WorldWideScience

Sample records for jt8d-9 9a 11

  1. 75 FR 27972 - Airworthiness Directives; Pratt & Whitney JT8D-9, -9A, -11, -15, -17, and -17R Turbofan Engines

    Science.gov (United States)

    2010-05-19

    ..., MAN- JT8D-2-06 and the Engine Manual Chapter/Section 72-33-21, Inspection 00. Definitions (i) For the... the technical contents of PW JT8D Maintenance Advisory Notice MAN-JT8D-2-06, dated November 20, 2006... Advisory Notice, MAN-JT8D-2-06 and the Engine Manual Chapter/Section 72-33-21, Inspection 00. (g) For...

  2. 75 FR 62319 - Airworthiness Directives; Pratt & Whitney JT8D-9, -9A, -11, -15, -17, and -17R Turbofan Engines

    Science.gov (United States)

    2010-10-08

    ... overhauling fan blade leading edges at the first shop visit after 4,000 cycles-in-service (CIS) since the last... proposed to require overhauling fan blade leading edges at the first shop visit after 4,000 CIS since the... Visit Delta Airlines, Inc. requests clarification of the shop visit definition in paragraph (i) of the...

  3. Metaheuristic and Machine Learning Models for TFE-731-2, PW4056, and JT8D-9 Cruise Thrust

    Science.gov (United States)

    Baklacioglu, Tolga

    2017-08-01

    The requirement for an accurate engine thrust model has a major antecedence in airline fuel saving programs, assessment of environmental effects of fuel consumption, emissions reduction studies, and air traffic management applications. In this study, utilizing engine manufacturers' real data, a metaheuristic model based on genetic algorithms (GAs) and a machine learning model based on neural networks (NNs) trained with Levenberg-Marquardt (LM), delta-bar-delta (DBD), and conjugate gradient (CG) algorithms were accomplished to incorporate the effect of both flight altitude and Mach number in the estimation of thrust. For the GA model, the analysis of population size impact on the model's accuracy and effect of number of data on model coefficients were also performed. For the NN model, design of optimum topology was searched for one- and two-hidden-layer networks. Predicted thrust values presented a close agreement with real thrust data for both models, among which LM trained NNs gave the best accuracies.

  4. PDE9A, PDE10A, and PDE11A expression in rat trigeminovascular pain signalling system

    DEFF Research Database (Denmark)

    Kruse, Lars S; Møller, Morten; Tibaek, Maiken

    2009-01-01

    as neocortex and cerebellar cortex. Real-time PCR and Western blotting showed that PDE9A, PDE10A and PDE11A are expressed in components of the rat trigeminovascular pain signalling system including middle cerebral artery, basilar artery, meninges, trigeminal ganglion and spinal trigeminal nucleus. Aorta...... and mesenteric artery as well as cerebral neocortex and cerebellar cortex also showed expression of PDE9A, PDE10A and PDE11A. Immunohistochemistry revealed that PDE9A, PDE10A and PDE11A are localised in the cytosol of nerve cell bodies of the trigeminal ganglion. We here present, for the first time...

  5. 10 CFR 770.11 - When does a claim “accrue” for purposes of notifying the Field Office Manager under § 770.9(a) of...

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false When does a claim âaccrueâ for purposes of notifying the Field Office Manager under § 770.9(a) of this part? 770.11 Section 770.11 Energy DEPARTMENT OF ENERGY... “accrue” for purposes of notifying the Field Office Manager under § 770.9(a) of this part? For purposes of...

  6. 11

    African Journals Online (AJOL)

    a routine working week. Special ... day of the working week and retested after finishing work on ... 4. 3. Med. 11,8. 12. -ye. 0. 5. 5. Med. 27,3. 107. -ye. 2. 6. 6. Med. 17,1. 80. -Ye. 0. 7. 3 .... present hours after first exposure (e.g. at night), it is also.

  7. Free-throw accuracy and success as a function of ball weight in 9- to 11-year-old male players Precisão e êxito em função do peso da bola em jogadores de 9 a 11 anos de idade

    Directory of Open Access Journals (Sweden)

    José Luis Arias

    2012-06-01

    Full Text Available The goal of this study was to analyze whether 9-11 years old children can attain more free-throw accuracy and success by modifying the ball weight in basketball game. The participants were 54 children (age: mean=10.63, SD=0.55 years from six basketball teams. The participants played four games with each of the following balls: (a standard ball weight (485 g, 69-71 cm, (b a lighter ball (440 g, 69-71 cm, and (c a heavier ball (540 g, 69-71 cm. The procedures adopted in the study were: (a defining the variables, (b instructing the observers and obtaining reliability, (c monitoring the properties of the ball and filming the games, and (d recording the data from the observation. The results revealed statistically significant differences for free-throw accuracy (χ²=1.76, df=2, p=.050 and success (χ²=5.69, df=2, p=.048. Free-throw accuracy and success were higher with the 440-g ball than with the 540-g ball.O objetivo deste estudo foi analisar se crianças de 9 a 11 anos poderiam alcançar maior precisão e êxito no lance livre em função de diferentes pesos da bola no basquetebol. Participaram do presente estudo 54 crianças (idade: M=10.63, SD=0.55 de seis equipes de basquetebol. Os participantes jogaram quatro jogos com cada um das seguintes bolas: (a bola regulamentar (485 g, 69-71 cm, (b bola menos pesada (440 g, 69-71 cm, e (c bola mais pesada (540 g, 69-71 cm. Os procedimentos seguidos foram: (a definição das variáveis, (b formação dos observadores e obtenção da confiabilidade, (c controle das propriedades da bola e filmagem dos jogos, e (d gravação dos dados de observação. Os resultados revelaram diferenças estatísticas significativas para precisão (χ²=1,76; df=2; p=0,05 e êxito do lance livre (χ²=5,69; df=2; p=0,048. A precisão e êxito do lance livre foram mais elevados com a bola de 440 g em comparação com a bola de 540 g.

  8. Major earthquake of Friday March 11, 2011, magnitude 8.9 at 5:46 UT, off Honshu island (Japan); Seisme majeur au large de l'Ile d'Honshu (Japon) du vendredi 11 mars 2011 Magnitude = 8,9 a 5h46 (TU)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    On Friday March 11, 2011, at 5:46 UT (2:46 PM local time), a magnitude 8.9 earthquake took place at 80 km east of Honshu island (Japan). The earthquake affected a large part of the Honshu territory and led to the automatic emergency shutdown of all nuclear power plants of the east coast. This paper recalls first the seismo-tectonic and historical seismic context of the Japan archipelago and the first analyses of the Tohoku earthquake impact on nuclear facilities. At the time of publication of this information report, no radioactive release in the environment and no anomaly at the Tokai-Mura and Rokkasho-Mura sites were mentioned. However, the evacuation of populations in a 3 to 10 km area around the Fukushima-Dai-ichi power plant had been ordered by the Governor as preventive measure, which made one think that the situation at this specific site was particularly worrying. (J.S.)

  9. 22 CFR 9a.4 - Classification.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Classification. 9a.4 Section 9a.4 Foreign... ENERGY PROGRAMS; RELATED MATERIAL § 9a.4 Classification. (a) Section 1 of E.O. 11932, August 4, 1976.... If the officer determines that the information or material warrants classification, he shall assign...

  10. Electrochemical Synthesis, Structure Elucidation and Antibacterial Evaluation of 9a-aza-9a-chloro-9a-homoerythromycin A

    Directory of Open Access Journals (Sweden)

    Zoran Mandic

    2014-09-01

    Full Text Available Electrochemical synthesis, structure elucidation and antibacterial evaluation of 9a-aza-9a-chloro-9a-homoerythromycin A were carried out. It was found that the anodic oxidation of 9a-aza-9a-homoerythromycin A via electrogenerated reactive chlorine species leads to the chlorination of lactam nitrogen in high yield provided the pH of the reaction mixture is maintained above 3. NOESY spectra reveal the existence of the mixture of two conformational families in the solution, the "folding-out" conformer being slightly more abundant comparing to 9a-Aza-9a-homoerythromycin A. The chlorine substitution of lactam hydrogen resulted in improved antimicrobial potency against Sreptococcus pyogenes PSCB0542, Moraxella catarrhalis ATCC 25238, Haemophilus  influenzae ATCC 49247 and Enteroccocus faecalis ATCC 29212.

  11. GF11

    International Nuclear Information System (INIS)

    Beetem, J; Denneav, M.; Weingarten, D.

    1986-01-01

    GF11 is a parallel processor currently under construction at the IBM Yorktown Research Center. The machine incorporates 576 floating-point boards. Each board has space for 2 x 10 6 bytes of memory and is capable of 2 x 10 7 floating point operations per second; given the total machine a peak of 1.15 x 10 9 bytes of memory and 1.15 x 10 10 floating point operations per second. The floatingpoint processors are interconnected by a dynamically reconfigurable switching network. At each machine cycle any of 1024 preselected permutations of data can be realized among the processors. The main intended application of GF11 is a class of calculations arising from quantum chormodynamics

  12. 11. Textbeispiele

    OpenAIRE

    Kunze, Rolf-Ulrich

    2017-01-01

    11.1 Seminararbeit zum Thema eines Seminarvortrags: Otto von Bismarck als preußischer Gesandter am Deutschen Bund in Frankfurt am Main, 1851-1859 Warum Bismarck? Man muß gar nicht auf den aus der Zeitgeschichte kommenden sozialgeschichtlichen Siegeszug des biographischen Genre seit einigen Jahren verweisen, um die seit ihren Anfängen offen zu Tage liegenden biographisch-strukturgeschichtlichen Defizite der makrotheoretisch-reduktionistischen politischen Sozialgeschichte Hans-Ulrich Wehlers un...

  13. Evaluation the COL9A2 gene with high myopia

    Science.gov (United States)

    Zhang, Dingding; Huang, Maomin

    2017-11-01

    This paper investigates the association of the COL9A2 gene between high myopia and normal controls in the Han Chinese population. It shows that the frameshift mutation (D281fs) in the COL9A2 gene is not associated with high myopia in the Han Chinese population, and the two novel variants(c.143G>C and c.884G>A) may contribute to the development of high myopia.

  14. Alternative Splicing of G9a Regulates Neuronal Differentiation

    Directory of Open Access Journals (Sweden)

    Ana Fiszbein

    2016-03-01

    Full Text Available Chromatin modifications are critical for the establishment and maintenance of differentiation programs. G9a, the enzyme responsible for histone H3 lysine 9 dimethylation in mammalian euchromatin, exists as two isoforms with differential inclusion of exon 10 (E10 through alternative splicing. We find that the G9a methyltransferase is required for differentiation of the mouse neuronal cell line N2a and that E10 inclusion increases during neuronal differentiation of cultured cells, as well as in the developing mouse brain. Although E10 inclusion greatly stimulates overall H3K9me2 levels, it does not affect G9a catalytic activity. Instead, E10 increases G9a nuclear localization. We show that the G9a E10+ isoform is necessary for neuron differentiation and regulates the alternative splicing pattern of its own pre-mRNA, enhancing E10 inclusion. Overall, our findings indicate that by regulating its own alternative splicing, G9a promotes neuron differentiation and creates a positive feedback loop that reinforces cellular commitment to differentiation.

  15. STS-9 crewmembers in training session in bldg 9A

    Science.gov (United States)

    1983-01-01

    Members of the STS-9 crew discuss flight procedures with a trainer in bldg 9A before the STS-9 mission. From left to right are Brewster Shaw, pilot; John Young, crew commander; Robert Parker, mission specialist; and unidentified trainer. They are reviewing procedures manuals on the shuttle mock-up hatch.

  16. 11 CFR 9032.11 - State.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false State. 9032.11 Section 9032.11 Federal Elections FEDERAL ELECTION COMMISSION PRESIDENTIAL ELECTION CAMPAIGN FUND: PRESIDENTIAL PRIMARY MATCHING FUND DEFINITIONS § 9032.11 State. State means each State of the United States, Puerto Rico, American...

  17. Partial deletion 11q

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Tommerup, N; Sørensen, F B

    1995-01-01

    We describe the cytogenetic findings and the dysmorphic features in a stillborn girl with a large de novo terminal deletion of the long arm of chromosome 11. The karyotype was 46,XX,del(11)(q21qter). By reviewing previous reports of deletion 11q, we found that cleft lip and palate are most...

  18. Intelligent Autonomous Systems 11: IAS-11

    NARCIS (Netherlands)

    Christensen, H.I.; Groen, F.; Petriu, E.

    2010-01-01

    This volume contains the proceedings of the eleventh International Conference on Intelligent Autonomous Systems (IAS-11) at the University of Ottawa in Canada. As ever, the purpose of the IAS conference is to bring together leading international researchers with an interest in all aspects of the

  19. Studio 1:1

    Index Scriptorium Estoniae

    2011-01-01

    Projekteerimis- ja disainistuudiost STUDIO 1:1 (Eindhoven), mis tegeleb avaliku ruumi loomise ja selle kasutamise kujundamisega. Projektidest "Linnulinn - linn lindude segakogukonna jaoks" ja ICT kogemuskeskus "De Verdieping"

  20. Local E11

    International Nuclear Information System (INIS)

    Riccioni, Fabio; West, Peter

    2009-01-01

    We give a method of deriving the field-strengths of all massless and massive maximal supergravity theories in any dimension starting from the Kac-Moody algebra E 11 . Considering the subalgebra of E 11 that acts on the fields in the non-linear realisation as a global symmetry, we show how this is promoted to a gauge symmetry enlarging the algebra by the inclusion of additional generators. We show how this works in eleven dimensions, and we call the resulting enlarged algebra E 11 local . Torus reduction to D dimensions corresponds to taking a subalgebra of E 11 local , called E 11,D local , that encodes the full gauge algebra of the corresponding D-dimensional massless supergravity. We show that each massive maximal supergravity in D dimensions is a non-linear realisation of an algebra E-tilde 11,D local . We show how this works in detail for the case of Scherk-Schwarz reduction of IIB to nine dimensions, and in particular we show how E-tilde 11,9 local arises as a subalgebra of the algebra E 11,10B local associated to the ten-dimensional IIB theory. This subalgebra corresponds to taking a combination of generators which is different to the massless case. We then show that E-tilde 11,D local appears as a deformation of the massless algebra E 11,D local in which the commutation relations between the E 11 and the additional generators are modified. We explicitly illustrate how the deformed algebra is constructed in the case of massive IIA and of gauged five-dimensional supergravity. These results prove the naturalness and power of the method.

  1. Lift11 / Ingrid Ruudi

    Index Scriptorium Estoniae

    Ruudi, Ingrid, 1978-

    2010-01-01

    23. augustist 11. oktoobrini 2010 toimuvast konkursist, mille eesmärk on leida kultuuripealinna üritusena toimuva linnainstallatsioonide festivali "Lift11" tarvis installatsioonide ideekavandeid. Festivali kuraatorid on kunstiteadlased Maarin Mürk ja Ingrid Ruudi ning arhitektid Margit Aule ja Margit Argus

  2. WOOD 1:1

    DEFF Research Database (Denmark)

    2013-01-01

    Report from 1:1 workshop at Virserum Konsthall in May 2013 with a team of Master's students from Royal Academy of Fine Arts, School of Architecture, Dpt. 3.......Report from 1:1 workshop at Virserum Konsthall in May 2013 with a team of Master's students from Royal Academy of Fine Arts, School of Architecture, Dpt. 3....

  3. The GF11 supercomputer

    International Nuclear Information System (INIS)

    Beetem, J.; Weingarten, D.

    1986-01-01

    GF11 is a parallel computer currently under construction at the IBM Yorktown Research Center. The machine incorporates 576 floating-point processors arrangedin a modified SIMD architecture. Each has space for 2 Mbytes of memory and is capable of 20 Mflops, giving the total machine a peak of 1.125 Gbytes of memory and 11.52 Gflops. The floating-point processors are interconnected by a dynamically reconfigurable non-blocking switching network. At each machine cycle any of 1024 pre-selected permutations of data can be realized among the processors. The main intended application of GF11 is a class of calculations arising from quantum chromodynamics

  4. The GF11 supercomputer

    International Nuclear Information System (INIS)

    Beetem, J.; Denneau, M.; Weingarten, D.

    1985-01-01

    GF11 is a parallel computer currently under construction at the IBM Yorktown Research Center. The machine incorporates 576 floating- point processors arranged in a modified SIMD architecture. Each has space for 2 Mbytes of memory and is capable of 20 Mflops, giving the total machine a peak of 1.125 Gbytes of memory and 11.52 Gflops. The floating-point processors are interconnected by a dynamically reconfigurable nonblocking switching network. At each machine cycle any of 1024 pre-selected permutations of data can be realized among the processors. The main intended application of GF11 is a class of calculations arising from quantum chromodynamics

  5. Tetratricopeptide repeat domain 9A is an interacting protein for tropomyosin Tm5NM-1

    International Nuclear Information System (INIS)

    Cao, Shenglan; Ho, Gay Hui; Lin, Valerie CL

    2008-01-01

    Tetratricopeptide repeat domain 9A (TTC9A) protein is a recently identified protein which contains three tetratricopeptide repeats (TPRs) on its C-terminus. In our previous studies, we have shown that TTC9A was a hormonally-regulated gene in breast cancer cells. In this study, we found that TTC9A was over-expressed in breast cancer tissues compared with the adjacent controls (P < 0.00001), suggesting it might be involved in the breast cancer development process. The aim of the current study was to further elucidate the function of TTC9A. Breast samples from 25 patients including the malignant breast tissues and the adjacent normal tissues were processed for Southern blot analysis. Yeast-two-hybrid assay, GST pull-down assay and co-immunoprecipitation were used to identify and verify the interaction between TTC9A and other proteins. Tropomyosin Tm5NM-1 was identified as one of the TTC9A partner proteins. The interaction between TTC9A and Tm5NM-1 was further confirmed by GST pull-down assay and co-immunoprecipitation in mammalian cells. TTC9A domains required for the interaction were also characterized in this study. The results suggested that the first TPR domain and the linker fragment between the first two TPR domains of TTC9A were important for the interaction with Tm5NM-1 and the second and the third TPR might play an inhibitory role. Since the primary function of tropomyosin is to stabilize actin filament, its interaction with TTC9A may play a role in cell shape and motility. In our previous results, we have found that progesterone-induced TTC9A expression was associated with increased cell motility and cell spreading. We speculate that TTC9A acts as a chaperone protein to facilitate the function of tropomyosins in stabilizing microfilament and it may play a role in cancer cell invasion and metastasis

  6. Lexikos - Vol 11 (2001)

    African Journals Online (AJOL)

    The compilation of electronic dictionaries for the African languages · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. D.J Prinsloo. http://dx.doi.org/10.5788/11-0-845 ...

  7. Data of evolutionary structure change: 1AJ9A-2ZLWD [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1AJ9A-2ZLWD 1AJ9 2ZLW A D -VLSPADKTNVKAAWGKVGAHAGEYGAEALERMFLSFPT...R VQLSGEEKAAVLALWDKVN--EEEVGGEALGRLLVVYPWTQRFFDSFGDLSNPGAVMGNPKVKAHGKKVLHSFGEGVHHLDNLKGTFAALSEL... 2ZLW D 2ZLWD

  8. Dop1 enhances conspecific olfactory attraction by inhibiting miR-9a maturation in locusts.

    Science.gov (United States)

    Guo, Xiaojiao; Ma, Zongyuan; Du, Baozhen; Li, Ting; Li, Wudi; Xu, Lingling; He, Jing; Kang, Le

    2018-03-22

    Dopamine receptor 1 (Dop1) mediates locust attraction behaviors, however, the mechanism by which Dop1 modulates this process remains unknown to date. Here, we identify differentially expressed small RNAs associated with locust olfactory attraction after activating and inhibiting Dop1. Small RNA transcriptome analysis and qPCR validation reveal that Dop1 activation and inhibition downregulates and upregulates microRNA-9a (miR-9a) expression, respectively. miR-9a knockdown in solitarious locusts increases their attraction to gregarious volatiles, whereas miR-9a overexpression in gregarious locusts reduces olfactory attraction. Moreover, miR-9a directly targets adenylyl cyclase 2 (ac2), causing its downregulation at the mRNA and protein levels. ac2 responds to Dop1 and mediates locust olfactory attraction. Mechanistically, Dop1 inhibits miR-9a expression through inducing the dissociation of La protein from pre-miR-9a and resulting in miR-9a maturation inhibition. Our results reveal a Dop1-miR-9a-AC2 circuit that modulates locust olfactory attraction underlying aggregation. This study suggests that miRNAs act as key messengers in the GPCR signaling.

  9. The GF11 supercomputer

    International Nuclear Information System (INIS)

    Beetem, J.; Denneau, M.; Weingarten, D.

    1985-01-01

    GF11 is a parallel computer currently under construction at the Yorktown Research Center. The machine incorporates 576 floating-point processors arranged in a modified SIMD architecture. Each processor has space for 2 Mbytes of memory and is capable of 20 MFLOPS, giving the total machine a peak of 1.125 Gbytes of memory and 11.52 GFLOPS. The floating-point processors are interconnected by a dynamically reconfigurable non-blocking switching network. At each machine cycle any of 1024 pre-selected permutations of data can be realized among the processors. The main intended application of GF11 is a class of calculations arising from quantum chromodynamics, a proposed theory of the elementary particles which participate in nuclear interactions

  10. Log of Apollo 11.

    Science.gov (United States)

    National Aeronautics and Space Administration, Washington, DC.

    The major events of the first manned moon landing mission, Apollo 11, are presented in chronological order from launch time until arrival of the astronauts aboard the U.S.S. Hornet. The log is descriptive, non-technical, and includes numerous color photographs of the astronauts on the moon. (PR)

  11. Apollo 11 Moon Landing

    Science.gov (United States)

    1969-01-01

    The crowning achievement for the Saturn V rocket came when it launched Apollo 11 astronauts, Neil Armstrong, Edwin (Buzz) Aldrin, and Michael Collins, to the Moon in July 1969. In this photograph, astronaut Aldrin takes his first step onto the surface of the Moon.

  12. Blitzerindringer om 11. september

    DEFF Research Database (Denmark)

    Hansen, Tia G. B.

    2011-01-01

    11. september 2001 skabte såkaldte ”blitzerindringer” i Danmark og mange andre lande. Det vil sige, at vores klare erindring ikke kun omfatter selve begivenheden, men også vores personlige oplevelse af at få kendskab til den, og at vi har en stor tiltro til denne erindring. Blitzerindringerne for...

  13. Beyond E 11

    Science.gov (United States)

    Bossard, Guillaume; Kleinschmidt, Axel; Palmkvist, Jakob; Pope, Christopher N.; Sezgin, Ergin

    2017-05-01

    We study the non-linear realisation of E 11 originally proposed by West with particular emphasis on the issue of linearised gauge invariance. Our analysis shows even at low levels that the conjectured equations can only be invariant under local gauge transformations if a certain section condition that has appeared in a different context in the E 11 literature is satisfied. This section condition also generalises the one known from exceptional field theory. Even with the section condition, the E 11 duality equation for gravity is known to miss the trace component of the spin connection. We propose an extended scheme based on an infinite-dimensional Lie superalgebra, called the tensor hierarchy algebra, that incorporates the section condition and resolves the above issue. The tensor hierarchy algebra defines a generalised differential complex, which provides a systematic description of gauge invariance and Bianchi identities. It furthermore provides an E 11 representation for the field strengths, for which we define a twisted first order self-duality equation underlying the dynamics.

  14. LIFT11 linnas

    Index Scriptorium Estoniae

    2010-01-01

    Tallinn 2011 programmi kuuluva installatsioonide festivali "Lift11" avalikule ideekonkursile esitati 129 tööd, välja valiti 17. Tutvustatakse Maarja Kase ja Ralf Lõokese tööd "L", Tomomi Hayashi tööd "Merele!", Toomas Paaveri, Teele Pehki ja Triin Talki tööd "Kalarand"

  15. Pentagon 9/11

    National Research Council Canada - National Science Library

    Goldberg, Alfred; Papadopoulos, Sarandis; Putney, Diane; Berlage, Nancy; Welch, Rebecca

    2007-01-01

    As no other event in U.S. history, not even Pearl Harbor, the deadly assaults on New York and Washington that took the lives of almost 3,000 people on 11 September 2001 shattered the nation's sense of security...

  16. G9a coordinates with the RPA complex to promote DNA damage repair and cell survival.

    Science.gov (United States)

    Yang, Qiaoyan; Zhu, Qian; Lu, Xiaopeng; Du, Yipeng; Cao, Linlin; Shen, Changchun; Hou, Tianyun; Li, Meiting; Li, Zhiming; Liu, Chaohua; Wu, Di; Xu, Xingzhi; Wang, Lina; Wang, Haiying; Zhao, Ying; Yang, Yang; Zhu, Wei-Guo

    2017-07-25

    Histone methyltransferase G9a has critical roles in promoting cancer-cell growth and gene suppression, but whether it is also associated with the DNA damage response is rarely studied. Here, we report that loss of G9a impairs DNA damage repair and enhances the sensitivity of cancer cells to radiation and chemotherapeutics. In response to DNA double-strand breaks (DSBs), G9a is phosphorylated at serine 211 by casein kinase 2 (CK2) and recruited to chromatin. The chromatin-enriched G9a can then directly interact with replication protein A (RPA) and promote loading of the RPA and Rad51 recombinase to DSBs. This mechanism facilitates homologous recombination (HR) and cell survival. We confirmed the interaction between RPA and G9a to be critical for RPA foci formation and HR upon DNA damage. Collectively, our findings demonstrate a regulatory pathway based on CK2-G9a-RPA that permits HR in cancer cells and provide further rationale for the use of G9a inhibitors as a cancer therapeutic.

  17. IDEA papers no 11

    International Nuclear Information System (INIS)

    Bocquet, R.

    2004-01-01

    The Information network on the Economic Development in Aquitaine (IDEA) aims to collect and spread the environmental information concerning the Aquitaine, in order to implement an observatory of the regional environment and of the sustainable development. The IDEA paper no.11 is devoted to the wastes management in Aquitaine. Data on wastes volume, type and recycling are presented and examples of enterprises actions are provided. (A.L.B.)

  18. Methyl (9aR*,10S*,11R*,13aS*,13bS*-9-oxo-6,7,9,9a,10,11-hexahydro-5H,13bH-11,13a-epoxypyrrolo[2′,1′:3,4][1,4]diazepino[2,1-a]isoindole-10-carboxylate

    Directory of Open Access Journals (Sweden)

    Flavien A. A. Toze

    2011-11-01

    Full Text Available The title compound, C17H18N2O4, is the methyl ester of the adduct of intramolecular Diels–Alder reaction between maleic anhydride and 1-(2-furyl-2,3,4,5-tetrahydro-1H-pyrrolo[1,2-a][1,4]diazepine. The molecule comprises a fused pentacyclic system containing four five-membered rings (viz. pyrrole, 2-pyrrolidinone, tetrahydrofuran and dihydrofuran and one seven-membered ring (1,4-diazepane. The pyrrole ring is approximately planar (r.m.s. deviation = 0.003 Å while the 2-pyrrolidinone, tetrahydrofuran and dihydrofuran five-membered rings have the usual envelope conformations. The central seven-membered diazepane ring adopts a boat conformation. In the crystal, molecules are bound by weak intermolecular C—H...O hydrogen-bonding interactions into zigzag chains propagating in [010]. In the crystal packing, the chains are stacked along the a axis.

  19. Wnt9a signaling is required for joint integrity and regulation of Ihh during chondrogenesis.

    Science.gov (United States)

    Später, Daniela; Hill, Theo P; O'sullivan, Roderick J; Gruber, Michaela; Conner, David A; Hartmann, Christine

    2006-08-01

    Joints, which separate skeleton elements, serve as important signaling centers that regulate the growth of adjacent cartilage elements by controlling proliferation and maturation of chondrocytes. Accurate chondrocyte maturation is crucial for endochondral ossification and for the ultimate size of skeletal elements, as premature or delayed maturation results predominantly in shortened elements. Wnt9a has previously been implicated as being a player in joint induction, based on gain-of function experiments in chicken and mouse. We show that loss of Wnt9a does not affect joint induction, but results to synovial chondroid metaplasia in some joints. This phenotype can be enhanced by removal of an additional Wnt gene, Wnt4, suggesting that Wnts are playing a crucial role in directing bi-potential chondro-synovioprogenitors to become synovial connective tissue, by actively suppressing their chondrogenic potential. Furthermore, we show that Wnt9a is a temporal and spatial regulator of Indian hedgehog (Ihh), a central player of skeletogenesis. Loss of Wnt9a activity results in transient downregulation of Ihh and reduced Ihh-signaling activity at E12.5-E13.5. The canonical Wnt/beta-catenin pathway probably mediates regulation of Ihh expression in prehypertrophic chondrocytes by Wnt9a, because embryos double-heterozygous for Wnt9a and beta-catenin show reduced Ihh expression, and in vivo chromatin immunoprecipitation demonstrates a direct interaction between the beta-catenin/Lef1 complex and the Ihh promoter.

  20. Pentagon 9/11

    Science.gov (United States)

    2007-09-01

    rooms. On the 4th Floor above the aircraft entry hole, when smoke and heat dis- oriented one of the troopers, Officers Donald Behe and Abraham Diaz ...11 September 2001. 4. Interv Jester, 19 Oct 01, 20; ibid, 31 Jan 06, 2; Alicia Borlik, "DoD Drill Tests Response to Terrorist Attack:’ 9Jun 98, AFPS...Behe, Diaz , and Mapp citations, OSD Hist. For rescue accounts by two Virginia state troopers see memos Trooper Myrlin Wimbish for 1st Sgt Richard S

  1. 11 CFR 9002.11 - Qualified campaign expense.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Qualified campaign expense. 9002.11 Section 9002.11 Federal Elections FEDERAL ELECTION COMMISSION PRESIDENTIAL ELECTION CAMPAIGN FUND: GENERAL ELECTION FINANCING DEFINITIONS § 9002.11 Qualified campaign expense. (a) Qualified campaign expense means...

  2. 11 World power conference

    International Nuclear Information System (INIS)

    Masters, R.

    1981-01-01

    Papers presented to the 11 World power conference ''Power for our peace'' held in Munich in September, 1980 are shortly surveyed. A few papers were devoted to nuclear power, that represents its present- state-of-the-art in the world. Except for the paper presented by experts of the International Energy Agency (IEA) and a number of others, there is carefulness and realism with respect to nuclear power in the most part of the papers; its forecasted growth rates are rather moderate. Even in the IEA paper the total world nuclear installed capacity in 1985 is evaluated about 550 GW, that is substantially smaller earlier evaluations. It is acknowledged that the primary energy production almost in all countries will increase mainly due to nuclear power and coal. But there are no answers to the problems related to management of the nuclear power development and to the public opinion in many countries. It is underlined that the problems of world power supply can be solved only on an international basis [ru

  3. Aquaporin-11 (AQP11 Expression in the Mouse Brain

    Directory of Open Access Journals (Sweden)

    Shin Koike

    2016-06-01

    Full Text Available Aquaporin-11 (AQP11 is an intracellular aquaporin expressed in various tissues, including brain tissues in mammals. While AQP11-deficient mice have developed fatal polycystic kidneys at one month old, the role of AQP11 in the brain was not well appreciated. In this study, we examined the AQP11 expression in the mouse brain and the brain phenotype of AQP11-deficient mice. AQP11 messenger ribonucleic acid (mRNA and protein were expressed in the brain, but much less than in the thymus and kidney. Immunostaining showed that AQP11 was localized at the epithelium of the choroid plexus and at the endothelium of the brain capillary, suggesting that AQP11 may be involved in water transport at the choroid plexus and blood-brain barrier (BBB in the brain. The expression of AQP4, another brain AQP expressed at the BBB, was decreased by half in AQP11-deficient mice, thereby suggesting the presence of the interaction between AQP11 and AQP4. The brain of AQP11-deficient mice, however, did not show any morphological abnormalities and the function of the BBB was intact. Our findings provide a novel insight into a water transport mechanism mediated by AQPs in the brain, which may lead to a new therapy for brain edema.

  4. Hereditary sensory and autonomic neuropathy type IID caused by an SCN9A mutation.

    Science.gov (United States)

    Yuan, Junhui; Matsuura, Eiji; Higuchi, Yujiro; Hashiguchi, Akihiro; Nakamura, Tomonori; Nozuma, Satoshi; Sakiyama, Yusuke; Yoshimura, Akiko; Izumo, Shuji; Takashima, Hiroshi

    2013-04-30

    To identify the clinical features of Japanese patients with suspected hereditary sensory and autonomic neuropathy (HSAN) on the basis of genetic diagnoses. On the basis of clinical, in vivo electrophysiologic, and pathologic findings, 9 Japanese patients with sensory and autonomic nervous dysfunctions were selected. Eleven known HSAN disease-causing genes and 5 related genes were screened using a next-generation sequencer. A homozygous mutation, c.3993delGinsTT, was identified in exon 22 of SCN9A from 2 patients/families. The clinical phenotype was characterized by adolescent or congenital onset with loss of pain and temperature sensation, autonomic nervous dysfunctions, hearing loss, and hyposmia. Subsequently, this mutation was discovered in one of patient 1's sisters, who also exhibited sensory and autonomic nervous system dysfunctions, with recurrent fractures being the most predominant feature. Nerve conduction studies revealed definite asymmetric sensory nerve involvement in patient 1. In addition, sural nerve pathologic findings showed loss of large myelinated fibers in patient 1, whereas the younger patient showed normal sural nerve pathology. We identified a novel homozygous mutation in SCN9A from 2 Japanese families with autosomal recessive HSAN. This loss-of-function SCN9A mutation results in disturbances in the sensory, olfactory, and autonomic nervous systems. We propose that SCN9A mutation results in the new entity of HSAN type IID, with additional symptoms including hyposmia, hearing loss, bone dysplasia, and hypogeusia.

  5. G9a and ZNF644 Physically Associate to Suppress Progenitor Gene Expression during Neurogenesis

    Directory of Open Access Journals (Sweden)

    Jonathan B. Olsen

    2016-09-01

    Full Text Available Proliferating progenitor cells undergo changes in competence to give rise to post-mitotic progeny of specialized function. These cell-fate transitions typically involve dynamic regulation of gene expression by histone methyltransferase (HMT complexes. However, the composition, roles, and regulation of these assemblies in regulating cell-fate decisions in vivo are poorly understood. Using unbiased affinity purification and mass spectrometry, we identified the uncharacterized C2H2-like zinc finger protein ZNF644 as a G9a/GLP-interacting protein and co-regulator of histone methylation. In zebrafish, functional characterization of ZNF644 orthologs, znf644a and znf644b, revealed complementary roles in regulating G9a/H3K9me2-mediated gene silencing during neurogenesis. The non-overlapping requirements for znf644a and znf644b during retinal differentiation demarcate critical aspects of retinal differentiation programs regulated by differential G9a-ZNF644 associations, such as transitioning proliferating progenitor cells toward differentiation. Collectively, our data point to ZNF644 as a critical co-regulator of G9a/H3K9me2-mediated gene silencing during neuronal differentiation.

  6. Structural basis for G9a-like protein lysine methyltransferase inhibition by BIX-01294

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Yanqi; Zhang, Xing; Horton, John R.; Upadhyay, Anup K.; Spannhoff, Astrid; Liu, Jin; Synder, James P.; Bedford, Mark T.; Cheng, Xiaodong; (Emory-MED); (Emory); (Texas)

    2009-03-26

    Histone lysine methylation is an important epigenetic mark that regulates gene expression and chromatin organization. G9a and G9a-like protein (GLP) are euchromatin-associated methyltransferases that repress transcription by methylating histone H3 Lys9. BIX-01294 was originally identified as a G9a inhibitor during a chemical library screen of small molecules and has previously been used in the generation of induced pluripotent stem cells. Here we present the crystal structure of the catalytic SET domain of GLP in complex with BIX-01294 and S-adenosyl-L-homocysteine. The inhibitor is bound in the substrate peptide groove at the location where the histone H3 residues N-terminal to the target lysine lie in the previously solved structure of the complex with histone peptide. The inhibitor resembles the bound conformation of histone H3 Lys4 to Arg8, and is positioned in place by residues specific for G9a and GLP through specific interactions.

  7. Astronaut Richard H. Truly in training session RMS for STS-2 bldg 9A

    Science.gov (United States)

    1981-01-01

    Astronaut Richard H. Truly in training session with the Remote Manipulator System (RMS) for STS-2 bldg 9A. Views show Truly working at the command console while watching out the windows. Karen Ehlers, an RMS procedures specialist, can be seen at left side of frame (34314); view from behind Truly as he trains at the RMS console (34315).

  8. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  9. Evaluation report no.11

    International Nuclear Information System (INIS)

    2005-06-01

    This 11. report of the French national commission of evaluation (CNE) presents the recent advances in the researches relative to the management of radioactive wastes in France and in the rest of the world: 1 - Introduction; 2 - comments from the commission about the informations and documents received: auditions and trips, organisation of evaluation, comments about the text supplied by the CEA entitled 'main conclusions and perspectives'; 3 - axis 1 - researches on advanced separation and transmutation (summary, introduction, scenario studies, separation, transmutation fuels and targets, transmutation, results of the PDS-XADS project, conclusion), statement of the commission, actinide content of transmutation fuels and targets; 4 - axis 2 - disposal in deep underground: summary, characterization criteria of potential sites, introduction, status of researched carried out at Bure's site, reversibility of disposal, granite, additional researches, conclusion, advice of the commission about ANDRA's 2003 status and works document, reflection about the salinity difference between Dogger, Callovo-Oxfordian and Oxfordian waters and on the osmosis phenomena inside the Callovo-Oxfordian formation, importance of diffusion in the Callovo-Oxfordian formation, description of the storage materials foreseen in the different modules; 5 - Axis 3 - long duration conditioning and disposal: summary, introduction, wastes conditioning, disposal; 6 - PRECCI program: introduction, researches evaluation, operational models, conclusion; 7 - status of researches and realizations performed abroad: overview, separation and transmutation, geological disposal, radioactive waste management in Sweden: a complete system, list of projects in progress about storage, separation and transmutation, Atalante 2004 conference (Nimes, France, June 21-24), advances of big European projects. Appendixes: Commission's members, dose-effect relationship and estimation of carcinogenic effects of low ionizing

  10. Caffeine-11C, ephedrine-11C and methylephedrine-11C: synthesis and distribution in mice

    International Nuclear Information System (INIS)

    Saji, Hideo; Ido, Tatsuo; Iwata, Ren; Suzuki, Kazutoshi; Tamate, Kazuhiko

    1978-01-01

    Caffeine, ephedrine and methylephedrine were labeled with carbon-11 by the action of methyliodide- 11 C on theophylline, norephedrine and ephedrine, respectively. Caffeine- 11 C was prepared in 44 min. with a radiochemical yield of 40%, ephedrine- 11 C in 45 min. with a 11% radiochemical yield and methylephedrine- 11 C in 36 min. with a 43% radiochemical yield. When injected in mice intravenously, these products show a high uptake in the liver, the kidney and the blood for caffeine- 11 C and in the liver and the kidney for ephedrine- 11 C and methylephedrine- 11 C. The brain uptake for these products was found to be 2.4 to 3.9% of the injected dose per gram at 5 min. after injection. These studies in mice have demonstrated that these products are potentially useful agents for the dynamic studies of the brain. (auth.)

  11. Crystallization and preliminary diffraction studies of CBM3b of cellobiohydrolase 9A from Clostridium thermocellum

    Energy Technology Data Exchange (ETDEWEB)

    Jindou, Sadanari [Department of Molecular Microbiology and Biotechnology, Tel Aviv University 69978 (Israel); Petkun, Svetlana [Department of Molecular Microbiology and Biotechnology, Tel Aviv University 69978 (Israel); The Daniella Rich Institute for Structural Biology, Tel Aviv University 69978 (Israel); Shimon, Linda [Department of Chemical Research Support, The Weizmann Institute of Science, Rehovot 76100 (Israel); Bayer, Edward A. [Department of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100 (Israel); Lamed, Raphael; Frolow, Felix, E-mail: mbfrolow@post.tau.ac.il [Department of Molecular Microbiology and Biotechnology, Tel Aviv University 69978 (Israel); The Daniella Rich Institute for Structural Biology, Tel Aviv University 69978 (Israel)

    2007-12-01

    The cloning, expression, purification and crystallization of the CBM3b module of cellobiohydrolase 9A from C. thermocellum is described. The crystals diffract to 2.68 Å. Family 3 carbohydrate-binding modules (CBM3s) are associated with the scaffoldin subunit of the multi-enzyme cellulosome complex and with the family 9 glycoside hydrolases, which are multimodular enzymes that act on plant cell-wall polysaccharides, notably cellulose. Here, the crystallization of CBM3b from cellobiohydrolase 9A is reported. The crystals are tetragonal and belong to space group P4{sub 1} or P4{sub 3}. X-ray diffraction data for CBM3b have been collected to 2.68 Å resolution on beamline ID14-4 at the ESRF.

