Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Nuclear magnetic resonance of perfused tissue
International Nuclear Information System (INIS)
Harpen, M.D.; Allison, R.C.
1986-01-01
The effect of perfusion on the NMR signal observed in NMR imaging is studied in a phantom and in two isolated perfused canine lungs. It is observed that perfusion in tissue has little effect on longitudinal relaxation times. Transverse relaxation rates are observed to correlate linearly with rates of perfusion, in accordance with a model presented. (author)
International Nuclear Information System (INIS)
Liang Hong; Chen Ju; Liu Sheng; Zeng Shiquan
2000-01-01
Myocardial blood perfusion (MBP) ECT and quantitative analysis were performed in 10 canines with experimental acute myocardial infarct (AMI). The accuracy of main myocardial quantitative index, including defect volume (DV) and defect fraction (DF), was estimated and correlated with histochemical staining (HS) of infarcted area. Other 21/AMI canines were divided into Nd:YAG laser trans-myocardial revascularization treated group LTMR and control group. All canines were performed MBP ECT after experimental AMI. Results found that the infarcted volume (IV) measured by HS has well correlated (r 0.88) with DV estimated by myocardial quantitative analysis. But the DF values calculated by both methods was not significantly different (t = 1.28 P > 0.05). In LTMR group 27.5% +- 3.9%, the DF is smaller than control group 32.1% +- 4.6% (t = 2.49 P 99m Tc-MIBI myocardial perfusion SPECT and quantitative study can accurately predict the myocardial blood flow and magnitude of injured myocardium. Nd:YAG LTMR could improve myocardial blood perfusion of ischemic myocardium and decrease effectively the infarct areas
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Tokihiro, E-mail: toyamamoto@ucdavis.edu [Department of Radiation Oncology, University of California Davis School of Medicine, Sacramento, California 95817 (United States); Kent, Michael S.; Wisner, Erik R. [Department of Surgical and Radiological Sciences, University of California Davis School of Veterinary Medicine, Davis, California 95616 (United States); Johnson, Lynelle R.; Stern, Joshua A. [Department of Medicine and Epidemiology, University of California Davis School of Veterinary Medicine, Davis, California 95616 (United States); Qi, Lihong [Department of Public Health Sciences, University of California Davis, Davis, California 95616 (United States); Fujita, Yukio [Department of Radiation Oncology, Tokai University, Isehara, Kanagawa 259-1193 (Japan); Boone, John M. [Department of Radiology, University of California Davis School of Medicine, Sacramento, California 95817 (United States)
2016-07-15
Purpose: Radiotherapy (RT) that selectively avoids irradiating highly functional lung regions may reduce pulmonary toxicity, which is substantial in lung cancer RT. Single-energy computed tomography (CT) pulmonary perfusion imaging has several advantages (e.g., higher resolution) over other modalities and has great potential for widespread clinical implementation, particularly in RT. The purpose of this study was to establish proof-of-principle for single-energy CT perfusion imaging. Methods: Single-energy CT perfusion imaging is based on the following: (1) acquisition of end-inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast agents, (2) deformable image registration (DIR) for spatial mapping of those two CT image data sets, and (3) subtraction of the precontrast image data set from the postcontrast image data set, yielding a map of regional Hounsfield unit (HU) enhancement, a surrogate for regional perfusion. In a protocol approved by the institutional animal care and use committee, the authors acquired CT scans in the prone position for a total of 14 anesthetized canines (seven canines with normal lungs and seven canines with diseased lungs). The elastix algorithm was used for DIR. The accuracy of DIR was evaluated based on the target registration error (TRE) of 50 anatomic pulmonary landmarks per subject for 10 randomly selected subjects as well as on singularities (i.e., regions where the displacement vector field is not bijective). Prior to perfusion computation, HUs of the precontrast end-inspiratory image were corrected for variation in the lung inflation level between the precontrast and postcontrast end-inspiratory CT scans, using a model built from two additional precontrast CT scans at end-expiration and midinspiration. The authors also assessed spatial heterogeneity and gravitationally directed gradients of regional perfusion for normal lung subjects and diseased lung subjects using a two-sample two-tailed t
Yamamoto, Tokihiro; Kent, Michael S; Wisner, Erik R; Johnson, Lynelle R; Stern, Joshua A; Qi, Lihong; Fujita, Yukio; Boone, John M
2016-07-01
Radiotherapy (RT) that selectively avoids irradiating highly functional lung regions may reduce pulmonary toxicity, which is substantial in lung cancer RT. Single-energy computed tomography (CT) pulmonary perfusion imaging has several advantages (e.g., higher resolution) over other modalities and has great potential for widespread clinical implementation, particularly in RT. The purpose of this study was to establish proof-of-principle for single-energy CT perfusion imaging. Single-energy CT perfusion imaging is based on the following: (1) acquisition of end-inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast agents, (2) deformable image registration (DIR) for spatial mapping of those two CT image data sets, and (3) subtraction of the precontrast image data set from the postcontrast image data set, yielding a map of regional Hounsfield unit (HU) enhancement, a surrogate for regional perfusion. In a protocol approved by the institutional animal care and use committee, the authors acquired CT scans in the prone position for a total of 14 anesthetized canines (seven canines with normal lungs and seven canines with diseased lungs). The elastix algorithm was used for DIR. The accuracy of DIR was evaluated based on the target registration error (TRE) of 50 anatomic pulmonary landmarks per subject for 10 randomly selected subjects as well as on singularities (i.e., regions where the displacement vector field is not bijective). Prior to perfusion computation, HUs of the precontrast end-inspiratory image were corrected for variation in the lung inflation level between the precontrast and postcontrast end-inspiratory CT scans, using a model built from two additional precontrast CT scans at end-expiration and midinspiration. The authors also assessed spatial heterogeneity and gravitationally directed gradients of regional perfusion for normal lung subjects and diseased lung subjects using a two-sample two-tailed t-test. The mean TRE
International Nuclear Information System (INIS)
Yamamoto, Tokihiro; Kent, Michael S.; Wisner, Erik R.; Johnson, Lynelle R.; Stern, Joshua A.; Qi, Lihong; Fujita, Yukio; Boone, John M.
2016-01-01
Purpose: Radiotherapy (RT) that selectively avoids irradiating highly functional lung regions may reduce pulmonary toxicity, which is substantial in lung cancer RT. Single-energy computed tomography (CT) pulmonary perfusion imaging has several advantages (e.g., higher resolution) over other modalities and has great potential for widespread clinical implementation, particularly in RT. The purpose of this study was to establish proof-of-principle for single-energy CT perfusion imaging. Methods: Single-energy CT perfusion imaging is based on the following: (1) acquisition of end-inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast agents, (2) deformable image registration (DIR) for spatial mapping of those two CT image data sets, and (3) subtraction of the precontrast image data set from the postcontrast image data set, yielding a map of regional Hounsfield unit (HU) enhancement, a surrogate for regional perfusion. In a protocol approved by the institutional animal care and use committee, the authors acquired CT scans in the prone position for a total of 14 anesthetized canines (seven canines with normal lungs and seven canines with diseased lungs). The elastix algorithm was used for DIR. The accuracy of DIR was evaluated based on the target registration error (TRE) of 50 anatomic pulmonary landmarks per subject for 10 randomly selected subjects as well as on singularities (i.e., regions where the displacement vector field is not bijective). Prior to perfusion computation, HUs of the precontrast end-inspiratory image were corrected for variation in the lung inflation level between the precontrast and postcontrast end-inspiratory CT scans, using a model built from two additional precontrast CT scans at end-expiration and midinspiration. The authors also assessed spatial heterogeneity and gravitationally directed gradients of regional perfusion for normal lung subjects and diseased lung subjects using a two-sample two-tailed t
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
Gillespie, Rosalyn; Chantier, Nariane
1994-12-08
Growing concern over the rising incidence of malignant melanoma has brought about a need for information on this disorder and the treatment available. Isolated limb perfusion is a relatively new technique used in only a few hospitals. An increased knowledge base will lead to a better understanding of the nursing care required and to a more in-depth care plan.
DEFF Research Database (Denmark)
Hansen, Anders E; Kristensen, Annemarie T; Law, Ian
2012-01-01
To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated.......To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated....
VANGINKEL, RJ; HOEKSTRA, HJ; MEUTSTEGE, FJ; OOSTERHUIS, JW; UGES, DRA; KOOPS, HS
To increase the effect of cisplatin on locoregional osteosarcoma, the short-term effect of hyperthermic isolated regional perfusion (HIRP) with cisplatin (30 mg/L extremity volume) was studied in 28 dogs with spontaneous osteogenic sarcoma, using clinical, radiological, and histological parameters.
Characterizing potential heart agents with an isolated perfused heart system
International Nuclear Information System (INIS)
Pendleton, D.B.; Sands, H.; Gallagher, B.M.; Camin, L.L.
1984-01-01
The authors have used an isolated perfused heart system for characterizing potential myocardial perfusion radiopharamaceuticals. Rabbit or guinea pig (GP) hearts are removed and perfused through the aorta with a blood-free buffer. Heart rate and ventricular pressure are monitored as indices of viability. Tc-99m-MAA is 96-100% retained in these hearts, and Tc-99m human serum albumin shows less than 5% extraction. Tl-201 is 30-40% extracted. It is known that in-vivo, Tc-99m(dmpe)/sub 2/Cl/sub 2//sup +/ is taken up by rabbit heart but not by GP or human heart. Analogous results are obtained with the isolated perfused heart model, where the complex is extracted well by the isolated rabbit heart (24%) but not by the GP heart (<5%). Values are unchanged if human, rabbit or GP blood is mixed and co-injected with the complex. Tc-99m)dmpe)/sub 3//sup +/ is also taken up by rabbit but not by GP hearts in-vivo. However, isolated perfused hearts of both species extract this complex well (45-52%). Heart uptake is diminished to <7% if the complex is pre-equilibrated with human blood. GP blood produces a moderate inhibition (in GP hearts only) and rabbit blood has no effect. This suggests that a human or GP blood factor may have a significant effect on heart uptake of this complex. Tc-99m(CN-t-butyl)/sub 6//sup +/ is taken up well by both rabbit and GP hearts in-vivo, and is extracted 100% by both isolated perfused hearts. Heart retention remains high (73-75%) in the presence of human blood
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, T; Boone, J [University of California Davis School of Medicine, Sacramento, CA (United States); Kent, M; Wisner, E [University of California Davis School of Veterinary Medicine, Davis, CA (United States); Fujita, Y [Tokai University, Isehara (Japan)
2015-06-15
Purpose: Pulmonary perfusion imaging has provided significant insights into pulmonary diseases, and can be useful in radiotherapy. The purpose of this study was to prospectively establish proof-of-principle in a canine model for single-energy CT-based perfusion imaging, which has the potential for widespread clinical implementation. Methods: Single-energy CT perfusion imaging is based on: (1) acquisition of inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast medium, (2) deformable image registration (DIR) of the two CT image data sets, and (3) subtraction of the pre-contrast image from post-contrast image, yielding a map of Hounsfield unit (HU) enhancement. These subtraction image data sets hypothetically represent perfused blood volume, a surrogate for perfusion. In an IACUC-approved clinical trial, we acquired pre- and post-contrast CT scans in the prone posture for six anesthetized, mechanically-ventilated dogs. The elastix algorithm was used for DIR. The registration accuracy was quantified using the target registration errors (TREs) for 50 pulmonary landmarks in each dog. The gradient of HU enhancement between gravity-dependent (ventral) and non-dependent (dorsal) regions was evaluated to quantify the known effect of gravity, i.e., greater perfusion in ventral regions. Results: The lung volume difference between the two scans was 4.3±3.5% on average (range 0.3%–10.1%). DIR demonstrated an average TRE of 0.7±1.0 mm. HU enhancement in lung parenchyma was 34±10 HU on average and varied considerably between individual dogs, indicating the need for improvement of the contrast injection protocol. HU enhancement in ventral (gravity-dependent) regions was found to be greater than in dorsal regions. A population average ventral-to-dorsal gradient of HU enhancement was strong (R{sup 2}=0.94) and statistically significant (p<0.01). Conclusion: This canine study demonstrated relatively accurate DIR and a strong ventral
International Nuclear Information System (INIS)
Yamamoto, T; Boone, J; Kent, M; Wisner, E; Fujita, Y
2015-01-01
Purpose: Pulmonary perfusion imaging has provided significant insights into pulmonary diseases, and can be useful in radiotherapy. The purpose of this study was to prospectively establish proof-of-principle in a canine model for single-energy CT-based perfusion imaging, which has the potential for widespread clinical implementation. Methods: Single-energy CT perfusion imaging is based on: (1) acquisition of inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast medium, (2) deformable image registration (DIR) of the two CT image data sets, and (3) subtraction of the pre-contrast image from post-contrast image, yielding a map of Hounsfield unit (HU) enhancement. These subtraction image data sets hypothetically represent perfused blood volume, a surrogate for perfusion. In an IACUC-approved clinical trial, we acquired pre- and post-contrast CT scans in the prone posture for six anesthetized, mechanically-ventilated dogs. The elastix algorithm was used for DIR. The registration accuracy was quantified using the target registration errors (TREs) for 50 pulmonary landmarks in each dog. The gradient of HU enhancement between gravity-dependent (ventral) and non-dependent (dorsal) regions was evaluated to quantify the known effect of gravity, i.e., greater perfusion in ventral regions. Results: The lung volume difference between the two scans was 4.3±3.5% on average (range 0.3%–10.1%). DIR demonstrated an average TRE of 0.7±1.0 mm. HU enhancement in lung parenchyma was 34±10 HU on average and varied considerably between individual dogs, indicating the need for improvement of the contrast injection protocol. HU enhancement in ventral (gravity-dependent) regions was found to be greater than in dorsal regions. A population average ventral-to-dorsal gradient of HU enhancement was strong (R"2=0.94) and statistically significant (p<0.01). Conclusion: This canine study demonstrated relatively accurate DIR and a strong ventral
Energy Technology Data Exchange (ETDEWEB)
Claiborne, J.B. (Miami Univ., Coral Gables, FL (USA)); Evans, D.H. (Mt. Desert Island Biological Laboratory, Salsbury Cove, ME, USA)
1981-06-01
In vivo branchial blood pressure and unidirectional efflux values for NaCl were determined in the marine teleost, Myoxocephalus octodecimspinosus. Utilizing an isolated, perfused head preparation, perfused at in vivo pressure levels, NaCl efflux was measured and compared to in vivo values. The effect of variations in perfusion or irrigation rates on the ion efflux across the gills of the isolated head was also studied. The efflux of /sup 22/Na from the isolated, perfused head was found to be similar to in vivo values and dependent on perfusion flow and pressure. In vitro /sup 36/Cl efflux was lower than the efflux from intact animals and was determined to be flow/pressure independent. Irrigation rate changes at all rates tested did not affect the unidirectional efflux of either ion.
International Nuclear Information System (INIS)
Claiborne, J.B.; Evans, D.H.
1981-01-01
In vivo branchial blood pressure and unidirectional efflux values for NaCl were determined in the marine teleost, Myoxocephalus octodecimspinosus. Utilizing an isolated, perfused head preparation, perfused at in vivo pressure levels, NaCl efflux was measured and compared to in vivo values. The effect of variations in perfusion or irrigation rates on the ion efflux across the gills of the isolated head was also studied. The efflux of 22 Na from the isolated, perfused head was found to be similar to in vivo values and dependent on perfusion flow and pressure. In vitro 36 Cl efflux was lower than the efflux from intact animals and was determined to be flow/pressure independent. Irrigation rate changes at all rates tested did not affect the unidirectional efflux of either ion. (Auth.)
Sulphonylurea drugs reduce hypoxic damage in the isolated perfused rat kidney.
Engbersen, R; Moons, M M; Wouterse, A C; Dijkman, H B; Kramers, C; Smits, P; Russel, F G
2000-08-01
Sulphonylurea drugs have been shown to protect against hypoxic damage in isolated proximal tubules of the kidney. In the present study we investigated whether these drugs can protect against hypoxic damage in a whole kidney preparation. Tolbutamide (200 microM) and glibenclamide (10 microM) were applied to the isolated perfused rat kidney prior to changing the gassing from oxygen to nitrogen for 30 min. Hypoxic perfusions resulted in an increased fractional excretion of glucose (FE % glucose 14.3+/-1.5 for hypoxic perfusions vs 4.9+/-1.6 for normoxic perfusions, mean +/- s.e. mean, P<0.05), which could be completely restored by 200 microM tolbutamide (5.7+/-0.4 for tolbutamide vs 14.3+/-1.5 for untreated hypoxic kidneys, P<0.01). Furthermore, tolbutamide reduced the total amount of LDH excreted in the urine (220+/-100 mU for tolbutamide vs. 1220+/-160 mU for untreated hypoxic kidneys, P<0.01). Comparable results were obtained with glibenclamide (10 microM). In agreement with the effect on functional parameters, ultrastructural analysis of proximal tubules showed increased brush border preservation in tolbutamide treated kidneys compared to untreated hypoxic kidneys. We conclude that glibenclamide and tolbutamide are both able to reduce hypoxic damage to proximal tubules in the isolated perfused rat kidney when applied in the appropriate concentrations.
Reactivity of the isolated perfused rat tail vascular bed
Directory of Open Access Journals (Sweden)
A.S. França
1997-07-01
Full Text Available Isolated segments of the perfused rat tail artery display a high basal tone when compared to other isolated arteries such as the mesenteric and are suitable for the assay of vasopressor agents. However, the perfusion of this artery in the entire tail has not yet been used for functional studies. The main purpose of the present study was to identify some aspects of the vascular reactivity of the rat tail vascular bed and validate this method to measure vascular reactivity. The tail severed from the body was perfused with Krebs solution containing different Ca2+ concentrations at different flow rates. Rats were anesthetized with sodium pentobarbital (65 mg/kg and heparinized (500 U. The tail artery was dissected near the tail insertion, cannulated and perfused with Krebs solution plus 30 µM EDTA at 36oC and 2.5 ml/min and the procedures were started after equilibration of the perfusion pressure. In the first group a dose-response curve to phenylephrine (PE (0.5, 1, 2 and 5 µg, bolus injection was obtained at different flow rates (1.5, 2.5 and 3.5 ml/min. The mean perfusion pressure increased with flow as well as PE vasopressor responses. In a second group the flow was changed (1.5, 2, 2.5, 3 and 3.5 ml/min at different Ca2+ concentrations (0.62, 1.25, 2.5 and 3.75 mM in the Krebs solution. Increasing Ca2+ concentrations did not alter the flow-pressure relationship. In the third group a similar protocol was performed but the rat tail vascular bed was perfused with Krebs solution containing PE (0.1 µg/ml. There was an enhancement of the effect of PE with increasing external Ca2+ and flow. PE vasopressor responses increased after endothelial damage with air and CHAPS, suggesting an endothelial modulation of the tone of the rat tail vascular bed. These experiments validate the perfusion of the rat tail vascular bed as a method to investigate vascular reactivity
Phosphorus NMR of isolated perfused morris hepatomas
International Nuclear Information System (INIS)
Graham, R.A.; Meyer, R.A.; Brown, T.R.; Sauer, L.A.
1986-01-01
The authors are developing techniques for the study of perfused solid tumors by NMR. Tissue-isolated solid hepatomas were grown to 1-2 cm diameter as described previously. The arterial supply was isolated and the tumors perfused (0.5 - 1.0 ml/min) in vitro at 25 C with a 15% suspension of red blood cells in Krebs-Henseliet solution. 31 P-NMR spectra were acquired at 162 MHz in a specially-designed NMR probe using a solenoidal coil. Intracellular pH (monitored from the chemical shift of inorganic phosphate) and ATP levels were stable for up to 6 hrs during perfusion. During 30 min of global ischemia, ATP decreased by 75% and pH fell from 7.0 to 6.7. These changes were reversed by 1 hr reperfusion. In addition to ATP and phosphate, the spectra included a large resonance due to phosphomonoesters, as well as peaks consistent with glycerylphosphocholine, glyceryl-phosphoethanolamine, phosphocreatine, NAD, and UDPG. However, the most novel feature of the spectra was the presence of an unidentified peak in the phosphonate region (+ 16.9 ppm). The peak was not present in spectra of muscle, liver, brain, kidney, or fat tissues excised from the same animals. They are presently attempting to identify the compound that gives rise to this peak and to establish its metabolic origin
Morita, Hiroshi; Zipes, Douglas P; Morita, Shiho T; Wu, Jiashin
2014-12-01
The junction between the coronary sinus (CS) musculature and both atria contributes to initiation of atrial tachyarrhythmias. The current study investigated the effects of CS isolation from the atria by radiofrequency catheter ablation on the induction and maintenance of atrial fibrillation (AF). Using an optical mapping system, we mapped action potentials at 256 surface sites in 17 isolated and arterially perfused canine atrial tissues containing the entire musculature of the CS, right atrial septum, posterior left atrium, left inferior pulmonary vein, and vein of Marshal. Rapid pacing from each site before and after addition of acetylcholine (0.5 μmol/L) was applied to induce AF. Epicardial radiofrequency catheter ablation at CS-atrial junctions isolated the CS from the atria. Rapid pacing induced sustained AF in all tissues after acetylcholine. Microreentry within the CS drove AF in 88% of preparations. Reentries associated with the vein of Marshall (29%), CS-atrial junctions (53%), right atrium (65%), and pulmonary vein (76%) (frequently with 2-4 simultaneous circuits) were additional drivers of AF. Radiofrequency catheter ablation eliminated AF in 13 tissues before acetylcholine (Patrial tissue. The results suggest that CS can be a substrate of recurrent AF in patients after pulmonary vein isolation and that CS isolation might help prevent recurrent AF. © 2014 American Heart Association, Inc.
In vitro activity of difloxacin against canine bacterial isolates
Hoven, van den J.R.; Wagenaar, J.A.; Walker, R.D.
2000-01-01
The in vitro activity of difloxacin against canine bacterial isolates from clinical cases was studied in the United States and The Netherlands. Minimal inhibitory concentrations (MIC), the postantibiotic effect, the effect of pH on antimicrobial activity, and the bacterial killing rate tests were
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
Energy Technology Data Exchange (ETDEWEB)
Reske, S.N.; Schoen, S.; Schmitt, W.; Knopp, R.; Winkler, C.; Machulla, H.J.
1986-08-01
The effect of regional myocardial perfusion and flow-independent adrenergic stimulation, as well as lactate-mediated inhibition of cardiac lipolysis, on cardiac IPPA uptake and metabolism was examined in canine hearts (flow studies) and in the isolated perfused Langendorff rat heart (metabolic interventions). In both normal and ischaemic myocardium, local perfusion is a major determinant of cardiac IPPA uptake. In pacing-induced hyperaemia, the strict flow-dependence of cardiac IPPA uptake is not preserved. Adrenergic stimulation raises the rate of oxidation of both palmitic acid /sup 14/C and IPPA. This change is reflected by increased metabolite production released into the perfusate and radioactivity clearance recorded externally. Lactate in high concentrations exerts the opposite effect on cardiac free fatty acid oxidation. IPPA is stored in this condition preferentially in tissue phospholipids and triglycerides.
International Nuclear Information System (INIS)
Reske, S.N.; Schoen, S.; Schmitt, W.; Knopp, R.; Winkler, C.; Machulla, H.J.
1986-01-01
The effect of regional myocardial perfusion and flow-independent adrenergic stimulation, as well as lactate-mediated inhibition of cardiac lipolysis, on cardiac IPPA uptake and metabolism was examined in canine hearts (flow studies) and in the isolated perfused Langendorff rat heart (metabolic interventions). In both normal and ischaemic myocardium, local perfusion is a major determinant of cardiac IPPA uptake. In pacing-induced hyperaemia, the strict flow-dependence of cardiac IPPA uptake is not preserved. Adrenergic stimulation raises the rate of oxidation of both palmitic acid 14 C and IPPA. This change is reflected by increased metabolite production released into the perfusate and radioactivity clearance recorded externally. Lactate in high concentrations exerts the opposite effect on cardiac free fatty acid oxidation. IPPA is stored in this condition preferentially in tissue phospholipids and triglycerides. (orig.)
desensitisation and calcium-sensitivity in the isolated perfused rat ...
African Journals Online (AJOL)
Dr Olaleye
-induced desensitisation to noradrenaline were studied in the isolated perfused rat tail artery. Responses to the activators noradrenaline (NA). (3μM) and potassium chloride (KCl) (100mM) were obtained in Ca2+-buffered saline. Activators ...
Directory of Open Access Journals (Sweden)
Catherine A. Blunt
2013-05-01
Full Text Available Successful treatment of canine pyoderma has become compromised owing to the development of antimicrobial resistance with accompanying recurrence of infection. Canine skin samples submitted to a veterinary diagnostic laboratory for microbiological culture and sensitivity between January 2007 and June 2010, from which Staphylococcus intermedius was isolated, were selected for this investigation. Antimicrobial resistance of S. intermedius was most prevalent with reference to ampicillin followed by resistance to tetracycline and then potentiated sulphonamides. In general, antimicrobial resistance was low and very few methicillin-resistant isolates were detected. Temporal trends were not noted, except for ampicillin, with isolates becoming more susceptible, and potentiated sulphonamides (co-trimoxazole, with isolates becoming more resistant. In general, both the Kirby–Bauer disc diffusion and broth dilution minimum inhibitory concentration tests yielded similar results for the antimicrobial agents tested. The main difference was evident in the over-estimation of resistance by the Kirby–Bauer test for ampicillin, co-trimoxazole, penicillin and doxycycline. Knowledge of trends in bacterial resistance is important for veterinarians when presented with canine pyoderma. Analysis of antimicrobial susceptibility profiles of S. intermedius isolated from canine pyodermas will guide veterinarians’ use of the most appropriate agent and encourage prudent use of antimicrobials in companion animals.
The isolated perfused human skin flap model: A missing link in skin penetration studies?
Ternullo, Selenia; de Weerd, Louis; Flaten, Gøril Eide; Holsæter, Ann Mari; Škalko-Basnet, Nataša
2017-01-01
Development of effective (trans)dermal drug delivery systems requires reliable skin models to evaluate skin drug penetration. The isolated perfused human skin flap remains metabolically active tissue for up to 6h during in vitro perfusion. We introduce the isolated perfused human skin flap as a close-to-in vivo skin penetration model. To validate the model's ability to evaluate skin drug penetration the solutions of a hydrophilic (calcein) and a lipophilic (rhodamine) fluorescence marker were applied. The skin flaps were perfused with modified Krebs-Henseleit buffer (pH7.4). Infrared technology was used to monitor perfusion and to select a well-perfused skin area for administration of the markers. Flap perfusion and physiological parameters were maintained constant during the 6h experiments and the amount of markers in the perfusate was determined. Calcein was detected in the perfusate, whereas rhodamine was not detectable. Confocal images of skin cross-sections shoved that calcein was uniformly distributed through the skin, whereas rhodamine accumulated in the stratum corneum. For comparison, the penetration of both markers was evaluated on ex vivo human skin, pig skin and cellophane membrane. The proposed perfused flap model enabled us to distinguish between the penetrations of the two markers and could be a promising close-to-in vivo tool in skin penetration studies and optimization of formulations destined for skin administration. Copyright © 2016 Elsevier B.V. All rights reserved.
Isolated limb perfusion electrochemotherapy for the treatment of an ...
African Journals Online (AJOL)
After completing staging procedures, the lesion was approached with surgery and intraoperative electrochemotherapy (ECT) administration of bleomycin in isolated limb perfusion. A second session of surgery and ECT was performed one month later, followed by three additional monthly sessions of ECT. During periodic ...
Secretion of neurotensin from isolated perfused porcine ileum
DEFF Research Database (Denmark)
Holst Pedersen, J; Knuthsen, S; Bernabei, M
1988-01-01
The secretion and molecular nature of immunoreactive neurotensin (NT) was studied following stimulation of an isolated perfused porcine ileal segment with glucose, triglyceride and intra-arterial infusion of gastrin-releasing peptide (GRP). Secreted peptides were separated using gel chromatography...... in doses from 10(-10) to 10(-8) M stimulated NT release in a dose-related manner. Following gel chromatography only the intact peptide and no smaller or larger molecular size immunoreactive components were observed. The study showed that both luminal and humoral stimuli release NT from the isolated pig...
Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies
Directory of Open Access Journals (Sweden)
R Puentes
2012-09-01
Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.
López Cadenas, Cristina; Fernández Martínez, Nélida; Sierra Vega, Matilde; Diez Liébana, Maria J; Gonzalo Orden, Jose M; Sahagún Prieto, Ana M; García Vieitez, Juan J
2012-11-01
To determine the tissue distribution of enrofloxacin after intramammary or simulated systemic administration in isolated perfused sheep udders by measuring its concentration at various sample collection sites. 26 udders (obtained following euthanasia) from 26 healthy lactating sheep. For each isolated udder, 1 mammary gland was perfused with warmed, gassed Tyrode solution. Enrofloxacin (1 g of enrofloxacin/5 g of ointment) was administered into the perfused gland via the intramammary route or systemically via the perfusion fluid (equivalent to a dose of 5 mg/kg). Samples of the perfusate were obtained every 30 minutes for 180 minutes; glandular tissue samples were obtained at 2, 4, 6, and 8 cm from the teat base after 180 minutes. The enrofloxacin content of the perfusate and tissue samples was analyzed via high-performance liquid chromatography with UV detection. After intramammary administration, maximun perfusate enrofloxacin concentration was detected at 180 minutes and, at this time, mean tissue enrofloxacin concentration was detected and mean tissue enrofloxacin concentration was 123.80, 54.48, 36.72, and 26.42 μg/g of tissue at 2, 4, 6, and 8 cm from the teat base, respectively. Following systemic administration, perfusate enrofloxacin concentration decreased with time and, at 180 minutes, tissue enrofloxacin concentrations ranged from 40.38 to 35.58 μg/g of tissue. By 180 minutes after administration via the intramammary or systemic route in isolated perfused sheep mammary glands, mean tissue concentration of enrofloxacin was greater than the minimum inhibitory concentration required to inhibit growth of 90% of many common mastitis pathogens in sheep. Use of either route of administration (or in combination) appears suitable for the treatment of acute mastitis in sheep.
Halsøy, Kathrine; Kondratiev, Timofey; Tveita, Torkjel; Bjertnaes, Lars J
2016-01-01
Victims of severe accidental hypothermia are prone to fluid extravasation but rarely develop lung edema. We hypothesize that combined hypothermia-induced increase in pulmonary vascular resistance (PVR) and a concomitant fall in cardiac output protect the lungs against edema development. Our aim was to explore in hypothermic-isolated blood-perfused rat lungs whether perfusion at constant pressure influences fluid filtration differently from perfusion at constant flow. Isolated blood-perfused rat lungs were hanging freely in a weight transducer for measuring weight changes (ΔW). Fluid filtration coefficient (Kfc), was determined by transiently elevating left atrial pressure (Pla) by 5.8 mmHg two times each during normothermia (37°C) and during hypothermia (15°C). The lung preparations were randomized to two groups. One group was perfused with constant flow (Constant flow group) and the other group with constant pulmonary artery pressure (Constant PPA group). Microvascular pressure (Pmv) was determined before and during elevation of Pla (ΔPmv) by means of the double occlusion technique. Kfc was calculated with the formula Kfc = ΔW/ΔPmv/min. All Kfc values were normalized to predicted lung weight (P LW ), which was based on body weight (BW) according to the formula: P LW = 0.0053 BW - 0.48 and presented as Kfc PLW in mg/min/mmHg/g. At cessation, bronchoalveolar lavage (BAL) fluid/perfusate protein concentration (B/P) ratio was determined photometrically. Data were analyzed with parametric or non-parametric tests as appropriate. p Kfc PLW and B/P ratio increased significantly by more than 10-fold during hypothermia concerted by visible signs of edema in the trachea. Hemoglobin and hematocrit increased within the Constant flow group and between the groups at cessation of the experiments. In hypothermic rat lungs perfused at constant flow, fluid filtration coefficient per gram P LW and B/P ratio increased more than 10-fold concerted by increased
Directory of Open Access Journals (Sweden)
D Kazemi
2016-07-01
Full Text Available The purpose of the present study was to isolate, culture expand and characterize canine bone marrow derived mesenchymal stem cells. Bone marrow aspirates of 15 adult male dogs were collected to this end and their mononuclear cells isolated by centrifugation and cultured in standard media. The adherent cells were isolated and their mesenchymal origin was confirmed at 3rd passage by cellular morphology, expression of surface antigens and differentiation to osteogenic and adipogenic lineage. After 4 days, spindle shaped fibroblast like cells which were apparently bone marrow derived mesenchymal stem cells appeared in culture medium and their numbers increased over time. The cells reached 3rd passage with over 75% confluent after a mean of 22.89±5.75 days. Flow cytometric analysis revealed that the cells negatively expressed CD34 and CD45 antigens while positively expressing CD44 and CD105 antigens. Differentiation into osteogenic and adipogenic lineage had taken place after one month culture in induction medium. VDR, COL1A1, BGLAP and SPARC gene expression indicated that mesenchymal stem cells isolated from canine bone marrow had differentiated into osteogenic lineage. These findings can form the basis of any forthcoming clinical studies involving the use of canine mesenchymal stem cells particularly in the field of bone and cartilage regeneration.
Phosphorus nuclear magnetic resonance in isolated perfused rat pancreas
International Nuclear Information System (INIS)
Matsumoto, Takehisa; Kanno, Tomio; Seo, Yoshiteru; Murakami, Masataka; Watari, Hiroshi
1988-01-01
Phosphorus nuclear magnetic resonance spectroscopy was applied to measure phosphorus energy metabolites in isolated perfused rat pancreas. The gland was perfused with a modified Krebs-Henseleit solution at room temperature (25 degree C). 31 P resonances of creatine phosphate (PCr), ATP, ADP, inorganic phosphate (P i ) and phosphomonoesters (PMEs) were observed in all the preparations of pancreas. In different individual preparations, the resonance of PCr varied, but those of ATP were almost the same. The initial levels of PCr and ATP in individual preparations, however, remained almost unchanged during perfusion with the standard solution for 2 h. When the perfusion was stopped, the levels of ATP and PCr decreased, while the levels of PME and P i increased. At that time, the P i resonance shfted to a higher magnetic field, indicating that the tissue pH decreased. On reperfusion, the tissue levels of phosphorus compounds and the tissue pH were restored to their initial resting levels. Continuous infusion of 0.1 μM acetylcholine caused marked and sustained increases in the flow of pancreatic juice and protein output. During the stimulation the tissue levels of phosphorus compounds remained unchanged, while the tissue pH was decreased slightly
Phenotypic characterization of canine Malassezia spp., isolates
Directory of Open Access Journals (Sweden)
Angélica Hurtado-Suárez
2016-09-01
Full Text Available Objective. To characterize and identify yeasts of the genus Malassezia by phenotypic features. Materials and methods. First, the macroscopic and microscopic morphological characteristics were described. In addition we performed biochemical and physiological assays as Tweens and Cremophor, including more. Results. Our results evidenced of 105 isolates obtained from dogs diagnosed with external otitis, it was possible to identify two distinct species from 46 isolates within the Malassezia genus: 36.19% (n=38 were identified as M. pachydermatis and 7.62% (n=8 as M. furfur. According to phenotypic patterns the remaining 56.19% (n=59 were reported as Malassezia spp., possibly corresponding to M. furfur and/or M. pachydermatis. Conclusions. Results emphasize the necessity to characterize according to species. It is not feasible to define Malassezia by species based on morphological, biochemical, and physiological findings. Therefore, molecular genotyping should be performed to identify markers allowing a more precise isolate identification. This would broaden our epidemiological knowledge regarding different species involved in canine otitis pathologies.
De Smet, Hilde R; Bersten, Andrew D; Barr, Heather A; Doyle, Ian R
2007-12-01
Low tidal volume (V(T)) ventilation strategies may be associated with permissive hypercapnia, which has been shown by ex vivo and in vivo studies to have protective effects. We hypothesized that hypercapnic acidosis may be synergistic with low V(T) ventilation; therefore, we studied the effects of hypercapnia and V(T) on unstimulated and lipopolysaccharide-stimulated isolated perfused lungs. Isolated perfused rat lungs were ventilated for 2 hours with low (7 mL/kg) or moderately high (20 mL/kg) V(T) and 5% or 20% CO(2), with lipopolysaccharide or saline added to the perfusate. Hypercapnia resulted in reduced pulmonary edema, lung stiffness, tumor necrosis factor alpha (TNF-alpha) and interleukin 6 (IL-6) in the lavage and perfusate. The moderately high V(T) did not cause lung injury but increased lavage IL-6 and perfusate IL-6 as well as TNF-alpha. Pulmonary edema and respiratory mechanics improved, possibly as a result of a stretch-induced increase in surfactant turnover. Lipopolysaccharide did not induce significant lung injury. We conclude that hypercapnia exerts a protective effect by modulating inflammation, lung mechanics, and edema. The moderately high V(T) used in this study stimulated inflammation but paradoxically improved edema and lung mechanics with an associated increase in surfactant release.
Complete inhibition of creatine kinase in isolated perfused rat hearts
International Nuclear Information System (INIS)
Fossel, E.T.; Hoefeler, H.
1987-01-01
Transient exposure of an isolated isovolumic perfused rat heart to low concentrations (0.5 mM) of perfusate-born iodoacetamide resulted in complete inhibition of creatine kinase and partial inhibition of glyceraldehyde-3-phosphate dehydrogenase in the heart. At low levels of developed pressure, hearts maintained mechanical function, ATP, and creatine phosphate levels at control values. However, iodoacetamide-inhibited hearts were unable to maintain control values of end diastolic pressure or peak systolic pressure as work load increased. Global ischemia resulted in loss of all ATP without loss of creatine phosphate, indicating lack of active creatine kinase. These results indicate that isovolumic perfused rat hearts are able to maintain normal function and normal levels of high-energy phosphates without active creatine kinase at low levels of developed pressure. 31 P-NMR of the heart was carried out
Rosenfeldt, Franklin; Ou, Ruchong; Salamonsen, Robert; Marasco, Silvana; Zimmet, Adam; Byrne, Joshua; Cosic, Filip; Saxena, Pankaj; Esmore, Donald
2016-11-01
Donation after circulatory death (DCD) represents a potential new source of hearts to increase the donor pool. We showed previously that DCD hearts in Greyhound dogs could be resuscitated and preserved by continuous cold crystalloid perfusion but not by cold static storage and could demonstrate excellent contractile and metabolic function on an in vitro system. In the current study, we demonstrate that resuscitated DCD hearts are transplantable. Donor Greyhound dogs (n = 12) were divided into perfusion (n = 8) and cold static storage (n = 4) groups. General anesthesia was induced and ventilation ceased for 30 minutes to achieve circulatory death. Donor cardiectomy was performed, and for 4 hours the heart was preserved by controlled reperfusion, followed by continuous cold perfusion with an oxygenated crystalloid perfusate or by static cold storage, after which orthotopic heart transplantation was performed. Recovery was assessed over 4 hours by hemodynamic monitoring. During cold perfusion, hearts showed continuous oxygen consumption and low lactate levels, indicating aerobic metabolism. The 8 dogs in the perfusion group were weaned off bypass, and 4 hours after bypass produced cardiac output of 4.73 ± 0.51 liters/min, left ventricular power of 7.63 ± 1.32 J/s, right ventricular power of 1.40 ± 0.43 J/s, and left ventricular fractional area shortening of 39.1% ± 5.2%, all comparable to pre-transplant values. In the cold storage group, 3 of 4 animals could not be weaned from cardiopulmonary bypass, and the fourth exhibited low-level function. Cold crystalloid perfusion, but not cold static storage, can resuscitate and preserve the DCD donor heart in a canine model of heart transplantation, thus rendering it transplantable. Controlled reperfusion and cold crystalloid perfusion have potential for clinical application in DCD transplantation. Copyright © 2016. Published by Elsevier Inc.
Percutaneous Isolated Hepatic Perfusion for the Treatment of Unresectable Liver Malignancies
Energy Technology Data Exchange (ETDEWEB)
Burgmans, Mark C., E-mail: m.c.burgmans@lumc.nl [Leiden University Medical Centre, Department of Radiology (Netherlands); Leede, Eleonora M. de, E-mail: e.m.de-leede@lumc.nl [Leiden University Medical Centre, Department of Surgery (Netherlands); Martini, Christian H., E-mail: c.h.martini@lumc.nl [Leiden University Medical Centre, Department of Anesthesiology (Netherlands); Kapiteijn, Ellen, E-mail: h.w.kapiteijn@lumc.nl [Leiden University Medical Centre, Department of Medical Oncology (Netherlands); Vahrmeijer, Alexander L., E-mail: a.l.vahrmeijer@lumc.nl [Leiden University Medical Centre, Department of Surgery (Netherlands); Erkel, Arian R. van, E-mail: a.r.van-erkel@lumc.nl [Leiden University Medical Centre, Department of Radiology (Netherlands)
2016-06-15
Liver malignancies are a major burden of disease worldwide. The long-term prognosis for patients with unresectable tumors remains poor, despite advances in systemic chemotherapy, targeted agents, and minimally invasive therapies such as ablation, chemoembolization, and radioembolization. Thus, the demand for new and better treatments for malignant liver tumors remains high. Surgical isolated hepatic perfusion (IHP) has been shown to be effective in patients with various hepatic malignancies, but is complex, associated with high complication rates and not repeatable. Percutaneous isolated liver perfusion (PHP) is a novel minimally invasive, repeatable, and safer alternative to IHP. PHP is rapidly gaining interest and the number of procedures performed in Europe now exceeds 200. This review discusses the indications, technique and patient management of PHP and provides an overview of the available data.
Percutaneous Isolated Hepatic Perfusion for the Treatment of Unresectable Liver Malignancies
International Nuclear Information System (INIS)
Burgmans, Mark C.; Leede, Eleonora M. de; Martini, Christian H.; Kapiteijn, Ellen; Vahrmeijer, Alexander L.; Erkel, Arian R. van
2016-01-01
Liver malignancies are a major burden of disease worldwide. The long-term prognosis for patients with unresectable tumors remains poor, despite advances in systemic chemotherapy, targeted agents, and minimally invasive therapies such as ablation, chemoembolization, and radioembolization. Thus, the demand for new and better treatments for malignant liver tumors remains high. Surgical isolated hepatic perfusion (IHP) has been shown to be effective in patients with various hepatic malignancies, but is complex, associated with high complication rates and not repeatable. Percutaneous isolated liver perfusion (PHP) is a novel minimally invasive, repeatable, and safer alternative to IHP. PHP is rapidly gaining interest and the number of procedures performed in Europe now exceeds 200. This review discusses the indications, technique and patient management of PHP and provides an overview of the available data.
Cell-swelling-induced taurine release from isolated perfused rat liver
Brand, H. S.; Meijer, A. J.; Gustafson, L. A.; Jörning, G. G.; Leegwater, A. C.; Maas, M. A.; Chamuleau, R. A.
1994-01-01
Astrocytes and lymphocytes are able to release significant amounts of taurine during periods of hypotonicity to reduce the increase in cell volume. To investigate this mechanism in the liver, we studied the release of free amino acids from isolated perfused rat liver during hypotonicity. The
Kinetics of reversible-sequestration of leukocytes by the isolated perfused rat lung
Energy Technology Data Exchange (ETDEWEB)
Goliaei, B.
1980-08-01
The kinetics and morphology of sequestration and margination of rat leukocytes were studied using an isolated perfused and ventilated rat lung preparation. Whole rat blood, bone marrow suspension, or leukocyte suspensions, were used to perfuse the isolated rat lung. The lung was also perfused with latex particle suspensions and the passage of particles through the lung capillaries was studied. When a leukocyte suspension was perfused through the lung in the single-pass mode, the rate of sequestration decreased as more cells were perfused. In contrast, latex particles of a size comparable to that of leukocytes were totally stopped by the lung. When the leukocyte suspension was recirculated through the lung, cells were rapidly removed from circulation until a steady state was reached, after which no net removal of cells by the lung occurred. These results indicate that leukocytes are reversibly sequestered from circulation. The sequestered cells marginated and attached to the luminal surface of the endothelium of post-capillary venules and veins. A mathematical model was developed based on the assumption that the attachment and detachment of leukocytes to blood vessel walls follows first-order kinetics. The model correctly predicts the following characteristics of the system: (a) the kinetics of the sequestration of leukocytes by the lung; (b) the existence of a steady state when a suspension of leukocytes is recirculated through the lung; and (c) the independence of the fraction of cells remaining in circulation from the starting concentration for all values of starting concentration. (ERB)
Russell, Keith A.; Gibson, Thomas W. G.; Chong, Andrew; Co, Carmon; Koch, Thomas G.
2015-01-01
Background Mesenchymal stromal cells (MSC) are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS) is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL) has proven to be a suitable alternative to FBS for expansion of human MSC. Hypothesis and Objectives We hypothesized that canine adipose tissue (AT) and bone marrow (BM) MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1) isolation, 2) proliferation, 3) spontaneous differentiation, and 4) directed differentiation. Results 1) Medium with 10% PL was unable to isolate MSC. 2) MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT) or 30% (BM) enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3) Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4) MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis. Conclusions/Significance Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects. PMID:26353112
Directory of Open Access Journals (Sweden)
Keith A Russell
Full Text Available Mesenchymal stromal cells (MSC are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL has proven to be a suitable alternative to FBS for expansion of human MSC.We hypothesized that canine adipose tissue (AT and bone marrow (BM MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1 isolation, 2 proliferation, 3 spontaneous differentiation, and 4 directed differentiation.1 Medium with 10% PL was unable to isolate MSC. 2 MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT or 30% (BM enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3 Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4 MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis.Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects.
