 2500gm was 44.36. Overall average birth weight was 2348 ± 505gm. Out of 1100 newborns, 608 (55.27% were males and 492 (44.73% were females. Average birth weight for males was 2412

  1. Development of a cloud-screening method for MAX-DOAS measurements

    Science.gov (United States)

    Gielen, Clio; Van Roozendael, Michel; Hendrik, Francois; Fayt, Caroline; Hermans, Christian; Pinardi, Gaia; Vlemmix, Tim

    2013-04-01

    is easily detectable. Additional information is derived from the O4 DSCD measurements, since they are quite sensitive to the change of the light paths due to scattering at different altitudes. For example, thick clouds at low altitude show a very strong increase in the DSCD values due to scattering, combined with a low colour index value due to the intensity screening. In general, our method shows promising results to qualify the sky and cloud conditions of MAX- DOAS measurements, without the need for other external cloud-detection systems such as Brewer instruments or pyrheliometers.

  2. A method of simultaneous no-screen X-ray film taking with direct twofold magnification of hands and feet

    International Nuclear Information System (INIS)

    Zajgner, J.; Szymanska-Prach, H.

    1978-01-01

    The authors propose an original method of X-ray examination of hands and feet which makes possible simultaneous radiography without screen and direct twofold magnified film taking. The method is not connected with the necessity of exposing the patient to an additional dose of X-rays. It has been tried in 20 patients with suspected rheumatoid arthritis. It requires an X-ray tube with 0.3 x 0.3 mm microfocus. (author)

  3. A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

    Science.gov (United States)

    Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

    2013-03-11

    Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

  4. Investigation of toxigenic potential of fungal species by the use of simple screening method

    Directory of Open Access Journals (Sweden)

    Bočarov-Stančić Aleksandra S.

    2009-01-01

    Full Text Available Potential for the biosynthesis of aflatoxin B1 (AFLB1, ochratoxin A (OTA, diacetoxyscirpenol (DAS, T-2 toxin (T2, and zearalenone (ZON was investigated in different fungal species belonging to the genera: Aspergillus, Fusarium and Penicillium. The majority of investigated isolates originated from cereal grains, crushed oil soybean seed and fodder mixtures. The simple screening method developed by Filtenborg et al. (1983 was applied with few modifications concerning the type of the medium and cultivation temperature. In order to optimise the biosynthetic conditions for different mycotoxins, the following control cultures, known as mycotin producers were used: OTA - A. ochraceus CBS 108.08, DAS - F. semitectum (SL-B i SL-C, T2 - F. sporotrichioides (ITM-391, M-1-1, R-2301 and ZON - F. graminearum (GZ-LES. The fungi were cultivated on the standard medium (YESA - 2% yeast extract, 15% sucrose and 2% agar, pH 6.5, three modifications of the basic medium (YESAZn - the standard medium supplemented with 0.23 mg/l ZnSO4 x 5 H2O; PPSA - the medium in which yeast extract was replaced with peptone-1; PPSAZn - the medium in which yeast extract was replaced with peptone-1 and supplemented with 0.23 mg/l ZnSO4 x 5 H2O, and the potato-dextrose agar (PDA. The earlier biosynthesis of tested mycotoxins was recorded under the following cultivation conditions of fungal species: AFLB1 - after 14 days on PDA at 27±1°C, OTA - after 10 days on YESA and YESAZn at 27±1°C, DAS - after 10 days on PPSA and PPSAZn at 27±1°C, T2 - after 7 days on PPSAZn and PPSA at room temperature (20-24°C, and ZON - after 1 week on YESA and YESAZn at room temperature (21-24°C.

  5. Sanitary justice in scarcity

    Directory of Open Access Journals (Sweden)

    Miguel Kottow

    Full Text Available Justice in health care and the allocation of scarce medical resources must be analyzed differently in affluent as compared to economically weaker societies. The protective functions of the state must be extended to cover basic needs for those too poor to meet them on their own. Medical needs are a high priority, since poor health hampers the ability to secure other basic needs. The state may operate as either a health care provider or supervisor, guaranteeing that citizens be treated fairly by nongovernmental institutions. Two-tiered systems with a vigorous private health care sector are compatible with the explicit right to health care, provided the private tier operates without directly or indirectly draining public funds.

  6. An approximate-reasoning-based method for screening high-level waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at Hanford have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. AR models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. The authors performed a pilot study to investigate the utility of AR for flammable gas screening. They found that the effort to implement such a model was acceptable and that computational requirements were reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  7. An approximate reasoning-based method for screening high-level-waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    2000-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop and improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  8. An Approximate Reasoning-Based Method for Screening High-Level-Waste Tanks for Flammable Gas

    International Nuclear Information System (INIS)

    Eisenhawer, Stephen W.; Bott, Terry F.; Smith, Ronald E.

    2000-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  9. An approximate reasoning-based method for screening high-level-waste tanks for flammable gas

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    2000-06-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop and improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts.

  10. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, P.; Kandarakis, I.; Cavouras, D.; Kalivas, N.; Delis, H.; Panayiotakis, G.

    2007-01-01

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd 2 O 2 S:Tb phosphor material with packing density of 70% and grain size of 7 μm and (c) phosphor thickness ranging between 30 and 70 mg/cm 2 . The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm 2 phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems

  11. Organization, relational justice and absenteeism.

    Science.gov (United States)

    Stoetzer, Ulrich; Åborg, Carl; Johansson, Gun; Svartengren, Magnus

    2014-01-01

    There is a need for more knowledge on how to manage companies towards healthier and more prosperous organizations with low levels of absenteeism. Relational Justice can be a useful concept when managing such organizations. Organizational factors can help to explain why some companies have relatively low absenteeism rates, even though they are equal to other companies in many other aspects. Previous studies suggest that management may be one important factor. Efficient management may depend on good relations between the leaders and the employees. The concept of Relational Justice is designed to capture these relations. Consequently, a Relational Justice framework may be used to understand why some companies have a low incidence of absenteeism. Managers from a representative body of Swedish companies. Interviews were analyzed to explore whether the items representing the concept of Relational Justice can be used to further understand the strategies, procedures and structures that characterize organizations and management in companies with a low incidence of absenteeism. Strategies, procedures or principles related to Relational Justice were common and highlighted in companies with an incidence of absenteeism. The most frequently occurring factors were; to be treated with kindness and consideration, personal viewpoint considered and to be treated impartially. The results suggested that a Relational Justice framework could be used to increase understanding of the organizational and managerial factors typical for companies with a low incidence of absenteeism. A Relational Justice approach to organizational management may be used to successfully lower absenteeism, change organizations and promote healthy and prosperous companies.

  12. Comparison of Cardiovascular Risk Screening Methods and Mortality Data among Hungarian Primary Care Population: Preliminary Results of the First Government-Financed Managed Care Program.

    Science.gov (United States)

    Móczár, Csaba; Rurik, Imre

    2015-09-01

    Besides participation in the primary prevention, screening as secondary prevention is an important requirement for primary care services. The effect of this work is influenced by the characteristics of individual primary care practices and doctors' screening habits, as well as by the regulation of screening processes and available financial resources. Between 1999 and 2009, a managed care program was introduced and carried out in Hungary, financed by the government. This financial support and motivation gave the opportunity to increase the number of screenings. 4,462 patients of 40 primary care practices were screened on the basis of SCORE risk assessment. The results of the screening were compared on the basis of two groups of patients, namely: those who had been pre-screened (pre-screening method) for known risk factors in their medical history (smoking, BMI, age, family cardiovascular history), and those randomly screened. The authors also compared the mortality data of participating primary care practices with the regional and national data. The average score was significantly higher in the pre-screened group of patients, regardless of whether the risk factors were considered one by one or in combination. Mortality was significantly lower in the participating primary practices than had been expected on the basis of the national mortality data. This government-financed program was a big step forward to establish a proper screening method within Hungarian primary care. Performing cardiovascular screening of a selected target group is presumably more appropriate than screening within a randomly selected population. Both methods resulted in a visible improvement in regional mortality data, though it is very likely that with pre-screening a more cost-effective selection for screening may be obtained.

  13. Development of a method for efficient cost-effective screening of Aspergillus niger mutants having increased production of glucoamylase.

    Science.gov (United States)

    Zhu, Xudong; Arman, Bessembayev; Chu, Ju; Wang, Yonghong; Zhuang, Yingping

    2017-05-01

    To develop an efficient cost-effective screening process to improve production of glucoamylase in Aspergillus niger. The cultivation of A. niger was achieved with well-dispersed morphology in 48-deep-well microtiter plates, which increased the throughput of the samples compared to traditional flask cultivation. There was a close negative correlation between glucoamylase and its pH of the fermentation broth. A novel high-throughput analysis method using Methyl Orange was developed. When compared to the conventional analysis method using 4-nitrophenyl α-D-glucopyranoside as substrate, a correlation coefficient of 0.96 by statistical analysis was obtained. Using this novel screening method, we acquired a strain with an activity of 2.2 × 10 3  U ml -1 , a 70% higher yield of glucoamylase than its parent strain.

  14. Overview of a workshop on screening methods for detecting potential (anti-) estrogenic/androgenic chemicals in wildlife

    Science.gov (United States)

    Ankley, Gerald T.; Mihaich, Ellen; Stahl, Ralph G.; Tillitt, Donald E.; Colborn, Theo; McMaster, Suzzanne; Miller, Ron; Bantle, John; Campbell, Pamela; Denslow, Nancy; Dickerson, Richard L.; Folmar, Leroy C.; Fry, Michael; Giesy, John P.; Gray, L. Earl; Guiney, Patrick; Hutchinson, Thomas; Kennedy, Sean W.; Kramer, Vincent; LeBlanc, Gerald A.; Mayes, Monte; Nimrod, Alison; Patino, Reynaldo; Peterson, Richard; Purdy, Richard; Ringer, Robert; Thomas, Peter C.; Touart, Les; Van Der Kraak, Glen; Zacharewski, Tim

    1998-01-01

    The U.S. Congress has passed legislation requiring the U.S. Environmental Protection Agency (U.S. EPA) to develop, validate, and implement screening tests for identifying potential endocrine-disrupting chemicals within 3 years. To aid in the identification of methods suitable for this purpose, the U.S. EPA, the Chemical Manufacturers Association, and the World Wildlife Fund sponsored several workshops, including the present one, which dealt with wildlife species. This workshop was convened with 30 international scientists representing multiple disciplines in March 1997 in Kansas City, Missouri, USA. Participants at the meeting identified methods in terms of their ability to indicate (anti-) estrogenic/androgenic effects, particularly in the context of developmental and reproductive processes. Data derived from structure-activity relationship models and in vitro test systems, although useful in certain contexts, cannot at present replace in vivo tests as the sole basis for screening. A consensus was reached that existing mammalian test methods (e.g., with rats or mice) generally are suitable as screens for assessing potential (anti-) estrogenic/ androgenic effects in mammalian wildlife. However, due to factors such as among-class variation in receptor structure and endocrine function, it is uncertain if these mammalian assays would be of broad utility as screens for other classes of vertebrate wildlife. Existing full and partial life-cycle tests with some avian and fish species could successfully identify chemicals causing endocrine disruption; however, these long-term tests are not suitable for routine screening. However, a number of short-term tests with species from these two classes exist that could serve as effective screening tools for chemicals inducing (anti-) estrogenic/androgenic effects. Existing methods suitable for identifying chemicals with these mechanisms of action in reptiles and amphibians are limited, but in the future, tests with species from

  15. Measuring background by the DIN-1M spectrometer using the oscillating absorbing screen method

    International Nuclear Information System (INIS)

    Glazkov, Yu.Yu.; Liforov, V.G.; Novikov, A.G.; Parfenov, V.A.; Semenov, V.A.

    1982-01-01

    Technique for measuring background by a double pulse slow neutron spectrometer is described. To measure the background on oscillating absorbing screen (OAS) periodically overlapping primary neutron beam at the input of a mechanical interrupter was used. During the overlapping monochromatic neutrons conditioned the effect are removed out of the beam and general background conditions are not practically applied. Screen oscillation permits to realize the condition of simultaneous measurement of effect and background neutrons. The optimal period of oscillations amounts to approximately 3 min. Analysis of neutron spectra scattered with different materials and corresponding background curves measured by means of the OAS technique shows that the share of monochromatic neutrons passing through the screen constitutes less than 1% of elastic peak and relative decrease of the total background level doesn't exceed 1.5-2%

  16. Virtual screening applications: a study of ligand-based methods and different structure representations in four different scenarios.

    Science.gov (United States)

    Hristozov, Dimitar P; Oprea, Tudor I; Gasteiger, Johann

    2007-01-01

    Four different ligand-based virtual screening scenarios are studied: (1) prioritizing compounds for subsequent high-throughput screening (HTS); (2) selecting a predefined (small) number of potentially active compounds from a large chemical database; (3) assessing the probability that a given structure will exhibit a given activity; (4) selecting the most active structure(s) for a biological assay. Each of the four scenarios is exemplified by performing retrospective ligand-based virtual screening for eight different biological targets using two large databases--MDDR and WOMBAT. A comparison between the chemical spaces covered by these two databases is presented. The performance of two techniques for ligand--based virtual screening--similarity search with subsequent data fusion (SSDF) and novelty detection with Self-Organizing Maps (ndSOM) is investigated. Three different structure representations--2,048-dimensional Daylight fingerprints, topological autocorrelation weighted by atomic physicochemical properties (sigma electronegativity, polarizability, partial charge, and identity) and radial distribution functions weighted by the same atomic physicochemical properties--are compared. Both methods were found applicable in scenario one. The similarity search was found to perform slightly better in scenario two while the SOM novelty detection is preferred in scenario three. No method/descriptor combination achieved significant success in scenario four.

  17. Access to Justice and Labor Law Reform in Asia

    Directory of Open Access Journals (Sweden)

    Asri Wijayanti

    2016-06-01

    Full Text Available The existence of national labor law system guarantees fair is one of legal reform to achieve access to justice. This study aims to analyze whether the system of labor law has given capacity to achieve access to justice as the basis for implementing international labor relations in Asia. The method of this study is a normative legal research with statute approach. The findings support that there was an inconsistency on the substance of the legal structures that affect the low legal culture. The substance of the national labor law systems have not adapted the comprehensive International Labor Organization (ILO conventions. Less robust system of national labor laws affect access to justice in the weak field of labor in the region. How To Cite: Wijayanti, A. (2016. Access to Justice and Labor Law Reform in Asia. Rechtsidee, 3(1, 17-26. doi:http://dx.doi.org/10.21070/jihr.v3i1.144

  18. A hermeneutic of justice. Justice as discernment in Matthew ...

    African Journals Online (AJOL)

    In some important dictionaries for the study of the New Testament, δικαιοσύνη has two meanings: justice in the sense of distributive justice and righteousness as a relational notion. In Matthew, we discover that the word concerns a threefold loyalty: loyalty to the law, loyalty to fellow people, and loyalty to the will of God. In the ...