  12. The Purine-Utilizing Bacterium Clostridium acidurici 9a: A Genome-Guided Metabolic Reconsideration

    OpenAIRE

    Hartwich, Katrin; Poehlein, Anja; Daniel, Rolf

    2012-01-01

    Clostridium acidurici is an anaerobic, homoacetogenic bacterium, which is able to use purines such as uric acid as sole carbon, nitrogen, and energy source. Together with the two other known purinolytic clostridia C. cylindrosporum and C. purinilyticum, C. acidurici serves as a model organism for investigation of purine fermentation. Here, we present the first complete sequence and analysis of a genome derived from a purinolytic Clostridium. The genome of C. acidurici 9a consists ...

  13. On the presence of plutonium in Madagascar following the SNAP-9A satellite failure.

    Science.gov (United States)

    Rääf, C; Holm, E; Rabesiranana, N; Garcia-Tenorio, R; Chamizo, E

    2017-10-01

    This study examined the 238 Pu and 239+240 Pu activity concentration and the 240 Pu/ 239 Pu atomic ratio in peat bogs sampled in 2012 from marshlands in central Madagascar. The purpose was to investigate the presence of plutonium isotopes, 238, 239, 240 Pu, from the 1964 satellite failure carrying a SNAP-9A radiothermal generator. With an average 238 Pu/ 239+240 Pu activity ratio of 0.165 ± 0.02 (decay corrected to 1964), the peat bogs in Madagascar exhibit similar values as the ones found in the southeastern African continent, except they are one order of magnitude higher than expected (0.025) from global fallout in the Southern Hemisphere. The 240 Pu/ 239 Pu atomic ratio showed a distinct decrease for layers dating back to the mid-1960s (down to 0.069 compared with an anticipated ratio of 0.17 for global fallout), indicating that the SNAP-9A failure also resulted in an elevated deposition of 239 Pu. The obtained results demonstrate that further Pu analysis in Madagascar and in southeastern continental Africa is necessary to fully account for the regional Pu deposition from the SNAP-9A event. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Diagenetic controls on porosity variations within an aeolian sandstone reservoir, borehole Kudu 9A-3

    International Nuclear Information System (INIS)

    Marot, J.E.B.

    1990-01-01

    Three boreholes, Kudu 9A-1, 9A-2 and 9A-3, were drilled approximately 125 km west of the Orange River mouth to test a gas-bearing structure of Barremian age. The reservoir interval comprises an upper unit of interbedded shallow marine sandstones, limestones and volcaniclastic mass flow deposits, and a lower non-marine unit of interbedded aeolian sandstones, basaltic lavas and volcaniclastic deposits. Despite the overall good poroperm characteristics of the aeolian sandstone and its apparent mineralogical homogeneity, as implied by a gamma ray trace, the core analysis results show an extreme variation in porosity and permeability values. In order to assist in reservoir quality prediction and to assess the regional prospectivity of the sandstone, it was necessary to explain these variations. The resuls of the study indicate that compositionally and texturally the sandstones are extremely homogeneous. It is concluded that the marked variation in the poroperm characteristics of the aeolian sandstones is a result of a relatively complex diagenesis. A fluctuating water table resulted in the formation of a pattern of calcite, anhydrite and quartz cements within an aeolian dune sandstone. 7 refs., 1 fig

  15. The MSX1 homeoprotein recruits G9a methyltransferase to repressed target genes in myoblast cells.

    Directory of Open Access Journals (Sweden)

    Jingqiang Wang

    Full Text Available Although the significance of lysine modifications of core histones for regulating gene expression is widely appreciated, the mechanisms by which these modifications are incorporated at specific regulatory elements during cellular differentiation remains largely unknown. In our previous studies, we have shown that in developing myoblasts the Msx1 homeoprotein represses gene expression by influencing the modification status of chromatin at its target genes. We now show that genomic binding by Msx1 promotes enrichment of the H3K9me2 mark on repressed target genes via recruitment of G9a histone methyltransferase, the enzyme responsible for catalyzing this histone mark. Interaction of Msx1 with G9a is mediated via the homeodomain and is required for transcriptional repression and regulation of cellular differentiation, as well as enrichment of the H3K9me2 mark in proximity to Msx1 binding sites on repressed target genes in myoblast cells as well as the developing limb. We propose that regulation of chromatin status by Msx1 recruitment of G9a and other histone modifying enzymes to regulatory regions of target genes represents an important means of regulating the gene expression during development.

  16. Copper(II) complexes of alloferon 1 with point mutations (H1A) and (H9A) stability structure and biological activity.

    Science.gov (United States)

    Matusiak, Agnieszka; Kuczer, Mariola; Czarniewska, Elżbieta; Rosiński, Grzegorz; Kowalik-Jankowska, Teresa

    2014-09-01

    Mono- and polynuclear copper(II) complexes of the alloferon 1 with point mutations (H1A) A(1)GVSGH(6)GQH(9)GVH(12)G (Allo1A) and (H9A) H(1)GVSGH(6)GQA(9)GVH(12)G (Allo9A) have been studied by potentiometric, UV-visible, CD, EPR spectroscopic and mass spectrometry (MS) methods. To obtain a complete complex speciation different metal-to-ligand molar ratios ranging from 1:1 to 4:1 for Allo1A and to 3:1 for Allo9A were studied. The presence of the His residue in first position of the peptide chain changes the coordination abilities of the Allo9A peptide in comparison to that of the Allo1A. Imidazole-N3 atom of N-terminal His residue of the Allo9A peptide forms stable 6-membered chelate with the terminal amino group. Furthermore, the presence of two additional histidine residues in the Allo9A peptide (H(6),H(12)) leads to the formation of the CuL complex with 4N {NH2,NIm-H(1),NIm-H(6),NIm-H(12)} binding site in wide pH range (5-8). For the Cu(II)-Allo1A system, the results demonstrated that at physiological pH7.4 the predominant complex the CuH-1L consists of the 3N {NH2,N(-),CO,NIm} coordination mode. The inductions of phenoloxidase activity and apoptosis in vivo in Tenebrio molitor cells by the ligands and their copper(II) complexes at pH7.4 were studied. The Allo1A, Allo1K peptides and their copper(II) complexes displayed the lowest hemocytotoxic activity while the most active was the Cu(II)-Allo9A complex formed at pH7.4. The results may suggest that the N-terminal-His(1) and His(6) residues may be more important for their proapoptotic properties in insects than those at positions 9 and 12 in the peptide chain. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1.

    Science.gov (United States)

    Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi

    2018-01-01

    Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.

  18. Educational Modelling Language 1.1 (EML 1.1)

    NARCIS (Netherlands)

    Koper, Rob; Vogten, Hubert; Martens, Harrie

    2003-01-01

    Package contains the EML 1.1 dtd, schema and documentation as is created for the Edubox Player. It is slightly different from IMS Learning Design and provides an intermediate solution between EML 1.0 and IMD Learning Design. The Edubox Player 3.x works on EML 1.1. This package is stored for

  19. Discovery and optimization of adamantyl carbamate inhibitors of 11β-HSD1.

    Science.gov (United States)

    Tice, Colin M; Zhao, Wei; Krosky, Paula M; Kruk, Barbara A; Berbaum, Jennifer; Johnson, Judith A; Bukhtiyarov, Yuri; Panemangalore, Reshma; Scott, Boyd B; Zhao, Yi; Bruno, Joseph G; Howard, Lamont; Togias, Jennifer; Ye, Yuan-Jie; Singh, Suresh B; McKeever, Brian M; Lindblom, Peter R; Guo, Joan; Guo, Rong; Nar, Herbert; Schuler-Metz, Annette; Gregg, Richard E; Leftheris, Katerina; Harrison, Richard K; McGeehan, Gerard M; Zhuang, Linghang; Claremon, David A

    2010-11-15

    Synthesis of 2-adamantyl carbamate derivatives of piperidines and pyrrolidines led to the discovery of 9a with an IC(50) of 15.2 nM against human 11β-HSD1 in adipocytes. Optimization for increased adipocyte potency, metabolic stability and selectivity afforded 11k and 11l, both of which were >25% orally bioavailable in rat. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. The purine-utilizing bacterium Clostridium acidurici 9a: a genome-guided metabolic reconsideration.

    Directory of Open Access Journals (Sweden)

    Katrin Hartwich

    Full Text Available Clostridium acidurici is an anaerobic, homoacetogenic bacterium, which is able to use purines such as uric acid as sole carbon, nitrogen, and energy source. Together with the two other known purinolytic clostridia C. cylindrosporum and C. purinilyticum, C. acidurici serves as a model organism for investigation of purine fermentation. Here, we present the first complete sequence and analysis of a genome derived from a purinolytic Clostridium. The genome of C. acidurici 9a consists of one chromosome (3,105,335 bp and one small circular plasmid (2,913 bp. The lack of candidate genes encoding glycine reductase indicates that C. acidurici 9a uses the energetically less favorable glycine-serine-pyruvate pathway for glycine degradation. In accordance with the specialized lifestyle and the corresponding narrow substrate spectrum of C. acidurici 9a, the number of genes involved in carbohydrate transport and metabolism is significantly lower than in other clostridia such as C. acetobutylicum, C. saccharolyticum, and C. beijerinckii. The only amino acid that can be degraded by C. acidurici is glycine but growth on glycine only occurs in the presence of a fermentable purine. Nevertheless, the addition of glycine resulted in increased transcription levels of genes encoding enzymes involved in the glycine-serine-pyruvate pathway such as serine hydroxymethyltransferase and acetate kinase, whereas the transcription levels of formate dehydrogenase-encoding genes decreased. Sugars could not be utilized by C. acidurici but the full genetic repertoire for glycolysis was detected. In addition, genes encoding enzymes that mediate resistance against several antimicrobials and metals were identified. High resistance of C. acidurici towards bacitracin, acriflavine and azaleucine was experimentally confirmed.

  1. The purine-utilizing bacterium Clostridium acidurici 9a: a genome-guided metabolic reconsideration.

    Science.gov (United States)

    Hartwich, Katrin; Poehlein, Anja; Daniel, Rolf

    2012-01-01

    Clostridium acidurici is an anaerobic, homoacetogenic bacterium, which is able to use purines such as uric acid as sole carbon, nitrogen, and energy source. Together with the two other known purinolytic clostridia C. cylindrosporum and C. purinilyticum, C. acidurici serves as a model organism for investigation of purine fermentation. Here, we present the first complete sequence and analysis of a genome derived from a purinolytic Clostridium. The genome of C. acidurici 9a consists of one chromosome (3,105,335 bp) and one small circular plasmid (2,913 bp). The lack of candidate genes encoding glycine reductase indicates that C. acidurici 9a uses the energetically less favorable glycine-serine-pyruvate pathway for glycine degradation. In accordance with the specialized lifestyle and the corresponding narrow substrate spectrum of C. acidurici 9a, the number of genes involved in carbohydrate transport and metabolism is significantly lower than in other clostridia such as C. acetobutylicum, C. saccharolyticum, and C. beijerinckii. The only amino acid that can be degraded by C. acidurici is glycine but growth on glycine only occurs in the presence of a fermentable purine. Nevertheless, the addition of glycine resulted in increased transcription levels of genes encoding enzymes involved in the glycine-serine-pyruvate pathway such as serine hydroxymethyltransferase and acetate kinase, whereas the transcription levels of formate dehydrogenase-encoding genes decreased. Sugars could not be utilized by C. acidurici but the full genetic repertoire for glycolysis was detected. In addition, genes encoding enzymes that mediate resistance against several antimicrobials and metals were identified. High resistance of C. acidurici towards bacitracin, acriflavine and azaleucine was experimentally confirmed.

  2. Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region.

    Science.gov (United States)

    Costa, M G S; Silva, Y F; Batista, P R

    2018-03-14

    Microbial cellulosic degradation by cellulases has become a complementary approach for biofuel production. However, its efficiency is hindered by the recalcitrance of cellulose fibres. In this context, computational protein design methods may offer an efficient way to obtain variants with improved enzymatic activity. Cel9A-68 is a cellulase from Thermobifida fusca that is still active at high temperatures. In a previous work, we described a collective bending motion, which governs the overall cellulase dynamics. This movement promotes the approximation of its CBM and CD structural domains (that are connected by a flexible linker). We have identified two residues (G460 and P461) located at the linker that act as a hinge point. Herein, we applied a new level of protein design, focusing on the modulation of this collective motion to obtain cellulase variants with enhanced functional dynamics. We probed whether specific linker mutations would affect Cel9A-68 dynamics through computational simulations. We assumed that P461G and G460+ (with an extra glycine) constructs would present enhanced interdomain motions, while the G460P mutant would be rigid. From our results, the P461G mutation resulted in a broader exploration of the conformational space, as confirmed by clustering and free energy analyses. The WT enzyme was the most rigid system. However, G460P and P460+ explored distinct conformational states described by opposite directions of low-frequency normal modes; they sampled preferentially closed and open conformations, respectively. Overall, we highlight two significant findings: (i) all mutants explored larger conformational spaces than the WT; (ii) the selection of distinct conformational populations was intimately associated with the mutation considered. Thus, the engineering of Cel9A-68 motions through linker mutations may constitute an efficient way to improve cellulase activity, facilitating the disruption of cellulose fibres.

  3. Linkage between increased nociception and olfaction via a SCN9A haplotype.

    Directory of Open Access Journals (Sweden)

    Dirk Heimann

    Full Text Available BACKGROUND AND AIMS: Mutations reducing the function of Nav1.7 sodium channels entail diminished pain perception and olfactory acuity, suggesting a link between nociception and olfaction at ion channel level. We hypothesized that if such link exists, it should work in both directions and gain-of-function Nav1.7 mutations known to be associated with increased pain perception should also increase olfactory acuity. METHODS: SCN9A variants were assessed known to enhance pain perception and found more frequently in the average population. Specifically, carriers of SCN9A variants rs41268673C>A (P610T; n = 14 or rs6746030C>T (R1150W; n = 21 were compared with non-carriers (n = 40. Olfactory function was quantified by assessing odor threshold, odor discrimination and odor identification using an established olfactory test. Nociception was assessed by measuring pain thresholds to experimental nociceptive stimuli (punctate and blunt mechanical pressure, heat and electrical stimuli. RESULTS: The number of carried alleles of the non-mutated SCN9A haplotype rs41268673C/rs6746030C was significantly associated with the comparatively highest olfactory threshold (0 alleles: threshold at phenylethylethanol dilution step 12 of 16 (n = 1, 1 allele: 10.6±2.6 (n = 34, 2 alleles: 9.5±2.1 (n = 40. The same SCN9A haplotype determined the pain threshold to blunt pressure stimuli (0 alleles: 21.1 N/m(2, 1 allele: 29.8±10.4 N/m(2, 2 alleles: 33.5±10.2 N/m(2. CONCLUSIONS: The findings established a working link between nociception and olfaction via Nav1.7 in the gain-of-function direction. Hence, together with the known reduced olfaction and pain in loss-of-function mutations, a bidirectional genetic functional association between nociception and olfaction exists at Nav1.7 level.

  4. Inhibition of H3K9 methyltransferase G9a induces autophagy and apoptosis in oral squamous cell carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Aishu; Qiu, Yu [Chongqing Key Laboratory for Oral Diseases and Biomedical Sciences, Chongqing Medical University, Chongqing, 401147 (China); Affiliated Hospital of Stomatology, Chongqing Medical University, Chongqing, 401147 (China); Cui, Hongjuan [State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, 400716 (China); Fu, Gang, E-mail: fg.ras@hotmail.com [Chongqing Key Laboratory for Oral Diseases and Biomedical Sciences, Chongqing Medical University, Chongqing, 401147 (China); Affiliated Hospital of Stomatology, Chongqing Medical University, Chongqing, 401147 (China)

    2015-03-27

    Objective: To explore whether inhibition of H3K9 Methyltransferase G9a could exert an antitumoral effect in oral squamous cell carcinoma (OSCC). Materials and methods: First we checked G9a expression in two OSCC cell lines Tca8113 and KB. Next we used a special G9a inhibitor BIX01294 (BIX) to explore the effect of inhibition of G9a on OSCC in vitro. Cell growth was tested by typlan blue staining, MTT assay and Brdu immunofluorescence staining. Cell autophagy was examined by monodansylcadaverine (MDC) staining, LC3-II immunofluorescence staining and LC3-II western blot assay. Cell apoptosis was checked by FITC Annexin-V and PI labeling, tunnel staining and caspase 3 western blot assay. Finally, the effect of inhibition of G9a on clonogenesis and tumorigenesis capacity of OSCC was analyzed by soft agar growth and xenograft model. Results: Here we showed that G9a was expressed in both Tca8113 and KB cells. Inhibition of G9a using BIX significantly reduced cell growth and proliferation in Tca8113 and KB. Inhibition of G9a induced cell autophagy with conversion of LC3-I to LC3-II and cell apoptosis with the expression of cleaved caspase 3. We also found that inhibition of G9a reduced colony formation in soft agar and repressed tumor growth in mouse xenograph model. Conclusion: Our results suggested that G9a might be a potential epigenetic target for OSCC treatment. - Highlights: • Inhibition of G9a reduced cell growth and proliferation in OSCC cells. • Inhibition of G9a induces autophagy and apoptosis in OSCC cells. • Inhibition of G9a repressed tumor growth in mouse xenograph model.

  5. C-11 cyanide production system

    Science.gov (United States)

    Kim, Dohyun; Alexoff, David; Kim, Sung Won; Hooker, Jacob M.; Ferrieri, Richard A.

    2017-11-21

    A method for providing .sup.11C-labeled cyanides from .sup.11C labeled oxides in a target gas stream retrieved from an irradiated high pressure gaseous target containing O.sub.2, wherein .sup.11C labeled oxides are reduced with H.sub.2 in the presence of a nickel catalyst under a pressure and a temperature sufficient to form a product stream comprising at least about 95% .sup.11CH.sub.4, the .sup.11CH.sub.4 is then combined with an excess of NH.sub.3 in a carrier/reaction stream flowing at an accelerated velocity and the combined .sup.11CH4 carrier/reaction stream is then contacted with a platinum (Pt) catalyst particulate supported on a substantially-chemically-nonreactive heat-stable support at a temperature of at least about 900.degree. C., whereby a product stream comprising at least about 60% H.sup.11CN is provided in less than 10 minutes from retrieval of the .sup.11C labeled oxide.

  6. .11 .,~

    African Journals Online (AJOL)

    VoL 7. No.3 represent the tip of the iceberg. The disease is associated with a great deal of suffering and misery to both the patient and family, especially in late stage. 101 from the estates close to the Nkhotakota Game. Reserve boundary. Occasional unsuspected spread may also occur e.g. a stranded bus (due to a break-.

  7. High Frequency Magnetic Field Direction Finding Using MGL-S9A B-dot Sensors

    Science.gov (United States)

    2013-03-21

    electromagnetic theory every week I know I wouldn’t have gotten so much accomplished while still remembering the fundamentals of this research. Your... Electromagnetics . . . . . . . . . . . . . . . . . . . . . . . 23 2.5 Array Theory...of Figures Figure Page 1.1 Rivet Joint RC-135 aircraft [1] . . . . . . . . . . . . . . . . . . . . . . . . . . 2 1.2 MGL-S8A B-dot sensor [2

  8. Production of 11Li in the (11B,11Li) reaction on 232Th

    International Nuclear Information System (INIS)

    Scott, D.K.; Buenerd, M.; Hendrie, D.L.; KeKelis, G.; Mahoney, J.; Menchaca-Rocha, A.; Olmer, C.

    1975-01-01

    Production of the neutron-rich nucleus 11 Li in the bombardment of 232 Th by 11 B at 114 MeV suggests that multinucleon transfer reactions induced by neutron excess heavy ions on heavy targets present a feasible method of measuring the mass excess of exotic light nuclei in the limit of stability

  9. Turning physics up to 11

    CERN Multimedia

    2008-01-01

    Rock guitars, superstrings, 11 dimensions and the world's largest and highest energy particle accelerator are the lead instruments for the Institute of Physics' latest drive to get kids interested in science.

  10. 11 Theses on Entrepreneurship Education

    DEFF Research Database (Denmark)

    Blenker, Per

    2015-01-01

    . These theses are formulated around questions of the ontology of entrepreneurship, the entrepreneurial process, entrepreneurial learning and entrepreneurship education. Results The 11 theses are short, precise and constitute a framework, which educators and researchers can use either for agreeing or disagreeing......Questions I care about How can I best contribute to establishing clarity and precision to the way we develop the central elements of entrepreneurship education research? Approach Inspired by Karl Marx´s 11 theses on Feuerbach the paper establishes 11 short theses on entrepreneurship education...... on what should be the foundation of entrepreneurship education research. Implications The paper produces a few central statements (theses) that entrepreneurship educators and entrepreneurship education researchers would benefit from either agreeing or disagreeing on. Value/Originality The 11 theses...

  11. Fingerprinting 802.11 Devices

    National Research Council Canada - National Science Library

    Ellch, Jonathan P

    2006-01-01

    The research presented in this thesis provides the reader with a set of algorithms and techniques that enable the user to remotely determine what chipset and device driver an 802.11 device is using...

  12. HUC 8-11 Boundaries

    Data.gov (United States)

    Kansas Data Access and Support Center — This data set is a digital hydrologic unit boundary that is at the 4-digit, 6-digit, 8-digit, and 11-digit level. The data set was developed by delineating the...

  13. Phosphodiesterase 9A regulates central cGMP and modulates responses to cholinergic and monoaminergic perturbation in vivo.

    Science.gov (United States)

    Kleiman, Robin J; Chapin, Douglas S; Christoffersen, Curt; Freeman, Jody; Fonseca, Kari R; Geoghegan, Kieran F; Grimwood, Sarah; Guanowsky, Victor; Hajós, Mihály; Harms, John F; Helal, Christopher J; Hoffmann, William E; Kocan, Geralyn P; Majchrzak, Mark J; McGinnis, Dina; McLean, Stafford; Menniti, Frank S; Nelson, Fredrick; Roof, Robin; Schmidt, Anne W; Seymour, Patricia A; Stephenson, Diane T; Tingley, Francis David; Vanase-Frawley, Michelle; Verhoest, Patrick R; Schmidt, Christopher J

    2012-05-01

    Cyclic nucleotides are critical regulators of synaptic plasticity and participate in requisite signaling cascades implicated across multiple neurotransmitter systems. Phosphodiesterase 9A (PDE9A) is a high-affinity, cGMP-specific enzyme widely expressed in the rodent central nervous system. In the current study, we observed neuronal staining with antibodies raised against PDE9A protein in human cortex, cerebellum, and subiculum. We have also developed several potent, selective, and brain-penetrant PDE9A inhibitors and used them to probe the function of PDE9A in vivo. Administration of these compounds to animals led to dose-dependent accumulation of cGMP in brain tissue and cerebrospinal fluid, producing a range of biological effects that implied functional significance for PDE9A-regulated cGMP in dopaminergic, cholinergic, and serotonergic neurotransmission and were consistent with the widespread distribution of PDE9A. In vivo effects of PDE9A inhibition included reversal of the respective disruptions of working memory by ketamine, episodic and spatial memory by scopolamine, and auditory gating by amphetamine, as well as potentiation of risperidone-induced improvements in sensorimotor gating and reversal of the stereotypic scratching response to the hallucinogenic 5-hydroxytryptamine 2A agonist mescaline. The results suggested a role for PDE9A in the regulation of monoaminergic circuitry associated with sensory processing and memory. Thus, PDE9A activity regulates neuronal cGMP signaling downstream of multiple neurotransmitter systems, and inhibition of PDE9A may provide therapeutic benefits in psychiatric and neurodegenerative diseases promoted by the dysfunction of these diverse neurotransmitter systems.

  14. Interaction between bradykinin potentiating nonapeptide (BPP9a) and {beta}-cyclodextrin: A structural and thermodynamic study

    Energy Technology Data Exchange (ETDEWEB)

    Lula, Ivana; De Sousa, Frederico B. [Departamento de Quimica, Instituto de Ciencias Exatas, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, 31270-901, Belo Horizonte, MG (Brazil); Denadai, Angelo M.L. [Centro Federal de Educacao Tecnologica de Minas Gerais, CEFET-MG, Campus VII, 35.183-006, Timoteo, MG (Brazil); Ferreira de Lima, Guilherme; Duarte, Helio Anderson [Departamento de Quimica, Instituto de Ciencias Exatas, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, 31270-901, Belo Horizonte, MG (Brazil); Mares Guia, Thiago R. dos [Departamento de Bioquimica e Imunologia, ICB, Universidade Federal de Minas Gerais, 31270-901, Belo Horizonte, MG (Brazil); Faljoni-Alario, Adelaide [Departamento de Bioquimica, Instituto de Quimica, Universidade de Sao Paulo, 05508-900, Sao Paulo, SP (Brazil); Santoro, Marcelo M. [Departamento de Bioquimica e Imunologia, ICB, Universidade Federal de Minas Gerais, 31270-901, Belo Horizonte, MG (Brazil); Camargo, Antonio C.M. de [Center for Applied Toxinology CAT-CEPID, Laboratorio Especial de Toxicologia Aplicada, Instituto Butantan, 05503-900, Sao Paulo, SP (Brazil); Santos, Robson A.S. dos [Departamento de Fisiologia e Biofisica, ICB, Universidade Federal de Minas Gerais, 31270-901, Belo Horizonte, MG (Brazil); and others

    2012-02-01

    Herein, we demonstrate the physical and chemical characterizations of the supramolecular complex formed between {beta}-cyclodextrin ({beta}CD) and bradykinin potentiating nonapeptide (BPP9a), an endogenous toxin found in Bothrops jararaca. Circular dichroism results indicate a conformational change in the BPP9a secondary structure upon its complexation with {beta}CD. Nuclear magnetic resonance results, mainly from NOESY experiments, and theoretical calculations showed a favorable interaction between the tryptophan residue of BPP9a and the {beta}CD cavity. Thermodynamic inclusion parameters were investigated by isothermal titration calorimetry, demonstrating that {beta}CD/BPP9a complex formation is an exothermic process that results in a reduction in entropy. Additionally, in vitro degradation study of BPP9a against trypsin (37 Degree-Sign C, pH 7.2) showed higher stability of peptide in presence of {beta}CD. This {beta}CD/BPP9a complex, which presents new chemical properties arising from the peptide inclusion process, may be useful as an antihypertensive drug in oral pharmaceutical formulations. Highlights: Black-Right-Pointing-Pointer Cd and NMR showed evidences for the existence of more than one structure in solution. Black-Right-Pointing-Pointer Complexation with {beta}CD reduces the conformational rigidity of the peptide. Black-Right-Pointing-Pointer {beta}CD cavity recognize Trp and/or Pro segments of BPP9a. Black-Right-Pointing-Pointer Interactions involving disaggregation of BPP9a assemblies and binding with {beta}CD.

  15. The histone methyltransferase G9a as a therapeutic target to override gemcitabine resistance in pancreatic cancer

    Science.gov (United States)

    Pan, Mei-Ren; Hsu, Ming-Chuan; Luo, Chi-Wen; Chen, Li-Tzong; Shan, Yan-Shen; Hung, Wen-Chun

    2016-01-01

    Gemcitabine (GEM) resistance is a critical issue for pancreatic cancer treatment. The involvement of epigenetic modification in GEM resistance is still unclear. We established a GEM-resistant subline PANC-1-R from the parental PANC-1 pancreatic cancer cells and found the elevation of various chromatin-modifying enzymes including G9a in GEM-resistant cells. Ectopic expression of G9a in PANC-1 cells increased GEM resistance while inactivation of G9a in PANC-1-R cells reduced it. Challenge of PANC-1 cells with GEM increased the expression of stemness markers including CD133, nestin and Lgr5 and promoted sphere forming activity suggesting chemotherapy enriched cancer cells with stem-like properties. Inhibition of G9a in PANC-1-R cells reduced stemness and invasiveness and sensitized the cells to GEM. We revealed interleukin-8 (IL-8) is a downstream effector of G9a to increase GEM resistance. G9a-overexpressing PANC-1-R cells exhibited autocrine IL-8/CXCR1/2 stimulation to increase GEM resistance which could be decreased by anti-IL-8 antibody and G9a inhibitor. IL-8 released by cancer cells also activated pancreatic stellate cell (PSC) to increase GEM resistance. In orthotopic animal model, GEM could not suppress tumor growth of PANC-1-R cells and eventually promoted tumor metastasis. Combination with G9a inhibitor and GEM reduced tumor growth, metastasis, IL-8 expression and PSC activation in animals. Finally, we showed that overexpression of G9a correlated with poor survival and early recurrence in pancreatic cancer patients. Collectively, our results suggest G9a is a therapeutic target to override GEM resistance in the treatment of pancreatic cancer. PMID:27531902

  16. Catalytic conversion of 11CO2 and 11CO into synthesis precursors for 11C labelling

    International Nuclear Information System (INIS)

    Patt, J.T.

    1994-03-01

    The positron emitter carbon-11 (T 1/2 =20.3 min) is an ideal radio nuclide for tracers in positron emission tomography (PET). In this study catalytic methods for the synthesis of [ 11 C]alcohols have been investigated. The formation of [ 11 C]methanol has been studied on Pd/Al 2 O 3 and Cu/ZnO/Al 2 O 3 catalysts with respect to CO and CO 2 carrier addition to the synthesis gas. Carbon monoxide was identified as the precursor of methanol formation on the Pd/Al 2 O 3 -catalyst. In contrast on the Cu/ZnO/Al 2 O 3 -catalyst methanol was formed on a reaction pathway via an adsorbed CO 2 -species. A n.c.a.-[ 11 C]methanol synthesis basing on the Cu/ZnO/Al 2 O 3 -catalyst has been developed by substitution of the oxygen containing components CO and CO 2 in the synthesis gas by N 2 O. The radiochemical yield, the low selectivity of [ 11 C]methanol production and the rather slow kinetics of this process were arguments against the practical use of this process in the synthesis of 11 C-labelling agents. (orig.)

  17. Degradation of lignocelluloses in rice straw by BMC-9, a composite microbial system.

    Science.gov (United States)

    Zhao, Hongyan; Yu, Hairu; Yuan, Xufeng; Piao, Renzhe; Li, Hulin; Wang, Xiaofen; Cui, Zongjun

    2014-05-01

    To evaluate the potential utility of pretreatment of raw biomass with a complex microbial system, we investigated the degradation of rice straw by BMC-9, a lignocellulose decomposition strain obtained from a biogas slurry compost environment. The degradation characteristics and corresponding changes in the bacterial community were assessed. The results showed that rapid degradation occurred from day 0 to day 9, with a peak total biomass bacterium concentration of 3.3 × 10(8) copies/ml on day 1. The pH of the fermentation broth declined initially and then increased, and the mass of rice straw decreased steadily. The highest concentrations of volatile fatty acid contents (0.291 mg/l lactic acid, 0.31 mg/l formic acid, 1.93 mg/l acetic acid, and 0.73 mg/l propionic acid) as well as the highest xylanse activity (1.79 U/ml) and carboxymethyl cellulase activity (0.37 U/ml) occurred on day 9. The greatest diversity among the microbial community also occurred on day 9, with the presence of bacteria belonging to Clostridium sp., Bacillus sp., and Geobacillus sp. Together, our results indicate that BMC-9 has a strong ability to rapidly degrade the lignocelluloses of rice straw under relatively inexpensive conditions, and the optimum fermentation time is 9 days.

  18. Extracellular proteases of Halobacillus blutaparonensis strain M9, a new moderately halophilic bacterium.

    Science.gov (United States)

    Santos, Anderson F; Valle, Roberta S; Pacheco, Clarissa A; Alvarez, Vanessa M; Seldin, Lucy; Santos, André L S

    2013-12-01

    Halophilic microorganisms are source of potential hydrolytic enzymes to be used in industrial and/or biotechnological processes. In the present study, we have investigated the ability of the moderately halophilic bacterium Halobacillus blutaparonensis (strain M9), a novel species described by our group, to release proteolytic enzymes. This bacterial strain abundantly proliferated in Luria-Bertani broth supplemented with 2.5% NaCl as well as secreted proteases to the extracellular environment. The production of proteases occurred in bacterial cells grown under different concentration of salt, ranging from 0.5% to 10% NaCl, in a similar way. The proteases secreted by H. blutaparonensis presented the following properties: (i) molecular masses ranging from 30 to 80 kDa, (ii) better hydrolytic activities under neutral-alkaline pH range, (iii) expression modulated according to the culture age, (iv) susceptibility to phenylmethylsulphonyl fluoride, classifying them as serine-type proteases, (v) specific cleavage over the chymotrypsin substrate, and (vi) enzymatic stability in the presence of salt (up to 20% NaCl) and organic solvents (e.g., ether, isooctane and cyclohexane). The proteases described herein are promising for industrial practices due to its haloalkaline properties.

  19. C9.A/14 steelwork joints de poutres par plaque frontale : assemblages par gousset

    CERN Document Server

    2015-01-01

    Les Tables de résistances ultimes des assemblages boulonnés par plaque frontale et par gousset, complétées par une description des modèles de calcul et des exemples d’application, ont pour but de faciliter la tâche de l'ingénieur et du constructeur. Cette première partie C9.A/14 contient les chapitres suivants: - Joints de poutres par plaque frontale en acier S235 et S355 - Assemblages par gousset en acier S235 et S355 Les Tables contiennent des données relatives à la géométrie ainsi que les valeurs de calcul correspondantes des résistances ultimes des assemblages ; elles remplacent le chapitre « Assemblages par plaques frontales et boulons HR » des anciennes Tables C9.1 de 1983 / 2002. Le calcul de ces assemblages par plaque frontale est basé sur les hypothèses du modèle de la méthode des composants décrite dans la norme SN EN 1993-1-8. Les vérifications sont effectuées selon la norme SIA 263:2013. Les assemblages par gousset remplacent les assemblages par double cornière, (telle...

  20. Inhibition of the H3K9 methyltransferase G9A attenuates oncogenicity and activates the hypoxia signaling pathway

    Science.gov (United States)

    Ho, Jolene Caifeng; Abdullah, Lissa Nurrul; Pang, Qing You; Jha, Sudhakar; Chow, Edward Kai-Hua; Yang, Henry; Kato, Hiroyuki; Ueda, Jun

    2017-01-01

    Epigenetic mechanisms play important roles in the regulation of tumorigenesis, and hypoxia-induced epigenetic changes may be critical for the adaptation of cancer cells to the hypoxic microenvironment of solid tumors. Previously, we showed that loss-of-function of the hypoxia-regulated H3K9 methyltransferase G9A attenuates tumor growth. However, the mechanisms by which blockade of G9A leads to a tumor suppressive effect remain poorly understood. We show that G9A is highly expressed in breast cancer and is associated with poor patient prognosis, where it may function as a potent oncogenic driver. In agreement with this, G9A inhibition by the small molecule inhibitor, BIX-01294, leads to increased cell death and impaired cell migration, cell cycle and anchorage-independent growth. Interestingly, whole transcriptome analysis revealed that genes involved in diverse cancer cell functions become hypoxia-responsive upon G9A inhibition. This was accompanied by the upregulation of the hypoxia inducible factors HIF1α and HIF2α during BIX-01294 treatment even in normoxia that may facilitate the tumor suppressive effects of BIX-01294. HIF inhibition was able to reverse some of the transcriptional changes induced by BIX-01294 in hypoxia, indicating that the HIFs may be important drivers of these derepressed target genes. Therefore, we show that G9A is a key mediator of oncogenic processes in breast cancer cells and G9A inhibition by BIX-01294 can successfully attenuate oncogenicity even in hypoxia. PMID:29145444

  1. LSI-11 based multiparameter system

    International Nuclear Information System (INIS)

    Patwardhan, P.K.; Chatur, C.G.; Gupta, J.D.; Kumar, Sudhir

    1981-01-01

    This paper describes a LSI-11 based nuclear data processing system having four parameter capability. The system features simultaneous data acquisition and processing in independent memory zones. It also incorporates useful resident application programs and a built-in dual trace display. (author)

  2. Beyond E{sub 11}

    Energy Technology Data Exchange (ETDEWEB)

    Bossard, Guillaume [Centre de Physique Théorique, Ecole Polytechnique, CNRS,Université Paris-Saclay 91128 Palaiseau cedex (France); Kleinschmidt, Axel [Max-Planck-Institut für Gravitationsphysik (Albert-Einstein-Institut),Am Mühlenberg 1, DE-14476 Potsdam (Germany); International Solvay Institutes,ULB-Campus Plaine CP231, BE-1050 Brussels (Belgium); Palmkvist, Jakob; Pope, Christopher N.; Sezgin, Ergin [Mitchell Institute for Fundamental Physics and Astronomy,Texas A& M University, College Station, TX 77843 (United States)

    2017-05-03

    We study the non-linear realisation of E{sub 11} originally proposed by West with particular emphasis on the issue of linearised gauge invariance. Our analysis shows even at low levels that the conjectured equations can only be invariant under local gauge transformations if a certain section condition that has appeared in a different context in the E{sub 11} literature is satisfied. This section condition also generalises the one known from exceptional field theory. Even with the section condition, the E{sub 11} duality equation for gravity is known to miss the trace component of the spin connection. We propose an extended scheme based on an infinite-dimensional Lie superalgebra, called the tensor hierarchy algebra, that incorporates the section condition and resolves the above issue. The tensor hierarchy algebra defines a generalised differential complex, which provides a systematic description of gauge invariance and Bianchi identities. It furthermore provides an E{sub 11} representation for the field strengths, for which we define a twisted first order self-duality equation underlying the dynamics.

  3. RHM 1(1).indb

    African Journals Online (AJOL)

    mike

    Research in Hospitality Management 2011, 1(1): 43–52 ... Innovating concepts are becoming ever ... hospitality industry the concept of employer branding as ... Keywords: employer branding, hospitality industry, human resources management, strategy ..... is not much evidence on employer branding beyond cases.

  4. RHM 1(1).indb

    African Journals Online (AJOL)

    mike

    Research in Hospitality Management 2011, 1(1): 31–35. Printed in South ... perspective of tourism, this research examines the branding strategies of Qatar. To the Qatari, the ... and attempt to present the case of this country through broad description ... In this paper, the dreamland concept forms a framework for reflecting on ...

  5. Apollo 11 Command Service Module

    Science.gov (United States)

    1969-01-01

    A close-up view of the Apollo 11 command service module ready to be mated with the spacecraft LEM adapter of the third stage. The towering 363-foot Saturn V was a multi-stage, multi-engine launch vehicle standing taller than the Statue of Liberty. Altogether, the Saturn V engines produced as much power as 85 Hoover Dams.