Su, Shuo; Yuan, Ziguo; Chen, Jidang; Xie, Jiexiong; Li, Huatao; Huang, Zhen; Zhang, Minze; Du, Guohao; Chen, Zhongming; Tu, Liqing; Zou, Yufei; Miao, Junhao; Wang, Hui; Jia, Kun; Li, Shoujun
2013-06-01
A H3N2 canine influenza virus, A/canine/Guangdong/3/2011 (H3N2), was isolated from roaming dogs in rural China. Sequence and phylogenetic analysis of eight gene segments revealed that the A/canine/Guangdong/3/2011 (H3N2) was most similar to a recent H3N2 canine influenza virus isolated in cats from South Korea, which originated from an avian strain. To our knowledge, this is the first report of an avian-origin H3N2 CIV which was isolated from roaming dogs in China. The epidemiologic information provided herein suggests that continued study is required to determine if this virus could be established in the roaming dog population in rural China and pose potential threats to public health.
STEEN, H; MEIJER, DKF; Merema, M.T.
The effect of ethanol on the hepatic uptake of various cationic drugs was studied in isolated perfused rat livers, isolated rat hepatocytes and isolated rat liver mitochondria. In isolated rat hepatocytes and in isolated perfused rat livers, the uptake of the model organic cation
The Use of Orthogonal Polarizations in Microwave Imagery of Isolated Canine Kidney
Larsen, L. E.; Jacobi, J. H.
1980-06-01
A method of imaging biological targets using microwave radiation at a frequency of 4 GHz is presented. Linearly polarized radiation is transmitted through an isolated canine kidney and received with co-polarized and cross-polarized antennas. Images are displayed as the spatial variation of the magnitude of the transmission scattering parameter S21 for each mode of polarization. The relationship between the spatial variation of the magnitude of S21 and canine renal anatomy is discussed. It is shown that within the kidney the cross-polarized image tends to emphasize linear or piecewise linear structures, whereas the co-polarized image balances renal cortical lobulations.
Concentration of (+/-)-propranolol in isolated, perfused lungs of rat.
Dollery, C T; Junod, A F
1976-01-01
1 The metabolism and the accumulation of (+/-)-propranolol have been studied in isolated lungs of the rat, perfused with an artificial medium. 2 Little or no metabolism took place during the perfusion periods (up to 10 minutes). 3 Accumulation was observed with high tissue/medium ratios for substrate concentrations of 0.2 muM to 1 mM; there was evidence for saturability, but no real plateau could be seen. The presence of two binding sites with different affinities was established. 4 Cold greatly inhibited the accumulation process at low substrate concentrations, but had no effect at 1 mM propranolol. 5 Inhibition of accumulation was measured in the presence of imipramine, desmethylimipramine, nortryptiline, chlorpromazine and of Na+-free medium. Cocaine, 5-hydroxytryptamine and noradrenaline had no effect. Lidocaine enhanced the accumulation process. Release of previously bound propranolol was accelerated in the presence of propranolol and imipramine, unaffected by a Na+-free medium and decreased by cold and by lidocaine. 6 Experiments on lung tissue slices yielded qualitatively similar results to those obtained with perfused lungs. Ouabain and KCN had no or little effect on propranolol accumulation. PMID:1276542
van Iersel, L. B. J.; Koopman, M.; van de Velde, C. J. H.; Mol, L.; van Persijn van Meerten, E. L.; Hartgrink, H. H.; Kuppen, P. J. K.; Vahrmeijer, A. L.; Nortier, J. W. R.; Tollenaar, R. A. E. M.; Punt, C.; Gelderblom, H.
2010-01-01
To compare the median overall survival of patients with isolated nonresectable liver metastases in comparable groups of patients treated with either isolated hepatic perfusion (IHP) with melphalan or systemic chemotherapy. Colorectal cancer patients with isolated liver metastases, who underwent IHP,
International Nuclear Information System (INIS)
Sharma, R.; Kodavanti, U.P.; Smith, L.L.; Mehendale, H.M.
1991-01-01
Cystamine has been reported to be taken up by the lung slices and metabolized to taurine via hypotaurine through enzymatic processes. The objective of these studies was to determine whether intact isolated, ventilated and perfused rat and rabbit lungs also posses similar characteristics. The lungs were isolated from male New Zealand white rabbits and S-D rats and perfused with 20 μM [ 14 C] cystamine (Sp. Act., 16.4 mCi/mmol) for 60 min and 30 min, respectively. Cystamine and its metabolites in lung as well as in perfusate were separated by TLC and quantitated using scintillation spectrometry. Similar experiments were also conducted with 20 μM taurine to investigate its fate in perfused lungs. Significant pulmonary uptake of cystamine and taurine occurred during perfusion. Cystamine was metabolized to [ 14 C] hypotaurine and [ 14 C] taurine. No further metabolism of taurine was evident in rat or rabbit lungs. Inclusion of 1 nM GSH did not significantly alter the ability of lungs to sequester cystamine, but the metabolism of hypotaurine to taurine was decreased. It was evident that cystamine was metabolized to taurine by perfused lungs in the same way as in lung slices
International Nuclear Information System (INIS)
Brier, M.E.; Bowsher, R.R.; Henry, D.P.; Mayer, P.R.
1991-01-01
The authors used the isolated perfused rat kidney to evaluate the role of renal decarboxylation of p-tyrosine as the source of urinary p-tyramine. Kidneys were perfused with concentrations of p-tyrosine ranging from 0.02 mM to 2.0 mM. p-Tyramine was measured by a sensitive and specific radioenzymatic assay. An increase in the perfusate concentration of p-tyrosine resulted in a significant increase in p-tyramine production that was blocked by the addition of NSD-1015, an inhibitor of aromatic-1-amino decarboxylase (AADC). They conclude p-tyrosine is the precursor for the renal production of p-tyramine, renal AADC catalyzes the formation of urinary p-tyramine, synthesized p-tyramine is predominantly excreted in the urine, and p-tyramine synthesis is modulated by the arterial delivery of p-tyrosine to the kidney
Metabolism of 1-[14C]nitropyrene in isolated perfused rat livers
International Nuclear Information System (INIS)
Bond, J.A.; Medinsky, M.A.; Dutcher, J.S.
1984-01-01
1-Nitropyrene (1-NP), a constituent of diesel exhaust, is carcinogenic to rats and is a bacterial and mammalian mutagen. Biliary and fecal excretion of 1-NP metabolites are the major routes of excretion in rats, suggesting that hepatic metabolism plays a dominant role in determining the biological fate of 1-NP. The purpose of this investigation was to quantitate 1-[14C]NP metabolites formed in isolated perfused rat livers and excreted in bile from rats. Perfused rat livers displayed a capacity for oxidation, reduction, acetylation, and conjugation of 1-NP (or its metabolites). Reduction of 1-NP followed by N-acetylation was the major metabolic pathway observed in the perfused livers. Acetylaminopyrene (AAP) was the major metabolite detected, with total quantities (150 nmol) accounting for about 60% of the total 1-[14C]NP dose (258 nmol) added to the perfusate. Considerably smaller quantities of aminopyrene and hydroxynitropyrenes were also detected. Livers perfused with 1-[14C]NP excreted about 36 nmol equivalents of 1-[14C]NP (12% of the total 1-NP dose) in bile after 60 min. Some of the biliary metabolites were tentatively identified as metabolites of the mercapturic acid pathway. The spectrum of biliary metabolites was qualitatively identical to that seen in bile from intact rats. Quantities of 14C covalently bound to hepatic macromolecules from perfused livers were 0.4 nmol 1-NP eq/g liver. The data from this study indicate that the liver may be an important site for metabolism of 1-NP
New method of isolation and perfusion of rat pancreas for phosphorus nucletic resonance study
Energy Technology Data Exchange (ETDEWEB)
Matsumoto, Takehisa; Kanno, Tomio; Murakami, Masataka; Watari, Hiroshi; Seo, Yoshiteru
1988-02-01
Phosphorus nuclear magnetic resonance (/sup 31/P-NMR) was applied to measure phosphorus metabolites in the pancreas. Rat pancreatic gland was isolated and perfused with a modified Krebs-Henseleit solution at room temperature (25 deg C). Removal of the duodenum from the pancreas made it possible to record /sup 31/P-NMR spectra only from the pancreatic tissue. /sup 31/P signals of creatine phosphate (PCr), ATP and inorganic phosphate (Pi) were observed in all the glands. In different individual glands, the Signal intensity of PCr varied, but those of ATP were almost the same. The initial levels of all the phosphorus metabolites in individual glands remained almost unchanged during perfusion with the standard solution for 2 hours. When the perfusion was stopped, signal intensity of ATP and PCr decreased while Pi resonance increased and shifted to a higher magnetic field, indicating tissue acidification. On re-perfusion, each resonance and tissue pH were restored to the respective initial resting levels. Continuous stimulation with 0.3 ..mu..M acetylcholine (ACh) or 0.1 nM CCK-8 caused a markedly larger increase in pancreatic exocrine secretion than that observed in the perfused pancreas which was prepared by the previous method. Continuous stimulation with 0.1 ..mu..M ACh caused a marked and sustained increase in pancreatic exocrine secretion. During the stimulation, the resonances of phosphorus energy metabolites and tissue pH remained almost unchanged. These results indicate that the isolated perfused rat pancreas which is prepared by our new method is a useful preparation for analysis of secretion-metabolism coupling in the exocrine pancreas.
Major amputation for intractable extremity melanoma after failure of isolated limb perfusion
Kapma, M. R.; Vrouenraets, B. C.; Nieweg, O. E.; van Geel, A. N.; Noorda, E. M.; Eggermont, A. M. M.; Kroon, B. B. R.
2005-01-01
AIM: The aim of this study was to analyse indications and results of amputation for intractable extremity melanoma after failure of isolated limb perfusion (ILP). METHODS: Between 1978 and 2001, 451 patients with loco-regional advanced extremity melanoma underwent 505 ILPs. Amputation of the
Characterization of an Isolated Kidney's Vasculature for Use in Bio-Thermal Modeling
Payne, Allison H.; Parker, Dennis L.; Moellmer, Jeff; Roemer, Robert B.; Clifford, Sarah
2007-05-01
Accurate bio-thermal modeling requires site-specific modeling of discrete vascular anatomy. Presented herewith are several steps that have been developed to describe the vessel network of isolated canine and bovine kidneys. These perfused, isolated kidneys provide an environment to repeatedly test and improve acquisition methods to visualize the vascular anatomy, as well as providing a method to experimentally validate discrete vasculature thermal models. The organs are preserved using a previously developed methodology that keeps the vasculature intact, allowing for the organ to be perfused. It also allows for the repeated fixation and re-hydration of the same organ, permitting the comparison of various methods and models. The organ extraction, alcohol preservation, and perfusion of the organ are described. The vessel locations were obtained through a high-resolution time-of-flight (TOF) magnetic resonance angiography (MRA) technique. Sequential improvements of both the experimental setup used for this acquisition, as well as MR sequence development are presented. The improvements in MR acquisition and experimental setup improved the number of vessels seen in both the raw data and segmented images by 50%. An automatic vessel centerline extraction algorithm describes both vessel location and genealogy. Centerline descriptions also allows for vessel diameter and flow rate determination, providing valuable input parameters for the discrete vascular thermal model. Characterized vessels networks of both canine and bovine kidneys are presented. While these tools have been developed in an ex vivo environment, all steps can be applied to in vivo applications.
Uptake, incorporation and metabolism of (3H)triolein in the isolated perfused rabbit heart
International Nuclear Information System (INIS)
Weis, M.T.; Palazzo, A.J.; Williams, J.L. Jr.; Malik, K.U.
1990-01-01
The purpose of these experiments was to study the uptake and metabolism of exogenous triglyceride in the isolated perfused rabbit heart. When infused into the rabbit heart, [9,10-3H(N)]triolein was retained and incorporated into a lipid fraction that had the chromatographic mobility of authentic triolein. Incorporation of labeled triolein was not likely to be the result of a lipoprotein lipase-mediated lipolysis/resynthesis cycle, since: (i) The distribution of radioactivity following administration of [3H]oleic acid was markedly different from the distribution of radioactivity following the administration of [3H]triolein; (ii) heparin was administered to the rabbits at the time of sacrifice; and (iii) the hearts were perfused with a protein-free buffer for 20 min prior to the labelling period. When isoproterenol was administered to hearts labelled with [3H]triolein, there was an increased output of total radioactivity, composed of labelled free fatty acids, diacylglycerol and monoacylglycerol. In these same hearts, there was an increased output of glycerol in response to isoproterenol. However, following the administration of bradykinin or angiotensin II, neither the radioactivity nor the glycerol content of the perfusate was changed. These data suggest that [3H]triolein is selectively incorporated into the triglyceride pool of the isolated perfused rabbit heart. Furthermore, this [3H]triolein is available to hormonally-activated lipolytic enzymes
Barashkov, V A; Gitel'zon, I I; Nefedov, V P; Trubachev, I N
1975-07-01
The dynamics of the amino acid composition of the medium under conditions of adequate perfusion of the isolated organs of a dog (sternum, kidney and liver) was studied. It was found that after a 6-hour perfusion of the complex of organs the amount in the perfusion medium of such amino acids as histidine, lysine, alanine, considerably increased, whereas the amount of arginine, serine, aspartic acid, threonine with glutamine, isoleucine, proline, leucine and valine decreased as compared with their initial concentration. The dynamics of the amino acid medium composition during a 4-hour perfusion was studied in experiments with the isolated sternum. The concentration of alanine, lysine and histidine increased in the medium. At the same time there was seen a decrease in the concentration of serine, aspartic acid, isoleucine, tyrosine and phenyl-alanine.
DEFF Research Database (Denmark)
Kristoffersen, Ulrik Sloth; Straalman, Kristina; Schmidt, Grethe
2009-01-01
PURPOSE: Hyperthermic isolated limb perfusion (HILP) is an effective method in the treatment of recurrent melanomas and soft tissue sarcomas. To avoid systemic toxicity, leakage from the limb perfusate into the systemic circulation is real-time monitored by administration of a radioactive agent...
Isolation and identification of Helicobacter spp, from canine and feline gastric mucosa
DEFF Research Database (Denmark)
Jalava, K.; On, Stephen L.W.; VanDamme, P.A.R.
1998-01-01
It is known that virtually all healthy adult dogs and cats harbor spiral helicobacters in their gastric mucosa, Three species, Helicobacter felis, Helicobacter bizzozeronii, and Helicobacter salomonis have been isolated in vitro from the gastric mucosa of these animals. The aims of this study were...... conventional phenotypic tests, whole-cell protein profiling, and ultrastructural analysis in identifying the different species isolated from canine and feline gastric mucose. We cultured 95 and 22 gastric mucosal biopsies from dogs and cats, respectively. Twenty-one H. bizzozeronii strains, 8 H. felis strains......, 8 H. salomonis strains, 3 mixed cultures, 2 "Flexispira rappini"-like organisms, and 3 as get uncharacterized strains were isolated from the dogs, and 3 H. felis strains were isolated from the cats. The methods used here yielded Helicobacter isolation rates of 51% from dogs and 13.6% from cats...
Isolated Liver Perfusion Using Percutaneous Methods:[ql An Experimental Study in the Pig
International Nuclear Information System (INIS)
Harnek, Jan; Cwikiel, Wojciech; Bergqvist, Lennart; Persson, Bo; Stridbeck, Hans
1996-01-01
Purpose: To develop a method for isolated perfusion of the liver using radiological methods. Methods: Twenty-one pigs, weighing about 20 kg, were divided into three groups. By transjugular and transfemoral approaches two occlusion balloons were placed in the inferior vena cava cranial and caudal, respectively, to the origin of the hepatic veins. One occlusion balloon was placed transfemorally in the common hepatic artery. Another occlusion balloon was inserted in the main branch of the portal vein via the transjugular-transhepatic approach in 11 pigs (groups 1 and 2), and in 10 pigs (group 3) by a percutaneous transhepatic route. After inflation of the balloons, patency of the isolated liver circulation was evaluated by recirculation of 99 Tc m -labelled human albumin during 30 min. Blood tests were obtained after 1, 3, 5, 10, 15, and 30 min to evaluate leakage from the liver to the systemic circulation. Results: Increasing leakage to the systemic circulation from the isolated liver circulation was observed in groups 1 and 2. In the third group the leakage was less than 10%. Conclusion: In an experimental animal model, isolated perfusion of the liver with minor leakage to the systemic circulation may be achieved using radiological methods
Double-Balloon Catheter for Isolated Liver Perfusion: An Experimental Study
International Nuclear Information System (INIS)
Cwikiel, Wojciech; Bergqvist, Lennart; Harnek, Jan
2001-01-01
Purpose: Further development of a previously described interventional method for isolated liver perfusion (ILP) with a new double-lumen balloon catheter, and evaluation of the side-effects of such isolation.Methods: In six pigs a double-balloon occlusion catheter was placed via the transjugular approach with its tip in the portal vein. One of the balloons was positioned in the inferior vena cava (IVC), cranial to the origin of the hepatic veins and the other balloon in the portal vein. By the transfemoral approach, a single-balloon occlusion catheter was placed in the IVC caudal to the origin of the hepatic veins. A third catheter was placed by the transfemoral route with the occlusion balloon in the proper hepatic artery. After inflation of all balloons 99 Tc m -labelled human serum albumin was recirculated through the liver. The isolation was evaluated by repeated measurement of radioactivity levels in peripheral blood. Laboratory tests of liver and pancreas function, and hemoglobin, were taken before, at the end of, and 3 days after the procedure. Blood gases were tested at the beginning and end of the procedure.Results: One pig died during the procedure due to technical failure and was excluded from the study. In the other pigs leakage from the isolated liver to the systemic circulation increased slowly, up to 9.7% (mean) during 30 min of recirculation of the perfusate through the liver. Laboratory tests were normal in all pigs except insignificant acidosis directly after the procedure and the slight elevation of s-ALAT after 3 days.Conclusions: Only minor leakage from the liver to the systemic circulation was noted during ILP performed with a new, double-balloon catheter. There were no serious side effects
Energy Technology Data Exchange (ETDEWEB)
Garlick, P.B.; Medina, R.A.; Southworth, R.; Marsden, P.K. [Department of Radiological Sciences, Guy' s, King' s and St. Thomas' School of Medicine, London (United Kingdom)
1999-10-01
Fluorine-18 2-fluoro-2-deoxyglucose (FDG) and 2-deoxyglucose (DG) are widely used as tracers of glucose uptake in the myocardium. Although there is agreement that the two analogues behave similarly to glucose under control conditions, there is growing evidence that some interventions (e.g. insulin stimulation or ischaemia/reperfusion) cause differential changes in their behaviour. The addition of a two-surface coil nuclear magnetic resonance (NMR) probe and a dual-perfusion cannula to our recently developed PET and NMR dual-acquisition (PANDA) system allows us to collect PET (FDG) images and phosphorus-31 NMR (2-deoxyglucose-6-phosphate) spectra simultaneously from each independently perfused coronary bed of the heart. We have used this technique to study the effect of regional ischaemia/reperfusion on FDG and DG uptake in the isolated, perfused rat heart. During control perfusion, FDG uptake was almost identical in both coronary beds. When one coronary bed was made ischaemic, FDG uptake ceased on that side but continued on the control side. Reperfusion failed to restore FDG uptake. In contrast, NMR spectra showed that, during reperfusion, the uptake and phosphorylation of DG did not differ between the two coronary beds. The results thus demonstrate that regional myocardial ischaemia/reperfusion has different effects on the uptake of FDG and DG in the isolated, perfused rat heart. (orig.)
International Nuclear Information System (INIS)
Garlick, P.B.; Medina, R.A.; Southworth, R.; Marsden, P.K.
1999-01-01
Fluorine-18 2-fluoro-2-deoxyglucose (FDG) and 2-deoxyglucose (DG) are widely used as tracers of glucose uptake in the myocardium. Although there is agreement that the two analogues behave similarly to glucose under control conditions, there is growing evidence that some interventions (e.g. insulin stimulation or ischaemia/reperfusion) cause differential changes in their behaviour. The addition of a two-surface coil nuclear magnetic resonance (NMR) probe and a dual-perfusion cannula to our recently developed PET and NMR dual-acquisition (PANDA) system allows us to collect PET (FDG) images and phosphorus-31 NMR (2-deoxyglucose-6-phosphate) spectra simultaneously from each independently perfused coronary bed of the heart. We have used this technique to study the effect of regional ischaemia/reperfusion on FDG and DG uptake in the isolated, perfused rat heart. During control perfusion, FDG uptake was almost identical in both coronary beds. When one coronary bed was made ischaemic, FDG uptake ceased on that side but continued on the control side. Reperfusion failed to restore FDG uptake. In contrast, NMR spectra showed that, during reperfusion, the uptake and phosphorylation of DG did not differ between the two coronary beds. The results thus demonstrate that regional myocardial ischaemia/reperfusion has different effects on the uptake of FDG and DG in the isolated, perfused rat heart. (orig.)
International Nuclear Information System (INIS)
Hansen, Anders E.; Kristensen, Annemarie T.; Law, Ian; McEvoy, Fintan J.; Kjær, Andreas; Engelholm, Svend A.
2012-01-01
Purpose: To compare the distribution and uptake of the hypoxia tracer 64 Cu-diacetyl-bis(N 4 -methylthiosemicarbazone) ( 64 Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition 64 Cu-ATSM distribution over time was evaluated. Methods and materials: Nine spontaneous cancer-bearing dogs were prospectively enrolled. FDG (1 h pi.) and 64 Cu-ATSM (3 and 24 h pi.) PET/CT were performed over three consecutive days. DCE-pCT was performed on day 2. Tumor uptake of FDG and 64 Cu-ATSM was assessed semi-quantitatively and the distribution of FDG, 64 Cu-ATSM and CT perfusion parameters correlated. Results: 64 Cu-ATSM distribution on scans performed 24 h apart displayed moderate to strong correlation; however, temporal changes were observed. The spatial distribution pattern of 64 Cu-ATSM between scans was moderately to strongly positively correlated to FDG, whereas the correlation of CT perfusion parameters to FDG and to 64 Cu-ATSM yielded more varying results. Conclusions: 64 Cu-ATSM uptake was positively correlated to FDG. 64 Cu-ATSM was found to be relatively stable between PET scans performed at different time points, important temporal changes were however observed in hypo-perfused regions. These findings potentially indicate that prolonged uptake periods for 64 Cu-ATSM imaging may be needed. Although a moderate to strong correlation between 64 Cu-ATSM and FDG PET/CT is observed, the two tracers provide different biological information with an overlapping spatial distribution.
Directory of Open Access Journals (Sweden)
Haas Norbert P
2008-04-01
Full Text Available Abstract Background The severity of associated soft tissue trauma in complex injuries of the extremities guides fracture treatment and decisively determines patient's prognosis. Trauma-induced microvascular dysfunction and increased tissue pressure is known to trigger secondary soft tissue damage and seems to adversely affect skeletal muscle function. Methods 20 patients with isolated tibial fractures were included. Blood pressure and compartment pressure (anterior and deep posterior compartment were measured continuously up to 24 hours. Corresponding perfusion pressure was calculated. After 4 and 12 weeks isokinetic muscle peak torque and mean power of the ankle joint in dorsal and plantar flexion were measured using a Biodex dynamometer. Results A significant inverse correlation between the anterior perfusion pressure at 24 hours and deficit in dorsiflexion at 4 weeks was found for both, the peak torque (R = -0.83; p Conclusion The functional relationship between the decrease in intramuscular perfusion pressures and muscle performance in the early rehabilitation period indicate a causative and prognostic role of early posttraumatic microcirculatory derangements and skeletal muscle function. Therapeutic concepts aimed at effective muscle recovery, early rehabilitation, and decreased secondary tissue damage, should consider the maintenance of an adequate intramuscular perfusion pressure.
Toxicity and Kinetics of (3H)Microcystin-LR in Isolated Perfused Rat Livers
1990-03-20
with a Waters 490 multiwavelength detector, as described by Robinson et al. (1989). A C-18 column (Adsorbosphere HS, 4.6 x 250 mm, 5 Am, Alltech ...1988). The isolated perfused liver has several advantages over other model systems for the study of hepatotoxins. Unlike the in-vitro cell systems
Monitoring system for isolated limb perfusion based on a portable gamma camera
International Nuclear Information System (INIS)
Orero, A.; Muxi, A.; Rubi, S.; Duch, J.; Vidal-Sicart, S.; Pons, F.; Roe, N.; Rull, R.; Pavon, N.; Pavia, J.
2009-01-01
Background: The treatment of malignant melanoma or sarcomas on a limb using extremity perfusion with tumour necrosis factor (TNF-α) and melphalan can result in a high degree of systemic toxicity if there is any leakage from the isolated blood territory of the limb into the systemic vascular territory. Leakage is currently controlled by using radiotracers and heavy external probes in a procedure that requires continuous manual calculations. The aim of this work was to develop a light, easily transportable system to monitor limb perfusion leakage by controlling systemic blood pool radioactivity with a portable gamma camera adapted for intraoperative use as an external probe, and to initiate its application in the treatment of MM patients. Methods: A special collimator was built for maximal sensitivity. Software for acquisition and data processing in real time was developed. After testing the adequacy of the system, it was used to monitor limb perfusion leakage in 16 patients with malignant melanoma to be treated with perfusion of TNF-α and melphalan. Results: The field of view of the detector system was 13.8 cm, which is appropriate for the monitoring, since the area to be controlled was the precordial zone. The sensitivity of the system was 257 cps/MBq. When the percentage of leakage reaches 10% the associated absolute error is ±1%. After a mean follow-up period of 12 months, no patients have shown any significant or lasting side-effects. Partial or complete remission of lesions was seen in 9 out of 16 patients (56%) after HILP with TNF-α and melphalan. Conclusion: The detector system together with specially developed software provides a suitable automatic continuous monitoring system of any leakage that may occur during limb perfusion. This technique has been successfully implemented in patients for whom perfusion with TNF-α and melphalan has been indicated. (orig.)
Monitoring system for isolated limb perfusion based on a portable gamma camera
Energy Technology Data Exchange (ETDEWEB)
Orero, A.; Muxi, A.; Rubi, S.; Duch, J. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); Vidal-Sicart, S.; Pons, F. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); Inst. d' Investigacions Biomediques August Pi i Sunyer (IDIBAPS), Barcelona (Spain); Red Tematica de Investigacion Cooperativa en Cancer (RTICC), Barcelona (Spain); Roe, N. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); CIBER de Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), Barcelona (Spain); Rull, R. [Servei de Cirurgia, Hospital Clinic, Barcelona (Spain); Pavon, N. [Inst. de Fisica Corpuscular, CSIC - UV, Valencia (Spain); Pavia, J. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); Inst. d' Investigacions Biomediques August Pi i Sunyer (IDIBAPS), Barcelona (Spain); CIBER de Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), Barcelona (Spain)
2009-07-01
Background: The treatment of malignant melanoma or sarcomas on a limb using extremity perfusion with tumour necrosis factor (TNF-{alpha}) and melphalan can result in a high degree of systemic toxicity if there is any leakage from the isolated blood territory of the limb into the systemic vascular territory. Leakage is currently controlled by using radiotracers and heavy external probes in a procedure that requires continuous manual calculations. The aim of this work was to develop a light, easily transportable system to monitor limb perfusion leakage by controlling systemic blood pool radioactivity with a portable gamma camera adapted for intraoperative use as an external probe, and to initiate its application in the treatment of MM patients. Methods: A special collimator was built for maximal sensitivity. Software for acquisition and data processing in real time was developed. After testing the adequacy of the system, it was used to monitor limb perfusion leakage in 16 patients with malignant melanoma to be treated with perfusion of TNF-{alpha} and melphalan. Results: The field of view of the detector system was 13.8 cm, which is appropriate for the monitoring, since the area to be controlled was the precordial zone. The sensitivity of the system was 257 cps/MBq. When the percentage of leakage reaches 10% the associated absolute error is {+-}1%. After a mean follow-up period of 12 months, no patients have shown any significant or lasting side-effects. Partial or complete remission of lesions was seen in 9 out of 16 patients (56%) after HILP with TNF-{alpha} and melphalan. Conclusion: The detector system together with specially developed software provides a suitable automatic continuous monitoring system of any leakage that may occur during limb perfusion. This technique has been successfully implemented in patients for whom perfusion with TNF-{alpha} and melphalan has been indicated. (orig.)
NMR study of damage on isolated perfused rat heart exposed to ischemia and hypoxia
International Nuclear Information System (INIS)
Luo Xuechun; Yan Yongbin; Zhang Riqing; Fan Lili
2001-01-01
Myocardial ischemia is the most common and primary cause of myocardium damage. Numerous conventional techniques and methods have been developed for ischemia and reperfusion studies. However, because of damage to the heart sample, most of these techniques can not be used to continuously monitor the full dynamic course of the myocardial metabolic pathway. The nuclear magnetic resonance (NMR) surface coil technique, which overcomes the limitations of conventional instrumentation, can be used to quantitatively study every stage of the perfused heart (especially after perfusion stoppage) continuously, dynamically, and without damage under normal or designed physiological conditions at the molecular level. In this paper, 31 P-NMR was used to study the effects of ischemia and hypoxia on isolated perfused hearts. The results show that complete hypoxia caused more severe functional damage to the myocardial cells than complete ischemia
Chen, Y; Wu, W; Zhang, X; Fan, W; Shen, L
2011-01-01
Purpose To investigate the feasibility of bypassing occluded segments of retinal venous main vessels in isolated, arterially perfused caprine eyes via the closed-sky vitrectomy approach using keratoprosthesis. Methods Isolated caprine eyes were used in this study. For each eye, the retinal vessel was perfused by Krebs solution via ophthalmic artery, and pars plana vitrectomy was performed using temporary keratoprosthesis. All retinal micro-vascular maneuvers were performed in a closed-sky eyeball. The main retinal vein was blocked by endodiathermy at the site of the vessel's first branching. Two openings, several millimeters apart, were created by vascular punctures in both the main vein and its branch vein wall straddling the induced occluded segment. Catheterization was achieved using a flexible polyimide tube, with each end inserted into the vessel wall opening. A sealed connection between the vessel and the tube was obtained by endodiathermy. Bypass of the occluded retinal vein segment was thus achieved, and the patency of this vascular bypass was confirmed by intravascular staining. Results Puncturing, catheterization, and endodiathermy were viable by closed-sky approach using keratoprosthesis. Bypassing of the occluded retinal main vein segment was accomplished with the combination of these maneuvers. Good results were obtained in 23 of 38 (60%) caprine eyes. Conclusions This study demonstrated that bypassing the occluded segment of retinal main vein can be successfully performed in a closed-sky eyeball model of isolated, arterially perfused caprine eye. This early work indicated that the more advanced retinal vascular bypass surgery in in vivo eye may be feasible in the future. PMID:21921946
The isolation of canine parvovirus and pathological changes of infected dogs
Directory of Open Access Journals (Sweden)
Indrawati Sendow
2004-03-01
Full Text Available The aims of this study are to isolate canine parvovirus (CPV from the field case and to evaluate its histological aspects in CPV infected dogs. Samples were collected from intestine, intestine contained and mucose, as well as dogs feses from diarrhoea and blood diarrhoea. The suspension of those specimen was inoculated into Feline Kidney cells and observed for cythopathic effect (CPE. The presence of CPE indicated that there was viral isolate and continued to further identification using Haemaglutination (HA test with pig red blood cells. Samples with positif in HA test were further identification using Haemaglutination Inhibition (HI test against reference CPV antisera. Isolation result showed that from 81 samples processed, 10 samples indicated CPE in cell cultures, and had agglutinated in pig red blood cells and neutralised reference CPV antisera as the same titer of reference CPV antisera. Nine isolates were obtained from feces and 1 isolate was obtained from Mucose intestine from bloody diarrhoea dogs. Those isolates were also obtained from 1 to 2 days post blood diarrhea clinical signs. Two from 10 cadavers examined showed histological changes to CPV infection. Isolate of CPV, originally from feces, was also obtained from one of the two cadavers. Based on the results it was concluded that more CPV viral isolates can be obtained from bloody diarrhea feces.
International Nuclear Information System (INIS)
Schumann, Stefan; Schließmann, Stephan J; Wagner, Giskard; Goebel, Ulrich; Priebe, Hans-Joachim; Guttmann, Josef; Kirschbaum, Andreas
2010-01-01
Flush perfusion of the pulmonary artery with organ protection solution is a standard procedure before lung explantation. However, rapid flush perfusion may cause pulmonary oedema which is deleterious in the lung transplantation setting. In this study we tested the hypotheses that high pulmonary perfusion pressure contributes to the development of pulmonary oedema and positive end-expiratory pressure (PEEP) counteracts oedema formation. We expected oedema formation to increase weight and decrease compliance of the lungs on the basis of a decrease in alveolar volume as fluid replaces alveolar air spaces. The pulmonary artery of 28 isolated porcine lungs was perfused with a low-potassium dextrane solution at low (mean 27 mmHg) or high (mean 40 mmHg) pulmonary artery pressure (PAP) during mechanical ventilation at low (4 cmH 2 O) or high (8 cmH 2 O) PEEP, respectively. Following perfusion and storage, relative increases in lung weight were smaller (p < 0.05) during perfusion at low PAP (62 ± 32% and 42 ± 26%, respectively) compared to perfusion at high PAP (133 ± 54% and 87 ± 30%, respectively). Compared to all other PAP–PEEP combinations, increases in lung weight were smallest (44 ± 9% and 27 ± 12%, respectively), nonlinear intratidal lung compliance was largest (46% and 17% respectively, both p < 0.05) and lung histology showed least infiltration of mononuclear cells in the alveolar septa, and least alveolar destruction during the combination of low perfusion pressure and high PEEP. The findings suggest that oedema formation during pulmonary artery flush perfusion in isolated and ventilated lungs can be reduced by choosing low perfusion pressure and high PEEP. PAP–PEEP titration to minimize pulmonary oedema should be based on lung mechanics and PAP monitoring
Polarographic measurement of ascorbate washout in isolated perfused rabbit hearts
International Nuclear Information System (INIS)
Arts, T.; Kuikka, J.T.; Reneman, R.S.; Bassingthwaighte, J.B.
1985-01-01
To study the myocardial washout of ascorbate, the applicability of polarographic detection of ascorbate ions by a platinum electrode (sensitive area 0.03 mm2) was investigated, in both a calibration setup (sampling flow along the electrode: 100 microliter X s-1) and isolated, retrogradely perfused rabbit hearts. In the calibration setup at pH 7.4, the sensitivity of the electrode was 70 microA/mol. This sensitivity increased moderately with increasing pH (13%/unit pH) and increasing sampling flow rate (14% at an increase from 100 to 150 microliter X s-1). In the isolated hearts, ascorbate infused into the aorta was detected in a right ventricular drain by the electrode as well as by the use of 14 C-labeled ascorbate. Both recorded time courses were similar except for a scaling factor dependent on flow velocity. During continuous infusion the arteriovenous difference of ascorbate was 2 +/- 2% (SD), indicating a relatively low consumption of ascorbate by the isolated heart. The authors conclude that polarographic measurement of ascorbate in the coronary effluent of an isolated rabbit heart can be performed on-line and relatively easily
Luminal and basolateral uptake of insulin in isolated perfused, proximal tubules
International Nuclear Information System (INIS)
Nielsen, S.; Nielsen, J.T.; Christensen, E.I.
1987-01-01
The present study was performed to quantitate compare the luminal and the peritubular uptake of 125 I-insulin in isolated, perfused, proximal tubules from rabbit kidneys. 125 I-insulin was added in physiological concentrations to either the perfusate or the bath fluid for 30 min. The luminal uptake in 30 min averaged 0.76 pg/mm at physiological concentrations and 18.0 pg/mm at high insulin concentrations. About 15-41% of the absorbed insulin was digested and 125 I-insulin at physiological and high concentrations in the bath was 0.136 and 0.318 pg, respectively. The data indicates that insulin is bound/absorbed at the basolateral membranes both by a saturable specific mechanism and a nonspecific, nonsaturable mechanism. The basolateral absorption constituted 15.2 and 1.8% of the total tubular extraction of insulin at physiological and high insulin concentrations, respectively. Electron microscope autoradiography showed that, after luminal as well as basolateral endocytosis, insulin was exclusively accumulated in endocytic vacuoles and lysosomes
Mocellin, Simone; Pilati, Pierluigi; Da Pian, Pierpaolo; Forlin, Marco; Corazzina, Susanna; Rossi, Carlo Riccardo; Innocente, Federico; Ori, Carlo; Casara, Dario; Ujka, Francesca; Nitti, Donato; Lise, Mario
2007-02-01
In the present work, we report on the results of our pilot study of hyperthermic isolated hepatic perfusion (IHP) with melphalan alone for patients with unresectable metastatic liver tumors refractory to conventional treatments, with particular regard to the correlation between pharmacokinetic findings and hepatic toxicity. Inclusion criteria were unresectable liver metastases, hepatic parenchyma replacement
Zhao, Lu-Yan; Liu, Shan; Chen, Zong-Gui; Zou, Jian-Zhong; Wu, Feng
2016-11-24
To investigate whether cavitation enhances the degree of coagulation during pulsed high-intensity focussed ultrasound (HIFU) in an isolated liver perfusion system. Isolated liver was treated by pulsed HIFU or continuous-wave HIFU with different portal vein flow rates. The cavitation emission during exposure was recorded, and real-time ultrasound images were used to observe changes in the grey scale. The coagulation size was measured and calculated. HIFU treatment led to complete coagulation necrosis and total cell destruction in the target regions. Compared to exposure at a duty cycle (DC) of 100%, the mean volumes of lesions induced by 6 s exposure at DCs of 50% and 10% were significantly larger (P cavitation activity for the pulsed-HIFU (P > .05). For continuous-wave HIFU exposure, there was a significant decrease in the necrosis volume and cavitation activity for exposure times of 1, 2, 3, 4, and 6 s with increasing portal perfusion rates. Perfusion flow rates negatively influence cavitation activity and coagulation volume. Ablation is significantly enhanced during pulsed HIFU exposure compared with continuous-wave HIFU.
Arterio-venous anastomoses in isolated, perfused rat lungs.
Conhaim, Robert L; Segal, Gilad S; Watson, Kal E
2016-11-01
Several studies have suggested that large-diameter (>25 μm) arterio-venous shunt pathways exist in the lungs of rats, dogs, and humans. We investigated the nature of these pathways by infusing specific-diameter fluorescent latex particles (4, 7, 15, 30, or 50 μm) into isolated, ventilated rat lungs perfused at constant pressure. All lungs received the same mass of latex (5 mg), which resulted in infused particle numbers that ranged from 1.7 × 10 7 4 μm particles to 7.5 × 10 4 50 μm particles. Particles were infused over 2 min. We used a flow cytometer to count particle appearances in venous effluent samples collected every 0.5 min for 12 min from the start of particle infusion. Cumulative percentages of infused particles that appeared in the samples averaged 3.17 ± 2.46% for 4 μm diameter particles, but ranged from 0.01% to 0.17% for larger particles. Appearances of 4 μm particles followed a rapid upslope beginning at 30 sec followed by a more gradual downslope that lasted for up to 12 min. All other particle diameters also began to appear at 30 sec, but followed highly irregular time courses. Infusion of 7 and 15 μm particles caused transient but significant perfusate flow reductions, while infusion of all other diameters caused insignificant reductions in flow. We conclude that small numbers of bypass vessels exist that can accommodate particle diameters of 7-to-50 μm. We further conclude that our 4 μm particle data are consistent with a well-developed network of serial and parallel perfusion pathways at the acinar level. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.
International Nuclear Information System (INIS)
Ward, W.F.; Moss, A.L.
1985-01-01
To further evaluate the role of the lysosomal system in insulin degradation, the authors have compared the effects of inhibitors of lysosomal function on the degradation of 125 I-insulin with 125 I-asialofetuin, a lysosomally targeted molecule, by the intact, perfused rat liver and the isolated rat hepatocyte. The inhibitors employed were chloroquine ( 125 microM), NH 4 Cl (10 mM), and leupeptin (50 micrograms/ml). In the intact, perfused liver the observed inhibition of 125 I-asialofetuin degradation at 30 min was as follows: chloroquine, 38%; NH 4 Cl, 32%; and leupeptin, 86%. Chloroquine also inhibited 125 I-insulin degradation in the intact, perfused liver (29%), but NH 4 Cl and leupeptin had no effect. Using the isolated hepatocyte, the observed values for inhibition of 125I-asialofetuin at 60 min were: chloroquine, 85%; NH 4 Cl, 76%; and leupeptin, 81%. Chloroquine produced a 28% inhibition of 125I-insulin degradation, while NH 4 Cl and leupeptin had no effect. Chloroquine and NH 4 Cl decreased cell-associated radioactivity when isolated hepatocytes were incubated with 125I-asialofetuin (leupeptin had no effect), whereas chloroquine caused a 107% increase in cell-associated radioactivity when 125I-insulin was added to the incubation media (NH 4 Cl and leupeptin had no effect). These results indicate that the effects of chloroquine on insulin degradation are an extralysosomal action and that lysosomes appear not to be involved in the physiologic degradation of the insulin molecule
Churchill, A E
1987-04-04
Canine parvovirus isolated from a case of haemorrhagic enteritis in a breeding kennel in England was passaged and cloned in cultured feline and canine cells. No significant evidence of pathogenicity was found during six serial passages of the modified virus back through young dogs. The attenuated virus was excreted by inoculated animals and spread rapidly to uninoculated animals held in contact. When high titre attenuated virus was given to the six-week-old offspring of a seropositive dam a prompt seroconversion was observed. When the attenuated virus was used as an experimental vaccine in 108 pups in an infected breeding colony a highly significant improvement was obtained in the accumulated morbidity and mortality compared with a parallel group vaccinated with modified live feline panleucopenia virus.
Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn
2013-09-27
Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
The influence of Poly-Vinyl-Chloride tubing on the isolated perfused rat´s heart.
Meijler, F.L.; Durrer, D.
1950-01-01
There are types of poly-vinyl-chloride tubing sold and used for medical and biological purposes which deteriorate heart action in a few minutes. A simple method for testing P.V.C. tubing can be found in the isolated rat's he art perfused according to Langendorff.
Ismail, Ahmed M; Rayan, Mona; Adel, Amr; Demerdash, Salah; Atef, Mohamed; Abdallah, Mohamed; Nammas, Wail
2014-02-01
We explored the prevalence and pattern of abnormal myocardial perfusion in patients with isolated coronary artery ectasia (CAE), as demonstrated by (99m)Tc-sestamibi scintigraphy. Prospectively, we enrolled 35 patients with angiographically documented CAE and no significant coronary obstruction, who underwent elective coronary angiography. Patients underwent Stress-rest (99m)Tc-sestamibi scintigraphy within 4 days of coronary angiography. They were divided into 2 groups: group I: with normal perfusion scan; and group II: with reversible perfusion defects. The mean age was 49.6 ± 6.9 years; 34 (97.1 %) were males. Seventy-nine (75.2 %) arteries were affected by CAE. Among 79 arteries affected by CAE, affection was diffuse in 37 (46.8 %). Thirteen (37.1 %) patients had normal perfusion scan (group I), whereas 22 (62.9 %) had reversible perfusion defects (group II). Among 22 patients with reversible perfusion defects, 20 (90.9 %) had mild and 2 (9.1 %) had moderate ischemia. Among 49 myocardial segments with reversible perfusion defects, 22 (44.9 %) were basal, 18 (36.7 %) mid-, and 9 (18.4 %) apical segments. Diffuse CAE was significantly more prevalent in group II versus group I, in all 3 major coronary arteries (p < 0.05 for all). In patients with isolated CAE who underwent elective coronary angiography, reversible perfusion defects demonstrated by (99m)Tc-sestamibi scintigraphy were rather prevalent, mostly mild, more likely to affect the basal and mid-segments of the myocardium, and more frequently associated with diffuse ectasia.
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Perfusion-induced changes in cardiac contractility depend on capillary perfusion.
Dijkman, M A; Heslinga, J W; Sipkema, P; Westerhof, N
1998-02-01
The perfusion-induced increase in cardiac contractility (Gregg phenomenon) is especially found in heart preparations that lack adequate coronary autoregulation and thus protection of changes in capillary pressure. We determined in the isolated perfused papillary muscle of the rat whether cardiac muscle contractility is related to capillary perfusion. Oxygen availability of this muscle is independent of internal perfusion, and perfusion may be varied or even stopped without loss of function. Muscles contracted isometrically at 27 degrees C (n = 7). During the control state stepwise increases in perfusion pressure resulted in all muscles in a significant increase in active tension. Muscle diameter always increased with increased perfusion pressure, but muscle segment length was unaffected. Capillary perfusion was then obstructed by plastic microspheres (15 microns). Flow, at a perfusion pressure of 66.6 +/- 26.2 cmH2O, reduced from 17.6 +/- 5.4 microliters/min in the control state to 3.2 +/- 1.3 microliters/min after microspheres. Active tension developed by the muscle in the unperfused condition before microspheres and after microspheres did not differ significantly (-12.8 +/- 29.4% change). After microspheres similar perfusion pressure steps as in control never resulted in an increase in active tension. Even at the two highest perfusion pressures (89.1 +/- 28.4 and 106.5 +/- 31.7 cmH2O) that were applied a significant decrease in active tension was found. We conclude that the Gregg phenomenon is related to capillary perfusion.