  19. Estimation of Pap-test coverage in an area with an organised screening program: challenges for survey methods

    Directory of Open Access Journals (Sweden)

    Raggi Patrizio

    2006-03-01

    Full Text Available Abstract Background The cytological screening programme of Viterbo has completed the second round of invitations to the entire target population (age 25–64. From a public health perspective, it is important to know the Pap-test coverage rate and the use of opportunistic screening. The most commonly used study design is the survey, but the validity of self-reports and the assumptions made about non respondents are often questioned. Methods From the target population, 940 women were sampled, and responded to a telephone interview about Pap-test utilisation. The answers were compared with the screening program registry; comparing the dates of Pap-tests reported by both sources. Sensitivity analyses were performed for coverage over a 36-month period, according to various assumptions regarding non respondents. Results The response rate was 68%. The coverage over 36 months was 86.4% if we assume that non respondents had the same coverage as respondents, 66% if we assume they were not covered at all, and 74.6% if we adjust for screening compliance in the non respondents. The sensitivity and specificity of the question, "have you ever had a Pap test with the screening programme" were 84.5% and 82.2% respectively. The test dates reported in the interview tended to be more recent than those reported in the registry, but 68% were within 12 months of each other. Conclusion Surveys are useful tools to understand the effectiveness of a screening programme and women's self-report was sufficiently reliable in our setting, but the coverage estimates were strongly influenced by the assumptions we made regarding non respondents.

  20. Revision of FMM-Yukawa: An adaptive fast multipole method for screened Coulomb interactions

    Science.gov (United States)

    Zhang, Bo; Huang, Jingfang; Pitsianis, Nikos P.; Sun, Xiaobai

    2010-12-01

    FMM-YUKAWA is a mathematical software package primarily for rapid evaluation of the screened Coulomb interactions of N particles in three dimensional space. Since its release, we have revised and re-organized the data structure, software architecture, and user interface, for the purpose of enabling more flexible, broader and easier use of the package. The package and its documentation are available at http://www.fastmultipole.org/, along with a few other closely related mathematical software packages. New version program summaryProgram title: FMM-Yukawa Catalogue identifier: AEEQ_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEQ_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU GPL 2.0 No. of lines in distributed program, including test data, etc.: 78 704 No. of bytes in distributed program, including test data, etc.: 854 265 Distribution format: tar.gz Programming language: FORTRAN 77, FORTRAN 90, and C. Requires gcc and gfortran version 4.4.3 or later Computer: All Operating system: Any Classification: 4.8, 4.12 Catalogue identifier of previous version: AEEQ_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2331 Does the new version supersede the previous version?: Yes Nature of problem: To evaluate the screened Coulomb potential and force field of N charged particles, and to evaluate a convolution type integral where the Green's function is the fundamental solution of the modified Helmholtz equation. Solution method: The new version of fast multipole method (FMM) that diagonalizes the multipole-to-local translation operator is applied with the tree structure adaptive to sample particle locations. Reasons for new version: To handle much larger particle ensembles, to enable the iterative use of the subroutines in a solver, and to remove potential contention in assignments for parallelization. Summary of revisions: The software package FMM-Yukawa has been

  1. Alternative Dispute Resolution – Justice without Trial?

    Directory of Open Access Journals (Sweden)

    Angelica Roşu

    2012-05-01

    Full Text Available This research is proposed to analyze the alternative means of dispute resolution, as an alternativeof justice, or as a justice alternative, after studying both European critical literature and national one. Thephrase „alternative dispute resolution” means any alternative way of dispute resolution method whereby two ormore people try using a third party to reach a solution to the problem that precludes them, whether it ismediation, conciliation, assisted negotiation. In this research, we proposed to use the observation as a commonmethod. We concluded that the main reason of the alternative means for dispute resolution results from thepossibility to avoid the judicial system that makes it available for the litigants. It was also shown that users ofalternative means for dispute resolution not seek to resolve the dispute outside a court as an amicablesettlement, negotiated, consensual of their dispute.

  2. A novel automatic quantification method for high-content screening analysis of DNA double strand-break response.

    Science.gov (United States)

    Feng, Jingwen; Lin, Jie; Zhang, Pengquan; Yang, Songnan; Sa, Yu; Feng, Yuanming

    2017-08-29

    High-content screening is commonly used in studies of the DNA damage response. The double-strand break (DSB) is one of the most harmful types of DNA damage lesions. The conventional method used to quantify DSBs is γH2AX foci counting, which requires manual adjustment and preset parameters and is usually regarded as imprecise, time-consuming, poorly reproducible, and inaccurate. Therefore, a robust automatic alternative method is highly desired. In this manuscript, we present a new method for quantifying DSBs which involves automatic image cropping, automatic foci-segmentation and fluorescent intensity measurement. Furthermore, an additional function was added for standardizing the measurement of DSB response inhibition based on co-localization analysis. We tested the method with a well-known inhibitor of DSB response. The new method requires only one preset parameter, which effectively minimizes operator-dependent variations. Compared with conventional methods, the new method detected a higher percentage difference of foci formation between different cells, which can improve measurement accuracy. The effects of the inhibitor on DSB response were successfully quantified with the new method (p = 0.000). The advantages of this method in terms of reliability, automation and simplicity show its potential in quantitative fluorescence imaging studies and high-content screening for compounds and factors involved in DSB response.

  3. An analysis of normalization methods for Drosophila RNAi genomic screens and development of a robust validation scheme

    Science.gov (United States)

    Wiles, Amy M.; Ravi, Dashnamoorthy; Bhavani, Selvaraj; Bishop, Alexander J.R.

    2010-01-01

    Genome-wide RNAi screening is a powerful, yet relatively immature technology that allows investigation into the role of individual genes in a process of choice. Most RNAi screens identify a large number of genes with a continuous gradient in the assessed phenotype. Screeners must then decide whether to examine just those genes with the most robust phenotype or to examine the full gradient of genes that cause an effect and how to identify the candidate genes to be validated. We have used RNAi in Drosophila cells to examine viability in a 384-well plate format and compare two screens, untreated control and treatment. We compare multiple normalization methods, which take advantage of different features within the data, including quantile normalization, background subtraction, scaling, cellHTS2 1, and interquartile range measurement. Considering the false-positive potential that arises from RNAi technology, a robust validation method was designed for the purpose of gene selection for future investigations. In a retrospective analysis, we describe the use of validation data to evaluate each normalization method. While no normalization method worked ideally, we found that a combination of two methods, background subtraction followed by quantile normalization and cellHTS2, at different thresholds, captures the most dependable and diverse candidate genes. Thresholds are suggested depending on whether a few candidate genes are desired or a more extensive systems level analysis is sought. In summary, our normalization approaches and experimental design to perform validation experiments are likely to apply to those high-throughput screening systems attempting to identify genes for systems level analysis. PMID:18753689

  4. Wastewater screening method for evaluating applicability of zero-valent iron to industrial wastewater

    International Nuclear Information System (INIS)

    Lee, J.W.; Cha, D.K.; Oh, Y.K.; Ko, K.B.; Jin, S.H.

    2010-01-01

    This study presents a screening protocol to evaluate the applicability of the ZVI pretreatment to various industrial wastewaters of which major constituents are not identified. The screening protocol consisted of a sequential analysis of UV-vis spectrophotometry, high-performance liquid chromatograph (HPLC), and bioassay. The UV-vis and HPLC analyses represented the potential reductive transformation of unknown constituents in wastewater by the ZVI. The UV-vis and HPLC results were quantified using principal component analysis (PCA) and Euclidian distance (ED). The short-term bioassay was used to assess the increased biodegradability of wastewater constituents after ZVI treatment. The screening protocol was applied to seven different types of real industrial wastewaters. After identifying one wastewater as the best candidate for the ZVI treatment, the benefit of ZVI pretreatment was verified through continuous operation of an integrated iron-sequencing batch reactor (SBR) resulting in the increased organic removal efficiency compared to the control. The iron pretreatment was suggested as an economical option to modify some costly physico-chemical processes in the existing wastewater treatment facility. The screening protocol could be used as a robust strategy to estimate the applicability of ZVI pretreatment to a certain wastewater with unknown composition.

  5. A high-throughput screening method for determining the substrate scope of nitrilases.

    Science.gov (United States)

    Black, Gary W; Brown, Nicola L; Perry, Justin J B; Randall, P David; Turnbull, Graeme; Zhang, Meng

    2015-02-14

    Nitrile compounds are intermediates in the synthesis of pharmaceuticals such as atorvastatin. We have developed a chromogenic reagent to screen for nitrilase activity as an alternative to Nessler's reagent. It produces a semi-quantifiable blue colour and hydrolysis of 38 nitrile substrates by 23 nitrilases as cell-free extracts has been shown.

  6. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    The generation of genetically engineered mouse models (GEMMs), including knock-out (KO) and knock-in (KI) models, often requires genomic screening of many mouse ES cell (mESC) clones by Southern blot. The use of large targeting constructs facilitates the recombination of exogenous DNA in a specific...

  7. New methods for the screening of antioxidants in three Sideritis species

    NARCIS (Netherlands)

    Koleva, I.

    2007-01-01

    This thesis describes the rapid and robust evaluation of antioxidant activity of complex mixtures such as plant extracts. The study was directed to establish the best screening and isolation procedures for components with antioxidative properties to ensure the development of an “algorithm” for

  8. Using pre-screening methods for an effective and reliable site characterization at megasites

    DEFF Research Database (Denmark)

    Nielsen, Mette Algreen; Kalisz, Mariusz; Stalder, Marcel

    2015-01-01

    also expanded the applicabilityof tree coring to BTEX compounds and tested the use ofhigh-resolution direct-push sensors for light hydrocarbons.Comparison of screening results to results from conventionalsoil and groundwater sampling yielded in most cases high rankcorrelation and confirmed the findings...

  9. Developing and validating a perinatal depression screening tool in Kenya blending Western criteria with local idioms: A mixed methods study.

    Science.gov (United States)

    Green, Eric P; Tuli, Hawa; Kwobah, Edith; Menya, D; Chesire, Irene; Schmidt, Christina

    2018-03-01

    Routine screening for perinatal depression is not common in most primary health care settings. The U.S. Preventive Services Task Force only recently updated their recommendation on depression screening to specifically recommend screening during the pre- and postpartum periods. While practitioners in high-income countries can respond to this new recommendation by implementing one of several existing depression screening tools developed in Western contexts, such as the Edinburgh Postnatal Depression Scale (EPDS) or the Patient Health Questionnaire-9 (PHQ-9), these tools lack strong evidence of cross-cultural equivalence, validity for case finding, and precision in measuring response to treatment in developing countries. Thus, there is a critical need to develop and validate new screening tools for perinatal depression that can be used by lay health workers, primary health care personnel, and patients. Working in rural Kenya, we used free listing, card sorting, and item analysis methods to develop a locally-relevant screening tool that blended Western psychiatric concepts with local idioms of distress. We conducted a validation study with a random sample of 193 pregnant women and new mothers to test the diagnostic accuracy of this scale along with the EPDS and PHQ-9. The sensitivity/specificity of the EPDS and PHQ-9 was estimated to be 0.70/0.72 and 0.70/0.73, respectively. This compared to sensitivity/specificity of 0.90/0.90 for a new 9-item locally-developed tool called the Perinatal Depression Screening (PDEPS). Across these three tools, internal consistency reliability ranged from 0.77 to 0.81 and test-retest reliability ranged from 0.57 to 0.67. The prevalence of depression ranges from 5.2% to 6.2% depending on the clinical reference standard. The EPDS and PHQ-9 are valid and reliable screening tools for perinatal depression in rural Western Kenya, the PDEPS may be a more useful alternative. At less than 10%, the prevalence of depression in this region appears

  10. Organizational Justice Perception According to Generations

    Directory of Open Access Journals (Sweden)

    Zeki YÜKSEKBİLGİLİ

    2015-12-01

    Full Text Available Although there are many different researches on the subject of organizational justice, there is no research on organizational justice perception according to generations. In this study, the research subject is defined if there is a difference on the perception of organizational justice between x and y generations. After a conduct of 430 surveys the Organizational Justice Scale is used. As a result, it is proved that there is no significant difference between the organizational justice perceptions according to generations

  11. Gendering agency in transitional justice

    DEFF Research Database (Denmark)

    Björkdahl, Annika; Selimovic, Johanna Mannergren

    2015-01-01

    -Herzegovina, where we point out instances of critical, creative, and transformative agency performed by women that challenge or negotiate patterns of gendered relations of domination. We collect women’s oral narratives and explore new sets of questions to capture women’s unique experiences in doing justice......Mainstream transitional justice and peacebuilding practices tend to re-entrench gendered hierarchies by ignoring women or circumscribing their presence to passive victims in need of protection. As a consequence we have limited knowledge about the multifaceted ways women do justice and build peace....... To address this lacuna we conceptualize and unpack the meaning of gendered agency, by identifying its critical elements and by locating it in space and in time. The conceptual work that we undertake is underpinned by empirical mapping of the transitional justice spaces in post-conflict Bosnia...

  12. Restorative justice innovations in Canada.

    Science.gov (United States)

    Wilson, Robin J; Huculak, Bria; McWhinnie, Andrew

    2002-01-01

    As many jurisdictions move towards more retributive measures as a means to address public discontent with crime, a parallel movement has developed in regard to restorative justice. This article presents three restorative initiatives currently in use in Canada. Each initiative addresses offender behavior and community engagement at a different point in the justice continuum. The use of Sentencing Circles is an example of how restorative justice principles can be instituted at the front end, prior to an offender becoming lodged in the system. The Restorative Justice Options to Parole Suspension project demonstrates how community engagement can assist in preventing offenders from being returned to the system once they have achieved conditional release. The Circles of Support and Accountability project has enlisted the support of professionally supported volunteers in the community reintegration of high-risk sexual offenders. These initiatives are presented within a framework of effective correctional interventions and increased empowerment for a variety of stakeholders. Copyright 2002 John Wiley & Sons, Ltd.

  13. Allegheny County Environmental Justice Areas

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — Environmental Justice areas in this guide have been defined by the Pennsylvania Department of Environmental Protection. The Department defines an environmental...