  6. Dual fields and E11

    International Nuclear Information System (INIS)

    Riccioni, Fabio; West, Peter

    2007-01-01

    We show that the adjoint representation of E 11 contains generators corresponding to the infinite possible dual descriptions of the bosonic on-shell degrees of freedom of eleven-dimensional supergravity. We also give an interpretation for the fields corresponding to many of the other generators in the adjoint representation

  7. TH-A-9A-03: Dosimetric Effect of Rotational Errors for Lung Stereotactic Body Radiotherapy

    International Nuclear Information System (INIS)

    Lee, J; Kim, H; Park, J; Kim, J; Kim, H; Ye, S

    2014-01-01

    Purpose: To evaluate the dosimetric effects on target volume and organs at risk (OARs) due to roll rotational errors in treatment setup of stereotactic body radiation therapy (SBRT) for lung cancer. Methods: There were a total of 23 volumetric modulated arc therapy (VMAT) plans for lung SBRT examined in this retrospective study. Each CT image of VMAT plans was intentionally rotated by ±1°, ±2°, and ±3° to simulate roll rotational setup errors. The axis of rotation was set at the center of T-spine. The target volume and OARs in the rotated CT images were re-defined by deformable registration of original contours. The dose distributions on each set of rotated images were re-calculated to cover the planning target volume (PTV) with the prescription dose before and after the couch translational correction. The dose-volumetric changes of PTVs and spinal cords were analyzed. Results: The differences in D95% of PTVs by −3°, −2°, −1°, 1°, 2°, and 3° roll rotations before the couch translational correction were on average −11.3±11.4%, −5.46±7.24%, −1.11±1.38% −3.34±3.97%, −9.64±10.3%, and −16.3±14.7%, respectively. After the couch translational correction, those values were −0.195±0.544%, −0.159±0.391%, −0.188±0.262%, −0.310±0.270%, −0.407±0.331%, and −0.433±0.401%, respectively. The maximum dose difference of spinal cord among the 23 plans even after the couch translational correction was 25.9% at −3° rotation. Conclusions: Roll rotational setup errors in lung SBRT significantly influenced the coverage of target volume using VMAT technique. This could be in part compensated by the translational couch correction. However, in spite of the translational correction, the delivered doses to the spinal cord could be more than the calculated doses. Therefore if rotational setup errors exist during lung SBRT using VMAT technique, the rotational correction would rather be considered to prevent over-irradiation of normal

  8. Double optimization of Xe(L) amplifier power scaling at λ ∼ 2.9 A

    International Nuclear Information System (INIS)

    Borisov, Alex B; Song, Xiangyang; Zhang Ping; McCorkindale, John C; Khan, Shahab F; Poopalasingam, Sankar; Zhao Ji; Dai Yang; Rhodes, Charles K

    2007-01-01

    The spectral and spatial characteristics of the Xe(L) amplifier at λ ∼ 2.9 A determine an optimum for the scaling of the peak power with channel length. The Xe 31+ and Xe 32+ (3d → 2p) transition arrays represent two identical spectral optima for amplification, a property stemming from the extremum of spectral components (3245) characteristic of their electron configurations. Adroit matching of the spatial distribution of the intensity characteristic of the propagating 248 nm pulse dynamically generating the self-trapped plasma channel with the intensity required to excite selectively and efficiently the Xe 31+ and Xe 32+ arrays can also simultaneously maximize the spatial volume of the excitation. The net outcome of this double maximization is an amplifying channel for the optimal transitions that possesses high gain (∼100 cm -1 ), low losses ( -1 cm -1 ) and a diameter of 15-20 μm, a size sufficient to produce an x-ray pulse energy of ∼50-100 mJ from a channel having an average xenon density of ∼10 20 cm -3 and a length of 1 cm. Since previous studies have experimentally demonstrated the ability to produce a saturated bandwidth of ∼60 eV, a magnitude sufficient to support a pulse duration of ∼30 as, peak powers P x >> 1 PW are clearly within the scaling limits of the Xe(L) system. The corresponding peak brightness scaling limit is accordingly bounded from below by P x /λ 2 ≅ 10 30 W cm -2 sr -1 . (fast track communication)

  9. Intrinsic bent DNA sites in the chromosomal replication origin of Xylella fastidiosa 9a5c

    Directory of Open Access Journals (Sweden)

    F. Gimenes

    2008-04-01

    Full Text Available The features of the nucleotide sequences in both replication and promoter regions have been investigated in many organisms. Intrinsically bent DNA sites associated with transcription have been described in several prokaryotic organisms. The aim of the present study was to investigate intrinsic bent DNA sites in the segment that holds the chromosomal replication origin, oriC, of Xylella fastidiosa 9a5c. Electrophoretic behavior analyses, as well as in silico analyses of both the 2-D projection and helical parameters, were performed. The chromosomal segment analyzed contains the initial sequence of the rpmH gene, an intergenic region, the dnaA gene, the oriC sequence, and the 5' partial sequence of the dnaN gene. The analysis revealed fragments with reduced electrophoretic mobility, which indicates the presence of curved DNA segments. The analysis of the helical parameter ENDS ratio revealed three bent DNA sites (b1, b2, and b3 located in the rpmH-dnaA intergenic region, the dnaA gene, and the oriC 5' end, respectively. The chromosomal segment of X. fastidiosa analyzed here is rich in phased AT tracts and in CAnT motifs. The 2-D projection indicated a segment whose structure was determined by the cumulative effect of all bent DNA sites. Further, the in silico analysis of the three different bacterial oriC sequences indicated similar negative roll and twist >34.00° values. The DnaA box sequences, and other motifs in them, may be associated with the intrinsic DNA curvature.

  10. 76 FR 60582 - Notice of Meeting of the Industry Trade Advisory Committee on Small and Minority Business (ITAC-11)

    Science.gov (United States)

    2011-09-29

    ... Finance Update. --Trans-Atlantic Business Dialogue Activities. --U.S. Commercial Service National Export... Committee on Small and Minority Business (ITAC-11) AGENCY: Office of the United States Trade Representative... Business (ITAC-11) will hold a meeting on Wednesday, October 12, 2011, from 9 a.m. to 4 p.m. The meeting...

  11. Simulation of LSI-11/PDP-11 series minicomputers

    International Nuclear Information System (INIS)

    Myers, J.R.; Cottrell, R.L.A.; Bricaud, B.M.

    1979-04-01

    A functional simulation of te PDP-11 series minicomputers was implemented to run either interactively or as a batch job on an IBM 370 computer. The simulator operates in two modes, the supervisor mode and the run mode. In the supervisor mode, the simulator implements a command language, which allows users to examine and change the contents of memory or other addressable registers in the simulated machine. Optionally, an instruction trace may also be turned on or off. In the run mode, the simulation of the instruction set is tested by successfully running DEC's MAINDEC basic instruction test on the simulated machine. The interrupt structure is modeled. The simulation is open ended in the sense that users may define new peripheral devices, by including their own FORTRAN callable subroutines for each simulated device. Currently the following devices are supported: floppy disks, a console terminal, a card reader, a card punch, a line printer, and a communications multiplexer (DH11). With these devices DEC's RT-11 versions 2C and 3B have been successfully run on the simulator. At SLAC this simulator is proving useful in debugging software for one-of-a-kind hardware configurations, such as communications front end processors, that are not readily accessible for stand alone testing. 5 figures

  12. Purification and crystallization of Cor a 9, a major hazelnut allergen

    International Nuclear Information System (INIS)

    Guo, Feng; Kothary, Mahendra H.; Wang, Yang; Yu, Xiaoping; Howard, Andrew J.; Fu, Tong-Jen; Zhang, Yu-Zhu

    2008-01-01

    The major hazelnut allergen Cor a 9 was purified from the natural source and crystallized. Diffraction data were collected to 1.9 Å resolution using a synchrotron-radiation source. Hazelnut (Corylus avellana) is one of the food sources that induce allergic reaction in a subpopulation of people with food allergy. The 11S legumin-like seed-storage protein from hazelnut has been identified as one of the major hazelnut allergens and named Cor a 9. In this study, Cor a 9 was extracted from hazelnut kernels using a high-salt solution and was purified by desalting out and FPLC to a highly purified state. Diffraction-quality single crystals were obtained using the hanging-drop vapour-diffusion method. Diffraction data were collected and a structure solution has been obtained by molecular-replacement calculations. Further refinement of the structure is currently in progress

  13. 1+1 Gaudin Model

    Directory of Open Access Journals (Sweden)

    Andrei V. Zotov

    2011-07-01

    Full Text Available We study 1+1 field-generalizations of the rational and elliptic Gaudin models. For sl(N case we introduce equations of motion and L-A pair with spectral parameter on the Riemann sphere and elliptic curve. In sl(2 case we study the equations in detail and find the corresponding Hamiltonian densities. The n-site model describes n interacting Landau-Lifshitz models of magnets. The interaction depends on position of the sites (marked points on the curve. We also analyze the 2-site case in its own right and describe its relation to the principal chiral model. We emphasize that 1+1 version impose a restriction on a choice of flows on the level of the corresponding 0+1 classical mechanics.

  14. Annual report 2010-11

    International Nuclear Information System (INIS)

    2011-01-01

    Research and development and other activities of Pakistan Atomic Energy Commission (PAEC) for the year 2010-11 are reported. The activities of PAEC are described under the headings: Highlights, Nuclear Power, Engineering, Physical Sciences, Biological Sciences, Nuclear Materials, Safety, Quality, Human Resource Development, PAEC General Health Services, Projects and International Collaboratioin and publications. Its publication is aimed to document the achievements and concerted endeavour put in by all establishments of PAEC towards the fulfillment of its programme. (A.B.)

  15. Advances in magnetic resonance 11

    CERN Document Server

    Waugh, John S

    2013-01-01

    Advances in Magnetic Resonance, Volume 11, presents a variety of contributions to the theory and practice of magnetic resonance. The book contains three chapters and begins with a discussion of the principles and applications of dynamic nuclear polarization, with emphasis on molecular motions and collisions, intermolecular couplings, and chemical interactions. Subsequent chapters focus on the assessment of a proposed broadband decoupling method and studies of time-domain (or Fourier transform) multiple-quantum nuclear magnetic resonance.

  16. TEK11 graphics user's guide

    International Nuclear Information System (INIS)

    Stewart, C.R. Jr.; Joubert, W.D.; Overbey, D.R.; Stewart, K.A.

    1978-10-01

    The TEK11 graphics library was written for use on PDP-11 minicomputers running the RT-11 operating system to drive Tektronix 4010 graphics display terminals. Library subroutines are coded in FORTRAN and assembly language. The library includes routines to draw axes, either linear or semilog, to plot data in terms of logical values without first scaling to screen coordinates, to label graphs, and to plot in a maximum of four regions on the screen. Modes of plotting may be point plot with any character at the point, vector plot, or bar plot. Two features, automatic scaling and windowing, permit the researcher to use computer graphics without spending time first to learn about scaling or ''Tek points'' and preparing long parameter lists for subroutines. Regions on the screen are defined by specifying minima and maxima logical coordinates, i.e., 0 K or milliseconds, and a region number. After definition, a region may be activated for plotting by calling REGN with the region number as an argument

  17. Apollo 11 Earth Training Exercises

    Science.gov (United States)

    1969-01-01

    In preparation of the nation's first lunar landing mission, Apollo 11 crew members underwent training to practice activities they would be performing during the mission. In this photograph, taken at the Manned Spacecraft Center in Houston, Texas, an engineer, Bob Mason, donned in a space suit, goes through some of those training exercises on the mock lunar surface. He performed activites similar to those planned for astronauts Neil Armstrong and Edwin Aldrin during their moon walk. The Apollo 11 mission launched from the Kennedy Space Center (KSC) in Florida via the Marshall Space Flight Center (MSFC) developed Saturn V launch vehicle on July 16, 1969 and safely returned to Earth on July 24, 1969. Aboard the space craft were astronauts Neil A. Armstrong, commander; Michael Collins, Command Module (CM) pilot; and Edwin E. (Buzz) Aldrin Jr., Lunar Module (LM) pilot. The CM, 'Columbia', piloted by Collins, remained in a parking orbit around the Moon while the LM, 'Eagle'', carrying astronauts Armstrong and Aldrin, landed on the Moon. On July 20, 1969, Armstrong was the first human to ever stand on the lunar surface, followed by Aldrin. During 2½ hours of surface exploration, the crew collected 47 pounds of lunar surface material for analysis back on Earth. With the success of Apollo 11, the national objective to land men on the Moon and return them safely to Earth had been accomplished.

  18. 25 CFR 11.1007 - Petition.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Petition. 11.1007 Section 11.1007 Indians BUREAU OF... Juvenile Offender Procedure § 11.1007 Petition. (a) Proceedings under §§ 11.1000-11.1014 of this part shall be instituted by a petition filed by the presenting officer on behalf of the tribe and in the...

  19. M2-9 - a planetary nebula with an eruptive nucleus?

    International Nuclear Information System (INIS)

    Balick, B.

    1989-01-01

    M2-9 is a striking bipolar, or butterfly, planetary nebula (PN) whose nuclear spectrum is uncharacteristic of PN nuclei. Narrow lines ranging in ionization from O I, Fe II, forbidden Fe II, and Si II through forbidden O III are observed in the stellar spectrum. The H-alpha emission line has wings extending nearly 11,000 km/s at the base, and there is a deep self-absorption feature near the H-alpha line peak at the same velocity as nebular gas observed in one of the two bipolar lobes. The spectrum of M2-9's nucleus is more similar to the slow nova RR Tel, some symbiotic stars, and Seyfert (type 1.9) galactic nuclei than the central stars of most other PNs. Although its morphology, size, and nebular spectrum share many similarities with other PNs, M2-9 may not share a common evolutionary history with that class of objects. 31 references

  20. Inhibition of the H3K9 methyltransferase G9A attenuates oncogenicity and activates the hypoxia signaling pathway.

    Directory of Open Access Journals (Sweden)

    Jolene Caifeng Ho

    Full Text Available Epigenetic mechanisms play important roles in the regulation of tumorigenesis, and hypoxia-induced epigenetic changes may be critical for the adaptation of cancer cells to the hypoxic microenvironment of solid tumors. Previously, we showed that loss-of-function of the hypoxia-regulated H3K9 methyltransferase G9A attenuates tumor growth. However, the mechanisms by which blockade of G9A leads to a tumor suppressive effect remain poorly understood. We show that G9A is highly expressed in breast cancer and is associated with poor patient prognosis, where it may function as a potent oncogenic driver. In agreement with this, G9A inhibition by the small molecule inhibitor, BIX-01294, leads to increased cell death and impaired cell migration, cell cycle and anchorage-independent growth. Interestingly, whole transcriptome analysis revealed that genes involved in diverse cancer cell functions become hypoxia-responsive upon G9A inhibition. This was accompanied by the upregulation of the hypoxia inducible factors HIF1α and HIF2α during BIX-01294 treatment even in normoxia that may facilitate the tumor suppressive effects of BIX-01294. HIF inhibition was able to reverse some of the transcriptional changes induced by BIX-01294 in hypoxia, indicating that the HIFs may be important drivers of these derepressed target genes. Therefore, we show that G9A is a key mediator of oncogenic processes in breast cancer cells and G9A inhibition by BIX-01294 can successfully attenuate oncogenicity even in hypoxia.

  1. The Histone Methyltransferase Inhibitor A-366 Uncovers a Role for G9a/GLP in the Epigenetics of Leukemia.

    Directory of Open Access Journals (Sweden)

    William N Pappano

    Full Text Available Histone methyltransferases are epigenetic regulators that modify key lysine and arginine residues on histones and are believed to play an important role in cancer development and maintenance. These epigenetic modifications are potentially reversible and as a result this class of enzymes has drawn great interest as potential therapeutic targets of small molecule inhibitors. Previous studies have suggested that the histone lysine methyltransferase G9a (EHMT2 is required to perpetuate malignant phenotypes through multiple mechanisms in a variety of cancer types. To further elucidate the enzymatic role of G9a in cancer, we describe herein the biological activities of a novel peptide-competitive histone methyltransferase inhibitor, A-366, that selectively inhibits G9a and the closely related GLP (EHMT1, but not other histone methyltransferases. A-366 has significantly less cytotoxic effects on the growth of tumor cell lines compared to other known G9a/GLP small molecule inhibitors despite equivalent cellular activity on methylation of H3K9me2. Additionally, the selectivity profile of A-366 has aided in the discovery of a potentially important role for G9a/GLP in maintenance of leukemia. Treatment of various leukemia cell lines in vitro resulted in marked differentiation and morphological changes of these tumor cell lines. Furthermore, treatment of a flank xenograft leukemia model with A-366 resulted in growth inhibition in vivo consistent with the profile of H3K9me2 reduction observed. In summary, A-366 is a novel and highly selective inhibitor of G9a/GLP that has enabled the discovery of a role for G9a/GLP enzymatic activity in the growth and differentiation status of leukemia cells.

  2. Interplay between EZH2 and G9a Regulates CXCL10 Gene Repression in Idiopathic Pulmonary Fibrosis.

    Science.gov (United States)

    Coward, William R; Brand, Oliver J; Pasini, Alice; Jenkins, Gisli; Knox, Alan J; Pang, Linhua

    2018-04-01

    Selective repression of the antifibrotic gene CXCL10 contributes to tissue remodeling in idiopathic pulmonary fibrosis (IPF). We have previously reported that histone deacetylation and histone H3 lysine 9 (H3K9) methylation are involved in CXCL10 repression. In this study, we explored the role of H3K27 methylation and the interplay between the two histone lysine methyltransferases enhancer of zest homolog 2 (EZH2) and G9a in CXCL10 repression in IPF. By applying chromatin immunoprecipitation, Re-ChIP, and proximity ligation assays, we demonstrated that, like G9a-mediated H3K9 methylation, EZH2-mediated histone H3 lysine 27 trimethylation (H3K27me3) was significantly enriched at the CXCL10 promoter in fibroblasts from IPF lungs (F-IPF) compared with fibroblasts from nonfibrotic lungs, and we also found that EZH2 and G9a physically interacted with each other. EZH2 knockdown reduced not only EZH2 and H3K27me3 but also G9a and H3K9me3, and G9a knockdown reduced not only G9 and H3K9me3 but also EZH2 and H3K27me3. Depletion and inhibition of EZH2 and G9a also reversed histone deacetylation and restored CXCL10 expression in F-IPF. Furthermore, treatment of fibroblasts from nonfibrotic lungs with the profibrotic cytokine transforming growth factor-β1 increased EZH2, G9a, H3K27me3, H3K9me3, and histone deacetylation at the CXCL10 promoter, similar to that observed in F-IPF, which was correlated with CXCL10 repression and was prevented by EZH2 and G9a knockdown. These findings suggest that a novel and functionally interdependent interplay between EZH2 and G9a regulates histone methylation-mediated epigenetic repression of the antifibrotic CXCL10 gene in IPF. This interdependent interplay may prove to be a target for epigenetic intervention to restore the expression of CXCL10 and other antifibrotic genes in IPF.

  3. 11. International Oil Summit 2010

    International Nuclear Information System (INIS)

    Anon.

    2010-01-01

    In his introduction at the 11. international oil summit 2010, Mr N. Ait-Laoussine (President of Nalcosa and past Energy Minister in Algeria) has summarized the main points which will be approached during the meeting: 1)after the crisis of 2008, what will be the challenges of the petroleum industry? the environmental constraints? the availability of the new technologies? Will the prices volatility be permanent? 2)what will be the strategy at middle/long term of the national petroleum companies, of the international petroleum companies and of the service companies (partnership, research and innovation,....)? (O.M.)

  4. Germany after March 11th

    International Nuclear Information System (INIS)

    Wolski, A.

    2011-01-01

    A retrospective since March 11th is presented with stress on the Fukushima accident, political situation in Germany, media and public opinion. Fukushima has devastated the trust in expert opinions about safety of NPPs. Germany’s Turn in Energy - consensus for nuclear phase-out exists between All political parties. The government has already announced adoption of the recommendations of the ethics commission. The 7 oldest units will remain shut-down. Further 7 units will be shut down until 2021. The youngest 3 units will be permanently shut down until 2022

  5. 11th Edoardo Amaldi Conference on Gravitational Waves (AMALDI 11)

    International Nuclear Information System (INIS)

    Lee, Hyung Mok; Oh, John

    2016-01-01

    The 11 th Amaldi Conference on gravitational waves was held from June 21 to 26, 2016 in Gwangju, Korea. This meeting was sponsored by the International Union of Pure and Applied Physics (IUPAP), Korean Astronomical Society, Korean Physical Society, Korean Federation of Science and Technology (KOFST), National Research Foundation (NRF), Korea Tourism Organism, and Gwangju Convention Bureau. More than 150 scientists from 26 countries attended the 11 th Amaldi Confernece. Although there was an outbreak of Middle East Respiratory Syndrome (MERS) just before the conference, there were very little cancellations. There was no incident related to the MERS disease. The scientific program, including the list of the invited plenary speakers, was arranged by the Gravitational Wave International Committee (GWIC) chaired by Eugenio Coccia. Most of the communication between the GWIC and the Local Organizing Committee (LOC) was handled by Stan Whitcomb, general secretary of the GWIC. There were 10 plenary sessions and 13 parallel sessions. Two plenary sessions were held each morning from Monday to Friday while the afternoon was devoted to parallel sessions. A special lecture for the participants of the meeting on ultra-high intensity lasers was delivered by Chang Hee Nam, director of the Center for Relativistic Laser Science located at the Gwangju Institute of Science and Technology. Bernard Schutz gave a public talk entitled “Listening to Black Holes and the Big Bang - the Oldest Concert of the Universe” in the evening on June 23. More than 250 students and general public attended this talk. Most of the topics ranging from detector instruments, data analysis, to astrophysics and source modeling were covered in 10 invited talks, 67 contributed oral presentations, and 39 posters. After the conference, we invited all participants to submit written papers for proceedings. We received 35 papers and went through the peer review process and accepted 34 papers for publications. We

  6. VPS9a activates the Rab5 GTPase ARA7 to confer distinct pre- and postinvasive plant innate immunity

    DEFF Research Database (Denmark)

    Nielsen, Mads Eggert; Jürgens, Gerd; Thordal-Christensen, Hans

    2017-01-01

    Plant innate immunity can effectively prevent the proliferation of filamentous pathogens. Papilla formation at the site of attack is essential for preinvasive immunity; in postinvasive immunity, the encasement of pathogen structures inside host cells can hamper disease. Whereas papillae are highly...... (Blumeria graminis f. sp hordei) in Arabidopsis thaliana. Surprisingly, VPS9a acts in addition to two previously well-described innate immunity components and thus represents an additional step in the regulation of how plants resist pathogens. We found VPS9a to be important for delivering membrane material...

  7. Modeling of LVRF critical experiments in ZED-2 using WIMS9A/PANTHER and MCNP5

    International Nuclear Information System (INIS)

    Sissaoui, M.T.; Carlson, P.A.; Lebenhaft, J.R.

    2009-01-01

    The accuracy of WIMS9A/PANTHER and MCNP5 in modeling D 2 O-moderated, and H 2 O-, D 2 O- or air-cooled, doubly heterogeneous lattices of fuel clusters was demonstrated using Low Void Reactivity Fuel (LVRF) substitution experiments in the ZED-2 critical facility. MCNP5 with ENDF/B-VI (Release 5) underpredicted k eff but gave excellent coolant void reactivity (CVR) bias values. WIMS9A/PANTHER with JEF-2.2 overpredicted k eff and underpredicted the CVR bias relative to MCNP5 by 100-200 pcm. Both codes reproduced the measured axial and radial flux shapes accurately

  8. 7 CFR 1739.11 - Eligible project.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 11 2010-01-01 2010-01-01 false Eligible project. 1739.11 Section 1739.11 Agriculture... BROADBAND GRANT PROGRAM Community Connect Grant Program § 1739.11 Eligible project. To be eligible for a grant, the Project must: (a) Serve a Rural Area where Broadband Transmission Service does not currently...

  9. 28 CFR 11.7 - Salary adjustments.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Salary adjustments. 11.7 Section 11.7 Judicial Administration DEPARTMENT OF JUSTICE DEBT COLLECTION Administration of Debt Collection § 11.7 Salary adjustments. The following debts shall not be subject to the salary offset procedures of § 11.8...

  10. 37 CFR 11.26 - Settlement.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Settlement. 11.26 Section 11... Disciplinary Proceedings; Jurisdiction, Sanctions, Investigations, and Proceedings § 11.26 Settlement. Before or after a complaint under § 11.34 is filed, a settlement conference may occur between the OED...

  11. 11th International Conference Mechatronics

    CERN Document Server

    Brezina, Tomas

    2016-01-01

    Focusing on the most rapidly changing areas of mechatronics, this book discusses signals and system control, mechatronic products, metrology and nanometrology, automatic control & robotics, biomedical engineering, photonics, design manufacturing and testing of MEMS. It is reflected in the list of contributors, including an international group of 302 leading researchers representing 12 countries. The book is intended for use in academic, government and industry R&D departments, as an indispensable reference tool for the years to come. Thid volume can serve a global community as the definitive reference source in Mechatronics. The book comprises carefully selected 93 contributions presented at the 11th International Conference Mechatronics 2015, organized by Faculty of Mechatronics, Warsaw University of Technology, on September 21-23, in Warsaw, Poland. .

  12. Annual Report 2010-11

    International Nuclear Information System (INIS)

    2012-01-01

    Annual report of Pakistan Institute of Nuclear Science and Technology (PINSTECH), Islamabad, Pakistan for the year 2010-11 has been compiled which describe a concise but comprehensive description of R and D activities conducted during this period. PINSTECH has contributed considerably in the discipline of chemical, engineering, environmental and physical sciences. It has always been extending technical help and services to Pakistan Atomic Energy Commission (PAEC) as well as other organizations. There are about 90 publications in summary form which gives the main theme of the research activities. At the end of this report different institute activities like courses organized, collaboration with universities, internship, honours /awards and list of publications during the year is also presented. (A.B.)

  13. 11th KES International Conference

    CERN Document Server

    Kusek, Mario; Chen-Burger, Yun-Heh; Howlett, Robert; Jain, Lakhmi

    2017-01-01

    This volume highlights new trends and challenges in research on agents and the new digital and knowledge economy, and includes 23 papers classified into the following categories: business process management, agent-based modeling and simulation, and anthropic-oriented computing. All papers were originally presented at the 11th International KES Conference on Agents and Multi-Agent Systems – Technologies and Applications (KES-AMSTA 2017) held June 21–23, 2017 in Vilamoura, Algarve, Portugal. Today’s economy is driven by technologies and knowledge. Digital technologies can free, shift and multiply choices, and often intrude on the territory of other industries by providing new ways of conducting business operations and creating value for customers and companies. The topics covered in this volume include software agents, multi-agent systems, agent modeling, mobile and cloud computing, big data analysis, business intelligence, artificial intelligence, social systems, computer embedded systems and nature insp...

  14. 37 CFR 11.11 - Administrative suspension, inactivation, resignation, and readmission.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Administrative suspension, inactivation, resignation, and readmission. 11.11 Section 11.11 Patents, Trademarks, and Copyrights UNITED... Other Non-Patent Law § 11.11 Administrative suspension, inactivation, resignation, and readmission. (a...

  15. 25 CFR 11.1107 - Petition.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Petition. 11.1107 Section 11.1107 Indians BUREAU OF... Minor-in-Need-of-Care Procedure § 11.1107 Petition. Proceedings under §§ 11.1100-11.1114 of this part shall be instituted by a petition filed by the presenting officer on behalf of the tribe and the...

  16. 33 CFR 89.25 - Waters upon which Inland Rules 9(a)(ii), 14(d), and 15(b) apply.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Waters upon which Inland Rules 9(a)(ii), 14(d), and 15(b) apply. 89.25 Section 89.25 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INLAND NAVIGATION RULES INLAND NAVIGATION RULES: IMPLEMENTING RULES Waters...

  17. Cyanobacterial photosystem II at 2.9-A resolution and the role of quinones, lipids, channels and chloride

    NARCIS (Netherlands)

    Guskov, Albert; Kern, Jan; Gabdulkhakov, Azat; Broser, Matthias; Zouni, Athina; Saenger, Wolfram

    Photosystem II (PSII) is a large homodimeric protein-cofactor complex located in the photosynthetic thylakoid membrane that acts as light-driven water:plastoquinone oxidoreductase. The crystal structure of PSII from Thermosynechococcus elongatus at 2.9-A resolution allowed the unambiguous assignment

  18. Inland post-glacial dispersal in East Asia revealed by mitochondrial haplogroup M9a'b

    Directory of Open Access Journals (Sweden)

    Wang Wen-Zhi

    2011-01-01

    Full Text Available Abstract Background Archaeological studies have revealed a series of cultural changes around the Last Glacial Maximum in East Asia; whether these changes left any signatures in the gene pool of East Asians remains poorly indicated. To achieve deeper insights into the demographic history of modern humans in East Asia around the Last Glacial Maximum, we extensively analyzed mitochondrial DNA haplogroup M9a'b, a specific haplogroup that was suggested to have some potential for tracing the migration around the Last Glacial Maximum in East Eurasia. Results A total of 837 M9a'b mitochondrial DNAs (583 from the literature, while the remaining 254 were newly collected in this study pinpointed from over 28,000 subjects residing across East Eurasia were studied here. Fifty-nine representative samples were further selected for total mitochondrial DNA sequencing so we could better understand the phylogeny within M9a'b. Based on the updated phylogeny, an extensive phylogeographic analysis was carried out to reveal the differentiation of haplogroup M9a'b and to reconstruct the dispersal histories. Conclusions Our results indicated that southern China and/or Southeast Asia likely served as the source of some post-Last Glacial Maximum dispersal(s. The detailed dissection of haplogroup M9a'b revealed the existence of an inland dispersal in mainland East Asia during the post-glacial period. It was this dispersal that expanded not only to western China but also to northeast India and the south Himalaya region. A similar phylogeographic distribution pattern was also observed for haplogroup F1c, thus substantiating our proposition. This inland post-glacial dispersal was in agreement with the spread of the Mesolithic culture originating in South China and northern Vietnam.

  19. Hypochondriasis: considerations for ICD-11

    Directory of Open Access Journals (Sweden)

    Odile A. van den Heuvel

    2014-01-01

    Full Text Available The World Health Organization (WHO is currently revisiting the ICD. In the 10th version of the ICD, approved in 1990, hypochondriacal symptoms are described in the context of both the primary condition hypochondriacal disorder and as secondary symptoms within a range of other mental disorders. Expansion of the research base since 1990 makes a critical evaluation and revision of both the definition and classification of hypochondriacal disorder timely. This article addresses the considerations reviewed by members of the WHO ICD-11 Working Group on the Classification of Obsessive-Compulsive and Related Disorders in their proposal for the description and classification of hypochondriasis. The proposed revision emphasizes the phenomenological overlap with both anxiety disorders (e.g., fear, hypervigilance to bodily symptoms, and avoidance and obsessive-compulsive and related disorders (e.g., preoccupation and repetitive behaviors and the distinction from the somatoform disorders (presence of somatic symptom is not a critical characteristic. This revision aims to improve clinical utility by enabling better recognition and treatment of patients with hypochondriasis within the broad range of global health care settings.

  20. Synthesis of [11C]-Sarin

    International Nuclear Information System (INIS)

    Prenant, C.; Crouzel, C.

    1990-01-01

    [ 11 C]-acetone, prepared from 11 CO 2 and methyllithium, was reduced to [ 11 C]-isopropanol. The latter reacted with methylphosphonic acid difluoride in the presence of diisopropylamine, to yield [11C]-sarin. 3.4 GBq (100 mCi) of [ 11 C]-sarin may be obtained from about 55.5 GBq (1.5 Ci) of 11 CO 2 in 40 minutes. The product purified by HPLC, is obtained with a specific radioactivity ranging from 22.2 to 33.3 GBq (600 to 900 mCi/μmol.). (author)

  1. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    International Nuclear Information System (INIS)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan; Yang, Zhihong; Huang, Yi; Bennett, Jason; Wang, Li

    2016-01-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  2. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Yang, Zhihong [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); Huang, Yi [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Bennett, Jason [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Wang, Li, E-mail: li.wang@uconn.edu [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Department of Internal Medicine, Section of Digestive Diseases, Yale University, New Haven, CT 06520 (United States)

    2016-08-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  3. September 11 and Nuclear Energy

    International Nuclear Information System (INIS)

    Knapp, V.

    2002-01-01

    The terrible September 11 attacks have demonstrated the ability of international terrorists to carry out well-planned and complex operations that can kill thousands of citizens. The potential for biological, chemical and nuclear terrorism has increased and will remain as long as their underlying causes. Nuclear installations could be the targets, or the sources of materials usable for terrorism. Whilst thick containment buildings around nuclear reactors are unlikely to be breached, some installations, such as spent fuel pond are more vulnerable. The safety of nuclear installations must be reconsidered taking into account some new initiating events hitherto considered of very low probability. A resistance against nuclear power plant sabotage by terrorist group penetrating into reactor building, is a controversial topic. Measures against diversion of nuclear materials, which could be used in nuclear terrorism, must be reviewed. The danger of diversion from giant military stocks of highly enriched uranium and plutonium by far exceeds that from peaceful use of nuclear energy. Measures to neutralize these stocks, such as dilution of highly enriched uranium, should be speeded up and have a priority in public concern. As for the nuclear power stations, public should be informed about the recommendations of IAEA for better physical protection of nuclear materials prepared in 1999 (INFCIRC 225/Rev.4) and about Additional protocol to inadequate Convention on Physical Protection of Nuclear Materials from 1980, which is in a process of ratification. For acceptable nuclear future public must be aware that all required measures to eliminate unacceptable risks resulting from terrorist activity against nuclear installations will be undertaken. (author)

  4. Modeling of LVRF Critical Experiments in ZED-2 Using WIMS9A/PANTHER and MCNP5

    International Nuclear Information System (INIS)

    Sissaoui, M.T.; Lebenhaft, J.R; Carlson, P.A.

    2008-01-01

    The accuracy of WIMS9A/PANTHER and MCNP5 in modeling D 2 O-moderated, and H 2 O-, D 2 O- or air-cooled, doubly heterogeneous lattices of fuel clusters was demonstrated using Low Void Reactivity Fuel (LVRF) substitution experiments in the ZED-2 critical facility. MCNP5 with ENDF/B-VI (Release 5) under-predicted k eff but gave excellent coolant void reactivity (CVR) bias values. WIMS9A/PANTHER with JEF-2.2 over-predicted k eff and under-predicted the CVR bias relative to MCNP5 by 100 pcm to 200 pcm. Both codes reproduced the measured axial and radial flux shapes accurately. (authors)

  5. samaru-main-vol 11 2011

    African Journals Online (AJOL)

    Library _info_Sc_ 1

    2004-07-11

    Jul 11, 2004 ... Samaru Journal of Information Studies Vol. 11 (1 & 2)2011 ... It is therefore paramount that the library ... source of primary and up to date information, both students and ... entertainment, arts, fashion, law, economy, medicine,.

  6. 41 CFR 301-11.11 - How do I make my lodging reservations?

    Science.gov (United States)

    2010-07-01

    ... your agency travel management service as required by part 301-50 of this chapter. [FTR Amdt. 108, 67 FR... reservations? 301-11.11 Section 301-11.11 Public Contracts and Property Management Federal Travel Regulation System TEMPORARY DUTY (TDY) TRAVEL ALLOWANCES ALLOWABLE TRAVEL EXPENSES 11-PER DIEM EXPENSES General...

  7. CTD data from the Madeira and Iberian Abyssal Plains. CHARLES DARWIN cruises 3/85 and 9A/85

    International Nuclear Information System (INIS)

    Saunders, P.M.

    1986-01-01

    This report presents lists and graphs of CTD data taken aboard RRS Charles Darwin on cruises 3 (May 1985) and 9A (November 1985). The majority of the lowerings were made in support of two experiments; the deployment of deep SOFAR floats and of deep moored current meters, the latter near 31 0 30'N 25 0 W (GME site). All CTD data is compared with reversing thermometer observations, and with determinations of salinity and dissolved oxygen derived from samples. (author)

  8. Modelling of 28-element UO2 flux-map critical experiments in ZED-2 using WIMS9A/PANTHER

    International Nuclear Information System (INIS)

    Sissaoui, M.T.; Kozier, K.S.; Labrie, J.P.

    2011-01-01

    The accuracy of WIMS9A/PANTHER in modelling D 2 O-moderated, and H 2 O- or air-cooled, doubly heterogeneous lattices of fuel clusters has been demonstrated using 28-element UO 2 flux-map critical experiments in the ZED-2 facility. Presented here are the predicted k eff values, coolant void reactivity biases, and the radial and axial flux shapes.

  9. Effect of Tween 80 on 9a-steroid hydroxylating activity and ultrastructural characteristics of Rhodococcus sp. cells

    OpenAIRE

    Avramova , Tatyana; Spassova , Dimitrina; Mutafov , Sava; Momchilova , Svetlana; Boyadjieva , Lilyana; Damyanova , Boryana; Angelova , Blaga

    2010-01-01

    International audience; Studied is the effect of the non-ionic surfactant Tween 80 on the microbial transformation of 4-androstene- 3,17-dione into its 9a-hydroxy-derivative by resting Rhodococcus sp. cells. The surfactant was applied in the cultivation medium as an additional source of carbon, in the transformation reaction medium as a mediator of the steroid substrate solubility or was used for permeabilization of the glucose grown Rhodococcus sp. cells. Special attention is paid to the fac...

  10. The GF11 project at IBM

    International Nuclear Information System (INIS)

    Sexton, J.C.

    1990-01-01

    The GF11 project at IBM's T. J. Watson Research Center is entering full production for QCD numerical calculations. This paper describes the GF11 hardware and system software, and discusses the first production program which has been developed to run on GF11. This program is a variation of the Cabbibo Marinari pure gauge Monte Carlo program for SU(3) and is currently sustaining almost 6 gigaflops on 360 processors in GF11

  11. The GF11 project at IBM

    Science.gov (United States)

    Sexton, James C.

    1990-08-01

    The GF11 project at IBM's T. J. Watson Research Center is entering full production for QCD numerical calculations. This paper describes the GF11 hardware and system software, and discusses the first production program which has been developed to run on GF11. This program is a variation of the Cabbibo Marinari pure gauge Monte Carlo program for SU(3) and is currently sustaining almost 6 gigaflops on 360 processors in GF11.

  12. 49 CFR 179.400-11 - Welding.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.400-11 Section 179.400-11...-11 Welding. (a) Except for closure of openings and a maximum of two circumferential closing joints in... subchapter). (d) Each welding procedure, welder, and fabricator must be approved. [Amdt. 179-32, 48 FR 27708...

  13. 49 CFR 179.11 - Welding certification.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding certification. 179.11 Section 179.11 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Design Requirements § 179.11 Welding certification. (a) Welding procedures, welders and fabricators shall...

  14. 42 CFR 86.11 - Eligibility.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Eligibility. 86.11 Section 86.11 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES GRANTS FOR EDUCATION PROGRAMS IN OCCUPATIONAL SAFETY AND HEALTH Occupational Safety and Health Training Grants § 86.11...

  15. 40 CFR 406.11 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 406.11 Section 406.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS GRAIN MILLS POINT SOURCE CATEGORY Corn Wet Milling Subcategory § 406.11 Specialized definitions...

  16. 9 CFR 309.11 - Vaccine livestock.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Vaccine livestock. 309.11 Section 309.11 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY... CERTIFICATION ANTE-MORTEM INSPECTION § 309.11 Vaccine livestock. Vaccine livestock with unhealed lesions of...

  17. 21 CFR 610.11 - General safety.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false General safety. 610.11 Section 610.11 Food and... GENERAL BIOLOGICAL PRODUCTS STANDARDS General Provisions § 610.11 General safety. A general safety test... for administration to humans. The general safety test is required in addition to other specific tests...

  18. 7 CFR 1421.11 - Spot checks.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Spot checks. 1421.11 Section 1421.11 Agriculture... ASSISTANCE LOANS AND LOAN DEFICIENCY PAYMENTS FOR 2008 THROUGH 2012 General § 1421.11 Spot checks. (a) CCC... CCC access to the farm and storage facility as necessary to conduct collateral inspections, or “spot...

  19. 10 CFR 218.11 - Supply orders.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Supply orders. 218.11 Section 218.11 Energy DEPARTMENT OF ENERGY OIL STANDBY MANDATORY INTERNATIONAL OIL ALLOCATION Supply Orders § 218.11 Supply orders. (a) A supply order shall require that the firm to which it is issued take actions specified therein relating to...

  20. 10 CFR 1800.11 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Definitions. 1800.11 Section 1800.11 Energy NORTHEAST... INTERSTATE LOW-LEVEL RADIOACTIVE WASTE COMPACT § 1800.11 Definitions. The definitions contained in Article II..., corporation, business enterprise or other legal entity, either public or private, and expressly includes...

  1. 22 CFR 42.11 - Classification symbols.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Classification symbols. 42.11 Section 42.11... NATIONALITY ACT, AS AMENDED Classification and Foreign State Chargeability § 42.11 Classification symbols. A... visa symbol to show the classification of the alien. Immigrants Symbol Class Section of law Immediate...

  2. 25 CFR 11.1000 - Complaint.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Complaint. 11.1000 Section 11.1000 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Juvenile Offender Procedure § 11.1000 Complaint. A complaint must be filed by a law enforcement officer or...

  3. 49 CFR 233.11 - Civil penalties.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Civil penalties. 233.11 Section 233.11..., DEPARTMENT OF TRANSPORTATION SIGNAL SYSTEMS REPORTING REQUIREMENTS § 233.11 Civil penalties. Any person (an... subject to a civil penalty of at least $650 and not more than $25,000 per violation, except that...

  4. 12 CFR 215.11 - Civil penalties.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Civil penalties. 215.11 Section 215.11 Banks... OFFICERS, DIRECTORS, AND PRINCIPAL SHAREHOLDERS OF MEMBER BANKS (REGULATION O) § 215.11 Civil penalties... subject to civil penalties as specified in section 29 of the Federal Reserve Act (12 U.S.C. 504). [Reg. O...

  5. 49 CFR 1150.11 - Introduction.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 8 2010-10-01 2010-10-01 false Introduction. 1150.11 Section 1150.11 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION BOARD, DEPARTMENT... Designated Operators § 1150.11 Introduction. A certificate of designated operator will be issued to an...

  6. 36 CFR 292.11 - Introduction.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Introduction. 292.11 Section 292.11 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE NATIONAL RECREATION AREAS Whiskeytown-Shasta-Trinity National Recreation Area § 292.11 Introduction. (a...

  7. 49 CFR 262.11 - Application process.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Application process. 262.11 Section 262.11 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... IMPROVEMENT PROJECTS § 262.11 Application process. (a) All grant applications for opportunities funded under...

  8. 34 CFR 31.11 - Offset process.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Offset process. 31.11 Section 31.11 Education Office of the Secretary, Department of Education SALARY OFFSET FOR FEDERAL EMPLOYEES WHO ARE INDEBTED TO THE UNITED STATES UNDER PROGRAMS ADMINISTERED BY THE SECRETARY OF EDUCATION § 31.11 Offset process. (a) The...

  9. 46 CFR 310.11 - Cadet uniforms.

    Science.gov (United States)

    2010-10-01

    ... for State, Territorial or Regional Maritime Academies and Colleges § 310.11 Cadet uniforms. Cadet uniforms shall be supplied at the school in accordance with the uniform regulations of the School. Those... 46 Shipping 8 2010-10-01 2010-10-01 false Cadet uniforms. 310.11 Section 310.11 Shipping MARITIME...