Isolation and phylogenetic characterization of Canine distemper virus from India.
Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek
2015-09-01
Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Cheng, Yi; Ji, Yikuan; Wang, Yu; Sun, Leilei; Huang, Jiaxin
2012-01-01
A widespread hemorrhagic gastroenteritis in young dogs occurred in South China. A virulent field canine parvovirus (CPV) strain, SC02/2011, was isolated from a puppy showing enteric signs in Guangdong, China. The genome of CPV strain SC02/2011 was sequenced and analyzed, which will promote a better understanding of the molecular epidemiology and genetic diversity of CPV field isolates in South China. PMID:23166228
Peroxynitrite-induced relaxation in isolated canine cerebral arteries and mechanisms of action
International Nuclear Information System (INIS)
Li Jianfeng; Li Wenyan; Altura, Bella T.; Altura, Burton M.
2004-01-01
The present study was undertaken to determine the vascular actions of peroxynitrite (ONOO - ), the product of superoxide and nitric oxide (NO), in isolated canine cerebral arteries and to gain insight into its potential mechanisms of action. In the absence of any vasoactive agent, ONOO - (from 10 -7 to 10 -6 M) was able to reduce the basal tension. In prostaglandin F2α-precontracted canine basilar arterial rings, ONOO - elicited concentration-dependent relaxation at concentrations from 10 -8 to 10 -5 M. The effective concentrations producing approximately 50% maximal relaxation (EC 50 ) to ONOO - were 4.06 x 10 -6 and 4.12 x 10 -6 M in intact and denuded rings, respectively (P > 0.05). No significant differences in relaxation responses were found in ring preparations with or without endothelium (P > 0.05). The presence of either 5 μM methylene blue (MB) or 5 μM 1H-[1,2,4]oxadiazolo-[4,3-α]quinoxalin-1-one (ODQ) significantly inhibited the relaxations induced by ONOO - . Tetraethylammonium chloride (T-2265) significantly decreased the ONOO - -induced relaxations in a concentration-dependent manner. However, ONOO - had no effect on rings precontracted by high KCL (P > 0.05). Addition of low concentrations of calyculin A (50 nM) was able to abolish the ONOO - -induced relaxation. Furthermore, ONOO - significantly inhibited calcium-induced contractions of K + -depolarized canine cerebral rings in a concentration-related manner. Lastly, a variety of pharmacological agents and antagonists including L-NMMA, L-arginine, indomethacin, atropine, naloxone, diphenhydramine, cimetine, glibenclamide, haloperidol, etc., did not influence the relaxant effects of ONOO - on the rings. Our new results suggest that ONOO - -triggered relaxation, on canine cerebral arteries, is mediated by elevation of cyclic guanosine monophosphate (cGMP) levels, membrane hyperpolarization via K+ channel activation, activation of myosin light chain phosphatase activity, and interference with
Directory of Open Access Journals (Sweden)
Schudt Christian
2005-07-01
Full Text Available Abstract Background The sources and measurement of reactive oxygen species (ROS in intact organs are largely unresolved. This may be related to methodological problems associated with the techniques currently employed for ROS detection. Electron spin resonance (ESR with spin trapping is a specific method for ROS detection, and may address some these technical problems. Methods We have established a protocol for the measurement of intravascular ROS release from isolated buffer-perfused and ventilated rabbit and mouse lungs, combining lung perfusion with the spin probe l-hydroxy-3-carboxy-2,2,5,5-tetramethylpyrrolidine (CPH and ESR spectroscopy. We then employed this technique to characterize hypoxia-dependent ROS release, with specific attention paid to NADPH oxidase-dependent superoxide formation as a possible vasoconstrictor pathway. Results While perfusing lungs with CPH over a range of inspired oxygen concentrations (1–21 %, the rate of CP• formation exhibited an oxygen-dependence, with a minimum at 2.5 % O2. Addition of superoxide dismutase (SOD to the buffer fluid illustrated that a minor proportion of this intravascular ROS leak was attributable to superoxide. Stimulation of the lungs by injection of phorbol-12-myristate-13-acetate (PMA into the pulmonary artery caused a rapid increase in CP• formation, concomitant with pulmonary vasoconstriction. Both the PMA-induced CPH oxidation and the vasoconstrictor response were largely suppressed by SOD. When the PMA challenge was performed at different oxygen concentrations, maximum superoxide liberation and pulmonary vasoconstriction occurred at 5 % O2. Using a NADPH oxidase inhibitor and NADPH-oxidase deficient mice, we illustrated that the PMA-induced superoxide release was attributable to the stimulation of NADPH oxidases. Conclusion The perfusion of isolated lungs with CPH is suitable for detection of intravascular ROS release by ESR spectroscopy. We employed this technique to
Isolated thoracic perfusion with chemofiltration for progressive malignant pleural mesothelioma
Directory of Open Access Journals (Sweden)
Aigner KR
2017-06-01
Full Text Available Karl Reinhard Aigner, Emir Selak, Sabine Gailhofer Department of Surgical Oncology, Medias Klinikum, Burghausen, Germany Introduction: Therapy of malignant pleural mesothelioma and especially the adequate role of surgery in this context remain the subject of controversial discussions. Radical surgery in particular, which is associated with substantial morbidity, failed to translate into a definite survival advantage. We report on interim results of an ongoing Phase II study of regional chemotherapy in terms of isolated thoracic perfusion with chemofiltration (ITP-F.Patients and methods: Twenty-eight patients (25 male, 3 female, mean age 63.4 years with advanced pleural mesothelioma were included in this study. Isolation of the chest was achieved by insertion of a venous and arterial stop-flow balloon catheter via a femoral access. The aorta and inferior vena cava were blocked at the level of the diaphragm and the upper arms were blocked by pneumatic cuffs. Chemotherapy, consisting of 60 mg/m² cisplatin and 15 mg/m² mitoxantrone, was administered directly into the aorta. The isolated circuit was maintained for 15 minutes followed by ~45 minutes of chemofiltration with a hemoprocessor until 5 L of filtrate were reached. The endpoints of the study were overall survival and quality of life (QoL.Results: Out of 28 patients enrolled in the study, 5 had prior surgeries, 10 patients had systemic chemotherapy, and 5 patients additional irradiation. In all patients in restaging, clinical progress was noted. In all, 162 cycles were administered. Due to chemofiltration, toxicity was within tolerable limits, revealing World Health Organization grade I leucopenia and thrombocytopenia in 9 patients and mucositis grade I in 6 patients. The major surgical complication was inguinal lymphatic fistula in 40% of the cases. Gastrointestinal toxicity and/or neurotoxicity were never observed. One-year survival was 49%, 2-year and 3-year survival was 31%, and 5
Inhibition of mirtazapine metabolism by Ecstasy (MDMA) in isolated perfused rat liver model.
Jamshidfar, Sanaz; Ardakani, Yalda H; Lavasani, Hoda; Rouini, Mohammadreza
2017-06-28
Nowadays MDMA (3,4-methylendioxymethamphetamine), known as ecstasy, is widely abused among the youth because of euphoria induction in acute exposure. However, abusers are predisposed to depression in chronic consumption of this illicit compound. Mirtazapine (MRZ), an antidepressant agent, may be prescribed in MDMA-induced depression. MRZ is extensively metabolized in liver by CYP450 isoenzymes. 8-hydroxymirtazapine (8-OH) is mainly produced by CYP2D6. N-desmethylmirtazapine (NDES) is generated by CYP3A4. MDMA is also metabolized by the mentioned isoenzymes and demonstrates mechanism-based inhibition (MBI) in association with CYP2D6. Several studies revealed that MDMA showed inhibitory effects on CYP3A4. In the present study, our aim was to evaluate the impact of MDMA on the metabolism of MRZ in liver. Therefore, isolated perfused rat liver model was applied as our model of choice in this assessment. The subjects of the study were categorized into two experimental groups. Rats in the control group received MRZ-containing Krebs-Henselit buffer (1 μg/ml). Rats in the treatment group received aqueous solution of 1 mg/ml MDMA (3 mg/kg) intraperitoneally 1 hour before receiving MRZ. Perfusate samples were analyzed by HPLC. Analyses of perfusate samples showed 80% increase in the parent drug concentrations and 50% decrease in the concentrations of both metabolites in our treatment group compared to the control group. In the treatment group compared to the control group, AUC (0-120) of the parent drug demonstrated 50% increase and AUC (0-120) of 8-OH and NDES showed 70% and 60% decrease, respectively. Observed decrease in metabolic ratios were 83% and 79% for 8-OH and NDES in treatment group compared to control group, respectively. Hepatic clearance (CL h ) and intrinsic clearance (Cl int ) showed 20% and 60% decrease in treatment group compared to control group. All findings prove the inhibitory effects of ecstasy on both CYP2D6 and CYP3A4 hepatic isoenzymes. In
DEFF Research Database (Denmark)
Osadchii, Oleg E; Bentzen, Bo Hjorth; Olesen, Søren-Peter
2009-01-01
of hypokalaemic perfusion (2.5 mm K(+) for 30 min) were assessed in isolated guinea-pig heart preparations using simultaneous recordings of volume-conducted electrocardiogram and monophasic action potentials from six ventricular epicardial sites. Effective refractory periods, ventricular fibrillation thresholds...... for re-entrant tachyarrhythmias. Taken together, these findings suggest that proarrhythmic effects of hypokalaemia are mostly attributed to increased LV arrhythmogenicity in the guinea-pig heart....
Directory of Open Access Journals (Sweden)
A. K. Sahoo
2017-12-01
Full Text Available Aim: In this study, the canine endometrium tissue is characterized for its stem cell properties such as adherence to tissue culture plate (plasticity, short population doubling time, serial clonal passaging, long-term culturing properties, stem cell marker expression, and multilineage differentiation potential. Materials and Methods: The present work describes a novel isolation protocol for obtaining mesenchymal stem cells from the uterine endometrium and is compared with cells derived from umbilical cord matrix as a positive control. These cells are clonogenic, can undergo several population doublings in vitro, and can be differentiated to the osteocytes in mature mesenchymal tissues when grown in osteogenic differentiation media as detected by Alizarin Red-S staining. Results: It is reported for the first time that the cells derived from the canine endometrium (e-multipotent stem cells [MSCs] were able to differentiate into a heterologous cell type: Osteocytes, thus demonstrating the presence of MSCs. Thus, the endometrium may be told as a potential source of MSCs which can be used for various therapeutic purposes. Conclusion: The endometrium can be used as a potential source of MSCs, which can be used for various therapeutic purposes.
Release of galanin from isolated perfused porcine adrenal glands
DEFF Research Database (Denmark)
Holst, J J; Ehrhart-Bornstein, M; Messell, T
1991-01-01
We found a high concentration of galanin in extracts of porcine adrenal glands (114 pmol/g). By immunohistochemistry, galanin was localized to groups of medullary cells previously shown to produce norepinephrine. To study mechanisms for the release of galanin, we developed the following in vitro...... model: isolated perfused porcine adrenals with intact splanchnic nerve supply. When the nerves were electrically stimulated, epinephrine and norepinephrine secretion increased 276- and 291-fold, respectively, and galanin release increased up to 1,300-fold. Acetylcholine at 10(-6) M stimulated galanin...... release, and hexamethonium almost abolished the response to nerve stimulation. Galanin infusions had no effect on epinephrine and norepinephrine secretion in concentrations of 10(-8) and 10(-7) M, but increased both cortisol and aldosterone secretion (P less than 0.05). Splanchnic nerve stimulation...
Kidney in potassium depletion. II. K+ handling by the isolated perfused rat kidney
International Nuclear Information System (INIS)
Hayashi, M.; Katz, A.I.
1987-01-01
In a companion paper the authors reported a large increment in Na + -K + -ATPase activity and [ 3 H]ouabain binding the inner stripe of outer medullary collecting tubules from K-depleted rats. To test the hypothesis that the increased number of Na + -K + pumps in these animals may be involved in potassium reabsorption they examined the effect of ouabain on K excretion by isolated, perfused kidneys from rats fed a K-free diet for 3 wk. Kidneys from K-depleted rats retain potassium avidly, both the fractional (FE/sub K/) and absolute K excretion being approximately fivefold lower than in control kidneys. Ouabain (5 mM) increased FE/sub K/ in kidneys from each K-depleted rat; similar results were obtained when kidneys were perfused with low and high potassium concentrations. In contrast, ouabain produced a variable effect in control kidneys, that depended on the perfusate potassium concentration. In K-depleted rats amiloride did not significantly alter K excretion and did not block the ouabain-induced kaliuresis, suggesting that the latter is not due to enhanced secretion secondary to increased distal fluid delivery. These results provide evidence for ouabain-sensitive potassium reabsorption in kidneys of chronically K-depleted rats, and suggest an explanation for the increased Na + -K + -ATPase observed in such animals
Isolation and phylogenetic analysis of canine distemper virus among domestic dogs in Vietnam.
Nguyen, Dung Van; Suzuki, Junko; Minami, Shohei; Yonemitsu, Kenzo; Nagata, Nao; Kuwata, Ryusei; Shimoda, Hiroshi; Vu, Chien Kim; Truong, Thuy Quoc; Maeda, Ken
2017-01-20
Canine distemper virus (CDV) is one of the most serious pathogens found in many species of carnivores, including domestic dogs. In this study, hemagglutinin (H) genes were detected in five domestic Vietnamese dogs with diarrhea, and two CDVs were successfully isolated from dogs positive for H genes. The complete genome of one isolate, CDV/dog/HCM/33/140816, was determined. Phylogenetic analysis showed that all Vietnamese CDVs belonged to the Asia-1 genotype. In addition, the H proteins of Vietnamese CDV strains were the most homologous to those of Chinese CDVs (98.4% to 99.3% identity). These results indicated that the Asia-1 genotype of CDV was the predominant genotype circulating among the domestic dog population in Vietnam and that transboundary transmission of CDV has occurred between Vietnam and China.
Carpenter, Laurie Jean
When administered intravenously or intratracheally to rats, rabbits and sheep, phorbol myristate acetate (PMA) produces changes in lung morphology and function are similar to those seen in humans with the adult respiratory distress syndrome (ARDS). Therefore, it is thought that information about the mechanism of ARDS development can be gained from experiments using PMA-treated animals. Currently, the mechanisms by which PMA causes pneumotoxicity are unknown. Results from other studies in rabbits and in isolated, perfused rabbit lungs suggest that PMA-induced lung injury is mediated by active oxygen species from neutrophils (PMN), whereas studies in sheep and rats suggest that PMN are not required for the toxic response. The role of PMN, active oxygen metabolites and thromboxane (TxA_2) in PMA-induced injury to isolated, perfused rat lungs (IPLs) was examined in this thesis. To determine whether PMN were required for PMA to produce toxicity to the IPL, lungs were perfused for 30 min with buffer containing various concentrations of PMA (in the presence or absence of PMN). When concentrations >=q57 ng/ml were added to medium devoid of added PMN, perfusion pressure and lung weight increased. When a concentration of PMA (14-28 ng/ml) that did not by itself cause lungs to accumulate fluid was added to the perfusion medium containing PMN (1 x 10 ^8), perfusion pressure increased, and lungs accumulated fluid. These results indicate that high concentrations of PMA produce lung injury which is independent of PMN, whereas injury induced by lower concentrations is PMN-dependent. To examine whether active oxygen species were involved in mediating lung injury induced by PMA and PMN, lungs were coperfused with the oxygen radical scavengers SOD and/or catalase. Coperfusion with either or both of these enzymes totally protected lungs against injury caused by PMN and PMA. These results suggest that active oxygen species (the hydroxyl radical in particular), mediate lung injury in
Increased sinusoidal volume and solute extraction during retrograde liver perfusion
International Nuclear Information System (INIS)
Bass, N.M.; Manning, J.A.; Weisiger, R.A.
1989-01-01
Retrograde isolated liver perfusion has been used to probe acinar functional heterogeneity, but the hemodynamic effects of backward flow have not been characterized. In this study, extraction of a long-chain fatty acid derivative, 12-N-methyl-7-nitrobenzo-2-oxa-1,3-diazol-amino stearate (12-NBDS), was greater during retrograde than during anterograde perfusion of isolated rat liver. To determine whether hemodynamic differences between anterograde and retrograde perfused livers could account for this finding, the hepatic extracellular space was measured for both directions of flow by means of [ 14 C]sucrose washout during perfusion as well as by direct measurement of [ 14 C]sucrose entrapped during perfusion. A three- to fourfold enlargement of the total hepatic extracellular space was found during retrograde perfusion by both approaches. Examination of perfusion-fixed livers by light microscopy and morphometry revealed that marked distension of the sinusoids occurred during retrograde perfusion and that this accounts for the observed increase in the [ 14 C]sucrose space. These findings support the hypothesis that maximum resistance to perfusate flow in the isolated perfused rat liver is located at the presinusoidal level. In addition, increased transit time of perfusate through the liver and greater sinusoidal surface area resulting from sinusoidal distension may account for the higher extraction of 12-NBDS and possibly other compounds by retrograde perfused liver
Putte, B.P. van
2003-01-01
Isolated lung perfusion is an experimental surgical technique for the treatment of pulmonary metastases in order to improve the current 5-year survival of approximately 40 % after surgical resection of manually palpable metastases. Several drugs have been tested in animals models and five phase I
Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung
2012-01-01
Purpose In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. Materials and Methods We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. Result...
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Characterisation of canine parvovirus strains isolated from cats with feline panleukopenia.
Decaro, Nicola; Buonavoglia, Domenico; Desario, Costantina; Amorisco, Francesca; Colaianni, Maria Loredana; Parisi, Antonio; Terio, Valentina; Elia, Gabriella; Lucente, Maria Stella; Cavalli, Alessandra; Martella, Vito; Buonavoglia, Canio
2010-10-01
Unlike the original canine parvovirus type 2 (CPV-2), CPV-2 variants have gained the ability to replicate in vivo in cats but there is limited information on the disease patterns induced by these variants in the feline host. During 2008, two distinct cases of parvoviral infection were diagnosed in our laboratories. A CPV-2a variant was identified in a 3-month-old Persian kitten displaying clinical sign of feline panleukopenia (FPL) (acute gastroenteritis and marked leukopenia) and oral ulcerations, that died eight days after the onset of the disease. Two pups living in the same pet shop as the cat were found to shed a CPV-2a strain genetically identical to the feline virus and were likely the source of infection. Also, non-fatal infection by a CPV-2c strain occurred in a 2.5-month-old European shorthair kitten displaying non-haemorrhagic diarrhoea and normal white blood cell counts. By sequence analysis of the major capsid protein (VP2) gene, the feline CPV-2c strain showed 100% identity to a recent canine type-2c isolate. Both kittens had been administered multivalent vaccines against common feline pathogens including FPL virus. Whether and to which extent the FPL vaccines can protect cats adequately from the antigenic variants of CPV-2 should be assessed. 2010 Elsevier Ltd. All rights reserved.
Gier, R.P.E. de; Feitz, W.F.J.; Masereeuw, R.; Wouterse, A.C.; Smits, D.; Russel, F.G.M.
2003-01-01
OBJECTIVE: To study the pathophysiological changes of renal tubular drug transport mechanisms in congenital renal obstruction, by developing a model for perfusing the isolated kidney (IPK) after neonatal surgical induction of partial ureteric obstruction in Hanover Wistar rats. MATERIAL AND METHODS:
Propofol attenuates oxidant-induced acute lung injury in an isolated perfused rabbit-lung model.
Yumoto, Masato; Nishida, Osamu; Nakamura, Fujio; Katsuya, Hirotada
2005-01-01
Reactive oxygen species have been strongly implicated in the pathogenesis of acute lung injury (ALI). Some animal studies suggest that free radical scavengers inhibit the onset of oxidant-induced ALI. Propofol (2,6-diisopropylphenol) is chemically similar to phenol-based free radical scavengers such as the endogenous antioxidant vitamin E. Both in vivo and in vitro studies have suggested that propofol has antioxidant potential. We hypothesized that propofol may attenuate ALI by acting as a free-radical scavenger. We investigated the effects of propofol on oxidant-induced ALI induced by purine and xanthine oxidase (XO), in isolated perfused rabbit lung, in two series of experiments. In series 1, we examined the relationship between the severity of ALI and the presence of hydrogen peroxide (H2O2). In series 2, we evaluated the effects of propofol on attenuating ALI and the dose dependence of these effects. The lungs were perfused for 90 min, and we evaluated the effects on the severity of ALI by monitoring the pulmonary capillary filtration coefficient (Kfc), pulmonary arterial pressure (Ppa), and the pulmonary capillary hydrostatic pressure (Ppc). In series 1, treatment with catalase (an H2O2 scavenger) prior to the addition of purine and XO resulted in complete prevention of ALI, suggesting that H2O2 may be involved closely in the pathogenesis of ALI. In series 2, pretreatment with propofol at concentrations in excess of 0.5 mM significantly inhibited the increases in the Kfc values, and that in excess of 0.75 mM significantly inhibited the increase in the Ppa values. Propofol attenuates oxidant-induced ALI in an isolated perfused rabbit lung model, probably due to its antioxidant action.
International Nuclear Information System (INIS)
Cheng Eap Ng; Seh-Hoon Song
1978-01-01
Albumin labelled with 125 I was used as a tracer to investigate the washout kinetics of plasma from the coronary circulation of isolated perfused feline hearts. Compartmentalization with experimental results showed at least two compartments. The model was compared with a three-compartment model found previously for red blood cells. The results indicate that there is a separation of plasma and RBC in the coronary microcirculation. (author)
Characterization of a new dog isolate of canine distemper virus from China.
Qiao, J; Meng, Q; Chen, C; Xia, X; Cai, X; Ren, Y; Zhang, H
2011-01-01
Canine distemper virus (CDV) is a highly contagious pathogen of dogs. Vaccination is an effective way to protect dogs from CDV infection, but occasionally fails. In the present study, a wild type (wt) CDV, named XJ2, was isolated from a dead vaccinated dog. The hemagglutinin (H) gene of the XJ2 was amplified and analyzed for the molecular characteristics including N-glycosylation sites, phylogenesis, hydrophobicity and epitopes. The data indicated that XJ2 was a genetic variant strain of CDV. CDV-sero-negative dogs were inoculated intranasally with XJ2, developed severe clinical symptoms and died, suggesting high virulence.
Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C
2018-02-26
Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.
Tabereaux, Paul B; Walcott, Greg P; Rogers, Jack M; Kim, Jong; Dosdall, Derek J; Robertson, Peter G; Killingsworth, Cheryl R; Smith, William M; Ideker, Raymond E
2007-09-04
The roles of Purkinje fibers (PFs) and focal wave fronts, if any, in the maintenance of ventricular fibrillation (VF) are unknown. If PFs are involved in VF maintenance, it should be possible to map wave fronts propagating from PFs into the working ventricular myocardium during VF. If wave fronts ever arise focally during VF, it should be possible to map them appearing de novo. Six canine hearts were isolated, and the left main coronary artery was cannulated and perfused. The left ventricular cavity was exposed, which allowed direct endocardial mapping of the anterior papillary muscle insertion. Nonperfused VF was induced, and 6 segments of data, each 5 seconds long, were analyzed during 10 minutes of VF. During 36 segments of data that were analyzed, 1018 PF or focal wave fronts of activation were identified. In 534 wave fronts, activation was mapped propagating from working ventricular myocardium to PF. In 142 wave fronts, activation was mapped propagating from PF to working ventricular myocardium. In 342 wave fronts, activation was mapped arising focally. More than 1 of these 3 patterns could occur in the same wave front. PFs are highly active throughout the first 10 minutes of VF. In addition to retrograde propagation from the working ventricular myocardium to PFs, antegrade propagation occurs from PFs to working ventricular myocardium, which suggests PFs are important in VF maintenance. Prior plunge needle recordings in dogs indicate activation propagates from the endocardium toward the epicardium after 1 minute of VF, which suggests that focal sites on the endocardium may represent foci and not breakthrough. If so, in addition to reentry, abnormal automaticity or triggered activity may also occur during VF.
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Short-term memory and electrical restitution in the canine transmural ventricle
International Nuclear Information System (INIS)
Zhang, Hong; Ueyama, Takeshi; Lin, Shien-Fong; Wang, Juan; Wu, Rui-Juan
2011-01-01
Cardiac short-term memory is an intrinsic property of paced myocardium that reflects the influence of pacing history. Using an optical mapping method to record membrane voltage and intracellular calcium (Ca 2+ i ), this study investigated the properties and mechanisms of short-term memory in isolated and perfused canine wedge preparations. In addition to the dynamic and S1S2 pacing protocols, a perturbed downsweep pacing protocol was used to get a complete overview of the restitution portrait. Abrupt changes in basic cycle length (BCL) were applied to investigate the accommodation process of action potential duration (APD). The results showed unobvious differences of memory among the epi-, mid- and endo-myocytes, implying an insignificant memory-induced transient heterogeneity in APD across the transmural canine hearts. With the decrease of pacing rate S1, memory gradually elevated and achieved a maximum around 400 ms, and then reduced as S1 decreased further, indicating a non-monotonic relationship between memory and the pacing rate. After suppressing the Ca 2+ i transient with ryanodine (3 µmol l −1 ), the accommodation process of APD to a new BCL significantly abbreviated (τ = 37.41 ± 4.42 stimuli before ryanodine, τ = 15.84 ± 4.74 stimuli after ryanodine, p < 0.01). Therefore, Ca 2+ i cycling was suggested to play an important role in memory during dynamic pacing
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Isolated hepatic perfusion as a treatment for uveal melanoma liver metastases (the SCANDIUM trial)
DEFF Research Database (Denmark)
Olofsson, Roger; Ny, Lars; Eilard, Malin Sternby
2014-01-01
for patients with liver metastases is between 6 and 12 months, and no treatment has in randomized trials ever been shown to prolong survival. A previous phase II trial using isolated hepatic perfusion (IHP) has suggested a 14-month increase in overall survival compared with a historic control group consisting...... of the longest surviving patients in Sweden during the same time period (26 versus 12 months). METHODS/DESIGN: This is the protocol for a multicenter phase III trial randomizing patients with isolated liver metastases of uveal melanoma to IHP or best alternative care (BAC). Inclusion criteria include liver....... The planned sample size is 78 patients throughout five years. DISCUSSION: Patients with isolated liver metastases of uveal melanoma origin have a short expected survival and no standard treatment option exists. This is the first randomized clinical trial to evaluate IHP as a treatment option with overall...
MR-based assessment of pulmonary ventilation-perfusion in animal models
International Nuclear Information System (INIS)
Yang Jian; Wan Mingxi; Guo Youmin
2003-01-01
Objective: To show the feasibility and value in the diagnosis of airway obstruction and pulmonary embolism with MR oxygen-enhanced ventilation combined with pulmonary perfusion imaging. Methods: Eight canines were implemented for peripheral pulmonary embolism by intravenous injection of gelfoam granules at pulmonary segmental arterial level, and five of them were formed airway obstruction models by inserting self-made balloon catheter at second-bronchia. The oxygen-enhanced MR ventilation imaging was introduced by subtracting the images of pre- and post- inhaled pure oxygen. The MR pulmonary perfusion imaging was achieved by the first-pass contrast agent method. Moreover, the manifestation of MR ventilation and perfusion imaging was observed and contradistinguished with that of general pathologic anatomy, ventilation-perfusion scintigraphy, and pulmonary angiography. Results: The manifestations of airway obstruction regions in MR ventilation and perfusion imaging were matched, but those of pulmonary embolism regions were dismatched. The defect range of airway obstruction in MR ventilation image was smaller than that in ventilation scintigraphy. The abnormal perfusion regions of pulmonary embolism were divided into defect regions and reduce regions based on the time courses of signal intensity changes. The sensitivity and specificity of diagnosis on pulmonary embolism by MR ventilation combined with perfusion technique were 75.0% and 98.1%. The diagnostic results were in good coherence with ventilation-perfusion scintigraphy and pulmonary angiography (K=0.743, 0.899). Conclusion: The MR oxygen-enhanced ventilation combined with pulmonary perfusion imaging can be used to diagnose the airway and vascular abnormity in lung. This technique resembles the ventilation-perfusion scintigraphy. It can provide quantitative functional information and better spatial and temporal resolution, and possesses the value of clinical application
E.R. Manusama (Eric)
1998-01-01
textabstractIsolated limb perfusion (lLP) with high dose TNFa in combination with IFNr and melphalan in patients with melanoma in transit metastases confined to the limb has recently been reported to result in much higher complete tumor response rates than after the standard therapy of ILP with
The effect of age on outcomes after isolated limb perfusion for advanced extremity malignancies.
Smith, H G; Wilkinson, M J; Smith, M J F; Strauss, D C; Hayes, A J
2018-06-22
Isolated limb perfusion (ILP) is a well-established treatment for patients with advanced extremity malignancies unsuitable for limb-conserving surgery. However, little is known about the outcomes of this treatment in elderly patients. We sought to determine the effects of age on the tolerability and efficacy of ILP for advanced extremity malignancy. Patients undergoing ILP at our institution between January 2005 and January 2018 were identified from a prospectively maintained database. Patients were stratified by pathology (melanoma, soft-tissue sarcoma, other) and age (<75 years and ≥75 years). Outcomes of interest were perioperative morbidity and mortality, locoregional toxicities, response rates and oncological outcomes. During the study period, a total of 189 perfusions were attempted. Successful perfusions were performed in 179 patients, giving a technical success rate of 94.7%. No difference in perfusion success rates, severe locoregional toxicity and perioperative morbidity or mortality was noted between those aged <75 years and ≥75 years. The overall response rate in melanoma was 82.4%, and no difference in response rates or oncological outcomes between age groups was noted in these patients. The overall response rate in soft-tissue sarcoma was 63.5%, with no difference in response rates noted between age groups. However, patients aged <75 years with soft-tissue sarcoma had prolonged local recurrence-free survival compared with older patients (13 versus 6 months), possibly due to the prevalence of chemosensitive subtypes in the younger age group. ILP is an effective treatment for advanced extremity malignancies in the elderly, with comparable response rates and toxicities to younger patients. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines
Directory of Open Access Journals (Sweden)
Yamaguchi Ryoji
2009-10-01
Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.
Mochizuki, Masami; Ohshima, Takahisa; Une, Yumi; Yachi, Akiko
2008-12-01
Canine parvovirus type 2 (CPV) is a pathogen that causes severe hemorrhagic gastroenteritis with a high fatality rate in pups worldwide. Since CPV emerged in the late 1970s, its origin has been explored with the conclusion that CPV originated from feline panleukopenia virus or a closely related virus. Both high mutation rate and recombination are assumed to be key factors in the evolution of parvoviruses. Here we provide evidence for natural recombination in CPV isolated from dogs in cell culture. Antigenic and genetic properties of isolates from 10 diseased pups were elucidated. Six pups had been vaccinated beforehand with live combined vaccine containing original antigenic type CPV (CPV-2). Six isolates recovered from 4 vaccinated pups in cell cultures were found to contain either CPV-2 or CPV-2-like viruses. The other isolates, including all those from non-vaccinated pups, were CPV-2b viruses. Antigenic typing of two CPV-2-like isolates, 03-029/M and 1887/f, with a monoclonal antibody panel suggested they were a mixture of CPV-2 and CPV-2a (03-029/M) and a recombinant of CPV-2 and CPV-2b (1887/f). Genetic analysis of the VP1 gene indicated that isolate 03-029/M was a mixture of CPV-2, CPV-2a and a recombinant of CPV-2 and CPV-2a viruses, while isolate 1887/f was composed of a recombinant of CPV-2 and CPV-2b viruses. This is the first demonstration of natural CPV recombination in the field and suggests that recombination in the evolution of CPV is a more frequent and important process than previously believed.
Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S
2015-01-01
The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.
Spacek, M; Mitás, P; Lacina, L; Krajsová, I; Hodková, G; Salmay, M; Spunda, R; Brlicová, L; Lindner, J
2011-01-01
Hyperthermic isolated limb perfusion (HILP) is a standardized method of treatment in selected patients with in-transient locoregional recurrence/methastasis of melanoma or, some other soft tissue tumors (incl. sarcoma etc.) Authors present history and current status of this treatment modality in General University Hospital in Prague. During one year period (7/2009-6/2010) 10 patients were indicated for this procedure. We performed 13 procedures (3x redo), 11 in lower extremity and 2 in upper extremity. There was no serious complication in this cohort of patiens. Multidisciplinar approach is indicated in melanoma patients care.
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Directory of Open Access Journals (Sweden)
Tan Bin
2011-11-01
Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.
Tan, Bin; Wen, Yong-Jun; Wang, Feng-Xue; Zhang, Shu-Qin; Wang, Xiu-Dong; Hu, Jia-Xin; Shi, Xin-Chuan; Yang, Bo-Chao; Chen, Li-Zhi; Cheng, Shi-Peng; Wu, Hua
2011-11-16
A new isolate of canine distemper virus (CDV), named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N), phosphoprotein (P) and receptor binding haemagglutinin (H) gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Januschowski, Kai; Zhour, Ahmad; Lee, Albert; Maddani, Ramin; Mueller, Sebastien; Spitzer, Martin S; Schnichels, Sven; Schultheiss, Maximilian; Doycheva, Deshka; Bartz-Schmidt, Karl-Ulrich; Szurman, Peter
2012-03-01
The effects of a glutathione-containing intra-ocular irrigation solution, BSS Plus©, on retinal function and on the survival of ganglion cells in whole-mount retinal explants were studied. Evidence is provided that the perfused ex vivo bovine retina can serve as an alternative to in vivo animal testing. Isolated bovine retinas were prepared and perfused with an oxygen-saturated standard irrigation solution, and an electroretinogram was recorded to assess retinal function. After stable b-waves were detected, the isolated retinas were perfused with BSS Plus for 45 minutes. To investigate the effects of BSS Plus on photoreceptor function, 1mM aspartate was added to the irrigation solution in order to obtain a-waves, and the ERG trace was monitored for 75 minutes. For histological analysis, isolated whole retinal mounts were stored for 24 hours at 4°C, in the dark. The percentages of cell death in the retinal ganglion cell layer and in the outer and inner nuclear layers were estimated by using an ethidium homodimer-1 stain and the TUNEL assay. General swelling of the retina was examined with high-resolution optical coherence tomography. During perfusion with BSS Plus, no significant changes in a-wave and b-wave amplitudes were recorded. Retinas stored for 24 hours in BSS Plus showed a statistically significant smaller percentage (52.6%, standard deviation [SD] = 16.1%) of cell death in the retinal ganglion cell layer compared to the control group (69.6%, SD = 3.9, p = 0.0031). BSS Plus did not seem to affect short-term retinal function, and had a beneficial effect on the survival of retinal ganglion cells. This method for analysing the isolated perfused retina represents a valuable alternative for testing substances for their retinal biocompatibility and toxicity. 2012 FRAME.
Noestelthaller, Arne; Probst, Alexander; Koenig, Horst E
2005-10-01
To study and investigate branching patterns of the canine coronary arteries and collateral circulation by use of corrosion casting techniques. 31 hearts obtained from cadavers of clinically normal dogs of various ages and breeds and of either sex. 3-dimensional reproduction of coronary arteries was achieved by postmortem injection and perfusion with casting materials into the aortic sinus via the ascending aorta. Perfused hearts were macerated and carefully irrigated; the air-dried specimens were examined macroscopically and with a magnifying headset. Collateral arteries and inter- and intra-arterial anastomoses were successfully detected in 8 corrosion cast specimens. In total, 9 coronary collateral arteries and 3 interarterial anastomoses were found. Our finding of coronary collateral arteries in canine hearts is in agreement with recent findings in coronary flow study. On the basis of our results, vasodilation treatment to improve collateral vessel remodeling in dogs with myocardial dysfunction may be warranted.
Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung
2012-07-01
In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. The attenuated isolate conferred complete protection against lethal homologous CPV infection in dogs such that they did not develop any clinical symptoms, and their antibody titers against CPV were significantly high at 7-11 days post infection. These results suggest that the virus isolate obtained after passaging can be developed as a novel vaccine against paroviral infection.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
Directory of Open Access Journals (Sweden)
Mohammad Karami
2016-07-01
Full Text Available Background: Corn silk (CS is widely used in Iranian traditional medicine. The aim of this study was to investigate hepatoprotective activity of CS by Isolated Rat Liver Perfusion System (IRLP. Methods: Hydro-alcoholic extract of corn silk (10, 20, 40, and 100 mg kg-1 was evaluated for its hepatoprotective activity by IRLP. Phenol and flavonoid contents of the extract were determined as gallic acid and quercetin equivalents from a calibration curve, respectively. IRLP system is ideal for studying biochemical alterations of chemicals with minimum neuro-hormonal effects. In this study, the liver was perfused with Kerbs-Henseleit buffer, containing different concentration of hydro-alcoholic extract of corn silk (10, 20, 40, 50,100mg/kg, added to the buffer, and perfused for 2 hours. During the perfusion, many factors, including amino-transferees activities and the level of GSH, were assessed as indicators of liver viability. Consequently, sections of liver tissues were examined for any histopathological changes. Results: Histopathological changes in liver tissues were related to hydro-alcoholic extract of corn silk concentrations in a dose-dependent manner. Also, 50 and 100mg/kg doses caused significant (P<0.05 histopathological changes. Level of GSH in samples perfused with hydro-alcoholic extract increased compared to the control group. Conclusion: Hepatoprotective effect of CS is due to decreased lipid peroxidation, although other mechanisms might also be involved.
DEFF Research Database (Denmark)
Christiansen, Charlotte Bayer; Gabe, Maria Buur Nordskov; Svendsen, Berit
2018-01-01
chain fatty acids (SCFAs) produced by local bacterial fermentation are suggested to activate the colonic free fatty acid receptors FFAR2 (GPR43) and FFAR3 (GPR41), stimulating the colonic L-cells. We used the isolated perfused rat colon as a model of colonic endocrine secretion and studied the effects...
Directory of Open Access Journals (Sweden)
Gurpreet Kaur
2015-01-01
Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.
Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q
2015-02-01
Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.
Perfusion of the isolated rat brain with [14C]-Δ1-tetrahydrocannabinol
International Nuclear Information System (INIS)
Martin, B.; Agurell, S.; Krieglstein, J.; Rieger, H.
1977-01-01
There is controversy over whether Δ 1 -tetrahydrocannabinol (Δ 1 -THC) or its metabolites is responsible for the behavioural and cardiovascular effects of cannabis. It has been shown that, even in the absence of metabolism, Δ 1 -THC was capable of altering the EEG of isolated perfused rat brain, and must therefore contribute to the psychoactivity of cannabis. TLC studies showed no evidence for brain metabolism of [ 14 C]-Δ 1 -THC, and in particular the 7-hydroxylated metabolite (7-OH-Δ 1 -THC) could not be detected. A disproportionate amount of CNS activity in the rat cannot therefore be attributed to 7-OH-Δ 1 -THC on the basis that it is formed at or near its locus of action. (U.K.)
A Review of Liver Perfusion Method in Toxicology Studies
Directory of Open Access Journals (Sweden)
M karami
2014-06-01
Full Text Available Introduction: The isolated perfused rat liver is an accepted method in toxicology studies. The isolated perfused rat liver (IPRL is a useful experimental system for evaluating hepatic function without the influence of other organ systems, undefined plasma constituents, and neural-hormonal effects. Methods: The untreated male rats (180-220gr body weight were anesthetised with ether and then surgery with proper method. The abdomen was opened through a midline and one transversal incision and the bile duct was cannulated. Heparin sodium solution (0.5 ml; 500 U/ml in 0.9% NaCl was injected via the abdominal vena cava to prevent blood clotting. The liver inferior venacava was cannulated with PE-10 tubing and secured. The portal vein was immediately cannulated with an 23gr catheter which was secured and then liver was perfused in situ by Krebs- Henseleit buffer (pH 7.4; saturated with 95% O2 and 5% CO2; 37°C at a flow rate of 20 ml/min for 3hr. Temperature, perfusion pressure, flow rate and perfusion fluid pH were closely monitored during the perfusion. Results: Transferase enzymes (ALT, AST alterations can be widely used as a measure of biochemical alterations in order to assess liver damage due to use of drugs such as isoniazid (INH and animal and plant toxins. Accumulated material in gallbladder are valuable samples to assess the level of Glutathione (GSH. Sections of perfused liver tissue can also be effectively analyzed for pathological aspects such as necrosis, fibrosis, cellularity. Conclusion: The isolated perfused rat liver (IPRL is a useful and Sutible experimental system for evaluating hepatic function. In this system, the effects of adjacent organs, on the liver is minimized
Gamoh, K; Senda, M; Inoue, Y; Itoh, O
2005-09-03
Canine parvovirus type 2a (CPV-2a) and type 2b (CPV-2b) have recently been isolated from cats throughout the world, and CPV-2b strain FP84 has been reported to be virulent in domestic cats. Although live feline panleucopenia virus (FPLV) vaccines protect domestic cats from CPV infection, the efficacy of inactivated FPLV vaccines has not been established. In this study, two domestic cats were vaccinated with a commercial inactivated FPLV vaccine and challenged with CPV-2b strain FP84 isolated from a domestic cat. The cats were protected against CPV-2b strain FP84 infection and their clinical signs were suppressed, although the two unvaccinated cats showed the typical clinical signs of parvovirus infection.
Xu, Xiaowei; Jiang, Li; Luo, Man; Li, Jiaoxing; Li, Weidong; Sheng, Wenli
2015-06-01
The etiology of isolated vertigo has been a substantial diagnostic challenge for both neurologists and otolaryngologists. This study was designed to detect recurrent isolated vertigo due to cerebral hypoperfusion using perfusion-weighted magnetic resonance imaging (PWI). We recruited isolated vertigo patients whose clinical condition was suspected to be caused by hypodynamics of the brain; these individuals formed the case group. We generated two additional groups: a negative group composed of vertigo patients whose symptoms were caused by problems associated with the ear and a healthy control group. Each subject underwent PWI, and seven regions of interest (ROIs) were chosen. The relative cerebral blood volume (rCBV), relative cerebral blood flow (rCBF), and mean transit time (MTT) were obtained from each ROI. We further calculated the absolute difference of relative parameter values between two mirrored ROIs. The significant difference in the relative MTT from the mirrored cerebellar ROI (|rMTTleft-right|) of the case group was larger than those from the negative and healthy control groups (p = 0.026 and p = 0.038, respectively). Signal differences in |rrCBVleft-right| and |rrCBFleft-right| were not found among the three groups. In summary, disequilibrium in the rMTT of the bilateral cerebellum in the case group implied that hypoperfusion of the posterior circulation could trigger recurrent isolated vertigo and could be shown efficiently using PWI.
Microangiographic study of the canine dental tissues: a preliminary report
International Nuclear Information System (INIS)
Miyabayashi, T.; Morgan, J.P.
1987-01-01
A microangiographic study of the dental tissues was performed on one adult mongrel dog to examine the usefulness of the technique. This preliminary study used 30% wt/vol Micropaque suspension which was perfused into the common carotid arteries. After the complete perfusion, the specimen was fixed into a mixture of 10% buffered neutral formalin solution and 95% ethyl alcohol. The mandibular bone with teeth in situ was decalcified. The specimen was embedded in methyl methacrylate. One mm slab sections were made, and then the microangiographs were made. Adequate filling of arterioles was evident on the microangiographs. This technique is shown to be useful in characterizing the nature of the blood supply to the bone and teeth that might be involved in the pathogenesis of radiation-induced injury in the canine dental and periodontal tissues
Thijssens, KMJ; van Ginkel, RJ; Pras, E; Suurmeijer, AJH; Hoekstra, HJ
Background: The aim was to investigate the value of adjuvant radiotherapy for locally advanced soft tissue sarcoma after hyperthermic isolated limb perfusion (ILP) with tumor necrosis factor alpha and melphalan followed by limb-saving surgery. Methods: From 1991 to 2003, 73 patients (median age, 54
2005-01-01
An important but unresolved question is whether mammalian mitochondria metabolize arginine to agmatine by the ADC (arginine decarboxylase) reaction. 15N-labelled arginine was used as a precursor to address this question and to determine the flux through the ADC reaction in isolated mitochondria obtained from rat liver. In addition, liver perfusion system was used to examine a possible action of insulin, glucagon or cAMP on a flux through the ADC reaction. In mitochondria and liver perfusion, 15N-labelled agmatine was generated from external 15N-labelled arginine. The production of 15N-labelled agmatine was time- and dose-dependent. The time-course of [U-15N4]agmatine formation from 2 mM [U-15N4]arginine was best fitted to a one-phase exponential curve with a production rate of approx. 29 pmol·min−1·(mg of protein)−1. Experiments with an increasing concentration (0– 40 mM) of [guanidino-15N2]arginine showed a Michaelis constant Km for arginine of 46 mM and a Vmax of 3.7 nmol·min−1·(mg of protein)−1 for flux through the ADC reaction. Experiments with broken mitochondria showed little changes in Vmax or Km values, suggesting that mitochondrial arginine uptake had little effect on the observed Vmax or Km values. Experiments with liver perfusion demonstrated that over 95% of the effluent agmatine was derived from perfusate [guanidino-15N2]arginine regardless of the experimental condition. However, the output of 15N-labelled agmatine (nmol·min−1·g−1) increased by approx. 2-fold (P<0.05) in perfusions with cAMP. The findings of the present study provide compelling evidence that mitochondrial ADC is present in the rat liver, and suggest that cAMP may stimulate flux through this pathway. PMID:15656789
Directory of Open Access Journals (Sweden)
Robert J. Van Ginkel
1999-01-01
Full Text Available Purpose. The feasibility of hyperthermic isolated limb perfusion (HILP with tumor necrosis factor-α (TNFα and cisplatin for the management of osteosarcoma was studied in the canine model.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Bu, Rui; Yin, Li; Yang, Han; Wang, Qi; Wu, Feng; Zou, Jian Zhong
2013-08-01
The aims of this study were to investigate the feasibility of accelerated tissue ablation using a peripheral scanning mode with high-intensity focused ultrasound (HIFU) and to explore the effect of flow rate on total energy consumption of the target tissues. Using a model of isolated porcine liver perfusion via the portal vein and hepatic artery, we conducted a scanning protocol along the periphery of the target tissues using linear-scanned HIFU to carefully adjust the varying focal depth, generator power, scanning velocity and line-by-line interval over the entire ablation range. Porcine livers were divided into four ablation groups: group 1, n = 12, with dual-vessel perfusion; group 2, n = 11, with portal vein perfusion alone; group 3, n = 10, with hepatic artery perfusion alone; and group 4, n = 11, control group with no-flow perfusion. The samples were cut open consecutively at a thickness of 3 mm, and the actual ablation ranges were calculated along the periphery of the target tissues after triphenyl tetrazolium chloride staining. Total energy consumption was calculated as the sum of the energy requirements at various focal depths in each group. On the basis of the pre-supposed scanning protocol, the peripheral region of the target tissue formed a complete coagulation necrosis barrier in each group with varying dose combinations, and the volume of the peripheral necrotic area did not differ significantly among the four groups (p > 0.05). Furthermore, total energy consumption in each group significantly decreased with the corresponding decrease in flow rate (p Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua
2015-10-01
Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.