  14. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  15. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    Science.gov (United States)

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Social and psychological aspects of criminal juvenile justice in the world practice (Anglo-Saxon model of juvenile justice

    Directory of Open Access Journals (Sweden)

    D.S. Oshevsky

    2013-10-01

    Full Text Available The article is the final part of the review of existing foreign models of juvenile criminal justice system. We analyze the principles of juvenile justice in the criminal trial: protective orientation, personalization and social richness of the trial, the emphasis on educational influences. We present the foreign experience of incorporating social, psychological and clinical special knowledge into specialized justice concerning juvenile offenders. We analyze modern trends in the development of juvenile justice in the United States and Canada. We present material related to methods of risk assessment of re-offending among adolescents. We highlight approaches to complex long-term follow-up of juvenile offenders in Anglo-Saxon juvenile justice. We describe some aspects of the probation service using the method of case management. In the context of the accepted “National Strategy for Action for the Benefit of Children for 2012-2017”, the prospects for the development of specialized criminal justice for young offenders in the Russian Federation are discussed

  17. Development and implementation of a screening method to categorise the greenhouse gas mitigation potential of 91 landfills

    DEFF Research Database (Denmark)

    Fredenslund, Anders Michael; Mønster, Jacob; Kjeldsen, Peter

    2018-01-01

    A cost-effective screening method for assessing methane emissions was developed and employed to categorise 91 older Danish landfills into three categories defined by the magnitude of their emissions. The overall aim was to assess whether these landfills were relevant or irrelevant with respect...... to variations in input parameters. Of the 91 landfills in the survey, 25 were found to be relevant for biocover construction when the methane emission threshold was set at 2 kg CH4 h−1....

  18. Determination of the Modulation Transfer Function of Screen-Film Combinations in X-ray photography by the grating method

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    An intercomparison experiment concerning the determination of the Modulation Transfer Function (MTF) of Screen-Film Combinations in x-ray photography by the grating method was made. Six laboratories located in four countries participated. Each laboratory has used its own, individually developed measurement procedure. The results have shown a surprisingly good agreement, the standard deviation (1 σ value) of MTF values reported by the different laboratories was about ± 0.02

  19. High Throughput Screening Method for Systematic Surveillance of Drugs of Abuse by Multisegment Injection-Capillary Electrophoresis-Mass Spectrometry.

    Science.gov (United States)

    DiBattista, Alicia; Rampersaud, Dianne; Lee, Howard; Kim, Marcus; Britz-McKibbin, Philip

    2017-11-07

    New technologies are urgently required for reliable drug screening given a worldwide epidemic of prescription drug abuse and its devastating socioeconomic impacts on public health. Primary screening of drugs of abuse (DoA) currently relies on immunoassays that are prone to bias and are not applicable to detect an alarming array of psychoactive stimulants, tranquilizers, and synthetic opioids. These limitations impact patient safety when monitoring for medication compliance, drug substitution, or misuse/abuse and require follow-up confirmatory testing by more specific yet lower throughput instrumental methods. Herein, we introduce a high throughput platform for nontargeted screening of a broad spectrum of DoA and their metabolites based on multisegment injection-capillary electrophoresis-mass spectrometry (MSI-CE-MS). We demonstrate that MSI-CE-MS enables serial injections of 10 samples within a single run (high resolution MS with full-scan data acquisition. Unambiguous drug identification was achieved by four or more independent parameters, including comigration with a deuterated internal standard or in silico prediction of electromigration behavior together with accurate mass, most likely molecular formula, as well as MS/MS as required for confirmation testing. Acceptable precision was demonstrated for over 50 DoA at 3 concentration levels over 4 days (median coefficient of variance = 13%, n = 117) with minimal ion suppression, isobaric interferences, and sample carry-over (screening cutoff levels in human urine while allowing for systematic surveillance, specimen verification, and retrospective testing of designer drugs that elude conventional drug tests.

  20. A Systematic Protein Refolding Screen Method using the DGR Approach Reveals that Time and Secondary TSA are Essential Variables.

    Science.gov (United States)

    Wang, Yuanze; van Oosterwijk, Niels; Ali, Ameena M; Adawy, Alaa; Anindya, Atsarina L; Dömling, Alexander S S; Groves, Matthew R

    2017-08-24

    Refolding of proteins derived from inclusion bodies is very promising as it can provide a reliable source of target proteins of high purity. However, inclusion body-based protein production is often limited by the lack of techniques for the detection of correctly refolded protein. Thus, the selection of the refolding conditions is mostly achieved using trial and error approaches and is thus a time-consuming process. In this study, we use the latest developments in the differential scanning fluorimetry guided refolding approach as an analytical method to detect correctly refolded protein. We describe a systematic buffer screen that contains a 96-well primary pH-refolding screen in conjunction with a secondary additive screen. Our research demonstrates that this approach could be applied for determining refolding conditions for several proteins. In addition, it revealed which "helper" molecules, such as arginine and additives are essential. Four different proteins: HA-RBD, MDM2, IL-17A and PD-L1 were used to validate our refolding approach. Our systematic protocol evaluates the impact of the "helper" molecules, the pH, buffer system and time on the protein refolding process in a high-throughput fashion. Finally, we demonstrate that refolding time and a secondary thermal shift assay buffer screen are critical factors for improving refolding efficiency.

  1. Transgenerational epigenetics and environmental justice.

    Science.gov (United States)

    Rothstein, Mark A; Harrell, Heather L; Marchant, Gary E

    2017-07-01

    Human transmission to offspring and future generations of acquired epigenetic modifications has not been definitively established, although there are several environmental exposures with suggestive evidence. This article uses three examples of hazardous substances with greater exposures in vulnerable populations: pesticides, lead, and diesel exhaust. It then considers whether, if there were scientific evidence of transgenerational epigenetic inheritance, there would be greater attention given to concerns about environmental justice in environmental laws, regulations, and policies at all levels of government. To provide a broader perspective on environmental justice the article discusses two of the most commonly cited approaches to environmental justice. John Rawls's theory of justice as fairness, a form of egalitarianism, is frequently invoked for the principle that differential treatment of individuals is justified only if actions are designed to benefit those with the greatest need. Another theory, the capabilities approach of Amartya Sen and Martha Nussbaum, focuses on whether essential capabilities of society, such as life and health, are made available to all individuals. In applying principles of environmental justice the article considers whether there is a heightened societal obligation to protect the most vulnerable individuals from hazardous exposures that could adversely affect their offspring through epigenetic mechanisms. It concludes that unless there were compelling evidence of transgenerational epigenetic harms, it is unlikely that there would be a significant impetus to adopt new policies to prevent epigenetic harms by invoking principles of environmental justice.

  2. Large-scale systematic analysis of 2D fingerprint methods and parameters to improve virtual screening enrichments.

    Science.gov (United States)

    Sastry, Madhavi; Lowrie, Jeffrey F; Dixon, Steven L; Sherman, Woody

    2010-05-24

    A systematic virtual screening study on 11 pharmaceutically relevant targets has been conducted to investigate the interrelation between 8 two-dimensional (2D) fingerprinting methods, 13 atom-typing schemes, 13 bit scaling rules, and 12 similarity metrics using the new cheminformatics package Canvas. In total, 157 872 virtual screens were performed to assess the ability of each combination of parameters to identify actives in a database screen. In general, fingerprint methods, such as MOLPRINT2D, Radial, and Dendritic that encode information about local environment beyond simple linear paths outperformed other fingerprint methods. Atom-typing schemes with more specific information, such as Daylight, Mol2, and Carhart were generally superior to more generic atom-typing schemes. Enrichment factors across all targets were improved considerably with the best settings, although no single set of parameters performed optimally on all targets. The size of the addressable bit space for the fingerprints was also explored, and it was found to have a substantial impact on enrichments. Small bit spaces, such as 1024, resulted in many collisions and in a significant degradation in enrichments compared to larger bit spaces that avoid collisions.

  3. Evaluation of the usefulness of visceral fat area measurement by the bioelectrical impedance method during workplace health screening

    International Nuclear Information System (INIS)

    Igarashi, Chiyo

    2008-01-01

    In the field of occupational health, health guidance concerning obesity is often conducted in order to prevent lifestyle-related diseases. With recent awareness of the concept of metabolic syndrome, measurement of the visceral fat area (VFA) by CT has been useful for health guidance, but it is difficult in workplace health screening. Presently, the BMI (Body Mass Index), body fat percentage measured by the bioelectrical impedance method, and waist girth at the umbilical level (abdominal girth) are practical indices of obesity used in such health screening. In this study, VAF was measured in 590 clerical or sales workers in the manufacturing industry using a body fat meter capable of a visceral fat measurement by the bioelectrical impedance method. The relationship of this value to the results of biochemical tests and lifestyle was then evaluated using analysis of covariance structures. Analysis indicated that the risk of lifestyle-related disease was closely related to the degree of obesity. Among indices of the degree of obesity, VFA was more closely related than BMI or body fat percentage, and only slightly less closely related than abdominal girth to the risk of lifestyle-related diseases. Since VFA is effective in screening for latent obesity, health guidance based on digital data, and the subjects' body imaging, its measurement by the bioelectrical impedance method is considered useful for workplace health management. (author)

  4. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening.

    Science.gov (United States)

    Köferle, Anna; Worf, Karolina; Breunig, Christopher; Baumann, Valentin; Herrero, Javier; Wiesbeck, Maximilian; Hutter, Lukas H; Götz, Magdalena; Fuchs, Christiane; Beck, Stephan; Stricker, Stefan H

    2016-11-14

    The bacterial CRISPR system is fast becoming the most popular genetic and epigenetic engineering tool due to its universal applicability and adaptability. The desire to deploy CRISPR-based methods in a large variety of species and contexts has created an urgent need for the development of easy, time- and cost-effective methods enabling large-scale screening approaches. Here we describe CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a method for the generation of comprehensive gRNA libraries for CRISPR-based screens. CORALINA gRNA libraries can be derived from any source of DNA without the need of complex oligonucleotide synthesis. We show the utility of CORALINA for human and mouse genomic DNA, its reproducibility in covering the most relevant genomic features including regulatory, coding and non-coding sequences and confirm the functionality of CORALINA generated gRNAs. The simplicity and cost-effectiveness make CORALINA suitable for any experimental system. The unprecedented sequence complexities obtainable with CORALINA libraries are a necessary pre-requisite for less biased large scale genomic and epigenomic screens.

  5. Justice orientation as a moderator of the framing effect on procedural justice perception.

    Science.gov (United States)

    Sasaki, Hiroyuki; Hayashi, Yoichiro

    2014-01-01

    Justice orientation is a justice-relevant personality trait, which is referred to as the tendency to attend to fairness issues and to internalize justice as a moral virtue. This study examined the moderating role of justice orientation in the relationship between justice perception and response to a decision problem. The authors manipulated procedural justice and the outcome valence of the decision frame within a vignette, and measured justice orientation of 174 Japanese participants. As hypothesized, the results indicated an interaction between procedural justice and framing manipulation, which was moderated by individual differences in justice orientation. In negative framing, justice effects were larger for individuals with high rather than low justice orientation. The results are explained from a social justice perspective, and the contributions and limitations of this study are also discussed with respect to our sample and framing manipulation.

  6. Comparison of three radiographic methods in screening of temporomandibular joint involvement in patients with psoriatic arthritis

    International Nuclear Information System (INIS)

    Koenoenen, M.; Kilpinen, E.

    1990-01-01

    Fifty-three randomly selected subjects with psoriatic arthritis (PA) were examined radiographically by means of orthopantomography, transcranial radiography, and transmaxillary radiography. Two examiners graded the radiographic signs of flattening, osteophytes, erosion, and sclerosis. The findings obtained were then compared to determine the best technique for screening of temporomandibular joint (TMJ) bone changes. Together the techniques showed definite (24%) and possible (6%) changes, suggesting TMJ involvement in 31 of 106 joints. In all projections, radiographic signs suggesting TMJ involvement were most frequent in the condyle. Erosion in the condyle was the most frequent finding. Agreement with regard to definite changes in the condyle was found in only one-third to half of the cases. It is concluded that in radiography of the TMJ in subjects with PA, a combination of radiographic techniques should be used to obtain maximum information. However, orthopantomography is well suited for screening of TMJ involvement in subjects with PA. 30 refs., 2 figs., 3 tabs

  7. Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

    2010-01-01

    We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

  8. Multiparameter telemetry as a sensitive screening method to detect vaccine reactogenicity in mice.

    Directory of Open Access Journals (Sweden)

    Margarete Arras

    Full Text Available Refined vaccines and adjuvants are urgently needed to advance immunization against global infectious challenges such as HIV, hepatitis C, tuberculosis and malaria. Large-scale screening efforts are ongoing to identify adjuvants with improved efficacy profiles. Reactogenicity often represents a major hurdle to the clinical use of new substances. Yet, irrespective of its importance, this parameter has remained difficult to screen for, owing to a lack of sensitive small animal models with a capacity for high throughput testing. Here we report that continuous telemetric measurements of heart rate, heart rate variability, body core temperature and locomotor activity in laboratory mice readily unmasked systemic side-effects of vaccination, which went undetected by conventional observational assessment and clinical scoring. Even minor aberrations in homeostasis were readily detected, ranging from sympathetic activation over transient pyrogenic effects to reduced physical activity and apathy. Results in real-time combined with the potential of scalability and partial automation in the industrial context suggest multiparameter telemetry in laboratory mice as a first-line screen for vaccine reactogenicity. This may accelerate vaccine discovery in general and may further the success of vaccines in combating infectious disease and cancer.

  9. The SOBANE risk management strategy and the Déparis method for the participatory screening of the risks.

    Science.gov (United States)

    Malchaire, J B

    2004-08-01

    The first section of the document describes a risk-prevention strategy, called SOBANE, in four levels: screening, observation, analysis and expertise. The aim is to make risk prevention faster, more cost effective, and more effective in coordinating the contributions of the workers themselves, their management, the internal and external occupational health (OH) practitioners and the experts. These four levels are: screening, where the risk factors are detected by the workers and their management, and obvious solutions are implemented; observation, where the remaining problems are studied in more detail, one by one, and the reasons and the solutions are discussed in detail; analysis, where, when necessary, an OH practitioner is called upon to carry out appropriate measurements to develop specific solutions; expertise, where, in very sophisticated and rare cases, the assistance of an expert is called upon to solve a particular problem. The method for the participatory screening of the risks (in French: Dépistage Participatif des Risques), Déparis, is proposed for the first level screening of the SOBANE strategy. The work situation is systematically reviewed and all the aspects conditioning the easiness, the effectiveness and the satisfaction at work are discussed, in search of practical prevention measures. The points to be studied more in detail at level 2, observation, are identified. The method is carried out during a meeting of key workers and technical staff. The method proves to be simple, sparing in time and means and playing a significant role in the development of a dynamic plan of risk management and of a culture of dialogue in the company.