  10. 7 CFR 614.11 - Mediation.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Mediation. 614.11 Section 614.11 Agriculture... AGRICULTURE CONSERVATION OPERATIONS NRCS APPEAL PROCEDURES § 614.11 Mediation. (a) A participant who wishes to pursue mediation must file request for mediation under this part with the NRCS official designated in the...

  11. 40 CFR 172.11 - Publication.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Publication. 172.11 Section 172.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS EXPERIMENTAL USE PERMITS Federal Issuance of Experimental Use Permits § 172.11 Publication. (a) Notice of receipt of an...

  12. 5 CFR 1206.11 - Meeting place.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Meeting place. 1206.11 Section 1206.11 Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES OPEN MEETINGS Conduct of Meetings § 1206.11 Meeting place. The Board will hold open meetings in meeting rooms designated in the...

  13. 39 CFR 952.11 - Default.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Default. 952.11 Section 952.11 Postal Service... AND LOTTERY ORDERS § 952.11 Default. (a) If the Respondent fails to file an answer within the time specified in the notice of answer and hearing, he shall be deemed in default, and to have waived hearing and...

  14. 39 CFR 963.11 - Default.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Default. 963.11 Section 963.11 Postal Service... PANDERING ADVERTISEMENTS STATUTE, 39 U.S.C. 3008 § 963.11 Default. If a petitioner, without notice or cause... thereupon may find the petitioner to be in default and refer the matter to the Judicial Officer for...

  15. 40 CFR 55.11 - Delegation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 5 2010-07-01 2010-07-01 false Delegation. 55.11 Section 55.11... CONTINENTAL SHELF AIR REGULATIONS § 55.11 Delegation. (a) The Governor or the Governor's designee of any State... request for delegation within 6 months of the receipt of the request. (d) If the Administrator finds that...

  16. 33 CFR 214.11 - Costs.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Costs. 214.11 Section 214.11... SUPPLIES OF DRINKING WATER § 214.11 Costs. Costs incurred by the Corps of Engineers in furnishing emergency... by the community generally will not be required. Costs of necessary measures for the decontamination...

  17. 49 CFR 266.11 - Allowable costs.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Allowable costs. 266.11 Section 266.11... TRANSPORTATION ACT § 266.11 Allowable costs. Allowable costs include only the following costs which are properly allocable to the work performed: Planning and program operation costs which are allowed under Federal...

  18. 39 CFR 3002.11 - Administrative Office.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Administrative Office. 3002.11 Section 3002.11 Postal Service POSTAL REGULATORY COMMISSION PERSONNEL ORGANIZATION § 3002.11 Administrative Office. (a) The incumbent head of the office is responsible for exercising two executive functions of the...

  19. 19 CFR 11.2 - Manufactured tobacco.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Manufactured tobacco. 11.2 Section 11.2 Customs... PACKING AND STAMPING; MARKING Packing and Stamping § 11.2 Manufactured tobacco. (a) If the invoice and entry presented for manufactured tobacco specify all the information necessary for prompt determination...

  20. 25 CFR 11.435 - Obstructing justice.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Obstructing justice. 11.435 Section 11.435 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Criminal Offenses § 11.435 Obstructing justice. A person commits a misdemeanor if, with...

  1. 39 CFR 11.1 - Establishment.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Establishment. 11.1 Section 11.1 Postal Service UNITED STATES POSTAL SERVICE THE BOARD OF GOVERNORS OF THE U.S. POSTAL SERVICE ADVISORY BOARDS (ARTICLE XI) § 11.1 Establishment. The Board of Governors may create such advisory boards as it may deem...

  2. 42 CFR 73.11 - Security.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Security. 73.11 Section 73.11 Public Health PUBLIC... AND TOXINS § 73.11 Security. (a) An individual or entity required to register under this part must develop and implement a written security plan. The security plan must be sufficient to safeguard the...

  3. 9 CFR 121.11 - Security.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Security. 121.11 Section 121.11... AGENTS AND TOXINS § 121.11 Security. (a) An individual or entity required to register under this part must develop and implement a written security plan. The security plan must be sufficient to safeguard...

  4. 7 CFR 331.11 - Security.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Security. 331.11 Section 331.11 Agriculture..., DEPARTMENT OF AGRICULTURE POSSESSION, USE, AND TRANSFER OF SELECT AGENTS AND TOXINS § 331.11 Security. (a) An individual or entity required to register under this part must develop and implement a written security plan...

  5. 25 CFR 11.421 - Bad checks.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Bad checks. 11.421 Section 11.421 Indians BUREAU OF... Criminal Offenses § 11.421 Bad checks. (a) A person who issues or passes a check or similar sight order for..., and the issuer failed to make good within 10 days after receiving notice of that refusal. ...

  6. 29 CFR 401.11 - Secret ballot.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Secret ballot. 401.11 Section 401.11 Labor Regulations Relating to Labor OFFICE OF LABOR-MANAGEMENT STANDARDS, DEPARTMENT OF LABOR LABOR-MANAGEMENT STANDARDS MEANING OF TERMS USED IN THIS SUBCHAPTER § 401.11 Secret ballot. Secret ballot means the expression by...

  7. 20 CFR 211.11 - Miscellaneous pay.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Miscellaneous pay. 211.11 Section 211.11 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT CREDITABLE RAILROAD COMPENSATION § 211.11 Miscellaneous pay. Any payment made to an employee by an employer which is...

  8. 7 CFR 987.11 - Trade demand.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Trade demand. 987.11 Section 987.11 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... RIVERSIDE COUNTY, CALIFORNIA Order Regulating Handling Definitions § 987.11 Trade demand. Trade demand means...

  9. 23 CFR 652.11 - Planning.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Planning. 652.11 Section 652.11 Highways FEDERAL HIGHWAY... ACCOMMODATIONS AND PROJECTS § 652.11 Planning. Federally aided bicycle and pedestrian projects implemented within... unless excluded by agreement between the State and the metropolitan planning organization. ...

  10. 40 CFR 23.11 - Holidays.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Holidays. 23.11 Section 23.11... STATUTES § 23.11 Holidays. If the date determined under §§ 23.2 to 23.10 falls on a Federal holiday, then... that is not a Federal holiday. ...

  11. 45 CFR 5b.11 - Exempt systems.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Exempt systems. 5b.11 Section 5b.11 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.11 Exempt systems. (a) General policy. The Act permits certain types of specific systems of records to be exempt from...

  12. 46 CFR 11.555 - Engineer (OSV).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Engineer (OSV). 11.555 Section 11.555 Shipping COAST... ENDORSEMENTS Professional Requirements for Engineer Officer § 11.555 Engineer (OSV). (a) Except as provided by paragraph (b) of this section, to qualify for an endorsement as Engineer (OSV), an applicant shall present...

  13. 7 CFR 11.21 - Organization.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Organization. 11.21 Section 11.21 Agriculture Office of the Secretary of Agriculture NATIONAL APPEALS DIVISION Organization And Functions § 11.21 Organization. NAD was established on October 13, 1994. Delegation of authority to the Director, NAD, appears at...

  14. 14 CFR 414.11 - Application.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Application. 414.11 Section 414.11 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION LICENSING SAFETY APPROVALS Application Procedures § 414.11 Application. (a) The application must...

  15. 48 CFR 11.203 - Customer satisfaction.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Customer satisfaction. 11.203 Section 11.203 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Using and Maintaining Requirements Documents 11.203 Customer satisfaction...

  16. 46 CFR 11.707 - Examination requirements.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Examination requirements. 11.707 Section 11.707 Shipping... OFFICER ENDORSEMENTS Professional Requirements for Pilots § 11.707 Examination requirements. (a) An... required to pass the examination described in subpart I of this part. (b) An applicant for an extension of...

  17. 25 CFR 11.1014 - Medical examination.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Medical examination. 11.1014 Section 11.1014 Indians... ORDER CODE Juvenile Offender Procedure § 11.1014 Medical examination. The children's court may order a medical examination for a minor who is alleged to be a juvenile offender. ...

  18. 21 CFR 11.50 - Signature manifestations.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Signature manifestations. 11.50 Section 11.50 Food... RECORDS; ELECTRONIC SIGNATURES Electronic Records § 11.50 Signature manifestations. (a) Signed electronic...: (1) The printed name of the signer; (2) The date and time when the signature was executed; and (3...

  19. 49 CFR 232.11 - Penalties.

    Science.gov (United States)

    2010-10-01

    ... hazard of death or injury to persons, or has caused death or injury, a penalty not to exceed $100,000 per... 49 Transportation 4 2010-10-01 2010-10-01 false Penalties. 232.11 Section 232.11 Transportation...-TRAIN DEVICES General § 232.11 Penalties. (a) Any person (including but not limited to a railroad; any...

  20. 7 CFR 246.11 - Nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nutrition education. 246.11 Section 246.11 Agriculture... Participant Benefits § 246.11 Nutrition education. (a) General. (1) Nutrition education shall be considered a benefit of the Program, and shall be made available at no cost to the participant. Nutrition education...

  1. 32 CFR 231.11 - Guidelines.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Guidelines. 231.11 Section 231.11 National... PROCEDURES GOVERNING BANKS, CREDIT UNIONS AND OTHER FINANCIAL INSTITUTIONS ON DOD INSTALLATIONS Guidelines for Application of the Privacy Act to Financial Institution Operations § 231.11 Guidelines. (a) The...

  2. 12 CFR 412.11 - Payment guidelines.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Payment guidelines. 412.11 Section 412.11 Banks and Banking EXPORT-IMPORT BANK OF THE UNITED STATES ACCEPTANCE OF PAYMENT FROM A NON-FEDERAL SOURCE FOR TRAVEL EXPENSES § 412.11 Payment guidelines. (a) Payments from a non-Federal source, other than...

  3. 21 CFR 1304.11 - Inventory requirements.

    Science.gov (United States)

    2010-04-01

    ... the inventory of the registered location to which they are subject to control or to which the person... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Inventory requirements. 1304.11 Section 1304.11... REGISTRANTS Inventory Requirements § 1304.11 Inventory requirements. (a) General requirements. Each inventory...

  4. 34 CFR 104.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Discrimination prohibited. 104.11 Section 104.11... ASSISTANCE Employment Practices § 104.11 Discrimination prohibited. (a) General. (1) No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or...

  5. 15 CFR 8b.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Discrimination prohibited. 8b.11 Section 8b.11 Commerce and Foreign Trade Office of the Secretary of Commerce PROHIBITION OF DISCRIMINATION... Practices § 8b.11 Discrimination prohibited. (a) General. (1) No qualified handicapped individual shall, on...

  6. 45 CFR 84.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Discrimination prohibited. 84.11 Section 84.11... § 84.11 Discrimination prohibited. (a) General. (1) No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or activity to which this...

  7. 45 CFR 605.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Discrimination prohibited. 605.11 Section 605.11... Employment Practices § 605.11 Discrimination prohibited. (a) General. (1) No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or...

  8. 31 CFR 50.11 - Definition.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Definition. 50.11 Section 50.11 Money and Finance: Treasury Office of the Secretary of the Treasury TERRORISM RISK INSURANCE PROGRAM Disclosures as Conditions for Federal Payment § 50.11 Definition. For purposes of this subpart, unless the...

  9. 10 CFR 11.5 - Policy.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Policy. 11.5 Section 11.5 Energy NUCLEAR REGULATORY COMMISSION CRITERIA AND PROCEDURES FOR DETERMINING ELIGIBILITY FOR ACCESS TO OR CONTROL OVER SPECIAL NUCLEAR MATERIAL General Provisions § 11.5 Policy. It is the policy of the Nuclear Regulatory Commission to carry...

  10. 49 CFR 633.11 - Covered projects.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Covered projects. 633.11 Section 633.11..., DEPARTMENT OF TRANSPORTATION PROJECT MANAGEMENT OVERSIGHT Project Management Oversight Services § 633.11 Covered projects. The Administrator may contract for project management oversight services when the...

  11. 7 CFR 1215.11 - Person.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Person. 1215.11 Section 1215.11 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... CONSUMER INFORMATION Popcorn Promotion, Research, and Consumer Information Order Definitions § 1215.11...

  12. 25 CFR 11.426 - Bribery.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Bribery. 11.426 Section 11.426 Indians BUREAU OF INDIAN... Criminal Offenses § 11.426 Bribery. (a) A person is guilty of bribery, a misdemeanor, if he or she offers... a person whom the actor sought to influence was not qualified to act in the desired way, whether...

  13. 5 CFR 1651.11 - Simultaneous death.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Simultaneous death. 1651.11 Section 1651.11 Administrative Personnel FEDERAL RETIREMENT THRIFT INVESTMENT BOARD DEATH BENEFITS § 1651.11 Simultaneous death. If a beneficiary dies at the same time as the participant, the beneficiary will be treated...

  14. 45 CFR 503.11 - Reports.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Reports. 503.11 Section 503.11 Public Welfare... Regulations § 503.11 Reports. (a) The Administrative Officer or designee will provide adequate advance notice... separately listed and reported to the Office of Management and Budget. ...

  15. 50 CFR 35.11 - Scientific uses.

    Science.gov (United States)

    2010-10-01

    ... NATIONAL WILDLIFE REFUGE SYSTEM WILDERNESS PRESERVATION AND MANAGEMENT General Rules § 35.11 Scientific uses. Recognizing the scientific value of wilderness, research data gathering and similar scientific... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Scientific uses. 35.11 Section 35.11...

  16. 36 CFR 261.11 - Sanitation.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Sanitation. 261.11 Section 261.11 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE PROHIBITIONS General Prohibitions § 261.11 Sanitation. The following are prohibited: (a) Depositing in any toilet...

  17. 42 CFR 9.11 - Animal transport.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Animal transport. 9.11 Section 9.11 Public Health... CHIMPANZEES HELD IN THE FEDERALLY SUPPORTED SANCTUARY SYSTEM § 9.11 Animal transport. The transportation of... and Regulations and the International Air Transport Association (IATA) Live Animal Regulations and...

  18. 12 CFR 404.11 - Administrative appeal.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Administrative appeal. 404.11 Section 404.11 Banks and Banking EXPORT-IMPORT BANK OF THE UNITED STATES INFORMATION DISCLOSURE Procedures for Disclosure of Records Under the Freedom of Information Act. § 404.11 Administrative appeal. (a) General...

  19. 25 CFR 11.908 - Court records.

    Science.gov (United States)

    2010-04-01

    ... INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Children's Court § 11.908 Court records. (a) A record of all hearings under §§ 11.900-11.1114 of this part shall be made and preserved. (b) All children's court records shall be confidential and shall not be...

  20. 37 CFR 11.52 - Discovery.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Discovery. 11.52 Section 11... Disciplinary Proceedings; Jurisdiction, Sanctions, Investigations, and Proceedings § 11.52 Discovery. Discovery... establishes that discovery is reasonable and relevant, the hearing officer, under such conditions as he or she...

  1. 7 CFR 985.11 - Salable oil.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Salable oil. 985.11 Section 985.11 Agriculture... HANDLING OF SPEARMINT OIL PRODUCED IN THE FAR WEST Order Regulating Handling Definitions § 985.11 Salable oil. Salable oil means that oil which is free to be handled. ...

  2. 45 CFR 16.11 - Hearing.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Hearing. 16.11 Section 16.11 Public Welfare... BOARD § 16.11 Hearing. (a) Electing a hearing. If the appellant believes a hearing is appropriate, the... appeal file). The Board will approve a request (and may schedule a hearing on its own or in response to a...

  3. 25 CFR 11.412 - Theft.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Theft. 11.412 Section 11.412 Indians BUREAU OF INDIAN... Criminal Offenses § 11.412 Theft. A person who, without permission of the owner, shall take, shoplift... thereto shall be guilty of theft, a misdemeanor. ...

  4. 38 CFR 3.11 - Homicide.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Homicide. 3.11 Section 3.11 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation General § 3.11 Homicide. Any person who has...

  5. 20 CFR 255.11 - Fault.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Fault. 255.11 Section 255.11 Employees... § 255.11 Fault. (a) Before recovery of an overpayment may be waived, it must be determined that the overpaid individual was without fault in causing the overpayment. If recovery is sought from other than the...

  6. 22 CFR 191.11 - Applicable benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 191.11 Section 191.11...' and Sailors' Civil Relief Act § 191.11 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50 U.S.C. App. 501, et seq...

  7. 22 CFR 19.11 - Survivor benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Survivor benefits. 19.11 Section 19.11 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR SPOUSES AND FORMER SPOUSES OF PARTICIPANTS IN THE FOREIGN SERVICE RETIREMENT AND DISABILITY SYSTEM § 19.11 Survivor benefits. ...

  8. 22 CFR 192.11 - Applicable benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 192.11 Section 192.11 Foreign Relations DEPARTMENT OF STATE HOSTAGE RELIEF VICTIMS OF TERRORISM COMPENSATION Payment of Salary and Other Benefits for Captive Situations § 192.11 Applicable benefits. (a) Captives are entitled to...

  9. 40 CFR 76.11 - Emissions averaging.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Emissions averaging. 76.11 Section 76.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) ACID RAIN NITROGEN OXIDES EMISSION REDUCTION PROGRAM § 76.11 Emissions averaging. (a) General...

  10. 29 CFR 2.11 - General principles.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true General principles. 2.11 Section 2.11 Labor Office of the Secretary of Labor GENERAL REGULATIONS Audiovisual Coverage of Administrative Hearings § 2.11 General principles. The following general principles will be observed in granting or denying requests for permission...

  11. 32 CFR 727.11 - Supervision.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 5 2010-07-01 2010-07-01 false Supervision. 727.11 Section 727.11 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY PERSONNEL LEGAL ASSISTANCE § 727.11 Supervision. The Judge Advocate General will exercise supervision over all legal assistance activities in the Department of the Navy. Subject to the...

  12. 43 CFR 11.21 - Emergency restorations.

    Science.gov (United States)

    2010-10-01

    ... Preassessment Phase § 11.21 Emergency restorations. (a) Reporting requirements and definition. (1) In the event of a natural resource emergency, the natural resource trustee shall contact the National Response... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Emergency restorations. 11.21 Section 11...

  13. 40 CFR 73.11 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false [Reserved] 73.11 Section 73.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) SULFUR DIOXIDE ALLOWANCE SYSTEM Allowance Allocations § 73.11 [Reserved] ...

  14. 25 CFR 11.601 - Marriage licenses.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Marriage licenses. 11.601 Section 11.601 Indians BUREAU... ORDER CODE Domestic Relations § 11.601 Marriage licenses. A marriage license shall be issued by the clerk of the court in the absence of any showing that the proposed marriage would be invalid under any...

  15. 46 CFR 160.171-11 - Performance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Performance. 160.171-11 Section 160.171-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Immersion Suits § 160.171-11 Performance. (a) Buoyancy. Each...

  16. 46 CFR 160.176-11 - Performance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Performance. 160.176-11 Section 160.176-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Inflatable Lifejackets § 160.176-11 Performance. (a) General...

  17. 49 CFR 397.11 - Fires.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Fires. 397.11 Section 397.11 Transportation Other... PARKING RULES General § 397.11 Fires. (a) A motor vehicle containing hazardous materials must not be operated near an open fire unless its driver has first taken precautions to ascertain that the vehicle can...

  18. 12 CFR 1402.11 - Current index.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Current index. 1402.11 Section 1402.11 Banks... the Farm Credit System Insurance Corporation § 1402.11 Current index. The Farm Credit System Insurance Corporation will make available for public inspection and copying a current index to provide identifying...

  19. 30 CFR 1.1 - Official emblem.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Official emblem. 1.1 Section 1.1 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR OFFICIAL EMBLEM AND OMB CONTROL NUMBERS... OFFICIAL EMBLEM § 1.1 Official emblem. The following emblem is established and shall be used as the...

  20. A SCN9A gene-encoded dorsal root ganglia sodium channel polymorphism associated with severe fibromyalgia

    Directory of Open Access Journals (Sweden)

    Vargas-Alarcon Gilberto

    2012-02-01

    Full Text Available Abstract Background A consistent line of investigation suggests that autonomic nervous system dysfunction may explain the multi-system features of fibromyalgia (FM; and that FM is a sympathetically maintained neuropathic pain syndrome. Dorsal root ganglia (DRG are key sympathetic-nociceptive short-circuit sites. Sodium channels located in DRG (particularly Nav1.7 act as molecular gatekeepers for pain detection. Nav1.7 is encoded in gene SCN9A of chromosome 2q24.3 and is predominantly expressed in the DRG pain-sensing neurons and sympathetic ganglia neurons. Several SCN9A sodium channelopathies have been recognized as the cause of rare painful dysautonomic syndromes such as paroxysmal extreme pain disorder and primary erythromelalgia. The aim of this study was to search for an association between fibromyalgia and several SCN9A sodium channels gene polymorphisms. Methods We studied 73 Mexican women suffering from FM and 48 age-matched women who considered themselves healthy. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ. Genomic DNA from whole blood containing EDTA was extracted by standard techniques. The following SCN9A single-nucleotide polymorphisms (SNP were determined by 5' exonuclease TaqMan assays: rs4371369; rs4387806; rs4453709; rs4597545; rs6746030; rs6754031; rs7607967; rs12620053; rs12994338; and rs13017637. Results The frequency of the rs6754031 polymorphism was significantly different in both groups (P = 0.036 mostly due to an absence of the GG genotype in controls. Interestingly; patients with this rs6754031 GG genotype had higher FIQ scores (median = 80; percentile 25/75 = 69/88 than patients with the GT genotype (median = 63; percentile 25/75 = 58/73; P = 0.002 and the TT genotype (median = 71; percentile 25/75 = 64/77; P = 0.001. Conclusion In this ethnic group; a disabling form of FM is associated to a particular SCN9A sodium channel gene variant. These preliminary results raise the possibility that

  1. Rapid labelling of radiopharmaceuticals using 11CO2 and 11CH4

    International Nuclear Information System (INIS)

    Crouzel, C.

    1988-07-01

    In the past two decades, much effort has been devoted to the development of new molecules, labelled with β+ emitters usable for Positron Emission Tomography. Gaseous forms of 11 C ( 11 CO 2 or 11 CH 4 ) must be converted to a reactive form known as a ''radioactive precursor'': 11 C-methanol, 11 C-formaldehyde, 11 C-acetone, 11 C-phosgene, 11 C-diazomethane, 11 C-methylamine. These precursors are used to label radiopharmaceuticals. Few examples are given: 11 C-prazosin, 11 C-CGP 12177, 11 C-pindolol. Such synthesis procedures require strong initial activity (1.5 Ci). The processes are therefore remotely controlled or automated, and confined to shielded cells. Small laboratory robots have lately been introduced for this type of production

  2. The new duty of care for nuclear power plant operators in Sec. 9a subpara. 2a AtG; Zur neuen Sorgepflicht der Kraftwerksbetreiber gem. paragraph 9a Abs. 2a AtG

    Energy Technology Data Exchange (ETDEWEB)

    Posser, Herbert [Freshfields Bruckhaus Deringer LLP, Duesseldorf (Germany)

    2014-07-15

    The new stipulation in Sec. 9a subpara. 2a AtG - pursuant to which operators of nuclear power plants are no longer entitled to use the interim storage facility in Gorleben for radioactive waste stemming from the reprocessing plants in Sellafield and La Hague, but have to establish further capacities in their own facilities for spent nuclear fuels at the site of the power plants - is illegal under constitutional law. It imposes an unproportional burden on the plant operators as well as on GNS, and infringes property rights without pursuing a legitimate purpose. (orig.)

  3. miR-9a mediates the role of Lethal giant larvae as an epithelial growth inhibitor in Drosophila

    Directory of Open Access Journals (Sweden)

    Scott G. Daniel

    2018-01-01

    Full Text Available Drosophila lethal giant larvae (lgl encodes a conserved tumor suppressor with established roles in cell polarity, asymmetric division, and proliferation control. Lgl's human orthologs, HUGL1 and HUGL2, are altered in human cancers, however, its mechanistic role as a tumor suppressor remains poorly understood. Based on a previously established connection between Lgl and Fragile X protein (FMRP, a miRNA-associated translational regulator, we hypothesized that Lgl may exert its role as a tumor suppressor by interacting with the miRNA pathway. Consistent with this model, we found that lgl is a dominant modifier of Argonaute1 overexpression in the eye neuroepithelium. Using microarray profiling we identified a core set of ten miRNAs that are altered throughout tumorigenesis in Drosophila lgl mutants. Among these are several miRNAs previously linked to human cancers including miR-9a, which we found to be downregulated in lgl neuroepithelial tissues. To determine whether miR-9a can act as an effector of Lgl in vivo, we overexpressed it in the context of lgl knock-down by RNAi and found it able to reduce the overgrowth phenotype caused by Lgl loss in epithelia. Furthermore, cross-comparisons between miRNA and mRNA profiling in lgl mutant tissues and human breast cancer cells identified thrombospondin (tsp as a common factor altered in both fly and human breast cancer tumorigenesis models. Our work provides the first evidence of a functional connection between Lgl and the miRNA pathway, demonstrates that miR-9a mediates Lgl's role in restricting epithelial proliferation, and provides novel insights into pathways controlled by Lgl during tumor progression.

  4. The new duty of care for nuclear power plant operators in Sec. 9a subpara. 2a AtG

    International Nuclear Information System (INIS)

    Posser, Herbert

    2014-01-01

    The new stipulation in Sec. 9a subpara. 2a AtG - pursuant to which operators of nuclear power plants are no longer entitled to use the interim storage facility in Gorleben for radioactive waste stemming from the reprocessing plants in Sellafield and La Hague, but have to establish further capacities in their own facilities for spent nuclear fuels at the site of the power plants - is illegal under constitutional law. It imposes an unproportional burden on the plant operators as well as on GNS, and infringes property rights without pursuing a legitimate purpose. (orig.)

  5. Effects of Designer Hyper-Interleukin 11 (H11 on Hematopoiesis in Myelosuppressed Mice.

    Directory of Open Access Journals (Sweden)

    Hanna Dams-Kozlowska

    Full Text Available The incidence of cancer is constantly increasing. Chemo/radiotherapy is one of major methods of treating cancer. Although adverse chemo/radiotherapy events, such as anemia and neutropenia, can be successfully cured, thrombocytopenia is still problematic. We constructed the Hyper-IL11 (H11 cytokine by linking soluble interleukin 11 receptor alpha (sIL-11Ralpha with IL-11. In vivo H11 activity was examined in myelosuppressed mice. Myelosuppression was induced by either i sublethal irradiation and carboplatin administration or ii sublethal irradiation. A dose of 100 μg/kg of H11 or IL-11 was administered subcutaneously for 7 days. IL-11 and H11 accelerated leukocyte, hematocrit and platelet recovery. The effect on the attenuation of thrombocytopenia was significant. Moreover, both cytokines increased the cellularity and numbers of megakaryocyte, erythroid, and granulocyte/macrophage progenitors in the bone morrow and spleen compared with the control. Although H11 was administered at a molar concentration that was three times lower, its effects were comparable with or better than those of IL-11; thus, the activity of H11 was superior to that of IL-11. Because no toxicity was observed after the intravenous administration of H11, this hyper-cytokine may be potentially useful for treatment of thrombocytopenia and other IL-11-dependent disorders.

  6. 26 CFR 11.412(c)-11 - Election with respect to bonds.

    Science.gov (United States)

    2010-04-01

    ... amount payable at maturity (or, in the case of a bond which is callable prior to maturity, the earliest... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Election with respect to bonds. 11.412(c)-11... OF 1974 § 11.412(c)-11 Election with respect to bonds. (a) In general. Section 412(c)(2)(B) provides...

  7. Industrial Exhibition “11th Germany at CERN“

    CERN Multimedia

    FP Department

    2010-01-01

    Administration Building (Bldg. 60/61) Tuesday 25 January: 11a.m. - 5.30 p.m. Wednesday 26 January: 9 a.m. - 5 p.m. The Federal Ministry of Education and Research (BMBF), together with CERN, will hold the Industrial Exhibition “11th Germany at CERN”. Some 30 German companies will present their latest products/technologies related to the field of particle physics and their services to the scientists and buyers of CERN, establish contacts and find out about future purchasing opportunities. On 25 January, Dr. B. Vierkorn-Rudolph of the Federal Ministry of Education and Research and CERN Director-General, Prof. R. D. Heuer, will open the exhibition, followed by a tour of the stands. The main subjects are: electrical engineering, electronics, informatics, mechanical engineering, vacuum & low temperature technologies, instrumentation and safety. CERN staff wishing to obtain information concerning the programme, the exhibitors and their profiles or to get in contact with exhibitors are r...

  8. Industrial Exhibition “11th Germany at CERN“

    CERN Multimedia

    FP Department

    2011-01-01

    Administration Building (Bldg. 60/61) Tuesday 25 January: 11a.m. - 5.30 p.m. Wednesday 26 January: 9 a.m. - 5 p.m. The Federal Ministry of Education and Research (BMBF), together with CERN, will hold the Industrial Exhibition “11th Germany at CERN”. Some 30 German companies will present their latest products/technologies related to the field of particle physics and their services to the scientists and buyers of CERN, establish contacts and find out about future purchasing opportunities. On 25 January, Dr. B. Vierkorn-Rudolph of the Federal Ministry of Education and Research and CERN Director-General, Prof. R. D. Heuer, will open the exhibition, followed by a tour of the stands. The main subjects are: electrical engineering, electronics, informatics, mechanical engineering, vacuum & low temperature technologies, instrumentation and safety. CERN staff wishing to obtain information concerning the programme, the exhibitors and their profiles or to get in contact with exhibitors are ...

  9. 7 CFR 201.11a - Hybrid.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Hybrid. 201.11a Section 201.11a Agriculture... REGULATIONS Labeling Agricultural Seeds § 201.11a Hybrid. If any one kind or kind and variety of seed present in excess of 5 percent is “hybrid” seed, it shall be designated “hybrid” on the label. The percentage...

  10. 16 CFR 1507.11 - Party poppers.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Party poppers. 1507.11 Section 1507.11... FIREWORKS DEVICES § 1507.11 Party poppers. Party poppers (also known by other names such as “Champagne Party Poppers,” and “Party Surprise Poppers,”) shall not contain more than 0.25 grains of pyrotechnic...

  11. 47 CFR 11.31 - EAS protocol.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false EAS protocol. 11.31 Section 11.31... characters. FM or TV call signs must use a slash ASCII character number 47 (/) in lieu of a dash. (c) The EAS... the State EAS Mapbook. FIPS# State: AL 01 AK 02 AZ 04 AR 05 CA 06 CO 08 CT 09 DE 10 DC 11 FL 12 GA 13...

  12. Automated photosynthesis of 11C-glucose

    International Nuclear Information System (INIS)

    Ishiwata, K.; Monma, M.; Iwata, R.; Ido, T.

    1982-01-01

    Glucose and fructose, labelled with 11 C, were produced by passing 11 CO 2 into an evacuated chamber containing spinach leaves. Photosynthesis was carried out by day light lamp illumination. 75-95% of the 11 CO 2 was absorbed by the leaves and the radioactivity in the leaves was extracted in ethanol as sugars. Radiochemical purity was determined by HPLC. The automated system was controlled by timers. (U.K.)

  13. 25 CFR 11.454 - Domestic violence.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Domestic violence. 11.454 Section 11.454 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Criminal Offenses § 11.454 Domestic violence. (a) A person who commits domestic violence by inflicting physical harm, bodily injury, or sexua...

  14. 25 CFR 11.1104 - Shelter care.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Shelter care. 11.1104 Section 11.1104 Indians BUREAU OF... Minor-in-Need-of-Care Procedure § 11.1104 Shelter care. (a) A minor alleged to be a minor-in-need-of-care may be detained, pending a court hearing, in the following places: (1) A foster care facility...

  15. 46 CFR 160.174-11 - Performance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Performance. 160.174-11 Section 160.174-11 Shipping...: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Thermal Protective Aids § 160.174-11 Performance. (a) Thermal... between −30 °C (−22 °F) and +65 C (149 °F). (d) In water performance. The thermal protective aid must be...

  16. Clec9a-Mediated Ablation of Conventional Dendritic Cells Suggests a Lymphoid Path to Generating Dendritic Cells In Vivo

    Directory of Open Access Journals (Sweden)

    Johanna Salvermoser

    2018-04-01

    Full Text Available Conventional dendritic cells (cDCs are versatile activators of immune responses that develop as part of the myeloid lineage downstream of hematopoietic stem cells. We have recently shown that in mice precursors of cDCs, but not of other leukocytes, are marked by expression of DNGR-1/CLEC9A. To genetically deplete DNGR-1-expressing cDC precursors and their progeny, we crossed Clec9a-Cre mice to Rosa-lox-STOP-lox-diphtheria toxin (DTA mice. These mice develop signs of age-dependent myeloproliferative disease, as has been observed in other DC-deficient mouse models. However, despite efficient depletion of cDC progenitors in these mice, cells with phenotypic characteristics of cDCs populate the spleen. These cells are functionally and transcriptionally similar to cDCs in wild type control mice but show somatic rearrangements of Ig-heavy chain genes, characteristic of lymphoid origin cells. Our studies reveal a previously unappreciated developmental heterogeneity of cDCs and suggest that the lymphoid lineage can generate cells with features of cDCs when myeloid cDC progenitors are impaired.

  17. 15 CFR 700.11 - Priority ratings.

    Science.gov (United States)

    2010-01-01

    ... OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE NATIONAL SECURITY INDUSTRIAL BASE REGULATIONS DEFENSE PRIORITIES AND ALLOCATIONS SYSTEM Industrial Priorities § 700.11 Priority ratings. (a) Levels of...

  18. 36 CFR 294.11 - Definition.

    Science.gov (United States)

    2010-07-01

    ... subsequent update or revision of those maps through the land management planning process. ... State Petitions for Inventoried Roadless Area Management § 294.11 Definition. Inventoried roadless areas...

  19. Synthesis of electrophilic 11C-synthons: 11C-cyanogen bromide and some 11C-cyano reagents

    International Nuclear Information System (INIS)

    Westerberg, G.; Malmborg, P.; Langstroem, B.

    1990-01-01

    A fast, simple, and reliable method has been developed for the synthesis of carbon-11 labelled cyanogen bromide and several of its stabilized amine salts or cyanates. Preparation of cyanogen bromide is by bromination (bromine gas) of carbon-11 labelled hydrocyanic acid, followed by reaction with a tertiary amine or a phenol to yield the ammonium salts or cyanates

  20. Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells

    Directory of Open Access Journals (Sweden)

    Sharma Shikhar

    2012-01-01

    Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.

  1. 9 CFR 4.11 - Stipulations.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Stipulations. 4.11 Section 4.11 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE RULES OF PRACTICE GOVERNING PROCEEDINGS UNDER THE ANIMAL WELFARE ACT Supplemental Rules of...

  2. 40 CFR 130.11 - Program management.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Program management. 130.11 Section 130... PLANNING AND MANAGEMENT § 130.11 Program management. (a) State agencies may apply for grants under sections 106, 205(j) and 205(g) to carry out water quality planning and management activities. Interstate...

  3. LANL FY11 activities(u)

    Energy Technology Data Exchange (ETDEWEB)

    Aragon, Ezekiel D [Los Alamos National Laboratory

    2011-01-06

    Briefings presenting W78 programmatic activities for FY11 and the status and plan for associated Hydro 3617, is included wherewith in support of the NNSA W78 Program Review Meetings scheduled for January 11 thru 13, 2011, at the Savannah River Plant, SC.

  4. 40 CFR 407.11 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 407.11 Section 407.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS CANNED AND PRESERVED FRUITS AND VEGETABLES PROCESSING POINT SOURCE CATEGORY Apple Juice...

  5. 12 CFR 1780.11 - Computing time.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Computing time. 1780.11 Section 1780.11 Banks... time. (a) General rule. In computing any period of time prescribed or allowed by this subpart, the date of the act or event that commences the designated period of time is not included. The last day so...

  6. 41 CFR 50-203.11 - Review.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Review. 50-203.11 Section...-Healey Public Contracts Act § 50-203.11 Review. (a) Within twenty (20) days after service of the decision... administrative law judge an original and four copies of a petition for review of the decision. The petition shall...

  7. 49 CFR 605.11 - Exemptions.

    Science.gov (United States)

    2010-10-01

    ...) That private school bus operators in the urban area are unable to provide adequate transportation, at a... 49 Transportation 7 2010-10-01 2010-10-01 false Exemptions. 605.11 Section 605.11 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT ADMINISTRATION, DEPARTMENT OF...

  8. 7 CFR 3016.11 - State plans.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false State plans. 3016.11 Section 3016.11 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND COOPERATIVE AGREEMENTS TO STATE AND LOCAL...

  9. 45 CFR 1203.11 - Judicial review.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Judicial review. 1203.11 Section 1203.11 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE... Judicial review. Action taken pursuant to section 602 of title VI is subject to judicial review as provided...

  10. Meeting March 11 / Rokas M. Tracevskis

    Index Scriptorium Estoniae

    Tracevskis, Rokas M.

    2010-01-01

    Leedus tähistatakse 11. märtsil 2010 iseseisvuse taastamise 20. aastapäeva. Vilniusesse saabuvatest külalistest, kelle seas on ka Eesti president Toomas Hendrik Ilves. Töövisiit Vilniusesse 11.03.2010

  11. 43 CFR 29.11 - Investment.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Investment. 29.11 Section 29.11 Public... Investment. (a) The monies accumulated in the Fund shall be prudently invested in the following types of... investment advisor or custodian to the Fund, or their affiliates may be purchased or held by the Fund. (3...

  12. 15 CFR 325.11 - Judicial review.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Judicial review. 325.11 Section 325.11 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE MISCELLANEOUS REGULATIONS EXPORT TRADE CERTIFICATES OF...

  13. 45 CFR 1201.11 - Authority.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Authority. 1201.11 Section 1201.11 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE PRODUCTION... Authority. The Corporation receives authority to change its governing regulations from the National and...

  14. 40 CFR 450.11 - General definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false General definitions. 450.11 Section 450.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND.... (a) New source. New source means any source, whose discharges are defined in 40 CFR 122.26(b)(14)(x...

  15. 43 CFR 11.14 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Definitions. 11.14 Section 11.14 Public Lands: Interior Office of the Secretary of the Interior NATURAL RESOURCE DAMAGE ASSESSMENTS Introduction... assessment means the process of collecting, compiling, and analyzing information, statistics, or data through...

  16. 18 CFR 801.11 - Public values.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Public values. 801.11... POLICIES § 801.11 Public values. (a) The basin has many points of archeological and historic interest, and... value of these areas cannot be measured simply in economic terms and will strive to preserve and promote...

  17. 28 CFR 11.2 - Pilot program.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Pilot program. 11.2 Section 11.2 Judicial... Pilot program. The Assistant Attorney General for Administration, in consultation with the Executive Office for United States Attorneys, shall designate the districts that will participate in the pilot...

  18. 44 CFR 68.11 - Determination.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Determination. 68.11 Section... § 68.11 Determination. The board shall render its written decision within 45 days after the conclusion... Administrator for review and approval. The Administrator shall make the final base flood elevation determination...

  19. 30 CFR 884.11 - State eligibility.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false State eligibility. 884.11 Section 884.11 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR....5 of this chapter within your jurisdiction. We may approve your proposed reclamation plan if you...

  20. 25 CFR 11.410 - Criminal mischief.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Criminal mischief. 11.410 Section 11.410 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND... he or she: (1) Damages tangible property of another purposely, recklessly, or by negligence in the...

  1. 48 CFR 536.570-11 - Heat.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Heat. 536.570-11 Section... OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Contract Clauses 536.570-11 Heat. Insert the clause at 552.236-80, Heat, in solicitations and contracts if construction, dismantling...

  2. 40 CFR 191.11 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... of spent nuclear fuel or high-level or transuranic radioactive wastes; (2) Radiation doses received... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Applicability. 191.11 Section 191.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS...

  3. 21 CFR 1308.11 - Schedule I.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Schedule I. 1308.11 Section 1308.11 Food and Drugs...) Mecloqualone 2572 (3) Methaqualone 2565 (f) Stimulants. Unless specifically excepted or unless listed in... following substances having a stimulant effect on the central nervous system, including its salts, isomers...

  4. 29 CFR 1604.11 - Sexual harassment.

    Science.gov (United States)

    2010-07-01

    ... employees, an employer is responsible for acts of sexual harassment in the workplace where the employer (or... the acts of non-employees, with respect to sexual harassment of employees in the workplace, where the... 29 Labor 4 2010-07-01 2010-07-01 false Sexual harassment. 1604.11 Section 1604.11 Labor...

  5. 20 CFR 602.11 - Secretary's interpretation.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Secretary's interpretation. 602.11 Section 602.11 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR QUALITY CONTROL... methods of administration as will reasonably ensure the prompt and full payment of unemployment benefits...

  6. 48 CFR 11.304 - Contract clause.

    Science.gov (United States)

    2010-10-01

    ... Section 11.304 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Acceptable Material 11.304 Contract clause. Insert the clause at 52.211-5, Material Requirements, in solicitations and contracts for supplies that are not commercial items. ...

  7. 22 CFR 142.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 142.11 Section 142... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Employment Practices § 142.11 Discrimination... discrimination in employment under any program or activity receiving Federal financial assistance. (2) A...