Chronological analysis of canine parvovirus type 2 isolates in Japan.
Ohshima, Takahisa; Hisaka, Mitsuaki; Kawakami, Kazuo; Kishi, Masahiko; Tohya, Yukinobu; Mochizuki, Masami
2008-08-01
Fifty-five canine parvovirus type 2 (CPV) samples, 12 fecal specimens and 43 cell culture isolates, were examined for their genetic characteristics of VP2 gene. They were collected from the diseased dogs at various districts of Japan during 27 years from 1980 to 2006. A fragment of VP2 gene was analyzed by restriction fragment length polymorphism assay and DNA sequencing. The original antigenic type 2 of CPV (CPV-2) was no longer found in the samples since 1984, and two antigenic variants CPV-2a and CPV-2b replaced CPV-2 as predominant types for about 5 years from 1982. A new genetic variant of prototype CPV-2a with non-synonymous substitution at the VP2 amino acid residue 297 from Ser to Ala was first detected in 1987. New CPV-2b with the same amino acid substitution at position 297 as new CPV-2a was also detected from the samples collected in 1997. Since then new CPV-2b has been the predominant CPV over the field of Japan. Several additional amino acid substitutions were detected in the VP2 gene of some recent CPV strains. Neither CPV-2c(a), CPV-2c(b), nor "Glu-426" of the antigenic variants previously found outside the country was detected in any samples tested. Reactivity of new CPV-2a and 2b variants against antibodies produced by the current vaccine products was determined by a cross hemagglutination-inhibition test. The recent field CPV isolates reacted more efficiently to the antibodies produced in dogs vaccinated with the new CPV-2b vaccine strain than the conventional CPV-2 vaccine strain.
Kaur, G; Chandra, M; Dwivedi, P N
2016-03-01
Canine parvovirus (CPV) causes hemorrhagic enteritis, especially in young dogs, leading to high morbidity and mortality. It has four main antigenic types CPV-2, CPV-2a, CPV-2b and CPV-2c. Virus protein 2 (VP2) is the main capsid protein and mutations affecting VP2 gene are responsible for the evolution of various antigenic types of CPV. Full length VP2 gene from field isolates was amplified and cloned for sequence analysis. The sequences were submitted to the GenBank and were assigned Acc. Nos., viz. KP406928.1 for P12, KP406927.1 for P15, KP406930.1 for P32, KP406926.1 for Megavac-6 and KP406929.1 for NobivacDHPPi. Phylogenetic analysis indicated that the samples were forming a separate clad with vaccine strains. When the samples were compared with the world and Indian isolates, it was observed that samples formed a separate node indicating regional genetic variation in CPV.
Li, Wenxian; Feng, Youzhen; Lu, Weibiao; Xie, Xie; Xiong, Zhilin; Jing, Zhen; Cai, Xiangran; Huang, Li'an
2016-11-15
To determine the morphological changes of intracranial arteries and whole-brain perfusion in undetermined isolated vertigo (UIV) patients using 320-detector row computed tomography (CT). A total of 150 patients who underwent CT angiography (CTA) and CT perfusion (CTP) imaging were divided into UIV group and benign paroxysmal positional vertigo (BPPV) group. Sixty individuals with sex- and age-matched without vertigo and cerebral diseases served as the control. The morphological changes of intracranial arteries, perfusion parameters and vascular risk factors (VRFs) were analyzed, calculated and compared. In UIV patients, hypertension (HT), hyperlipidemia and number of VRFs≥3 occurred more commonly (P<0.0125, respectively). The incidence of vertebral artery dominance (VAD), vertebral artery stenosis (VAS) and basilar artery curvature (BAC) were significantly higher (P<0.0125, respectively). HT was an independent risk predictor of non-VAD (OR: 5.411, 95%CI: 1.401; 20.900, P=0.014). HT and VAD associated with BAC served as risk predictors (OR: 4.081, 95%CI: 1.056;15.775, P=0.041 and OR: 6.284, 95%CI: 1.848; 21.365, P=0.003, respectively). The absolute difference in relative values of CTP parameters from cerebellum and brainstem were significantly different (P<0.05), and hypoperfusion was found in the territories of the non-VAD side and the BAC cohort (P<0.05, respectively). On the basis of multiple VRFs, morphological changes of vertebrobasilar artery (VBA) and the unilateral hypoperfusion of the cerebellum and brainstem, that acts as a herald for IV occurrence, which should be paid cautious attention to UIV patients. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Rytter, Dorte; Gesser, Hans
2007-01-01
In heart muscle from mammals, catecholamines frequently evoke an oxygen waste and reduce efficiency. It was examined if this also applies to fish in which heart muscle activity is often restricted by oxygen availability. In the isolated perfused heart from rainbow trout, adrenaline (0.5 micro...
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
van Ginkel, Robert J.; Thijssens, Katja M. J.; Pras, Elisabeth; van der Graaf, Winette T. A.; Suurmeijer, Albert J. H.; Hoekstra, Harald J.
Background: The aim of this study was to investigate the long-term limb salvage rate and overall survival after isolated limb perfusion (ILP) with tumor necrosis factor alpha and melphalan for locally advanced soft tissue sarcoma (STS). Methods: From 1991 to 2003, 73 patients (36 men, 37 women,
Effects of thyroid state on respiration of perfused rat and guinea pig hearts
International Nuclear Information System (INIS)
Read, L.C.; Wallace, P.G.; Berry, M.N.
1987-01-01
The effects of thyroid state on the respiration of the isolated heart were investigated using retrograde perfused rat and guinea pig hearts. In both species, hypothyroidism caused a marked depression in circulating thyroid hormone concentrations and in the respiration of the isolated, retrograde perfused heart. Hypothyroidism was caused by injecting animals with Na 131 I. The effects on myocardial respiration could be attributed to changes in the contraction frequency and in the oxygen consumption per beat, with little contribution from basal respiration. Treatment of animals with thyroxine elevated plasma thyroid hormones to a similar extent in rats and guinea pigs. In the latter, thyroxine treatment was associated with substantial increases in the contraction frequency and the oxygen consumption per beat of the isolated heart. In contrast, only small changes were apparent in the retrograde perfused rat heart, observations that were confirmed in rat hearts perfused at near physiological work loads. It was concluded that rat hearts isolated from normal animals function at near maximal thyroid state, in contrast to the guinea pig heart, which requires higher circulating concentrations of thyroid hormones to attain maximal responses
Hydrogen ion changes and contractile behavior in the perfused rat heart
Cingolani, H.E.; Maas, A.H.J.; Zimmerman, A.N.E.; Meijler, F.L.
1975-01-01
The effect of acid-base alterations was analyzed using isolated rat hearts perfused at constant coronary perfusion pressure, and stimulated to contract at constant rate. The amount of shortening in the major axis and its derivative were measured to assess myocardial contractility. Both the
Opie, L H; Tuschmidt, R; Bricknell, O; Girardier, L
1980-01-01
1. Changing substrates from glucose to pyruvate in paced isolated rat hearts, perfused by the Langendorff technique at 65 cm H2O with a Krebs-Henseleit bicarbonate buffer, produced effects which are opposite to those of ouabain treatment: negative inotropy, decreased work efficiency, hyperpolarization, increased maximum rate of rise and amplitude of the action potential, increased conduction velocity. 2. All the effects resulting from perfusion with pyruvate can be reversed by adding ouabain at a concentration of 100 microM. 3. The correlation between various tissue metabolises and change in contractile force (delta F), rate of tension development [maximum + (dF/dt)] and rate of relaxation [maximum -(dF/dt)] was studied by multiple linear regression. No significant correlation was found with either glycogen content and tissue lactate or with cAMP and cGMP. A weak negative correlation was found with ATP and phosphocreatine. The strongest correlation was found 76 to 807 nM/g in passing from glucose- to pyruvate-containing perfusion solution. 4. In vitro tests performed with a solution containing high energy phosphates and magnesium at concentrations equal to their calculated values in the cytosol (pH 7.0) showed that a significant negative correlation exists between citrate concentration (range: 1 and 1500 M) and free calcium concentration in the micromole range. 5. It is concluded that the effects of pyruvate (non glucose substrate) perfusion could be mediated by a decrease in cytosolic-free calcium resulting from an increase in intracellular citrate. The observation that all these effects can be reversed by ouabain is taken as a circumstantial evidence of a common mechanism.
Energy Technology Data Exchange (ETDEWEB)
Schreiber, S S; Oratz, M; Rothschild, M A [Veterans Administration Hospital, New York (USA)
1980-12-01
Reperfusion after ischemia and perfusion with total anoxia were studied in the isolated guinea pig heart model, Deprivation of oxygen in both situations resulted in a marked shift of circulation from the left to the right ventricle, with markedly increased spaces of distribution of sup(99m)Tc radionuclides and albumin in the latter. In view of the complexities of measuring protein synthesis during ischemia, continuous anoxic perfusion was used to evaluate this parameter in anoxic induced arrest. There was a profound fall in protein synthesis associated with this arrest, accompanied by a fall in ATP, creatine phosphate, glycogen, potassium, and a rise in lactate production. The fall in protein synthesis was more marked in the left ventricle. The changes in synthesis were almost completely prevented by initiating cardiac arrest with high K/sup +/ (16 meq/l) at the same time as anoxia; energy metabolism remained near normal, and recovery of contractility was nearly complete. The studies demonstrated the differences in vascular distribution between the ventricles after ischemia or with perfusion anoxia, the possible difference in availability of substrate to the two ventricles under these conditions, as well as the difference in protein synthetic response, and further support the protective effect of potassium induced arrest on the hypoxic heart.
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
International Nuclear Information System (INIS)
Janes, N.; Clemens, J.A.; Glickson, J.D.; Cameron, J.L.
1988-01-01
The first nuclear magnetic resonance spectroscopic study of the canine pancreas is described. Both in-vivo, ex-vivo protocols and NMR observables are discussed. The stability of the ex-vivo preparation based on the NMR observables is established for at least four hours. The spectra obtained from the in-vivo and ex-vivo preparations exhibited similar metabolite ratios, further validating the model. Metabolite levels were unchanged by a 50% increase in perfusion rate. Only trace amounts of phosphocreatine were observed either in the intact gland or in extracts. Acute alcoholic pancreatitis was mimicked by free fatty acid infusion. Injury resulted in hyperamylasemia, edema (weight gain), increased hematocrit and perfusion pressure, and depressed levels of high energy phosphates
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Directory of Open Access Journals (Sweden)
Zhijun Zhong
2014-07-01
Full Text Available Canine parvovirus 2 (CPV-2 was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04% encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China.
Zhong, Zhijun; Liang, Luqi; Zhao, Juan; Xu, Xiaoyang; Cao, Xuefeng; Liu, Xuehan; Zhou, Ziyao; Ren, Zhihua; Shen, Liuhong; Geng, Yi; Gu, Xiaobin; Peng, Guangneng
2014-01-01
Canine parvovirus 2 (CPV-2) was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04%) encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China. PMID:25007818
DEFF Research Database (Denmark)
Paulsen, Ida F; Chakera, Annette Hougaard; Schmidt, Grethe
2015-01-01
(99m) Tc-labelled tracer infused into the isolated limb circulation. RESULTS: One hundred and sixteen of 131 procedures were completed. In 13%, a leakage of ≥10% was detected; in 6% (n = 8), the cytotoxic drug was never infused because of constant leakage; in 7% (n = 9), leakage ≥10% was measured......INTRODUCTION: The aim is to describe the importance of leakage monitoring in hyperthermic isolated limb perfusion (ILP). It is generally recommended that leakage should not exceed 10% because of risk of systemic toxicity. MATERIAL AND METHODS: Data retrieved by retrospective analysis of 131...... were observed in 14%. Three of the patients with leakage ≥10% were successfully treated in a repeated procedure. CONCLUSION: Leakage monitoring using a threshold of 10% during ILP saves the patients from systemic toxicity, however, at the expense of early termination or cancellation of ILP treatment...
Brunstein, Flavia; Hoving, Saske; Seynhaeve, Ann L B; van Tiel, Sandra T; Guetens, Gunther; de Bruijn, Ernst A; Eggermont, Alexander M M; ten Hagen, Timo L M
2004-11-03
We have previously shown how tumor response of isolated limb perfusion (ILP) with melphalan was improved when tumor necrosis factor alpha (TNF-alpha) was added. Taking into account that other vasoactive drugs could also improve tumor response to ILP, we evaluated histamine (Hi) as an alternative to TNF-alpha. We used a rat ILP model to assess the combined effects of Hi and melphalan (n = 6) on tumor regression, melphalan uptake (n = 6), and tissue histology (n = 2) compared with Hi or melphalan alone. We also evaluated the growth of BN-175 tumor cells as well as apoptosis, necrosis, cell morphology, and paracellular permeability of human umbilical vein endothelial cells (HUVECs) after Hi treatment alone and in combination with melphalan. The antitumor effect of the combination of Hi and melphalan in vivo was synergistic, and Hi-dependent reduction in tumor volume was blocked by H1 and H2 receptor inhibitors. Tumor regression was observed in 66% of the animals treated with Hi and melphalan, compared with 17% after treatment with Hi or melphalan alone. Tumor melphalan uptake increased and vascular integrity in the surrounding tissue was reduced after ILP treatment with Hi and melphalan compared with melphalan alone. In vitro results paralleled in vivo results. BN-175 tumor cells were more sensitive to the cytotoxicity of combined treatment than HUVECs, and Hi treatment increased the permeability of HUVECs. Hi in combination with melphalan in ILP improved response to that of melphalan alone through direct and indirect mechanisms. These results warrant further evaluation in the clinical ILP setting and, importantly, in organ perfusion.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
P.M.M. Dourado
2006-06-01
Full Text Available Myocardial contrast echocardiography has been used for assessing myocardial perfusion. Some concerns regarding its safety still remain, mainly regarding the induction of microvascular alterations. We sought to determine the bioeffects of microbubbles and real-time myocardial contrast echocardiography (RTMCE in a closed-chest canine model. Eighteen mongrel dogs were randomly assigned to two groups. Nine were submitted to continuous intravenous infusion of perfluorocarbon-exposed sonicated dextrose albumin (PESDA plus continuous imaging using power pulse inversion RTMCE for 180 min, associated with manually deflagrated high-mechanical index impulses. The control group consisted of 3 dogs submitted to continuous imaging using RTMCE without PESDA, 3 dogs received PESDA alone, and 3 dogs were sham-operated. Hemodynamics and cardiac rhythm were monitored continuously. Histological analysis was performed on cardiac and pulmonary tissues. No hemodynamic changes or cardiac arrhythmias were observed in any group. Normal left ventricular ejection fraction and myocardial perfusion were maintained throughout the protocol. Frequency of mild and focal microhemorrhage areas in myocardial and pulmonary tissue was similar in PESDA plus RTMCE and control groups. The percentages of positive microscopical fields in the myocardium were 0.4 and 0.7% (P = NS in the PESDA plus RTMCE and control groups, respectively, and in the lungs they were 2.1 and 1.1%, respectively (P = NS. In this canine model, myocardial perfusion imaging obtained with PESDA and RTMCE was safe, with no alteration in cardiac rhythm or left ventricular function. Mild and focal myocardial and pulmonary microhemorrhages were observed in both groups, and may be attributed to surgical tissue manipulation.
Perfusion of the isolated rat brain with (/sup 14/C)-. delta. /sup 1/-tetrahydrocannabinol
Energy Technology Data Exchange (ETDEWEB)
Martin, B; Agurell, S [Dept. of Pharmacognosy, Faculty of Pharmacy, BMC, Uppsala (Sweden); Krieglstein, J; Rieger, H
1977-12-01
There is controversy over whether ..delta../sup 1/-tetrahydrocannabinol (..delta../sup 1/-THC) or its metabolites is responsible for the behavioural and cardiovascular effects of cannabis. It has been shown that, even in the absence of metabolism, ..delta../sup 1/-THC was capable of altering the EEG of isolated perfused rat brain, and must therefore contribute to the psychoactivity of cannabis. TLC studies showed no evidence for brain metabolism of (/sup 14/C)-..delta../sup 1/-THC, and in particular the 7-hydroxylated metabolite (7-OH-..delta../sup 1/-THC) could not be detected. A disproportionate amount of CNS activity in the rat cannot therefore be attributed to 7-OH-..delta../sup 1/-THC on the basis that it is formed at or near its locus of action.
Molecular characterization of canine parvovirus in Vientiane, Laos.
Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn
2017-05-01
The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.
Ge, Lan; Kino, Aya; Lee, Daniel; Dharmakumar, Rohan; Carr, James C; Li, Debiao
2010-01-01
First-pass perfusion magnetic resonance imaging (MRI) is a promising technique for detecting ischemic heart disease. However, the diagnostic value of the method is limited by the low spatial coverage, resolution, signal-to-noise ratio (SNR), and cardiac motion-related image artifacts. A combination of sliding window and conjugate-gradient HighlY constrained back-PRojection reconstruction (SW-CG-HYPR) method has been proposed in healthy volunteer studies to reduce the acquisition window for each slice while maintaining the temporal resolution of 1 frame per heartbeat in myocardial perfusion MRI. This method allows for improved spatial coverage, resolution, and SNR. In this study, we use a controlled animal model to test whether the myocardial territory supplied by a stenotic coronary artery can be detected accurately by SW-CG-HYPR perfusion method under pharmacological stress. Results from 6 mongrel dogs (15-25 kg) studies demonstrate the feasibility of SW-CG-HYPR to detect regional perfusion defects. Using this method, the acquisition time per cardiac cycle was reduced by a factor of 4, and the spatial coverage was increased from 2 to 3 slices to 6 slices as compared with the conventional techniques including both turbo-Fast Low Angle Short (FLASH) and echoplanar imaging (EPI). The SNR of the healthy myocardium at peak enhancement with SW-CG-HYPR (12.68 ± 2.46) is significantly higher (P < 0.01) than the turbo-FLASH (8.65 ± 1.93) and EPI (5.48 ± 1.24). The spatial resolution of SW-CG-HYPR images is 1.2 × 1.2 × 8.0 mm, which is better than the turbo-FLASH (1.8 × 1.8 × 8.0 mm) and EPI (2.0 × 1.8 × 8.0 mm). Sliding-window CG-HYPR is a promising technique for myocardial perfusion MRI. This technique provides higher image quality with respect to significantly improved SNR and spatial resolution of the myocardial perfusion images, which might improve myocardial perfusion imaging in a clinical setting.
Bu, Lihong; Li, Renfei; Jin, Zhongnan; Wen, Xiaofei; Liu, Shuang; Yang, Baofeng; Shen, Baozhong; Chen, Xiaoyuan
2011-02-01
(99) (m)TcN-MPO ([(99) (m)TcN(mpo)(PNP5)](+): mpo = 2-mercaptopyridine oxide and PNP5 = N-ethoxyethyl-N,N-bis[2-(bis(3-methoxypropyl)phosphino)ethyl]amine) is a cationic (99) (m)Tc-nitrido complex, which has favorable biodistribution and myocardial uptake with rapid liver clearance in Sprague Dawley rats. The objective of this study was to compare the biodistribution and pharmacokinetics of (99) (m)TcN-MPO and (99) (m)Tc-Sestamibi in normal dogs, and to evaluate the potential of (99) (m)TcN-MPO as a myocardial perfusion agent in canines with acute myocardial infarction. Five normal mongrel dogs were injected intravenously with (99) (m)TcN-MPO. Venous blood samples were collected via a femoral vein catheter at 0.5, 1, 2, 3, 4, 5, 10, 20, 30, 40, 60, and 90 min post-injection (p.i.). Anterior-posterior planar images were acquired by γ-camera at 10, 20, 30, 60, 90, and 120 min p.i. Regions of interest (ROIs) were drawn around the heart, liver, and lungs. The heart/liver and heart/lung ratios were calculated by dividing the mean counts in heart ROI by the mean counts in the liver and lung ROI, respectively. For comparison, (99) (m)Tc-sestamibi was also evaluated in the same five dogs. The interval period between the two examinations was 1 week to eliminate possible interference between these two radiotracers. In addition, single positron emission computed tomography (SPECT) images in the canine infarct model were collected 24 h after myocardial infarction at 30 and 60 min after the administration of (99) (m)TcN-MPO (n = 4) or (99) (m)Tc-Sestamibi (n = 4). It was found that (99) (m)TcN-MPO and (99) (m)Tc-Sestamibi displayed very similar blood clearance characteristics during the first 90 min p.i. Both (99) (m)TcN-MPO and (99) (m)Tc-Sestamibi had a rapid blood clearance with less than 50% of initial radioactivity remaining at 1 min and less than 5% at 30 min p.i. (99) (m)TcN-MPO and (99) (m)Tc-Sestamibi both showed good
Bellomo, Rinaldo; Suzuki, Satoshi; Marino, Bruno; Starkey, Graeme K; Chambers, Brenton; Fink, Michael A; Wang, Bao Zhong; Houston, Shane; Eastwood, Glenn; Calzavacca, Paolo; Glassford, Neil; Skene, Alison; Jones, Daryl A; Jones, Robert
2012-09-01
Liver transplantation is a major life-saving procedure, and donation after cardiac death (DCD) has increased the pool of potential liver donors. However, DCD livers are at increased risk of primary graft dysfunction and biliary tract ischaemia. Normothermic extracorporeal liver perfusion (NELP) may increase the ability to protect, evaluate and, in future, transplant DCD livers. We conducted proof-of-concept experiments using a DCD model in the pig to assess the short-term (4 hours) feasibility and functional efficacy of NELP. Using extracorporeal membrane oxygenation, parenteral nutrition, separate hepatic artery and portal vein perfusion, and physiological perfusion pressures, we achieved NELP and evidence of function (bile production, paracetamol removal, maintenance of normal ammonia and lactate levels) for 4 hours in pig livers subjected to 15 and 30 minutes of cardiac arrest before explantation. Our experiments justify further investigations of the feasibility and efficacy of human DCD liver preservation by ex-vivo perfusion.
Perfusion device for liver preservation ex vivo before transplantation: first experimental study
Directory of Open Access Journals (Sweden)
O. N. Reznik
2017-01-01
Full Text Available Introduction. Successful liver transplantation including from donors with a sudden irreversible cardiac arrest requires the use of modern hardware and technical support to maintain, select and sustain organ viability for the period from harvesting to transplantation to the recipient.Materials and methods. Hardware-software system (HSS developed by the Russian State Scientific Center for Robotics and Technical Cybernetics (RTC was used for testing of normothermic perfusion of donor’s liver ex vivo. The experiment was conducted on the isolated pig liver (Duroc breed in accordance with the ethical principles.Result. During perfusion spontaneous recovery of bile outflow through the cannula installed in the common bile duct (volume of bile released – 240 ml was observed, and the color and uniformity of the perfused liver did not differ from the normal parameters. Biochemical indicators were stabilized at the physiological values after 40 minutes of perfusion procedure.Conclusion. Isolated liver transplant was completely restored after 30 minutes of warm ischemia and was functioning well due to ex vivo perfusion procedure on the new perfusion device. The first case of the new device usage for normothermic liver ex vivo demonstrated hopeful results to be further investigated.
Evaluation in dogs of a new double-dose technique for imaging changes in myocardial perfusion
International Nuclear Information System (INIS)
Rothendler, J.A.; Okada, R.D.; Strauss, H.W.; Chesler, D.A.; Pohost, G.M.
1984-01-01
Assessment of myocardial perfusion with thallium immediately before and after an intervention that alters blood flow has been difficult due to presence of residual activity from the first tracer dose at the time of the second imaging. In a canine model the authors investigated a technique using two separate thallium injections during an intervention and after its reversal. Images were obtained after each injection, and a difference image was obtained by subtracting the first from the second image to correct for tracer persisting from the first injection. Interventions on coronary blood flow included: transient occlusion, subcritical stenosis with dipyridamole infusion, and permanent occlusion. The first images showed defects corresponding to the occlusion or stenosis, while the ''difference'' images correlated with myocardial perfusion at the time of the second injection
Molecular characterisation of canine parvovirus strains circulating in ...
African Journals Online (AJOL)
STORAGESEVER
2010-07-19
Jul 19, 2010 ... Canine parvovirus (CPV) was first isolated at 1978 in the USA. Analysis of ... Japan, Australia, Italy and Africa although the proportions of CPV-2a ... T/A clone PCR product cloning Kit (Takara, DaLian, China). Sequencing was ...
International Nuclear Information System (INIS)
Nishimura, Tsunehiko; Sago, Masayoshi; Kihara, Koichi; Oka, Hisashi; Shimonagata, Tsuyoshi; Katabuchi, Tetsuro; Hayashi, Makoto; Uehara, Toshiisa; Hayashida, Kohei; Noda, Hiroyuki; Takano, Hisateru
1989-01-01
To evaluate the relationship between myocardial perfusion and fatty acid metabolism in canine myocardial infarction, 16 dogs were studied using thallium and 123 I-β-methyl-iodophenyl pentadecanoic acid (BMIPP). Eight dogs (group A) had left anterior coronary arterial occlusion (6 h ligation), 6 dogs (group B) had reperfusion (3 h ligation and 1 h reperfusion) and 2 dogs served as the normal control. Myocardial imaging with BMIPP was excellent, owing to its higher uptake and longer retention in myocardium and rapid blood disappearance in addition to diminished liver and lung uptake. The mean half time value which was generated from the BMIPP myocardial washout curve, was significantly larger in the reperfused myocardium. The gamma camera imaging showed uncoupling of BMIPP and thallium (BMIPP uptake greater than thallium uptake) in five dogs in group B. On the other hand, all dogs in group A had a persistent defect in BMIPP and thallium uptake. Our findings indicate that the combination of BMIPP and thallium for myocardial imaging supply different information about the zone of infarction and ischemia, which may be useful for the assessment of myocardial viability. (orig.)
Molecular characterization of canine distemper vi- rus circulating in ...
African Journals Online (AJOL)
2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Clinical manifestations of canine distemper in Nigerian dogs ...
African Journals Online (AJOL)
Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...
Canine distemper associated with generalized oedema in Nigerian ...
African Journals Online (AJOL)
Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...
International Nuclear Information System (INIS)
Yan Yongbin; Luo Xuechun; Zhang Riqing; Wang Xiaoyin; Zuo Lin; Liu Wei
2000-01-01
ischemic preconditioning (IPC) will protect the heart from the damage caused by a subsequent long ischemia period. 31 P spectra of isolated perfused rat heart measured by the nuclear magnetic resonance (NMR) surface coil technique can be used to continually, dynamically and noninvasively obtain metabolism information. This paper explores the IPC mechanisms by NMR. This study shows that IPC has no effect on enhancing the ATP and PCr levels during reperfusion but makes significantly slows and smooths the changes of intracellular pH and ATP during ischemia periods. The ATP and PCr recovery rate of the IPC group after ischemia is significantly higher than that of the control group. In conclusion, the above results support that IPC can protect the rat heart by reducing damage during the ischemia period
International Nuclear Information System (INIS)
Tapalaga, D.; Suciu, A.; Schvartz, M.; Duca, S.
1979-01-01
In order to establish whether the increased bromosulfophthalein (BSP) secretion in the bile following phenobarbital administration is the consequence of change in the bile output or of the enzymatic induction, the dynamics of the elimination of 131 I-BSP was studied in animals treated with alpha-naphthylisothiocyanate (ANIT) and pehnobarbital in the conditions of isolated perfused liver. At the same time the levels of the conjugation enzyme of BSP were also determined. It was noted that after phenobarbital the biliary elimination of 131 I-BSP is in correlation with the important increase of the output; in the animals treated with ANIT, on the other hand, the biliary excretion of BSP is minimal. The biliary elimination is directly proportional to the increase of the bile output and reflects the changes found in the perfusate. Our findings allow us to assume that the increased biliary BSP excretion is the consequence of the increase of the bile output and in a smaller extent the result of the stimulation of the BSP, conjugation with glutathion. (author)
Ecology of genus Porphyromonas in canine periodontal disease.
Isogai, H; Kosako, Y; Benno, Y; Isogai, E
1999-09-01
Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.
Bellomo, Rinaldo; Marino, Bruno; Starkey, Graeme; Fink, Michael; Wang, Bao Zhong; Eastwood, Glenn M; Peck, Leah; Young, Helen; Houston, Shane; Skene, Alison; Opdam, Helen; Jones, Robert
2014-09-01
Donation after circulatory death (DCD) livers are at markedly increased risk of primary graft dysfunction and biliary tract ischaemia. Normothermic extracorporeal liver perfusion (NELP) may increase the ability to transplant DCD livers and may allow their use for artificial extracorporeal liver support of patients with fulminant liver failure. We conducted two proof-of-concept experiments using human livers after DCD to assess the feasibility and functional efficacy of NELP over an extended period. We applied extracorporeal membrane oxygenation, parenteral nutrition, separate hepatic artery and portal vein perfusion and physiological perfusion pressures to two livers obtained after DCD. We achieved NELP and evidence of liver function (bile production, paracetamol removal and maintenance of normal lactate levels) in both livers; one for 24 hours and the other for 43 hours. Histological examination showed areas of patchy ischaemia but preserved biliary ducts and canaliculi. Our experiments justify further investigations of the feasibility and efficacy of extended DCD liver preservation by ex-vivo perfusion.
Radiation-induced increase in the release of amino acids by isolated, perfused skeletal muscle
International Nuclear Information System (INIS)
Schwenen, M.
1989-01-01
Local exposure of the hindquarter of the rat to 15Gy of gamma-radiation resulted, 4-6h after irradiation, in increased release of amino acids by the isolated, perfused hindquarter preparation, 70% of which is skeletal muscle. This increase in release involves not only alanine and glutamine, but also those amino acids not metabolized by muscle and, therefore, released in proportion to their occurrence in muscle proteins. Because metabolic parameters and content of energy-rich phosphate compounds in muscle remain unchanged, it is unlikely that general cellular damage is the underlying cause of the radiation-induced increase in amino acid release. The findings strongly favour the hypothesis that increased availability of amino acids results from enhanced protein break-down in skeletal muscle which has its onset shortly after irradiation. This radiation-induced disturbance in protein metabolism might be one of the pathogenetic factors in the aetiology of radiation myopathy. (author)
Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.
Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu
2014-08-01
Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.
Canine distemper virus in Lake Baikal seals (Phoca sibirica).
L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)
1996-01-01
textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
MRI-based quantification of Duchenne muscular dystrophy in a canine model
Wang, Jiahui; Fan, Zheng; Kornegay, Joe N.; Styner, Martin A.
2011-03-01
Duchenne muscular dystrophy (DMD) is a progressive and fatal X-linked disease caused by mutations in the DMD gene. Magnetic resonance imaging (MRI) has shown potential to provide non-invasive and objective biomarkers for monitoring disease progression and therapeutic effect in DMD. In this paper, we propose a semi-automated scheme to quantify MRI features of golden retriever muscular dystrophy (GRMD), a canine model of DMD. Our method was applied to a natural history data set and a hydrodynamic limb perfusion data set. The scheme is composed of three modules: pre-processing, muscle segmentation, and feature analysis. The pre-processing module includes: calculation of T2 maps, spatial registration of T2 weighted (T2WI) images, T2 weighted fat suppressed (T2FS) images, and T2 maps, and intensity calibration of T2WI and T2FS images. We then manually segment six pelvic limb muscles. For each of the segmented muscles, we finally automatically measure volume and intensity statistics of the T2FS images and T2 maps. For the natural history study, our results showed that four of six muscles in affected dogs had smaller volumes and all had higher mean intensities in T2 maps as compared to normal dogs. For the perfusion study, the muscle volumes and mean intensities in T2FS were increased in the post-perfusion MRI scans as compared to pre-perfusion MRI scans, as predicted. We conclude that our scheme successfully performs quantitative analysis of muscle MRI features of GRMD.
Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro
Directory of Open Access Journals (Sweden)
Cintia Xavier de Mello
2014-12-01
Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
Delwart, Eric; Kapusinszky, Beatrix; Pesavento, Patricia A; Estrada, Marko; Seguin, M Alexis; Leutenegger, Christian M
2017-07-20
We report here the first canine polyomavirus genome, identified by metagenomics in respiratory secretions of two dogs with severe pneumonia, which tested negative for all canine respiratory pathogens except Mycoplasma cynos The isolate, Canis familiaris polyomavirus 1 (DogPyV-1), is a beta polyomavirus whose closest known LT antigen relatives are primate polyomaviruses. Copyright © 2017 Delwart et al.
Functional state of perfused liver tissue in X-ray irradiated rats
Energy Technology Data Exchange (ETDEWEB)
Borovikova, G.V.; Dokshina, G.A.; Lapteva, T.A. (Tomskij Gosudarstvennyj Univ. (USSR). Nauchno-Issledovatel' skij Inst. Biologii i Biofiziki)
1981-01-01
The results of studying the functional state of perfused liver tissue isolated from rats after irradiation in the 18.06x10/sup -2/ Kl/kg dose, which has been estimated by transamination process rate catalized alanine-(KF 2.6x1.2, ALT and aspartate by aminotransferases (KF 2.6x1.1, ACT), gluconeogenesis and urea production intensity presented. When comparing the results obtained on the perfused liver deprived of homeostatic body effects it has been found that the liver isolated from the body for the first 24 hours of the radiation sickness development possesses a higher radiation activity which manifests itself in intensification of the processes of gluconeogenesis and transamination with substrate addition. The third 24 hours upon irradiation in the isolated liver the intensity of the gluconeogenesis and transamination processes is attenuated.
Genetic characterization of the complete genome of a mutant canine parvovirus isolated in China.
Li, Chuanfeng; Tang, Jingyu; Chen, Zongyan; Li, Qi; Huang, Zhenhua; Wang, Quan; Meng, Chunchun; Wang, Yong; Liu, Guangqing
2018-02-01
A field canine parvovirus (CPV) strain, CPV-SH14, was previously isolated from an outbreak of severe gastroenteritis in Shanghai in 2014. The complete genome of CPV-SH14 was determined by using PCR with modified primers. When compared to other CPV-2 strains, several insertions, deletions, and point mutations were identified in the 5' and 3' UTR, with key amino acid (aa) mutations (K19R, E572K in NS1 and F267Y, Y324I and T440A in VP2) also being observed in the coding regions of CPV-SH14. These results indicated that significant and unique genetic variations have occurred at key sites or residues in the genome of CPV-SH14, suggesting the presence of a novel genetic variant of new CPV-2a. Phylogenetic analysis of the VP2 gene revealed that CPV-SH14 may have the potential to spread worldwide. In conclusion, CPV-SH14 may be a novel genetic variant of new CPV-2a, potentially with a selective advantage over other strains.
Tumour response after hyperthermic isolated limb perfusion for locally advanced melanoma
DEFF Research Database (Denmark)
Paulsen, Ida Felbo; Chakera, A H; Drejøe, Jennifer Berg
2014-01-01
AND METHODS: A total of 84 perfusions were performed (53 women, 31 men, median age 63 years) from 1993 to 2010. 95% of the perfusions were administered to the lower limbs and 5% to the upper limbs. The inclusion criteria were recurrent and/or clinically apparent cutaneous/subcutaneous extremity in....... Time from ILP to recurrence was a median of seven months (range 1-37 months) for patients with CR or PR. Survival was longer for patients with CR or PR than for patients showing NC or progression. Several patients had mild or moderate local toxicity reactions, two patients developed severe local...... to improve local disease control in patients with multiple and/or recurrent melanoma confined to an extremity if surgical excision is not possible. FUNDING: not relevant. TRIAL REGISTRATION: not relevant....
Pulmonary O2 transfer during pulsatile and non-pulsatile perfusion.
Hauge, A; Nicolaysen, G
1980-07-01
The importance of the perfusion pattern for the oxygen transfer has been examined in isolated rabbit lungs perfused with plasma at constant volume inflow. The lungs were ventilated with constant tidal volume and constant end-expiratory pressure. Following a standardized rise in FIO2 the rate of rise in pulmonary venous PO2 (delta PO2/delta t) was measured during alternately pulsatile and non-pulsatile perfusion in normal lungs and in lungs made edematous by elevation of left atrial pressure. In normal lungs there was no difference in delta PO2/delta t when the two modes of perfusion were compared. In edematous lungs delta PO/delta t was statistically higher during pulsatile perfusion, indicating a beneficial effect of flow- and pressure pulsations, e.g. a better distribution of V/Q ratios throughout the lungs. In a separate series of expts. the advancement of a high O2 front through the airways was measured, and the two perfusion patterns compared. Since no difference was found, we suggest that the phenomenon of "cardiogenic gas mixing" in the airways in vivo is a result of a direct action of the heart on the lungs rather than arterial pulsations.
DEFF Research Database (Denmark)
Martella, V.; Cirone, F.; Elia, G.
2006-01-01
Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
The functional state of perfused liver tissue in X-ray irradiated rats
International Nuclear Information System (INIS)
Borovikova, G.V.; Dokshina, G.A.; Lapteva, T.A.
1981-01-01
The results of studying the functional state of perfused liver tissue isolated from rates after irradiation in the 18.06x10 - 2 Kl/kg dose, which has been estimated by transamination process rate catalized alanine-(KF 2.6x1.2, ALT and aspartate by aminotransferases (KF 2.6x1.1, ACT), gluconeogenesis and urea production intensity presented. When comparing the results obtained on the perfused liver deprived of homeostatic body effects it has been found that the liver isolated from the body for the first 24 hours of the radiation sickness development possesses a higher radiation activity which manifests itself in intensification of the processes of gluconeogenesis and transamination with substrate addition. The third 24 hours upon irradiation in the isolated liver the intensity of the gluconeogenesis and transamination processes is attenuated
Directory of Open Access Journals (Sweden)
H. Rodriguez-Angulo
2013-01-01
Full Text Available Chagas' myocardiopathy, caused by the intracellular protozoan Trypanosoma cruzi, is characterized by microvascular alterations, heart failure and arrhythmias. Ischemia and arrythmogenesis have been attributed to proteins shed by the parasite, although this has not been fully demonstrated. The aim of the present investigation was to study the effect of substances shed by T. cruzi on ischemia/reperfusion-induced arrhythmias. We performed a triple ischemia-reperfusion (I/R protocol whereby the isolated beating rat hearts were perfused with either Vero-control or Vero T. cruzi-infected conditioned medium during the different stages of ischemia and subsequently reperfused with Tyrode's solution. ECG and heart rate were recorded during the entire experiment. We observed that triple I/R-induced bradycardia was associated with the generation of auricular-ventricular blockade during ischemia and non-sustained nodal and ventricular tachycardia during reperfusion. Interestingly, perfusion with Vero-infected medium produced a delay in the reperfusion-induced recovery of heart rate, increased the frequency of tachycardic events and induced ventricular fibrillation. These results suggest that the presence of parasite-shed substances in conditioned media enhances the arrhythmogenic effects that occur during the I/R protocol.
DEFF Research Database (Denmark)
Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane
Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...
Cha, Se-Yeoun; Kim, Eun-Ju; Kang, Min; Jang, Sang-Ho; Lee, Hae-Beom; Jang, Hyung-Kwan
2012-09-01
Raccoon dogs (Nyctereutes procyonoides) are widespread and common in South Korea. In 2011, we obtained serum samples from 102 wild raccoon dogs to survey their exposure to canine distemper virus (CDV). Forty-five of the 102 animals (44.1%) were seropositive. Field cases of canine distemper in wild raccoon dogs from 2010 to 2011 were investigated. Fourteen cases of CDV infection were identified by a commercially available CDV antigen detection kit. These cases were used for virus isolation and molecular analysis. Sequence analysis of hemagglutinin genes indicated that all viruses isolated belonged to the Asia-2 genotype. H protein residues which are related to the receptor and host specificity (residues 530 and 549) were analyzed. A glutamic acid (E) residue is present at 530 in all isolates. At 549, a histidine (H) residue was found in five isolates and tyrosine (Y) residue was found in 6 isolates. Our study demonstrated that CDV infection was widespread in wild raccoon dogs in South Korea. Copyright © 2012 Elsevier Ltd. All rights reserved.
Presence of infectious RD-114 virus in a proportion of canine parvovirus isolates.
Yoshikawa, Rokusuke; Sato, Eiji; Miyazawa, Takayuki
2012-03-01
We recently found that certain canine live attenuated vaccines produced using `non-feline' cell lines were contaminated with an infectious feline endogenous retrovirus, termed RD-114 virus. We suspected that RD-114 virus may have contaminated the seed stock of canine parvovirus (CPV) during the production of the contaminated vaccines. In this study, we collected stock viruses of CPVs propagated in a feline cell line, and checked the presence of infectious RD-114 virus. Consequently, we found that RD-114 viral RNA was present in all stock viruses, and 7 out of 18 stock viruses were contaminated with infectious RD-114 virus. We also found that RD-114 virus was stable physically and is capable of retaining its infectivity for a long period at -80°C.
International Nuclear Information System (INIS)
Miller, D.L.; Carrasquillo, J.A.; Lutz, R.J.; Chang, A.E.
1989-01-01
The standard method for the evaluation of hepatic perfusion during hepatic artery infusion (HAI) chemotherapy is planar hepatic artery perfusion scintigraphy (HAPS). Planar HAPS was performed with 2 mCi of [99mTc] macroaggregated albumin infused at 1 ml/min and compared with single photon emission CT (SPECT) HAPS and with a new study, CT performed during the slow injection of contrast material through the HAI catheter (HAI-CT). Thirteen patients underwent 16 HAI-CT studies, 14 planar HAPS studies, and 9 SPECT HAPS studies. In 13 of 14 studies (93%) HAI-CT and planar HAPS were in complete agreement as to the perfusion pattern of intrahepatic metastases and normal liver. In nine studies where all modalities were performed, the findings identified by HAI-CT and planar HAPS agreed in all cases, whereas the results of two SPECT scans disagreed with the other studies. With respect to perfusion of individual metastases, 14 of 14 HAI-CT studies, 12 of 13 planar HAPS studies, and 9 of 9 SPECT HAPS studies correctly demonstrated the perfusion status of individual lesions as indicated by the pattern of changes in tumor size determined on CT obtained before and after the perfusion studies. Hepatic artery infusion CT was superior for delineation of individual metastases, particularly small lesions, and for the evaluation of nonperfused portions of the liver. Planar HAPS detected extrahepatic perfusion in four patients, and this was not detected by HAI-CT. We conclude that HAI-CT and scintigraphy are complementary techniques. Hepatic artery infusion CT has advantages for the evaluation of intrahepatic perfusion, and planar HAPS is superior to HAI-CT for the detection of extrahepatic perfusion
Optical measurement of isolated canine lung filtration coefficients at normal hematocrits.
Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J
1997-12-01
In this study, lung filtration coefficient (Kfc) values were measured in eight isolated canine lung preparations at normal hematocrit values using three methods: gravimetric, blood-corrected gravimetric, and optical. The lungs were kept in zone 3 conditions and subjected to an average venous pressure increase of 10.24 +/- 0.27 (SE) cmH2O. The resulting Kfc (ml . min-1 . cmH2O-1 . 100 g dry lung wt-1) measured with the gravimetric technique was 0.420 +/- 0.017, which was statistically different from the Kfc measured by the blood-corrected gravimetric method (0.273 +/- 0.018) or the product of the reflection coefficient (sigmaf) and Kfc measured optically (0. 272 +/- 0.018). The optical method involved the use of a Cellco filter cartridge to separate red blood cells from plasma, which allowed measurement of the concentration of the tracer in plasma at normal hematocrits (34 +/- 1.5). The permeability-surface area product was measured using radioactive multiple indicator-dilution methods before, during, and after venous pressure elevations. Results showed that the surface area of the lung did not change significantly during the measurement of Kfc. These studies suggest that sigmafKfc can be measured optically at normal hematocrits, that this measurement is not influenced by blood volume changes that occur during the measurement, and that the optical sigmafKfc agrees with the Kfc obtained via the blood-corrected gravimetric method.