  10. Measurement and account method for the available standing time of a smoke screen applying the diffusion equation

    Energy Technology Data Exchange (ETDEWEB)

    Chen-Guang, Zhu; Gong-Pei, Pan; Xiao-Yun, Wu; Hua, Guan [308, School of Chemical Engineering, Nanjing University of Science and Technology, 210094 (China)

    2006-06-15

    The available shielding area of a smoke screen is an important parameter to evaluate its protection capability. It varies with time according to a parabola equation, which could be obtained by the diffusion equation and a few measured data. The available standing time which could satisfy the request of rating area can be calculated. The process of deriving the equation, the experimental procedure and the method of data collecting and processing is presented in detail in this paper. The calculated result is compared with engineering experience to verify the method. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  11. Radioimmunoassay of alpha-foetoprotein in the eluate of dried blood. A method for antenatal screening of neural tube defects

    International Nuclear Information System (INIS)

    Travert, G.; Herlicoviez, M.; Laroche, D.

    1979-01-01

    A radioimmunoassay for alpha-foetoprotein (AFP) in dried blood spots is reported. The main technical characteristics (reproducibility, sensitivity, recovery of exogenous AFP added and AFP stability in dried blood) are evaluated. They indicate that this method is feasible and well adapted to AFP measurement during pregnancy. AFP determination in maternal serum allows early detection of at least 80% of neural tube defects. The use of dried blood spots as samples for AFP assay makes our method a possible mass screening test for these malformations, which occur with an incidence of 12 for 10,000 [fr

  12. Optimization of TRPV6 Calcium Channel Inhibitors Using a 3D Ligand-Based Virtual Screening Method.

    OpenAIRE

    Simonin Céline; Awale Mahendra; Brand Michael; van Deursen Ruud; Schwartz Julian; Fine Michael; Kovacs Gergely; Häfliger Pascal; Gyimesi Gergely; Sithampari Abilashan; Charles Roch-Philippe; Hediger Matthias A; Reymond Jean-Louis

    2015-01-01

    Herein we report the discovery of the first potent and selective inhibitor of TRPV6 a calcium channel overexpressed in breast and prostate cancer and its use to test the effect of blocking TRPV6 mediated Ca(2+) influx on cell growth. The inhibitor was discovered through a computational method xLOS a 3D shape and pharmacophore similarity algorithm a type of ligand based virtual screening (LBVS) method described briefly here. Starting with a single weakly active seed molecule two successive rou...

  13. A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

    Science.gov (United States)

    Zhang, Qingyang

    2018-05-16

    Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

  14. Electron screening effects in (p,α) reactions induced on boron isotopes studied via the Trojan Horse Method

    International Nuclear Information System (INIS)

    Lamia, L; Spitaleri, C; Cherubini, S; Gulino, M; Puglia, S M R; Rapisarda, G G; Romano, S; Sergi, M L; Carlin, N; Gameiro Munhoz, M; Gimenez Del Santo, M; Kiss, G G; Somorjai, E; Kroha, V; Kubono, S; La Cognata, M; Pizzone, R G; Li, C; Wen, Qungang; Mukhamedzhanov, A

    2013-01-01

    The Trojan Horse Method is a powerful indirect technique allowing one to measure the bare nucleus S(E)-factor and the electron screening potential for astrophysically relevant reactions without the needs of extrapolations. The case of the (p,α) reactions induced on the two boron isotopes 10,11 B is here discussed in view of the recent Trojan Horse (TH) applications to the quasi-free 10,11 B+ 2 H reactions. The comparison between the TH and the low-energy direct data allowed us to determine the electron screening potential for the 11 B(p,α) reaction, while preliminary results on the 10 B(p,α) reaction have been extracted.

  15. DETECTION OF MICROVASCULAR COMPLICATIONS OF TYPE 2 DIABETES BY EZSCAN AND ITS COMPARISON WITH STANDARD SCREENING METHODS

    Directory of Open Access Journals (Sweden)

    Sarita Bajaj

    2016-08-01

    Full Text Available BACKGROUND EZSCAN is a new, noninvasive technique to detect sudomotor dysfunction and thus neuropathy in diabetes patients at an early stage. It further predicts chances of development of other microvascular complications. In this study, we evaluated EZSCAN for detection of microvascular complications in Type 2 diabetes patients and compared accuracy of EZSCAN with standard screening methods. MATERIALS AND METHODS 104 known diabetes patients, 56 males and 48 females, were studied. All cases underwent the EZSCAN test, Nerve Conduction Study (NCS test, Vibration perception threshold test (VPT, Monofilament test, Fundus examination and Urine micral test. The results of EZSCAN were compared with standard screening methods. The data has been analysed and assessed by applying appropriate statistical tests within different groups. RESULTS Mean age of the subjects was 53.5 ± 11.4 years. For detection of diabetic neuropathy, sensitivity and specificity of EZSCAN was found to be 77.0 % and 95.3%, respectively. Odd’s ratio (OR was 68.82 with p < 0.0001. AUC in ROC curve was 0.930. Sensitivity and specificity of EZSCAN for detection of nephropathy were 67.1% and 94.1%, respectively. OR = 32.69 with p < 0.0001. AUC was 0.926. Sensitivity of EZSCAN for detection of retinopathy was 90% while specificity is 70.3%. OR = 21.27; p< 0.0001. AUC came out to be 0.920. CONCLUSION Results of EZSCAN test compared significantly to the standard screening methods for the detection of microvascular complications of diabetes and can be used as a simple, noninvasive and quick method to detect microvascular complications of diabetes.

  16. A combined enrichment/polymerase chain reaction based method for the routine screening of Streptococcus agalactiae in pregnant women

    Directory of Open Access Journals (Sweden)

    F.M. Munari

    2012-03-01

    Full Text Available Group B Streptococcus (GBS is the most common cause of life-threatening infection in neonates. Guidelines from CDC recommend universal screening of pregnant women for rectovaginal GBS colonization. The objective of this study was to compare the performance of a combined enrichment/PCR based method targeting the atr gene in relation to culture using enrichment with selective broth medium (standard method to identify the presence of GBS in pregnant women. Rectovaginal GBS samples from women at ≥36 weeks of pregnancy were obtained with a swab and analyzed by the two methods. A total of 89 samples were evaluated. The prevalence of positive results for GBS detection was considerable higher when assessed by the combined enrichment/PCR method than with the standard method (35.9% versus 22.5%, respectively. The results demonstrated that the use of selective enrichment broth followed by PCR targeting the atr gene is a highly sensitive, specific and accurate test for GBS screening in pregnant women, allowing the detection of the bacteria even in lightly colonized patients. This PCR methodology may provide a useful diagnostic tool for GBS detection and contributes for a more accurate and effective intrapartum antibiotic and lower newborn mortality and morbidity.

  17. Critical remarks on Simon Caney's humanity- centered approach to global justice

    Directory of Open Access Journals (Sweden)

    Julian Culp

    2016-09-01

    The practice-independent approach to theorizing justice (PIA holds that the social practices to which a particular conception of justice is meant to apply are of no importance for the justification of such a conception. In this paper I argue that this approach to theorizing justice is incompatible with the method of reflective equilibrium (MRE because the MRE is antithetical to a clean separation between issues of justification and application. In particular I will be maintaining that this incompatibility renders Simon Caney’s cosmopolitan theory of global justice inconsistent, because Caney claims to endorse both a humanity-centered PIA and the MRE.

  18. Pre-screening method for somatic cell contamination in human sperm epigenetic studies.

    Science.gov (United States)

    Jenkins, Timothy G; Liu, Lihua; Aston, Kenneth I; Carrell, Douglas T

    2018-04-01

    Sperm epigenetic profiles are frequently studied and are of great interest in many fields. One major technical concern when assessing these marks is the potential for somatic cell contamination. Because somatic cells have dramatically different epigenetic signatures, even small levels of contamination can result in significant problems in analysis and interpretation of data. In this study we evaluate an assay, which we designed to offer a reliable 'pre-screen' for somatic cell contamination that directly assesses the DNA being used in the study to determine tissue purity. In brief, we designed an inexpensive and simple assay that utilizes the strong differential methylation between sperm and somatic cells at four genomic loci to assess the general purity of samples prior to performing expensive and time intensive assays. The assay is able to reliably detect contamination qualitatively by running the sample on an agarose gel, or quantitatively with the use of a bioanalyzer. With this technique we have found that we can detect potentially contaminating signals in samples of many different types, including those from patients with poor sperm phenotypes (oligozoospermia, asthenozoospermia, and teratozoospermia). We also have found that the use of multiple sites to determine potential contamination is key, as some conditions (asthenozoospermia specifically) appear at one site to reflect a somatic-like profile, while at all other sites it appears to have very typical sperm DNA methylation signatures. Taken together, the use of the assay described herein was effective at identifying contamination and could be implemented in many labs to quickly and inexpensively pre-screen samples prior to performing far more expensive and labor intensive procedures. Additionally, the principles applied to the development of this assay could be easily adapted for the development of other assays to pre-screen different tissue/cell types or model organisms.

  19. Cost comparison of laboratory methods and four field screening technologies for uranium-contaminated soil

    International Nuclear Information System (INIS)

    Douthat, D.M.; Armstrong, A.Q.

    1994-01-01

    To address the problem of characterizing uranium-contaminated surface soil at federal facilities, the Department of Energy has the development of four uranium field screening technologies, under the direction of the Uranium-in-Soils Integrated Demonstration (USID) Program. These four technologies include: a long-range alpha detector a beta scintillation detector, an in situ gamma detector, and a mobile laser ablation-inductively coupled plasma/atomic emission spectrometry (LA-ICP/AES) laboratory. As part of the performance assessment for these field screening technologies, cost estimates for the development and operation of each technology were created. A cost study was conducted to compare three of the USID field screening technologies to the use of traditional field surveying equipment to adequately characterize surface soils of a one-acre site. The results indicate that the use of traditional equipment costs more than the in situ gamma detector, but less than the beta scintillation detector and LRAD. The use of traditional field surveying equipment results in cost savings of 4% and 34% over the use of the beta scintillation and LRAD technologies, respectively. A study of single-point surface soil sampling and laboratory analysis costs was also conducted. Operational costs of the mobile LA-ICP/AES laboratory were compared with operational costs of traditional sampling and analysis, which consists of collecting soil samples and conducting analysis in a radiochemical laboratory. The cost study indicates that the use of the mobile LA-ICP/AES laboratory results in cost savings of 23% and 40% over traditional field sampling and laboratory analysis conducted by characterization groups at two DOE facilities

  20. An improved single cell ultrahigh throughput screening method based on in vitro compartmentalization.

    Directory of Open Access Journals (Sweden)

    Fuqiang Ma

    Full Text Available High-throughput screening is a key technique in discovery and engineering of enzymes. In vitro compartmentalization based fluorescence-activated cell sorting (IVC-FACS has recently emerged as a powerful tool for ultrahigh-throughput screening of biocatalysts. However, the accuracy of current IVC-FACS assays is severely limited by the wide polydispersity of micro-reactors generated by homogenizing. Here, an improved protocol based on membrane-extrusion technique was reported to generate the micro-reactors in a more uniform manner. This crucial improvement enables ultrahigh-throughput screening of enzymatic activity at a speed of >10⁸ clones/day with an accuracy that could discriminate as low as two-fold differences in enzymatic activity inside the micro-reactors, which is higher than similar IVC-FACS systems ever have reported. The enzymatic reaction in the micro-reactors has very similar kinetic behavior compared to the bulk reaction system and shows wide dynamic range. By using the modified IVC-FACS, E. coli cells with esterase activity could be enriched 330-fold from large excesses of background cells through a single round of sorting. The utility of this new IVC-FACS system was further illustrated by the directed evolution of thermophilic esterase AFEST. The catalytic activity of the very efficient esterase was further improved by ∼2-fold, resulting in several improved mutants with k(cat/K(M values approaching the diffusion-limited efficiency of ∼10⁸ M⁻¹s⁻¹.

  1. Leadership and post-traumatic stress disorder: are soldiers' perceptions of organizational justice during deployment protective?

    Science.gov (United States)

    Elrond, Andreas F; Høgh, Annie; Andersen, Søren B

    2018-01-01

    Background : Soldiers' perception of leadership during military deployment has gained research attention as a potentially modifiable factor to buffer against the development of postdeployment post-traumatic stress disorder (PTSD). Within nonmilitary research, the organizational justice (OJ) framework, i.e. distributive justice, procedural justice (PJ) and interactional justice (IJ), has been found to relate to mental health outcomes. Aspects of OJ may, therefore, be protective against PTSD. Objectives : We examined the prospective relationship between aspects of OJ, namely the perceptions of PJ and IJ by subordinate soldiers without leadership obligations in relationship to immediate superiors and PTSD. Method : Participants were soldiers ( n =  245) deployed to Helmand Province in Afghanistan in 2009. Logistic regression procedures were used. The primary analysis measured PTSD cases using the Structured Clinical Interview for DSM-IV-TR Axis-I Disorder (SCID) 2½ years after homecoming. PJ/IJ was measured during deployment with a 6-item composite measure ranging from 0 to 12. Supplementary primary analyses were performed with PJ/IJ measured before and immediately after deployment. A secondary PJ/IJ analysis also tested against four postdeployment measures with the Post-Traumatic Stress Disorder Checklist Civilian (PCL-C) dichotomized at screening symptom levels. Results : Higher levels of perceived PJ/IJ for soldiers without leadership obligations during deployment had a prospective relation (OR = 0.86, 95% CI = 0.75-0.98) with PTSD on the SCID 2½ years after homecoming after adjustment for factors including predeployment PTSD symptoms, trauma and combat exposure, and state affectivity. Similar results were found by measuring PJ/IJ before (OR = 0.83, 95% CI = 0.71-0.95) but not immediately after homecoming (OR = 0.97, 95% CI = 0.85-1.11). A relationship with PTSD symptoms at the screening level at the four measurements of PCL-C was found, but only

  2. A tree based method for the rapid screening of chemical fingerprints

    DEFF Research Database (Denmark)

    Kristensen, Thomas Greve; Nielsen, Jesper; Pedersen, Christian Nørgaard Storm

    2009-01-01

    The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules......: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds...

  3. Screening of various botanical extracts for antioxidant activity using DPPH free radical method.

    Science.gov (United States)

    Waqas, Muhammad Khurram; Saqib, Najam-Us; Rashid, Saeed-Ur; Shah, Pervaiz Akhtar; Akhtar, Naveed; Murtaza, Ghulam

    2013-01-01

    Aiming at the exploration of herbal use by society, crude extracts of the seeds of some commonly used medicinal plants (Vitis vinifera, Tamarindus indica and Glycin max) were screened for their free radical scavenging properties using ascorbic acid as standard antioxidant. Free radical scavenging activity was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical. The overall antioxidant activity of grape seeds (Vitis vinifera) was the strongest, followed in descending order by soybean (Glycin max) and tamarind (Tamarindus indica). The seeds extract of Vitis vinifera, Glycin max and Tamarindus indica showed 85.61%, 83.45% and 79.26%, DPPH scavenging activity respectively.