  8. 49 CFR 663.11 - Audit financing.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Audit financing. 663.11 Section 663.11 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT ADMINISTRATION... Audit financing. A recipient purchasing revenue rolling stock with FTA funds may charge the cost of...

  9. 7 CFR 1209.11 - Mushrooms.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Mushrooms. 1209.11 Section 1209.11 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209...

  10. 36 CFR 64.11 - Project performance.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Project performance. 64.11 Section 64.11 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR GRANTS... Project performance. The State or local applicant shall be responsible for insuring the project is carried...

  11. 46 CFR 98.33-11 - Smoking.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Smoking. 98.33-11 Section 98.33-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CARGO AND MISCELLANEOUS VESSELS SPECIAL CONSTRUCTION, ARRANGEMENT, AND OTHER PROVISIONS FOR CERTAIN DANGEROUS CARGOES IN BULK Portable Tanks for Certain Grade E Combustible Liquids and Other Regulated...

  12. 37 CFR 11.61 - Savings clause.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Savings clause. 11.61 Section... Disciplinary Proceedings; Jurisdiction, Sanctions, Investigations, and Proceedings § 11.61 Savings clause. (a... subsequent to such effective date, if such conduct would continue to justify suspension or exclusion under...

  13. 25 CFR 11.1010 - Adjudicatory hearing.

    Science.gov (United States)

    2010-04-01

    ... conduct the adjudicatory hearing for the sole purpose of determining the guilt or innocence of the minor. The hearing shall be private and closed. (b) All the rights listed in § 11.906 shall be afforded the... pursuant to § 11.1009. (c) If the minor admits the allegations of the petition, the children's court shall...

  14. 15 CFR 785.11 - Prehearing conference.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Prehearing conference. 785.11 Section 785.11 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE ADDITIONAL PROTOCOL REGULATIONS ENFORCEMENT § 785...

  15. 15 CFR 286.11 - Listings.

    Science.gov (United States)

    2010-01-01

    ..., e.g., printed directories, electronic bulletin boards, or other means to ensure accessibility by all... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Listings. 286.11 Section 286.11 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade NATIONAL INSTITUTE OF...

  16. 48 CFR 31.205-11 - Depreciation.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Depreciation. 31.205-11....205-11 Depreciation. (a) Depreciation on a contractor's plant, equipment, and other capital facilities... method of depreciation or the class life asset depreciation range system is used, the residual value need...

  17. 9 CFR 11.3 - Scar rule.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Scar rule. 11.3 Section 11.3 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL... inflammation, and, other bilateral evidence of abuse indicative of soring including, but not limited to...

  18. 16 CFR 1031.11 - Procedural safeguards.

    Science.gov (United States)

    2010-01-01

    ....11 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION GENERAL COMMISSION PARTICIPATION AND COMMISSION EMPLOYEE INVOLVEMENT IN VOLUNTARY STANDARDS ACTIVITIES Employee Involvement § 1031.11 Procedural... employees may be involved in voluntary standards activities that will further the objectives and programs of...

  19. 7 CFR 982.11 - Pack.

    Science.gov (United States)

    2010-01-01

    ... according to size, internal quality, and external appearance and condition of hazelnuts packed in accordance... 7 Agriculture 8 2010-01-01 2010-01-01 false Pack. 982.11 Section 982.11 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and...

  20. 16 CFR 1.1 - Policy.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Policy. 1.1 Section 1.1 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE GENERAL PROCEDURES Industry... substantial or novel question of fact or law and there is no clear Commission or court precedent; or (2) The...

  1. 31 CFR 210.11 - Limited liability.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Limited liability. 210.11 Section 210.11 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  2. 27 CFR 11.22 - Consignment sales.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Consignment sales. 11.22... OF THE TREASURY LIQUORS CONSIGNMENT SALES Unlawful Sales Arrangements § 11.22 Consignment sales. Consignment sales are arrangements wherein the trade buyer is under no obligation to pay for distilled spirits...

  3. 36 CFR 293.11 - Water rights.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Water rights. 293.11 Section...-PRIMITIVE AREAS § 293.11 Water rights. Nothing in the regulations in this part constitutes an expressed or implied claim or denial on the part of the Department of Agriculture as to exemption from State water laws. ...

  4. Synthesis of racemic [3-11C]phenylalanine and [3-11C] DOPA

    International Nuclear Information System (INIS)

    Halldin, C.; Laangstroem, B.

    1984-01-01

    The synthesis of racemic [3- 11 C]phenylalanine and [3- 11 C]DOPA is reported. The [ 11 C]benzaldehyde and [ 11 C]veratraldehyde prepared in a two-step reaction from the corresponding [ 11 C]acid salt and [ 11 C]alcohol, by means of selective oxidation with tetrabutylammonium hydrogen chromate, were reacted with 2-phenyl-5-oxazolone or 2-(4-chloro)phenyl-5-oxazolone in the presence of a tertiary amine to give the corresponding [α- 11 C]-4-arylene-2-aryl-5-oxazolones. Ring opening of these olefins, hydrogenation, and removal of protecting groups was carried out in one step using hydroiodic cid/phosphorus, with the production of the racemic [3- 11 C]amino acids in 8-30% radiochemical yield (starting with 11 CO 2 ) within 52-60 min (including LC separation). (author)

  5. CRISPR-Cas9, a tool to efficiently increase the development of recombinant African swine fever viruses.

    Science.gov (United States)

    Borca, Manuel V; Holinka, Lauren G; Berggren, Keith A; Gladue, Douglas P

    2018-02-16

    African swine fever virus (ASFV) causes a highly contagious disease called African swine fever. This disease is often lethal for domestic pigs, causing extensive losses for the swine industry. ASFV is a large and complex double stranded DNA virus. Currently there is no commercially available treatment or vaccine to prevent this devastating disease. Development of recombinant ASFV for producing live-attenuated vaccines or studying the involvement of specific genes in virus virulence has relied on the relatively rare event of homologous recombination in primary swine macrophages, causing difficulty to purify the recombinant virus from the wild-type parental ASFV. Here we present the use of the CRISPR-Cas9 gene editing system as a more robust and efficient system to produce recombinant ASFVs. Using CRISPR-Cas9 a recombinant virus was efficiently developed by deleting the non-essential gene 8-DR from the genome of the highly virulent field strain Georgia07 using swine macrophages as cell substrate.

  6. Enzymatic synthesis of 11C-pyruvic acid and 11C-L-lactic acid

    International Nuclear Information System (INIS)

    Cohen, M.B.; Spolter, L.; Chang, C.C.; Cook, J.S.; Macdonald, N.S.

    1980-01-01

    L-Lactic acid is formed as the end product of glycolysis under anaerobic conditions in all cells, but this reaction is of special significance in the myocardium. L-Lactic acid is reversibly formed from and is in equilibrium with myocardial pyruvic acid, which is its sole metabolic pathway. 11 C-Pyruvic acid is synthesized from 11 C carbon dioxide using pyruvate-ferredoxin oxidoreductase and coenzymes. The 11 C-pyruvic acid is then converted to 11 -L-lactic acid by lactic acid dehydrogenase. The availability of 11 C-pyruvic acid and 11 C-L-lactic acid will permit the in vivo investigation of lactate metabolism. (author)

  7. Identification and Characterization of CYP9A40 from the Tobacco Cutworm Moth (Spodoptera litura), a Cytochrome P450 Gene Induced by Plant Allelochemicals and Insecticides

    Science.gov (United States)

    Wang, Rui-Long; Staehelin, Christian; Xia, Qing-Qing; Su, Yi-Juan; Zeng, Ren-Sen

    2015-01-01

    Cytochrome P450 monooxygenases (P450s) of insects play crucial roles in the metabolism of endogenous and dietary compounds. Tobacco cutworm moth (Spodoptera litura), an important agricultural pest, causes severe yield losses in many crops. In this study, we identified CYP9A40, a novel P450 gene of S. litura, and investigated its expression profile and potential role in detoxification of plant allelochemicals and insecticides. The cDNA contains an open reading frame encoding 529 amino acid residues. CYP9A40 transcripts were found to be accumulated during various development stages of S. litura and were highest in fifth and sixth instar larvae. CYP9A40 was mainly expressed in the midgut and fat body. Larval consumption of xenobiotics, namely plant allelochemicals (quercetin and cinnamic acid) and insecticides (deltamethrin and methoxyfenozide) induced accumulation of CYP9A40 transcripts in the midgut and fat body. Injection of dsCYP9A40 (silencing of CYP9A40 by RNA interference) significantly increased the susceptibility of S. litura larvae to the tested plant allelochemicals and insecticides. These results indicate that CYP9A40 expression in S. litura is related to consumption of xenobiotics and suggest that CYP9A40 is involved in detoxification of these compounds. PMID:26393579

  8. Complete Genome Sequence of Amycolicicoccus subflavusDQS3-9A1T, an Actinomycete Isolated from Crude Oil-Polluted Soil ▿

    Science.gov (United States)

    Cai, Man; Chen, Wei-Min; Nie, Yong; Chi, Chang-Qiao; Wang, Ya-Nan; Tang, Yue-Qin; Li, Guo-Ying; Wu, Xiao-Lei

    2011-01-01

    Amycolicicoccus subflavusDQS3-9A1T, isolated from crude oil-polluted soil in the Daqing Oilfield in China, is a type strain of a newly published novel species in the novel genus Amycolicicoccus. Here we report the complete genome of DQS3-9A1Tand genes associated with oil-polluted environment. PMID:21725023

  9. Zinc finger protein 219-like (ZNF219L) and Sox9a regulate synuclein-γ2 (sncgb) expression in the developing notochord of zebrafish.

    Science.gov (United States)

    Lien, Huang-Wei; Yang, Chung-Hsiang; Cheng, Chia-Hsiung; Liao, Yung-Feng; Han, Yu-San; Huang, Chang-Jen

    2013-12-13

    Zebrafish synuclein-γ2 (sncgb) has been reported to be expressed specifically in the notochord. However, the mechanism by which the sncgb gene promoter is regulated has not been described. In this paper, we demonstrate that Zinc finger protein 219-like (ZNF219L) and sox9a are involved in the regulation of sncgb gene expression. Furthermore, we observed that over-expression of both ZNF219L and Sox9a resulted in increased sncgb expression. In addition, ZNF219L is physically associated with Sox9a, and simultaneous morpholino knockdown of znf219L and sox9a caused a synergistic decrease of sncgb expression in the notochord. Taken together, our results reveal that coordination of ZNF219L with Sox9a is involved in the regulation of notochord-specific expression of sncgb. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  10. 11 CFR 100.11 - State (2 U.S.C. 431(12)).

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false State (2 U.S.C. 431(12)). 100.11 Section 100.11 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) General Definitions § 100.11 State (2 U.S.C. 431(12)). State means each State of the United States, the District of...

  11. Routine production of H11CN and :11C:-1-aminocyclopentanecarboxylic acid

    International Nuclear Information System (INIS)

    Sambre, J.; Vandecasteele, C.; Geothals, P.; Rabi, N.A.; Haver, D. van; Slegers, G.

    1985-01-01

    The production of H 11 CN using the 14 N(p,α) 11 C reaction, was studied. The yield is 140 mCi/μA at saturation (EOB). From 1.8 Ci of H 11 CN 140 mCi of [ 11 C]ACPC are produced routinely and under remote-control. Chemical and pharmaceutical controls showed that the product is suitable for injection. (author)

  12. 11 CFR 102.11 - Petty cash fund (2 U.S.C. 432(h)(2)).

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Petty cash fund (2 U.S.C. 432(h)(2)). 102.11 Section 102.11 Federal Elections FEDERAL ELECTION COMMISSION GENERAL REGISTRATION, ORGANIZATION, AND... and Congressional district) sought by such candidate. ...

  13. 26 CFR 11.401(a)-11 - Qualified joint and survivor annuities.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Qualified joint and survivor annuities. 11.401... SECURITY ACT OF 1974 § 11.401(a)-11 Qualified joint and survivor annuities. (a) In general—(1) General rule... annuity (i.e., an annuity requiring survival of the participant or his spouse as a condition for payment...

  14. 10 CFR 300.11 - Independent verification.

    Science.gov (United States)

    2010-01-01

    ... DEPARTMENT OF ENERGY CLIMATE CHANGE VOLUNTARY GREENHOUSE GAS REPORTING PROGRAM: GENERAL GUIDELINES § 300.11... managing an auditing or verification process, including the recruitment and allocation of other individual.... (c) Qualifications of organizations accrediting verifiers. Organizations that accredit individual...

  15. 25 CFR 11.402 - Terroristic threats.

    Science.gov (United States)

    2010-04-01

    ... ORDER CODE Criminal Offenses § 11.402 Terroristic threats. A person is guilty of a misdemeanor if he or she threatens to commit any crime of violence with purpose to terrorize another or to cause evacuation...

  16. 11 Things to Know about Cerebral Palsy

    Science.gov (United States)

    ... Button Past Emails 11 Things to Know about Cerebral Palsy Language: English (US) Español (Spanish) Recommend on Facebook Tweet Share Compartir Cerebral palsy (CP) is the most common motor disability in ...

  17. 25 CFR 11.318 - Extradition.

    Science.gov (United States)

    2010-04-01

    ... Criminal Procedure § 11.318 Extradition. Any Court of Indian Offenses may order delivery to the proper..., the accused shall be accorded a right to contest the propriety of the court's order in a hearing...

  18. 'FIFA 11 for Health' for Europe. 1

    DEFF Research Database (Denmark)

    Fuller, Colin W; Ørntoft, Christina Øyangen; Larsen, Malte Nejst

    2017-01-01

    AIM: To modify the 'FIFA 11 for Health' programme to the European situation, and to assess its effects on health knowledge and well-being in Danish school children. METHOD: A two-cohort study with seven intervention and two control schools. Of the 546 Danish children (boys 269; girls 277) of mean...... age 11.1 (±0.4) years from five city and four country-side schools, 402 undertook the 'FIFA 11 for Health' programme and 144 acted as controls. As part of each school's PE curriculum, seven intervention schools received a 45 min Play Football period (football skills and 3 vs 3 games) and a 45 min Play...... negatively. CONCLUSIONS: The 'FIFA 11 for Health' programme modified for Europe demonstrated positive effects on children's health knowledge and social dimension of well-being, thereby providing evidence that the football-based health education programme can be used effectively within a European school...

  19. 40 CFR 444.11 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... from air pollution control systems and water used to quench flue gas or slag generated as a result of... 55. (11) Zinc means total zinc, Parameter 75. POTW means a publicly owned treatment works. ...

  20. 27 CFR 11.21 - General.

    Science.gov (United States)

    2010-04-01

    ... TREASURY LIQUORS CONSIGNMENT SALES Unlawful Sales Arrangements § 11.21 General. It is unlawful for an industry member to sell, offer for sale, or contract to sell to any trade buyer, or for any such trade...

  1. 27 CFR 11.3 - Application.

    Science.gov (United States)

    2010-04-01

    ... THE TREASURY LIQUORS CONSIGNMENT SALES Scope of Regulations § 11.3 Application. (a) General. The regulations in this part apply to transactions between industry members and trade buyers. (b) Transactions...

  2. BOREAS AFM-11 Aircraft Flux Analysis Reports

    Data.gov (United States)

    National Aeronautics and Space Administration — Reports from the BOREAS AFM-11 team regarding quality control and sampling analysis of data collected by other AFM personnel using the Electra, LongEZ, and Twin...

  3. Physics at the FQMT'11 conference

    NARCIS (Netherlands)

    Špička, V.; Nieuwenhuizen, T.M.; Keefe, P.D.

    2012-01-01

    This paper deals with the recent state of the art of the following topics presented at the FQMT’11 conference: foundations of quantum physics, quantum measurement; nonequilibrium quantum statistical physics; quantum thermodynamics; quantum measurement, entanglement and coherence; dissipation,

  4. 30 CFR 717.11 - General obligations.

    Science.gov (United States)

    2010-07-01

    ... construction, operation, and reclamation of shafts, adits, underground support facilities, underground mining... Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR INITIAL PROGRAM REGULATIONS UNDERGROUND MINING GENERAL PERFORMANCE STANDARDS § 717.11 General obligations. (a...

  5. USEEIO v1.1 - Matrices

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset provides the basic building blocks for the USEEIO v1.1 model and life cycle results per $1 (2013 USD) demand for all goods and services in the model in...

  6. 27 CFR 11.31 - General.

    Science.gov (United States)

    2010-04-01

    ... TREASURY LIQUORS CONSIGNMENT SALES Rules for the Return of Distilled Spirits, Wine, and Malt Beverages § 11... products, and outline the conditions and limitations for such returns. (b) An industry member is under no...

  7. 27 CFR 11.39 - Seasonal dealers.

    Science.gov (United States)

    2010-04-01

    ... OF THE TREASURY LIQUORS CONSIGNMENT SALES Rules for the Return of Distilled Spirits, Wine, and Malt Beverages Exchanges and Returns for Ordinary and Usual Commercial Reasons § 11.39 Seasonal dealers. Industry...

  8. γ spectroscopy of 11ΛB

    International Nuclear Information System (INIS)

    Miura, Y.; Ajimura, S.; Fujii, Y.; Fukuda, T.; Hashimoto, O.; Hotchi, H.; Imai, K.; Imoto, W.; Kakiguchi, Y.; Kameoka, S.; Krutenkova, A.; Maruta, T.; Matsumura, A.; Miwa, K.; Mizunuma, K.; Nakamura, S.N.; Nagae, T.; Nomura, H.; Noumi, H.; Outa, H.; Saha, P.K.; Saitoh, T.; Sato, Y.; Sekimoto, M.; Takahashi, T.; Tamura, H.; Tanida, K.; Toyoda, A.; Ukai, M.; Yamauchi, H.

    2005-01-01

    We have performed a γ spectroscopy experiment in 11 Λ B using a germanium detector array, Hyperball. In this experiment, we have observed six γ transitions from 11 Λ B. Among these transitions, the γ ray peak at 1482 keV is identified as E2 (1/2+->5/2+). The result of this experiment indicates that the level structure seems quite different from a theoretical prediction based on the results of the previous experiments

  9. PC 11: Symbiotic star or planetary nebulae?

    International Nuclear Information System (INIS)

    Gutierrez-Moreno, A.; Moreno, H.; Cortes, G.

    1987-01-01

    PC 11 is an object listed in Perek and Kohoutek (1967) Catalogue of Galactic Planetary Nebulae as PK 331 -5 0 1. Some authors suggest that it is not a planetary nebula, but that it has some characteristics (though not all) of symbiotic stars. We have made photographic, spectrophotometric and spectroscopic observations of PC 11. The analysis of the results suggests that it is a young planetary nebula. (Author)

  10. Structure of NaH/sub 2/As/sub 3/O/sub 9/: A new condensed arseniate anion

    Energy Technology Data Exchange (ETDEWEB)

    Driss, A.; Jouini, T.; Durif, A.; Averbuch-Pouchot, M.T.

    1988-09-15

    (NaH/sub 2/As/sub 3/O/sub 9/)/sub n/, M/sub r/=393.77, triclinic, Panti 1, a=7.167(1), b=7.575(1), c=7.850(1) A, ..cap alpha..=109.89(1), ..beta..=107.27(1), ..gamma..=106.15(1)/sup 0/, V=346.9 A/sup 3/, Z=2, D/sub m/=3.58, D/sub x/=3.77 g cm/sup -3/, F(000)=368, lambda(Mo K anti ..cap alpha..)=0.7107 A, ..mu..=142 cm/sup -1/, final R=0.034 and wR=0.039 for 1485 reflections with F > sigma(F). A new condensed arseniate anion is found. It consists of infinite (H/sub 2/As/sub 3/O/sub 9/)/sub n//sup n-/ chains built from As/sub 4/O/sub 14/ rings linked by bidentate bridging AsO/sub 4/ tetrahedra.

  11. Common variation at 1q24.1 (ALDH9A1 is a potential risk factor for renal cancer.

    Directory of Open Access Journals (Sweden)

    Marc Y R Henrion

    Full Text Available So far six susceptibility loci for renal cell carcinoma (RCC have been discovered by genome-wide association studies (GWAS. To identify additional RCC common risk loci, we performed a meta-analysis of published GWAS (totalling 2,215 cases and 8,566 controls of Western-European background with imputation using 1000 Genomes Project and UK10K Project data as reference panels and followed up the most significant association signals [22 single nucleotide polymorphisms (SNPs and 3 indels in eight genomic regions] in 383 cases and 2,189 controls from The Cancer Genome Atlas (TCGA. A combined analysis identified a promising susceptibility locus mapping to 1q24.1 marked by the imputed SNP rs3845536 (Pcombined =2.30x10-8. Specifically, the signal maps to intron 4 of the ALDH9A1 gene (aldehyde dehydrogenase 9 family, member A1. We further evaluated this potential signal in 2,461 cases and 5,081 controls from the International Agency for Research on Cancer (IARC GWAS of RCC cases and controls from multiple European regions. In contrast to earlier findings no association was shown in the IARC series (P=0.94; Pcombined =2.73x10-5. While variation at 1q24.1 represents a potential risk locus for RCC, future replication analyses are required to substantiate our observation.

  12. Psychometric Testing of the Personal Internet Gaming Disorder Evaluation-9: A New Measure Designed to Assess Internet Gaming Disorder.

    Science.gov (United States)

    Pearcy, Benjamin T D; Roberts, Lynne D; McEvoy, Peter M

    2016-05-01

    Internet Gaming Disorder (IGD) is in the early stages of recognition as a disorder, following its inclusion in the Diagnostic and Statistical Manual for Mental Disorders (DSM-5; American Psychiatric Association(1)) as a condition for further study. Existing measures of Internet gaming pathology are limited in their ability to measure IGD as defined in the DSM-5. We present the initial development and validation of a new measure derived from the proposed DSM-5 criteria for IGD, the Personal Internet Gaming Disorder Evaluation-9 (PIE-9). A student sample (n = 119) and a community sample (n = 285), sourced through a variety of online gaming forums, completed an online survey comprising the new measure, existing measures of IGD, and a range of health and demographic questions. Exploratory and confirmatory factor analysis supported a single factor structure for the 9-item PIE-9. Internal consistency (α = 0.89) and test-retest reliability (intraclass correlation [ICC] = 0.77) were high. Convergent validity was demonstrated with similar gaming addiction measures. Predictive validity was established through significant differences in distress and disability between those who met the criteria for IGD and those who did not. The distress and disability associated with meeting IGD criteria fell within the range of other common DSM-5 disorders. Preliminary testing of the PIE-9 has demonstrated that it is an efficient and straightforward measure for use in further research of IGD, and as a potential screening measure in clinical practice.

  13. Identification of T-cell epitopes of Lol p 9, a major allergen of ryegrass (Lolium perenne) pollen.

    Science.gov (United States)

    Blaher, B; Suphioglu, C; Knox, R B; Singh, M B; McCluskey, J; Rolland, J M

    1996-07-01

    T-cell recognition of Lol p 9, a major allergen of ryegrass pollen, was investigated by using a T-cell line and T-cell clones generated from the peripheral blood of an atopic donor. The T-cell line reacted with purified Lol p 9, as well as with crude ryegrass pollen extract, but failed to cross-react with Bermuda grass pollen extract. All of six T-cell clones generated from this line proliferated in response to Lol p 9. Epitope mapping was carried out with a panel of 34 overlapping synthetic peptides, which spanned the entire sequence of the Lol p 9 12R isoform. The T-cell line responded to two of the peptides, Lol p 9 (105-116) and Lol p 9 (193-204), whereas reactivity with one or other of these peptides was shown by five T-cell clones. These two peptides contained sequences consistent with motifs previously reported for major histocompatibility complex class II-restricted peptides. HLA antibody blocking studies showed that presentation of peptide Lol p 9 (105-116) to one T-cell clone was HLA-DR-restricted; this clone expressed a T helper cell phenotype (CD3+, CD4+) and the T-cell receptor alpha beta. The identification of immunodominant T-cell epitope(s) on allergens is essential for devising safer and more effective immunotherapy strategies, which can interrupt the chain of events leading to allergic disease.

  14. Recursos materiales para el desarrollo motor grueso en escolares de 6-9 años

    Directory of Open Access Journals (Sweden)

    José Manuel Cenizo Benjumea

    2017-11-01

    Full Text Available El objetivo de la investigación ha sido conocer los recursos materiales de educación física más eficaces para mejorar el desarrollo motor grueso del alumnado de 6 a 9 años, en función de su sexo y edad. La muestra de 982 escolares estuvo dividida en tres grupos experimentales según el tipo de material fungible y un grupo de control. Se empleó el test TGM-2, mediante un pretest y un postest tras una intervención de 14 sesiones. La diferencia de puntuaciones directas en los dos ámbitos (locomotor y control de objetos fue mayor en los grupos experimentales (p-valor<0,05. Dicha diferencia resulta más elevada con el uso de materiales alternativos, seguido de “solo balones” y “no balones” en ambos ciclos educativos y en los dos sexos, excepto para las niñas de segundo ciclo, donde los mejores resultados se producen en el grupo experimental de materiales “solo balones”.

  15. Carbon-11 in Bone and Lung Scanning

    Energy Technology Data Exchange (ETDEWEB)

    Myers, W. G.; Hunter, Jr., W. W. [Ohio State University Health Center, Columbus, OH (United States)

    1969-05-15

    Radiocarbon-11 decays with 20.3-min half-life by emitting positrons with 1.0-MeV maximum energy. Two 511-keV {sup {+-}}{gamma}-photons almost always are emitted coincidentally with each disintegration, at 180 Degree-Sign to each other. This 'back-to-back' relationship makes it possible readily to locate small accumulations of {sup 11}C in vivo by opposed detectors connected by coincidence circuitry. The calculated narrow-beam half-thickness in water is more than 7 cm, to provide good penetration from deep organs, and with little scatter. Multimillicurie amounts of a mixture of {sup 11}CO and {sup 11}CO{sub 2} are generated readily in our small cyclotron when probe targets of B{sub 2}O{sub 3} are bombarded with protons, deuterons, or {sup 3}He{sup ++} ions. The {sup 11}CO is oxidized to {sup 11}CO{sub 2} by hopcalite placed in the vacuum line. Dogs with primary or metastatic bone tumours received {sup 11}CO{sub 2}, either by inhalation in a closed system, or in slightly basic solution in travenously. Scintigraphs, that were obtained within 10-20 min by means of a Nuclear-Chicago focused-collimator scanning machine, revealed significant accumulations of {sup 11}C at sites where bone erosion was demonstrable roentgenographically. Good pictures of dog lungs were obtained either with the mechanical scanner, or with our Nuclear-Chicago scintillation camera, after intravenous injection of 4-12 {mu}m diam. smoothly-rounded aggregates of SrCO{sub 3} that were formed in dextran-saline solution. These 'photon-carrier' aggregates have been made either with {sup 11}C; or with 2.8-h {sup 87m}Sr, which emits 388-keV gamma-rays. Alternatively, they might be made to 'carry' the 231-keV gamma-rays of 70-m in {sup 85m}Sr, that are advantageous for scintigraphy. The advent of Anger's positron camera, with choice of plane of prime interest, will provide opportunities to emphasize the maximum target/nontarget ratio in pictures of localized accumulations of {sup 11}C, as well as of {sup

  16. EPICS release 3.11 specific documentation -- EPICS release notes for 3.11

    International Nuclear Information System (INIS)

    1994-01-01

    EPICS release 3.11 is now ready for user testing. A person who wants to set up a simplified application environment to boot an IOC and create databases using R3.11 should follow the directions in Appendix B, page 27, of the EPICS Source/Release Control Manual, Sept. 20, 1993. The R3.11 EPICS path at ANL/APS is /net/phebos/epics/R3.11 so the command to get the new release is /net/phebos/epics/R3.11/Unix/share/bin/getrel /net/phebos/epics/R3.11. An existing R3.8 short form report can be copied to this new directory and used to create a database. ANL/APS is currently testing an Application Developers Source/Release control system. It is not yet ready for general distribution. Attached are the EPICS R3.11 release notes

  17. CERN takes off at Lift11

    CERN Multimedia

    Katarina Anthony

    2011-01-01

    CERN was especially featured at the Lift11 conference, held in Geneva early this month. Tara Shears delivered a keynote speech at the event, while Paul Oortman Gerlings (DGS-SEE) and Erik van der Bij (BE-CO) – winners of the Bulletin’s Lift11 competition – organised the CERN workshop.   Paul Oortman Gerlings takes questions at CERN's Lift11 workshop. Lift11 was an opportunity for CERN to reach today’s innovators and developers. “The event was filled with people eager to learn new ideas, who were not afraid to ask questions,” says Tara Shears, physicist from the LHCb Collaboration who presented an update on the status of the LHC. “People were amazed by what goes on inside CERN, by our science, our facilities – even by the way we carry out our day-to-day work. It is a branch of fundamental research that really seems to inspire everyone.” A small Lift11 group had the chance to take a tour of CERN, ...

  18. Nuclear charge radius of {sup 11}Li

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez, Rodolfo, E-mail: R.Sanchez@GSI.de; Noertershaeuser, Wilfried [Gesellschaft fuer Schwerionenforschung (Germany); Dax, Andreas [CERN(Switzerland); Ewald, Guido; Goette, Stefan; Kirchner, Reinhard; Kluge, H.-Juergen; Kuehl, Thomas [Gesellschaft fuer Schwerionenforschung (Germany); Wojtaszek, Agnieszka [Swietokrzyska Academy, Institute of Physics (Poland); Bushaw, Bruce A. [Pacific Northwest National Laboratory (United States); Drake, Gordon W. F. [University of Windsor, Department of Physics (Canada); Yan Zongchao [University of New Brunswick, Department of Physics (Canada); Zimmermann, Claus [Physikalisches Institut, Eberhard Karls Universitaet Tuebingen (Germany); Albers, Daniel; Behr, John; Bricault, Pierre; Dilling, Jens; Dombsky, Marik; Lassen, Jens; Phil Levy, C. D. [Tri-University Meson Facility (Canada)

    2006-07-15

    We have determined the nuclear charge radius of {sup 11}Li by high-precision laser spectroscopy. The experiment was performed at the TRIUMF-ISAC facility where the {sup 7}Li-{sup 11}Li isotope shift (IS) was measured in the 2s{yields}3s electronic transition using Doppler-free two-photon spectroscopy with a relative accuracy better than 10{sup -5}. The accuracy for the IS of the other lithium isotopes was also improved. IS's are mainly caused by differences in nuclear mass, but changes in proton distribution also give small contributions. Comparing experimentally measured IS with advanced atomic calculation of purely mass-based shifts, including QED and relativistic effects, allows derivation of the nuclear charge radii. The radii are found to decrease monotonically from {sup 6}Li to {sup 9}Li, and then increase with {sup 11}Li about 11% larger than {sup 9}Li. These results are a benchmark for the open question as to whether nuclear core excitation by halo neutrons is necessary to explain the large nuclear matter radius of {sup 11}Li; thus, the results are compared with a number of nuclear structure models.

  19. Nuclear charge radius of 11Li

    International Nuclear Information System (INIS)

    Sanchez, Rodolfo; Noertershaeuser, Wilfried; Dax, Andreas; Ewald, Guido; Goette, Stefan; Kirchner, Reinhard; Kluge, H.-Juergen; Kuehl, Thomas; Wojtaszek, Agnieszka; Bushaw, Bruce A.; Drake, Gordon W. F.; Yan Zongchao; Zimmermann, Claus; Albers, Daniel; Behr, John; Bricault, Pierre; Dilling, Jens; Dombsky, Marik; Lassen, Jens; Phil Levy, C. D.

    2006-01-01

    We have determined the nuclear charge radius of 11 Li by high-precision laser spectroscopy. The experiment was performed at the TRIUMF-ISAC facility where the 7 Li- 11 Li isotope shift (IS) was measured in the 2s → 3s electronic transition using Doppler-free two-photon spectroscopy with a relative accuracy better than 10 -5 . The accuracy for the IS of the other lithium isotopes was also improved. IS's are mainly caused by differences in nuclear mass, but changes in proton distribution also give small contributions. Comparing experimentally measured IS with advanced atomic calculation of purely mass-based shifts, including QED and relativistic effects, allows derivation of the nuclear charge radii. The radii are found to decrease monotonically from 6 Li to 9 Li, and then increase with 11 Li about 11% larger than 9 Li. These results are a benchmark for the open question as to whether nuclear core excitation by halo neutrons is necessary to explain the large nuclear matter radius of 11 Li; thus, the results are compared with a number of nuclear structure models.

  20. Crystal structure of the disintegrin heterodimer from saw-scaled viper (Echis carinatus) at 1.9 A resolution.

    Science.gov (United States)

    Bilgrami, Sameeta; Yadav, Savita; Kaur, Punit; Sharma, Sujata; Perbandt, Markus; Betzel, Christian; Singh, Tej P

    2005-08-23

    Disintegrins constitute a family of potent polypeptide inhibitors of integrins. Integrins are transmembrane heterodimeric molecules involved in cell-cell and cell-extracellular matrix interactions. They are involved in many diseases such as cancer and thrombosis. Thus, disintegrins have a great potential as anticancer and antithrombotic agents. A novel heterodimeric disintegrin was isolated from the venom of saw-scaled viper (Echis carinatus) and was crystallized. The crystals diffracted to 1.9 A resolution and belonged to space group P4(3)2(1)2. The data indicated the presence of a pseudosymmetry. The structure was solved by applying origin shifts to the disintegrin homodimer schistatin solved in space group I4(1)22 with similar cell dimensions. The structure refined to the final R(cryst)/R(free) factors of 0.213/0.253. The notable differences are observed between the loops, (Gln39-Asp48) containing the important Arg42-Gly43-Asp44, of the present heterodimer and schistatin. These differences are presumably due to the presence of two glycines at positions 43 and 46 that allow the molecule to adopt variable conformations. A comparative analysis of the surface-charge distributions of various disintegrins showed that the charge distribution on monomeric disintegrins occurred uniformly over the whole surface of the molecule, while in the dimeric disintegrins, the charge is distributed only on one face. Such a feature may be important in the binding of two integrins to a single dimeric disintegrin. The phylogenetic analysis developed on the basis of amino acid sequence and three-dimensional structures indicates that the protein diversification and evolution presumably took place from the medium disintegrins and both the dimeric and short disintegrins evolved from them.

  1. Blogging 9/11 and Memory Discourse

    Directory of Open Access Journals (Sweden)

    Maria Cristina Paganoni

    2011-09-01

    This article highlights a few of the salient discursive and linguistic patterns that recur in the 9/11 narratives that have multiplied online on several dedicated websites and investigates the evolution of 9/11 cultural memory practices, torn between the discourse of the unrepresentable and the imperative to remember. It claims that blogging 9/11, immediately after the attacks and over the years, well illustrates how the logic of memory and its interpretation of the past follow different criteria from history writing. It shows how memorialization practices, dictated by the fear of forgetting the vanishing present, contribute to that excess of memory that lies at the core of the instability and mutual competition of sources retrieved on the Internet and that might ultimately lead to a rethinking of what is the contribution of collective memory to historiography.

  2. Quality control of 11C-carfentanil

    International Nuclear Information System (INIS)

    Zhang Xiaojun; Zhang Jinming; Tian Jiahe; Xiang Xiaohui

    2013-01-01

    To study the quality control of 11 C-Carfentanil injection, physical, chemical and biological identification were used. The chemical and radiochemical purity of 11 C-Carfentanil Injection were detected by HPLC and Flower Count system; measured the quantity of product by LC-MS, specific activity was calculated later; The PTS was used to detect endotoxin, and other quality control methods were put up to guarantee the security of its clinical application. The produce appeared colorless and transparent, the radiochemical purity was more than 98%, content of the endotoxin was less than 5 EU/mL. The result showed that 11 C-Carfentanil injection had fulfilled pharmaceutical quality control request and could be applied safely to animal experiment and clinical diagnosis. (authors)

  3. Tri-State Synfuels Project Review: Volume 9A. Subcontract information. [Proposed Henderson, Kentucky coal to gasoline plant; water supply and civil engineering subcontracts

    Energy Technology Data Exchange (ETDEWEB)

    1982-06-01

    Volume 9A considers subcontract work done at the site involving hydrogeological studies with respect to water supply and geotechnical work with respect to the building foundations necessary based on boreholes drilled and the lithology of the area. (LTN)

  4. Verification report for SIMREP 1.1

    International Nuclear Information System (INIS)

    Tarapore, P.S.

    1987-06-01

    SIMREP 1.1 is a discrete event computer simulation of repository operations in the surface waste-handling facility. The logic for this model is provided by Fluor Technology, Inc., the Architect/Engineer of the salt repository. The verification methods included a line-by-line review of the code, a detailed examination of a generated trace of all simulated events over a given period of operations, and a comparison of the simulation output results with expected values. SIMREP 1.1 performs in the required manner under the given range of input conditions

  5. Abastecimiento y saneamiento del Sector 11

    OpenAIRE

    Bellido Martín, Álvaro

    2009-01-01

    [ES] El presente proyecto tiene por objeto definir y valorar las obras necesarias para poder llevar a cabo el Abastecimiento y Saneamiento del Sector 11(R9-D) de Castellanos de Moriscos, de acuerdo con las normativas técnicas y de medio ambiente, así como la normativa urbanística municipal. [EN] This project aims to define and assess the work required to carry out the Supply and Sanitation Sector 11 (R9-D) of Castellanos de Moriscos, in accordance with technical standards and env...

  6. Oracle Goldengate 11g complete cookbook

    CERN Document Server

    Gupta, Ankur

    2013-01-01

    Oracle Goldengate 11g Complete Cookbook follows the Cookbook style. Each recipe provides step by step instructions with various examples and scripts. This book provides the necessary information to successfully complete most of the possible administration tasks.Oracle Goldengate 11g Complete Cookbook is aimed at Database Administrators, Architects, and Middleware Administrators who are keen to know more about Oracle Goldengate. Whether you are handling Goldengate environments on a day-to-day basis, or using it just for migration, this book provides the necessary information required to success

  7. Optical absorption spectra of Ag-11 isomers

    DEFF Research Database (Denmark)

    Martinez, Jose Ignacio; Fernandez, E. M.

    2009-01-01

    The optical absorption spectra of the three most; stable structural isomers of the Ag-11 cluster were calculated using the time-dependent, density functional theory within the Casida formalism. The slightly different, spectra, of the isomers may permit the identification of the ground-stale confi......The optical absorption spectra of the three most; stable structural isomers of the Ag-11 cluster were calculated using the time-dependent, density functional theory within the Casida formalism. The slightly different, spectra, of the isomers may permit the identification of the ground...

  8. Benchmark Imagery FY11 Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Pope, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2011-06-14

    This report details the work performed in FY11 under project LL11-GS-PD06, “Benchmark Imagery for Assessing Geospatial Semantic Extraction Algorithms.” The original LCP for the Benchmark Imagery project called for creating a set of benchmark imagery for verifying and validating algorithms that extract semantic content from imagery. More specifically, the first year was slated to deliver real imagery that had been annotated, the second year to deliver real imagery that had composited features, and the final year was to deliver synthetic imagery modeled after the real imagery.

  9. Automated radiochemical synthesis and biodistribution of [11C]l-α-acetylmethadol ([11C]LAAM)

    International Nuclear Information System (INIS)

    Sai, Kiran Kumar Solingapuram; Fan, Jinda; Tu, Zhude; Zerkel, Patrick; Mach, Robert H.; Kharasch, Evan D.

    2014-01-01

    Long-acting opioid agonists methadone and l-α-acetylmethadol (LAAM) prevent withdrawal in opioid-dependent persons. Attempts to synthesize [ 11 C]-methadone for PET evaluation of brain disposition were unsuccessful. Owing, however, to structural and pharmacologic similarities, we aimed to develop [ 11 C]LAAM as a PET ligand to probe the brain exposure of long-lasting opioids in humans. This manuscript describes [ 11 C]LAAM synthesis and its biodistribution in mice. The radiochemical synthetic strategy afforded high radiochemical yield, purity and specific activity, thereby making the synthesis adaptable to automated modules. - Highlights: • Radiochemical synthesis of opioid [ 11 C]l-α-acetylmethadol (LAAM) described for the first time. • High radiochemical yield, purity and specific activity. • Easily reproducible and adaptable synthesis to any C-11 automated modules. • [ 11 C]LAAM utility as a PET radiopharmaceutical for assessing brain penetration

  10. Characterization of a Rab11-like GTPase, EhRab11, of Entamoeba histolytica.

    Science.gov (United States)

    McGugan, Glen C; Temesvari, Lesly A

    2003-07-01

    The Entamoeba histolytica Rab11 family of small molecular weight GTPases consists of three members, EhRab11, EhRab11B, and EhRab11C. The functions of these Rabs in Entamoeba have not been determined. Therefore, as an approach to elucidate the role of the Rab11 family of GTPases in Entamoeba, immunofluorescence microscopy was undertaken to define the subcellular localization of one member of this family, EhRab11. Under conditions of growth, EhRab11 displayed a punctate pattern in the cytoplasm of trophozoites. EhRab11 did not colocalize with markers for the Golgi apparatus, endoplasmic reticulum, pinosomes, phagosomes, or compartments formed by receptor-mediated endocytosis, suggesting that this Rab may not play a role in vesicle trafficking between these organelles. Under conditions of iron and serum starvation, EhRab11 was translocated to the periphery of the cell. The altered cellular localization was accompanied by multinucleation of the cells as well as the acquisition of detergent resistance by the cells, features that are characteristic of Entamoeba cysts. The translocation of EhRab11 to the periphery of the cell during iron and serum starvation was specific as the subcellular localizations of two other Rab GTPases, EhRab7 and EhRabA, were not altered under the same conditions. In addition, the formation of multinucleated cells by inhibition of cytokinesis was not sufficient to induce the translocation of EhRab11 to the cell periphery. Taken together, the data suggest that iron and serum starvation may induce encystation in E. histolytica and that EhRab11 may play a role in this process. Moreover, these studies are the first to describe a putative role for a Rab GTPase in encystation in Entamoeba sp.