PET imaging of cerebral perfusion and oxygen metabolism in stroke
Energy Technology Data Exchange (ETDEWEB)
Pointon, O.; Yasaka, M.; Berlangieri, S.U.; Newton, M.R.; Thomas, D.L.; Chan, C.G.; Egan, G.F.; Tochon-Danguy, H.J.; O``Keefe, G.; Donnan, G.A.; McKay, W.J. [Austin Hospital, Melbourne, VIC (Australia). Centre for PET and Depts of Nuclear Medicine and Neurology
1998-03-01
Full text: Stroke remains a devastating clinical event with few therapeutic options. In patients with acute stroke, we studied the cerebral perfusion and metabolic patterns with {sup 15}O-CO{sub 2} or H{sub 2}O and {sup 15}O-O{sub 2} positron emission tomography and correlated these findings to the clinical background. Forty three patients underwent 45 studies 0-23 days post-stroke (mean 7 days). Fifteen patients showed luxury perfusion (Group A), 10 had matched low perfusion and metabolism (B) and 3 showed mixed pattern including an area of misery perfusion (C). Seventeen showed no relevant abnormality (D) and there were no examples of isolated misery perfusion. Twelve of the 15 in Group A had either haemorrhagic transformation on CT, re-opening on angiography, or a cardioembolic mechanism. In contrast only 5/10 in Group B, 0/3 in Group C and 2/17 in Group D had these features. Although 7/10 in group B had moderate or large size infarcts on CT the incidence of haemorrhagic transformation was low (2/10) and significant carotid stenoses were more common in those studied (5/8) compared with the other groups. Misery perfusion was not seen beyond five days. Thus, luxury perfusion seems to be related to a cardio-embolic mechanism or reperfusion. Matched low perfusion and metabolism was associated with a low rate of haemorrhagic transformation despite a high incidence of moderate to large size infarcts. Misery perfusion is an early phenomenon in the evolution of ischaemic stroke.
Production of acetone and conversion of acetone to acetate in the perfused rat liver
International Nuclear Information System (INIS)
Gavino, V.C.; Somma, J.; Philbert, L.; David, F.; Garneau, M.; Belair, J.; Brunengraber, H.
1987-01-01
The utilization of millimolar concentrations of [2- 14 C]acetone and the production of acetone from acetoacetate were studied in perfused livers from 48-h starved rats. We devised a procedure for determining, in a perfused liver system, the first-order rate constant for the decarboxylation of acetoacetate (0.29 +/- 0.09 h-1, S.E., n = 8). After perfusion of livers with [2- 14 C]acetone, labeled acetate was isolated from the perfusion medium and characterized as [1- 14 C]acetate. No radioactivity was found in lactate or 3-hydroxybutyrate. After 90 min of perfusion with [2- 14 C]acetone, the specific activity of acetate was 30 +/- 4% (n = 13) of the initial specific activity of acetone. We conclude that, in perfused livers from 2-day starved rats, acetone metabolism occurs for the most part via free acetate
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
An experimental in-vivo canine model for adult shunt infection
Directory of Open Access Journals (Sweden)
Procop Gary
2008-10-01
Full Text Available Abstract Background Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional "human" shunts, and that a shunt infection could be established so that further studies could then be planned. Methods Hydrocephalus was induced in seven dogs (Canis familiaris by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison. Results All the dogs remained well after shunting. Examination of removed shunt components revealed S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three "negative" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source. Conclusion Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection.
Changes in Maxillary Canine Pulpal Blood Flow During Dentoalveolar Distraction Osteogenesis.
Ersahan, Seyda; Sabuncuoglu, Fidan Alakus
2016-05-01
The aim of this study was to assess the effects of dentoalveolar distraction osteogenesis (DD) on the pulpal blood flow (PBF) of maxillary canines. A laser Doppler flowmeter (LDF) was used to measure PBF in maxillary canines of 10 patients undergoing DD (study group) and 10 nonsurgical subjects who received no orthodontic treatment (control group). PBF was measured at baseline, at 4 and 7 days postoperatively, at the end of distraction and at the end of consolidation in the study group and at similar time-points in nonsurgical control subjects. Data were analyzed using paired and Student t tests, with the significance level set at 0.05. Study findings showed that baseline PBF values did not differ significantly between groups. PBF in the control group did not vary over time; however, in the study group, an initial decrease in PBF was observed at 4 days postoperatively and was followed by a gradual increase to preoperative levels at the end of distraction. During the DD latency period, there appears to be a short-lived ischemic phase when perfusion of pulp tissue declines; however, blood-flow returns to normal by the end of distraction.
Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model
Energy Technology Data Exchange (ETDEWEB)
Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo [Seoul National University College of Medicine, Seoul (Korea, Republic of)
2008-04-15
Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion.
Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model
International Nuclear Information System (INIS)
Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo
2008-01-01
Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
50 Years of renal physiology from one man and the perfused tubule: Maurice B. Burg.
Hamilton, Kirk L; Moore, Antoni B
2016-08-01
Technical advancements in research techniques in science are made in slow increments. Even so, large advances from insight and hard work of an individual with a single technique can have astonishing ramifications. Here, we examine the impact of Dr. Maurice B. Burg and the isolated perfused renal tubule technique and celebrate the 50th anniversary of the publication by Dr. Burg and his colleagues of their landmark paper in the American Journal of Physiology in 1966. In this study, we have taken a scientific visualization approach to study the scientific contributions of Dr. Burg and the isolated perfused tubule preparation as determining research impact by the number of research students, postdoctoral fellows, visiting scientists, and national and international collaborators. Additionally, we have examined the research collaborations (first and second generation scientists), established the migrational visualization of the first generation scientists who worked directly with Dr. Burg, quantified the metrics indices, identified and quantified the network of coauthorship of the first generation scientists with their second generation links, and determined the citations analyses of outputs of Dr. Burg and/or his first generation collaborators as coauthors. We also review the major advances in kidney physiology that have been made with the isolated perfused tubule technique. Finally, we are all waiting for the discoveries that the isolated perfused preparation technique will bring during the next 50 years. Copyright © 2016 the American Physiological Society.
DEFF Research Database (Denmark)
Weihprecht, H; Lorenz, J N; Schnermann, J
1990-01-01
Adenosine has been proposed to act within the juxtaglomerular apparatus (JGA) as a mediator of the inhibition of renin secretion produced by a high NaCl concentration at the macula densa. To test this hypothesis, we studied the effects of the adenosine1 (A1)-receptor blocker 8-cyclopentyl-1......,3-dipropylxanthine (CPX) on renin release from single isolated rabbit JGAs with macula densa perfused. The A1-receptor agonist, N6-cyclohexyladenosine (CHA), applied in the bathing solution at 10(-7) M, was found to inhibit renin secretion, an effect that was completely blocked by adding CPX (10(-5) M) to the bath....... Applied to the lumen, 10(-5) M CPX produced a modest stimulation of renin secretion rates suppressed by a high NaCl concentration at the macula densa (P less than 0.05). The effect of changing luminal NaCl concentration on renin secretion rate was examined in the presence of CPX (10(-7) and 10(-5) M...
International Nuclear Information System (INIS)
Nevasaari, K.; Alakare, B.; Kaerki, N.T.
1976-01-01
The effect of pretreatment with spironolactone, phenobarbital and 3,4-benzpyrene on biliary excretion of ouabain was studied in isolated perfused rat liver system after a single dose of 3 H-ouabain. Spironolactone pretreatment (100 mg/kg intraperitoneally for 4 days) changed the time course of the excretion, thus accelerating the transport of ouabain into the bile. Phenobarbital pretreatment (75 mg/kg intraperitoneally for 4 days) enhanced bile flow and increased biliary excretion of ouabain only after 15 min. At longer time periods the increase in bile flow diluted the bile level of ouabain there being no difference in the amounts excreted into the bile between the treated and untreated groups. 3,4-benzpyrene pretreatment (20 mg/kg intraperitoneally for 4 days) was without efffect on biliary excretion of ouabain. The results suggest that spironolactone differs from phenobarbital in its enhancing effect on biliary excretion of ouabain, possibly through a specific effect on an unknown hepatic transport mechanism. (author)
Ex vivo perfusion of human spleens maintains clearing and processing functions.
Buffet, Pierre A; Milon, Geneviève; Brousse, Valentine; Correas, Jean-Michel; Dousset, Bertrand; Couvelard, Anne; Kianmanesh, Reza; Farges, Olivier; Sauvanet, Alain; Paye, François; Ungeheuer, Marie-Noëlle; Ottone, Catherine; Khun, Huot; Fiette, Laurence; Guigon, Ghislaine; Huerre, Michel; Mercereau-Puijalon, Odile; David, Peter H
2006-05-01
The spleen plays a central role in the pathophysiology of several potentially severe diseases such as inherited red cell membrane disorders, hemolytic anemias, and malaria. Research on these diseases is hampered by ethical constraints that limit human spleen tissue explorations. We identified a surgical situation--left splenopancreatectomy for benign pancreas tumors--allowing spleen retrieval at no risk for patients. Ex vivo perfusion of retrieved intact spleens for 4 to 6 hours maintained a preserved parenchymal structure, vascular flow, and metabolic activity. Function preservation was assessed by testing the ability of isolated-perfused spleens to retain Plasmodium falciparum-infected erythrocytes preexposed to the antimalarial drug artesunate (Art-iRBCs). More than 95% of Art-iRBCs were cleared from the perfusate in 2 hours. At each transit through isolated-perfused spleens, parasite remnants were removed from 0.2% to 0.23% of Art-iRBCs, a proportion consistent with the 0.02% to 1% pitting rate previously established in artesunate-treated patients. Histologic analysis showed that more than 90% of Art-iRBCs were retained and processed in the red pulp, providing the first direct evidence of a zone-dependent parasite clearance by the human spleen. Human-specific physiologic or pathophysiologic mechanisms involving clearing or processing functions of the spleen can now be experimentally explored in a human tissue context.
Energy Technology Data Exchange (ETDEWEB)
Gut, I.; Hatle, K.; Zizkova, L.
1981-03-01
Factors responsible for different quantitative effect of phenobarbital (PB) pretreatment on benzene metabolism to phenol in vivo and in vitro were studied in male Wistar rats. A more than 4-fold increase of benzene metabolism was observed with 9,000 g supernatant of liver homogenate, 2.8- to 4-fold increase with isolated perfused liver; phenol formation in vivo after oral benzene was increased by PB 2-fold, but only shortly following benzene administration and the enhancement rapidly diminished to 1.15-fold increase in the total excreted phenol. Benzene concentrations in 9,000 g supernatant incubations were 2 mM, those with isolated perfused livers were up to 4 mM, but those in blood in vivo were below 0.3 mM; the effect of PB induction in vivo disappeared along with decreasing benzene and increasing phenol blood concentrations which surpassed benzene 2-3 h after oral benzene administration. The effect of benzene concentration on the manifestation of PB induction is also supported by almost a 2-fold increased phenol formation in PB rats over controls in vivo after repeated administration of benzene. The elimination of radioactive metabolites of orally administered benzene-/sup 14/C, in urine was markedly inhibited by intraperitoneal administration of phenol, but not by pyrocatechol, resorcinol or hydroquinol suggesting that phenol might inhibit benzene metabolism in vivo especially when its concentration exceeds that of benzene.
Jaundice and bilirubinemia as manifestations of canine distemper in raccoons and ferrets
Kilham, L.; Habermann, R.T.; Herman, C.M.
1956-01-01
1) Two strains of distemper virus have been isolated from wild raccoons and one strain from ferrets. 2) All strains isolated have induced bilirubinemia in raccoons and ferrets. Many raccoons with bilirubinemia also had jaundice. 3) Identification of these strains as members of the canine distemper virus complex has been by clinical and pathological findings consistent with this diagnosis as well as by cross-immunity tests.
Directory of Open Access Journals (Sweden)
Reza Heidari
2016-03-01
Full Text Available Taurine (2-aminoethane sulfonic acid is a non-protein amino acid found in high concentration in different tissues. Glycine (Amino acetic acid is the simplest amino acid incorporated in the structure of proteins. Several investigations indicate the hepatoprotective properties of these amino acids. On the other hand, antineoplastic agents-induced serum transaminase elevation and liver injury is a clinical complication. The current investigation was designed to screen the possible hepatoprotective properties of taurine and glycine against antineoplastic drugs-induced hepatic injury in an ex vivo model of isolated perfused rat liver. Rat liver was perfused with different concentration (10 μM, 100 μM and 1000 μM of antineoplastic drugs (Mitoxantrone, Cyclophosphamide, Cisplatin, 5 Fluorouracil, Doxorubicin and Dacarbazine via portal vein. Taurine and glycine were administered to drug-treated livers and liver perfusate samples were collected for biochemical measurements (ALT, LDH, AST, and K+. Markers of oxidative stress (reactive oxygen species formation, lipid peroxidation, total antioxidant capacity and glutathione were also assessed in liver tissue. Antineoplastic drugs caused significant pathological changes in perfusate biochemistry. Furthermore, markers of oxidative stress were significantly elevated in drug treated livers. It was found that taurine (5 and 10 mM and glycine (5 and 10 mM administration significantly mitigated the biomarkers of liver injury and attenuated drug induced oxidative stress. Our data indicate that taurine and glycine supplementation might help as potential therapeutic options to encounter anticancer drugs-induced liver injury.
Genetic variant of canine distemper virus from clinical cases in ...
African Journals Online (AJOL)
Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...
Studies on manifestations of canine distemper virus infection in an urban dog population.
Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P
1993-10-01
An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.
Directory of Open Access Journals (Sweden)
Santanu Panda
Full Text Available In farm animals, there is no suitable cell line available to understand liver-specific functions. This has limited our understanding of liver function and metabolism in farm animals. Culturing and maintenance of functionally active hepatocytes is difficult, since they survive no more than few days. Establishing primary culture of hepatocytes can help in studying cellular metabolism, drug toxicity, hepatocyte specific gene function and regulation. Here we provide a simple in vitro method for isolation and short-term culture of functionally active buffalo hepatocytes.Buffalo hepatocytes were isolated from caudate lobes by using manual enzymatic perfusion and mechanical disruption of liver tissue. Hepatocyte yield was (5.3 ± 0.66×107 cells per gram of liver tissue with a viability of 82.3 ± 3.5%. Freshly isolated hepatocytes were spherical with well contrasted border. After 24 hours of seeding onto fibroblast feeder layer and different extracellular matrices like dry collagen, matrigel and sandwich collagen coated plates, hepatocytes formed confluent monolayer with frequent clusters. Cultured hepatocytes exhibited typical cuboidal and polygonal shape with restored cellular polarity. Cells expressed hepatocyte-specific marker genes or proteins like albumin, hepatocyte nuclear factor 4α, glucose-6-phosphatase, tyrosine aminotransferase, cytochromes, cytokeratin and α1-antitrypsin. Hepatocytes could be immunostained with anti-cytokeratins, anti-albumin and anti α1-antitrypsin antibodies. Abundant lipid droplets were detected in the cytosol of hepatocytes using oil red stain. In vitro cultured hepatocytes could be grown for five days and maintained for up to nine days on buffalo skin fibroblast feeder layer. Cultured hepatocytes were viable for functional studies.We developed a convenient and cost effective technique for hepatocytes isolation for short-term culture that exhibited morphological and functional characteristics of active hepatocytes
Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A
2004-10-13
Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.
Quantitative lung perfusion evaluation using Fourier decomposition perfusion MRI.
Kjørstad, Åsmund; Corteville, Dominique M R; Fischer, Andre; Henzler, Thomas; Schmid-Bindert, Gerald; Zöllner, Frank G; Schad, Lothar R
2014-08-01
To quantitatively evaluate lung perfusion using Fourier decomposition perfusion MRI. The Fourier decomposition (FD) method is a noninvasive method for assessing ventilation- and perfusion-related information in the lungs, where the perfusion maps in particular have shown promise for clinical use. However, the perfusion maps are nonquantitative and dimensionless, making follow-ups and direct comparisons between patients difficult. We present an approach to obtain physically meaningful and quantifiable perfusion maps using the FD method. The standard FD perfusion images are quantified by comparing the partially blood-filled pixels in the lung parenchyma with the fully blood-filled pixels in the aorta. The percentage of blood in a pixel is then combined with the temporal information, yielding quantitative blood flow values. The values of 10 healthy volunteers are compared with SEEPAGE measurements which have shown high consistency with dynamic contrast enhanced-MRI. All pulmonary blood flow (PBF) values are within the expected range. The two methods are in good agreement (mean difference = 0.2 mL/min/100 mL, mean absolute difference = 11 mL/min/100 mL, mean PBF-FD = 150 mL/min/100 mL, mean PBF-SEEPAGE = 151 mL/min/100 mL). The Bland-Altman plot shows a good spread of values, indicating no systematic bias between the methods. Quantitative lung perfusion can be obtained using the Fourier Decomposition method combined with a small amount of postprocessing. Copyright © 2013 Wiley Periodicals, Inc.
... Radionuclide renal perfusion scan; Perfusion scintiscan - renal; Scintiscan - renal perfusion Images Kidney anatomy Kidney - blood and urine flow Intravenous pyelogram References Rottenberg G, Andi AC. Renal ...
Binn, Leonard N; Norby, Erica A; Marchwicki, Ruth H; Jarman, Richard G; Keiser, Paul B; Hang, Jun
2018-02-23
Vesiviruses (family Caliciviridae) had been shown capable of invading a variety of host species, raising concern of their zoonotic potential. Since the 1980's, several canine caliciviruses (CaCV) isolates have been reported and are phylogenetically related to the vesiviruses with features distinct from both Vesicular exanthema of swine virus (VESV) and Feline calicivirus (FCV) species in phylogeny, serology and cell culture specificities. Etiological studies of canine diseases in dogs used for military services and laboratory studies were conducted in 1963-1978 at the Walter Reed Army Institute of Research. Multiple known and unknown viral pathogens including caliciviruses were recovered. Four unidentified isolates were recovered in Walter Reed Canine Cells (WRCC) from respiratory, fecal and penile specimens. Physicochemical tests, electron microscopy, viral cultivation in human and animal cells, antibody neutralization assays, and recently the genome sequencing were used to characterize the isolates. Sera from these dogs and their cohorts were tested with the isolates to determine origin and prevalence of the infections. The viral isolates were small non-enveloped spherical RNA virions, 27 to 42 nm in diameter with cup-like structures, indicating they are caliciviruses. They propagated in WRCC and MDCK cells, not in either other canine cells or human and other animal cells. Each isolate is antigenically distinct and react with dog sera in respective cohorts. The genomes have nucleotide identities ranging from 70.3% to 90.7% and encode the non-structural polyprotein (1810 amino acids), major capsid protein (691 amino acids) and minor structural protein (134 amino acids). They belong to two different phylogenetic clades in Vesivirus genus with close relation with canine calicivirus (CaCV). These CaCV isolates have restricted cell tropism, antigenic diversity and genetic variation. Further investigation will shed light on antigenic relation to other vesiviruses, and
BACTERIAL PROFILE OF NECROTIC PULPS IN CHEETAH (ACINONYX JUBATUS) CANINE TEETH.
Almansa Ruiz, José C; Bosman, Anna-Mari; Steenkamp, Gerhard
2016-03-01
The role of microbes and their antimicrobial susceptibilities in both acute and chronic infections of the dental pulp in humans has been well studied. Presently, no data are available on endodontic pathogens in cheetahs (Acinonyx jubatus). The aim of this study was to isolate and identify the bacteria found in the canine teeth of cheetahs, where the pulp was necrotic and exposed due to a complicated crown fracture. Thirty-six microbiologic samples were taken from root canals (RCs) of the canine teeth of 19 cheetahs: one pulp sample was taken from 10 cheetahs, four samples from 2 cheetahs, two samples from 3 cheetahs, and three samples from 4 cheetahs. Exposed pulps were cultured for aerobic and anaerobic bacteria; an additional screening with a 16S rRNA-specific polymerase chain reaction (PCR) was used for the last six samples. Antimicrobial susceptibility of isolates was determined by use of the Kirby-Bauer diffusion test. In total, 59 cultivable isolates belonging to 19 microbial species and 13 genera were recovered from the 36 RCs sampled. Only two samples yielded no cultivable bacteria. Thirty-two (54.49%) of the cultivable isolates were Gram positive and 27 (45.71%) were Gram negative. The maximum number of isolates cultivated from an individual RC was six. Facultative anaerobes (62.72%) were the most common bacteria of the RCs that yielded cultivable bacteria. Of the isolates, 28.81% were aerobic and 8.47% were strict anaerobes. The antimicrobials that showed the greatest efficacy in vitro against the different bacteria isolates were amikacin and gentamicin. The more common bacterial species isolated by PCR were anaerobes (60.8%), facultative anaerobes (30.2%), and aerobes (8.6%).
Stephen Wilson; Joanna Illambas; Elisabeth Siedek; Anne Thomas; Vickie King; Catrina Stirling; Edita Plevová; Jeremy Salt; Gordon Sture
2014-01-01
Four challenge studies following vaccination of dogs with a multivalent vaccine containing canine parvovirus (CPV-2b), adenovirus (CAV-1/-2) and distemper (CDV) are described. Six week old puppies received a single vaccination while non-vaccinated control dogs received water. In each respective trial, groups of dogs were challenged 21 days after vaccination with heterologous viral isolates. Clinical observations, rectal temperature measurements, and blood and swab samples for analysis were co...
Canine Distemper in an isolated population of fishers (Martes pennanti) from California
Stefan m. Keller; Mourad Gabriel; Karen A. Terio; Edward J. Dubovi; Elizabeth Van Wormer; Rick Sweitzer; Reginald Barret; Craig Thompson; Kathryn Purcell; Linda Munson
2012-01-01
Four fishers (Martes pennanti) from an insular population in the southern Sierra Nevada Mountains, California, USA died as a consequence of an infection with canine distemper virus (CDV) in 2009. Three fishers were found in close temporal and spatial relationship; the fourth fisher died 4 mo later at a 70 km distance from the initial group. Gross...
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar
2015-01-01
Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.
Typing of Canine Parvovirus Strains Circulating in North-East China.
Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S
2017-04-01
Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.
Fatal vaccine-induced canine distemper virus infection in black-footed ferrets
Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.
1976-01-01
Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.
Epizootic canine distemper virus infection among wild mammals.
Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken
2012-01-27
In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. Copyright © 2011 Elsevier B.V. All rights reserved.
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
DEFF Research Database (Denmark)
Wogensen, L; Helqvist, S; Pociot, F
1990-01-01
Previous studies have demonstrated a stimulatory effect of interleukin-1 beta (IL-1 beta) on insulin and glucagon release from the perfused rat pancreas, accompanied by selective lysis of 20% of beta-cells as assessed by electronmicroscopy. However, we have not observed an inhibitory action of IL-1...... beta on insulin release from the perfused pancreas as shown for isolated islets. To test whether periodical exposure of the endocrine pancreas to circulating IL-1 beta in vivo affects insulin release from the intact perfused pancreas, rats were treated with daily intraperitoneal injections of 4...
Monis, P T; Andrews, R H; Mayrhofer, G; Mackrill, J; Kulda, J; Isaac-Renton, J L; Ey, P L
1998-01-01
Infection of suckling mice with Giardia trophozoites recovered from the intestines of 11 dogs autopsied in Central and Southern Australia in each case produced an established isolate. In contrast, only 1 isolate was obtained by inoculation of faecal cysts. The organisms grew poorly in comparison with isolates from humans or non-canine animal hosts. Light microscopy revealed that the trophozoites had median bodies with the 'claw hammer' appearance typical of G. intestinalis (syn. G. duodenalis, G. lamblia) but that they differed in shape and nuclear morphology from axenic isolates of human or canine origin. Allozymic analysis of electrophoretic data representing 26 loci and phylogenetic analysis of nucleotide sequences obtained from DNA amplified from the glutamate dehydrogenase locus showed that the 11 isolates examined from Australian dogs were genetically distinct from all isolates of G. intestinalis that have been established previously from humans and animals, and also from G. muris. Both analytical methods placed 10 of the Australian canine isolates into a unique genetic lineage (designated Assemblage C) and the eleventh into a deep-rooted second branch (designated Assemblage D), each well separated from the 2 lineages (Assemblages A and B) of G. intestinalis that encompass all the genotypes known to infect humans. In contrast, 4 axenic isolates derived from dogs in Canada and Europe (the only other isolates to have been established from dogs) have genotypes characteristic of genetic Assemblages A or B. The findings indicate that the novel Giardia identified in these rural Australian dogs have a restricted host range, possibly confined to canine species. The poor success rate in establishing Giardia from dogs in vitro suggests, further, that similar genotypes may predominate as canine parasites world-wide. The absence of such organisms among isolates of Giardia that have been established from humans by propagation in suckling mice indicates that they are
Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo
2013-08-01
Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Directory of Open Access Journals (Sweden)
Verónica Gómez Pérez
2016-08-01
Full Text Available Visceral leishmaniasis (VL caused by the protozoan parasite Leishmania infantum, is one of the most important zoonotic diseases affecting dogs and humans in the Mediterranean area. The presence of infected dogs as the main reservoir host of L. infantum is regarded as the most significant risk for potential human infection. We have studied the susceptibility profile to antimony and other anti-leishmania drugs (amphotericin B, miltefosine, paromomycin in Leishmania infantum isolates extracted from a dog before and after two therapeutic interventions with meglumine antimoniate (subcutaneous Glucantime®, 100 mg/kg/day for 28 days. After the therapeutic intervention, these parasites were significantly less susceptible to antimony than pretreatment isolate, presenting a resistance index of 6-fold to SbIII for promastigotes and >3-fold to SbIII and 3-fold to SbV for intracellular amastigotes. The susceptibility profile of this resistant L. infantum line is related to a decreased antimony uptake due to lower aquaglyceroporin-1 expression levels. Additionally, other mechanisms including an increase in thiols and overexpression of enzymes involved in thiol metabolism, such as ornithine decarboxylase, trypanothione reductase, mitochondrial tryparedoxin and mitochondrial tryparedoxin peroxidase, could contribute to the resistance as antimony detoxification mechanisms. A major contribution of this study in a canine L. infantum isolate is to find an antimony-resistant mechanism similar to that previously described in other human clinical isolates.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
International Nuclear Information System (INIS)
Vogl, Thomas J.; Koch, Silvia A.; Lotz, Gösta; Gebauer, Bernhard; Willinek, Winfried; Engelke, Christoph; Brüning, Roland; Zeile, Martin; Wacker, Frank; Vogel, Arndt; Radeleff, Boris; Scholtz, Jan-Erik
2017-01-01
PurposePercutaneous isolated hepatic perfusion (PIHP) with Melphalan has been developed as a treatment for patients with isolated hepatic metastases of uveal melanoma. We discuss patient outcome and safety in a retrospective multi-centre study.Materials and MethodsBetween 2012 and 2016 18 patients with un-resectable isolated hepatic metastases of uveal melanoma received single or repeated PIHP with Melphalan (n = 35) at seven sites. Progression-free time, overall survival time (OS) and tumour response by means of RECIST 1.1 criteria were evaluated. Peri- and post-procedural adverse events (AE) were registered. Patients’ life quality was assessed using four-point scale questionnaires.ResultsOf 18 patients, initial PIHP treatment resulted in partial response (PR) in eight, stable disease (SD) in seven and progressive disease (PD) in three cases. Nine patients underwent second PIHP with PR in eight cases and PD in one case. Six patients were evaluated after third PIHP with PR in five patients and SD in one patient. Two patients received fourth PIHP with PD in both cases. Median OS was 9.6 months (range 1.6–41.0 months). Median progression-free survival time was 12.4 months (range 0.9–41.0 months) with 1-year survival of 44%. Most common post-procedural AE grade 3 and 4 were temporary leukopenia (n = 11) and thrombocytopenia (n = 8). Patients’ self-assessments showed good ratings for overall health and quality of life with only slight changes after PIHP, and a high degree of satisfaction with PIHP treatment.ConclusionPIHP with Melphalan proved to be a relatively safe, minimal-invasive and repeatable treatment for patients with non-resectable hepatic metastases of uveal melanoma.
Energy Technology Data Exchange (ETDEWEB)
Vogl, Thomas J., E-mail: t.vogl@em.uni-frankfurt.de; Koch, Silvia A., E-mail: silvia.koch@web.de [University Hospital Frankfurt, Department of Diagnostic and Interventional Radiology (Germany); Lotz, Gösta, E-mail: goesta.lotz@kgu.de [University Hospital Frankfurt, Department of Anesthesiology, Intensive-Care Medicine and Pain Therapy (Germany); Gebauer, Bernhard, E-mail: bernhard.gebauer@charite.de [Universitätsmedizin Berlin, Department of Diagnostic and Interventional Radiology, Campus Charité Mitte (Germany); Willinek, Winfried, E-mail: w.willinek@bk-trier.de [Brüderkrankenhaus Trier, Department of Diagnostic and Interventional Radiology (Germany); Engelke, Christoph, E-mail: engelke@ekweende.de [Evangelisches Krankenhaus Göttingen-Weende gGmbH, Department of Diagnostic and Interventional Radiology (Germany); Brüning, Roland, E-mail: r.bruening@asklepios.com; Zeile, Martin, E-mail: m.zeile@asklepios.com [Asklepios Klinik Barmbek, Department of Diagnostic and Interventional Radiology (Germany); Wacker, Frank, E-mail: wacker.frank@mh-hannover.de [Medizinische Hochschule Hannover, Department of Diagnostic and Interventional Radiology (Germany); Vogel, Arndt, E-mail: vogel.arndt@mh-hannover.de [Medizinische Hochschule Hannover, Department of Gastroenterology, Hepatology and Endocrinology (Germany); Radeleff, Boris, E-mail: boris.radeleff@med.uni-heidelberg.de [Heidelberg University Hospital, Department of Diagnostic and Interventional Radiology (Germany); Scholtz, Jan-Erik, E-mail: janerikscholtz@gmail.com [University Hospital Frankfurt, Department of Diagnostic and Interventional Radiology (Germany)
2017-06-15
PurposePercutaneous isolated hepatic perfusion (PIHP) with Melphalan has been developed as a treatment for patients with isolated hepatic metastases of uveal melanoma. We discuss patient outcome and safety in a retrospective multi-centre study.Materials and MethodsBetween 2012 and 2016 18 patients with un-resectable isolated hepatic metastases of uveal melanoma received single or repeated PIHP with Melphalan (n = 35) at seven sites. Progression-free time, overall survival time (OS) and tumour response by means of RECIST 1.1 criteria were evaluated. Peri- and post-procedural adverse events (AE) were registered. Patients’ life quality was assessed using four-point scale questionnaires.ResultsOf 18 patients, initial PIHP treatment resulted in partial response (PR) in eight, stable disease (SD) in seven and progressive disease (PD) in three cases. Nine patients underwent second PIHP with PR in eight cases and PD in one case. Six patients were evaluated after third PIHP with PR in five patients and SD in one patient. Two patients received fourth PIHP with PD in both cases. Median OS was 9.6 months (range 1.6–41.0 months). Median progression-free survival time was 12.4 months (range 0.9–41.0 months) with 1-year survival of 44%. Most common post-procedural AE grade 3 and 4 were temporary leukopenia (n = 11) and thrombocytopenia (n = 8). Patients’ self-assessments showed good ratings for overall health and quality of life with only slight changes after PIHP, and a high degree of satisfaction with PIHP treatment.ConclusionPIHP with Melphalan proved to be a relatively safe, minimal-invasive and repeatable treatment for patients with non-resectable hepatic metastases of uveal melanoma.
DEFF Research Database (Denmark)
Rasmussen, T N; Schmidt, P; Poulsen, S S
2001-01-01
was abolished by infusion of hexamethonium (3x10(-5) M). Infusion of capsaicin (10(-5) M) caused a significant increase in the release of CGRP-LI to 485+/-82% of basal output (n=5). Our results suggest a dual origin of CGRP innervation of the porcine ileum (intrinsic and extrinsic). The intrinsic CGRP neurons...... extracts, CGRP-LI corresponded entirely to porcine CGRP plus smaller amounts of oxidised CGRP. Using isolated vascularly perfused segments of the ileum, we studied the release of CGRP-LI in response to electrical stimulation of the mixed extrinsic periarterial nerves and to infusion of different...... receive excitatory input by parasympathetic, possibly vagal, preganglionic fibres, via release of acetylcholine acting on nicotinic receptors. The stimulatory effect of capsaicin suggests that CGRP is also released from extrinsic sensory neurons....
First complete genome sequence of canine bocavirus 2 in mainland China
Directory of Open Access Journals (Sweden)
S.-L. Zhai
2017-07-01
Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.
Povey, R. C.; Carman, P. S.; Ewert, E.
1983-01-01
Dogs were successfully isolated for a period of either 52 or 64 weeks following vaccination with an inactivated, adjuvanted canine parvovirus-2 vaccine. Antibody persisted in all ten vaccinated dogs, although in one case by 52 weeks postvaccination only virus neutralizing antibody, and not hemagglutination-inhibiting antibody, could be detected. Sentinel unvaccinated dogs housed alongside the vaccinated dogs throughout the study remained free of canine parvovirus-2 antibody until challenged. ...
Ibey, Bennett; Subramanian, Hariharan; Ericson, Nance; Xu, Weijian; Wilson, Mark; Cote, Gerard L.
2005-03-01
A blood perfusion and oxygenation sensor has been developed for in situ monitoring of transplanted organs. In processing in situ data, motion artifacts due to increased perfusion can create invalid oxygenation saturation values. In order to remove the unwanted artifacts from the pulsatile signal, adaptive filtering was employed using a third wavelength source centered at 810nm as a reference signal. The 810 nm source resides approximately at the isosbestic point in the hemoglobin absorption curve where the absorbance of light is nearly equal for oxygenated and deoxygenated hemoglobin. Using an autocorrelation based algorithm oxygenation saturation values can be obtained without the need for large sampling data sets allowing for near real-time processing. This technique has been shown to be more reliable than traditional techniques and proven to adequately improve the measurement of oxygenation values in varying perfusion states.
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh
DEFF Research Database (Denmark)
Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh
2016-01-01
AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...
Optical measurement of isolated canine lung filtration coefficients after alloxan infusion.
Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J
1998-04-01
In this study, lung filtration coefficient (Kfc) was measured in eight isolated canine lung preparations by using three methods: standard gravimetric (Std), blood-corrected gravimetric (BC), and optical. The lungs were held in zone III conditions and were subjected to an average venous pressure increase of 8.79 +/- 0.93 (mean +/- SD) cmH2O. The permeability of the lungs was increased with an infusion of alloxan (75 mg/kg). The resulting Kfc values (in milliliters . min-1 . cmH2O-1 . 100 g dry lung weight-1) measured by using Std and BC gravimetric techniques before vs. after alloxan infusion were statistically different: Std, 0.527 +/- 0.290 vs. 1. 966 +/- 0.283; BC, 0.313 +/- 0.290 vs. 1.384 +/- 0.290. However, the optical technique did not show any statistical difference between pre- and postinjury with alloxan, 0.280 +/- 0.305 vs. 0.483 +/- 0. 297, respectively. The alloxan injury, quantified by using multiple-indicator techniques, showed an increase in permeability and a corresponding decrease in reflection coefficient for albumin (sigmaf). Because the optical method measures the product of Kfc and sigmaf, this study shows that albumin should not be used as an intravascular optical filtration marker when permeability is elevated. However, the optical technique, along with another means of measuring Kfc (such as BC), can be used to calculate the sigmaf of a tracer (in this study, sigmaf of 0.894 at baseline and 0.348 after injury). Another important finding of this study was that the ratio of baseline-to-injury Kfc values was not statistically different for Std and BC techniques, indicating that the percent contribution of slow blood-volume increases does not change because of injury.
International Nuclear Information System (INIS)
Shi Haibin; Liu Sheng; Ji Libiao; Li Lingsun; Huang Jun
2005-01-01
Objective: To establish interventionally a new canine model of focal cerebral infarction suitable to the study of imaging diagnosis and thrombolytic therapy, and to evaluate the application of computed tomography perfusion (CTP) in super acute ischemic cerebrovascular disease. Methods: Ten beagle adult dogs with self white thrombi of venous blood, injected into the left internal carotid arteries through 4F headhunter catheter selectively were created under fluoroscopic guidance. The cerebral angiography was performed before and after the embolization and the patency of the occluded cerebral arteries was observed with angiography at 1, 2 and 5 hours after the procedure. The CTP was performed at 2 hours after embolization. These dogs were sacrificed and their cerebra were taken out for pathologic study at 24th hour. Results: The occlusions of middle cerebral artery were shown angiographically in all 10 dogs with additional other cerebral arteries occlusion in 4. All occluded arteries were not recanalized at 2 hours after embolization, but the occluded arteries of 2 canines were partly recanalized at 5 hours. The regional cerebral blood flow (rCBF) was decreased to 48.3% ± 13.2% (33.7%-69.2%) in CTP of 9 canines showing no significant difference between digital subtraction angiography (DSA) and CTP (P>0.05). All dogs were survived at 24 hours without any severe complications. The cerebral infarction was found in deep part of cerebrum of all dogs. Conclusions: The establishment of acute cerebral infarction model in dogs with interventional technique is simple, micro invasive and reliable, for investigating CTP as a fast, accurate and no invasive method in evaluating the canine super acute ischemic cerebrovascular disease. (authors)
Directory of Open Access Journals (Sweden)
Falkenstein D.
1999-01-01
Full Text Available High magnesium concentration inhibits the effect of arginine vasopressin (AVP on smooth muscle contraction and platelet aggregation and also influences hepatocyte AVP receptor binding. The aim of this study was to determine the role of magnesium concentration [Mg2+] in AVP-stimulated water transport in the kidney collecting duct. The effect of low and high peritubular [Mg2+] on the AVP-stimulated osmotic water permeability coefficient (Pf was evaluated in the isolated perfused rabbit cortical collecting duct (CCD. Control tubules bathed and perfused with standard Ringer bicarbonate solution containing 1 mM Mg2+ presented a Pf of 223.9 ± 27.2 µm/s. When Mg2+ was not added to the bathing solution, an increase in the AVP-stimulated Pf to 363.1 ± 57.2 µm/s (P<0.05 was observed. An elevation of Mg2+ to 5 mM resulted in a decrease in Pf to 202.9 ± 12.6 µm/s (P<0.05. This decrease in the AVP-stimulated Pf at 5 mM Mg2+ persisted when the CCDs were returned to 1 mM Mg2+, Pf = 130.2 ± 20.3 µm/s, and was not normalized by the addition of 8-[4-chlorophenylthio]-adenosine 3',5'-cyclic monophosphate, a cAMP analogue, to the preparation. These data indicate that magnesium may play a modulatory role in the action of AVP on CCD osmotic water permeability, as observed in other tissues.
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
International Nuclear Information System (INIS)
Huang Gang; Michel Comet; Zhao Huiyang; Zhu Cuiying; Yuan Jimin
1998-01-01
Purpose: The fatty acid metabolism and the effect of glucose on it were studied in isolated and reperfused rat heat. Methods: 32 isolated working rat hearts were perfused in Langengdorff device with modified Krebs and were divided into normal and ischemia-reperfused group. Each group was also classified into two subgroups, modified krebs with or without glucose subgroup. 131 I-HA was injected into aorta of isolated working rat heart and then the radio-residue curves were acquired. Results: When the isolated rat hearts were perfused with krebs plus glucose, the catabolism of fatty acid was significantly decreased in normal group, but a remarkable increase of fatty acid catabolism was found in ischemia-reperfused group. While the isolated rat hearts were perfused with krebs without glucose, the catabolism of fatty acid in ischemia-reperfused isolated rat hearts were perfused with krebs without glucose, the catabolism of fatty acid in ischemia-reperfused isolated rat heart was less than that in normal group. Conclusions: Transient ischemia damages the catabolism of myocardial fatty acid in mitochondria in some degree. In normal isolated working rat heart, the principal energy source is glucose. However, the major energy source is switched to catabolism of fatty acid in ischemia-reperfused isolated rat heart. This phenomenon may be related to compensative increase of fatty acid catabolism for replenishing the loss of energy during ischemia
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Directory of Open Access Journals (Sweden)
Efrosini Z. Papadaki
2014-01-01
Full Text Available Background. Patients with clinically isolated syndrome (CIS demonstrate brain hemodynamic changes and also suffer from difficulties in processing speed, memory, and executive functions. Objective. To explore whether brain hemodynamic disturbances in CIS patients correlate with executive functions. Methods. Thirty CIS patients and forty-three healthy subjects, matched for age, gender, education level, and FSIQ, were administered tests of visuomotor learning and set shifting ability. Cerebral blood volume (CBV, cerebral blood flow (CBF, and mean transit time (MTT values were estimated in normal-appearing white matter (NAWM and normal-appearing deep gray Matter (NADGM structures, using a perfusion MRI technique. Results. CIS patients showed significantly elevated reaction time (RT on both tasks, while their CBV and MTT values were globally increased, probably due to inflammatory vasodilation. Significantly, positive correlation coefficients were found between error rates on the inhibition condition of the visuomotor learning task and CBV values in occipital, periventricular NAWM and both thalami. On the set shifting condition of the respective task significant, positive associations were found between error rates and CBV values in the semioval center and periventricular NAWM bilaterally. Conclusion. Impaired executive function in CIS patients correlated positively with elevated regional CBV values thought to reflect inflammatory processes.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
International Nuclear Information System (INIS)
Boll, Daniel T.; Lewin, Jonathan S.; Young, Philip; Gilkeson, Robert C.; Siwik, Ernest S.
2005-01-01
The aim of this work was to assess magnetic resonance (MR) perfusion patterns of chronic, nonembolic pulmonary diseases of congenital and neoplastic origin and to compare the findings with results obtained with pulmonary, contrast-enhanced multislice computed tomography (CT) imaging to prove that congenital and neoplastic pulmonary conditions require MR imaging over the pulmonary perfusion cycle to successfully and directly detect changes in lung perfusion patterns. Twenty-five patients underwent concurrent CT and MR evaluation of chronic pulmonary diseases of congenital (n=15) or neoplastic (n=10) origin. Analysis of MR perfusion and contrast-enhanced CT datasets was realized by defining pulmonary and vascular regions of interest in corresponding positions. MR perfusion calculated time-to-peak enhancement, maximal enhancement and the area under the perfusion curve. CT datasets provided pulmonary signal-to-noise ratio measurements. Vessel centerlines of bronchial arteries were determined. Underlying perfusion type, such as pulmonary arterial or systemic arterial supply, as well as regions with significant variations in perfusion were determined statistically. Analysis of the pulmonary perfusion pattern detected pulmonary arterial supply in 19 patients; six patients showed systemic arterial supply. In pulmonary arterial perfusion, MR and multislice CT imaging consistently detected the perfusion type and regions with altered perfusion patterns. In bronchial arterial supply, MR perfusion and CT imaging showed significant perfusion differences. Patients with bronchial arterial supply had bronchial arteries ranging from 2.0 to 3.6 mm compared with submillimeter diameters in pulmonary arterial perfusion. Dynamic MR imaging of congenital and neoplastic pulmonary conditions allowed characterization of the pulmonary perfusion type. CT imaging suggested the presence of systemic arterial perfusion by visualizing hypertrophied bronchial arteries. (orig.)
Calculating regional tissue volume for hyperthermic isolated limb perfusion: Four methods compared.
Cecchin, D; Negri, A; Frigo, A C; Bui, F; Zucchetta, P; Bodanza, V; Gregianin, M; Campana, L G; Rossi, C R; Rastrelli, M
2016-12-01
Hyperthermic isolated limb perfusion (HILP) can be performed as an alternative to amputation for soft tissue sarcomas and melanomas of the extremities. Melphalan and tumor necrosis factor-alpha are used at a dosage that depends on the volume of the limb. Regional tissue volume is traditionally measured for the purposes of HILP using water displacement volumetry (WDV). Although this technique is considered the gold standard, it is time-consuming and complicated to implement, especially in obese and elderly patients. The aim of the present study was to compare the different methods described in the literature for calculating regional tissue volume in the HILP setting, and to validate an open source software. We reviewed the charts of 22 patients (11 males and 11 females) who had non-disseminated melanoma with in-transit metastases or sarcoma of the lower limb. We calculated the volume of the limb using four different methods: WDV, tape measurements and segmentation of computed tomography images using Osirix and Oncentra Masterplan softwares. The overall comparison provided a concordance correlation coefficient (CCC) of 0.92 for the calculations of whole limb volume. In particular, when Osirix was compared with Oncentra (validated for volume measures and used in radiotherapy), the concordance was near-perfect for the calculation of the whole limb volume (CCC = 0.99). With methods based on CT the user can choose a reliable plane for segmentation purposes. CT-based methods also provides the opportunity to separate the whole limb volume into defined tissue volumes (cortical bone, fat and water). Copyright © 2016 Elsevier Ltd. All rights reserved.
Fabrication and perfusion culture of anatomically shaped artificial bone using stereolithography
International Nuclear Information System (INIS)
Du, Dajiang; Asaoka, Teruo; Ushida, Takashi; Furukawa, Katsuko S
2014-01-01
Because patient bone defects are usually varied and complicated in geometry, it would be preferred to fabricate custom-made artificial bone grafts that are anatomically specific to individual patient defects. Using a rabbit femoral segment as a bone reconstruction model, we successfully produced customized ceramic scaffolds by stereolithography, which not only had an anatomically correct external shape according to computed tomography data but also contained an interconnecting internal network of channels designed for perfusion culture. Rabbit bone marrow stromal cells were isolated and cultured with these scaffolds using a novel oscillatory perfusion system that was stereolithographically fabricated to fit well to the unique scaffold shapes. After five days of three-dimensional culture with oscillatory perfusion, the cells attached and proliferated homogenously in the scaffolds. However, control cells inside the scaffolds cultured under static conditions were dead after prolonged in vitro culture. Cellular DNA content and alkaline phosphatase activities were significantly higher in the perfusion group versus the static group. Therefore, anatomically correct artificial bone can be successfully constructed using stereolithography and oscillatory culture technology, and could be useful for bone engraftment and defect repair. (paper)
International Nuclear Information System (INIS)
Padma, S.; Sundaram, P.S.; Zachariah, M.; Hariads, K.K.