  4. Gendered Justice Gaps in Bosnia-Herzegovina

    DEFF Research Database (Denmark)

    Björkdahl, Annika; Mannergren Selimovic, Johanna

    2014-01-01

    , and reparations gaps-this article examines structural constraints for women to engage in shaping and implementing transitional justice, and unmasks transitional justice as a site for the long-term construction of the gendered post-conflict order. Thus, the gendered dynamics of peacebuilding and transitional...... justice have produced a post-conflict order characterized by gendered peace and justice gaps. Yet, we conclude that women are doing justice within the Bosnian-Herzegovina transitional justice project, and that their presence and participation is complex, multilayered, and constrained yet critical....

  5. Environmental justice and healthy communities

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-01

    The environmental justice movement has come a long way since its birth a decade ago in rural and mostly African American Warren County, North Carolina. The selection of Warren County for a PCB landfill, they brought national attention to waste facility siting inequities and galvanized African American church and civil rights leaders` support for environmental justice. The demonstrations also put {open_quotes}environmental racism{close_quotes} on the map and challenged the myth that African Americans are not concerned about or involved in environmental issues. Grassroots groups, after decades of struggle, have grown to become the core of the multi-issue, multiracial, and multi-regional environmental justice movement. Diverse community-based groups have begun to organize and link their struggles to issues of civil and human rights, land rights and sovereignty, cultural survival , racial and social justice, and sustainable development. The impetus for getting environmental justice on the nations`s agenda has come from an alliance of grassroots activists, civil rights leaders, and a few academicians who questioned the foundation of the current environmental protection paradigm--where communities of color receive unequal protection. Whether urban ghettos and barrios, rural {open_quotes}poverty pockets,{close_quotes} Native American reservations, or communities in the Third World, grassroots groups are demanding an end to unjust and nonsustainable environmental and development policies.

  6. Prevalence, Diagnosis, and Treatment Rates of Mood Disorders among Opioid Users under Criminal Justice Supervision.

    Science.gov (United States)

    Mbaba, Mary; Brown, Shan-Estelle; Wooditch, Alese; Kiss, Marissa; Murphy, Amy; Kumari, Suneeta; Taxman, Faye; Altice, Frederick; Lawson, William B; Springer, Sandra A

    2018-01-15

    Individuals involved in the criminal justice system have disproportionately high rates of psychiatric disorders when compared to the general U.S. If left untreated, the likelihood of subsequent arrest increases and risk for adverse health consequences is great, particularly among opioid users. To explore the prevalence, characteristics, and treatment of mood disorders among justice involved opioid-dependent populations. The current study enrolled 258 treatment-seeking opioid-dependent individuals under community-based criminal justice supervision (e.g., probation, parole) screened from the larger parent study, Project STRIDE, a seek/test/treat randomized control trial (RCT) examining HIV and opioid use treatment. During baseline, individuals were screened for depression using the Patient Health Questionnaire-9 (PHQ-9) and screened for bipolar disorder using the Mood Disorder Questionnaire (MDQ) tool. Overall, 78 (30%) participants screened positive for moderate to severe depression and 54 (21%) screened positive for bipolar disorder. Participants self-reported mood disorders at higher rates than they screened positive for these conditions. Participants screening positive for these conditions experienced significantly greater family, legal, and medical problems on the Addiction Severity Index-Lite (ASI-Lite) than those who did not screen positive. Incidence of a lifetime suicide attempt was found to be associated with a positive screen for both mood disorders. Prescribed psychotropic treatment utilization was similar among those who screened positive for depression or bipolar disorder with approximately 38% reporting taking medication. Findings suggest universal mood disorder screening to improve comprehensive psychiatric care and treatment of opioid-dependent justice-involved individuals.

  7. On the Evaluation Overlap Integrals with the Same and Different Screening Parameters Over Slater Type Orbitals via the Fourier-Transform Method

    International Nuclear Information System (INIS)

    Yavuz, M.; Yuekcue, N.; Oeztekin, E.; Yilmaz, H.; Doenduer, S.

    2005-01-01

    In this paper, derivation of analytical expressions for overlap integrals with the same and different screening parameters of Slater type orbitals (STOs) via the Fourier-transform method is presented. Consequently, it is relatively easy to express the Fourier integral representations of the overlap integrals with same and different screening parameters mentioned as finite sums of Gegenbauer, Gaunt, binomial coefficients, and STOs.

  8. A rapid screening-level method to optimize location of infiltration ponds.

    Science.gov (United States)

    Fennemore, G G; Davis, A; Goss, L; Warrick, A W

    2001-01-01

    A rapid-screening technique was developed to identify lithologies that best disperse artificial recharge via surface infiltration and minimize effects on ground water chemistry. The technique prospectively evaluates basin infiltration rates and water chemistry influences by integrating geotechnical, hydraulic, and water quality data with column test data and numerical modeling. The technique was validated using field data collected from surface infiltration basins designed to recharge ground water pumped from the Pipeline pit gold mine in Nevada. Observed recharge rates at these infiltration sites correlated most significantly with depth to groundwater, with basins in coarse-grained lithologies performing better (0.45 to 0.85 m/day) than those with fine-grained layers ( 2000 mg/L) than coarse-grained soils (infiltration basins for a variety of lithologies. Sites for infiltration basins can be rapidly screened to include areas with greatest depth to groundwater and in coarsest alluvial sediments, and impact to ground water chemistry can be reliably predicted using computer modeling and column test results.

  9. An unbiased method to build benchmarking sets for ligand-based virtual screening and its application to GPCRs.

    Science.gov (United States)

    Xia, Jie; Jin, Hongwei; Liu, Zhenming; Zhang, Liangren; Wang, Xiang Simon

    2014-05-27

    Benchmarking data sets have become common in recent years for the purpose of virtual screening, though the main focus had been placed on the structure-based virtual screening (SBVS) approaches. Due to the lack of crystal structures, there is great need for unbiased benchmarking sets to evaluate various ligand-based virtual screening (LBVS) methods for important drug targets such as G protein-coupled receptors (GPCRs). To date these ready-to-apply data sets for LBVS are fairly limited, and the direct usage of benchmarking sets designed for SBVS could bring the biases to the evaluation of LBVS. Herein, we propose an unbiased method to build benchmarking sets for LBVS and validate it on a multitude of GPCRs targets. To be more specific, our methods can (1) ensure chemical diversity of ligands, (2) maintain the physicochemical similarity between ligands and decoys, (3) make the decoys dissimilar in chemical topology to all ligands to avoid false negatives, and (4) maximize spatial random distribution of ligands and decoys. We evaluated the quality of our Unbiased Ligand Set (ULS) and Unbiased Decoy Set (UDS) using three common LBVS approaches, with Leave-One-Out (LOO) Cross-Validation (CV) and a metric of average AUC of the ROC curves. Our method has greatly reduced the "artificial enrichment" and "analogue bias" of a published GPCRs benchmarking set, i.e., GPCR Ligand Library (GLL)/GPCR Decoy Database (GDD). In addition, we addressed an important issue about the ratio of decoys per ligand and found that for a range of 30 to 100 it does not affect the quality of the benchmarking set, so we kept the original ratio of 39 from the GLL/GDD.

  10. Comparing different methods for fast screening of microbiological quality of beach sand aimed at rapid-response remediation.

    Science.gov (United States)

    Testolin, Renan C; Almeida, Tito C M; Polette, Marcus; Branco, Joaquim O; Fischer, Larissa L; Niero, Guilherme; Poyer-Radetski, Gabriel; Silva, Valéria C; Somensi, Cleder A; Corrêa, Albertina X R; Corrêa, Rogério; Rörig, Leonardo R; Itokazu, Ana Gabriela; Férard, Jean-François; Cotelle, Sylvie; Radetski, Claudemir M

    2017-05-15

    There is scientific evidence that beach sands are a significant contributor to the pathogen load to which visitors are exposed. To develop beach quality guidelines all beach zones must be included in microbiological evaluations, but monitoring methods for beach sand quality are relatively longstanding, expensive, laborious and require moderate laboratory infrastructure. This paper aimed to evaluate the microorganism activity in different beach zones applying and comparing a classical method of membrane filtration (MF) with two colorimetric screening methods based on fluorescein (FDA) and tetrazolium (TTC) salt biotransformation to evaluate a new rapid and low-cost method for beach sand microbiological contamination assessments. The colorimetric results can help beach managers to evaluate rapidly and at low cost the microbiological quality of different beach zones in order to decide whether remedial actions need to be adopted to prevent exposure of the public to microbes due to beach sand and/or water contamination. Copyright © 2017. Published by Elsevier Ltd.

  11. Toxic Cyanobacteria in Svalbard: Chemical Diversity of Microcystins Detected Using a Liquid Chromatography Mass Spectrometry Precursor Ion Screening Method

    Directory of Open Access Journals (Sweden)

    Julia Kleinteich

    2018-04-01

    Full Text Available Cyanobacteria synthesize a large variety of secondary metabolites including toxins. Microcystins (MCs with hepato- and neurotoxic potential are well studied in bloom-forming planktonic species of temperate and tropical regions. Cyanobacterial biofilms thriving in the polar regions have recently emerged as a rich source for cyanobacterial secondary metabolites including previously undescribed congeners of microcystin. However, detection and detailed identification of these compounds is difficult due to unusual sample matrices and structural congeners produced. We here report a time-efficient liquid chromatography-mass spectrometry (LC-MS precursor ion screening method that facilitates microcystin detection and identification. We applied this method to detect six different MC congeners in 8 out of 26 microbial mat samples of the Svalbard Archipelago in the Arctic. The congeners, of which [Asp3, ADMAdda5, Dhb7] MC-LR was most abundant, were similar to those reported in other polar habitats. Microcystins were also determined using an Adda-specific enzyme-linked immunosorbent assay (Adda-ELISA. Nostoc sp. was identified as a putative toxin producer using molecular methods that targeted 16S rRNA genes and genes involved in microcystin production. The mcy genes detected showed highest similarities to other Arctic or Antarctic sequences. The LC-MS precursor ion screening method could be useful for microcystin detection in unusual matrices such as benthic biofilms or lichen.

  12. [Multi-residue method for screening of pesticides in crops by liquid chromatography with tandem mass spectrometry].

    Science.gov (United States)

    Tanizawa, Haruna; Shima, Mikie; Ikehara, Chieko; Kobata, Masakazu; Sato, Motoaki

    2005-10-01

    A simple and rapid method was developed for the screening of 82 pesticides/metabolites in a wide variety of crops, using solid-phase extraction and liquid chromatography with tandem mass spectrometry (LC/MS/MS). After extraction with methanol, the filtered extracts were made up to 100 mL and a 2 mL aliquot was subjected to solid-phase extraction. Co-extractives were removed with a C18 mini-column, while pesticides were retained on 3 kinds of mini-columns (HLB, SAX, activated carbon), and then eluted with acetonitrile. Analysis was performed by LC/MS/MS, and MS acquisition parameters were established in positive and negative ESI modes. The utility of the method was demonstrated by the analysis of 6 crops (carrot, cabbage, onion, spinach, lemon, brown rice) and one mixed vegetable juice. Of 82 compounds tested, 75 in carrot and 62 in lemon were obtained with recoveries ranging from 70-120%. For all samples tested, 75 compounds could be obtained with recoveries of over 50%, and the detection limits of most compounds were lower than 0.01 microg/g. This method provides acceptable performance for analysis of these 75 compounds. Further, by using aliquots of the extracts with small-scale mini-columns, purified samples could be obtained. This proposed method with small matrix effects, is effective and suitable for screening of multiple residual pesticides by using LC/MS/MS.

  13. A gas/liquid chromatographic-mass spectrometric method for the rapid screening of 250 pesticides in aqueous matrices

    Energy Technology Data Exchange (ETDEWEB)

    Chandramouli, B.; Harvan, D.; Brittain, S.; Hass, R. [Eno River Labs, LLC. Durham, NC (United States)

    2004-09-15

    Pesticide residues in food present a potentially serious and significant cause for concern. Many pesticides have been associated with significant health effects to the nervous and endocrine systems and some have been deemed carcinogenic. There are many well-established techniques for pesticide analysis. However, commercial pesticide methods have traditionally only been available for specific pesticide families, such as chlorinated pesticides or herbicides, and at detection limits ranging from 0.05 ppb to 1 ppm in aqueous matrices. Techniques that can quickly screen for the presence/absence of pesticide residues in food matrices are critical in ensuring the safety of food and water. This paper outlines a combined Gas Chromatographic-High Resolution Mass Spectrometric (GC-HRMS) and Liquid Chromatographic Tandem Mass Spectrometric (LC-MS/MS) screening assay for 250 pesticides that was developed for use in water, and soda samples at screening levels ranging from 0.1-5 ppb. The pesticides selected have been identified by the European Union as being of concern and the target of possible legislation. The list encompasses a variety of pesticide classes and compound groupings.

  14. Nontargeted Screening Method for Illegal Additives Based on Ultrahigh-Performance Liquid Chromatography-High-Resolution Mass Spectrometry.

    Science.gov (United States)

    Fu, Yanqing; Zhou, Zhihui; Kong, Hongwei; Lu, Xin; Zhao, Xinjie; Chen, Yihui; Chen, Jia; Wu, Zeming; Xu, Zhiliang; Zhao, Chunxia; Xu, Guowang

    2016-09-06

    Identification of illegal additives in complex matrixes is important in the food safety field. In this study a nontargeted screening strategy was developed to find illegal additives based on ultrahigh-performance liquid chromatography-high-resolution mass spectrometry (UHPLC-HRMS). First, an analytical method for possible illegal additives in complex matrixes was established including fast sample pretreatment, accurate UHPLC separation, and HRMS detection. Second, efficient data processing and differential analysis workflow were suggested and applied to find potential risk compounds. Third, structure elucidation of risk compounds was performed by (1) searching online databases [Metlin and the Human Metabolome Database (HMDB)] and an in-house database which was established at the above-defined conditions of UHPLC-HRMS analysis and contains information on retention time, mass spectra (MS), and tandem mass spectra (MS/MS) of 475 illegal additives, (2) analyzing fragment ions, and (3) referring to fragmentation rules. Fish was taken as an example to show the usefulness of the nontargeted screening strategy, and six additives were found in suspected fish samples. Quantitative analysis was further carried out to determine the contents of these compounds. The satisfactory application of this strategy in fish samples means that it can also be used in the screening of illegal additives in other kinds of food samples.