  11. Mass of 11Li from the 1H(11Li,9Li)3H reaction

    International Nuclear Information System (INIS)

    Roger, T.; Savajols, H.; Mittig, W.; Caamano, M.; Roussel-Chomaz, P.; Tanihata, I.; Alcorta, M.; Bandyopadhyay, D.; Bieri, R.; Buchmann, L.; Davids, B.; Galinski, N.; Howell, D.; Mills, W.; Mythili, S.; Openshaw, R.; Padilla-Rodal, E.; Ruprecht, G.; Sheffer, G.; Shotter, A. C.

    2009-01-01

    The mass of 11 Li has been determined from Q-value measurements of the 1 H( 11 Li, 9 Li) 3 H reaction. The experiment was performed at TRIUMF laboratory with the GANIL active target MAYA. Energy-energy and angle-angle kinematics reconstruction give a Q value of 8.119(22) MeV for the reaction. The derived 11 Li two-neutron separation energy is S 2n =363(22) keV

  12. EPICS release 3.11.6 specific documentation -- Release notes for EPICS 3.11.6

    International Nuclear Information System (INIS)

    1994-01-01

    These notes cover the following: (1) directions for switching to production APS release R3.11.6; (2) unbundling of channel access clients; (3) access security; (4) channel access additions; synchronous time support; and (5) description of major differences between R3.11.3 and R3.11.6 Also included is a list of new and/or updated documentation for the program

  13. A study of 11C-acetate production using 11C-choline commercial module

    International Nuclear Information System (INIS)

    Zhang Jinming; Tian Jiahe; Yao Shulin; Chen Yan

    2008-01-01

    Objective: 11 C-acetate is a useful PET tracer in evaluating myocardial metabolism but more interest has been focused on its application in tumor detection in recent years, especially hepatocellular carcinoma (HCC). This study was designed to evaluate the laboratory, preparation of 11 C-acetate with a modified 11 C-choline commercial module and to investigate its biodistribution in tumor (lung adenocarcinoma)-bearing mice as well as its potential as a tumor imaging agent. Methods: 11 C-acetate was synthesized with a modified 11 C choline module: Methyl magnesium bromide Grignard (0.1 ml of 1.5 mol/L) was load- ed to a Teflon loop before 11 CO 2 was recovered from the target. Cartier acetate solution (2 ml of 1 mmol/L) was pushed through the loop, SPE cartridges (mixed AG50 and IC-Ag) and then the QMA. The loop and cartridges were then rinsed with water. The product 11 C-acetate was then washed out from QMA with 0.9% NaCl solution into a collection vial containing diluted HCl. 11 C-carbonate was removed by nitrogen bubbling for 2 min. After neutralization with trisodium citrate, the injectable 11 C-acetate solution was obtained. The tumor-bearing mice were sacrificed. The percentage activity of injected dose per gram of tissue (% ID/g) for tumor and other tissues were calculated. One patient with known diagnosis of moderately differentiated HCC was injected with 11 C-acetate and imaged by PET/CT, followed by 18 F-fluorodeoxyglucose (FDG). Results: The synthesis yield of 11 C-acetate was (60.5 ± 8.7)% (decay conected, n=10); the radio-chemistry purity was > 98% and the synthesis time was 10 min from 11 CO 2 to 11 C-acetate. The radioactivity ratio for tumor/muscle was 1.76 at 30 min. A patient with known HCC showed positive 11 C-acetate accumulation in the tumor but was negative in 18 F-FDG. Conclusion: The synthesis of 11 C-acetate by modification of an 11 C-choline commercial module was feasible and it could be achieved with high yield, high radiochemical purity

  14. Carbon-11 labelling of an inhibitor of acetylcholinesterase: [11C]physostigmine

    International Nuclear Information System (INIS)

    Bonnot-Lours, S.; Crouzel, C.; Prenant, C.; Hinnen, F.

    1993-01-01

    Physostigmine, an alkaloid from calabar bean is a strong inhibitor of acetylcholinesterase and has been used clinically in the treatment of glaucoma, atropine intoxication, myasthenia gravis and more recently, in experimental trials in Alzheimer's disease. In order to study the AChE activity in the brain by positron emission tomography, we have undertaken the labelling of physostigmine with carbon-11. The synthesis involves the reaction of [ 11 C]methylisocyanate with eseroline. [ 11 C]Methylisocyanate was obtained by heating [ 11 C]acetylchloride with tetrabutylammonium azide in toluene. The synthesis of [ 11 C]CH 3 COC1 involves the carbonation of methylmagnesium bromide in THF with cyclotron produced [ 11 C]carbon dioxide and the addition of phthaloyl dichloride. The [ 11 C]methylisocyanate is distilled into a solution of eseroline in ether with a small piece of sodium. After 10 minutes at 25 o C, the solution is purified by HPLC and the appropriate fraction collected. Starting with 55.5 GBq (1.5 Ci) of [ 11 C]carbon dioxide, 0.92-1.48 GBq (25-40 mCi) of [ 11 C]Physostigmine are obtained 57 minutes after EOB. (author)

  15. Carbon-11 labelling of an inhibitor of acetylcholinesterase: [[sup 11]C]physostigmine

    Energy Technology Data Exchange (ETDEWEB)

    Bonnot-Lours, S.; Crouzel, C.; Prenant, C.; Hinnen, F. (CEA, 91 - Orsay (France). Service Hospitalier Frederic Joliot)

    1993-01-01

    Physostigmine, an alkaloid from calabar bean is a strong inhibitor of acetylcholinesterase and has been used clinically in the treatment of glaucoma, atropine intoxication, myasthenia gravis and more recently, in experimental trials in Alzheimer's disease. In order to study the AChE activity in the brain by positron emission tomography, we have undertaken the labelling of physostigmine with carbon-11. The synthesis involves the reaction of [[sup 11]C]methylisocyanate with eseroline. [[sup 11]C]Methylisocyanate was obtained by heating [[sup 11]C]acetylchloride with tetrabutylammonium azide in toluene. The synthesis of [[sup 11]C]CH[sub 3]COC1 involves the carbonation of methylmagnesium bromide in THF with cyclotron produced [[sup 11]C]carbon dioxide and the addition of phthaloyl dichloride. The [[sup 11]C]methylisocyanate is distilled into a solution of eseroline in ether with a small piece of sodium. After 10 minutes at 25[sup o]C, the solution is purified by HPLC and the appropriate fraction collected. Starting with 55.5 GBq (1.5 Ci) of [[sup 11]C]carbon dioxide, 0.92-1.48 GBq (25-40 mCi) of [[sup 11]C]Physostigmine are obtained 57 minutes after EOB. (author).

  16. 30 CFR 14.11 - Revocation.

    Science.gov (United States)

    2010-07-01

    ... MINING PRODUCTS REQUIREMENTS FOR THE APPROVAL OF FLAME-RESISTANT CONVEYOR BELTS General Provisions § 14.11 Revocation. (a) MSHA may revoke for cause an approval issued under this Part if the conveyor belt... a conveyor belt poses an imminent danger to the safety or health of miners, an approval may be...

  17. New floristic records in the Balkans: 11

    DEFF Research Database (Denmark)

    2009-01-01

    -50, 59-61, 70, 71, 79, 80), Berberidaceae (62), Brassicaceae (17, 27, 35), Campanulaceae (3, 4, 42-44), Caryophyllaceae (5, 28, 72, 81), Commelinaceae (22), Crassulaceae (29), Fabaceae (7-10, 36, 51-58, 63, 82, 83), Geraniaceae (18), Guttiferae (73), Iridaceae (31-33), Lamiaceae (74), Liliaceae s.l. (11...

  18. Paving the Way for Apollo 11

    CERN Document Server

    Harland, David M

    2009-01-01

    In 'Paving the Way for Apollo 11' David Harland explains the lure of the Moon to classical philosophers, astronomers, and geologists, and how NASA set out to investigate the Moon in preparation for a manned lunar landing mission. It focuses particularly on the Lunar Orbiter and Surveyor missions.

  19. African Health Sciences - Vol 11 (2011)

    African Journals Online (AJOL)

    Evaluation of oxidative status in patients with Fasciola hepatica infection · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. H Karsen, M Sunnetcioglu, RM Ceylan, M Bayraktar, A Taskin, N Aksoy, R Erten, 14-19. http://dx.doi.org/10.4314/ahs.v11i3.70064 ...

  20. 11 CFR 300.35 - Office buildings.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Office buildings. 300.35 Section 300.35 Federal... FUNDS State, District, and Local Party Committees and Organizations § 300.35 Office buildings. (a) General provision. For the purchase or construction of its office building, a State or local party...

  1. 29 CFR 4050.11 - Limitations.

    Science.gov (United States)

    2010-07-01

    ... missing participants. (b) Limitation on benefit value. The total actuarial present value of all benefits... Relating to Labor (Continued) PENSION BENEFIT GUARANTY CORPORATION PLAN TERMINATIONS MISSING PARTICIPANTS § 4050.11 Limitations. (a) Exclusive benefit. The benefits provided for under this part will be the only...

  2. 48 CFR 11.107 - Solicitation provision.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Solicitation provision. 11... transaction-based reporting method to report its use of voluntary consensus standards to the National... Use of Voluntary Consensus Standards and in Conformity Assessment Activities”). Use of the provision...

  3. Vacuum state supersymmetry in d=11 supergravity

    International Nuclear Information System (INIS)

    Vasilevich, D.V.

    1987-01-01

    Supersymmetry of vacuum state in d=11 supergravity is considered. Proceeding on sufficiently general assumptions relatively superformation parameter only Freud-Rubin type solutions may possess supersymmetries. To obtain this result no restrictions on the form of superformation parameter, supealgebra of vacuum global supersymmetry and the form of boson fields were imposed

  4. Postdisaster Psychological Intervention since 9/11

    Science.gov (United States)

    Watson, Patricia J.; Brymer, Melissa J.; Bonanno, George A.

    2011-01-01

    A wealth of research and experience after 9/11 has led to the development of evidence-based and evidence-informed guidelines and strategies to support the design and implementation of public mental health programs after terrorism and disaster. This article reviews advances that have been made in a variety of areas, including development of…

  5. Search Results | Page 11 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 101 - 110 of 163 ... ... Growth and Economic Opportunities for Women 11 Apply Growth and ... Adapting to Water Stress in the Comahue Region of Argentina. Climate change is expected to lead to decreases in annual precipitation for the ... The city of Cape Town is facing the dual challenge of redressing the legacy ...

  6. 'FIFA 11 for Health' for Europe. II:

    DEFF Research Database (Denmark)

    Ørntoft, Christina Øyangen; Fuller, Colin W; Larsen, Malte Nejst

    2016-01-01

    carried out 2 weekly 45 min ‘FIFA 11 for Health’ sessions focusing on health issues, football skills and 3v3 games. CG continued regular school PE activities. Measurements of body composition, blood pressure at rest, Yo-Yo intermittent recovery level 1 children’s test (YYIR1C), balance, jump and sprint......Objectives To evaluate whether a modified ‘FIFA 11 for Health’ programme for non-communicable diseases had effects on body composition, blood pressure and physical fitness of Danish schoolchildren aged 10–12 years. Design A cluster-randomised controlled study with 7 intervention and 2 control...... schools. Participants 546 Danish 5th grade municipal schoolchildren allocated to an intervention group (IG; n=402: 11.1±0.4 (±SD) years, 150.1±7.0 cm, 41.3±8.4 kg) and a control group (CG; n=144: 11.0±0.5 years, 151.2±7.8 cm, 41.3±9.0 kg). Intervention As part of the physical education (PE) curriculum, IG...

  7. 24 CFR 3500.11 - Mailing.

    Science.gov (United States)

    2010-04-01

    ... REAL ESTATE SETTLEMENT PROCEDURES ACT § 3500.11 Mailing. The provisions of this part requiring or... obtained by the lender or settlement agent, except that a revised address shall be used where the lender or settlement agent has been expressly informed in writing of a change in address. ...

  8. Sibelius. Karelia Suite, Op. 11 / Robert Layton

    Index Scriptorium Estoniae

    Layton, Robert

    1996-01-01

    Uuest heliplaadist "Sibelius. Karelia Suite, Op. 11. Luonnotar, Op. 70 a. Andante festivo. The Oceanides, Op. 73. King Christian II, Op. 27-Suite. Finlandia, Op. 26a. Gothenburg Symphony Orchester, Neeme Järvi" DG 447 760-2GH (72 minutes: DDD)

  9. 25 CFR 11.605 - Dissolution.

    Science.gov (United States)

    2010-04-01

    ... Domestic Relations § 11.605 Dissolution. (a) The Court of Indian Offenses shall enter a decree of... supported by evidence that (i) the parties have lived separate and apart for a period of more than 180 days..., or provided for child custody, the support of any child entitled to support, the maintenance of...

  10. 32 CFR 11.5 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... nature or characterization of the conflict, but the nexus to it. This element does not require a... armed conflict which, by their nature, location, purpose, or use, effectively contribute to the opposing... BY MILITARY COMMISSION § 11.5 Definitions. (a) Combatant immunity. Under the law of armed conflict...

  11. 11 CFR 9409.9 - Final determination.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Final determination. 9409.9 Section 9409.9... INFORMATION AND PRODUCTION OF OFFICIAL RECORDS IN LEGAL PROCEEDINGS § 9409.9 Final determination. The General Counsel will make the final determination on demands and requests to employees for production of official...

  12. 30 CFR 282.11 - Director's authority.

    Science.gov (United States)

    2010-07-01

    ... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR Jurisdiction and Responsibilities of Director § 282.11 Director's authority. (a) In the exercise of jurisdiction under § 282.10, the Director is... of two or more OCS mineral leases or portions of two or more OCS mineral leases into a single mining...

  13. 30 CFR 740.11 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... jurisdiction. (e) This subchapter shall not apply to surface coal mining and reclamation operations within a... Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR FEDERAL LANDS PROGRAM GENERAL REQUIREMENTS FOR SURFACE COAL MINING AND RECLAMATION OPERATIONS ON FEDERAL LANDS § 740.11...

  14. 33 CFR 279.11 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.11 Responsibilities. Division engineers will... preparation to insure timely compliance on development of resource use objectives. Future budget submissions and expenditures of construction and operation and maintenance funds will be reviewed by division...

  15. Specific and social phobias in ICD-11

    NARCIS (Netherlands)

    Emmelkamp, P.M.G.

    2012-01-01

    The purpose of this article is to discuss the current status of research with respect to specific phobias and social phobia as defined in the ICD-10 and DSM-IV, and to provide op- tions for their classification in the ICD-11. Both ICD-10 and DSM-IV identify three main classes of phobias: specific

  16. 7 CFR 1610.11 - Prepayments.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) RURAL TELEPHONE BANK, DEPARTMENT OF AGRICULTURE LOAN POLICIES § 1610.11 Prepayments. (a) Bank loans approved before November 1, 1993, may be prepaid in... prepay part or all of a Bank loan made on or after November 1, 1993, by paying the outstanding principal...

  17. 11 CFR 100.82 - Bank loans.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Bank loans. 100.82 Section 100.82 Federal... Contributions § 100.82 Bank loans. (a) General provisions. A loan of money to a political committee or a candidate by a State bank, a federally chartered depository institution (including a national bank) or a...

  18. 11 CFR 100.142 - Bank loans.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Bank loans. 100.142 Section 100.142 Federal... Expenditures § 100.142 Bank loans. (a) General provisions. Repayment of a loan of money to a candidate or a political committee by a State bank, a federally chartered depository institution (including a national bank...

  19. 48 CFR 11.701 - Supply contracts.

    Science.gov (United States)

    2010-10-01

    ... DESCRIBING AGENCY NEEDS Variation in Quantity 11.701 Supply contracts. (a) A fixed-price supply contract may authorize Government acceptance of a variation in the quantity of items called for if the variation is... items in a fixed-price contract, within allowable variations, if any. If a contractor delivers a...

  20. Physics at the FQMT'11 conference

    Czech Academy of Sciences Publication Activity Database

    Špička, Václav; Nieuwenhuizen, T.M.; Keefe, P.D.

    T151, Nov (2012), 1-16 ISSN 0031-8949 R&D Projects: GA ČR GAP204/12/0897 Institutional research plan: CEZ:AV0Z10100521 Keywords : foundations of quantum physics * statistical physics * quantum measurement * review * FQMT'11 conference Subject RIV: BE - Theoretical Physics Impact factor: 1.032, year: 2012

  1. 29 CFR 1620.11 - Fringe benefits.

    Science.gov (United States)

    2010-07-01

    ... Relating to Labor (Continued) EQUAL EMPLOYMENT OPPORTUNITY COMMISSION THE EQUAL PAY ACT § 1620.11 Fringe... unlawful for an employer to discriminate between men and women performing equal work with regard to fringe... spouses or families of employees of one gender where the same benefits are not made available for the...

  2. Lithuania celebrates March 11 / Rokas M. Tracevskis

    Index Scriptorium Estoniae

    Tracevskis, Rokas M.

    2011-01-01

    11. märtsil tähistati Leedus iseseisvuse taastamise 21. aastapäeva. President Dalia Grybauskaite oli sellel ajal Brüsselis, kus toimus Euroopa Liidu valitsusjuhtide ja riigipeade erakorraline kriisikohtumine Liibüa teemal. Vilniuses toimunud meeleavaldustest

  3. 7 CFR 1767.11 - Purpose.

    Science.gov (United States)

    2010-01-01

    ..., business and affairs of the borrower in accordance with the methods and principles of accounting of this... (CONTINUED) ACCOUNTING REQUIREMENTS FOR RUS ELECTRIC BORROWERS Uniform System of Accounts § 1767.11 Purpose...A for electric borrowers and by providing accounting methodologies and procedures which are...

  4. USEEIOv1.1 - openLCA

    Data.gov (United States)

    U.S. Environmental Protection Agency — This is a version of the full USEEIO v1.1 model in the openLCA schema serialized as JSON-LD that can be imported into openLCA software (www.openlca.org) v1.5 and...

  5. 28 CFR 81.11 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... Administration DEPARTMENT OF JUSTICE (CONTINUED) CHILD ABUSE AND CHILD PORNOGRAPHY REPORTING DESIGNATIONS AND PROCEDURES Child Pornography Reporting Designations and Procedures § 81.11 Purpose. The regulations in this... pornography that are forwarded from the National Center for Missing and Exploited Children under the...

  6. 11 CFR 9032.1 - Authorized committee.

    Science.gov (United States)

    2010-01-01

    ... behalf of the candidate who authorized the committee cannot qualify as an independent expenditure. (e) A..., authorized committee means with respect to candidates (as defined at 11 CFR 9032.2) seeking the nomination of... candidate to solicit or receive contributions or to incur expenditures on behalf of the candidate. The term...

  7. Final Technical Report, 11 Jan 2013

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ineke Buskens

    2013-01-11

    Jan 11, 2013 ... sub-projects in MENA focused on a wide range of ICTs and involved a wide variety of different ..... groundedness, reliability and applicability of their contributions. ..... “Yet even within this container, open sharing between the ...

  8. Notes on Loricata (Mollusca) 11-14

    NARCIS (Netherlands)

    Kaas, P.

    1985-01-01

    Four new species of chitons (Mollusca, Polyplacophora) are described, viz Leptochiton (L.) dispersus and L. (L.) permodestus from Transkei, L. (L.) meiringae from the eastern Cape Province, S Africa (note 11) and Ischnochiton (Stenosemus) vanbellei from the Mediterranean Sea (note 14). New records

  9. Search Results | Page 11 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Remove Project filter Project; Reports 46 Apply Reports filter · Papers 27 Apply Papers filter · Research in Action 11 Apply Research in Action filter · Journal articles 6 Apply Journal articles filter · Evaluations 5 Apply Evaluations filter · Studies 3 Apply Studies filter · Grants and Awards 2 Apply Grants and Awards filter ...

  10. 48 CFR 11.302 - Policy.

    Science.gov (United States)

    2010-10-01

    ... virgin material is vital for safety or meeting performance requirements of the contract. (b)(1) When....302 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Acceptable Material 11.302 Policy. (a) Agencies must not require virgin material or...

  11. 11 CFR 6.110 - Evaluation.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Evaluation. 6.110 Section 6.110 Federal... OR ACTIVITIES CONDUCTED BY THE FEDERAL ELECTION COMMISSION § 6.110 Evaluation. (a) Within one year of... persons, including handicapped persons and organizations representing handicapped persons, and evaluation...

  12. 22 CFR 217.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 217.11 Section 217... Discrimination prohibited. (a) General. (1) No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or activity to which this part applies. (2) A...

  13. 11 CFR 9038.1 - Audit.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Audit. 9038.1 Section 9038.1 Federal Elections... EXAMINATIONS AND AUDITS § 9038.1 Audit. (a) General. (1) The Commission will conduct an audit of the qualified... primary matching funds. The audit may be conducted at any time after the date of the candidate's...

  14. SPOKEN AYACUCHO QUECHUA, UNITS 11-20.

    Science.gov (United States)

    PARKER, GARY J.; SOLA, DONALD F.

    THE ESSENTIALS OF AYACUCHO GRAMMAR WERE PRESENTED IN THE FIRST VOLUME OF THIS SERIES, SPOKEN AYACUCHO QUECHUA, UNITS 1-10. THE 10 UNITS IN THIS VOLUME (11-20) ARE INTENDED FOR USE IN AN INTERMEDIATE OR ADVANCED COURSE, AND PRESENT THE STUDENT WITH LENGTHIER AND MORE COMPLEX DIALOGS, CONVERSATIONS, "LISTENING-INS," AND DICTATIONS AS WELL…

  15. 18 CFR 4.11 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 4.11 Section 4... Reports. Representatives of the Commission will inspect the project works, engineering reports, and other... report of their findings with respect to the inventory, appraisal, original cost, accrued depreciation...

  16. 40 CFR 439.11 - Special definitions.

    Science.gov (United States)

    2010-07-01

    ... STANDARDS PHARMACEUTICAL MANUFACTURING POINT SOURCE CATEGORY Fermentation Products § 439.11 Special definitions. For the purpose of this subpart: (a) Fermentation means process operations that utilize a... occurring in unicellular plants such as yeast, molds, or fungi to produce a specified product. (b) Product...

  17. 47 CFR 11.32 - EAS Encoder.

    Science.gov (United States)

    2010-10-01

    ... Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL EMERGENCY ALERT SYSTEM (EAS) Equipment Requirements § 11... operation. (vi) Indicator Display. The encoder shall be provided with a visual and/or aural indicator which... to +50 degrees C and a range of relative humidity of up to 95%. (c) Primary Supply Voltage Variation...

  18. 25 CFR 11.1114 - Termination.

    Science.gov (United States)

    2010-04-01

    ... Minor-in-Need-of-Care Procedure § 11.1114 Termination. (a) Parental rights to a child may be terminated... rights if, following efforts to prevent or eliminate the need to remove the minor, it finds such efforts... alternatives: (1) If parental rights to a child are terminated, the children's court shall place the minor in a...

  19. 30 CFR 795.11 - Assistance funding.

    Science.gov (United States)

    2010-07-01

    ... Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR SMALL OPERATOR ASSISTANCE PERMANENT REGULATORY PROGRAM-SMALL OPERATOR ASSISTANCE PROGRAM § 795.11 Assistance... eligible small operators if available funds are less than those required to provide the services pursuant...

  20. 11 CFR 6.140 - Employment.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Employment. 6.140 Section 6.140 Federal... OR ACTIVITIES CONDUCTED BY THE FEDERAL ELECTION COMMISSION § 6.140 Employment. No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any...

  1. 40 CFR 503.11 - Special definitions.

    Science.gov (United States)

    2010-07-01

    ... land with indigenous vegetation. (n) Reclamation site is drastically disturbed land that is reclaimed... FOR THE USE OR DISPOSAL OF SEWAGE SLUDGE Land Application § 503.11 Special definitions. (a) Agricultural land is land on which a food crop, a feed crop, or a fiber crop is grown. This includes range land...

  2. 11 CFR 100.154 - Candidate debates.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.154 Section 100.154 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.154 Candidate debates. Funds used to defray costs incurred in staging candidate debates in...

  3. 11 CFR 100.92 - Candidate debates.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.92 Section 100.92 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Contributions § 100.92 Candidate debates. Funds provided to defray costs incurred in staging candidate debates...

  4. 40 CFR 435.11 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... daily values for 30 consecutive days means the average of the daily values obtained during any 30... of organic compounds in digested sludge—Method by measurement of the biogas production (1995 edition... 51. Copies may be obtained from the American National Standards Institute, 11 West 42nd Street, 13th...

  5. 25 CFR 11.910 - Expungement.

    Science.gov (United States)

    2010-04-01

    ... INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Children's Court § 11.910 Expungement. When a minor who has been the subject of any proceeding before the children's court attains his or her twenty-first birthday, the children's court magistrate shall order the...

  6. 25 CFR 11.911 - Appeal.

    Science.gov (United States)

    2010-04-01

    ... AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Children's Court § 11.911 Appeal. (a) For purposes of appeal, a record of the proceedings shall be made... the party seeking the appeal. (b) Any party to a children's court hearing may appeal a final order or...

  7. 25 CFR 11.905 - Jurisdiction.

    Science.gov (United States)

    2010-04-01

    ... INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Children's Court § 11.905 Jurisdiction. The children's court has exclusive, original jurisdiction of the... established is alleged to be a juvenile offender, unless the children's court transfers jurisdiction to the...

  8. 25 CFR 11.900 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Children's Court § 11.900 Definitions. For purposes of sections pertaining to the children's court: (a..., (2) A person 18 years of age or older concerning whom proceedings are commenced in the children's...

  9. 25 CFR 11.903 - Presenting officer.

    Science.gov (United States)

    2010-04-01

    ... OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Children's Court § 11.903 Presenting officer. (a) The agency superintendent and the chief magistrate of the children's court shall jointly appoint a presenting officer to carry out the duties and...

  10. 29 CFR 1977.11 - Testimony.

    Science.gov (United States)

    2010-07-01

    ... Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) DISCRIMINATION AGAINST EMPLOYEES EXERCISING RIGHTS UNDER THE WILLIAMS-STEIGER OCCUPATIONAL SAFETY AND HEALTH ACT... Act is also prohibited by section 11(c). This protection would of course not be limited to testimony...

  11. The Danish 22q11 research initiative

    DEFF Research Database (Denmark)

    Schmock, Henriette; Vangkilde, Anders; Larsen, Kit Melissa

    2015-01-01

    mechanisms may come from studies of subjects with homogenous etiologies. Breakthroughs in psychiatric genetics have shown that several genetic anomalies predispose for neurodevelopmental brain disorders. We have established a Danish research initiative to study the common microdeletion at chromosome 22q11...

  12. 36 CFR 9.11 - Reclamation requirements.

    Science.gov (United States)

    2010-07-01

    ... MINERALS MANAGEMENT Mining and Mining Claims § 9.11 Reclamation requirements. (a) As contemporaneously as... within the time specified in an approved mining reclamation plan, unless a longer period is authorized in... topsoil necessary for vegetative restoration; and (vi) Reestablishing native vegetative communities. (b...

  13. September 11, Neo-liberalism and Discourse

    DEFF Research Database (Denmark)

    Holmgreen, Lise-Lotte

    2006-01-01

    of British financial news reports is analysed. This corpus covers the two-month period before and after the September-11 attacks and illustrates the extent to which economic ideology (neo-liberalism) and socio-economic change (the terrorist attacks) influence the choice of metaphor, and hence...

  14. 28 CFR 545.11 - Procedures.

    Science.gov (United States)

    2010-07-01

    ... Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT WORK AND COMPENSATION Inmate Financial Responsibility Program § 545.11 Procedures. When an inmate has a financial obligation, unit staff shall help that inmate develop a financial plan and shall monitor the inmate's...

  15. The IEEE 802.11a standards

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. The IEEE 802.11a standards. Provides higher data rate and system capacities and uses OFDM in Physical Layer to mitigate the multi path effects;. Supports multiple 20Mhz channel. Each channel being an OFDM Modulated;; 52 Carriers. 48 data carrier; 4 Carry pilot ...

  16. 11 CFR 9003.2 - Candidate certifications.

    Science.gov (United States)

    2010-01-01

    ... funds under 11 CFR 9003.2(c)(3) shall not count against such candidate's $50,000 expenditure limitation... expenditures. (8) Expenditures made using a credit card for which the candidate is jointly or solely liable will count against the limits of this section to the extent that the full amount due, including any...

  17. 18 CFR 11.16 - Filing requirements.

    Science.gov (United States)

    2010-04-01

    ... ACT Charges for Headwater Benefits § 11.16 Filing requirements. (a) Applicability. (1) Any party subject to a headwater benefits determination under this subpart must supply project-specific data, in... are attributable to the annual costs of interest, maintenance, and depreciation, identifying the...

  18. APOLLO 11 COMMANDER NEIL ARMSTRONG IN SIMULATOR

    Science.gov (United States)

    1969-01-01

    Apollo 11 commander Neil Armstrong is going through flight training in the lunar module simulator situated in the flight crew training building at KSC. Armstrong will pilot the lunar module to a moon landing on July 20, following launch from KSC on July 16.

  19. 12 CFR 370.11 - Enforcement mechanisms.

    Science.gov (United States)

    2010-01-01

    ... TEMPORARY LIQUIDITY GUARANTEE PROGRAM § 370.11 Enforcement mechanisms. (a) Termination of Participation. If... participate in the temporary liquidity guarantee program, the FDIC will inform the entity that it will no longer be provided the protections of the temporary liquidity guarantee program. (1) Termination of...

  20. 11 CFR 9007.7 - Administrative record.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Administrative record. 9007.7 Section 9007.7 Federal Elections FEDERAL ELECTION COMMISSION PRESIDENTIAL ELECTION CAMPAIGN FUND: GENERAL ELECTION... properly subject to privileges such as an attorney-client privilege, or items constituting attorney work...

  1. 11 CFR 1.14 - Specific exemptions.

    Science.gov (United States)

    2010-01-01

    ... to refer apparent violations of the Act to the Attorney General or other law enforcement authorities... 11 Federal Elections 1 2010-01-01 2010-01-01 false Specific exemptions. 1.14 Section 1.14 Federal Elections FEDERAL ELECTION COMMISSION PRIVACY ACT § 1.14 Specific exemptions. (a) No individual, under the...

  2. 15 CFR 990.11 - Scope.

    Science.gov (United States)

    2010-01-01

    ... ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE OIL POLLUTION ACT REGULATIONS NATURAL RESOURCE DAMAGE ASSESSMENTS Introduction § 990.11 Scope. The Oil Pollution Act of 1990 (OPA), 33 U.S.C. 2701 et seq., provides for the designation of federal, state, and, if designated by the Governor of the state, local...

  3. 49 CFR 11.107 - IRB membership.

    Science.gov (United States)

    2010-10-01

    ... Transportation Office of the Secretary of Transportation PROTECTION OF HUMAN SUBJECTS § 11.107 IRB membership. (a..., to promote respect for its advice and counsel in safeguarding the rights and welfare of human... individuals who are knowledgeable about and experienced in working with these subjects. (b) Every...

  4. 25 CFR 11.315 - Sentencing.

    Science.gov (United States)

    2010-04-01

    ... shall allow him or her a reasonable period of time to pay the entire sum or allow him or her to make.... If the offender defaults on such payments the court may find him or her in contempt of court and imprison him or her accordingly. [58 FR 54411, Oct. 21, 1993, as amended at 73 FR 39861, July 11, 2008] ...

  5. 40 CFR 434.11 - General definitions.

    Science.gov (United States)

    2010-07-01

    ... General Provisions § 434.11 General definitions. (a) The term “acid or ferruginous mine drainage” means mine drainage which, before any treatment, either has a pH of less than 6.0 or a total iron... processes within a coal preparation plant. (h) The term “mine drainage” means any drainage, and any water...

  6. The chemistry of 1,1-dithiolates

    DEFF Research Database (Denmark)

    Henriksen, Lars; Autrup, Herman

    1970-01-01

    The reaction of dipotassium 2-nitroethylene-1,1-dithiolate (III) with α-halogeno aldehydes or ketones leads to derivatives of 3-nitro-thiophene-2-thiols. These reactions proceed by an acid catalyzed cyclization of the initially formed 1-(acylmethylthio)-2-nitroethylene-1-thiolates (IV). The infra...

  7. Ghana Mining Journal - Vol 11 (2010)

    African Journals Online (AJOL)

    Symbolism of umat's emblem, flag and ceremonial mace - conglomeration of the university's essence and aspirations · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. M.F Annku, D Mireku-Gyimah. http://dx.doi.org/10.4314/gm.v11i1.53275 ...

  8. Neuronal RING finger protein 11 (RNF11 regulates canonical NF-κB signaling

    Directory of Open Access Journals (Sweden)

    Pranski Elaine L

    2012-04-01

    Full Text Available Abstract Background The RING domain-containing protein RING finger protein 11 (RNF11 is a member of the A20 ubiquitin-editing protein complex and modulates peripheral NF-κB signaling. RNF11 is robustly expressed in neurons and colocalizes with a population of α-synuclein-positive Lewy bodies and neurites in Parkinson disease patients. The NF-κB pathway has an important role in the vertebrate nervous system, where the absence of NF-κB activity during development can result in learning and memory deficits, whereas chronic NF-κB activation is associated with persistent neuroinflammation. We examined the functional role of RNF11 with respect to canonical NF-κB signaling in neurons to gain understanding of the tight association of inflammatory pathways, including NF-κB, with the pathogenesis of neurodegenerative diseases. Methods and results Luciferase assays were employed to assess NF-κB activity under targeted short hairpin RNA (shRNA knockdown of RNF11 in human neuroblastoma cells and murine primary neurons, which suggested that RNF11 acts as a negative regulator of canonical neuronal NF-κB signaling. These results were further supported by analyses of p65 translocation to the nucleus following depletion of RNF11. Coimmunoprecipitation experiments indicated that RNF11 associates with members of the A20 ubiquitin-editing protein complex in neurons. Site-directed mutagenesis of the myristoylation domain, which is necessary for endosomal targeting of RNF11, altered the impact of RNF11 on NF-κB signaling and abrogated RNF11’s association with the A20 ubiquitin-editing protein complex. A partial effect on canonical NF-κB signaling and an association with the A20 ubiquitin-editing protein complex was observed with mutagenesis of the PPxY motif, a proline-rich region involved in Nedd4-like protein interactions. Last, shRNA-mediated reduction of RNF11 in neurons and neuronal cell lines elevated levels of monocyte chemoattractant protein 1 and

  9. MD-11 PCA - Research flight team photo

    Science.gov (United States)

    1995-01-01

    On Aug. 30, 1995, a the McDonnell Douglas MD-11 transport aircraft landed equipped with a computer-assisted engine control system that has the potential to increase flight safety. In landings at NASA Dryden Flight Research Center, Edwards, California, on August 29 and 30, the aircraft demonstrated software used in the aircraft's flight control computer that essentially landed the MD-11 without a need for the pilot to manipulate the flight controls significantly. In partnership with McDonnell Douglas Aerospace (MDA), with Pratt & Whitney and Honeywell helping to design the software, NASA developed this propulsion-controlled aircraft (PCA) system following a series of incidents in which hydraulic failures resulted in the loss of flight controls. This new system enables a pilot to operate and land the aircraft safely when its normal, hydraulically-activated control surfaces are disabled. This August 29, 1995, photo shows the MD-11 team. Back row, left to right: Tim Dingen, MDA pilot; John Miller, MD-11 Chief pilot (MDA); Wayne Anselmo, MD-11 Flight Test Engineer (MDA); Gordon Fullerton, PCA Project pilot; Bill Burcham, PCA Chief Engineer; Rudey Duran, PCA Controls Engineer (MDA); John Feather, PCA Controls Engineer (MDA); Daryl Townsend, Crew Chief; Henry Hernandez, aircraft mechanic; Bob Baron, PCA Project Manager; Don Hermann, aircraft mechanic; Jerry Cousins, aircraft mechanic; Eric Petersen, PCA Manager (Honeywell); Trindel Maine, PCA Data Engineer; Jeff Kahler, PCA Software Engineer (Honeywell); Steve Goldthorpe, PCA Controls Engineer (MDA). Front row, left to right: Teresa Hass, Senior Project Management Analyst; Hollie Allingham (Aguilera), Senior Project Management Analyst; Taher Zeglum, PCA Data Engineer (MDA); Drew Pappas, PCA Project Manager (MDA); John Burken, PCA Control Engineer.

  10. 11 CFR 110.11 - Communications; advertising; disclaimers (2 U.S.C 441d).

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Communications; advertising; disclaimers (2 U.S... AND EXPENDITURE LIMITATIONS AND PROHIBITIONS § 110.11 Communications; advertising; disclaimers (2 U.S... through radio or television, or through any broadcast, cable, or satellite transmission, must comply with...

  11. 44 CFR 11.11 - Administrative claim; when presented; appropriate FEMA office.

    Science.gov (United States)

    2010-10-01

    ... Federal Tort Claims Act § 11.11 Administrative claim; when presented; appropriate FEMA office. (a) For the purpose of this part, and the provisions of the Federal Tort Claims Act a claim is deemed to have been... Administrator of the FEMA Regional Office in which is employed the FEMA employee whose negligence or wrongful...

  12. Characterization of the interaction between collectin 11 (CL-11, CL-K1) and nucleic acids

    DEFF Research Database (Denmark)

    Henriksen, Maiken Lumby; Brandt, Jette; Iyer, Sinduja S C

    2013-01-01

    Collectins are a group of innate immune proteins that contain collagen-like regions and globular C-type lectin domains. Via the lectin domains, collectins recognize and bind to various microbial carbohydrate patterns. Collectin 11 (CL-11) exists in complex with the complement activating MBL-assoc...... to particles and surfaces presenting extracellular DNA, such as apopototic cells, neutrophil extracellular traps and biofilms....

  13. Study of 11Li and 10,11Be nuclei through elastic scattering and breakup reactions

    Science.gov (United States)

    Gaidarov, M. K.; Lukyanov, V. K.; Kadrev, D. N.; Zemlyanaya, E. V.; Antonov, A. N.; Lukyanov, K. V.; Spasova, K.

    2016-01-01

    The hybrid model of the microscopic optical potential (OP) is applied to calculate the 11Li+p, 10,11Be+p, and 10,11Be+12C elastic scattering cross sections at energies E energy approximation (HEA) theory. For the 11Li+p elastic scattering, the microscopic large-scale shell model (LSSM) density of 11Li is used, while the density distributions of 10,11Be nuclei obtained within the quantum Monte Carlo (QMC) model and the generator coordinate method (GCM) are utilized to calculate the microscopic OPs and cross sections of elastic scattering of these nuclei on protons and 12C. The depths of the real and imaginary parts of OP are fitted to the elastic scattering data, being simultaneously adjusted to reproduce the true energy dependence of the corresponding volume integrals. Also, the cluster models, in which 11Li consists of 2n-halo and the 9Li core having its own LSSM form of density and 11Be consists of a n-halo and the 10Be core, are adopted. Within the latter, we give predictions for the longitudinal momentum distributions of 9Li fragments produced in the breakup of 11Li at 62 MeV/nucleon on a proton target. It is shown that our results for the diffraction and stripping reaction cross sections in 11Be scattering on 9Be, 93Nb, 181Ta, and 238U targets at 63 MeV/nucleon are in a good agreement with the available experimental data.

  14. Study of 11Li and 10,11Be nuclei through elastic scattering and breakup reactions

    Directory of Open Access Journals (Sweden)

    Gaidarov M. K.

    2016-01-01

    Full Text Available The hybrid model of the microscopic optical potential (OP is applied to calculate the 11Li+p, 10,11Be+p, and 10,11Be+12C elastic scattering cross sections at energies E < 100 MeV/nucleon. The OP’s contain the folding-model real part (ReOP with the direct and exchange terms included, while its imaginary part (ImOP is derived within the high-energy approximation (HEA theory. For the 11Li+p elastic scattering, the microscopic large-scale shell model (LSSM density of 11Li is used, while the density distributions of 10,11Be nuclei obtained within the quantum Monte Carlo (QMC model and the generator coordinate method (GCM are utilized to calculate the microscopic OPs and cross sections of elastic scattering of these nuclei on protons and 12C. The depths of the real and imaginary parts of OP are fitted to the elastic scattering data, being simultaneously adjusted to reproduce the true energy dependence of the corresponding volume integrals. Also, the cluster models, in which 11Li consists of 2n-halo and the 9Li core having its own LSSM form of density and 11Be consists of a n-halo and the 10Be core, are adopted. Within the latter, we give predictions for the longitudinal momentum distributions of 9Li fragments produced in the breakup of 11Li at 62 MeV/nucleon on a proton target. It is shown that our results for the diffraction and stripping reaction cross sections in 11Be scattering on 9Be, 93Nb, 181Ta, and 238U targets at 63 MeV/nucleon are in a good agreement with the available experimental data.