2004-01-01
Objectives: Adenosine pharmacological stress Myocardial Perfusion Imaging (AMPI) is the preferred imaging modality for IHD evaluation in pts with Left Bundle Branch Block (LBBB). Good prognosis has been reported in recent onset LBBB pts with normal MPI. Our aim was to evaluate the utility and analyze the predictive value of SestaMIBI AMPI in symptomatic recent onset LBBB hypertensives for coronary artery disease evaluation. Methods: 29 hypertensive pts, age range 36-72yrs, mean 54+ 6 yrs, M:F- 21:8 with recent onset complete LBBB, under evaluation for typical/atypical angina who had AMPI between Nov 02-Nov 03, were retrospectively analyzed. LBBB was diagnosed ECG wise if there is prolonged QRS complex i.e. 0.125sec or more in sinus/supraventricular rhythm, a QS or rS complex in lead 1, and an R-wave peak time of 0.06sec in leads 1, V5 or V6 with no Q wave in same lead. Pts with prior Myocardial Infarct / revasularisation, pacemaker induced LBBB were excluded. Single day 6 min. Adenosine infusion Stress-rest 99m Tc MIBI gated MPI was performed with a dual head variable angle Gamma Camera at 76-degree angle. Coronary Angiogram (CAG) correlation was available in 24 pts. Results: Myocardial perfusion SPECT images were assessed visually and by a 20-segment model. Location, extent and severity of the LV perfusion defects were evaluated. 6/29 pts (20.7%) had normal stress-rest perfusion in all LV segments.12 (41.4%) had isolated septal fixed defect with normal perfusion in rest of the segments.3 pts (10.3%)showed isolated reversible septal defects while 8(27.6%) had reversible septal defects with reversible defects in other LV segments also. Pts with fixed septal perfusion defect showed moderate to good septal wall thickening in gated SPECT images. While all pts with multiple reversible perfusion defects had angiographically proven coronary artery disease (i.e. 3pts had LAD lesion, 2 had Triple vessel and 3 showed double vessel lesions), 1 out of 3 pts with isolated
International Nuclear Information System (INIS)
Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.
2011-01-01
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology
Energy Technology Data Exchange (ETDEWEB)
Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)
2011-03-30
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Effect of Japanese Green Tea Extract on Canine Periodontal Diseases
Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.
2011-01-01
Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Surgical construction of a novel simulated carotid siphon in canines
International Nuclear Information System (INIS)
Tan Huaqiao; Li Minghua; Zhu Yueqi; Fang Chun; Wang Jue; Wu Chungen; Cheng Yingsheng; Xie Jian; Zhang He
2008-01-01
Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)
Laser doppler perfusion imaging
International Nuclear Information System (INIS)
Waardell, K.
1992-01-01
Recording of tissue perfusion is important in assessing the influence of peripheral vascular diseases on the microcirculation. This thesis reports on a laser doppler perfusion imager based on dynamic light scattering in tissue. When a low power He-Ne laser beam sequentally scans the tissue, moving blood cells generate doppler components in the back-scattered light. A fraction of this light is detected by a photodetector and converted into an electrical signal. In the processor, a signal proportional to the tissue perfusion at each measurement site is calculated and stored. When the scanning procedure is completed, a color-coded perfusion image is presented on a monitor. To convert important aspects of the perfusion image into more quantitative parameters, data analysis functions are implemented in the software. A theory describing the dependence of the distance between individual measurement points and detector on the system amplification factor is proposed and correction algorithms are presented. The performance of the laser doppler perfusion imager was evaluated using a flow simulator. A linear relationship between processor output signal and flow through the simulator was demonstrated for blood cell concentrations below 0.2%. The median sampling depth of the laser beam was simulated by a Monte Carlo technique and estimated to 235 μm. The perfusion imager has been used in the clinic to study perfusion changes in port wine stains treated with argon laser and to investigate the intensity and extension of the cutaneous axon reflex response after electrical nerve stimulation. The fact that perfusion can be visualized without touching the tissue implies elimination of sterilization problems, thus simplifying clinical investigations of perfusion in association with diagnosis and treatment of peripheral vascular diseases. 22 refs
Directory of Open Access Journals (Sweden)
Yong Cao
2013-03-01
Full Text Available OBJECTIVE: A simple method to reduce the ischemia/reperfusion injury that can accompany cardiac surgery would have great clinical value. This study was to investigate the effect of hyperosmotic perfusion on ischemia/reperfusion injury in isolated perfused rat hearts. METHOD: Forty male Sprague-Dawley rats were randomly divided either to have their isolated hearts perfused with normal osmotic buffer or buffer made hyperosmotic by addition of glucose. Hearts were then subjected to 30 min ischemia followed by 30 min reperfusion. Coronary flow, time to ischemic arrest, reperfusion arrhythmia, and ventricular function were recorded. Creatine phosphokinase leakage into the coronary artery, and myocardial content and activity of superoxide dismutase and catalase were also examined. RESULTS: Rat hearts with hyperosmotic perfusion showed higher coronary flow, a prolonged time to ischemic arrest (10.60 vs. 5.63 min, POBJETIVO: Um método simples para reduzir a lesão de isquemia/reperfusão que pode acompanhar a cirurgia cardíaca teria grande valor clínico. O objetivo deste estudo foi investigar o efeito da perfusão hiperosmótica na isquemia/reperfusão em corações isolados de ratos perfundidos. MÉTODOS: Quarenta ratos machos Sprague-Dawley foram divididos aleatoriamente e tiveram os seus corações isolados perfundidos com tampão osmótico normal ou tampão hiperosmótico com a adição de glucose. Os corações foram então submetidos a 30 minutos de isquemia, seguida de 30 min de reperfusão. O fluxo coronariano, tempo de parada isquêmica, arritmia de reperfusão e da função ventricular foram registrados. Vazamento creatinofosfoquinase na artéria coronária, o miocárdio e atividade de superóxido dismutase e catalase foram também examinados. RESULTADOS: Crações de ratos com perfusão hiperosmótica apresentaram maior fluxo coronariano, tempo prolongado de parada isquêmica (10,60 vs. 5,63 min, P<0,005, menor pontuação de reperfus
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Blood perfusion and pH monitoring in organs by laser-induced fluorescence spectroscopy
Vari, Sandor G.; Papazoglou, Theodore G.; Pergadia, Vani R.; Stavridi, Marigo; Snyder, Wendy J.; Papaioannou, Thanassis; Duffy, J. T.; Weiss, Andrew B.; Thomas, Reem; Grundfest, Warren S.
1994-01-01
Sensitivity of laser-induced fluorescence spectroscopy (LIFS) in detecting a change in tissue pH, and blood perfusion was determined. Rabbits were anesthetized, paralyzed, and mechanically ventilated. The arterial and venous blood supplies of the kidney were isolated and ligated to alter the perfusion. The femoral artery was cannulated to extract samples for blood gas analysis. A 308-nm XeCl was used as an excitation source. A 600 micrometers core diameter fiber was used for fluorescence acquisition, and the spectra analyzed by an optical multichannel analyzer (EG & G, OMA III). the corresponding intensity ratio R equals INADH / ICOLL was used as an index for respiratory acidosis. Blood perfusion was assessed using the following algorithm: (IELAS minus ICOLL) divided by (INADH minus ICOLL). The intensity ratio linearly decreased with the reduction of blood perfusion. When we totally occluded the artery the ratio decreased tenfold when compared to the ratio of a fully perfused kidney. Results of monitoring blood acidosis by laser-induced fluorescence spectroscopy shows a significant trend between pH and intensity ratio. Since all the slopes were negative, there is an obvious significant correlation between the pH and NADH.COLLAGEN RATIO. Blue-light-induced fluorescence measurements and ratio fluorometry is a sensitive method for monitoring blood perfusion and acidity or alkalinity of an organ.
Gatti, Monica; Wurth, Roberto; Vito, Guendalina; Pattarozzi, Alessandra; Campanella, Chiara; Thellung, Stefano; Maniscalco, Lorella; De Maria, Raffaella; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Bajetto, Adriana; Ratto, Alessandra; Ferrari, Angelo; Barbieri, Federica; Florio, Tullio
2016-05-01
Cancer stem cells (CSCs) represent a small subpopulation of cells responsible for tumor formation and progression, drug resistance, tumor recurrence and metastasization. CSCs have been identified in many human tumors including osteosarcoma (OSA). CSC distinctive properties are the expression of stem cell markers, sustained growth, self-renewal and tumorigenicity. Here we report the isolation of stem-like cells from two canine OSA cultures, characterized by self-renewal, evaluated by sphere formation ability, differential marker expression, and in vitro proliferation when cultured in a medium containing EGF and bFGF. Current therapies for OSA increased survival time, but prognosis remains poor, due to the development of drug resistance and metastases. Chemotherapy shrinks the tumor mass but CSCs remain unaffected, leading to tumor recurrence. Metformin, a drug for type 2 diabetes, has been shown to possess antitumor properties affecting CSC survival in different human and animal cancers. Here we show that metformin has a significant antiproliferative effect on canine OSA stem-like cells, validating this in vitro model for further pre-clinical drug evaluations. In conclusion, our results demonstrate the feasibility of obtaining CSC-enriched cultures from primary canine OSA cells as a promising model for biological and pharmacological studies of canine and human OSAs.
Effect of ADH on rubidium transport in isolated perfused rat cortical collecting tubules
International Nuclear Information System (INIS)
Schafer, J.A.; Troutman, S.L.
1986-01-01
Unidirectional fluxes of 86Rb+ were measured as an indicator of potassium transport in isolated rat cortical collecting tubules perfused and bathed at 38 degrees C with isotonic solutions in which Rb+ replaced K+. Under control conditions the lumen-to-bath flux (Jl----b) was significantly less than the bath-to-lumen flux (Jb----l), indicating net Rb+ secretion. Net secretion increased approximately 180% after addition of 100 microU/ml of arginine vasopressin (ADH) to the bathing solution, due to a rapid and reversible increase in Jb----l from 4.6 +/- 0.8 to 9.0 +/- 1.9 pmol X min-1 X mm-1 with no significant change in Jl----b. The ADH effect was completely inhibited by 2 mM luminal Ba2+. The average transepithelial voltage (Ve) was not significantly different from zero in the control period but became lumen negative (-5 to -10 mV) after ADH. With 10(-5) M amiloride in the lumen Ve was lumen positive (+2 to +4 mV) and was unaltered by ADH or Ba2+, yet ADH produced a significant but attentuated increase in Jb----l with no change in Jl----b. The results indicate that ADH augments net K+ secretion either by an increase in the Ba2+-sensitive conductance of the apical membrane or by an increase in the electrochemical potential driving force for net Rb+ secretion through this pathway
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
DEFF Research Database (Denmark)
Waeckel, L.; Bertin, F.; Clavreul, N.
2015-01-01
-transgenic female mice expressing human angiotensinogen and renin (AR) genes received either control or a high-salt diet associated to a nitric oxide (NO) synthase inhibitor treatment (BLSL and ARSL). Changes in renal perfusion pressure (RPP) were measured in isolated perfused kidneys. BLSL and AR were moderately...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Directory of Open Access Journals (Sweden)
Esterhuyse Adriaan J
2010-06-01
Full Text Available Abstract Background and Aims Recent studies have shown that dietary red palm oil (RPO supplementation improves functional recovery following ischaemia/reperfusion in isolated hearts. The main aim of this study was to investigate the effects of dietary RPO supplementation on myocardial infarct size after ischaemia/reperfusion injury. The effects of dietary RPO supplementation on matrix metalloproteinase-2 (MMP2 activation and PKB/Akt phosphorylation were also investigated. Materials and methods Male Wistar rats were divided into three groups and fed a standard rat chow diet (SRC, a SRC supplemented with RPO, or a SRC supplemented with sunflower oil (SFO, for a five week period, respectively. After the feeding period, hearts were excised and perfused on a Langendorff perfusion apparatus. Hearts were subjected to thirty minutes of normothermic global ischaemia and two hours of reperfusion. Infarct size was determined by triphenyltetrazolium chloride staining. Coronary effluent was collected for the first ten minutes of reperfusion in order to measure MMP2 activity by gelatin zymography. Results Dietary RPO-supplementation decreased myocardial infarct size significantly when compared to the SRC-group and the SFO-supplemented group (9.1 ± 1.0% versus 30.2 ± 3.9% and 27.1 ± 2.4% respectively. Both dietary RPO- and SFO-supplementation were able to decrease MMP2 activity when compared to the SRC fed group. PKB/Akt phosphorylation (Thr 308 was found to be significantly higher in the dietary RPO supplemented group when compared to the SFO supplemented group at 10 minutes into reperfusion. There was, however, no significant changes observed in ERK phosphorylation. Conclusions Dietary RPO-supplementation was found to be more effective than SFO-supplementation in reducing myocardial infarct size after ischaemia/reperfusion injury. Both dietary RPO and SFO were able to reduce MMP2 activity, which suggests that MMP2 activity does not play a major role in
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Abnormal perfusion on myocardial perfusion SPECT in patients with Wolff-Parkinson-White syndrome
International Nuclear Information System (INIS)
Kang, Do Young; Cha, Kwang Soo; Han, Seung Ho; Park, Tae Ho; Kim, Moo Hyun; Kim, Young Dae
2005-01-01
Abnormal myocardial perfusion may be caused by ventricular preexcitation, but its location, extent, severity and correlation with accessory pathway (AP) are not established. We evaluated perfusion patterns on myocardial perfusion SPECT and location of AP in patients with WPW (Wolff-Parkison-White) syndrome. Adenosine Tc-99m MIBI or Tl-201 myocardial perfusion SPECT was performed in 11 patients with WPW syndrome. Perfusion defects (PD) were compared to AP location based on ECT with Fitzpatrick's algorithm of electrophysiologic study and radiofrequency catheter ablation. Patients had atypical chest discomfort or no symptom. Risk of coronary artery disease (CAD) was below 0.1 in 11 patients using the nomogram to estimate the probability of CAD. Coronary angiography was performed in 4 patients(mid-LAD 50% in one, normal in others). In 4 patients, AP localization was done by electrophysiologic study and radiofrequency catheter ablation (RFCA). Small to large extent (11.0 ± 8.5%, range:3 ∼ 35%) and mild to moderate severity (-71 ± 42.7%, range:-217 ∼ -39%) of reversible (n=9) or fixed (n=1) perfusion defects were noted. One patients with right free wall (right lateral) AP showed normal. PD locations were variable following the location of AP. One patient with left lateral wall AP was followed 6 weeks after RFCA and showed significantly decreased PD on SPECT with successful ablation. Myocardial perfusion defect showed variable extent, severity and location in patients with WPW syndrome. Abnormal perfusion defect showed in most of all patients, but if did not seem to be correlated specifically with location of accessory pathway and coronary artery disease. Therefore myocardial perfusion SPECT should be interpreted carefully in patients with WPW syndrome
Abnormal perfusion on myocardial perfusion SPECT in patients with Wolff-Parkinson-White syndrome
Energy Technology Data Exchange (ETDEWEB)
Kang, Do Young; Cha, Kwang Soo; Han, Seung Ho; Park, Tae Ho; Kim, Moo Hyun; Kim, Young Dae [Donga University College of Medicine, Busan (Korea, Republic of)
2005-02-15
Abnormal myocardial perfusion may be caused by ventricular preexcitation, but its location, extent, severity and correlation with accessory pathway (AP) are not established. We evaluated perfusion patterns on myocardial perfusion SPECT and location of AP in patients with WPW (Wolff-Parkison-White) syndrome. Adenosine Tc-99m MIBI or Tl-201 myocardial perfusion SPECT was performed in 11 patients with WPW syndrome. Perfusion defects (PD) were compared to AP location based on ECT with Fitzpatrick's algorithm of electrophysiologic study and radiofrequency catheter ablation. Patients had atypical chest discomfort or no symptom. Risk of coronary artery disease (CAD) was below 0.1 in 11 patients using the nomogram to estimate the probability of CAD. Coronary angiography was performed in 4 patients(mid-LAD 50% in one, normal in others). In 4 patients, AP localization was done by electrophysiologic study and radiofrequency catheter ablation (RFCA). Small to large extent (11.0 {+-} 8.5%, range:3 {approx} 35%) and mild to moderate severity (-71 {+-} 42.7%, range:-217 {approx} -39%) of reversible (n=9) or fixed (n=1) perfusion defects were noted. One patients with right free wall (right lateral) AP showed normal. PD locations were variable following the location of AP. One patient with left lateral wall AP was followed 6 weeks after RFCA and showed significantly decreased PD on SPECT with successful ablation. Myocardial perfusion defect showed variable extent, severity and location in patients with WPW syndrome. Abnormal perfusion defect showed in most of all patients, but if did not seem to be correlated specifically with location of accessory pathway and coronary artery disease. Therefore myocardial perfusion SPECT should be interpreted carefully in patients with WPW syndrome.
Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko
2014-12-05
Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.
Two zero-flow pressure intercepts exist in autoregulating isolated skeletal muscle.
Braakman, R; Sipkema, P; Westerhof, N
1990-06-01
The autoregulating vascular bed of the isolated canine extensor digitorum longus muscle was investigated for the possible existence of two positive zero-flow pressure axis intercepts, a tone-dependent one and a tone-independent one. An isolated preparation, perfused with autologous blood, was used to exclude effects of collateral flow and nervous and humoral regulation while autoregulation was left intact [mean autoregulatory gain 0.50 +/- 0.24 (SD)]. In a first series of experiments, the steady-state (zero flow) pressure axis intercept [mean 8.9 +/- 2.6 (SD) mmHg, tone independent] and the instantaneous (zero flow) pressure axis intercept [mean 28.5 +/- 9.9 (SD) mmHg, tone dependent] were determined as a function of venous pressure (range: 0-45 mmHg) and were independent of venous pressure until the venous pressure exceeded their respective values. Beyond this point the relations between the venous pressure and the steady-state and instantaneous pressure axis intercept followed the line of identity. The findings agree with the predictions of the vascular waterfall model. In a second series it was shown by means of administration of vasoactive drugs that the instantaneous pressure axis intercept is tone dependent, whereas the steady-state pressure axis intercept is not. It is concluded that there is a (proximal) tone-dependent zero-flow pressure at the arteriolar level and a (distal) tone-independent zero-flow pressure at the venous level.
Energy Technology Data Exchange (ETDEWEB)
Deneve, Jeremiah L., E-mail: Jeremiah.Deneve@Moffitt.org [Moffitt Cancer Center, Department of Cutaneous and Sarcoma Oncology (United States); Choi, Junsung [Moffitt Cancer Center, Department of Interventional Radiology (United States); Gonzalez, Ricardo J.; Conley, Anthony P.; Stewart, Steven; Han, Dale [Moffitt Cancer Center, Department of Cutaneous and Sarcoma Oncology (United States); Werner, Philip; Chaudhry, Tariq A. [Moffitt Cancer Center, Department of Anesthesia (United States); Zager, Jonathan S., E-mail: Jonathan.Zager@Moffitt.org [Moffitt Cancer Center, Department of Cutaneous and Sarcoma Oncology (United States)
2012-12-15
Purpose: Treatment of patients with unresectable liver metastases is challenging. Regional therapies to the liver have been developed that maximize treatment of the localized disease process without systemic toxic adverse effects. We discuss the procedural aspects of liver chemosaturation with percutaneous hepatic perfusion (CS-PHP). Methods: We present as an illustration of this technique a case report of the treatment of unresectable metastatic leiomyosarcoma of the liver. Results: A randomized phase III trial for unresectable liver metastases from melanoma was recently completed comparing CS-PHP with melphalan vs. best alternative care (BAC). When compared with BAC, CS-PHP was associated with a significant improvement in hepatic progression-free survival (8.0 months CS-PHP vs. 1.6 months BAC, p < 0.0001) and overall progression-free survival (6.7 months CS-PHP vs. 1.6 months BAC, p < 0.0001), respectively. On the basis of these results, and given our experience as one of the treating institutions for this phase III trial, we appealed for compassionate use of CS-PHP in a patient with isolated bilobar unresectable hepatic metastases from leiomyosarcoma. Four target lesions were identified and monitored to assess treatment response. A total of 4 CS-PHP procedures were performed, with a 25 % reduction in size of the largest lesion observed and 16 month hepatic progression-free survival. Toxicity was mild (neutropenia) and manageable on an outpatient basis. Conclusion: CS-PHP offers several advantages for unresectable hepatic sarcoma metastases. CS-PHP is minimally invasive and repeatable, and it has a predictable and manageable systemic toxicity profile. For appropriately selected patients, CS-PHP can delay tumor progression and could potentially improve survival.
International Nuclear Information System (INIS)
Deneve, Jeremiah L.; Choi, Junsung; Gonzalez, Ricardo J.; Conley, Anthony P.; Stewart, Steven; Han, Dale; Werner, Philip; Chaudhry, Tariq A.; Zager, Jonathan S.
2012-01-01
Purpose: Treatment of patients with unresectable liver metastases is challenging. Regional therapies to the liver have been developed that maximize treatment of the localized disease process without systemic toxic adverse effects. We discuss the procedural aspects of liver chemosaturation with percutaneous hepatic perfusion (CS-PHP). Methods: We present as an illustration of this technique a case report of the treatment of unresectable metastatic leiomyosarcoma of the liver. Results: A randomized phase III trial for unresectable liver metastases from melanoma was recently completed comparing CS-PHP with melphalan vs. best alternative care (BAC). When compared with BAC, CS-PHP was associated with a significant improvement in hepatic progression-free survival (8.0 months CS-PHP vs. 1.6 months BAC, p < 0.0001) and overall progression-free survival (6.7 months CS-PHP vs. 1.6 months BAC, p < 0.0001), respectively. On the basis of these results, and given our experience as one of the treating institutions for this phase III trial, we appealed for compassionate use of CS-PHP in a patient with isolated bilobar unresectable hepatic metastases from leiomyosarcoma. Four target lesions were identified and monitored to assess treatment response. A total of 4 CS-PHP procedures were performed, with a 25 % reduction in size of the largest lesion observed and 16 month hepatic progression-free survival. Toxicity was mild (neutropenia) and manageable on an outpatient basis. Conclusion: CS-PHP offers several advantages for unresectable hepatic sarcoma metastases. CS-PHP is minimally invasive and repeatable, and it has a predictable and manageable systemic toxicity profile. For appropriately selected patients, CS-PHP can delay tumor progression and could potentially improve survival.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Goebel, Katie; Merner, Nancy D
2017-05-01
Canines are excellent models for cancer studies due to their similar physiology and genomic sequence to humans, companion status and limited intra-breed heterogeneity. Due to their affliction to mammary cancers, canines can serve as powerful genetic models of hereditary breast cancers. Variants within known human breast cancer susceptibility genes only explain a fraction of familial cases. Thus, further discovery is necessary but such efforts have been thwarted by genetic heterogeneity. Reducing heterogeneity is key, and studying isolated human populations have helped in the endeavour. An alternative is to study dog pedigrees, since artificial selection has resulted in extreme homogeneity. Identifying the genetic predisposition to canine mammary tumours can translate to human discoveries - a strategy currently underutilized. To explore this potential, we reviewed published canine mammary tumour genetic studies and proposed benefits of next generation sequencing canine cohorts to facilitate moving beyond incremental advances.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
DEFF Research Database (Denmark)
Buggeskov, Katrine B; Sundskard, Martin M; Jonassen, Thomas
2016-01-01
INTRODUCTION: Absence of pulmonary perfusion during cardiopulmonary bypass (CPB) may be associated with reduced postoperative oxygenation. Effects of active pulmonary artery perfusion were explored in patients with chronic obstructive pulmonary disease (COPD) undergoing cardiac surgery. METHODS: 90...... perfusion with normothermic oxygenated blood during cardiopulmonary bypass appears to improve postoperative oxygenation in patients with COPD undergoing cardiac surgery. Pulmonary artery perfusion with hypothermic HTK solution does not seem to improve postoperative oxygenation. TRIAL REGISTRATION NUMBER...
Reverse ventilation--perfusion mismatch
International Nuclear Information System (INIS)
Palmaz, J.C.; Barnett, C.A.; Reich, S.B.; Krumpe, P.E.; Farrer, P.A.
1984-01-01
Patients having lobar airway obstruction or consolidation usually have decreases of both ventilation and perfusion on lung scans. We report three patients in whom hypoxic vasoconstriction was apparently incomplete, resulting in a ''reversed'' ventilation-perfusion mismatch. Perfusion of the hypoxic lobe on the radionuclide scan was associated with metabolic alkalosis, pulmonary venous and pulmonary arterial hypertension in these patients
Mittal, Mitesh; Chakravarti, Soumendu; Mohapatra, J K; Chug, P K; Dubey, Rahul; Upmanuyu, Vikramaditya; Narwal, P S; Kumar, Anil; Churamani, C P; Kanwar, N S
2014-04-01
Canine parvovirus-2 (CPV-2), which emerged in 1978, is considered as the major viral enteric pathogen of the canine population. With the emergence of new antigenic variants and incidences of vaccine failure, CPV has become one of the dreaded diseases of the canines worldwide. The present study was undertaken in an organized kennel from North India to ascertain the molecular basis of the CPV outbreaks in the vaccinated dogs. 415 samples were collected over a 5year period (2008-2012). The outbreak of the disease was more severe in 2012 with high incidence of mortality in pups with pronounced clinical symptoms. Molecular typing based on the VP2 gene was carried out with the 11 isolates from different years and compared with the CPV prototype and the vaccine strains. All the isolates in the study were either new CPV-2a (2012 isolates) or new CPV-2b (2008 and 2011 isolates). There were amino acid mutations at the Tyr324Ile and at the Thr440Ala position in five isolates from 2012 indicating new CPV mutants spreading in India. The CPV vaccines used in the present study failed to generate protective antibody titer against heterogeneous CPV antigenic types. The findings were confirmed when the affected pups were treated with hyper-immune heterogeneous purified immunoglobulin's against CPV in dogs of different antigenic types. Copyright © 2014 Elsevier B.V. All rights reserved.
Isolated heart models: cardiovascular system studies and technological advances.
Olejnickova, Veronika; Novakova, Marie; Provaznik, Ivo
2015-07-01
Isolated heart model is a relevant tool for cardiovascular system studies. It represents a highly reproducible model for studying broad spectrum of biochemical, physiological, morphological, and pharmaceutical parameters, including analysis of intrinsic heart mechanics, metabolism, and coronary vascular response. Results obtained in this model are under no influence of other organ systems, plasma concentration of hormones or ions and influence of autonomic nervous system. The review describes various isolated heart models, the modes of heart perfusion, and advantages and limitations of various experimental setups. It reports the improvements of perfusion setup according to Langendorff introduced by the authors.
Lin, Dexin; Wu, Xianbin; Ji, Xiaoke; Zhang, Qiyu; Lin, YuanWei; Chen, WeiJian; Jin, Wangxun; Deng, Liming; Chen, Yunzhi; Chen, Bicheng; Li, Jianmin
2012-01-01
Current large animal models that could closely resemble the typical features of cirrhotic portal hypertension in human have not been well established. Thus, we aimed to develop and describe a reliable and reproducible canine cirrhosis model of portal hypertension. A total of 30 mongrel dogs were randomly divided into four groups: 1 (control; n = 5), 2 (portal vein stenosis [PVS]; n = 5], 3 (thioacetamide [TAA]; n = 5), and 4 (PVS plus TAA; n = 15). After 4-months modeling period, liver and spleen CT perfusion, abdominal CT scans, portal hemodynamics, gastroscopy, hepatic function, blood routine, the bone marrow, liver, and spleen histology were studied. The animals in group 2 (PVS) developed extrahepatic portosystemic collateral circulation, particularly esophageal varices, without hepatic cirrhosis and portal hypertension. Animals from group 3 (TAA) presented mild cirrhosis and portal hypertension without significant symptoms of esophageal varices and hypersplenism. In contrast, animals from group 4 (PVS + TAA) showed well-developed micronodular and macronodular cirrhosis, associated with significant portal hypertension and hypersplenism. The combination of PVS and TAA represents a novel, reliable, and reproducible canine cirrhosis model of portal hypertension, which is associated with the typical characteristics of portal hypertension, including hypersplenism.
Michaëlis--Menten kinetics of phenazone elimination in the perfused pig liver
DEFF Research Database (Denmark)
Andreasen, B; Tonnesen, K; Rabol, A
1977-01-01
The purpose of the present study was to define the elimination kinetics of phenazone (NFN) in the isolated perfused pig liver. In five experiments phenazone was administered as constant infusion to obtain steady-state periods over a wide range of concentrations. The elimination of phenazone follo...
Directory of Open Access Journals (Sweden)
Mohammad Karami
2014-04-01
Full Text Available Background: Corn silk is obtained from the plant Zea mays L. A traditional herbal medicine is in China. This has been used in many parts of the world to treat edema, kidney infections, gout, kidney stones, kidney diseases and prostate. Reports of the antioxidant effects of this material are available. Although little scientific resources are available to confirm its efficacy. In this study we tried to find out the antioxidant effect and preventing of hepatotoxicity effect of Corn silk with IRLP Isolated Rat Liver Perfusion system. Material and Methods: The aqueous and methanol extracts of dried Corn silk doses (10, 20, 40, 50 and 100 mg/kg was used. Albino Rats weighing 220-180 g were examined after anesthesia by diethyl ether, the abdominal cavity of the animal T-shaped pattern excision in the abdomen and around is opened.Then portal vein connected to the perfusion flow by using small scalp Vienna (No. 23 into the portal vein. After reaching perfusion flow rate to 20 ml per minute, extracts and fraction with above doses were added to perfusion buffer. Fluid outflows from the inferior vena cava, were collected for measurement of glutathione. One sample of the liver was removed for glutathione measurement and one sample was maintained in 10% formalin for histopathological examination. Differences between group means were estimated using oneway ANOVA followed by Duncan’s multiple range test. Results: The results showed that reduced glutathione level increased significantly by aqueous and methanol extract in comparison with controls. Pathology results confirmed that by increasing dose of extracts, severity of tissue damage (hemorrhage, fibrosis, and necrosis is reduced. In samples taken at intervals of 120 minutes, changes in the glutathione of case groups showed significant difference in comparison with the control group (p<0.01. Conclusion: Findings indicated that aqueous and methanolic extracts of corn fiber, reduced hepatic damages of MDMA
Epicardial excitation pattern as observed in the isolated revived and perfused fetal human heart
Durrer, D.; Büller, J.; Graaff, P.; Lo, G.I.; Meijler, F.L.
1961-01-01
The resuscitated fetal human heart can be used as an experimental tooI for the investigation of the excitatory process in the human heart. During perfusion the configuration of the epicardial electrocardiograms does not change appreciably. For accurate recording permitting a detailed analysis, the
31P-NMR studies on perfused mouse liver
International Nuclear Information System (INIS)
McLaughlin, A.C.; Takeda, H.; Chance, B.
1978-01-01
From a metabolic viewpoint, the most important organ in the body is the liver. In contrast to more specialized organs such as heart and kidney which perform only one major function, the liver performs a number of major metabolic functions. Two of the most important functions are the catabolism and storage of foodstuffs (in the form of glycogen) and the control of most of the constituents of the blood (in particular, the blood glucose level). Most of these functions are localized within a single type of cell. One way that the liver is able to regulate these diverse reactions is by the control of the ATP level in the cell. Encouraged by the recent success of many groups in using 31 P-NMR to provide a continuous and non-destructive monitor of ATP levels in isolated cells, skeletal muscle, and perfused organs such as heart and kidney, 31 P-NMR was used to investigate ATP levels in perfused liver of mice
Chiba, Y; Ishii, Y; Kitamura, S; Sugiyama, Y
2001-09-01
Acute lung injury is attributed primarily to increased vascular permeability caused by reactive oxygen species derived from neutrophils, such as hydrogen peroxide (H2O2). Increased permeability is accompanied by the contraction and cytoskeleton reorganization of endothelial cells, resulting in intercellular gap formation. The Rho family of Ras-like GTPases is implicated in the regulation of the cytoskeleton and cell contraction. We examined the role of Rho in H2O2-induced pulmonary edema with the use of isolated perfused rabbit lungs. To our knowledge, this is the first study to examine the role of Rho in increased vascular permeability induced by H2O2 in perfused lungs. Vascular permeability was evaluated on the basis of the capillary filtration coefficient (Kfc, ml/min/cm H2O/100 g). We found that H2O2 (300 microM) increased lung weight, Kfc, and pulmonary capillary pressure. These effects of H2O2 were abolished by treatment with Y-27632 (50 microM), an inhibitor of the Rho effector p160 ROCK. In contrast, the muscular relaxant papaverine inhibited the H2O2-induced rise in pulmonary capillary pressure, but did not suppress the increases in lung weight and Kfc. These findings indicate that H2O2 causes pulmonary edema by elevating hydrostatic pressure and increasing vascular permeability. Y-27632 inhibited the formation of pulmonary edema by blocking both of these H2O2-induced effects. Our results suggest that Rho-related pathways have a part in the mechanism of H2O2-induced pulmonary edema. Copyright 2001 Academic Press.
Canine parvovirus effect on wolf population change and pup survival
Mech, L.D.; Goyal, S.M.
1993-01-01
Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.
Perfusion dyssynchrony analysis
Chiribiri, A.; Villa, A.D.M.; Sammut, E.; Breeuwer, M.; Nagel, E.
2015-01-01
AIMS: We sought to describe perfusion dyssynchrony analysis specifically to exploit the high temporal resolution of stress perfusion CMR. This novel approach detects differences in the temporal distribution of the wash-in of contrast agent across the left ventricular wall. METHODS AND RESULTS:
Molecular epidemiology of canine parvovirus in southern India
Directory of Open Access Journals (Sweden)
V. M. Vivek Srinivas,
2013-08-01
Full Text Available Aim: The present study was conducted to isolate and characterize canine parvovirus circulating in Southern India by genetic analysis of VP2 capsid protein gene.Materials and Methods: In this study, 128 samples were collected from nine different locations covering five Southern Indian states (Pondicherry, Tamil Nadu, Kerala, Andhra Pradesh and Karnataka . Out of 128 samples, 69 samples were found to be positive by PCR assay. Out of 69 positive samples, 36 were randomly selected and processed for virus isolation. Twenty viruses could be isolated successfully and 18 randomly selected isolate were subjected to VP2 gene sequence analysis along with 6 random clinical samples.Result: Seventeen isolates and 5 clinical samples were characterized as New CPV-2a (CPV2a with 297-Ser→Ala. But one isolate and one clinical sample had amino acids variations which were characteristics of New CPV-2b. The phylogenetic analysis revealed that one of the field isolates was found to be phylogenetically closely related to New CPV-2b strains of India; rest other sequences was found to share ancestral origins with New CPV-2a reference strains of Japan, China, Thailand and India.Conclusion: The present study revealed that the predominant CPV strain circulating in Southern India is New CPV-2a. There is also enough indication of New CPV-2b strain from different states of Southern India.
DEFF Research Database (Denmark)
Calloe, Kirstine; Soltysinska, Ewa; Jespersen, Thomas
2009-01-01
To examine the electrophysiological and molecular properties of the transient outward current (I(to)) in canine left ventricle using a novel I(to) activator, NS5806, I(to) was measured in isolated epicardial (Epi), midmyocardial (Mid) and endocardial (Endo) cells using whole-cell patch-clamp tech...
Brain perfusion: computed tomography applications
International Nuclear Information System (INIS)
Miles, K.A.
2004-01-01
Within recent years, the broad introduction of fast multi-detector computed tomography (CT) systems and the availability of commercial software for perfusion analysis have made cerebral perfusion imaging with CT a practical technique for the clinical environment. The technique is widely available at low cost, accurate and easy to perform. Perfusion CT is particularly applicable to those clinical circumstances where patients already undergo CT for other reasons, including stroke, head injury, subarachnoid haemorrhage and radiotherapy planning. Future technical developments in multi-slice CT systems may diminish the current limitations of limited spatial coverage and radiation burden. CT perfusion imaging on combined PET-CT systems offers new opportunities to improve the evaluation of patients with cerebral ischaemia or tumours by demonstrating the relationship between cerebral blood flow and metabolism. Yet CT is often not perceived as a technique for imaging cerebral perfusion. This article reviews the use of CT for imaging cerebral perfusion, highlighting its advantages and disadvantages and draws comparisons between perfusion CT and magnetic resonance imaging. (orig.)
Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.
Directory of Open Access Journals (Sweden)
Kinga Majchrzak
Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Directory of Open Access Journals (Sweden)
Valdo José Carreira
2008-03-01
Full Text Available OBJETIVO: Estudar os resultados da técnica descrita por Carreira et al. com utilização de perfusão cerebral seletiva bilateral (PCSAB pelo isolamento do tronco braquiocefálico e artéria carótida esquerda. MÉTODOS: Quinze pacientes foram operados consecutivamente entre de junho de 2005 e setembro de 2007. Os dados foram analisados por programa informatizado Epi Info e significância estatística com p0,05. CONCLUSÃO: A técnica de PCSAB é reprodutível e apresenta resultados semelhantes aos da literatura mundial. A excelente evolução neurológica e o fácil controle de sangramentos nas linhas de sutura podem ter contribuído com os resultados obtidos.OBJECTIVE: To evaluate the results of a technique described by Carreira et al. using bilateral antegrade selective cerebral perfusion by isolating the brachiocephalic trunk and the left carotid artery. METHODS: Fifteen patients were operated between June 2005 and September 2007. Data analysis were performed using Epi Info and statistical significance was set at p0.05. CONCLUSION: The technique of bilateral selective cerebral perfusion described by Carreira et al. can be performed by others and presents similar results to the international literature. The excellent neurological outcome and easy bleeding control on surgical sutures lines are the major advantages of this new procedure.
Energy Technology Data Exchange (ETDEWEB)
Oki, Glaucia Celeste Rossatto [Clinica Diagnoson and Hospital Aristides Maltez, Salvador, BA (Brazil). Servicos de Medicina Nuclear; Pavin, Elizabeth Joao; Parisi, Maria Candida R. [Universidade Estadual de Campinas (Unicamp), Campinas, SP (Brazil). Department of Internal Medicine. Service of Endocrinology; Coelho, Otavio Rizzi; Almeida, Raitany C. [Universidade Estadual de Campinas (Unicamp), Campinas, SP (Brazil). Department of Internal Medicine. Service of Cardiology; Etchebehere, Elba Cristina Sa de Camargo; Ramos, Celso Dario, E-mail: cdramos@unicamp.br [Universidade Estadual de Campinas (Unicamp), Campinas, SP (Brazil). Department of Radiology. Service of Nuclear Medicine; Camargo, Edwaldo Eduardo [Hospital Sirio-Libanes, Campinas, SP (Brazil). Service of Nuclear Medicine
2013-01-15
Objective: This study was aimed to evaluate myocardial perfusion in asymptomatic patients with type 1 (DM1) and type 2 diabetes mellitus (DM2) without previous diagnoses of coronary artery disease (CAD) or cerebral infarction. Materials and Methods: Fifty-nine consecutive asymptomatic patients (16 DM1, 43 DM2) underwent myocardial perfusion scintigraphy with {sup 99m}Tc-sestamibi (MPS). They were evaluated for body mass index, metabolic control of DM, type of therapy, systemic arterial hypertension, dyslipidemia, nephropathy, retinopathy, peripheral neuropathy, smoking, and familial history of CAD. Results: MPS was abnormal in 15 patients (25.4%): 12 (20.3%) with perfusion abnormalities, and 3 with isolated left ventricular dysfunction. The strongest predictors for abnormal myocardial perfusion were: age 60 years and above (p = 0.017; odds ratio [OR] = 6.0), peripheral neuropathy (p = 0.028; OR = 6.1), nephropathy (p = 0.031; OR = 5.6), and stress ECG positive for ischemia (p = 0.049; OR = 4.08). Conclusion: Silent myocardial ischemia occurs in more than one in five asymptomatic diabetic patients. The strongest predictors of ischemia in this study were: patient age, peripheral neuropathy, nephropathy, retinopathy and a stress ECG positive for ischemia. (author)
International Nuclear Information System (INIS)
Oki, Glaucia Celeste Rossatto; Pavin, Elizabeth Joao; Parisi, Maria Candida R.; Coelho, Otavio Rizzi; Almeida, Raitany C.; Etchebehere, Elba Cristina Sa de Camargo; Ramos, Celso Dario; Camargo, Edwaldo Eduardo
2013-01-01
Objective: This study was aimed to evaluate myocardial perfusion in asymptomatic patients with type 1 (DM1) and type 2 diabetes mellitus (DM2) without previous diagnoses of coronary artery disease (CAD) or cerebral infarction. Materials and Methods: Fifty-nine consecutive asymptomatic patients (16 DM1, 43 DM2) underwent myocardial perfusion scintigraphy with 99m Tc-sestamibi (MPS). They were evaluated for body mass index, metabolic control of DM, type of therapy, systemic arterial hypertension, dyslipidemia, nephropathy, retinopathy, peripheral neuropathy, smoking, and familial history of CAD. Results: MPS was abnormal in 15 patients (25.4%): 12 (20.3%) with perfusion abnormalities, and 3 with isolated left ventricular dysfunction. The strongest predictors for abnormal myocardial perfusion were: age 60 years and above (p = 0.017; odds ratio [OR] = 6.0), peripheral neuropathy (p = 0.028; OR = 6.1), nephropathy (p = 0.031; OR = 5.6), and stress ECG positive for ischemia (p = 0.049; OR = 4.08). Conclusion: Silent myocardial ischemia occurs in more than one in five asymptomatic diabetic patients. The strongest predictors of ischemia in this study were: patient age, peripheral neuropathy, nephropathy, retinopathy and a stress ECG positive for ischemia. (author)
International Nuclear Information System (INIS)
Depre, Christophe
1998-01-01
Isolated heart preparations are used to study physiological and metabolic parameters of the heart independently of its environment. Several preparations of isolated perfused heart are currently used, mainly the retrograde perfusion system and the working heart model. Both models allow investigations of the metabolic regulation of the heart in various physiological conditions (changes in workload, hormonal influences, substrate competition). These systems may also reproduce different pathological conditions, such as ischemia, reperfusion and hypoxia. Quantitation of metabolic activity can be performed with specific radioactive tracers. Finally, the effects of various drugs on cardiac performance and resistance to ischemia can be studied as well. Heart perfusion also revealed efficient methods to determine the tracer/tracee relation for radioisotopic analogues used with Positron Emission Tomography
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
A capillary-based perfusion phantom for simulation of brain perfusion for MRI
International Nuclear Information System (INIS)
Maciak, A.; Kronfeld, A.; Mueller-Forell, W.; Wille, C.; Kempski, O.; Stoeter, P.
2010-01-01
Purpose: The measurement of the CBF is a non-standardized procedure and there are no reliable gold standards. This abstract shows a capillary-based perfusion-phantom for CE-DSC-MRI. It has equivalent flow properties to those within the tissue capillary system of the human brain and allows the validation of the Siemens Perfusion (MR) software. Materials and Methods: The perfusion phantom consists of a dialyzer for the simulation of the capillary system, a feeding tube for simulation of the AIF and a pulsatile pump for simulation of the heart. Using this perfusion phantom, the exact determination of the gold standard CBF due to the well-known geometry of the phantom is easy. It was validated based on different perfusion measurements. These measurements were investigated with standard software (Siemens Perfusion MR). The software determined the CBF within the capillary system. Based on this CBF, a comparison to the gold standard was made with several different flow speeds. After AIF selection, a total of 726 CBF data points were automatically extracted by the software. Results: This results in a comparison of the gold standard CBF to these 726 CBF values. Therefore, a reproducible and reliable deviation estimation between gold standard CBF and measured CBF using the software was computed. It can be shown that the deviation between gold standard and software-based evaluation ranges between 1 and 31 %. Conclusion: There is no significance for any correlation between flow speed and amount of deviation. The mean measured CBF is 11.4 % higher than the gold standard CBF (p-value < 0.001). Using this kind of perfusion-phantom, the validation of different software systems allows reliable conclusions about their quality. (orig.)
International Nuclear Information System (INIS)
Eckert, Bernd; Roether, Joachim; Fiehler, Jens; Thomalla, Goetz
2015-01-01
Modern multislice CT scanners enable multimodal protocols including non-enhanced CT, CT angiography, and CT perfusion. A 64-slice CT scanner provides 4-cm coverage. To cover the whole brain, a 128 - 256-slice scanner is needed. The use of perfusion CT requires an optimized scan protocol in order to reduce exposure to radiation. As compared to non-enhanced CT and CT angiography, the use of CT perfusion increases detection rates of cerebral ischemia, especially small cortical ischemic lesions, while the detection of lacunar and infratentorial stroke lesions remains limited. Perfusion CT enables estimation of collateral flow in acute occlusion of large intra- or extracranial arteries. Currently, no established reliable thresholds are available for determining infarct core and penumbral tissue by CT perfusion. Moreover, perfusion parameters depend on the processing algorithms and the software used for calculation. However, a number of studies point towards a reduction of cerebral blood volume (CBV) below 2 ml/100 g as a critical threshold that identifies infarct core. Large CBV lesions are associated with poor outcome even in the context of recanalization. The extent of early ischemic signs on non-enhanced CT remains the main parameter from CT imaging to guide acute reperfusion treatment. Nevertheless, perfusion CT increases diagnostic and therapeutic certainty in the acute setting. Similar to stroke MRI, perfusion CT enables the identification of tissue at risk of infarction by the mismatch between infarct core and the larger area of critical hypoperfusion. Further insights into the validity of perfusion parameters are expected from ongoing trials of mechanical thrombectomy in stroke.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Anticancer effects of geopropolis produced by stingless bees on canine osteosarcoma cells in vitro.
Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Araújo, Maria José Abigail Mendes; Búfalo, Michelle Cristiane; Sforcin, José Maurício
2013-01-01
Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent), and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent) had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.
Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro
Directory of Open Access Journals (Sweden)
Naiara Costa Cinegaglia
2013-01-01
Full Text Available Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent, and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.
International Nuclear Information System (INIS)
Pleta, M.; Chan, T.
1987-01-01
Using ( 3 H) CB, they attempted to quantitate the changes in the amount of glucose transporters in the plasma membrane (PM) and intracellular membranes (HSP) prepared from rat hearts perfused with insulin, under low and high pressure. Membranes isolated from non-perfused hearts showed a PM/HSP ratio of (0.593). Hearts perfused with low pressure showed a lower ratio of (0.474). Perfusion with insulin increased the ratio to (1.8), almost a 3-4 fold increase from low perfusion pressure. These data correlate with insulin effects in glucose transport and CB binding in the fat cells. High pressure perfusion increased the PM/HSP ratio by 1-2 fold. ( 3 H) 2-DG transport indicates a comparable increase in glucose uptake with high pressure, but with insulin only a 1.5 fold increase was observed. Initial data obtained from streptozotocin (STZ) injected diabetic rats indicate low CB binding in the PM fraction. Only insulin, but not high perfusion pressure increased PM/HSP ratio in the STZ-diabetic hearts. Their data imply that while both caused apparent translocation of glucose transporters, influences on cardiac glucose metabolism by work load are different. Furthermore, STZ induced diabetes affected only the high perfusion pressure-induced and not the insulin-stimulated change in CB binding
Escherichia coli : host interactions in the pathogenesis of canine pyometra
Henriques, Sofia Correia Rosa de Barros
2016-01-01
Tese de Doutoramento em Ciências Veterinárias na Especialidade de Ciências Biológicas e Biomédicas Canine pyometra develops as a result of a complex interaction of etiological and physiopathological factors, such as the virulence and type of the bacteria and the individual host defence mechanisms. Since Escherichia coli is the most common bacterium isolated from uterus of bitches with pyometra, one main objective of this work was to characterize E. coli virulence potential, and...
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Energy Technology Data Exchange (ETDEWEB)
Othman, Ahmed E. [RWTH Aachen University, Department of Diagnostic and Interventional Neuroradiology, Aachen (Germany); Eberhard Karls University Tuebingen, University Hospital Tuebingen, Department for Diagnostic and Interventional Radiology, Tuebingen (Germany); Afat, Saif; Nikoubashman, Omid; Mueller, Marguerite; Wiesmann, Martin; Brockmann, Carolin [RWTH Aachen University, Department of Diagnostic and Interventional Neuroradiology, Aachen (Germany); Schubert, Gerrit Alexander [RWTH Aachen University, Department of Neurosurgery, Aachen (Germany); Bier, Georg [Eberhard Karls University Tuebingen, University Hospital Tuebingen, Department for Diagnostic and Interventional Neuroradiology, Tuebingen (Germany); Brockmann, Marc A. [RWTH Aachen University, Department of Diagnostic and Interventional Neuroradiology, Aachen (Germany); University Hospital Mainz, Department of Neuroradiology, Mainz (Germany)
2016-08-15
In this study, we aimed to evaluate the diagnostic performance of different volume perfusion CT (VPCT) maps regarding the detection of cerebral vasospasm compared to angiographic findings. Forty-one datasets of 26 patients (57.5 ± 10.8 years, 18 F) with subarachnoid hemorrhage and suspected cerebral vasospasm, who underwent VPCT and angiography within 6 h, were included. Two neuroradiologists independently evaluated the presence and severity of vasospasm on perfusion maps on a 3-point Likert scale (0 - no vasospasm, 1 - vasospasm affecting <50 %, 2 - vasospasm affecting >50 % of vascular territory). A third neuroradiologist independently assessed angiography for the presence and severity of vasospasm on a 3-point Likert scale (0 - no vasospasm, 1 - vasospasm affecting < 50 %, 2 - vasospasm affecting > 50 % of vessel diameter). Perfusion maps of cerebral blood volume (CBV), cerebral blood flow (CBF), mean transit time (MTT), and time to drain (TTD) were evaluated regarding diagnostic accuracy for cerebral vasospasm with angiography as reference standard. Correlation analysis of vasospasm severity on perfusion maps and angiographic images was performed. Furthermore, inter-reader agreement was assessed regarding findings on perfusion maps. Diagnostic accuracy for TTD and MTT was significantly higher than for all other perfusion maps (TTD, AUC = 0.832; MTT, AUC = 0.791; p < 0.001). TTD revealed higher sensitivity than MTT (p = 0.007). The severity of vasospasm on TTD maps showed significantly higher correlation levels with angiography than all other perfusion maps (p ≤ 0.048). Inter-reader agreement was (almost) perfect for all perfusion maps (kappa ≥ 0.927). The results of this study indicate that TTD maps have the highest sensitivity for the detection of cerebral vasospasm and highest correlation with angiography regarding the severity of vasospasm. (orig.)
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
Effects of neuropeptide Y on regulation of blood flow rate in canine myocardium
DEFF Research Database (Denmark)
Svendsen, Jesper Hastrup; Sheikh, S P; Jørgensen, J
1990-01-01
The effect of neuropeptide Y (NPY) on tension development was examined in isolated canine coronary arteries, and the effects on local myocardial blood flow rate were studied in open-chest anesthetized dogs by the local 133Xe washout technique. By immunohistochemistry, numerous NPY-like immunoreac......The effect of neuropeptide Y (NPY) on tension development was examined in isolated canine coronary arteries, and the effects on local myocardial blood flow rate were studied in open-chest anesthetized dogs by the local 133Xe washout technique. By immunohistochemistry, numerous NPY......+. In contrast, intracoronary NPY (0.01-10 micrograms) induced a considerable degree of vasoconstriction; the reduction of blood flow rate was dose related, with a maximum reduction to 52% of control values. The effect of intracoronary NPY (1 microgram) on maximally relaxed arterioles elicited by 30 s...... of ischemia was studied in separate experiments during reactive hyperemia. NPY induced a decrease in maximum blood flow during reactive hyperemia (166.6 vs. 214.6% of preocclusive blood flow rate, mean values; P = 0.05), an increase in the cumulative excess blood flow (61.0 vs. 35.3 ml/100 g; P = 0...
Walewska, Magdalena; Dolka, Izabella; Małek, Anna; Wojtalewicz, Anna; Wojtkowska, Agata; Żbikowski, Artur; Lechowski, Roman; Zabielska-Koczywąs, Katarzyna
2017-05-12
The chick embryo chorioallantoic membrane (CAM) model is extensively used in human medicine in preclinical oncological studies. The CAM model has several advantages: low cost, simple experimental approach, time saving and following "3R principles". Research has shown that the human osteosarcoma cell lines U2OS, MMNG-HOS, and SAOS can form tumors on the CAM. In veterinary medicine, this has been described only for feline fibrosarcomas, feline mammary carcinomas and canine osteosarcomas. However, in case of canine osteosarcomas, it has been shown that only non-adherent osteosarcoma stem cells isolated from KTOSA5 and CSKOS cell lines have the ability to form microtumors on the CAM after an incubation period of 5 days, in contrast to adherent KTOSA5 and CSKOS cells. In the presented study, we have proven that the commercial adherent canine osteosarcoma cell line (D-17) can form vascularized tumors on the CAM after the incubation period of 10 days.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Djuric-Stefanovic, A., E-mail: avstefan@eunet.rs [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Unit of Digestive Radiology (First University Surgical Clinic), Center of Radiology and MR, Clinical Center of Serbia, Belgrade (Serbia); Saranovic, Dj., E-mail: crvzve4@gmail.com [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Unit of Digestive Radiology (First University Surgical Clinic), Center of Radiology and MR, Clinical Center of Serbia, Belgrade (Serbia); Sobic-Saranovic, D., E-mail: dsobic2@gmail.com [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Center of Nuclear Medicine, Clinical Center of Serbia, Belgrade (Serbia); Masulovic, D., E-mail: draganmasulovic@yahoo.com [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Unit of Digestive Radiology (First University Surgical Clinic), Center of Radiology and MR, Clinical Center of Serbia, Belgrade (Serbia); Artiko, V., E-mail: veraart@beotel.rs [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Center of Nuclear Medicine, Clinical Center of Serbia, Belgrade (Serbia)
2015-03-15
Purpose: Standardized perfusion value (SPV) is a universal indicator of tissue perfusion, normalized to the whole-body perfusion, which was proposed to simplify, unify and allow the interchangeability among the perfusion measurements and comparison between the tumor perfusion and metabolism. The aims of our study were to assess the standardized perfusion value (SPV) of the esophageal carcinoma, and its correlation with quantitative CT perfusion measurements: blood flow (BF), blood volume (BV), mean transit time (MTT) and permeability surface area product (PS) of the same tumor volume samples, which were obtained by deconvolution-based CT perfusion analysis. Methods: Forty CT perfusion studies of the esophageal cancer were analyzed, using the commercial deconvolution-based CT perfusion software (Perfusion 3.0, GE Healthcare). The SPV of the esophageal tumor and neighboring skeletal muscle were correlated with the corresponding mean tumor and muscle quantitative CT perfusion parameter values, using Spearman's rank correlation coefficient (r{sub S}). Results: Median SPV of the esophageal carcinoma (7.1; range: 2.8–13.4) significantly differed from the SPV of the skeletal muscle (median: 1.0; range: 0.4–2.4), (Z = −5.511, p < 0.001). The cut-off value of the SPV of 2.5 enabled discrimination of esophageal cancer from the skeletal muscle with sensitivity and specificity of 100%. SPV of the esophageal carcinoma significantly correlated with corresponding tumor BF (r{sub S} = 0.484, p = 0.002), BV (r{sub S} = 0.637, p < 0.001) and PS (r{sub S} = 0.432, p = 0.005), and SPV of the skeletal muscle significantly correlated with corresponding muscle BF (r{sub S} = 0.573, p < 0.001), BV (r{sub S} = 0.849, p < 0.001) and PS (r{sub S} = 0.761, p < 0.001). Conclusions: We presented a database of the SPV for the esophageal cancer and proved that SPV of the esophageal neoplasm significantly differs from the SPV of the skeletal muscle, which represented a sample of healthy
Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni
2016-12-01
Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Vongsavan, Kadkao; Samdrup, Tshering; Kijsamanmith, Kanittha; Rirattanapong, Praphasri; Vongsavan, Noppakun
2018-05-10
The aim of this study was to determine the effect of intraosseous (IO) anesthesia with 4% articaine and 1:100,000 epinephrine on pulpal blood flow (PBF) and pulpal anesthesia of mandibular first molars and canines in human subjects. Ten healthy volunteers with intact mandibular first molar and canine were given an osteocentral technique of IO injection using the Quick Sleeper 5 system and 4% articaine with 1:100,000 epinephrine at distal site of mandibular first molar. The PBF was monitored by a laser Doppler flowmeter (LDF). Pulpal anesthesia was assessed with an electric pulp tester (EPT). IO injection caused a decrease in PBF in molars from 6.31 ± 3.85 perfusion units (P.U.) before injection to 2.51 ± 2.53 P.U. 1 min after injection (P anesthesia in the molars, the mean onset was 2.40 ± 0.84 min and the mean duration was 38 ± 16.19 min. In the canines, there was a decrease in the sensitivity to EPT but complete pulpal anesthesia was not achieved. IO injection distal to mandibular first molar caused a decrease in PBF and successful pulpal anesthesia in first molar, but not in canine. Both PBF and EPT readings returned to normal, suggesting that pulpal ischemia may not occur. IO anesthesia is safe to use as a primary technique in teeth with normal pulp.
Vliegenthart, Rozemarijn; De Cecco, Carlo N.; Wichmann, Julian L.; Meinel, Felix G.; Pelgrim, Gert Jan; Tesche, Christian; Ebersberger, Ullrich; Pugliese, Francesca; Bamberg, Fabian; Choe, Yeon Hyeon; Wang, Yining; Schoepf, U. Joseph
2016-01-01
Background: To identify patients with early signs of myocardial perfusion reduction, a reference base for perfusion measures is needed. Objective: To analyze perfusion parameters derived from dynamic computed tomography perfusion imaging (CTPI) in patients with suspected coronary artery disease
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.
Directory of Open Access Journals (Sweden)
Ivaylo Gentschev
Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.
Methodology for ventilation/perfusion SPECT
DEFF Research Database (Denmark)
Bajc, Marika; Neilly, Brian; Miniati, Massimo
2010-01-01
radiolabeled liquid aerosols are not restricted to the presence of obstructive lung disease. Radiolabeled macroaggregated human albumin is the imaging agent of choice for perfusion scintigraphy. An optimal combination of nuclide activities and acquisition times for ventilation and perfusion, collimators......Ventilation/perfusion single-photon emission computed tomography (V/Q SPECT) is the scintigraphic technique of choice for the diagnosis of pulmonary embolism and many other disorders that affect lung function. Data from recent ventilation studies show that the theoretic advantages of Technegas over......, and imaging matrix yields an adequate V/Q SPECT study in approximately 20 minutes of imaging time. The recommended protocol based on the patient remaining in an unchanged position during the initial ventilation study and the perfusion study allows presentation of matching ventilation and perfusion slices...
The effect of cigarette smoke on the metabolism of arachidonic acid in isolated hamster lungs
International Nuclear Information System (INIS)
Maennistoe, J.; Toivonen, H.; Hartiala, J.; Bakhle, Y.S.; Uotila, P.
1981-01-01
The effects of cigarette smoke on the metabolism of exogenous arachidonic acid (AA) were investigated in isolated hamster lungs. Arachidonate was injected into the pulmonary circulation and the metabolites were analysed from the nonrecirculating perfusion effluent by thin layer chromatography. After the pulmonary injection of 66 nmol of 14C-AA about 20% of the injected radioactivity appeared in the perfusion effluent mostly as metabolites in six minutes. When isolated lungs were ventilated with cigarette smoke during the perfusion, the amounts of PGF2 alpha, PGE2 and two unidentified metabolite groups increased in the lung effluent. In two other experimental series hamsters were exposed to cigarette smoke before the lung perfusion either once for 30 min or during one hour daily for ten consecutive days. Neither pre-exposures caused any changes in the amounts of arachidonate metabolites in the lung effluent
Hydrostatic determinants of cerebral perfusion
International Nuclear Information System (INIS)
Wagner, E.M.; Traystman, R.J.
1986-01-01
We examined the cerebral blood flow response to alterations in perfusion pressure mediated through decreases in mean arterial pressure, increases in cerebrospinal fluid (CSF) pressure, and increases in jugular venous (JV) pressure in 42 pentobarbital anesthetized dogs. Each of these three pressures was independently controlled. Cerebral perfusion pressure was defined as mean arterial pressure minus JV or CSF pressure, depending on which was greater. Mean hemispheric blood flow was measured with the radiolabeled microsphere technique. Despite 30-mm Hg reductions in mean arterial pressure or increases in CSF or JV pressure, CBF did not change as long as the perfusion pressure remained greater than approximately 60 mm Hg. However, whenever perfusion pressure was reduced to an average of 48 mm Hg, cerebral blood flow decreased 27% to 33%. These results demonstrate the capacity of the cerebral vascular bed to respond similarly to changes in the perfusion pressure gradient obtained by decreasing mean arterial pressure, increasing JV pressure or increasing CSF pressure, and thereby support the above definition of cerebral perfusion pressure
Pang, Lisa Y; Gatenby, Emma L; Kamida, Ayako; Whitelaw, Bruce A; Hupp, Ted R; Argyle, David J
2014-01-01
Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs), which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05), and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.
Directory of Open Access Journals (Sweden)
Lisa Y Pang
Full Text Available Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs, which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05, and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.
The effects of baicalein on canine osteosarcoma cell proliferation and death.
Helmerick, E C; Loftus, J P; Wakshlag, J J
2014-12-01
Flavonoids are a group of modified triphenolic compounds from plants with medicinal properties. Baicalein, a specific flavone primarily isolated from plant roots (Scutellaria baicalensis), is commonly used in Eastern medicine for its anti-inflammatory and antineoplastic properties. Previous research shows greater efficacy for baicalein than most flavonoids; however, there has been little work examining their effects on sarcoma cells, let alone canine cells. Three canine osteosarcoma cell lines (HMPOS, D17 and OS 2.4) were treated with baicalein to examine cell viability, cell cycle kinetics, anchorage-independent growth and apoptosis. Results showed that osteosarcoma cells were sensitive to baicalein at concentrations from approximately 1 to 25 μM. Modest cell cycle changes were observed in one cell line. Baicalein was effective in inducing apoptosis and did not prevent doxorubicin cell proliferation inhibition in all the cell lines. The mechanism for induction of apoptosis has not been fully elucidated; however, changes in mitochondrial permeability supersede the apoptotic response. © 2012 Blackwell Publishing Ltd.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
First isolation and molecular characterization of Ehrlichia canis in Costa Rica, Central America.
Romero, L E; Meneses, A I; Salazar, L; Jiménez, M; Romero, J J; Aguiar, D M; Labruna, M B; Dolz, G
2011-08-01
The present study investigated Ehrlichia species in blood samples from dogs suspected of clinical ehrlichiosis, using molecular and isolation techniques in cell culture. From a total of 310 canine blood samples analyzed by 16S rRNA nested PCR, 148 (47.7%) were positive for Ehrlichia canis. DNA from Ehrlichia chaffeensis or Ehrlichia ewingii was not detected in any sample using species-specific primers in separated reactions. Leukocytes from five PCR-positive dogs were inoculated into DH82 cells; successful isolation of E. canis was obtained in four samples. Partial sequence of the dsb gene of eight canine blood samples (including the five samples for in vitro isolation) was obtained by PCR and their analyses through BLAST showed 100% of identity with the corresponding sequence of E. canis in GenBank. This study represents the first molecular diagnosis, isolation, and molecular characterization of E. canis in dogs from Costa Rica. Copyright © 2010 Elsevier Ltd. All rights reserved.
Successful Treatment of Canine Sporotrichosis with Terbinafine: Case Reports and Literature Review.
Viana, Paula Gonçalves; Figueiredo, Anna Barreto Fernandes; Gremião, Isabella Dib Ferreira; de Miranda, Luisa Helena Monteiro; da Silva Antonio, Isabela Maria; Boechat, Jéssica Sepulveda; de Sá Machado, Ana Caroline; de Oliveira, Manoel Marques Evangelista; Pereira, Sandro Antonio
2018-04-01
Sporotrichosis occurs worldwide, and the metropolitan region of Rio de Janeiro, Brazil, is a main endemic area, with a large number of human and animal cases in the last 19 years. This mycosis is more frequently described in cats rather than in dogs. There are a limited number of oral antifungal agents for the treatment of sporotrichosis in animals. In this context, the effectiveness of terbinafine in the treatment of sporotrichosis in humans, as well as the promising results of in vitro susceptibility tests, inspired us to use this drug in the therapy of this mycosis in dogs. We reported for the first time the use of terbinafine in the treatment of two dogs with sporotrichosis caused by Sporothrix brasiliensis. Moreover, we provided an overview of therapeutic features of canine sporotrichosis cases reported since the 1960s. One of the dogs presented the fixed cutaneous form of the disease, while the other patient presented hyperemia of the nasal mucosa and respiratory signs only. Terbinafine showed high antifungal activity in vitro against the canine Sporothrix isolates. The dogs were successfully treated with terbinafine, with remission of all clinical signs initially presented. The current reports indicate that this drug can emerge as a therapeutic option for canine sporotrichosis.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Effects of vasopressin on the isolated perfused human collecting tubule.
Yanagawa, N; Trizna, W; Bar-Khayim, Y; Fine, L G
1981-05-01
Cortical collecting tubules (CCT) were dissected from the surviving normal tissue of human kidneys removed at operation for either carcinoma or calculus. These CCT's were perfused in vitro shortly after the nephrectomy was performed. Transtubular potential differences in different tubules varied from +3.2 to -2.0 mV and were reduced towards zero by lowering the temperature or by adding ouabain to the bath. In the absence of vasopressin, tubules were essentially impermeable to water with extremely low net water fluxes even in the presence of a transtubular osmotic gradient. Addition of vasopressin to the bath caused the transtubular osmotic water permeability coefficient to increase to values of 125, 175, and 155 X 10(-4) cm/sec in three tubules thus studied. These results demonstrate close similarities between the human CCT and the more extensively studied rabbit CCT.
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Directory of Open Access Journals (Sweden)
Mark A Lum
Full Text Available To evaluate the ability of IA MR perfusion to characterize meningioma blood supply.Studies were performed in a suite comprised of an x-ray angiography unit and 1.5T MR scanner that permitted intraprocedural patient movement between the imaging modalities. Patients underwent intra-arterial (IA and intravenous (IV T2* dynamic susceptibility MR perfusion immediately prior to meningioma embolization. Regional tumor arterial supply was characterized by digital subtraction angiography and classified as external carotid artery (ECA dural, internal carotid artery (ICA dural, or pial. MR perfusion data regions of interest (ROIs were analyzed in regions with different vascular supply to extract peak height, full-width at half-maximum (FWHM, relative cerebral blood flow (rCBF, relative cerebral blood volume (rCBV, and mean transit time (MTT. Linear mixed modeling was used to identify perfusion curve parameter differences for each ROI for IA and IV MR imaging techniques. IA vs. IV perfusion parameters were also directly compared for each ROI using linear mixed modeling.18 ROIs were analyzed in 12 patients. Arterial supply was identified as ECA dural (n = 11, ICA dural (n = 4, or pial (n = 3. FWHM, rCBV, and rCBF showed statistically significant differences between ROIs for IA MR perfusion. Peak Height and FWHM showed statistically significant differences between ROIs for IV MR perfusion. RCBV and MTT were significantly lower for IA perfusion in the Dural ECA compared to IV perfusion. Relative CBF in IA MR was found to be significantly higher in the Dural ICA region and MTT significantly lower compared to IV perfusion.
Pulmonary perfusion ''without ventilation''
International Nuclear Information System (INIS)
Chapman, C.N.; Sziklas, J.J.; Spencer, R.P.; Rosenberg, R.J.
1983-01-01
An 88-yr-old man, with prior left upper lobectomy and phrenic nerve injury, had a ventilation/perfusion lung image. Both wash-in and equilibrium ventilation images showed no radioactive gas in the left lung. Nevertheless, the left lung was perfused. A similar result was obtained on a repeat study 8 days later. Delayed images, during washout, showed some radioactive gas in the left lung. Nearly absent ventilation (but continued perfusion) of that lung might have been related to altered gas dynamics brought about by the prior lobectomy, a submucosal bronchial lesion, phrenic nerve damage, and limited motion of the left part of the diaphragm. This case raises the issue of the degree of ventilation (and the phase relationship between the lungs) required for the entry of radioactive gas into a diseased lung, and the production of a ''reversed ventilation/perfusion mismatch.''
Impairment of aminopyrine clearance in aspirin-damaged canine gastric mucosa
International Nuclear Information System (INIS)
Miller, T.A.; Henagan, J.M.; Loy, T.M.
1983-01-01
Using an in vivo canine chambered stomach preparation, the clearance of [ 14 C]aminopyrine across mucosa when intravenously infused and the back-diffusion of this substance from gastric lumen to mucosa when topically applied to gastric epithelium were evaluated in aspirin-damaged gastric epithelium. In mucosa damaged by either 20 mM or 40 mM aspirin, the recovery of [ 14 C]aminopyrine, when topically mixed with acid (pH . 1.1) perfusate solution, was not significantly different from nondamaged control mucosa. In addition, the degree of ''trapping'' of this substance from back-diffusion was not different in damaged mucosa from that observed in nondamaged epithelium. In contrast, when [ 14 C]aminopyrine was intravenously infused, its clearance was significantly impaired in aspirin-damaged mucosa when compared with control studies, as evidenced by the increased ''trapping'' of this substance in injured epithelium. These findings indicate that movement of aminopyrine from plasma to gastric lumen is impaired in damaged epithelium, making the aminopyrine clearance technique an unreliable method to accurately measure absolute gastric blood flow in this experimental setting
International Nuclear Information System (INIS)
Xie Jian; Li Minghua; Tan Huaqiao; Zhu Yueqi; Hu Dingjun; Qiao Ruihua; Fan Chunhua
2009-01-01
Objective: The aim of the experiment is to make an intracranial aneurysm model in canine. Methods: A digital tube was made based on raw magnetic resonance images of the human intracranial carotid artery. Then 6 tubes were made in the 3D rapid prototyping machine and coated with silicone. Finally we isolated the common carotid arteries of 6 canines and made them go through the tubes and anastomosed them end-to-side to get the aneurysm model. Six stents were implanted after one week. Results: Six aneurysm models were successfully made in canines. The parent artery had similar geometry of the human carotid siphon. All the aneurysms and parent arteries were patent in one week's follow-up. One canine died of excessive anesthesia after stenting. Two vascular models kept patent in one month without stenosis. The other 3 had some stenosis on the bends of the vessel. Conclusions: The aneurysm model in the experiment has high flexibility and reliability. The model provides an effective tool for research and testing neurovascular devices. It's also a useful device to train the neuroradiologists and interventional physicians. (authors)
Energy Technology Data Exchange (ETDEWEB)
MacNicoll, A D; Wusteman, F S; Powell, G M; Curtis, C G [University Coll., Cardiff (UK)
1978-08-15
The isolated perfused rat liver system has been used to monitor the utilization of N-(/sup 3/H)acetyl-D-galactosamine and N-acetyl-D-(1-/sup 14/C)galactosamine for the biosynthesis of radiolabeled glycoproteins, which are subsequently secreted into the plasma. Both radiolabels appear in a number of different glycoproteins, predominantly as sialic acid and N-acetylglucosamine. The ratio of labelled sialic acid to labelled N-acetylglucosamine varies for different glycoproteins, but the bulk of N-acetyl-D-galactosamine is incorporated without deacetylation.
Hepatic perfusion changes in an experimental model of acute pancreatitis: Evaluation by perfusion CT
International Nuclear Information System (INIS)
Tutcu, Semra; Serter, Selim; Kaya, Yavuz; Kara, Eray; Nese, Nalan; Pekindil, Goekhan; Coskun, Teoman
2010-01-01
Purpose: It is known that acute pancreatitis may cause secondary changes in several organs. Liver is one of these involved organs. In different experimental studies hepatic damages were shown histopathologically in acute pancreatitis but there are a few studies about perfusion disorders that accompany these histopathologic changes. Perfusion CT (pCT) provides the ability to detect regional and global alterations in organ blood flow. The purpose of the study was to describe hepatic perfusion changes in experimental acute pancreatitis model with pCT. Materials and methods: Forty Sprague-Dawley rats of both genders with average weights of 250 g were used. Rats were randomized into two groups. Twenty rats were in control group and 20 in acute pancreatitis group. pCT was performed. Perfusion maps were formed by processing the obtained images with perfusion CT software. Blood flow (BF) and blood volume (BV) values were obtained from these maps. All pancreatic and liver tissues were taken off with laparotomy and histopathologic investigation was performed. Student's t test was used for statistical analyses. Results: In pCT we found statistically significant increase in blood volume in both lobes of liver and in blood flow in right lobe of the liver (p < 0.01). Although blood flow in left lobe of the liver increased, it did not reach statistical significance. Conclusion: The quantitative analysis of liver parenchyma with pCT showed that acute pancreatitis causes a significant perfusion changes in the hepatic tissue. Systemic mediators seem to be effective as well as local inflammatory changes in perfusion changes.
Hepatic perfusion changes in an experimental model of acute pancreatitis: Evaluation by perfusion CT
Energy Technology Data Exchange (ETDEWEB)
Tutcu, Semra [Department of Surgery, Celal Bayar University, School of Medicine, Manisa (Turkey); Serter, Selim, E-mail: serterselim@gmail.co [Department of Radiology, Celal Bayar University, School of Medicine, Manisa (Turkey); Kaya, Yavuz; Kara, Eray [Department of Surgery, Celal Bayar University, School of Medicine, Manisa (Turkey); Nese, Nalan [Department of Pathology, Celal Bayar University, School of Medicine, Manisa (Turkey); Pekindil, Goekhan [Department of Radiology, Celal Bayar University, School of Medicine, Manisa (Turkey); Coskun, Teoman [Department of Surgery, Celal Bayar University, School of Medicine, Manisa (Turkey)
2010-08-15
Purpose: It is known that acute pancreatitis may cause secondary changes in several organs. Liver is one of these involved organs. In different experimental studies hepatic damages were shown histopathologically in acute pancreatitis but there are a few studies about perfusion disorders that accompany these histopathologic changes. Perfusion CT (pCT) provides the ability to detect regional and global alterations in organ blood flow. The purpose of the study was to describe hepatic perfusion changes in experimental acute pancreatitis model with pCT. Materials and methods: Forty Sprague-Dawley rats of both genders with average weights of 250 g were used. Rats were randomized into two groups. Twenty rats were in control group and 20 in acute pancreatitis group. pCT was performed. Perfusion maps were formed by processing the obtained images with perfusion CT software. Blood flow (BF) and blood volume (BV) values were obtained from these maps. All pancreatic and liver tissues were taken off with laparotomy and histopathologic investigation was performed. Student's t test was used for statistical analyses. Results: In pCT we found statistically significant increase in blood volume in both lobes of liver and in blood flow in right lobe of the liver (p < 0.01). Although blood flow in left lobe of the liver increased, it did not reach statistical significance. Conclusion: The quantitative analysis of liver parenchyma with pCT showed that acute pancreatitis causes a significant perfusion changes in the hepatic tissue. Systemic mediators seem to be effective as well as local inflammatory changes in perfusion changes.
Directory of Open Access Journals (Sweden)
Enrico Pierluigi Spugnini
2017-06-01
Full Text Available A twenty-year-old female saddle horse was referred for evaluation of a seven month, non-healing erosive lesion of the right hind hoof with proliferation and bleeding of the underlying soft tissues. This lesion had been twice surgically treated as a canker but rapidly recurred. Histological examination of the second excision revealed a well-differentiated squamous cell carcinoma. At presentation, the horse was mildly depressed, lame and partially non-weight-bearing on the right hind leg, which exhibited a 10 x 10 cm erosive and proliferative lesion remodeling the hoof. After completing staging procedures, the lesion was approached with surgery and intraoperative electrochemotherapy (ECT administration of bleomycin in isolated limb perfusion. A second session of surgery and ECT was performed one month later, followed by three additional monthly sessions of ECT. During periodic recheck, the mare showed continuous improvement. One year after presentation, the mare was in complete remission and her gait markedly improved. ECT was well-tolerated and resulted in improved local control of a tumor in a challenging anatomical district.
Compartmented pyruvate in perfused working heart
International Nuclear Information System (INIS)
Buenger, R.
1985-01-01
Pyruvate compartmentation and lactate dehydrogenase (LDH) were studied in isolated perfused working guinea pig hearts. The mean intracellular pyruvate (Pyr) contents increased with perfusate Pyr (0-2 mM) but varied only slightly with glucose (0-10 mM) and additional insulin (0.04-5 U/l), respectively. With 5-10 mM glucose plus 5 U/l insulin, but not with Pyr or lactate (Lac) as substrates, a near equilibrium between the LDH and the glycerol-3-phosphate dehydrogenase seemed to exist. Evidence for an inhibitory effect of Pyr on the activity of the LDH system of the perfused hearts was not obtained. With [U- 14 C]glucose as sole substrate, the specific activity of coronary venous Lac was near half that of precursor glucose. 14 CO 2 production was thus in quantitative agreement with rates of pyruvate oxidation that were determined as glucose uptake minus (Pyr + Lac) release. In contrast, with 0.2 mM [1- 14 C]Pyr plus 5 mM glucose, the ratio of 14 CO 2 production to specific activity of Lac overestimated Pyr oxidation judged from myocardial substrate balances and O 2 uptake, respectively; here, at least three pools of [ 14 C]HCO-3 and [ 14 C]lac, respectively, were kinetically demonstrable during washout of trace amounts of 14 C-labeled Pyr. Evidently, the specific activity of Lac was equivalent to that of mitochondrial oxidized Pyr provided [ 14 C]glucose was the sole or major precursor of cellular pyruvate. However, exogenously applied [1- 14 C]Pyr of high specific activity seemed to induce intracellular formation of both a highly and lowly labeled Pyr; the latter Pyr compartment did not seem in ready equilibrium with the cell physiologically prevailing highly labeled Pyr pool
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Contralateral thalamic hypoperfusion on brain perfusion SPECT
International Nuclear Information System (INIS)
Lee, Seok Mo; Bae, Sang Kyun; Yoo, Kyung Moo; Yum, Ha Yong
2000-01-01
Brain perfusion single photon emission computed tomography (SPECT) is useful for the localization of cerebrovascular lesion and sometimes reveals more definite lesion than radiologic imaging modality such as CT or MRI does. The purpose of this study was to evaluate the diagnostic usefulness of brain perfusion SPECT in patients with hemisensory impairment. Thirteen consecutive patients (M:F= 8:5, mean age = 48) who has hemisensory impairment were included. Brain perfusion SPECT was performed after intravenous injection of 1110 MBq of Tc-99m ECD. The images were obtained using a dual-head gamma camera with ultra-high resolution collimator. Semiquantitative analysis was performed after placing multiple ROIs on cerebral cortex, basal ganglia, thalamus and cerebellum. There were 10 patients with left hemisensory impairment and 3 patients with right-sided symptom. Only 2 patients revealed abnormal signal change in the thalamus on MRI. But brain perfusion SPECT showed decreased perfusion in the thalamus in 9 patients. Six patients among 10 patients with left hemisensory impairment revealed decreased perfusion in the contralateral thalamus on brain SPECT. The other 4 patients revealed no abnormality. Two patients among 3 patients with right hemisensory impairment also showed decreased perfusion in the contralateral thalamus on brain SPECT. One patients with right hemisensory impairment showed ipsilateral perfusion decrease. Two patients who had follow-up brain perfusion SEPCT after treatment revealed normalization of perfusion in the thalamus. Brain perfusion SPECT might be a useful tool in diagnosing patients with hemisensory impairment
Magnetic resonance perfusion imaging without contrast media
International Nuclear Information System (INIS)
Martirosian, Petros; Graf, Hansjoerg; Schick, Fritz; Boss, Andreas; Schraml, Christina; Schwenzer, Nina F.; Claussen, Claus D.
2010-01-01
Principles of magnetic resonance imaging techniques providing perfusion-related contrast weighting without administration of contrast media are reported and analysed systematically. Especially common approaches to arterial spin labelling (ASL) perfusion imaging allowing quantitative assessment of specific perfusion rates are described in detail. The potential of ASL for perfusion imaging was tested in several types of tissue. After a systematic comparison of technical aspects of continuous and pulsed ASL techniques the standard kinetic model and tissue properties of influence to quantitative measurements of perfusion are reported. For the applications demonstrated in this paper a flow-sensitive alternating inversion recovery (FAIR) ASL perfusion preparation approach followed by true fast imaging with steady precession (true FISP) data recording was developed and implemented on whole-body scanners operating at 0.2, 1.5 and 3 T for quantitative perfusion measurement in various types of tissue. ASL imaging provides a non-invasive tool for assessment of tissue perfusion rates in vivo. Images recorded from kidney, lung, brain, salivary gland and thyroid gland provide a spatial resolution of a few millimetres and sufficient signal to noise ratio in perfusion maps after 2-5 min of examination time. Newly developed ASL techniques provide especially high image quality and quantitative perfusion maps in tissues with relatively high perfusion rates (as also present in many tumours). Averaging of acquisitions and image subtraction procedures are mandatory, leading to the necessity of synchronization of data recording to breathing in abdominal and thoracic organs. (orig.)
International Nuclear Information System (INIS)
Koyasu, Sho; Isoda, Hiroyoshi; Tsuji, Yoshihisa; Yamamoto, Hiroshi; Matsueda, Kazuhiro; Watanabe, Yuji; Chiba, Tsutomu; Togashi, Kaori
2012-01-01
Purpose: Although hepatic perfusion abnormalities have been reported in patients with acute pancreatitis, hepatic perfusion with severe acute pancreatitis (SAP) has not been quantitatively evaluated in humans. Therefore, we investigated hepatic perfusion in patients with SAP using perfusion CT. Materials and methods: Hepatic perfusion CT was performed in 67 patients with SAP within 3 days after symptom onset. The patients were diagnosed as having SAP according to the Atlanta criteria. Fifteen cases were established as a control group. Perfusion CT was obtained for 54 s beginning with a bolus injection of 40 ml of contrast agent (600–630 mgI/kg) at a flow rate of 4 ml/s. Perfusion data were analyzed by the dual-input maximum slope method to obtain hepatic arterial perfusion (HAP) and hepatic portal perfusion (HPP). Finally, we compared HAP and HPP in SAP patients with those in the control group, respectively. Results: Average HAP was significantly higher in SAP patients than in the control group (75.1 ± 38.0 vs. 38.2 ± 9.0 ml/min/100 ml; p < 0.001). There was no significant difference in average HPP between SAP patients and the control group (206.7 ± 54.9 vs. 204.4 ± 38.5 ml/min/100 ml; p = 0.92). Conclusion: Using quantitative analysis on perfusion CT, we first demonstrated an increase of HAP in the right hepatic lobe in SAP patients.
Improved visualization of delayed perfusion in lung MRI
International Nuclear Information System (INIS)
Risse, Frank; Eichinger, Monika; Kauczor, Hans-Ulrich; Semmler, Wolfhard; Puderbach, Michael
2011-01-01
Introduction: The investigation of pulmonary perfusion by three-dimensional (3D) dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) was proposed recently. Subtraction images are generated for clinical evaluation, but temporal information is lost and perfusion defects might therefore be masked in this process. The aim of this study is to demonstrate a simple analysis strategy and classification for 3D-DCE-MRI perfusion datasets in the lung without omitting the temporal information. Materials and methods: Pulmonary perfusion measurements were performed in patients with different lung diseases using a 1.5 T MR-scanner with a time-resolved 3D-GRE pulse sequence. 25 3D-volumes were acquired after iv-injection of 0.1 mmol/kg KG Gadolinium-DTPA. Three parameters were determined for each pixel: (1) peak enhancement S n,max normalized to the arterial input function to detect regions of reduced perfusion; (2) time between arterial peak enhancement in the large pulmonary artery and tissue peak enhancement τ to visualize regions with delayed bolus onset; and (3) ratio R = S n,max /τ was calculated to visualize impaired perfusion, irrespectively of whether related to reduced or delayed perfusion. Results: A manual selection of peak perfusion images is not required. Five different types of perfusion can be found: (1) normal perfusion; (2) delayed non-reduced perfusion; (3) reduced non-delayed perfusion; (4) reduced and delayed perfusion; and (5) no perfusion. Types II and IV could not be seen in subtraction images since the temporal information is necessary for this purpose. Conclusions: The analysis strategy in this study allows for a simple and observer-independent visualization and classification of impaired perfusion in dynamic contrast-enhanced pulmonary perfusion MRI by using the temporal information of the datasets.
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
Ventilation-perfused studies using SPECT
International Nuclear Information System (INIS)
Zwijnenburg, A.
1989-01-01
A method for the quantitative analysis of ventilation-perfusion SPECT studies is decribed and an effort is made to evaluate its usefullness. The technical details of the emthod are described. In the the transaxial reconstructions of the tomographic studies the contour of the lungs is detected and regional values of lung volume, ventilation, perfusion and ventilation-perfusion ratios are calculated. The method is operator independent. The lung volume calculations from the SPECT studies are validated by comparing them with lung volume measurements using the helium dilution technique. A good correlation (r=0.91) was found between the two volumes. SPECT volume was greater than the volume measured with helium dilution, which was attributed to non-gas-containing structures in the. lungs. The use of ventilation-perfusion ratio SPECT is described to evaluate the effect of ionizing radiation on the lungs in patients treated with mantle field irradiation for Hodgkin's disease. Perfusion changes appear as early as 2 months after the start of irradiation. Ventilation changes appear later and relatively minor. No changes are seen outside the radiation portals. The ventilation-perfusion inequality in pulmonary sarcoidosis is treated. It is suggested that the decrease D LCO in these patients may be partly due to an even distribution of ventilation perfusion ratios. An effort is made to establish the properties of a new tracer used for the assessment of the metabolic function of the pulmonary endothelium. The lung uptake of I-123 IMP mimics the distribution of a perfusion tracer and it is suggested that this tracer may be useful for the early detection of pulmonary vascular damage, even when blood flow is still intact. Some aspects of the use of Kr-81m as a ventilation tracer are discussed as well as the effect of noise on Kr-81m SPECT reconstructions. (author). 146 refs.; 39 figs.; 8 tabs
Automatic assessment of cardiac perfusion MRI
DEFF Research Database (Denmark)
Ólafsdóttir, Hildur; Stegmann, Mikkel Bille; Larsson, Henrik B.W.
2004-01-01
In this paper, a method based on Active Appearance Models (AAM) is applied for automatic registration of myocardial perfusion MRI. A semi-quantitative perfusion assessment of the registered image sequences is presented. This includes the formation of perfusion maps for three parameters; maximum up...
DEFF Research Database (Denmark)
Eckardt, Rozy; Kjeldsen, Bo Juel; Johansen, Allan
2012-01-01
OBJECTIVESWe wanted to evaluate whether preoperative myocardial perfusion scintigraphy (MPS) could predict changes in cardiac symptoms and postoperative myocardial perfusion and left ventricular function after coronary artery bypass grafting (CABG).METHODSNinety-two patients with stable angina...... in 26%. Left ventricular ejection fraction (LVEF), which was normal before operation in 45%, improved in 40% of all patients. The increase in LVEF was not related to the preoperative pattern of perfusion defects. Of 30 patients with normalized perfusion after CABG, 29 (97%) had reversible defects...... that reversible or partly reversible perfusion defects at a preoperative MPS have a high chance of normalized myocardial perfusion assessed by MPS 6 months after operation. Normal perfusion is obtained almost exclusively in territories with reversible ischaemia. Symptoms improved in nearly all patients and LVEF...
Nakano, Rei; Edamura, Kazuya; Sugiya, Hiroshi; Narita, Takanori; Okabayashi, Ken; Moritomo, Tadaaki; Teshima, Kenji; Asano, Kazushi; Nakayama, Tomohiro
2013-10-01
To investigate the in vitro differentiation of canine bone marrow stromal cells (BMSCs) into functional, mature neurons. Bone marrow from 6 adult dogs. BMSCs were isolated from bone marrow and chemically induced to develop into neurons. The morphology of the BMSCs during neuronal induction was monitored, and immunocytochemical analyses for neuron markers were performed after the induction. Real-time PCR methods were used to evaluate the mRNA expression levels of markers for neural stem or progenitor cells, neurons, and ion channels, and western blotting was used to assess the expression of neuronal proteins before and after neuronal induction. The electrophysiological properties of the neuron-like cells induced from canine BMSCs were evaluated with fluorescent dye to monitor Ca(2)+ influx. Canine BMSCs developed a neuron-like morphology after neuronal induction. Immunocytochemical analysis revealed that these neuron-like cells were positive for neuron markers. After induction, the cells' mRNA expression levels of almost all neuron and ion channel markers increased, and the protein expression levels of nestin and neurofilament-L increased significantly. However, the neuron-like cells derived from canine BMSCs did not have the Ca(2)+ influx characteristic of spiking neurons. Although canine BMSCs had neuron-like morphological and biochemical properties after induction, they did not develop the electrophysiological characteristics of neurons. Thus, these results have suggested that canine BMSCs could have the capacity to differentiate into a neuronal lineage, but the differentiation protocol used may have been insufficient to induce development into functional neurons.
Barashkov, V A; Gitel'zon, I I; Nefedov, V P; Trubachev, I N
1975-11-01
The dynamics of the medium amino acid composition was studied during a 6-hour perfusion of dog kidney and liver by a mixture of autogenic plasma and medium 199 (a ratio of 2 : 3). In comparison to the initial level the amount of histidine during 6-hour cultivation of the kidney was found to increase 2.2 times, that of glutamic acid--1.7 times, and of alanine and lysine--1.6 times. At the same time the amount of arginine, serine and asparagic acid became 3.3 times and of glutamine and threonine--2.5 times lower. With the liver perfusion the level of glutaminic acid became 2.9 times, of alanine--2.3 times, of cystine--2 times and of glycine--1.5 times higher. With the liver perfusion the level of arginine decreased so rapidly that none was found in the medium after a 2-hour perfusion. The described method of amino acid analysis during the cultivation of the organs could serve as means for elaborating and correcting the culture media.