  15. Development of a test of suprathreshold acuity in noise in Brazilian Portuguese: a new method for hearing screening and surveillance.

    Science.gov (United States)

    Vaez, Nara; Desgualdo-Pereira, Liliane; Paglialonga, Alessia

    2014-01-01

    This paper describes the development of a speech-in-noise test for hearing screening and surveillance in Brazilian Portuguese based on the evaluation of suprathreshold acuity performances. The SUN test (Speech Understanding in Noise) consists of a list of intervocalic consonants in noise presented in a multiple-choice paradigm by means of a touch screen. The test provides one out of three possible results: "a hearing check is recommended" (red light), "a hearing check would be advisable" (yellow light), and "no hearing difficulties" (green light) (Paglialonga et al., Comput. Biol. Med. 2014). This novel test was developed in a population of 30 normal hearing young adults and 101 adults with varying degrees of hearing impairment and handicap, including normal hearing. The test had 84% sensitivity and 76% specificity compared to conventional pure-tone screening and 83% sensitivity and 86% specificity to detect disabling hearing impairment. The test outcomes were in line with the degree of self-perceived hearing handicap. The results found here paralleled those reported in the literature for the SUN test and for conventional speech-in-noise measures. This study showed that the proposed test might be a viable method to identify individuals with hearing problems to be referred to further audiological assessment and intervention.

  16. Development of a Test of Suprathreshold Acuity in Noise in Brazilian Portuguese: A New Method for Hearing Screening and Surveillance

    Directory of Open Access Journals (Sweden)

    Nara Vaez

    2014-01-01

    Full Text Available This paper describes the development of a speech-in-noise test for hearing screening and surveillance in Brazilian Portuguese based on the evaluation of suprathreshold acuity performances. The SUN test (Speech Understanding in Noise consists of a list of intervocalic consonants in noise presented in a multiple-choice paradigm by means of a touch screen. The test provides one out of three possible results: “a hearing check is recommended” (red light, “a hearing check would be advisable” (yellow light, and “no hearing difficulties” (green light (Paglialonga et al., Comput. Biol. Med. 2014. This novel test was developed in a population of 30 normal hearing young adults and 101 adults with varying degrees of hearing impairment and handicap, including normal hearing. The test had 84% sensitivity and 76% specificity compared to conventional pure-tone screening and 83% sensitivity and 86% specificity to detect disabling hearing impairment. The test outcomes were in line with the degree of self-perceived hearing handicap. The results found here paralleled those reported in the literature for the SUN test and for conventional speech-in-noise measures. This study showed that the proposed test might be a viable method to identify individuals with hearing problems to be referred to further audiological assessment and intervention.

  17. 83 CHALLENGES AND PROSPECTS OF THE JUVENILE JUSTICE ...

    African Journals Online (AJOL)

    Fr. Ikenga

    Juvenile justice administration in Nigeria is weak and has been given very .... The Nigerian criminal justice system, of which the juvenile justice system is an integral part, ... as instruments of security and justice but as weapons of oppression8.

  18. Special Justice for Peace: A Transitional Justice Model According to Modern Tendencies and Orientations of Law and Justice

    OpenAIRE

    Carlos Arturo Gómez Pavajeau

    2016-01-01

    The article analyses the constitutional implications of the peace agreement about Colombia’s armed conflict. It examines constitutional rules and international instruments about human rights, confronting the agreement with justice criteria in the national and international context, to underline the role of justice for the definitive solution of the conflict. By using the methodology of opposing concepts, it reviews the implications of formal justice and material justice, to establish the supe...

  19. Global health justice and governance.

    Science.gov (United States)

    Ruger, Jennifer Prah

    2012-01-01

    While there is a growing body of work on moral issues and global governance in the fields of global justice and international relations, little work has connected principles of global health justice with those of global health governance for a theory of global health. Such a theory would enable analysis and evaluation of the current global health system and would ethically and empirically ground proposals for reforming it to more closely align with moral values. Global health governance has been framed as an issue of national security, human security, human rights, and global public goods. The global health governance literature is essentially untethered to a theorized framework to illuminate or evaluate governance. This article ties global health justice and ethics to principles for governing the global health realm, developing a theoretical framework for global and domestic institutions and actors.

  20. Social Justice, Research, and Adolescence.

    Science.gov (United States)

    Russell, Stephen T

    2016-03-01

    In what ways might research on adolescence contribute to social justice? My 2014 Presidential Address identified strategies for social justice in our field. First, we need research that is conscious of biases, power, and privilege in science, as well as in our roles as scholars. Second, we need research that attends to inequities in lives of adolescents, and as scholars we need to question the ways that our research may unwittingly reinforce those inequalities. Third, we need research that attends to urgencies, that is, issues or conditions that influence adolescents' well-being which demand attention and action. I draw from a range of concepts and theoretical perspectives to make the case for a framework of social justice in research on adolescence.

  1. Green justice in the city

    DEFF Research Database (Denmark)

    Rutt, Rebecca Leigh; Gulsrud, Natalie Marie

    2016-01-01

    tIn this short communication, we discuss European urban green space (UGS) research from an environ-mental justice perspective. We show that European UGS scholarship primarily focuses on functionalvalues and managerial aspects of UGS, while paying less attention to equity in the enjoyment of andde...... of anddecision-making around UGS. On this basis we discuss potentials for European urban green space researchto take up a more explicit environmental justice framing to shed much-needed light on injustices inEuropean cities and inspire change in policy and practice.......tIn this short communication, we discuss European urban green space (UGS) research from an environ-mental justice perspective. We show that European UGS scholarship primarily focuses on functionalvalues and managerial aspects of UGS, while paying less attention to equity in the enjoyment...

  2. Spheres of Justice within Schools

    DEFF Research Database (Denmark)

    Sabbagh, Clara; Resh, Nura; Mor, Michal

    2006-01-01

    This article argues that there are distinct spheres of justice within education and examines a range of justice norms and distribution rules that characterize the daily life of schools and classrooms. Moving from the macro to micro level, we identify the following five areas: the right to education......, the allocation of (or selection into) learning places, teaching–learning practices, teachers’ treatment of students, and student evaluations of grade distribution. We discuss the literature on the beliefs by students and teachers about the just distribution of educational goods in these five domains......, and on the practices used in the actual allocation of these goods. In line with normative ‘spheres of justice’ arguments in social theory, we conclude that the ideals of social justice within schools vary strongly according to the particular resource to be distributed. Moreover, these ideals often do not correspond...

  3. A broader view of justice.

    Science.gov (United States)

    Jecker, Nancy S

    2008-10-01

    In this paper I argue that a narrow view of justice dominates the bioethics literature. I urge a broader view. As bioethicists, we often conceive of justice using a medical model. This model focuses attention at a particular point in time, namely, when someone who is already sick seeks access to scarce or expensive services. A medical model asks how we can fairly distribute those services. The broader view I endorse requires looking upstream, and asking how disease and suffering came about. In contrast to a medical model, a social model of justice considers how social determinants affect the health of a population. For example, social factors such as access to clean drinking water, education, safe workplaces, and police protection, profoundly affect risk for disease and early death. I examine one important social determinant of health, health care coverage, to show the limits of a medical model and the merits of a broader view.

  4. Non-invasive method for screening and early detection of breast tumors using thermal field analysis

    Directory of Open Access Journals (Sweden)

    O. Drosu

    2009-10-01

    Full Text Available The paper refers to general presentation of international and European evaluation regarding breast cancer incidence and mortality as well as recommendations for prevention, screening, detection and treatment.The past years international research development in biomedical engineering has put a particular emphasis on the thermography use in breast pathology diagnosis and its main advantages, such as: an early diagnose of the breast cancer, in that stage when the mammography or ultrasounds can not easily detect the changes of the tissue; a totally non-invasive interaction with human body; very low costs and possibilities for the women to do a self thermographic test.We also present some important results of our research within the field of breast tumor detection using the numerical analysis of the thermal inverse problem.

  5. Editors' Introduction: Justice, Rights, Literature

    Directory of Open Access Journals (Sweden)

    Joxerramon Bengoetxea

    2014-12-01

    Full Text Available The articles gathered in this issue are the result of papers presented at the workshop held at the Oñati International Institute for the Sociology of Law on 20-21 May 2013 on Perspectives of Justice in Literature: Perspectives from Justice and Fundamental Rights in Literature: an Approach from Legal Culture in a European context. Literature and literary fiction can act as a thread that helps different disciplines to communicate with each other and can thus help go beyond the strictly legal field opening up to questions of justice and rights. These papers deal with issues of justice - mainly Fundamental Rights, but also procedural aspects of justice and its administration, philosophical perspectives of justice - and of legal culture - local, European, Universal - as reflected through and by literature. Los artículos que conforman este número son el resultado de las ponencias presentadas en el workshop celebrado en el Instituto Internacional de Sociología Jurídica de Oñati el 20 y 21 mayo de 2013 sobre las perspectivas de la justicia en la literatura: Perspectivas desde la Justicia y los Derechos Fundamentales en la Literatura: un Enfoque de Cultura Jurídica en el Contexto Europeo. La literatura y la ficción literaria pueden ser un hilo que favorece que diferentes disciplinas se comuniquen entre sí y pueden de esta forma ayudar a ir más allá del campo jurídico estricto, planteando cuestiones sobre justicia y derechos. Estos artículos tratan sobre aspectos de la justicia (principalmente derechos fundamentales, pero también sobre procedimiento judicial y administración de la justicia, perspectivas filosóficas de la justicia y de cultura jurídica (local, europea, universal, de la forma en la que se han reflejado en la literatura.DOWNLOAD THIS PAPER FROM SSRN: http://ssrn.com/abstract=2543450

  6. Buccal swab, a minimally invasive method for the screening of oral cancer in active smokers

    Science.gov (United States)

    Suyatmi; Subiyantoro, P.; Indrakila, S.

    2018-05-01

    Smoking is the main risk factor for developing oral cancer. The previous study showed that there was a strong correlation between the length of smoking with the risk to develop oral cancer. Early detection of epithelial changes of oral mucosa will be a good prevention of the incidence of oral cancer among active smokers. This study evaluated the potential use of buccal swab for the screening of early signs of malignancy in active smokers. This study involved 80 participants including those who were smokers and non smokers. The buccal swab was conducted using sterile cytobrush. An epithelial smear was made from the buccal swab and stained with Papanicolaou’s technique. An cytomorphometric analysis was conducted by comparing the ratio of nuclear cell to cytoplasmic diameter (ND/CD) between the two groups. The mean of ND observed in this study were 8.963µ for active smokers and 7.991µ for non smokers groups. While the mean of CD were 58.249µ and 63.473µ for active smoker and non-smoker respectively. The mean of ND/CD ratio were 0.156 for active smokers and 0.129 for non smokers groups. This study detected a significant difference on the ND/CD ratio among active smokers vs non smokers (p<0.0001 95% CI = -0.040 – -0.014). In conclusion buccal swab could be a routine procedure to obtain sample for identification of changes in cells morphology to screen an early development of oral cancer.

  7. An approximate-reasoning-based method for screening flammable gas tanks

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-03-01

    High-level waste (HLW) produces flammable gases as a result of radiolysis and thermal decomposition of organics. Under certain conditions, these gases can accumulate within the waste for extended periods and then be released quickly into the dome space of the storage tank. As part of the effort to reduce the safety concerns associated with flammable gas in HLW tanks at Hanford, a flammable gas watch list (FGWL) has been established. Inclusion on the FGWL is based on criteria intended to measure the risk associated with the presence of flammable gas. It is important that all high-risk tanks be identified with high confidence so that they may be controlled. Conversely, to minimize operational complexity, the number of tanks on the watchlist should be reduced as near to the true number of flammable risk tanks as the current state of knowledge will support. This report presents an alternative to existing approaches for FGWL screening based on the theory of approximate reasoning (AR) (Zadeh 1976). The AR-based model emulates the inference process used by an expert when asked to make an evaluation. The FGWL model described here was exercised by performing two evaluations. (1) A complete tank evaluation where the entire algorithm is used. This was done for two tanks, U-106 and AW-104. U-106 is a single shell tank with large sludge and saltcake layers. AW-104 is a double shell tank with over one million gallons of supernate. Both of these tanks had failed the screening performed by Hodgson et al. (2) Partial evaluations using a submodule for the predictor likelihood for all of the tanks on the FGWL that had been flagged previously by Whitney (1995)

  8. Screen printing as a holistic manufacturing method for multifunctional microsystems and microreactors

    International Nuclear Information System (INIS)

    Bejarano, D; Lozano, P; Mata, D; Cito, S; Constantí, M; Katakis, I

    2009-01-01

    Microsystems are commonly manufactured by photolithographic or injection moulding techniques in a variety of realizations and on almost any material. A perennial problem in the manufacturing of microsystems is the difficulty to obtain hybrid devices that incorporate distinct materials with different functionalities. In most of the cases, cumbersome prototyping and high investment needed for manufacturing are additional problems that add to the cost of the final product. Such drawbacks are true not only for lab-on-a-chip but also for certain microreactor applications. Most importantly, in many commercial applications where an intermediate product between full fluidics control and a 'strip' is needed, such restraints prohibit the feasibility of reduction to practice. Screen printing on the other hand is a low cost technique that has been used for years in mass producing two-dimensional low cost reproductions of a mask pattern for circuits and art incorporates prototyping in production and allows the use of an almost limitless variety of materials as 'inks'. In this work it is demonstrated that taking advantage of the deposited ink's three-dimensional nature, screen printing can be used as a versatile and low cost technique for the fabrication of microchannels. Microchannels with dimensions in the order of 100 µm were fabricated that could readily incorporate functionalities through the choice of the materials used to create the microstructure. Variables have been investigated through a factorial experimental design as important process parameters that affect the resolution and print thickness of the resulting microchannels that incorporate electroactive elements. Such studies can lead to the optimization of the process for custom applications

  9. JUSTICE IN THE WORKPLACE: THE INFLUENCE OF PROCEDURAL,DISTRIBUTIVE AND INTERACTIONAL JUSTICE ONORGANISATIONAL CITIZENSHIP BEHAVIOUR AMONGEMPLOYEES IN THE POLICE SERVICE

    Directory of Open Access Journals (Sweden)

    H.J. van Vuuren

    2016-01-01

    Full Text Available Organisational justice has received a fair amount of attention in businessenvironments. The study investigated employees’ perceptions of organisationaljustice and their effects on organisational citizenship behaviour at the SAPSAcademy, Paarl, South Africa. Using a quantitative research paradigm and anexploratory research method, 226 employees were sampledthrough a structuredquestionnaire. Systematic sampling wasused to ensure that the sample accuratelyreflected the larger population (N=457.Thecorrelation analysis revealed that allthree dimensions of organisational justice are related significantly and positivelyto organisational citizenship behaviour.Through regression analysisorganisational justice showed a strong predictive relationship with organisationalcitizenship behaviour. The study demonstrated that employeesshow a greaterpropensityto engage in organisational citizenship behaviour when they are able toform positiveperceptions of procedural, distributive and interactional justice. Thestudy established that there are major differences between the expectations ofemployees and managerial actions, which suggest that there are differentareas toexplore and different types of activities to undertake in order to successfullyenhance employees’ perceptions of organisational justice and reinforceorganisational citizenship behaviourin the academy.