  15. A monoclonal antibody (SJ-9A4) to P24 present on common alls, neuroblastomas and platelets - I. Characterization and development of a unique radioimmunometric assay.

    Science.gov (United States)

    Komada, Y; Peiper, S C; Melvin, S L; Metzger, D W; Tarnowski, B H; Green, A A

    1983-01-01

    We report the development and characterization of SJ-9A4, a monoclonal antibody (MoAb) produced against common acute lymphoblastic leukemia (C-ALL) cell lines. SJ-9A4 reacted with C-ALL, B-cell chronic lymphocytic leukemia (B-CLL), platelets and C-ALL neuroblastoma (NB) and the K562 cell lines. It had no significant reactivity with erythrocytes, granulocytes, circulating T or B lymphocytes, monocytes, granulocytic cell lines or a Ewing's sarcoma cell line. SJ-9A4 was shown to recognize the same region as two other MoAb to the p24 antigen, BA-2 and DU-ALL-1, as demonstrated by their ability to inhibit the binding of labeled SJ-9A4 to NALM-1 and NB cells. Other MoAb: J5, PI 153/3 and monoclonal anti-HLA-DR antibodies gave no inhibition. A solid phase indirect radioimmunometric assay (IRA) was developed which enabled the detection of P24 from C-ALL cells, utilizing its ability to bind the Ricinus communis agglutinin (RCA1) or wheat germ agglutinin (WGA) and SJ-9A4 simultaneously. When BA-2 and DU-ALL-1 were used in place of SJ-9A4, similar IRA results were obtained. Using the RCA1/SJ-9A4-IRA, P24 from as few as 1.6 X 10(4) cells of a C-ALL cell line could be detected; however, similar extracts of NB cell lines were negative despite high levels of SJ-9A4 binding to intact cells. The presence of P24 in NB extracts was demonstrated by (1) preincubation of NB extracts with SJ-9A4 which blocked MoAb binding to P24 and (2) immunoadsorption of P24 from solubilized membranes of 35S-methionine (met) labeled NB cells. Treatment of NB cells with neuraminidase did not result in IRA binding when either RCA1 or WGA were used as the solid phase lectin indicating that the differences in lectin affinity are not due to over sialation of NB membrane glycoproteins. These findings demonstrate a difference in the glycosylation of P24 from C-ALL and NB cells.

  16. Painter 11 Creativity Digital Artist's Handbook

    CERN Document Server

    Sutton, Jeremy

    2009-01-01

    Jeremy Sutton is one of the world’s premier Painter artists (www.JeremySutton.com and www.PaintboxJ.com), and in this brand new edition of his best-selling Painter Creativity: Digital Artist’s Handbook, he shows you the methods and techniques he’s developed over the years to perfect his art and earn him the title of Corel Painter Master. This edition has been completely revamped to cover all of the new features in Corel Painter 11 and the Wacom Intuos4 pen-tablet, including: .. *The new Hard Media brushes .. *Complete visual summary of all brushes, new and old, in Painter 11 .. *Revised and up

  17. Robotic synthesis of [carbon-11]methionine

    International Nuclear Information System (INIS)

    Korsakov, M.V.; Kisselev, M.Y.; Solovyov, D.; Horti, A.G.; Vasilev, A.; Nilsson, L.E.; Ulin, J.

    1992-01-01

    [ 11 C]Methionine was prepared in a fully automated robotic synthesis, using the SCANDITRONIX robotic system starting from [ 11 C]I and homocysteine thiolactone. The product was purified using solid phase extraction on anionic exchange cartridges. The decay corrected yield was 60% based on CH 3 I and 16 min synthesis time. The radiochemical purity was 98-99% and the chemical impurities were: homocysteine 0.05-0.07 mg/ml, homocystine 0.005 mg/ml, 'cold' methionine 0.03-0.05 mg/ml, and homocysteine thiolactone 0.0008-0.002 mg/ml. The total procedure takes 30 min from EOB. (author) 6 figs., 3 tabs

  18. Physics at the FQMT'11 conference

    Science.gov (United States)

    Špička, V.; Nieuwenhuizen, Th M.; Keefe, P. D.

    2012-11-01

    This paper deals with the recent state of the art of the following topics presented at the FQMT'11 conference: foundations of quantum physics, quantum measurement; nonequilibrium quantum statistical physics; quantum thermodynamics; quantum measurement, entanglement and coherence; dissipation, dephasing, noise, and decoherence; quantum optics; macroscopic quantum behavior; e.g. cold atoms; Bose-Einstein condensates; physics of quantum computing and quantum information; mesoscopic, nano-electro-mechanical systems and nano-optical systems; spin systems and their dynamics; biological systems and molecular motors; and cosmology, gravitation and astrophysics. The lectures and discussions at the FQMT'11 conference, as well as the contributions to the related topical issue, reveal important themes for future development. The recent literature is included.

  19. Physics at the FQMT'11 conference

    International Nuclear Information System (INIS)

    Špička, V; Nieuwenhuizen, Th M; Keefe, P D

    2012-01-01

    This paper deals with the recent state of the art of the following topics presented at the FQMT'11 conference: foundations of quantum physics, quantum measurement; nonequilibrium quantum statistical physics; quantum thermodynamics; quantum measurement, entanglement and coherence; dissipation, dephasing, noise, and decoherence; quantum optics; macroscopic quantum behavior; e.g. cold atoms; Bose-Einstein condensates; physics of quantum computing and quantum information; mesoscopic, nano-electro-mechanical systems and nano-optical systems; spin systems and their dynamics; biological systems and molecular motors; and cosmology, gravitation and astrophysics. The lectures and discussions at the FQMT'11 conference, as well as the contributions to the related topical issue, reveal important themes for future development. The recent literature is included.

  20. Synthesis of some 11C-labelled alkaloids

    International Nuclear Information System (INIS)

    Laangstroem, B.; Antoni, G.; Halldin, H.; Svaerd, H.; Bergson, G.

    1982-01-01

    Using ( 11 C)-methyl iodide in N-alkylation reactions in dimethylformamide (DMF), the alkaloids N-( 11 C-methyl)-morphine, N-( 11 C-methyl)-codeine, 6-N(methyl)-9, 10-dihydroergotamine, 6-N-( 11 C-methyl)-bromocriptine and N-( 11 C-methyl)-nicotine have been synthesized in radiochemical yields of 50-95%, within 5-10 min of introducing ( 11 C)-methyl iodide into the reaction vial. ( 11 C)-Methyl iodide was obtained within 4-7 min from ( 11 C)-carbon dioxide prepared by the 14 N(p,α) 11 C reaction. (Authors)

  1. 22q11.2 deletion syndrome

    Science.gov (United States)

    McDonald-McGinn, Donna M.; Sullivan, Kathleen E.; Marino, Bruno; Philip, Nicole; Swillen, Ann; Vorstman, Jacob A. S.; Zackai, Elaine H.; Emanuel, Beverly S.; Vermeesch, Joris R.; Morrow, Bernice E.; Scambler, Peter J.; Bassett, Anne S.

    2016-01-01

    22q11.2 deletion syndrome (22q11.2DS) is the most common chromosomal microdeletion disorder, estimated to result mainly from de novo non-homologous meiotic recombination events occurring in approximately 1 in every 1,000 fetuses. The first description in the English language of the constellation of findings now known to be due to this chromosomal difference was made in the 1960s in children with DiGeorge syndrome, who presented with the clinical triad of immunodeficiency, hypoparathyroidism and congenital heart disease. The syndrome is now known to have a heterogeneous presentation that includes multiple additional congenital anomalies and later-onset conditions, such as palatal, gastrointestinal and renal abnormalities, autoimmune disease, variable cognitive delays, behavioural phenotypes and psychiatric illness — all far extending the original description of DiGeorge syndrome. Management requires a multidisciplinary approach involving paediatrics, general medicine, surgery, psychiatry, psychology, interventional therapies (physical, occupational, speech, language and behavioural) and genetic counselling. Although common, lack of recognition of the condition and/or lack of familiarity with genetic testing methods, together with the wide variability of clinical presentation, delays diagnosis. Early diagnosis, preferably prenatally or neonatally, could improve outcomes, thus stressing the importance of universal screening. Equally important, 22q11.2DS has become a model for understanding rare and frequent congenital anomalies, medical conditions, psychiatric and developmental disorders, and may provide a platform to better understand these disorders while affording opportunities for translational strategies across the lifespan for both patients with 22q11.2DS and those with these associated features in the general population. PMID:27189754

  2. Aesthetic Appreciation, Ethics, and 9/11

    Directory of Open Access Journals (Sweden)

    Emmanouil Aretoulakis

    2008-01-01

    Full Text Available There have been numerous critical articles on what really happened on the otherwise beautiful morning of 11 September 2001. Beyond doubt, the bulk of the critical responses to the terrorist attacks focused on the ethical and humanitarian, or rather the unethical and inhumane implications of the atrocious act, leaving no room for any philosophical reflection on the potential assessment or reception of the event from the perspective of art and aesthetics. The few years that have gone by since 2001 have provided us with some a sense of emotional detachment from the horror of that day, a detachment that may have awakened our aesthetic and artistic instincts with regard to the attacks themselves as well as their visual representation. Chronological distance renders an unprejudiced and independent stance more possible now than ever. It also allows us to reconsider our initial politically correct and ethically justified repulsion of the efforts made by a few artists to aestheticize 9/11. Such repulsion, however, was associated with the delusion that by denouncing aesthetics we were really securing the prevalence of politics, morality and ethical responsibility in a terror-afflicted society. My point in this paper is that there is a need for aesthetic appreciation when contemplating a violent event such as the 9/11 terrorist attacks. What is more, appreciation of the beautiful, even in case of a 9/11, seems necessary because it is a key to establishing an ethical stance towards terror, life, and art. It should be stressed that independent aesthetic experience is not important in itself but is a means of cultivating an authentic moral and ethical judgment.

  3. Oracle Data Integrator 11g cookbook

    CERN Document Server

    Dupupet, Christophe; Gray, Denis; Testut, Julien

    2013-01-01

    Written as a practical Cookbook, the recipes in this essential guide will help you make the most out of Oracle Data Integrator 11g.This book is meant for people who already possess a basic understanding of Oracle Data Integrator and want to take it to the next level by learning how to better leverage advanced ODI features and functionality as they continue to develop and manage their data integration projects.

  4. SPARK Version 1.1 user manual

    International Nuclear Information System (INIS)

    Weissenburger, D.W.

    1988-01-01

    This manual describes the input required to use Version 1.1 of the SPARK computer code. SPARK 1.1 is a library of FORTRAN main programs and subprograms designed to calculate eddy currents on conducting surfaces where current flow is assumed zero in the direction normal to the surface. Surfaces are modeled with triangular and/or quadrilateral elements. Lorentz forces produced by the interaction of eddy currents with background magnetic fields can be output at element nodes in a form compatible with most structural analysis codes. In addition, magnetic fields due to eddy currents can be determined at points off the surface. Version 1.1 features eddy current streamline plotting with optional hidden-surface-removal graphics and topological enhancements that allow essentially any orientable surface to be modeled. SPARK also has extensive symmetry specification options. In order to make the manual as self-contained as possible, six appendices are included that present summaries of the symmetry options, topological options, coil options and code algorithms, with input and output examples. An edition of SPARK 1.1 is available on the Cray computers at the National Magnetic Fusion Energy Computer Center at Livermore, California. Another more generic edition is operational on the VAX computers at the Princeton Plasma Physics Laboratory and is available on magnetic tape by request. The generic edition requires either the GKS or PLOT10 graphics package and the IMSL or NAG mathematical package. Requests from outside the United States will be subject to applicable federal regulations regarding dissemination of computer programs. 22 refs

  5. 12 CFR 1403.11 - Criminal penalties.

    Science.gov (United States)

    2010-01-01

    ... Banks and Banking FARM CREDIT SYSTEM INSURANCE CORPORATION PRIVACY ACT REGULATIONS § 1403.11 Criminal penalties. Section 552a(i)(3) of the Privacy Act (5 U.S.C. 552a(i)(3)) makes it a misdemeanor, subject to a... from an agency under false pretenses. Sections 552a(i) (1) and (2) of the Act (5 U.S.C. 552a(i) (1), (2...

  6. E11s problemer, Havmandens lykke

    DEFF Research Database (Denmark)

    Clemmesen, Michael Hesselholt

    2017-01-01

    Den 19. oktober forsøgte den britiske undervandsbåd E11 at torpedere den danske undervandsbåd Havmanden nordøst for Nakkehoved Fyr i den tro, at det var den tyske ubåd U 3. Der var gode strategiske årsager til begivenheden, og den fik en betydelig indflydelse på karakteren af den danske neutralit...

  7. The chemistry of 1,1-dithiolates

    DEFF Research Database (Denmark)

    Henriksen, L.; Autrup, Herman

    1972-01-01

    A series of thieno[3,2-e]-3,4-dihydro-1,2,3-triazin-4-ones (V) and thieno[3,4-e]-3,4-dihydro-1,2,3-triazin-4-ones (VI) were prepared by diazotation of 3-aminothiophene-2-carboxamides (III) and 4-amino-thiophene-3-carboxamides (IV), respectively, both obtained by cyclization of 2-cyanoethylene-1,1...

  8. Stereotyped movement disorder in ICD-11.

    Science.gov (United States)

    Stein, Dan J; Woods, Douglas W

    2014-01-01

    According to current proposals for ICD-11, stereotyped movement disorder will be classified in the grouping of neurodevelopmental disorders, with a qualifier to indicate whether self-injury is present, similar to the classification of stereotypic movement disorder in DSM-5. At the same time, the WHO ICD-11 Working Group on the Classification of Obsessive-Compulsive and Related Disorders has proposed a grouping of body-focused repetitive behavior disorders within the obsessive-compulsive and related disorders (OCRD) cluster to include trichotillomania and skin-picking disorder. DSM-5 has taken a slightly different approach: trichotillomania and excoriation (skin picking) disorder are included in the OCRD grouping, while body-focused repetitive behavior disorder is listed under other specified forms of OCRD. DSM-5 also includes a separate category of nonsuicidal self-injury in the section on "conditions for further study." There are a number of unresolved nosological questions regarding the relationships among stereotyped movement disorder, body-focused repetitive behavior disorders, and nonsuicidal self-injury. In this article, we attempt to provide preliminary answers to some of these questions as they relate to the ICD-11 classification of mental and behavioral disorders.

  9. Microstructural stability of 11Cr ODS steel

    Energy Technology Data Exchange (ETDEWEB)

    Yamashiro, Tetsuya, E-mail: fgsjkr@eng.hokudai.ac.jp [Materials Science and Engineering, Graduate School of Engineering, Hokkaido University, N13, W-8, Kita-ku, Sapporo 060-8628 (Japan); Ukai, Shigeharu; Oono, Naoko [Materials Science and Engineering, Faculty of Engineering, Hokkaido University, N13, W-8, Kita-ku, Sapporo 060-8628 (Japan); Ohtsuka, Satoshi; Kaito, Takeji [Advanced Nuclear System R& D Directorate, Japan Atomic Energy Agency (JAEA), 4002, Narita, Oarai, Ibaraki-pref. 311-1393 (Japan)

    2016-04-15

    Aiming at further improvement of high-temperature oxidation and corrosion resistance, 11CrODS steel with martensitic base structure has been previously developed, as a candidate fuel cladding material for 4th generation advanced nuclear reactors. In this study, the microstructure of 11CrODS steel was characterized by means of EBSD and nanoindentation hardness measurement. The continuous cooling transformation (CCT) diagram was constructed. Upper critical cooling rate, which is minimum cooling rate necessary to form martensitic structure, was derived to be 60 °C/min (3600 °C/h). In contrast, lower critical cooling rate preventing from martensite formation, was derived to be 10 °C/min (600 °C/h). An area fraction of so called residual ferrite was estimated by image processing of EBSD-IQ map to be 21% of the total area. This fraction of the residual ferrite in 11CrODS steel was evaluated by considering the driving force for α to γ reverse transformation.

  10. Release Notes for Whisper-1.1

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Forrest B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rising, Michael Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Alwin, Jennifer Louise [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-04-27

    Whisper is a statistical analysis package developed in 2014 to support nuclear criticality safety (NCS) validation [1-3]. It uses the sensitivity profile data for an application as computed by MCNP6 [4-6] along with covariance files [7,8] for the nuclear data to determine a baseline upper-subcritical-limit (USL) for the application. Whisper version 1.0 was first developed and used at LANL in 2014 [3]. During 2015-2016, Whisper was updated to version 1.1 [9] and is to be included with the upcoming release of MCNP6.2. This document describes the Whisper-1.1 package that will be included with the MCNP6.2 release during 2017. Specific details are provided on the computer systems supported, the software quality assurance (SQA) procedures, installation, and testing. This document does not address other important topics, such as the importance of sensitivity-uncertainty (SU) methods to NCS validation, the theory underlying SU methodology, tutorials on the usage of MCNP-Whisper, practical approaches to using SU methodology to support and extend traditional validation, etc. There are over 50 documents included with Whisper-1.1 and available in the MCNP Reference Collection on the MCNP website (mcnp.lanl.gov) that address all of those topics and more. In this document, however, a complete bibliography of relevant MCNP-Whisper references is provided.

  11. 11C-methionine translocation in barley

    International Nuclear Information System (INIS)

    Nakanishi, Hiromi; Bughio, Naimatullah; Shigeta Ishioka, Noriko

    2000-01-01

    11 C-methionine was supplied to barley plants through a single leaf or via the roots and real time 11 C movement was monitored using a PETIS (positron emitting tracer imaging system). In Fe-deficient plants, 11 C-methionine was translocated from the tip of the absorbing leaf to the discrimination center' at the basal part of the shoot and then retranslocated to all the chlorotic leaves, while a negligible amount was retranslocated to the roots. In Fe-sufficient plants, methionine was translocated from the absorbing leaf to the discrimination center and then only to the newest leaf on the main shoot. A negligible amount was also retranslocated to the roots. Although, in Fe-sufficient plants, methionine translocation was observed from absorbing roots to shoots, in Fe-deficient plants, only a little amount was translocated from roots to shoots. In conclusion, methionine from the upper portion of a plant is not used as a precursor of mugineic acid under Fe-deficiency conditions. (author)

  12. 25 CFR 11.906 - Rights of parties.

    Science.gov (United States)

    2010-04-01

    ... ORDER CODE Children's Court § 11.906 Rights of parties. (a) In all hearings and proceedings under §§ 11.900-11.1114 of this part the following rights will be observed unless modified by the particular... 25 Indians 1 2010-04-01 2010-04-01 false Rights of parties. 11.906 Section 11.906 Indians BUREAU...

  13. TH-A-9A-10: Prostate SBRT Delivery with Flattening-Filter-Free Mode: Benefit and Accuracy

    International Nuclear Information System (INIS)

    Li, T; Yuan, L; Sheng, Y; Wu, Q

    2014-01-01

    Purpose: Flattening-filter-free (FFF) beam mode offered on TrueBeam™ linac enables delivering IMRT at 2400 MU/min dose rate. This study investigates the benefit and delivery accuracy of using high dose rate in the context of prostate SBRT. Methods: 8 prostate SBRT patients were retrospectively studied. In 5 cases treated with 600-MU/min dose rate, continuous prostate motion data acquired during radiation-beam-on was used to analyze motion range. In addition, the initial 1/3 of prostate motion trajectories during each radiation-beam-on was separated to simulate motion range if 2400-MU/min were used. To analyze delivery accuracy in FFF mode, MLC trajectory log files from an additional 3 cases treated at 2400-MU/min were acquired. These log files record MLC expected and actual positions every 20ms, and therefore can be used to reveal delivery accuracy. Results: (1) Benefit. On average treatment at 600-MU/min takes 30s per beam; whereas 2400-MU/min requires only 11s. When shortening delivery time to ~1/3, the prostate motion range was significantly smaller (p<0.001). Largest motion reduction occurred in Sup-Inf direction, from [−3.3mm, 2.1mm] to [−1.7mm, 1.7mm], followed by reduction from [−2.1mm, 2.4mm] to [−1.0mm, 2.4mm] in Ant-Pos direction. No change observed in LR direction [−0.8mm, 0.6mm]. The combined motion amplitude (vector norm) confirms that average motion and ranges are significantly smaller when beam-on was limited to the 1st 1/3 of actual delivery time. (2) Accuracy. Trajectory log file analysis showed excellent delivery accuracy with at 2400 MU/min. Most leaf deviations during beam-on were within 0.07mm (99-percentile). Maximum leaf-opening deviations during each beam-on were all under 0.1mm for all leaves. Dose-rate was maintained at 2400-MU/min during beam-on without dipping. Conclusion: Delivery prostate SBRT with 2400 MU/min is both beneficial and accurate. High dose rates significantly reduced both treatment time and intra-beam prostate

  14. Synthesis of [11C]cyanoalkyltriphenylphosphoranes via [11C]cyanide substitution on haloalkylphosphonium salts

    International Nuclear Information System (INIS)

    Hoernfeldt, K.

    1994-01-01

    The synthesis of the 11 C-labelled bifunctional precursors 3-[ 11 C]cyanoethyltriphenylphosphonium bromide (1'), 4-[ 11 C]cyanopropyltriphenylphosphonium bromide (2'), 5-[ 11 C]cyanobutyltriphenylphosphonium bromide (3'), 4-[ 11 C]cyanopropyltriphenylphosphonium iodide (4') and 5-[ 11 C]cyanobutyltriphenylphosphonium iodide (5') is presented. The label was introduced using [ 11 C]cyanide in a substitution reaction on the ω-halo-alkyltriphenylphosphonium salt (bromide or iodide salt). The phosphonium salts 1'-5' were formed in 33-99% radiochemical yield in 5-10 min reaction time. After addition of epichlorohydrin as generator of base, the precursors 1-3 were formed. The potential of the intermediates 1-3 in Wittig reactions was shown in model reactions with aromatic and aliphatic aldehydes. The aromatic olefins obtained from 1'-5' were formed in 85-96% radiochemical yield, with Z/E ratios between 67/33-75/25. The aliphatic olefins were obtained in 60-78% radiochemical yield from 4' and 5'. In the reaction with 1' and an aliphatic aldehyde, the yield decreased to 5-10%. The Z/E ratios were 100/0 for the aliphatic olefins. In an experiment starting with 2,7 GBq (73 mCi) hydrogen [ 11 C]cyanide, 451 MBq (12.2 mCi) olefin from 3' and 4-nitrobenzaldehyde was obtained in 44 min from hydrogen [ 11 C]cyanide production, with a 55% decay corrected radiochemical yield, the radiochemical purity was 96%. (Author)

  15. Normative data of the Barratt Impulsiveness Scale 11 (BIS-11) for Brazilian adults

    OpenAIRE

    Malloy-Diniz,Leandro F.; Paula,Jonas J. de; Vasconcelos,Alina G.; Almondes,Katie M. de; Pessoa,Rockson; Faria,Leonardo; Coutinho,Gabriel; Costa,Danielle S.; Duran,Victor; Coutinho,Thales V.; Corrêa,Humberto; Fuentes,Daniel; Abreu,Neander; Mattos,Paulo

    2015-01-01

    Objective:The Barratt Impulsiveness Scale (BIS-11) is a valid and reliable instrument, and one of the most often used tools to assess impulsivity. This study assesses the performance of a large sample of adults by using a version of BIS-11 adapted to Brazilian Portuguese.Methods:We assessed 3,053 adults from eight Brazilian states. Internal consistencies and performance data were presented for two correction criteria of BIS-11: original and the two-factor score.Results:The associations betwee...

  16. FgLPMO9A from Fusarium graminearum cleaves xyloglucan independently of the backbone substitution pattern

    DEFF Research Database (Denmark)

    Nekiunaite, Laura; Petrović, Dejan M.; Westereng, Bjørge

    2016-01-01

    Lytic polysaccharide monooxygenases (LPMOs) are important for the enzymatic conversion of biomass and seem to play a key role in degradation of the plant cell wall. In this study, we characterize an LPMO from the fungal plant pathogen Fusarium graminearum (FgLPMO9A) that catalyzes the mixed C1/C4...... that when incubated with a mixture of xyloglucan and cellulose, FgLPMO9A efficiently attacks the xyloglucan, whereas cellulose conversion is inhibited. This suggests that removal of hemicellulose may be the true function of this LPMO during biomass conversion....

  17. Plasma mSEPT9: A Novel Circulating Cell-free DNA-Based Epigenetic Biomarker to Diagnose Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Abderrahim Oussalah

    2018-04-01

    associated with HCC diagnosis (initial: OR = 6.30, for each mSEPT9 positive triplicate [2.92–13.61, p < 0.0001]; replication: OR = 6.07 [3.25–11.35, p < 0.0001]; meta-analysis: OR = 6.15 [2.93–9.38, p < 0.0001], no heterogeneity: I2 = 0%, p = 0.95; no publication bias. AUROC associated with the discrimination of the logistic regression models in initial and validation studies were 0.969 (0.930–0.989 and 0.942 (0.878–0.978, respectively, with a pooled AUROC of 0.962 ([0.937–0.987, p < 0.0001], no heterogeneity: I2 = 0%, p = 0.36; and no publication bias. Interpretation: Among patients with cirrhosis, the mSEPT9 test constitutes a promising circulating epigenetic biomarker for HCC diagnosis at the individual patient level. Future prospective studies should assess the mSEPT9 test in the screening algorithm for cirrhotic patients to improve risk prediction and personalized therapeutic management of HCC. Keywords: Cirrhosis, Hepatocellular carcinoma, Circulating cell-free DNA-based epigenetic biomarker, DNA methylation, mSEPT9

  18. C-11 production with MC-50 cyclotron and synthesis of L-[11C-methyl] methionine

    International Nuclear Information System (INIS)

    Kim, Sang Wook; Hur, Min Goo; Yang, Seung Dae; Ahn, Soon Hyuk; Chun, Kweon Soo

    2003-01-01

    L-[ 11 C-methyl] methionine was prepared via no-carrier-added(nca) fast S-alkylation of L-homocysteine with [ 11 C]CH 3 I using solid support (Al 2 O 3 /KF)at room temperature in ethanol. The radiochemical yield of methylation was 90.2%. After reaction, no radiochemical impurity was detected but traces of L-homocysteine precursor were monitored by UV detector. The purification was archived by passing successively through a C 18 and alumina sep-pak. the radiochemical purity of L-[ 11 C-methyl] methionine was over 98% after purification and total elapsed time to prepare was 10min from [ 11 C]CH 3 I delivery

  19. The synthesis of [1-11C]-butanol

    International Nuclear Information System (INIS)

    Helus, F.; Maier-Borst, W.; Oberdorfer, F.; Silvester, D.J.

    1982-01-01

    11 C-labelled butanol has been synthesised for use as a tracer in the assessment of regional blood supply for substrate utilisation in tumors. 11 CO 2 was produced by the 14 N(p,a) 11 C reactions in a cyclotron. 11 C-butanol was formed by the carboxylation of n-propyl magnesium chlorides with 11 CO 2 , and reduction of the resulting 11 C-butyric acid with LiAlH 4 . (U.K.)

  20. Resurgence of Neisseria meningitidis serogroup W ST-11 (cc11) in Madagascar, 2015-2016.

    Science.gov (United States)

    Rasoanandrasana, Saïda; Raberahona, Mihaja; Milenkov, Milen; Rakotomahefa Narison, Mbolanirina Lala; Ranaivo Rabetokotany, Felana; Rakotovao, Luc; Randria, Mamy Jean de Dieu; Hong, Eva; Paranhos-Baccalà, Glaucia; Taha, Muhamed-Kheir; Rakoto-Andrianarivelo, Mala

    2017-02-01

    The resurgence of invasive meningococcal disease caused by Neisseria meningitidis serogroup W with sequence type ST-11 (cc11) was observed in Madagascar in 2015-2016. Three cases were investigated in this study. Molecular characterization of the strains suggests the local transmission of a single genotype that may have been circulating for years. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Normative data of the Barratt Impulsiveness Scale 11 (BIS-11 for Brazilian adults

    Directory of Open Access Journals (Sweden)

    Leandro F. Malloy-Diniz

    2015-09-01

    Full Text Available Objective:The Barratt Impulsiveness Scale (BIS-11 is a valid and reliable instrument, and one of the most often used tools to assess impulsivity. This study assesses the performance of a large sample of adults by using a version of BIS-11 adapted to Brazilian Portuguese.Methods:We assessed 3,053 adults from eight Brazilian states. Internal consistencies and performance data were presented for two correction criteria of BIS-11: original and the two-factor score.Results:The associations between age, sex, region, and education and the BIS-11 scores present very small effect sizes. Therefore, we provided a percentile rank parameter for the different BIS-11 subscores considering the whole sample. Given the internal consistency of the two correction systems, we found that only the two-factor system fulfills the psychometric criteria of Cronbach’s alpha (cutoff value of at least 0.6.Conclusion:Our results support the use of the Brazilian adaptation of BIS-11 in different regions of the country as a measure of impulsivity. Since high impulsiveness is a characteristic of several dysfunctional behaviors, the establishment of normative parameters is of utmost relevance and should be extended to other age ranges and populations in future studies.

  2. From Editor vol 11, No.4

    OpenAIRE

    Ugur Demiray

    2010-01-01

    Greetings Dear readers of TOJDE,TOJDE is appeared on your screen now as Volume 11, Number: 4. In this issue it is published 4 notes for Editor, 12 articles, 2 book and one conference reviews. And this time, 27 authors from 10 different countries are placed. These published articles are from Bangldesh, Greece, India, Israel, Malaysia, Nigeria, Portugal, Singapore, Turkey and USA.The first Notes for editor arrived from USA, written by Kevin YEE and Jace HARGIS. They focused on PREZI: A Differen...

  3. La precariedad: el resultado de 11 contradicciones

    Directory of Open Access Journals (Sweden)

    Antonio Gómez Villar

    2017-12-01

    Full Text Available Proponemos pensar la precariedad como el resultado de 11 contradicciones, esto es, atravesando bloqueos, puntos de crisis, rupturas, apertura de nuevos planos y líneas de fuga inmanentes a la nueva configuración del trabajo postfordista. En cada contradicción podemos reconocer muchos de los medios que tenemos a nuestra disposición para articular proyectos de liberación del capital, para crear instituciones e institucionalidades que posibiliten el que consideramos el mayor de los legados de la teoría (postoperaista: la posibilidad que tiene el conocimiento de devenir autónomo.

  4. 11th AG STAB/DGLR Symposium

    CERN Document Server

    Heinemann, Hans-Joachim; Hilbig, Reinhard

    1999-01-01

    This volume contains the papers of the 11th Symposium of the AG STAB (German Aerospace Aerodynamics Association). In this association those scientists and engineers from universities, research-establishments and industry are involved, who are doing research and project work in numerical and experimental fluid mechanics and aerodynamics for aerospace and other applications. Many of the contributions are giving results from the "Luftfahrtforschungsprogramm der Bundesregierung (German Aeronautical Research Programme). Some of the papers report on work sponsored by the Deutsche Forschungsgemeinschaft, DFG, which also was presented at the symposium. The volume gives a broad overview over the ongoing work in this field in Germany.

  5. iPhoto '11 The Missing Manual

    CERN Document Server

    Pogue, David

    2011-01-01

    With better ways to get your photos online and new options for creating printed projects, iPhoto '11 makes it easier than ever to transfer photos from a digital camera, organize them, and publish, print, or share them in maps-but there's still no printed manual for the program. Fortunately, David Pogue and Lesa Snider team up in this witty, authoritative book that should have been in the box. Organize your collection. Discover all of the options for grouping your pictures-by events, in albums, or based on who's in the photo or where it was taken.Sharpen your editing skills. Learn how to use

  6. Cardiomyopathy from 1,1-Difluoroethane Inhalation.

    Science.gov (United States)

    Kumar, Suwen; Joginpally, Tejaswini; Kim, David; Yadava, Mrinal; Norgais, Konchok; Laird-Fick, Heather S

    2016-10-01

    Consumer aerosol products can be inhaled for their psychoactive effects, but with attendant adverse health effects including "sudden sniffing death." Cardiomyopathy has rarely been described in association with 1,1-difluoroethane (DFE), a common aerosol propellant. We report a 33-year-old male who developed acute myocardial injury and global hypokinesis along with rhabdomyolysis, acute kidney injury, and fulminant hepatitis after 2 days' nearly continuous huffing. Workup for other causes, including underlying coronary artery disease, was negative. His cardiac function improved over time. The exact mechanism of DFE's effects is uncertain but may include catecholamine-induced cardiomyopathy, coronary vasospasm, or direct cellular toxicity.

  7. Oracle SOA Suite 11g performance cookbook

    CERN Document Server

    Brasier, Matthew; Wright, Nicholas

    2013-01-01

    This is a Cookbook with interesting, hands-on recipes, giving detailed descriptions and lots of practical walkthroughs for boosting the performance of your Oracle SOA Suite.This book is for Oracle SOA Suite 11g administrators, developers, and architects who want to understand how they can maximise the performance of their SOA Suite infrastructure. The recipes contain easy to follow step-by-step instructions and include many helpful and practical tips. It is suitable for anyone with basic operating system and application server administration experience.

  8. Model of the VAX-11/780

    CERN Document Server

    1977-01-01

    It was the first member of the VAX family of computers, the first commercially available 32-bit computer and the first MIPS (one million instructions per second). It is a family of abandoned mini-computers developed and manufactured by Digital Equipment Corporation (DEC). The name "VAX" comes from an acronym for "Virtual address eXtension" as the successor to the PDP-11. The computer and its operating system (VMS) were designed from scratch. The result was a truly reliable, powerful and user-friendly system. In addition its affordable price has enabled many institutions and universities to acquire it.

  9. Hidrología, 2010-11

    OpenAIRE

    Sánchez San Román, Francisco Javier

    2010-01-01

    I. Materiales de clase: 1. El Ciclo Hidrológico. 2. Precipitaciones. 3. Evapotranspiración. 4. Hidrología Superficial (I): Medidas y Tratamiento de los datos. 5. Hidrología Superficial (II): Hidrogramas. 6. Hidrología Superficial (III): Relación Precipitación - Escorrentía. 7. Conceptos Fundamentales de Hidrogeología. 8. Flujo en medios porosos: Ley de Darcy. 9. Hidráulica Subterránea: Principios Básicos. 10. Hidráulica de captaciones: Fundamentos. 11. Hidroquímica. Conceptos Fundamentales. 1...

  10. VANDAL user guide. V. 1.1

    International Nuclear Information System (INIS)

    Unsworth, M.D.

    1989-02-01

    This document forms Volume 1.1 of the VANDAL User Guide and is intended to provide all the information necessary to define and run a case study. Information is given on the data to be specified, on the structure of the input data files and on how to execute the system. There are three related volumes to this, they are: Volume 1.2 - Input and Execution Appendices; Volume 2.1 - Ouput and Error Messages; and Volume 2.2 - PRA Output Analysis. (author)

  11. Formulation of 11-dimensional supergravity in superspace

    International Nuclear Information System (INIS)

    Cremmer, E.; Ferrara, S.

    1980-01-01

    We formulate on-shell 11-dimensional supergravity in superspace and express its equations of motion in terms of purely geometrical quantities. All torsion and curvature components are solved in terms of a single superfield Wsub(rstu), totally antisymmetric in its (flat vector) indices. The dimensional reduction of this formulation is expected to be related to the superspace formulation of N = 8 extended supergravity and might explain the origin of the hidden (local) SU(8) and (global) E 7 symmetries present in this theory. (orig.)

  12. Collected software engineering papers, volume 11

    Science.gov (United States)

    1993-01-01

    This document is a collection of selected technical papers produced by participants in the Software Engineering Laboratory (SEL) from November 1992 through November 1993. The purpose of the document is to make available, in one reference, some results of SEL research that originally appeared in a number of different forums. This is the 11th such volume of technical papers produced by the SEL. Although these papers cover several topics related to software engineering, they do not encompass the entire scope of SEL activities and interests. Additional information about the SEL and its research efforts may be obtained from the sources listed in the bibliography at the end of this document.

  13. BOREAS TE-11 Leaf Gas Exchange Measurements

    Science.gov (United States)

    Hall, Forrest G. (Editor); Papagno, Andrea (Editor); Saugier, Bernard; Pontailler, J. Y.

    2000-01-01

    The Boreal Ecosystem-Atmospheric Study (BOREAS) TE-11 (Terrestrial Ecology) team collected several data sets in support of its efforts to characterize and interpret information on the sap flow, gas exchange, and lichen photosynthesis of boreal vegetation and meteorological data of the area studied. This data set contains measurements of assimilation and transpiration conducted at the Old Jack Pine (OJP) site during the growing seasons of 1993 and 1994. The data are stored in ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  14. User Manual for Whisper-1.1

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Forrest B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rising, Michael Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Alwin, Jennifer Louise [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-01-26

    Whisper is a statistical analysis package developed in 2014 to support nuclear criticality safety (NCS) validation [1-3]. It uses the sensitivity profile data for an application as computed by MCNP6 [4-6] along with covariance files [7,8] for the nuclear data to determine a baseline upper-subcritical-limit (USL) for the application. Whisper version 1.0 was first developed and used at LANL in 2014 [3]. During 2015- 2016, Whisper was updated to version 1.1 and is to be included with the upcoming release of MCNP6.2. This document describes the user input and options for running whisper-1.1, including 2 perl utility scripts that simplify ordinary NCS work, whisper_mcnp.pl and whisper_usl.pl. For many detailed references on the theory, applications, nuclear data & covariances, SQA, verification-validation, adjointbased methods for sensitivity-uncertainty analysis, and more – see the Whisper – NCS Validation section of the MCNP Reference Collection at mcnp.lanl.gov. There are currently over 50 Whisper reference documents available.

  15. CAMAC/PDP 11-45 coupler

    International Nuclear Information System (INIS)

    Pascual, Joseph; Raoul, J.-C.

    1978-04-01

    The complex experimental devices used in high energy physics require the use of minicomputers. The latter are coupled to the detectors using the CAMAC standard which has been adopted by the majority of high energy physics laboratories, much to the ease of international collaboration. The performance of industrially available interfaces having shown to be inadequate, the DPhPE has undertaken the development of a multibranche CAMAC/PDP 11-45 coupler. This system can control up to 49 crates shared out between 7 branches. It consists of a programmed channel and up to three high speed (556 Kwords/second) automatic channels. The four channels can work simultaneously through time sharing. The coupler includes a LAM handling system. The correspondent software has been developed simultaneously: the monitor is an extended version of the RT 11 system supplied by the manufacturer. This interface has been used so far in five experiments on the CERN PS and SPS. Besides this publication, intended to give a description of the coupler, a user's utilisation manuel exists in English [fr

  16. User Manual for Whisper-1.1

    International Nuclear Information System (INIS)

    Brown, Forrest B.; Rising, Michael Evan; Alwin, Jennifer Louise

    2017-01-01

    Whisper is a statistical analysis package developed in 2014 to support nuclear criticality safety (NCS) validation [1-3]. It uses the sensitivity profile data for an application as computed by MCNP6 [4-6] along with covariance files [7,8] for the nuclear data to determine a baseline upper-subcritical-limit (USL) for the application. Whisper version 1.0 was first developed and used at LANL in 2014 [3]. During 2015- 2016, Whisper was updated to version 1.1 and is to be included with the upcoming release of MCNP6.2. This document describes the user input and options for running whisper-1.1, including 2 perl utility scripts that simplify ordinary NCS work, whisper_mcnp.pl and whisper_usl.pl. For many detailed references on the theory, applications, nuclear data & covariances, SQA, verification-validation, adjointbased methods for sensitivity-uncertainty analysis, and more - see the Whisper - NCS Validation section of the MCNP Reference Collection at mcnp.lanl.gov. There are currently over 50 Whisper reference documents available.

  17. Profiling adrenal 11β-hydroxyandrostenedione metabolites in prostate cancer cells, tissue and plasma: UPC2-MS/MS quantification of 11β-hydroxytestosterone, 11keto-testosterone and 11keto-dihydrotestosterone.

    Science.gov (United States)

    du Toit, Therina; Bloem, Liezl M; Quanson, Jonathan L; Ehlers, Riaan; Serafin, Antonio M; Swart, Amanda C

    2017-02-01

    Adrenal C 19 steroids serve as precursors to active androgens in the prostate. Androstenedione (A4), 11β-hydroxyandrostenedione (11OHA4) and 11β-hydroxytestosterone (11OHT) are metabolised to potent androgen receptor (AR) agonists, dihydrotestosterone (DHT), 11-ketotestosterone (11KT) and 11-ketodihydrotestosterone (11KDHT). The identification of 11OHA4 metabolites, 11KT and 11KDHT, as active androgens has placed a new perspective on adrenal C11-oxy C 19 steroids and their contribution to prostate cancer (PCa). We investigated adrenal androgen metabolism in normal epithelial prostate (PNT2) cells and in androgen-dependent prostate cancer (LNCaP) cells. We also analysed steroid profiles in PCa tissue and plasma, determining the presence of the C 19 steroids and their derivatives using ultra-performance liquid chromatography (UHPLC)- and ultra-performance convergence chromatography tandem mass spectrometry (UPC 2 -MS/MS). In PNT2 cells, sixty percent A4 (60%) was primarily metabolised to 5α-androstanedione (5αDIONE) (40%), testosterone (T) (10%), and androsterone (AST) (10%). T (30%) was primarily metabolised to DHT (10%) while low levels of A4, 5αDIONE and 3αADIOL (≈20%) were detected. Conjugated steroids were not detected and downstream products were present at <0.05μM. Only 20% of 11OHA4 and 11OHT were metabolised with the former yielding 11keto-androstenedione (11KA4), 11KDHT and 11β-hydroxy-5α-androstanedione (11OH-5αDIONE) and the latter yielding 11OHA4, 11KT and 11KDHT with downstream products <0.03μM. In LNCaP cells, A4 (90%) was metabolised to AST-glucuronide via the alternative pathway while T was detected as T-glucuronide with negligible conversion to downstream products. 11OHA4 (80%) and 11OHT (60%) were predominantly metabolised to 11KA4 and 11KT and in both assays more than 50% of 11KT was detected in the unconjugated form. In tissue, we detected C11-oxy C 19 metabolites at significantly higher levels than the C 19 steroids, with

  18. Parenting and Temperament Prior to September 11, 2001, and Parenting Specific to 9/11 as Predictors of Children's Posttraumatic Stress Symptoms Following 9/11

    Science.gov (United States)

    Wilson, Anna C.; Lengua, Liliana J.; Meltzoff, Andrew N.; Smith, Kimberly A.

    2010-01-01

    Parenting is related to children's adjustment, but little research has examined the role of parenting in children's responses to disasters. This study describes parenting responses specific to the 9/11 terrorist attacks and examines pre-9/11 parenting, child temperament, and 9/11-specific parenting as predictors of children's posttraumatic stress…

  19. Exon: CBRC-TGUT-11-0007 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available AGCACTACATCACAGAGAGGTCCCATAAGCACAACATCAGCTGGAGGAACaaaggaaggaagcagaggacccaaaccaccaccaccacccatTTCCACAACCAAAATT...CBRC-TGUT-11-0007 TGCCTACCACAGCAGTGACAATAACTTCTTCAGCAGAGCTTTACAAAACCACAGTGTCAACCACT

  20. Loss of PRDM11 promotes MYC-driven lymphomagenesis

    DEFF Research Database (Denmark)

    Fog-Tonnesen, Cathrine Kolster; Asmar, Fazila; Côme, Christophe Roger Michel

    2015-01-01

    of the previously uncharacterized PR-domain family member Prdm11 and overexpression of MYC. Overexpression of PRDM11 inhibits proliferation and induces apoptosis. Prdm11 knockout mice are viable, and loss of Prdm11 accelerates MYC-driven lymphomagenesis in the Eµ-Myc mouse model. Moreover, we show that patients...

  1. Exon: CBRC-RNOR-11-0147 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-11-0147 aagagaaaggaaagtgaagctacttgataggcaggatagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaa...gaaagaaagaaagagagagagagggagggggagggagagaggaagggaaagaaagaaagagagagagaaagagaggaaggaaggaagggaaagaaaaagaaaaaa...gaaagaaaggaaggaaggaaggaagaaagaaaggaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaggaaggaagaaaggcagttttactggcagagttataaagagacagttgcagagaacaaattaggcacaag ...

  2. Health physics research abstracts no. 11

    International Nuclear Information System (INIS)

    1984-07-01

    The present issue No. 11 of Health Physics Research Abstracts is the continuation of a series of Bulletins published by the Agency since 1967. They collect reports from Member States on Health Physics research in progress or just completed. The main aim in issuing such reports is to draw attention to work that is about to be published and to enable interested scientists to obtain further information through direct correspondence with the investigators. The attention of users of this publication is drawn to the fact that abstracts of published documents on Health Physics are published eventually in INIS Atomindex, which is one of the output products of the Agency's International Nuclear Information System. The present issue contains 235 reports received up to December 1983 from the following Member States. In parentheses the country's ISO code and number of reports are given

  3. 11th Portuguese Conference on Automatic Control

    CERN Document Server

    Matos, Aníbal; Veiga, Germano

    2015-01-01

    During the last 20 years the Portuguese association of automatic control, Associação Portuguesa de Controlo Automático, with the sponsorship of IFAC have established the CONTROLO conference as a reference international forum where an effective exchange of knowledge and experience amongst researchers active in various theoretical and applied areas of systems and control can take place, always including considerable space for promoting new technical applications and developments, real-world challenges and success stories. In this 11th edition the CONTROLO conference evolved by introducing two strategic partnerships with Spanish and Brazilian associations in automatic control, Comité Español de Automática and Sociedade Brasileira de Automatica, respectively.

  4. ORCID implementation in Invenio 1.1

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    We present an extension to the Invenio 1.1 software for semi-automatically harvesting ORCID IDs of users and allowing them to upload publications to their respective ORCID profile. This extension was created in the context of the Join2 initiative, however, it can easily be adapted to other Invenio instances because it is only loosely coupled with Invenio itself. It opens its own local webserver to handle the additional endpoints, and calls Invenio API functions and command line programs to interact with the database. We also present a recommended workflow for successfully harvesting ORCID ID in an institution. The implementation is realised in well-documented Python 2.6 and Go and will be published as Free Software.

  5. Test OPTRAN 1-1 results

    International Nuclear Information System (INIS)

    Martinson, Z.R.

    1982-01-01

    The objective of the OPT 1-1 Test Series was to evaluate the extent of damage and the threshold for failure during simulated BWR anticipated transients. Four power transient tests with progressively higher power levels were performed with preirradiated fuel rods at power ramp rates as high as 550 kW/m per second. Six separately shrouded fuel rods fabricated by the General Electric Co., and preirradiated in the Monticello BWR to burnups of about 5000 to 23,000 MWd/t were tested, four at a time. Four of the fuel rods were of typical GE 8 x 8 design, except for fuel length (0.75 m). Two of the rods included design modifications to improve their PCI-resistant characteristics. A lengthy fuel conditioning preceded the transient testing of the fuel rods

  6. Life span study report, 11, part 2

    International Nuclear Information System (INIS)

    Shimizu, Yukiko; Kato, Hiroo; Schull, W.J.

    1988-12-01

    ABCC and its successor, RERF, have followed since 1959 and retrospectively to 1950 the mortality in a fixed cohort of survivors of the atomic bombings of Hiroshima and Nagasaki, the so-called Life Span Study sample. The present study, the 11th in a series that began in 1961, extends the surveillance period three more years and covers the period 1950-85. It is based on the recently revised dose system, called DS86, that has replaced previous estimates of individual exposures. The impact of the change from the old system of dosimetry, the T65DR, to the new on the dose-response relationships for cancer mortality was described in the first of this series of reports. Here, the focus is on cancer mortality among the 76,000 A-bomb survivors within the LSS sample for whom DS86 doses have been estimated, with the emphasis on biological issues associated with radiation carcinogenesis. (author)

  7. Theophylline–gentisic acid (1/1

    Directory of Open Access Journals (Sweden)

    Srinivasulu Aitipamula

    2009-09-01

    Full Text Available In the title 1:1 cocrystal, C7H8N4O2·C7H6O4, the anti-asthmatic drug theophylline (systematic name: 1,3-dimethyl-7H-purine-2,6-dione and a non-steroidal anti-inflammatory drug, gentisic acid (systematic name: 2,5-dihydroxybenzoic acid crystallize together, forming two-dimensional hydrogen-bonded sheets involving N—H...O and O—H...N hydrogen bonds. The overall crystal packing features π–π stacking interactions [centroid–centroid distance = 3.348 (1 Å]. The cocrystal described herein belongs to the class of pharmaceutical cocrystals involving two active pharmaceutical ingredients which has been relatively unexplored to date.

  8. 11th International Workshop on Railway Noise

    CERN Document Server

    Anderson, David; Gautier, Pierre-Etienne; Iida, Masanobu; Nelson, James; Thompson, David; Tielkes, Thorsten; Towers, David; Vos, Paul

    2015-01-01

    The book reports on the 11th International Workshop on Railway Noise, held on 9 – 13 September, 2013, in Uddevalla, Sweden. The event, which was jointly organized by the Competence Centre Chalmers Railway Mechanics (CHARMEC) and the Departments of Applied Mechanics and Applied Acoustics at Chalmers University of Technology in Gothenburg, Sweden, covered a broad range of topics in the field of railway noise and vibration, including: prospects, legal regulations and perceptions; wheel and rail noise; prediction, measurements and monitoring; ground-borne vibration; squeal noise and structure-borne noise; and aerodynamic noise generated by high-speed trains. Further topics included: resilient track forms; grinding, corrugation and roughness; and interior noise and sound barriers. This book, which consists of a collection of peer-reviewed papers originally submitted to the workshop, not only provides readers with an overview of the latest developments in the field, but also offers scientists and engineers essent...

  9. MD-11 PCA - First Landing at Edwards

    Science.gov (United States)

    1995-01-01

    This McDonnell Douglas MD-11 approaches the first landing ever of a transport aircraft under engine power only on Aug. 29, 1995, at NASA's Dryden Flight Research Center, Edwards, California. The milestone flight, flown by NASA research pilot and former astronaut Gordon Fullerton, was part of a NASA project to develop a computer-assisted engine control system that enables a pilot to land a plane safely when it normal control surfaces are disabled. The Propulsion-Controlled Aircraft (PCA) system uses standard autopilot controls already present in the cockpit, together with the new programming in the aircraft's flight control computers. The PCA concept is simple--for pitch control, the program increases thrust to climb and reduces thrust to descend. To turn right, the autopilot increases the left engine thrust while decreasing the right engine thrust. The initial Propulsion-Controlled Aircraft studies by NASA were carried out at Dryden with a modified twin-engine F-15 research aircraft.

  10. MD-11 PCA - Research flight team egress

    Science.gov (United States)

    1995-01-01

    This McDonnell Douglas MD-11 has parked on the flightline at NASA's Dryden Flight Research Center, Edwards, California, following its completion of the first and second landings ever performed by a transport aircraft under engine power only (on Aug. 29, 1995). The milestone flight, with NASA research pilot and former astronaut Gordon Fullerton at the controls, was part of a NASA project to develop a computer-assisted engine control system that enables a pilot to land a plane safely when its normal control surfaces are disabled. Coming down the steps from the aircraft are Gordon Fullerton (in front), followed by Bill Burcham, Propulsion Controlled Aircraft (PCA) project engineer at Dryden; NASA Dryden controls engineer John Burken; John Feather of McDonnell Douglas; and Drew Pappas, McDonnell Douglas' project manager for PCA.

  11. Cure Schedule for Stycast 2651/Catalyst 11.

    Energy Technology Data Exchange (ETDEWEB)

    Kropka, Jamie Michael [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); McCoy, John D. [New Mexico Inst. of Mining and Technology, Socorro, NM (United States)

    2017-11-01

    The Henkel technical data sheet (TDS) for Stycast 2651/Catalyst 11 lists three alternate cure schedules for the material, each of which would result in a different state of reaction and different material properties. Here, a cure schedule that attains full reaction of the material is defined. The use of this cure schedule will eliminate variance in material properties due to changes in the cure state of the material, and the cure schedule will serve as the method to make material prior to characterizing properties. The following recommendation was motivated by (1) a desire to cure at a single temperature for ease of manufacture and (2) a desire to keep the cure temperature low (to minimize residual stress build-up associated with the cooldown from the cure temperature to room temperature) without excessively limiting the cure reaction due to vitrification (i.e., material glass transition temperature, Tg, exceeding cure temperature).

  12. TEDx Place Des Nations | 11 December

    CERN Multimedia

    2014-01-01

    On 11 December, Geneva will host the TEDxPlaceDesNations event.   TEDxPlaceDesNations, in the spirit of TED’s “Ideas Worth Spreading” principle, will involve innovators, humanitarians, entrepreneurs, scientists and peacemakers. The eleven speakers will share how their work can help find solutions to today’s challenges. Among the speakers will be Javier Serrano, a CERN physicist and electronics engineer. He is the co-author of the CERN Open Hardware License and the creator of the Open Hardware Repository, a web platform where companies, institutes and individuals can share their hardware designs for free. Additional information is available at the TEDxPlaceDesNations site. The detailed programme will be posted on 28 November. Seats are limited, so registration is essential. The event can be followed by live webcast here.

  13. IEEE 802.11 ECG monitoring system.

    Science.gov (United States)

    Tejero-Calado, Juan; Lopez-Casado, Carmen; Bernal-Martin, Antonio; Lopez-Gomez, Miguel; Romero-Romero, Marco; Quesada, Guillermo; Lorca, Julio; Rivas, Ramon

    2005-01-01

    New wireless technologies make possible the implementation of high level integration wireless devices which allow the replacement of traditional large wired monitoring devices. This kind of devices favours at-home hospitalization, reducing the affluence to sanitary assistance centers to make routine controls. This fact causes a really favourable social impact, especially for elder people, rural-zone inhabitant, chronic patients and handicapped people. Furthermore, it offers new functionalities to physicians and will reduce the sanitary cost. Among these functionalities, biomedical signals can be sent to other devices (screen, PDA, PC...) or processing centers, without restricting the patients' mobility. The aim of this project is the development and implementation of a reduced size multi-channel electrocardiograph based on IEEE 802.11, which allows wireless monitoring of patients, and the insertion of the information into the TCP/IP Hospital network.

  14. Frontiers in statistical quality control 11

    CERN Document Server

    Schmid, Wolfgang

    2015-01-01

    The main focus of this edited volume is on three major areas of statistical quality control: statistical process control (SPC), acceptance sampling and design of experiments. The majority of the papers deal with statistical process control, while acceptance sampling and design of experiments are also treated to a lesser extent. The book is organized into four thematic parts, with Part I addressing statistical process control. Part II is devoted to acceptance sampling. Part III covers the design of experiments, while Part IV discusses related fields. The twenty-three papers in this volume stem from The 11th International Workshop on Intelligent Statistical Quality Control, which was held in Sydney, Australia from August 20 to August 23, 2013. The event was hosted by Professor Ross Sparks, CSIRO Mathematics, Informatics and Statistics, North Ryde, Australia and was jointly organized by Professors S. Knoth, W. Schmid and Ross Sparks. The papers presented here were carefully selected and reviewed by the scientifi...

  15. [Pathological pelvic kidney. Apropos of 11 cases].

    Science.gov (United States)

    Benchekroun, A; Kasmaoui, E H; Jira, H; Iken, A; Nouini, Y; Benslimane, L; Faik, M

    2002-07-01

    The diseases ectopic kidney is a rare malformation. It can be associated with other urological or nonurological malformation. We report 11 cases observed between 1980 and 1998. They were five females and six males with a mean age of 28 years. The clinical symptomatology was dominated by pain and urinary symptoms. Diagnosis was based on the IVP data and ultrasonography. Renal stone and hynronephrosis were each associated in five cases and one patient had renal stone associated with hydronephrosis. The treatment consisted on a iliopelvic approach and extraction of the stone and or pyeloplasty. In three cases a nephrectomy was realised for muet kidney or pyonephrosis. The outcome was good in ten cases and one patient had a pyelo-ureteral secondary stenosis managed by endoscopy.

  16. A study of 11 Be an 11 Li halo nuclei by core breakup reactions

    International Nuclear Information System (INIS)

    Grevy, S.

    1997-01-01

    The study of light nuclei with large neutron excess are very useful for the understanding of nuclear matter far from stability. The nuclear halo phenomenon has been observed for the first time for Z 11 Be and 11 Li halo nuclei. In this channel, the neutron is supposed not to participate to the reaction and then, when detected, to carry out the same properties as in the halo nucleus. The deduced widths of the neutron momentum distributions are different from the one extracted from the core distributions and with the more recent theoretical models. From these studies, it is also stressed that the properties of the core are essential to understand the halo phenomenon. In particular, the correlation between the core vibrations and the halo neutron are able to explain the emergence of the halo in 11 Be. (author)

  17. PDP-11 front-end for a VAX-11/780

    International Nuclear Information System (INIS)

    Browne, M.J.; Granieri, C.; Sherden, D.J.; Weaver, L.J.

    1980-01-01

    An unpublicized feature of the VAX-11/780 is the provision for attaching a PDP-11 to the VAX UNIBUS Adapter. Doing this can give significantly improved I/O performance for applications which are limited by overhead in the VAX I/O driver rather than by the transfer speed of the UNIBUS itself. Such a system was implemented by using a PDP-11/04 as a front-end to a CAMAC data acquisition system. Both the PDP and the VAX have full access to the UNIBUS. That portion of the PDP address space that does not have UNIBUS memory can be mapped to buffers in the VAX memory; this approach allows the PDP to access VAX memory and to initiate DMA transfers directly to the VAX. The VAX also has full access to the PDP memory; a convenient means for developing and downloading the PDP software is thus provided. 5 figures

  18. Evidence of a new state in 11Be observed in the 11Li β-decay

    International Nuclear Information System (INIS)

    Madurga, M.; Borge, M.J.G.; Alcorta, M.; Fraile, L.M.; Fynbo, H.O.U.; Jonson, B.; Kirsebom, O.; Martinez-Pinedo, G.; Nilsson, T.; Nyman, G.; Perea, A.; Poves, A.; Riisager, K.; Tengblad, O.; Tengborn, E.; Van der Walle, J.

    2009-01-01

    Coincidences between charged particles emitted in the β-decay of 11 Li were observed using highly segmented detectors. The breakup channels involving three particles were studied in full kinematics allowing for the reconstruction of the excitation energy of the 11 Be states participating in the decay. In particular, the contribution of a previously unobserved state at 16.3 MeV in 11 Be has been identified selecting the α+ 7 He→α+ 6 He+n channel. The angular correlations between the α particle and the center of mass of the 6 He + n system favors spin and parity assignment of 3/2 - for this state as well as for the previously known state at 18 MeV.

  19. 1-/sup 11/C-D-glucose and related compounds

    Energy Technology Data Exchange (ETDEWEB)

    Shiue, C.Y.; Wolf, A.P.

    1982-01-26

    The novel compounds 1-/sup 11/C-D-glucose, 1-/sup 11/C-D-mannose, 1-/sup 11/C-D-galactose, 2-/sup 11/C-D-glucose, 2-/sup 11/C-D-mannose and 2-/sup 11/C-D-galactose which can be used in nuclear medicine to monitor the metabolism of glucose and galactose can be rapidly prepared by reaction of the appropriate aldose substrate with an alkali metal /sup 11/C-labeled cyanide followed by reduction with a Raney alloy in formic acid.

  20. A simple, versatile, low-cost and remotely operated apparatus for [11C]acetate, [11C]choline, [11C]methionine and [11C]PIB synthesis

    International Nuclear Information System (INIS)

    Cheung Manki; Ho Chilai

    2009-01-01

    A simple, efficient and remotely operated synthesis apparatus for carrying out routine [ 11 C]carboxylation, on-column and bubbling [ 11 C]methylation was essential for reliable, day-to-day production of [ 11 C]-labelled PET radiopharmaceuticals. We developed an in-house apparatus specifically applied to the synthesis of [ 11 C]acetate, [ 11 C]choline, [ 11 C]methionine and 2-(4'-N-[ 11 C]methylaminophenyl)-6-hydroxybenzothiazole ([ 11 C]PIB), where high radiochemical purity (≥97%) and moderate radiochemical yields (18% for [ 11 C]PIB, 41-55% for the others) could be achieved. These findings provided evidence that this was a fast, versatile and reliable apparatus suitable for a PET/CT centre with limited financial budget and hot cell space for synthesis of [ 11 C]-labelled radiopharmaceuticals

  1. Hardness in high temperature of steels ABNT H11 and ABNT H11 modified with niobium

    International Nuclear Information System (INIS)

    Goncalves, R.A.

    1984-01-01

    A method to measure the hardness of metallic materials was developed. The heating was done by the Joule effect heat dissipation in the sample, that is like an electrical resistor. A diamond penetrator with a revolution paraboloid format was used, that assure a linear relation between the load applyed and the penetration deep. Hardness tests were make in the range of 25 - 600 0 C, in the steels ABNT H11 and ABNT H11 modified with niobium, with the simultaneous register of the applied force, penetration deep and temperature. (E.G.) [pt

  2. 75 FR 47203 - Airworthiness Directives; McDonnell Douglas Corporation Model MD-11 and MD-11F Airplanes Equipped...

    Science.gov (United States)

    2010-08-05

    ... Airworthiness Directives; McDonnell Douglas Corporation Model MD- 11 and MD-11F Airplanes Equipped With General... Sec. 39.13 by adding the following new AD: 2010-16-03 McDonnell Douglas Corporation: Amendment 39... applies to McDonnell Douglas Corporation Model MD-11 and MD-11F airplanes, certified in any category...

  3. On Euclidean connections for su(1,1), suq(1,1) and the algebraic approach to scattering

    International Nuclear Information System (INIS)

    Ionescu, R.A.

    1994-11-01

    We obtain a general Euclidean connection for su(1,1) and suq(1,1) algebras. Our Euclidean connection allows an algebraic derivation for the S matrix. These algebraic S matrices reduce to the known ones in suitable circumstances. Also, we obtain a map between su(1,1) and su q (1,1) representations. (author). 8 refs

  4. Synthesis of [(11)C]Am80 via Novel Pd(0)-Mediated Rapid [(11)C]Carbonylation Using Arylboronate and [(11)C]Carbon Monoxide.

    Science.gov (United States)

    Takashima-Hirano, Misato; Ishii, Hideki; Suzuki, Masaaki

    2012-10-11

    (11)C-labeled methylbenzoates [(11)C]4a-d were synthesized using Pd(0)-mediated rapid cross-coupling reactions employing [(11)C]carbon monoxide and arylboronic acid neopentyl glycol esters 3a-d under atmospheric pressure in methanol-dimethylformamide (MeOH-DMF), in radiochemical yields of 12 ± 5-26 ± 13% (decay-corrected based on [(11)C]O). The reaction conditions were highly favorable for the synthesis of [(11)C]Am80 ([(11)C]2) and [(11)C]methyl 4-((5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)carbamoyl)benzoate ([(11)C]2-Me) using 4-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-N-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)benzamide (5), both of which produced a decay-corrected radiochemical yield (RCY) of 26 ± 13%, with >99% radiochemical purity and an average specific radioactivity of 44 GBq/μmol. The yields of [(11)C]4a, [(11)C]2-Me, and [(11)C]2 were improved by the use of a 2-fold excess of the solvents and reagents under the same conditions to give respective yields of 66 ± 8, 65 ± 7, and 48 ± 2%.

  5. The synthesis of no-carrier-added [11C]urea from [11C]carbon dioxide and application to [11C]uracil synthesis

    International Nuclear Information System (INIS)

    Chakraborty, P.K.; Mangner, T.J.; Chugani, H.T.

    1997-01-01

    No-carrier-added [ 11 C]urea has been synthesized by bubbling cyclotron-produced [ 11 C]-carbon dioxide directly into a tetrahydrofuran solution of lithium bis(trimethylsilyl)amide, followed by hydrolysis of the C-11 labeled adduct with aqueous ammonium chloride. Using this simple, one-pot method, [ 11 C]urea was produced in 55-70% radiochemical yield (decay-corrected) in 16 min following end-of-bombardment (or in 10 min following the introduction of the [ 11 C]carbon dioxide. The [ 11 C]urea thus produced was converted to [ 11 C]uracil (carrier-added) in 40-75% decay-corrected radiochemical yield by condensation with diethyl malate in presence of fuming sulfuric acid. (author)

  6. Alternative splicing of sept9a and sept9b in zebrafish produces multiple mRNA transcripts expressed throughout development.

    Directory of Open Access Journals (Sweden)

    Megan L Landsverk

    2010-05-01

    Full Text Available Septins are involved in a number of cellular processes including cytokinesis and organization of the cytoskeleton. Alterations in human septin-9 (SEPT9 levels have been linked to multiple cancers, whereas mutations in SEPT9 cause the episodic neuropathy, hereditary neuralgic amyotrophy (HNA. Despite its important function in human health, the in vivo role of SEPT9 is unknown.Here we utilize zebrafish to study the role of SEPT9 in early development. We show that zebrafish possess two genes, sept9a and sept9b that, like humans, express multiple transcripts. Knockdown or overexpression of sept9a transcripts results in specific developmental alterations including circulation defects and aberrant epidermal development.Our work demonstrates that sept9 plays an important role in zebrafish development, and establishes zebrafish as a valuable model organism for the study of SEPT9.

  7. Teaching through a Crisis: September 11 and Beyond. Occasional Paper Series 11

    Science.gov (United States)

    McKersie, Alison; Lent, Patricia; Rose, Megan; Stuart-Hunt, Rella; Edstrom, Lisa; Rothschild, Cynthia R.; Weisman, Alexandra; Delacorte, Kate; Vascellaro, Sal; Abell, Kate

    2003-01-01

    The days following September 11, 2001, were characterized for many by a startling clarity, as if someone had applied a magnified lens to life's everyday routines and every moment, every gesture, every word exchanged with friends, colleagues and family was more nuanced and precious than before. The decision to publish this volume of essays was…

  8. Linnainstallatsioonide festival "Lift 11" = Urban installations festival Lift 11 / Margit Aule, Margit Argus ; intervjueerinud Margit Mutso

    Index Scriptorium Estoniae

    Aule, Margit, 1981-

    2012-01-01

    Linnainstallatsioonide festivalist "Lift 11", installatsioonidest. Festivali kuraatorid Margit Argus ja Margit Aule ning kaaskuraatorid Maarin Ektermann ja Ingrid Ruudi pälvisid EK arhitektuuri sihtkapitali 2011. a. arhitektuurialase tegevuse preemia avaliku linnaruumi mitmekesisust märkama, kasutama ning mõtestama ärgitanud ürituse korraldamise eest

  9. Use of a human chromosome 11 radiation hybrid panel to map markers at 11q13

    International Nuclear Information System (INIS)

    Withers, D.; Richard, C. III; Meeker, T.C.; Maurer, S.; Evans, G.; Myers, R.M.; Cox, D.R.

    1990-01-01

    A human/hamster hybrid cell line containing human chromosome 11 was X-irradiated and 102-independent derivative lines were recovered. These 'radiation hybrids' contain random fragments of human chromosome 11. This radiation hybrid panel was used to score the retention of markers at band 11q13. Statistical analysis of marker co-retention patterns in the radiation hybrid panel permits a preliminary ordering and mapping of the markers used. The best order for six scored markers is: proximal - CD5 - CD20 - PGA - HST - BCL1 - SEA - distal. Additional markers are currently being scored. The six 11q13 markers above are spread over approximately 10-12 mB of DNA. The mapping data has implications for the identification of the bcl-1 gene. bcl-1 is the site of chromosome breakage in translocations associated with B lymphocytic malignancy. bcl-1 markers map at least 4 Mb away from any of four genes previously hypothesized to be activated by such translocations, thereby making them unlikely candidates for activation

  10. Cooperation between RUNX1-ETO9a and novel transcriptional partner KLF6 in upregulation of Alox5 in acute myeloid leukemia.

    Directory of Open Access Journals (Sweden)

    Russell C DeKelver

    Full Text Available Fusion protein RUNX1-ETO (AML1-ETO, RUNX1-RUNX1T1 is expressed as the result of the 8q22;21q22 translocation [t(8;21], which is one of the most common chromosomal abnormalities found in acute myeloid leukemia. RUNX1-ETO is thought to promote leukemia development through the aberrant regulation of RUNX1 (AML1 target genes. Repression of these genes occurs via the recruitment of the corepressors N-COR and SMRT due to their interaction with ETO. Mechanisms of RUNX1-ETO target gene upregulation remain less well understood. Here we show that RUNX1-ETO9a, the leukemogenic alternatively spliced transcript expressed from t(8;21, upregulates target gene Alox5, which is a gene critically required for the promotion of chronic myeloid leukemia development by BCR-ABL. Loss of Alox5 expression reduces activity of RUNX1-ETO9a, MLL-AF9 and PML-RARα in vitro. However, Alox5 is not essential for the induction of leukemia by RUNX1-ETO9a in vivo. Finally, we demonstrate that the upregulation of Alox5 by RUNX1-ETO9a occurs via the C₂H₂ zinc finger transcription factor KLF6, a protein required for early hematopoiesis and yolk sac development. Furthermore, KLF6 is specifically upregulated by RUNX1-ETO in human leukemia cells. This identifies KLF6 as a novel mediator of t(8;21 target gene regulation, providing a new mechanism for RUNX1-ETO transcriptional control.

  11. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  12. Christmas Sale on 11 and 12 December

    CERN Multimedia

    DSU Unit

    2008-01-01

    CERN Shop Are you short of ideas for Christmas presents? If so, come and have a look at the stall the CERN shop will be setting up outside Restaurant No. 1 in the Main Building on the Meyrin site on Thursday 11 and Friday 12 December from 10.30 a.m. to 4.30 p.m. Various new items will be on sale, including a new LHC booklet for the general public. In the style of a travel log, it recounts the fabulous voyage of a proton inside the accelerator. The text is complemented by eye-catching photos and illustrations and is available in English or French. The 2009 calendar, based on the same theme, will also be on sale at 10 CHF. Special reductions will be available on certain items. So come and stock up on your Christmas presents at the CERN shop. Bookshop If you are looking for an idea for your Christmas gifts, the Bookshop of the Central Library offers you a wide choice of titles in Physics, ...

  13. Geothermal Progress Monitor report No. 11

    Energy Technology Data Exchange (ETDEWEB)

    1989-12-01

    This issue of the Geothermal Progress Monitor (GPM) is the 11th since the inception of the publication in 1980. It continues to synthesize information on all aspects of geothermal development in this country and abroad to permit identification and quantification of trends in the use of this energy technology. In addition, the GPM is a mechanism for transferring current information on geothermal technology development to the private sector, and, over time, provides a historical record for those interested in the development pathway of the resource. In sum, the Department of Energy makes the GPM available to the many diverse interests that make up the geothermal community for the multiple uses it may serve. This issue of the GPM points up very clearly how closely knit many of those diverse interests have become. It might well be called an international issue'' since many of its pages are devoted to news of geothermal development abroad, to the efforts of the US industry to participate in overseas development, to the support given those efforts by federal and state agencies, and to the formation of the International Geothermal Association (IGA). All of these events indicate that the geothermal community has become truly international in character, an occurrence that can only enhance the future of geothermal energy as a major source of energy supply worldwide. 15 figs.

  14. Reactor physics special problem in 11. ENFIR

    International Nuclear Information System (INIS)

    Leszczynski, Francisco

    1997-01-01

    In this report, the computation method and the results of the work performed of the special topic on reactor physics proposed for the 11. ENFIR is presented. MCNP 4.2 has been adopted as the only code to perform the calculations. The full core of the IPEN-MB-1 critical unit has been modelled without important approximations. The specifications given by the Organizer Commission of the Special Topic were followed. The nuclear libraries adopted were those included on the MCNPDAT package, mainly from ENDF/B-V, except indium data, not included in this package. For indium, data obtained from LANL, based on ENDF/B-VI were used. The results are: critical position of the control banks assuming simultaneous movement: percent of extraction: (49±1)% ; excess of reactivity of the core: ρ =( 3590 ±50)pcm ; total reactivity of the one control rod bank: ρ= (4000±50) pcm. The reactivity curve of the control rods is included also. (author)

  15. Metallophilic interactions in polymeric group 11 thiols

    Science.gov (United States)

    Kolari, Kalle; Sahamies, Joona; Kalenius, Elina; Novikov, Alexander S.; Kukushkin, Vadim Yu.; Haukka, Matti

    2016-10-01

    Three polymeric group 11 transition metal polymers featuring metallophilic interactions were obtained directly via self-assembly of metal ions and 4-pyridinethiol ligands. In the cationic [Cu2(S-pyH)4]n2+ with [ZnCl4]n2- counterion (1) and in the neutral [Ag(S-py) (S-pyH)]n (2) 4-pyridinethiol (S-pyH) and its deprotonated form (S-py) are coordinated through the sulfur atom. Both ligands are acting as bridging ligands linking the metal centers together. In the solid state, the gold(I) polymer [Au(S-pyH)2]Cl (3) consists of the repeating cationic [Au(S-pyH)2]+ units held together by aurophilic interactions. Compound 1 is a zig-zag chain, whereas the metal chains in the structures of 2 and 3 are linear. The protonation level of the thiol ligand had an impact on the crystallization of polymers. Both nature of the metal center and reaction conditions affected the polymerization. QTAIM analysis confirmed direct metal-metal contacts only in polymers 1 and 3. In polymer 2, no theoretical evidence of argentophilic contacts was obtained even though the AgṡṡṡAg distance was found to be less than sum of the Bondi's van der Waals radius of silver.

  16. My Son 22.10.11

    Directory of Open Access Journals (Sweden)

    Rebecca Baillie

    2013-01-01

    Full Text Available 'My Son 22.10.11' was made immediately following a miscarriage 8 weeks into pregnancy. After bleeding lightly for a couple of hours, I went to the toilet and a large bloody mass fell from within me. I knew that I could not flush this away, and that to retrieve the mass was my only chance to connect with the unborn foetus. I fished the contents from the bottom of the toilet bowl using my hands and carried them into my small studio. I found some paper and began to dissect the mass. At the centre, I found the tiny, cold, hard foetus. I kissed it and then began to use it as a kind of painting tool, drawing the outline of the lost child using its very own flesh and blood. I knew that to create a lasting and tangible portrait of 'my son' was the best way to understand the somewhat unreal and fleeting experience of miscarriage. I thought of Frida Kahlo while making the work, thinking 'thank God' that I had a reference to miscarriage before it happened to me. I also thought of my childhood days spent on our family pig farm, and of all the dead pig foetuses that I had seen at various stages of development. Before the miscarriage, I thought little about the subject; afterwards, I recognise the profundity of the creation of a life that is never born. The experience is so common, yet so very rarely discussed or depicted.

  17. Solvent Hold Tank Sample Results For MCU-11-1452, MCU-11-1453, MCU-11-1454, MCU-11-1455, MCU-11-1456 And MCU-11-1457

    International Nuclear Information System (INIS)

    Peters, T.; Fondeur, F.; Fink, S.

    2012-01-01

    Solvent Hold Tank (SHT) samples are sent to Savannah River National Laboratory (SRNL) to examine solvent composition changes over time. On December 5, 2011, Operations personnel delivered six samples from the SHT (MCU-11-1452 through -1457) for analysis. These samples are intended to verify that the solvent is within the specified composition range. The results from the analyses are presented in this document. Samples were received in p-nut vials containing ∼10 mL each. Once taken into the Shielded Cells, the samples were combined. Samples were removed for analysis by density, semi-volatile organic analysis (SVOA), high performance liquid chromatography (HPLC), and Fourier-Transform Infra-Red spectroscopy (FTIR). Details for the work are contained in a controlled laboratory notebook. Each of the six p-nut vials contained a single phase, with no apparent solids contamination or cloudiness. Table 1 contains the results of the analyses for the combined samples. A duplicate density measurement of the organic phase gave a result of 0.844 g/mL (1.2% residual standard deviation - RSD). Using the density as a starting point, we know that the Isopar(reg s ign) L should be slightly higher than nominal and the other components should be slightly lower than nominal. The results as a whole are internally consistent. All measurements indicate Isopar(reg s ign) L higher than nominal, and Modifier lower than nominal. The extractant result is higher than expected - given the other results, the extractant concentration should be under nominal values. Using the measured density as well as the Isopar(reg s ign) L and Modifier concentrations from the FTIR results, we calculate an extractant concentration of 6888 mg/L. This value is outside the analytical uncertainty of the reported HPLC value. Given the other results, this most likely indicates that the HPLC extractant result was biased high. When compared to the MCU density target of 0.845 g/mL, there is no need to add an Isopar

  18. K9A1 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  19. Involvement of EZH2, SUV39H1, G9a and associated molecules in pathogenesis of urethane induced mouse lung tumors: Potential targets for cancer control

    International Nuclear Information System (INIS)

    Pandey, Manuraj; Sahay, Satya; Tiwari, Prakash; Upadhyay, Daya S.; Sultana, Sarwat; Gupta, Krishna P.

    2014-01-01

    In the present study, we showed the correlation of EZH2, SUV39H1 or G9a expression and histone modifications with the urethane induced mouse lung tumorigenesis in the presence or absence of antitumor agent, inositol hexaphosphate (IP6). Tumorigenesis and the molecular events involved therein were studied at 1, 4, 12 or 36 weeks after the exposure. There were no tumors at 1 or 4 weeks but tumors started appearing at 12 weeks and grew further till 36 weeks after urethane exposure. Among the molecular events, upregulation of EZH2 and SUV39H1 expressions appeared to be time dependent, but G9a expression was altered significantly only at later stages of 12 or 36 weeks. Alteration in miR-138 expression supports the upregulation of its target, EZH2. H3K9me2, H3K27me3 or H4K20me3 was found to be altered at 12 or 36 weeks. However, ChIP analysis of p16 and MLH1 promoters showed their binding with H3K9me2 and H3K27me3 which was maximum at 36 weeks. Thus, histone modification and their interactions with gene promoter resulted in the reduced expression of p16 and MLH1. IP6 prevented the incidence and the size of urethane induced lung tumors. IP6 also prevented the urethane induced alterations in EZH2, SUV39H1, G9a expressions and histone modifications. Our results suggest that the alterations in the histone modification pathways involving EZH2 and SUV39H1 expressions are among the early events in urethane induced mouse lung tumorigenesis and could be exploited for cancer control. - Highlights: • Urethane induces mouse lung tumor in a time dependent manner. • EZH2, SUV39H1, G9a induced by urethane and progress with time • Downregulation of miRNA-138 supports the EZH2 upregulation. • Methylation of histones showed a consequence of upregulated EZH2, SUV39H1 and G9a. • IP6 inhibits urethane induced changes and prevents tumor development

  20. Involvement of EZH2, SUV39H1, G9a and associated molecules in pathogenesis of urethane induced mouse lung tumors: Potential targets for cancer control

    Energy Technology Data Exchange (ETDEWEB)

    Pandey, Manuraj; Sahay, Satya; Tiwari, Prakash [Carcinogenesis Laboratory, CSIR-Indian Institute of Toxicology Research, Mahatma Gandhi Marg, Lucknow –226001 (India); Upadhyay, Daya S. [Laboratory Animals Services, CSIR-Central Drug Research Institute, Sitapur Road, Lucknow (India); Sultana, Sarwat [Dept. Medical Elementology and Toxicology, Jamia Hamdard, Hamdard Nagar, New Delhi (India); Gupta, Krishna P., E-mail: krishnag522@yahoo.co.in [Carcinogenesis Laboratory, CSIR-Indian Institute of Toxicology Research, Mahatma Gandhi Marg, Lucknow –226001 (India)

    2014-10-15

    In the present study, we showed the correlation of EZH2, SUV39H1 or G9a expression and histone modifications with the urethane induced mouse lung tumorigenesis in the presence or absence of antitumor agent, inositol hexaphosphate (IP6). Tumorigenesis and the molecular events involved therein were studied at 1, 4, 12 or 36 weeks after the exposure. There were no tumors at 1 or 4 weeks but tumors started appearing at 12 weeks and grew further till 36 weeks after urethane exposure. Among the molecular events, upregulation of EZH2 and SUV39H1 expressions appeared to be time dependent, but G9a expression was altered significantly only at later stages of 12 or 36 weeks. Alteration in miR-138 expression supports the upregulation of its target, EZH2. H3K9me2, H3K27me3 or H4K20me3 was found to be altered at 12 or 36 weeks. However, ChIP analysis of p16 and MLH1 promoters showed their binding with H3K9me2 and H3K27me3 which was maximum at 36 weeks. Thus, histone modification and their interactions with gene promoter resulted in the reduced expression of p16 and MLH1. IP6 prevented the incidence and the size of urethane induced lung tumors. IP6 also prevented the urethane induced alterations in EZH2, SUV39H1, G9a expressions and histone modifications. Our results suggest that the alterations in the histone modification pathways involving EZH2 and SUV39H1 expressions are among the early events in urethane induced mouse lung tumorigenesis and could be exploited for cancer control. - Highlights: • Urethane induces mouse lung tumor in a time dependent manner. • EZH2, SUV39H1, G9a induced by urethane and progress with time • Downregulation of miRNA-138 supports the EZH2 upregulation. • Methylation of histones showed a consequence of upregulated EZH2, SUV39H1 and G9a. • IP6 inhibits urethane induced changes and prevents tumor development.