  10. Photochemical binding of photoallergens to human serum albumin: a simple in vitro method for screening potential photoallergens

    International Nuclear Information System (INIS)

    Barratt, M.D.; Brown, K.R.

    1985-01-01

    A simple procedure employing UV spectroscopy is described for testing the ability of chemicals to form covalent conjugates with proteins after irradiation with the appropriate wavelength of light. A range of known photoallergens of widely differing structure has been tested using this procedure; results of these experiments, together with evidence from the scientific literature, provide a correlation between compounds known to be photoallergens and their ability to form covalent conjugates with proteins on irradiation with the appropriate wavelength of light. The method is proposed as an in vitro screening procedure for potential photoallergens. (Auth.)

  11. Engineering justice transforming engineering education and practice

    CERN Document Server

    Leydens, Jon A

    2018-01-01

    Using social justice as a catalyst for curricular transformation, Engineering Justice presents an examination of how politics, culture, and other social issues are inherent in the practice of engineering. It aims to align engineering curricula with socially just outcomes, increase enrollment among underrepresented groups, and lessen lingering gender, class, and ethnicity gaps by showing how the power of engineering knowledge can be explicitly harnessed to serve the underserved and address social inequalities. This book is meant to transform the way educators think about engineering curricula through creating or transforming existing courses to attract, retain, and motivate engineering students to become professionals who enact engineering for social justice. Engineering Justice offers thought-provoking chapters on: why social justice is inherent yet often invisible in engineering education and practice; engineering design for social justice; social justice in the engineering sciences; social justice in human...

  12. Screening of a new cadmium hyperaccumulator, Galinsoga parviflora, from winter farmland weeds using the artificially high soil cadmium concentration method.

    Science.gov (United States)

    Lin, Lijin; Jin, Qian; Liu, Yingjie; Ning, Bo; Liao, Ming'an; Luo, Li

    2014-11-01

    A new method, the artificially high soil cadmium (Cd) concentration method, was used to screen for Cd hyperaccumulators among winter farmland weeds. Galinsoga parviflora was the most promising remedial plant among 5 Cd accumulators or hyperaccumulators. In Cd concentration gradient experiments, as soil Cd concentration increased, root and shoot biomass decreased, and their Cd contents increased. In additional concentration gradient experiments, superoxide dismutase and peroxidase activities increased with soil Cd concentrations up to 75 mg kg(-1) , while expression of their isoenzymes strengthened. Catalase (CAT) activity declined and CAT isoenzyme expression weakened at soil Cd concentrations less than 50 mg kg(-1) . The maxima of Cd contents in shoots and roots were 137.63 mg kg(-1) and 105.70 mg kg(-1) , respectively, at 100 mg kg(-1) Cd in soil. The root and shoot bioconcentration factors exceeded 1.0, as did the translocation factor. In a field experiment, total extraction of Cd by shoots was 1.35 mg m(-2) to 1.43 mg m(-2) at soil Cd levels of 2.04 mg kg(-1) to 2.89 mg kg(-1) . Therefore, the artificially high soil Cd concentration method was effective for screening Cd hyperaccumulators. Galinsoga parviflora is a Cd hyperaccumulator that could be used to efficiently remediate Cd-contaminated farmland soil. © 2014 SETAC.

  13. FSH to estradiol ratio can be used as screening method for mild cognitive impairment in postmenopausal women.

    Science.gov (United States)

    Hestiantoro, A; Wiwie, M; Shadrina, A; Ibrahim, N; Purba, J S

    2017-12-01

    To determine the role of anthropometric measurement, menopausal symptoms and biochemical marker changes as screening methods for mild cognitive impairment (MCI) in postmenopausal women Methods: A cross-sectional study included 282 postmenopausal women in Jakarta, further classified into two groups, with and without MCI. Some related variables such as age, body mass index (BMI), duration of menopause, vasomotor symptoms, hormone levels such as follicle stimulating hormone (FSH), luteinizing hormone, leptin, estradiol, and cognitive status, were assessed and analyzed. The FSH levels significantly correlated with MCI incidence (p = 0.018), along with the ratio of FSH/estradiol levels (p = 0.029) and ratio of FSH/soluble leptin receptor (p = 0.011), while other variables did not. By multivariate analysis, the ratio of FSH/estradiol was known as the most significant factor with a probability of having MCI in menopausal women of 1.15. Using the ROC curve, the threshold of the ratio FSH/estradiol to predict MCI was 1.94, with sensitivity 66.5% and specificity 46.8%. The ratio of FSH to estradiol (>1.94) can be used as a screening method for the occurrence of MCI in postmenopausal women.

  14. Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

    Science.gov (United States)

    Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

  15. Organisational justice and cognitive function in middle-aged employees: the Whitehall II study.

    Science.gov (United States)

    Elovainio, Marko; Singh-Manoux, Archana; Ferrie, Jane E; Shipley, Martin; Gimeno, David; De Vogli, Roberto; Vahtera, Jussi; Virtanen, Marianna; Jokela, Markus; Marmot, Michael G; Kivimäki, Mika

    2012-06-01

    Little is known about the role that work-related factors play in the decline of cognitive function. This study examined the association between perceived organisational justice and cognitive function among middle-aged men and women. Perceived organisational justice was measured at phases 1 (1985-8) and 2 (1989-90) of the Whitehall II study when the participants were 35-55 years old. Assessment of cognitive function at the screening clinic at phases 5 (1997-9) and 7 (2003-4) included the following tests in the screening clinic: memory, inductive reasoning (Alice Heim 4), vocabulary (Mill Hill), and verbal fluency (phonemic and semantic). Mean exposure to lower organisational justice at phases 1 and 2 in relation to cognitive function at phases 5 and 7 were analysed using linear regression analyses. The final sample included 4531 men and women. Lower mean levels of justice at phases 1 and 2 were associated with worse cognitive function in terms of memory, inductive reasoning, vocabulary and verbal fluency at both phases 5 and 7. These associations were independent of covariates, such as age, occupational grade, behavioural risks, depression, hypertension and job strain. This study suggests an association between perceived organisational justice and cognitive function. Further studies are needed to examine whether interventions designed to improve organisational justice would affect employees' cognition function favourably.

  16. Longitudinal Relationships Between Organizational Justice, Productivity Loss, and Sickness Absence Among Older Employees

    NARCIS (Netherlands)

    Ybema, Jan Fekke; van der Meer, Laudry; Leijten, Fenna R M

    2016-01-01

    PURPOSE: The aim of this study was to assess whether organizational justice lowers productivity loss and sickness absence, and whether there are reverse effects of productivity loss and sickness absence on organizational justice. METHOD: A longitudinal study with 2 years of follow-up was conducted

  17. Longitudinal relationships between organizational justice, productivity, loss and sickness absence older employees

    NARCIS (Netherlands)

    Ybema, J.F.; Meer, L. van der; Leijten, F.R.M.

    2016-01-01

    Purpose The aim of this study was to assess whether organizational justice lowers productivity loss and sickness absence, and whether there are reverse effects of productivity loss and sickness absence on organizational justice.Method A longitudinal study with 2 years of follow-up was conducted

  18. Mob justice in Tanzania: a medico-social problem | Ng'walali ...

    African Journals Online (AJOL)

    Objective: To investigate the magnitude of mob justice and associated factors. Background: Mob justice is a social and public health problem that has grown in Tanzania in recent decades that has negative effects on social and health of the country, communities, and families. Materials and Methods: A four-year autopsy ...

  19. The Virtual Water Transactions Promote Environmental Justice?

    Directory of Open Access Journals (Sweden)

    Thaís Dalla Corte

    2016-12-01

    Full Text Available As natural water, virtual water is essential for the dynamics of life. It, that correspond to the total volume of fresh water used in the production process in one place and that was incorporated into the final goods, is a calculation that can contribute to human access to water be assured in sufficient quantities for a dignified life. Therefore, the objective of this research is, through the hypothetical-deductive method of approach, evaluate virtual water transfers from the perspective of environmental justice in a globalized world in the Anthropocene.

  20. A rapid fluorimetric screening method for the 1,4-benzodiazepines: Determination of their metabolite oxazepam in urine

    Energy Technology Data Exchange (ETDEWEB)

    Gil Tejedor, A.M. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain); Fernandez Hernando, P. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain)]. E-mail: pfhernando@ccia.uned.es; Durand Alegria, J.S. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain)

    2007-05-15

    Oxazepam is the major metabolite screened in urine samples for the evidence of the use of benzodiazepine drugs. The methods currently used, however, are laborious and time consuming. This paper proposes an oxazepam detection method based on its hydrolysis and cyclization - a reaction catalysed by cerium (IV) in an ortho-phosphoric acid-containing medium - to form 2-chloro-9(10H)-acridinone, a strongly fluorescent molecule. The variables involved in the hydrolysis and cyclization stages were optimised. Oxazepam was detectable in the 5-900 ng mL{sup -1} range, with a detection limit of 4.15 ng mL{sup -1} for k = 3. The method was successfully used for the determination of oxazepam in urine samples collected at different times after the oral administration of Valium[reg] and Tranxilium[reg].

  1. A rapid fluorimetric screening method for the 1,4-benzodiazepines: Determination of their metabolite oxazepam in urine

    International Nuclear Information System (INIS)

    Gil Tejedor, A.M.; Fernandez Hernando, P.; Durand Alegria, J.S.

    2007-01-01

    Oxazepam is the major metabolite screened in urine samples for the evidence of the use of benzodiazepine drugs. The methods currently used, however, are laborious and time consuming. This paper proposes an oxazepam detection method based on its hydrolysis and cyclization - a reaction catalysed by cerium (IV) in an ortho-phosphoric acid-containing medium - to form 2-chloro-9(10H)-acridinone, a strongly fluorescent molecule. The variables involved in the hydrolysis and cyclization stages were optimised. Oxazepam was detectable in the 5-900 ng mL -1 range, with a detection limit of 4.15 ng mL -1 for k = 3. The method was successfully used for the determination of oxazepam in urine samples collected at different times after the oral administration of Valium[reg] and Tranxilium[reg

  2. Engaging Global Justice Through Internships (Penultimate Draft)

    OpenAIRE

    Ericka Tucker

    2014-01-01

    Engaging with Global Justice through InternshipsGlobal justice, on its face, seems like an impossible task. As individuals, even citizens of wealthy and powerful countries, the task of economic, social and political justice seems to outstrip our intellectual, practical and emotional abilities. Considering the scope of 'global' justice, it would appear that a massive coordinated effort would be necessary to overcome the problems of global injustice, yet it would seem such coordination may be i...

  3. Globalization and Social Justice in OECD Countries

    OpenAIRE

    Björn Kauder; Niklas Potrafke

    2015-01-01

    Social justice is a topic of importance to social scientists and also political decision makers. We examine the relationship between globalization and social justice as measured by a new indicator for 31 OECD countries. The results show that countries that experienced rapid globalization enjoy social justice. When the KOF index of globalization increases by one standard deviation, the social justice indicator increases by about 0.4 points (on a scale from 1 to 10). The policy implication is t...

  4. 75 FR 9613 - Draft NIJ Restraints Standard for Criminal Justice

    Science.gov (United States)

    2010-03-03

    ... DEPARTMENT OF JUSTICE Office of Justice Programs [OJP (NIJ) Docket No. 1512] Draft NIJ Restraints Standard for Criminal Justice AGENCY: National Institute of Justice, Office of Justice Programs, DOJ. ACTION: Notice of Draft NIJ Restraints Standard for Criminal Justice and Certification Program...

  5. Application of Sweat Patch Screening for 16 Drugs and Metabolites Using a Fast and Highly Selective LC-MS/MS Method

    NARCIS (Netherlands)

    Koster, Remco A.; Alffenaar, Jan-Willem C.; Greijdanus, Ben; VanDerNagel, Joanneke E. L.; Uges, Donald R. A.

    Background: To facilitate the monitoring of drug abuse by patients, a method was developed and validated for fast and highly selective screening for amphetamine, methamphetamine, 3,4-methylenedioxymethamphetamine, methylenedioxyamphetamine, methylenedioxyethylamphetamine, methylphenidate, cocaine,

  6. Restorative Justice: A Changing Community Response

    Science.gov (United States)

    Ryan, Thomas G.; Ruddy, Sean

    2015-01-01

    Our purpose herein is to demonstrate how restorative justice continues to unfold globally and we explain how the use of a restorative justice ideology and intervention leads to a common alternative, not only in criminal justice institutions, but also within social agencies, such as elementary schools, and the related social support systems. We…

  7. Common Frame of Reference and social justice

    NARCIS (Netherlands)

    Hesselink, M.W.; Satyanarayana, R.

    2009-01-01

    The article "Common Frame of Reference and Social Justice" by Martijn W. Hesselink evaluates the Draft Common Frame of Reference (DCFR) of social justice. It discusses the important areas, namely a common frame of Reference in a broad sense, social justice and contract law, private law and

  8. A rapid quantification method for the screening indicator for β-thalassemia with near-infrared spectroscopy

    Science.gov (United States)

    Chen, Jiemei; Peng, Lijun; Han, Yun; Yao, Lijun; Zhang, Jing; Pan, Tao

    2018-03-01

    Near-infrared (NIR) spectroscopy combined with chemometrics was applied to rapidly analyse haemoglobin A2 (HbA2) for β-thalassemia screening in human haemolysate samples. The relative content indicator HbA2 was indirectly quantified by simultaneous analysis of two absolute content indicators (Hb and Hb • HbA2). According to the comprehensive prediction effect of the multiple partitioning of calibration and prediction sets, the parameters were optimized to achieve modelling stability, and the preferred models were validated using the samples not involved in modelling. Savitzky-Golay smoothing was firstly used for the spectral pretreatment. The absorbance optimization partial least squares (AO-PLS) was used to eliminate high-absorption wave-bands appropriately. The equidistant combination PLS (EC-PLS) was further used to optimize wavelength models. The selected optimal models were I = 856 nm, N = 16, G = 1 and F = 6 for Hb and I = 988 nm, N = 12, G = 2 and F = 5 for Hb • HbA2. Through independent validation, the root-mean-square errors and correlation coefficients for prediction (RMSEP, RP) were 3.50 g L- 1 and 0.977 for Hb and 0.38 g L- 1 and 0.917 for Hb • HbA2, respectively. The predicted values of relative percentage HbA2 were further calculated, and the calculated RMSEP and RP were 0.31% and 0.965, respectively. The sensitivity and specificity for β-thalassemia both reached 100%. Therefore, the prediction of HbA2 achieved high accuracy for distinguishing β-thalassemia. The local optimal models for single parameter and the optimal equivalent model sets were proposed, providing more models to match possible constraints in practical applications. The NIR analysis method for the screening indicator of β-thalassemia was successfully established. The proposed method was rapid, simple and promising for thalassemia screening in a large population.

  9. Q Sepharose micro-column chromatography: A simple screening method for identifying beta thalassemia traits and hemoglobin E carriers.

    Science.gov (United States)

    Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong

    2016-11-01

    For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  10. Social justice, health disparities, and culture in the care of the elderly.

    Science.gov (United States)

    Dilworth-Anderson, Peggye; Pierre, Geraldine; Hilliard, Tandrea S

    2012-01-01

    Older minority Americans experience worse health outcomes than their white counterparts, exhibiting the need for social justice in all areas of their health care. Justice, fairness, and equity are crucial to minimizing conditions that adversely affect the health of individuals and communities. In this paper, Alzheimer's disease (AD) is used as an example of a health care disparity among elderly Americans that requires social justice interventions. Cultural factors play a crucial role in AD screening, diagnosis, and access to care, and are often a barrier to support and equality for minority communities. The "conundrum of health disparities" refers to the interplay between disparity, social justice, and cultural interpretation, and encourages researchers to understand both (1) disparity caused by economic and structural barriers to access, treatment, and diagnosis, and (2) disparity due to cultural interpretation of disease, in order to effectively address health care issues and concerns among elderly Americans. © 2012 American Society of Law, Medicine & Ethics, Inc.

  11. DEPIVIH 2: Use of three HIV testing methods in French primary care settings - ELISA laboratory screening versus two rapid point-of-care HIV tests.

    Science.gov (United States)

    Papadima, D; Gauthier, R; Prévoteau du Clary, F; Bouée, S; Conort, G; Livrozet, J-M; Taulera, O; Wajsbrot, A; Majerholc, C; Peter, J-M; Aubert, J-P

    2018-03-01

    The primary endpoint was to evaluate the use of HIV testing methods by French primary care providers: Elisa laboratory screening, instant result HIV diagnostic test and rapid result HIV diagnostic test. The secondary endpoints were the population screening rate of unknown HIV status consulting during the study period, reasons for screening and for choosing the specific screening method, the investigators' satisfaction with the rapid diagnostic test (RDT) and problems encountered. National prospective interventional study with French family physicians (FP) from December 2013 to December 2014. FPs enrolled all consenting adults consulting for an HIV screening test during a 6-month period: the choice was an Elisa laboratory test or one of the two RDTs. During the study period, 43 FPs included 981 patients. HIV screening was performed for the first time for 31.6% of patients; 767 (78.2%) Elisa laboratory test prescriptions and 214 (21.8%) RDTs were performed, leading to a screening rate of 1.3%. For 120 (15.7%) of the Elisa laboratory tests, the result was not reported and six RDTs were not valid. Nine patients were diagnosed as HIV-infected (0.9%): five with Elisa laboratory test and four with RDT. Almost 90% of FPs were willing to keep on using RDTs in their daily practice. In general practice, RDTs may be an important additional tool to traditional HIV screening. They could account for one in five tests prescribed in this context. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. Justice blocks and predictability of U.S. Supreme Court votes.

    Directory of Open Access Journals (Sweden)

    Roger Guimerà

    Full Text Available Successful attempts to predict judges' votes shed light into how legal decisions are made and, ultimately, into the behavior and evolution of the judiciary. Here, we investigate to what extent it is possible to make predictions of a justice's vote based on the other justices' votes in the same case. For our predictions, we use models and methods that have been developed to uncover hidden associations between actors in complex social networks. We show that these methods are more accurate at predicting justice's votes than forecasts made by legal experts and by algorithms that take into consideration the content of the cases. We argue that, within our framework, high predictability is a quantitative proxy for stable justice (and case blocks, which probably reflect stable a priori attitudes toward the law. We find that U.S. Supreme Court justice votes are more predictable than one would expect from an ideal court composed of perfectly independent justices. Deviations from ideal behavior are most apparent in divided 5-4 decisions, where justice blocks seem to be most stable. Moreover, we find evidence that justice predictability decreased during the 50-year period spanning from the Warren Court to the Rehnquist Court, and that aggregate court predictability has been significantly lower during Democratic presidencies. More broadly, our results show that it is possible to use methods developed for the analysis of complex social networks to quantitatively investigate historical questions related to political decision-making.

  13. A robust method to screen detergents for membrane protein stabilization, revisited.

    Science.gov (United States)

    Champeil, Philippe; Orlowski, Stéphane; Babin, Simon; Lund, Sten; le Maire, Marc; Møller, Jesper; Lenoir, Guillaume; Montigny, Cédric

    2016-10-15

    This report is a follow up of our previous paper (Lund, Orlowski, de Foresta, Champeil, le Maire and Møller (1989), J Biol Chem 264:4907-4915) showing that solubilization in detergent of a membrane protein may interfere with its long-term stability, and proposing a protocol to reveal the kinetics of such irreversible inactivation. We here clarify the fact that when various detergents are tested for their effects, special attention has of course to be paid to their critical micelle concentration. We also investigate the effects of a few more detergents, some of which have been recently advertised in the literature, and emphasize the role of lipids together with detergents. Among these detergents, lauryl maltose neopentyl glycol (LMNG) exerts a remarkable ability, even higher than that of β-dodecylmaltoside (DDM), to protect our test enzyme, the paradigmatic P-type ATPase SERCA1a from sarcoplasmic reticulum. Performing such experiments for one's favourite protein probably remains useful in pre-screening assays testing various detergents. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Materials Screening for the Discovery of New Half-Heuslers: Machine Learning versus ab Initio Methods.

    Science.gov (United States)

    Legrain, Fleur; Carrete, Jesús; van Roekeghem, Ambroise; Madsen, Georg K H; Mingo, Natalio

    2018-01-18

    Machine learning (ML) is increasingly becoming a helpful tool in the search for novel functional compounds. Here we use classification via random forests to predict the stability of half-Heusler (HH) compounds, using only experimentally reported compounds as a training set. Cross-validation yields an excellent agreement between the fraction of compounds classified as stable and the actual fraction of truly stable compounds in the ICSD. The ML model is then employed to screen 71 178 different 1:1:1 compositions, yielding 481 likely stable candidates. The predicted stability of HH compounds from three previous high-throughput ab initio studies is critically analyzed from the perspective of the alternative ML approach. The incomplete consistency among the three separate ab initio studies and between them and the ML predictions suggests that additional factors beyond those considered by ab initio phase stability calculations might be determinant to the stability of the compounds. Such factors can include configurational entropies and quasiharmonic contributions.

  15. Bioprospecting of Thermostable Cellulolytic Enzymes through Modeling and Virtual Screening Method

    Directory of Open Access Journals (Sweden)

    R. Navanietha Krishnaraj

    2017-04-01

    Full Text Available Cellulolytic enzymes are promising candidates for the use of cellulose in any bioprocess operations and for the disposal of the cellulosic wastes in an environmentally benign manner. Cellulases from thermophiles have the advantage of hydrolyzing cellulose at wider range of operating conditions unlike the normal enzymes. Herein we report the modeled structures of cellulolytic enzymes (endoglucanase, cellobiohydrolase and ß-glucosidase from a thermophilic bacterium,Clostridium thermocellumand their validation using Root Mean Square Deviation (RMSD and Ramachandran plot analyses. Further, the molecular interactions of the modeled enzyme with cellulose were analyzed using molecular docking technique. The results of molecular docking showed that the endoglucanase, cellobiohydrolase and ß-glucosidase had the binding affinities of -10.7, -9.0 and -10.8 kcal/mol, respectively. A correlation between the binding affinity of the endoglucanase with cellulose and the enzyme activity was also demonstrated. The results showed that the binding affinities of cellulases with cellulose could be used as a tool to assess the hydrolytic activity of cellulases. The results obtained could be used in virtual screening of cellulolytic enzymes based on the molecular interactions with the substrate, and aid in developing systems biology models of thermophiles for industrial biotechnology applications.

  16. vSDC: a method to improve early recognition in virtual screening when limited experimental resources are available.

    Science.gov (United States)

    Chaput, Ludovic; Martinez-Sanz, Juan; Quiniou, Eric; Rigolet, Pascal; Saettel, Nicolas; Mouawad, Liliane

    2016-01-01

    In drug design, one may be confronted to the problem of finding hits for targets for which no small inhibiting molecules are known and only low-throughput experiments are available (like ITC or NMR studies), two common difficulties encountered in a typical academic setting. Using a virtual screening strategy like docking can alleviate some of the problems and save a considerable amount of time by selecting only top-ranking molecules, but only if the method is very efficient, i.e. when a good proportion of actives are found in the 1-10 % best ranked molecules. The use of several programs (in our study, Gold, Surflex, FlexX and Glide were considered) shows a divergence of the results, which presents a difficulty in guiding the experiments. To overcome this divergence and increase the yield of the virtual screening, we created the standard deviation consensus (SDC) and variable SDC (vSDC) methods, consisting of the intersection of molecule sets from several virtual screening programs, based on the standard deviations of their ranking distributions. SDC allowed us to find hits for two new protein targets by testing only 9 and 11 small molecules from a chemical library of circa 15,000 compounds. Furthermore, vSDC, when applied to the 102 proteins of the DUD-E benchmarking database, succeeded in finding more hits than any of the four isolated programs for 13-60 % of the targets. In addition, when only 10 molecules of each of the 102 chemical libraries were considered, vSDC performed better in the number of hits found, with an improvement of 6-24 % over the 10 best-ranked molecules given by the individual docking programs.Graphical abstractIn drug design, for a given target and a given chemical library, the results obtained with different virtual screening programs are divergent. So how to rationally guide the experimental tests, especially when only a few number of experiments can be made? The variable Standard Deviation Consensus (vSDC) method was developed to

  17. Biomarkers and bioassays as alternative screening methods for the presence and effects of PCDD, PCDF and PCB

    International Nuclear Information System (INIS)

    Bosveld, A.T.C.B.; Berg, M.V.

    1994-01-01

    Polyhalogenated aromatic hydrocarbons (PHAH) are wide spread, highly toxic, environmental contaminants. As such they pose risks for both humans and wildlife. For risk assessment purposes, concentrations are generally analyzed by HRGC-HR/LRMS. With the analytical data, mixture toxicity is calculated using the TEF concept. With this method only the defined congeners are taken into account and additivity for all congeners is assumed, whereas synergistic and antagonistic effects for several PCDD/F in combination with PCB have also been reported. To avoid these problems and high analytical costs, bioassays can be used for screening purposes. Cytochrome P 450 1 A 1 induction and vitamin A and thyroid hormone levels are shown to be useful markers for PHAH exposure. When bioassays based on cytochrome P 450 1 A 1 induction, in cultured cells, in multi-well culturing plates, are used, 2,3,7,8-TCDD detection limits <0.2 pg are possible. As such these bioassays are highly sensitive, cost effective and time saving. This application can be used as a pre-screening method to determine total ''dioxin'' content of environmental samples. (orig.)

  18. Use of 15N dilution method for screening soybean lines with high yield and high nitrogen fixation ability

    International Nuclear Information System (INIS)

    Li Haixian; Li Xinmin; Danso, S.K.A.

    1998-01-01

    15 N dilution method was used for screening soybean lines with high nitrogen fixation ability. Screened lines 1005, 8502, 2096, 943, 1454 and Dongnong-42 have high nitrogen fixation ability with their % Ndfa of about 70%. 1454 and 1555 are both high yield and high nitrogen fixation lines. The ability of nitrogen fixation was not related to the yield, but related to maturing time. The cultivars with different maturing time have different levels of nitrogen fixation ability. The longer the maturing period is, the greater the ability of nitrogen fixation it has. There were ten cultivars or lines used in the test of 1992 and 1994. Although the weather condition were greatly different between the two years the results of seven cultivars or lines were the same, indicating that nitrogen fixation ability of the soybean is stable with years. Using 15 N dilution method to estimate nitrogen fixation ability of soybean is reliable, however, the % Ndfa of lines 8502 and 2096 increased by 19% in 1994, a rainy year, indicating that a change in % Ndfa with a few varieties maybe caused by weather

  19. A sediment extraction and cleanup method for wide-scope multitarget screening by liquid chromatography-high-resolution mass spectrometry.

    Science.gov (United States)

    Massei, Riccardo; Byers, Harry; Beckers, Liza-Marie; Prothmann, Jens; Brack, Werner; Schulze, Tobias; Krauss, Martin

    2018-01-01

    Previous studies on organic sediment contaminants focused mainly on a limited number of highly hydrophobic micropollutants accessible to gas chromatography using nonpolar, aprotic extraction solvents. The development of liquid chromatography-high-resolution mass spectrometry (LC-HRMS) permits the spectrum of analysis to be expanded to a wider range of more polar and ionic compounds present in sediments and allows target, suspect, and nontarget screening to be conducted with high sensitivity and selectivity. In this study, we propose a comprehensive multitarget extraction and sample preparation method for characterization of sediment pollution covering a broad range of physicochemical properties that is suitable for LC-HRMS screening analysis. We optimized pressurized liquid extraction, cleanup, and sample dilution for a target list of 310 compounds. Finally, the method was tested on sediment samples from a small river and its tributaries. The results show that the combination of 100 °C for ethyl acetate-acetone (50:50, neutral extract) followed by 80 °C for acetone-formic acid (100:1, acidic extract) and methanol-10 mM sodium tetraborate in water (90:10, basic extract) offered the best extraction recoveries for 287 of 310 compounds. At a spiking level of 1 μg mL -1 , we obtained satisfactory cleanup recoveries for the neutral extract-(93 ± 23)%-and for the combined acidic/basic extracts-(42 ± 16)%-after solvent exchange. Among the 69 compounds detected in environmental samples, we successfully quantified several pharmaceuticals and polar pesticides.

  20. Juvenile Justice: A Bibliographic Essay.

    Science.gov (United States)

    Kondak, Ann

    1979-01-01

    Provides information on the background and legal framework of the juvenile justice system, the issues that confront it, and the pressures for change, as well as noting some sources of information on the system. Available from American Association of Law Libraries, 53 West Jackson Blvd., Suite 1201, Chicago, Illinois 60604; sc $4.00. (Author/IRT)