Swenson, Julie; Orr, Kathryn; Bradley, Gregory A
2012-06-01
A 15-yr-old, female, maned wolf (Chrysocyon brachyurus) was euthanized after presenting semicomatose with severe, uncontrolled frank hemorrhage from her rectum 6 days following a routine physical examination and vaccination. Histopathology indicated severe hemorrhagic and necrotizing hepatitis with intranuclear basophilic inclusion bodies in the liver that were thought to be consistent with adenoviral infection. Further classification by polymerase chain reaction, immunohistochemical staining, virus isolation, and electron microscopy confirmed the etiologic agent to be canine adenovirus-2. A representative sample of the vaccine that had been used was submitted and sequenced along with the virus isolated from the maned wolf. The sequencing of the etiologic agent that had been isolated from the maned wolf was determined to be the same as the strain of virus used in the production of the modified live vaccine that had been administered 6 days prior to death. From this information, the diagnosis of vaccine-induced adenoviral hepatitis was made. This is the first confirmed case of vaccine-induced canine adenoviral hepatitis in a maned wolf.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
International Nuclear Information System (INIS)
St-Pierre, M.V.; Schwab, A.J.; Goresky, C.A.; Lee, W.F.; Pang, K.S.
1989-01-01
The technique of normal and retrograde rat liver perfusion has been widely used to probe zonal differences in drug-metabolizing activities. The validity of this approach mandates the same tissue spaces being accessed by substrates during both normal and retrograde perfusions. Using the multiple-indicator dilution technique, we presently examine the extent to which retrograde perfusion alters the spaces accessible to noneliminated references. A bolus dose of 51Cr-labeled red blood cells, 125I-albumin, 14C-sucrose and 3H2O was injected into the portal (normal) or hepatic (retrograde) vein of rat livers perfused at 10 ml per min per liver. The outflow perfusate was serially collected over 220 sec to characterize the transit times and the distribution spaces of the labels. During retrograde perfusion, red blood cells, albumin and sucrose profiles peaked later and lower than during normal perfusion, whereas the water curves were similar. The transit times of red blood cells, albumin and sucrose were longer (p less than 0.005), whereas those for water did not change. Consequently, retrograde flow resulted in significantly larger sinusoidal blood volumes (45%), albumin Disse space (42%) and sucrose Disse space (25%) than during normal flow, whereas the distribution spaces for total and intracellular water remained unaltered. The distension of the vascular tree was confirmed by electron microscopy, by which occasional isolated foci of widened intercellular recesses and spaces of Disse were observed. Cellular ultrastructure was otherwise unchanged, and there was no difference found between normal and retrograde perfusion for bile flow rates, AST release, perfusion pressure, oxygen consumption and metabolic removal of ethanol, a substrate with flow-limited distribution, which equilibrates rapidly with cell water (hepatic extraction ratios were virtually identical: normal vs. retrograde, 0.50 vs. 0.48 at 6 to 7.4 mM input concentration)
Ex-vivo machine perfusion for kidney preservation.
Hamar, Matyas; Selzner, Markus
2018-06-01
Machine perfusion is a novel strategy to decrease preservation injury, improve graft assessment, and increase organ acceptance for transplantation. This review summarizes the current advances in ex-vivo machine-based kidney preservation technologies over the last year. Ex-vivo perfusion technologies, such as hypothermic and normothermic machine perfusion and controlled oxygenated rewarming, have gained high interest in the field of organ preservation. Keeping kidney grafts functionally and metabolically active during the preservation period offers a unique chance for viability assessment, reconditioning, and organ repair. Normothermic ex-vivo kidney perfusion has been recently translated into clinical practice. Preclinical results suggest that prolonged warm perfusion appears superior than a brief end-ischemic reconditioning in terms of renal function and injury. An established standardized protocol for continuous warm perfusion is still not available for human grafts. Ex-vivo machine perfusion represents a superior organ preservation method over static cold storage. There is still an urgent need for the optimization of the perfusion fluid and machine technology and to identify the optimal indication in kidney transplantation. Recent research is focusing on graft assessment and therapeutic strategies.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Cyclooxygenase-2-dependent bronchoconstriction in perfused rat lungs exposed to endotoxin.
Uhlig, S.; Nüsing, R.; von Bethmann, A.; Featherstone, R. L.; Klein, T.; Brasch, F.; Müller, K. M.; Ullrich, V.; Wendel, A.
1996-01-01
BACKGROUND: Lipopolysaccharides (LPS), widely used to study the mechanisms of gram-negative sepsis, increase airway resistance by constriction of terminal bronchioles. The role of the cyclooxygenase (COX) isoenzymes and their prostanoid metabolites in this process was studied. MATERIALS AND METHODS: Pulmonary resistance, the release of thromboxane (TX) and the expression of COX-2 mRNA were measured in isolated blood-free perfused rat lungs exposed to LPS. RESULTS: LPS induced the release of T...
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.
Directory of Open Access Journals (Sweden)
Nicola Decaro
Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.
In vitro evaluation of three different biomaterials as scaffolds for canine mesenchymal stem cells
Directory of Open Access Journals (Sweden)
Oduvaldo Câmara Marques Pereira-Junior
2013-05-01
Full Text Available PURPOSE: To evaluate in vitro ability the of three different biomaterials - purified hydroxyapatite, demineralized bone matrix and castor oil-based polyurethane - as biocompatible 3D scaffolds for canine bone marrow mesenchymal stem cell (MSC intending bone tissue engineering. METHODS: MSCs were isolated from canine bone marrow, characterized and cultivated for seven days with the biomaterials. Cell proliferation and adhesion to the biomaterial surface were evaluated by scanning electron microscopy while differentiation into osteogenic lineage was evaluated by Alizarin Red staining and Sp7/Osterix surface antibody marker. RESULTS: The biomaterials allowed cellular growth, attachment and proliferation. Osteogenic differentiation occurred in the presence of hydroxyapatite, and matrix deposition commenced in the presence of the castor oil-based polyurethane. CONCLUSION: All the tested biomaterials may be used as mesenchymal stem cell scaffolds in cell-based orthopedic reconstructive therapy.
Aksentijević, Dunja; Zervou, Sevasti; Faller, Kiterie M. E.; McAndrew, Debra J.; Schneider, Jurgen E.; Neubauer, Stefan; Lygate, Craig A.
2014-01-01
Background Multiple studies suggest creatine mediates anti-oxidant activity in addition to its established role in cellular energy metabolism. The functional significance for the heart has yet to be established, but antioxidant activity could contribute to the cardioprotective effect of creatine in ischaemia/reperfusion injury. Objectives To determine whether intracellular creatine levels influence responses to acute reactive oxygen species (ROS) exposure in the intact beating heart. We hypothesised that mice with elevated creatine due to over-expression of the creatine transporter (CrT-OE) would be relatively protected, while mice with creatine-deficiency (GAMT KO) would fare worse. Methods and Results CrT-OE mice were pre-selected for creatine levels 20–100% above wild-type using in vivo 1H–MRS. Hearts were perfused in isovolumic Langendorff mode and cardiac function monitored throughout. After 20 min equilibration, hearts were perfused with either H2O2 0.5 µM (30 min), or the anti-neoplastic drug doxorubicin 15 µM (100 min). Protein carbonylation, creatine kinase isoenzyme activities and phospho-PKCδ expression were quantified in perfused hearts as markers of oxidative damage and apoptotic signalling. Wild-type hearts responded to ROS challenge with a profound decline in contractile function that was ameliorated by co-administration of catalase or dexrazoxane as positive controls. In contrast, the functional deterioration in CrT-OE and GAMT KO hearts was indistinguishable from wild-type controls, as was the extent of oxidative damage and apoptosis. Exogenous creatine supplementation also failed to protect hearts from doxorubicin-induced dysfunction. Conclusions Intracellular creatine levels do not influence the response to acute ROS challenge in the intact beating heart, arguing against creatine exerting (patho-)physiologically relevant anti-oxidant activity. PMID:25272153
Perfusion based cell culture chips
DEFF Research Database (Denmark)
Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin
2010-01-01
Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....
Brain Perfusion Changes in Intracerebral Hemorrhage
International Nuclear Information System (INIS)
Mititelu, R.; Mazilu, C.; Ghita, S.; Rimbu, A.; Marinescu, G.; Codorean, I.; Bajenaru, O.
2006-01-01
Full text: Purpose: Despite the latest advances in medical treatment and neuro critical care, patients suffering spontaneous intracerebral hemorrhage (SICH) still have a very poor prognosis, with a greater mortality and larger neurological deficits at the survivors than for ischemic stroke. Many authors have shown that there are many mechanisms involved in the pathology of SICH: edema, ischemia, inflammation, apoptosis. All of these factors are affecting brain tissue surrounding hematoma and are responsible of the progressive neurological deterioration; most of these damages are not revealed by anatomical imaging techniques. The aim of our study was to asses the role of brain perfusion SPECT in demonstrating perfusion changes in SICH patients. Method: 17 SICH pts were studied. All pts underwent same day CT and brain SPECT with 99mTcHMPAO, 24h-5d from onset of stroke. Results: 14/17 pts showed a larger perfusion defect than expected after CT. In 2 pts hematoma diameter was comparable on CT and SPECT; 1pt had quasinormal aspect of SPECT study. In pts with larger defects, SPECT revealed a large cold spot with similar size compared with CT, and a surrounding hypo perfused area. 6/17 pts revealed cortical hyper perfusion adjacent to hypo perfused area and corresponding to a normal-appearing brain tissue on CT. In 3 pts we found crossed cerebellar diaskisis.In 2 pts we found cortical hypo perfused area in the contralateral cortex, with normal appearing brain tissue on CT. Conclusions: Brain perfusion SPECT revealed different types of perfusion changes in the brain tissue surrounding hematoma. These areas contain viable brain tissue that may be a target for future ne uroprotective strategies. Further studies are definitely required to demonstrate prognostic significance of these changes, but we can conclude that brain perfusion SPECT can play an important role in SICH, by early demonstrating functional changes responsible of clinical deterioration, thus allowing prompt
Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David
2011-12-15
Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.
Developing a Benchmarking Process in Perfusion: A Report of the Perfusion Downunder Collaboration
Baker, Robert A.; Newland, Richard F.; Fenton, Carmel; McDonald, Michael; Willcox, Timothy W.; Merry, Alan F.
2012-01-01
Abstract: Improving and understanding clinical practice is an appropriate goal for the perfusion community. The Perfusion Downunder Collaboration has established a multi-center perfusion focused database aimed at achieving these goals through the development of quantitative quality indicators for clinical improvement through benchmarking. Data were collected using the Perfusion Downunder Collaboration database from procedures performed in eight Australian and New Zealand cardiac centers between March 2007 and February 2011. At the Perfusion Downunder Meeting in 2010, it was agreed by consensus, to report quality indicators (QI) for glucose level, arterial outlet temperature, and pCO2 management during cardiopulmonary bypass. The values chosen for each QI were: blood glucose ≥4 mmol/L and ≤10 mmol/L; arterial outlet temperature ≤37°C; and arterial blood gas pCO2 ≥ 35 and ≤45 mmHg. The QI data were used to derive benchmarks using the Achievable Benchmark of Care (ABC™) methodology to identify the incidence of QIs at the best performing centers. Five thousand four hundred and sixty-five procedures were evaluated to derive QI and benchmark data. The incidence of the blood glucose QI ranged from 37–96% of procedures, with a benchmark value of 90%. The arterial outlet temperature QI occurred in 16–98% of procedures with the benchmark of 94%; while the arterial pCO2 QI occurred in 21–91%, with the benchmark value of 80%. We have derived QIs and benchmark calculations for the management of several key aspects of cardiopulmonary bypass to provide a platform for improving the quality of perfusion practice. PMID:22730861
Genotyping and pathobiologic characterization of canine parvovirus circulating in Nanjing, China.
Zhao, Yanbing; Lin, Yan; Zeng, Xujian; Lu, Chengping; Hou, Jiafa
2013-08-29
Canine parvovirus (CPV) is an important pathogen that causes acute enteric disease in dogs. It has mutated and spread throughout the world in dog populations. We provide an update on the molecular characterization of CPV that circulated in Nanjing, a provincial capital in China between 2009 and 2012. Seventy rectal swab samples were collected from the dogs diagnosed with CPV infection in 8 animal hospitals of Nanjing. Sequence analysis of VP2 genes of 31 samples revealed that 29 viral strains belonged to CPV-2a subtype, while other two strains were classified into CPV-2b. To investigate the pathogenicity of the prevalent virus, we isolated CPV-2a and performed the animal experiment. Nine beagles were inoculated with 105.86 of 50% tissue culture infectious doses (TCID50) of the virus. All the experimentally infected beagles exhibited mild to moderate mucoid or watery diarrhea on day 4 post-infection (p.i.). On day 9 p.i., characteristic histopathological lesions were clearly observed in multiple organs of infected dogs, including liver, spleen, kidney, brain and all segments of the small and large intestines, while viral DNA and antigen staining could be detected in the sampled tissues. It is notable that canine parvovirus was isolated in one from two brain samples processed. Our results indicated that CPV-2a is the predominant subtype in Nanjing of China. And this virus caused extensive lesions in a variety of tissues, including the brain.
Non-contrast MRI perfusion angiosome in diabetic feet
Energy Technology Data Exchange (ETDEWEB)
Zheng, Jie [Cardiovascular Imaging Lab, Mallinckrodt Institute of Radiology, St. Louis, MO (United States); Hastings, Mary K.; Mueller, Michael J. [Washington University School of Medicine, The Program in Physical Therapy, St. Louis, MO (United States); Muccigross, David; Hildebolt, Charles F. [Washington University School of Medicine, Mallinckrodt Institute of Radiology, St. Louis, MO (United States); Fan, Zhaoyang [Cedars-Sinai Medical Center, Biomedical Imaging Research Institute, Los Angeles, CA (United States); Gao, Fabao [West China Hospital, Sichuan University, Department of Radiology, Chengdu (China); Curci, John [Washington University School of Medicine, The Department of Surgery, St. Louis, MO (United States)
2015-01-15
The purpose of this study is to develop a non-contrast magnetic resonance imaging (MRI) approach to evaluate skeletal muscle perfusion in the diabetic foot based on the concept of angiosomes of the foot. Five healthy volunteers and five participants with diabetes (HbA1c = 7.2 ± 1.8 %) without a history of peripheral artery disease were examined. The non-contrast perfusion measurements were performed during a toe flexion challenge. Absolute perfusion maps were created and two regions (medial and lateral) on the maps were segmented based on angiosomes. Regional difference in the perfusion of foot muscle was readily visualized in the MRI perfusion angiosomes during the challenge. In the participants with diabetes, the perfusion during toe flexion challenge was significantly lower than in healthy volunteers (P < 0.01). The average perfusion for the medial plantar region of the right foot was lower in subjects with diabetes (38 ± 9 ml/min/100 g) than in healthy subjects (93 ± 33 ml/min/100 g). Non-contrast MRI perfusion angiosome maps demonstrate the feasibility of determining regional perfusion in foot muscles during toe challenge and may facilitate evaluation of muscle perfusion in diabetic feet. (orig.)
Non-contrast MRI perfusion angiosome in diabetic feet
International Nuclear Information System (INIS)
Zheng, Jie; Hastings, Mary K.; Mueller, Michael J.; Muccigross, David; Hildebolt, Charles F.; Fan, Zhaoyang; Gao, Fabao; Curci, John
2015-01-01
The purpose of this study is to develop a non-contrast magnetic resonance imaging (MRI) approach to evaluate skeletal muscle perfusion in the diabetic foot based on the concept of angiosomes of the foot. Five healthy volunteers and five participants with diabetes (HbA1c = 7.2 ± 1.8 %) without a history of peripheral artery disease were examined. The non-contrast perfusion measurements were performed during a toe flexion challenge. Absolute perfusion maps were created and two regions (medial and lateral) on the maps were segmented based on angiosomes. Regional difference in the perfusion of foot muscle was readily visualized in the MRI perfusion angiosomes during the challenge. In the participants with diabetes, the perfusion during toe flexion challenge was significantly lower than in healthy volunteers (P < 0.01). The average perfusion for the medial plantar region of the right foot was lower in subjects with diabetes (38 ± 9 ml/min/100 g) than in healthy subjects (93 ± 33 ml/min/100 g). Non-contrast MRI perfusion angiosome maps demonstrate the feasibility of determining regional perfusion in foot muscles during toe challenge and may facilitate evaluation of muscle perfusion in diabetic feet. (orig.)
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Dual-energy perfusion-CT of pancreatic adenocarcinoma
International Nuclear Information System (INIS)
Klauß, M.; Stiller, W.; Pahn, G.; Fritz, F.; Kieser, M.; Werner, J.; Kauczor, H.U.; Grenacher, L.
2013-01-01
Purpose: To evaluate the feasibility of dual-energy CT (DECT)-perfusion of pancreatic carcinomas for assessing the differences in perfusion, permeability and blood volume of healthy pancreatic tissue and histopathologically confirmed solid pancreatic carcinoma. Materials and methods: 24 patients with histologically proven pancreatic carcinoma were examined prospectively with a 64-slice dual source CT using a dynamic sequence of 34 dual-energy (DE) acquisitions every 1.5 s (80 ml of iodinated contrast material, 370 mg/ml, flow rate 5 ml/s). 80 kV p , 140 kV p , and weighted average (linearly blended M0.3) 120 kV p -equivalent dual-energy perfusion image data sets were evaluated with a body-perfusion CT tool (Body-PCT, Siemens Medical Solutions, Erlangen, Germany) for estimating perfusion, permeability, and blood volume values. Color-coded parameter maps were generated. Results: In all 24 patients dual-energy CT-perfusion was. All carcinomas could be identified in the color-coded perfusion maps. Calculated perfusion, permeability and blood volume values were significantly lower in pancreatic carcinomas compared to healthy pancreatic tissue. Weighted average 120 kV p -equivalent perfusion-, permeability- and blood volume-values determined from DE image data were 0.27 ± 0.04 min −1 vs. 0.91 ± 0.04 min −1 (p −1 vs. 0.67 ± 0.05 *0.5 min −1 (p = 0.06) and 0.49 ± 0.07 min −1 vs. 1.28 ± 0.11 min −1 (p p the standard deviations of the kV p 120 kV p -equivalent values were manifestly smaller. Conclusion: Dual-energy CT-perfusion of the pancreas is feasible. The use of DECT improves the accuracy of CT-perfusion of the pancreas by fully exploiting the advantages of enhanced iodine contrast at 80 kV p in combination with the noise reduction at 140 kV p . Therefore using dual-energy perfusion data could improve the delineation of pancreatic carcinomas
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
TU-EF-204-02: Hiigh Quality and Sub-MSv Cerebral CT Perfusion Imaging
International Nuclear Information System (INIS)
Li, Ke; Niu, Kai; Wu, Yijing; Chen, Guang-Hong
2015-01-01
Purpose: CT Perfusion (CTP) imaging is of great importance in acute ischemic stroke management due to its potential to detect hypoperfused yet salvageable tissue and distinguish it from definitely unsalvageable tissue. However, current CTP imaging suffers from poor image quality and high radiation dose (up to 5 mSv). The purpose of this work was to demonstrate that technical innovations such as Prior Image Constrained Compressed Sensing (PICCS) have the potential to address these challenges and achieve high quality and sub-mSv CTP imaging. Methods: (1) A spatial-temporal 4D cascaded system model was developed to indentify the bottlenecks in the current CTP technology; (2) A task-based framework was developed to optimize the CTP system parameters; (3) Guided by (1) and (2), PICCS was customized for the reconstruction of CTP source images. Digital anthropomorphic perfusion phantoms, animal studies, and preliminary human subject studies were used to validate and evaluate the potentials of using these innovations to advance the CTP technology. Results: The 4D cascaded model was validated in both phantom and canine stroke models. Based upon this cascaded model, it has been discovered that, as long as the spatial resolution and noise properties of the 4D source CT images are given, the 3D MTF and NPS of the final CTP maps can be analytically derived for a given set of processing methods and parameters. The cascaded model analysis also identified that the most critical technical factor in CTP is how to acquire and reconstruct high quality source images; it has very little to do with the denoising techniques often used after parametric perfusion calculations. This explained why PICCS resulted in a five-fold dose reduction or substantial improvement in image quality. Conclusion: Technical innovations generated promising results towards achieving high quality and sub-mSv CTP imaging for reliable and safe assessment of acute ischemic strokes. K. Li, K. Niu, Y. Wu: Nothing to
TU-EF-204-02: Hiigh Quality and Sub-MSv Cerebral CT Perfusion Imaging
Energy Technology Data Exchange (ETDEWEB)
Li, Ke; Niu, Kai; Wu, Yijing; Chen, Guang-Hong [University of Wisconsin, Madison, WI (United States)
2015-06-15
Purpose: CT Perfusion (CTP) imaging is of great importance in acute ischemic stroke management due to its potential to detect hypoperfused yet salvageable tissue and distinguish it from definitely unsalvageable tissue. However, current CTP imaging suffers from poor image quality and high radiation dose (up to 5 mSv). The purpose of this work was to demonstrate that technical innovations such as Prior Image Constrained Compressed Sensing (PICCS) have the potential to address these challenges and achieve high quality and sub-mSv CTP imaging. Methods: (1) A spatial-temporal 4D cascaded system model was developed to indentify the bottlenecks in the current CTP technology; (2) A task-based framework was developed to optimize the CTP system parameters; (3) Guided by (1) and (2), PICCS was customized for the reconstruction of CTP source images. Digital anthropomorphic perfusion phantoms, animal studies, and preliminary human subject studies were used to validate and evaluate the potentials of using these innovations to advance the CTP technology. Results: The 4D cascaded model was validated in both phantom and canine stroke models. Based upon this cascaded model, it has been discovered that, as long as the spatial resolution and noise properties of the 4D source CT images are given, the 3D MTF and NPS of the final CTP maps can be analytically derived for a given set of processing methods and parameters. The cascaded model analysis also identified that the most critical technical factor in CTP is how to acquire and reconstruct high quality source images; it has very little to do with the denoising techniques often used after parametric perfusion calculations. This explained why PICCS resulted in a five-fold dose reduction or substantial improvement in image quality. Conclusion: Technical innovations generated promising results towards achieving high quality and sub-mSv CTP imaging for reliable and safe assessment of acute ischemic strokes. K. Li, K. Niu, Y. Wu: Nothing to
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.
Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S
2016-04-01
In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.
Saint-Cyr, Michel; Lakhiani, Chrisovalantis; Cheng, Angela; Mangum, Michael; Liang, Jinyang; Teotia, Sumeet; Livingston, Edward H.; Zuzak, Karel J.
2013-03-01
The selection of well-vascularized tissue during DIEP flap harvest remains controversial. While several studies have elucidated cross-midline perfusion, further characterization of perfusion to the ipsilateral hemiabdomen is necessary for minimizing rates of fat necrosis or partial fat necrosis in bilateral DIEP flaps. Eighteen patients (29 flaps) underwent DIEP flap harvest using a prospectively designed protocol. Perforators were marked and imaged with a novel system for quantitatively measuring tissue oxygenation, the Digital Light Hyperspectral Imager. Images were then analyzed to determine if perforator selection influenced ipsilateral flap perfusion. Flaps based on a single lateral row perforator (SLRP) were found to have a higher level of hemoglobin oxygenation in Zone I (mean %HbO2 = 76.1) compared to single medial row perforator (SMRP) flaps (%HbO2 = 71.6). Perfusion of Zone III relative to Zone I was similar between SLRP and SMRP flaps (97.4% vs. 97.9%, respectively). These differences were not statistically significant (p>0.05). Perfusion to the lateral edge of the flap was slightly greater for SLRP flaps compared SMRP flaps (92.1% vs. 89.5%, respectively). SMRP flaps had superior perfusion travelling inferiorly compared to SLRP flaps (88.8% vs. 83.9%, respectively). Overall, it was observed that flaps were better perfused in the lateral direction than inferiorly. Significant differences in perfusion gradients directed inferiorly or laterally were observed, and perforator selection influenced perfusion in the most distal or inferior aspects of the flap. This suggests broader clinical implications for flap design that merit further investigation.
2013-01-01
Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727
DEFF Research Database (Denmark)
Minarik, David; Senneby, Martin; Wollmer, Per
2015-01-01
Background The interpretation of myocardial perfusion scintigraphy (MPS) largely relies on visual assessment by the physician of the localization and extent of a perfusion defect. The aim of this study was to introduce the concept of the perfusion vector as a new objective quantitative method...
Placental perfusion - a human alternative
DEFF Research Database (Denmark)
Mose, Tina; Knudsen, Lisbeth E
2006-01-01
Foetal exposures to environmental and medicinal products have impact on the growth of the foetus (e.g. cigarette smoke) and development of organs (e.g. methylmercury and Thalidomide). Perfusion studies of the human term placenta enable investigation of placental transport of chemical substances...... between the mother and foetus. Dual perfusion of a single cotyledon in the human placenta can contribute to a better understanding of the placental barrier, transport rate and mechanisms of different substances and placental metabolism. The perfusion system has recently been established in Copenhagen...
Diuwe, Piotr; Domagala, Piotr; Durlik, Magdalena; Trzebicki, Janusz; Chmura, Andrzej; Kwiatkowski, Artur
2017-08-01
One of the most important problems in transplantation medicine is the ischemia/reperfusion injury of the organs to be transplanted. The aim of the present study was to assess the effect of tumor necrosis factor-alpha (TNF-alpha) inhibitor etanercept on the machine perfusion hypothermia of renal allograft kidney function and organ perfusion. No statistically significant differences were found in the impact of the applied intervention on kidney machine perfusion during which the average flow and vascular resistance were evaluated. There were no statistically significant differences in the occurrence of delayed graft function (DGF). Fewer events in patients who received a kidney from the etanercept treated Group A compared to the patients who received a kidney from the control Group B were observed when comparing the functional DGF and occurrence of acute rejection episodes, however, there was no statistically significant difference. In summary, no effect of treatment with etanercept an inhibitor of TNF-alpha in a hypothermic machine perfusion on renal allograft renal survival and its perfusion were detected in this study. However, treatment of the isolated organ may be important for the future of transplantation medicine. Copyright © 2017 Elsevier Inc. All rights reserved.
van der Plaats, A.; Maathuis, M. H. J.; Hart, N. A. 't; Bellekom, A. A.; Hofker, H. S.; van der Houwen, E. B.; Verkerke, G. J.; Leuvenink, H. G. D.; Verdonck, P.; Ploeg, R. J.; Rakhorst, G.
2006-01-01
To improve preservation of donor livers, we have developed a portable hypothermic machine perfusion (HMP) system as an alternative for static cold storage. A prototype of the system was built and evaluated on functionality. Evaluation criteria included 24 h of adequate pressure controlled perfusion,
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Metabolism in the isolated rat heart: comparison of 125I-BMIPP with 125I-IPPA
International Nuclear Information System (INIS)
Chen Shaoliang; Cheng Aiping; Xu Lanwen; Qiao Weiwei
2008-01-01
Objective: The fatty acid metabolism in myocardium is recently one of the most interesting subjects in nuclear cardiology. The purpose of this study was to clarify the metabolic fate of 125 I-labeled 15-(p-iodophenyl)-3-(R, S)-methyl-pentadecanoic acid ( 125 I-BMIPP) and 15-(p-[ 125 I] iodophenyl) pentadecanoic acid ( 125 I-IPPA) by means of isolated rat hearts. Methods: Ten isolated rat hearts were prepared and perfused with 125 I-BMIPP (5 rats) or 125 I-IPPA (5 rats) for 3 h following a basic perfusion of 30 min. After perfusion, the radioactivity in the recirculated buffer was measured. The metabolites in the buffer were then extracted and analyzed using high performance liquid chromatography (HPLC) and thin-layer chromatography (TLC). Results: At the beginning (5 rain) of 125 I-BMIPP perfusion, the main radioactive peak appeared on HPLC at 37 min, which remained after 3 h perfusion. Several small peaks eluting were found before the parent peak at 30, 26, 21, 16, 12 and 9 min, respectively. At the beginning (5 min) of 125 I-IPPA perfusion, the main peak appeared on HPLC at 33 min, which disappeared after 3 h. Conclusions: 125 I-BMIPP strongly inhibited beta-oxidation, therefore appeared suitable for myocardial metabolic imaging. 125 I-IPPA was metabolized rapidly. (authors)
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Directory of Open Access Journals (Sweden)
Lucy J Holcombe
Full Text Available Periodontal disease (PD is a significant problem in dogs affecting between 44% and 63.6% of the population. The main etiological agent for PD is plaque, a microbial biofilm that colonizes teeth and causes inflammation of the gingiva. Understanding how this biofilm initiates on the tooth surface is of central importance in developing interventions against PD. Although the stages of plaque development on human teeth have been well characterized little is known about how canine plaque develops. Recent studies of the canine oral microbiome have revealed distinct differences between the canine and human oral environments and the bacterial communities they support, particularly with respect to healthy plaque. These differences mean knowledge about the nature of plaque formation in humans may not be directly translatable to dogs. The aim of this study was to identify the bacterial species important in the early stages of canine plaque formation in vivo and then use isolates of these species in a laboratory biofilm model to develop an understanding of the sequential processes which take place during the initial colonization of enamel. Supra-gingival plaque samples were collected from 12 dogs at 24 and 48 hour time points following a full mouth descale and polish. Pyrosequencing of the 16S rDNA identified 134 operational taxonomic units after statistical analysis. The species with the highest relative abundance were Bergeyella zoohelcum, Neisseria shayeganii and a Moraxella species. Streptococcal species, which tend to dominate early human plaque biofilms, had very low relative abundance. In vitro testing of biofilm formation identified five primary colonizer species, three of which belonged to the genus Neisseria. Using these pioneer bacteria as a starting point, viable two and three species communities were developed. Combining in vivo and in vitro data has led us to construct novel models of how the early canine plaque biofilm develops.
Vicarious audiovisual learning in perfusion education.
Rath, Thomas E; Holt, David W
2010-12-01
Perfusion technology is a mechanical and visual science traditionally taught with didactic instruction combined with clinical experience. It is difficult to provide perfusion students the opportunity to experience difficult clinical situations, set up complex perfusion equipment, or observe corrective measures taken during catastrophic events because of patient safety concerns. Although high fidelity simulators offer exciting opportunities for future perfusion training, we explore the use of a less costly low fidelity form of simulation instruction, vicarious audiovisual learning. Two low fidelity modes of instruction; description with text and a vicarious, first person audiovisual production depicting the same content were compared. Students (n = 37) sampled from five North American perfusion schools were prospectively randomized to one of two online learning modules, text or video.These modules described the setup and operation of the MAQUET ROTAFLOW stand-alone centrifugal console and pump. Using a 10 question multiple-choice test, students were assessed immediately after viewing the module (test #1) and then again 2 weeks later (test #2) to determine cognition and recall of the module content. In addition, students completed a questionnaire assessing the learning preferences of today's perfusion student. Mean test scores from test #1 for video learners (n = 18) were significantly higher (88.89%) than for text learners (n = 19) (74.74%), (p audiovisual learning modules may be an efficacious, low cost means of delivering perfusion training on subjects such as equipment setup and operation. Video learning appears to improve cognition and retention of learned content and may play an important role in how we teach perfusion in the future, as simulation technology becomes more prevalent.
Energy Technology Data Exchange (ETDEWEB)
Dowdle, S.C.; Human, D.G.; Mann, M.D. (Univ. of Cape Town (South Africa))
1990-08-01
Xenon-133 lung ventilation and perfusion scans were done preoperatively after cardiac catheterization and cineangiocardiography in 19 children; 6 had pulmonary atresia with an intact ventricular septum and hypoplastic right ventricle, 4 pulmonary atresia with associated complex univentricular heart, and 9 extreme Tetralogy of Fallot. The four patients with discrepancies in the sizes of the left and right pulmonary arteries on angiography had marked asymmetry of pulmonary perfusion and ventilation-perfusion imbalance on scintigraphy. Similar degrees of asymmetry and imbalance were present in 6 of the 15 children with equal-size pulmonary vessels. Asymmetry of pulmonary perfusion and ventilation-perfusion imbalance were associated with a poor prognosis.
International Nuclear Information System (INIS)
Dowdle, S.C.; Human, D.G.; Mann, M.D.
1990-01-01
Xenon-133 lung ventilation and perfusion scans were done preoperatively after cardiac catheterization and cineangiocardiography in 19 children; 6 had pulmonary atresia with an intact ventricular septum and hypoplastic right ventricle, 4 pulmonary atresia with associated complex univentricular heart, and 9 extreme Tetralogy of Fallot. The four patients with discrepancies in the sizes of the left and right pulmonary arteries on angiography had marked asymmetry of pulmonary perfusion and ventilation-perfusion imbalance on scintigraphy. Similar degrees of asymmetry and imbalance were present in 6 of the 15 children with equal-size pulmonary vessels. Asymmetry of pulmonary perfusion and ventilation-perfusion imbalance were associated with a poor prognosis
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
Distribution of coronary arterial capacitance in a canine model.
Lader, A S; Smith, R S; Phillips, G C; McNamee, J E; Abel, F L
1998-03-01
The capacitative properties of the major left coronary arteries, left main (LM), left anterior descending (LAD), and left circumflex (LCX), were studied in 19 open-chest isolated dog hearts. Capacitance was determined by using ramp perfusion and a left ventricular-to-coronary shunt diastolic decay method; both methods gave similar results, indicating a minimal systolic capacitative component. Increased pericardial pressure (PCP), 25 mmHg, was used to experimentally alter transmural wall pressure. The response to increased PCP was different in the LAD vs. LCX; increasing PCP decreased capacitance in the LCX but increased capacitance in the LAD. This may have been due to the different intramural vs. epicardial volume distribution of these vessels and a decrease in intramural tension during increased PCP. Increased PCP decreased LCX capacitance by approximately 13%, but no changes in conductance or zero flow pressure intercept occurred in any of the three vessels, i. e., evidence against the waterfall theory of vascular collapse at these levels of PCP. Coronary arterial capacitance was also linearly related to perfusion pressure.
Canine Distemper Virus in Wild Felids of Costa Rica.
Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea
2016-04-28
Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Clinical application of cerebral dynamic perfusion studies
International Nuclear Information System (INIS)
DeLand, F.H.
1975-01-01
Radionuclide cerebral perfusion studies are assuming a far greater importance in the detection and differential diagnosis of cerebral lesions. Perfusion studies not only contribute to the differential diagnosis of lesions but in certain cases are the preferred methods by which more accurate clinical interpretations can be made. The characteristic blood flow of arterio-venous malformations readily differentiates this lesion from neoplasms. The decreased perfusion or absent perfusion observed in cerebral infarctions is diagnostic without concurrent evidence from static images. Changes in rates and direction of blood flow contribute fundamental information to the status of stenosis and vascular occlusion and, in addition, offer valuable information on the competency and routes of collateral circulation. The degree of cerebral perfusion after cerebral vascular accidents appears to be directly related to patient recovery, particularly muscular function. Cerebral perfusion adds a new parameter in the diagnosis of subdural haematomas and concussion and in the differentiation of obscuring radioactivity from superficial trauma. Although pictorial displays of perfusion blood flow will offer information in most cerebral vascular problems, the addition of computer analysis better defines temporal relationships of regional blood flow, quantitative changes in flow and the detection of the more subtle increases or decreases in cerebral blood flow. The status of radionuclide cerebral perfusion studies has taken on an importance making it the primary modality for the diagnosis of cerebral lesions. (author)
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells.
Rici, Rose Eli Grassi; Alcântara, Dayane; Fratini, Paula; Wenceslau, Cristiane Valverde; Ambrósio, Carlos Eduardo; Miglino, Maria Angelica; Maria, Durvanei Augusto
2012-02-22
The bone morphogenetic proteins (BMPs) belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs) and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST) cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs) and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP) stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p53. We propose that rhBMP-2 has great
Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11
International Nuclear Information System (INIS)
Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma
2010-01-01
Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Meyer, David B; Jacobs, Jeffrey P; Hill, Kevin; Wallace, Amelia S; Bateson, Brian; Jacobs, Marshall L
2016-09-01
Regional cerebral perfusion (RCP) is used as an adjunct or alternative to deep hypothermic circulatory arrest (DHCA) for neonates and infants undergoing aortic arch repair. Clinical studies have not demonstrated clear superiority of either strategy, and multicenter data regarding current use of these strategies are lacking. We sought to describe the variability in contemporary practice patterns for use of these techniques. The Society of Thoracic Surgeons Congenital Heart Surgery Database (2010-2013) was queried to identify neonates and infants whose index operation involved aortic arch repair with cardiopulmonary bypass. Perfusion strategy was classified as isolated DHCA, RCP (with less than or equal to ten minutes of DHCA), or mixed (RCP with more than ten minutes of DHCA). Data were analyzed for the entire cohort and stratified by operation subgroups. Overall, 4,523 patients (105 centers) were identified; median age seven days (interquartile range: 5.0-13.0). The most prevalent perfusion strategy was RCP (43%). Deep hypothermic circulatory arrest and mixed perfusion accounted for 32% and 16% of cases, respectively. In all, 59% of operations involved some period of RCP. Regional cerebral perfusion was the most prevalent perfusion strategy for each operation subgroup. Neither age nor weight was associated with perfusion strategy, but reoperations were less likely to use RCP (31% vs 45%, P RCP and DHCA in the RCP group was longer than the DHCA time in the DHCA group (45 vs 36 minutes, P neonates and infants. In contemporary practice, RCP is the most prevalent perfusion strategy for these procedures. Use of DHCA is also common. Further investigation is warranted to ascertain possible relative merits of the various perfusion techniques. © The Author(s) 2016.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Energy Technology Data Exchange (ETDEWEB)
Kaemena, Andreas [Department of Radiology, Charite-Medical University Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany)], E-mail: andreas.kaemena@charite.de; Streitparth, Florian; Grieser, Christian; Lehmkuhl, Lukas [Department of Radiology, Charite-Medical University Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany); Jamil, Basil [Department of Radiotherapy, Charite-Medical University Berlin, Schumannstr. 20/21, D-10117 Berlin (Germany); Wojtal, Katarzyna; Ricke, Jens; Pech, Maciej [Department of Radiology, Charite-Medical University Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany)
2007-10-15
Purpose: To assess the influence of different temporal sampling rates on the accuracy of the results from cerebral perfusion CTs in patients with an acute ischemic stroke. Material and methods: Thirty consecutive patients with acute stroke symptoms received a dynamic perfusion CT (LightSpeed 16, GE). Forty millilitres of iomeprol (Imeron 400) were administered at an injection rate of 4 ml/s. After a scan delay of 7 s, two adjacent 10 mm slices at 80 kV and 190 mA were acquired in a cine mode technique with a cine duration of 49 s. Parametric maps for the blood flow (BF), blood volume (BV) and mean transit time (MTT) were calculated for temporal sampling intervals of 0.5, 1, 2, 3 and 4 s using GE's Perfusion 3 software package. In addition to the quantitative ROI data analysis, a visual perfusion map analysis was performed. Results: The perfusion analysis proved to be technically feasible with all patients. The calculated perfusion values revealed significant differences with regard to the BF, BV and MTT, depending on the employed temporal resolution. The perfusion contrast between ischemic lesions and healthy brain tissue decreased continuously at the lower temporal resolutions. The visual analysis revealed that ischemic lesions were best depicted with sampling intervals of 0.5 and 1 s. Conclusion: We recommend a temporal scan resolution of two images per second for the best detection and depiction of ischemic areas.
da Costa, Andréa Pereira; Costa, Francisco Borges; Soares, Herbert Sousa; Ramirez, Diego Garcia; de Carvalho Araújo, Andreina; da Silva Ferreira, Juliana Isabel Giuli; Tonhosolo, Renata; Dias, Ricardo Augusto; Gennari, Solange Maria; Marcili, Arlei
2015-12-01
Environment influences the composition, distribution, and behavior of the vectors and mammalian hosts involved in the transmission of visceral leishmaniasis (VL), affecting the epidemiology of the disease. In Brazil, the urbanization process and canine cases of VL are indicators for local health authorities. This study aimed to investigate the occurrence of the canine visceral leishmaniasis (CVL) in Maranhão State, Brazil. Blood samples collected from 960 dogs from six municipalities and six different ecosystems (Baixada Maranhense, Mangue, Mata dos Cocais, Amazônia, Cerrado, and Restinga) to serological tests (enzyme-linked immunosorbent assay [ELISA], indirect fluorescence antibody test [IFAT], and chromatographic immunoassay methods [Dual Path Platform technology, DPP(®)]) and parasitological diagnosis. From serological tests, 11.14% (107) of the dogs were positive for CVL, with 59.16% (568), 14.5% (148), and 131% (126) positives to ELISA, DPP, and IFAT tests, respectively. Only seven animals (0.73%) were positive in a parasitological test. We also performed parasite isolation and phylogenetic characterization. All isolates of dogs obtained from Maranhão were grouped in a single branch with Leishmania infantum chagasi from Brazil. The ecosystem Amazonia presented the highest positivity rates to CVL in serological and parasitological tests. Brazilian biomes/ecosystems suffer large degradation and may favor, depending on climatic conditions, the installation of new diseases. In the case of VL, dogs are reservoirs of parasites and sentinels for human infection.
Inhibition of gluconeogenesis in the perfusing liver of irradiated rats
International Nuclear Information System (INIS)
Borovikova, G.V.; Dokshina, G.A.; Ermakova, G.N.; Mashkova, N.Yu.
1981-01-01
It was shown on the perfusing liver taken from rats on the 1st and 3d days after irradiation in a dose of 18.06x10 -2 C/kg that insulin (400 μunits/ml) and taurine (40 mg%) exerted an inhibiting action on the rate of gluconeogenesi.s and transamination, catalyzed by alanine aminoferase and aspartate aminoferase, in a soluble fraction of the irradiated rat liver. The gluconeogenic capacity and the reactivity of the isolated organ were shown to decrease on the 3d day after irradiation [ru
Directory of Open Access Journals (Sweden)
Yutaka Matsumoto, Nozomi Gotoh, Shoko Sano, Kenkichi Sugiyama, Tatsuhiko Ito, Yohei Abe, Yumi Katano, Akira Ishihata
2014-07-01
Full Text Available Objective: Piceatannol, a polyphenol which is contained in passion fruits seed, is a derivative of resveratrol and is known to have antioxidant, anti-inflammatory and vasorelaxing activities. Passion fruits seed also contains a dimer of Piceatannol, Scirpusin B. The aim of this study was to investigate the effect of Scirpusin B on the coronary circulation of the isolated rat heart. Methods: Hearts were isolated from male Fischer 344 rats (5 – 6 months old, and perfused with modified Krebs-Henseleit solution aerated with 95% O2 and 5% CO2 (37 °C at constant pressure (75 cmH2O by Langendorff’s method. Piceatannol or Scirpusin B (10, 30 and 100 μM was injected as a bolus into the aortic cannula and coronary flow (CF was continuously measured by the electromagnetic flow meter. In some experiments, rat hearts were pretreated with L-NAME (an inhibitor of nitric oxide synthase or Diclofenac (an inhibitor of cyclooxygenase to reveal the possible involvement of nitric oxide (NO and vasodilating prostanoids in the effect of Scirpusin B. Results: Scirpusin B increased CF up to 108.2 % of the initial value, while Piceatannol did not increase CF. In addition; Scirpusin B increased CF concentration-dependently. Pretreatment with L-NAME or Diclofenac significantly attenuated the Scirpusin B-induced coronary vasodilatation. Scirpusin B did not change the heart rate either left ventricular pressure. Conclusion: This study shows that Scirpusin B could increase CF via production of NO and vasodilating prostanoids.
Characteristics of Brain Perfusion in Patients of Parkinson's Disease
International Nuclear Information System (INIS)
Jeong, Young Jin; Park, Min Jung; Kim, Jae Woo; Kang, Young Kang
2008-01-01
It was well known that cerebral blood perfusion is normal or diffusely decreased in the majority of patients with Parkinson's disease (PD). Actually we interpreted brain perfusion SPECT images of PD patients in the clinical situation, we observed various cerebral perfusion patterns in patients with PD. So we performed brain perfusion SPECT to know the brain perfusion patterns of PD patients and the difference of perfusion patterns according to the sex and the age. Also we classified PD patients into small groups based on the brain perfusion pattern. Two hundred nineteen patients (M: 70, F: 149, mean age: 62.9±6.9 y/o) who were diagnosed as PD without dementia clinically and 55 patients (M: 15, F: 40, mean age: 61.4±9.2 y/o) as normal controls who had no past illness history were performed 99m Tc-HMPAO brain perfusion SPECT and neuropsychological test. At first, we compared all patients with PD and normal controls. Brain perfusion in left inferior frontal gyrus, left insula, left transverse temporal gyrus, left inferior parietal lobule, left superior parietal lobule, right precuneus, right caudate tail were lower in patients with PD than normal controls. Secondly, we compared male and female patients with PD and normal controls, respectively. Brain perfusion SPECT showed more decreased cerebral perfusion in left hemisphere than right side in both male and female patients compared to normal controls. And there was larger hypoperfusion area in female patients compared with male. Thirdly, we classified patients with PD and normal controls into 4 groups according to the age and compared brain perfusion respectively. In patient below fifties, brain perfusion in both occipitoparietal and left temporal lobe were lower in PD group. As the patients with PD grew older, hypoperfusion area were shown in both frontal, temporal and limbic lobes. Fourthly, We were able to divide patients into small groups based on cerebral perfusion pattern. There was normal cerebral blood
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas
Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin
2017-01-01
In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenu...
Regional Cerebral Perfusion in Progressive Supranuclear Palsy
Energy Technology Data Exchange (ETDEWEB)
Lee, Won Yong; Lee, Ki Hyeong; Yoon, Byung Woo; Lee, Sang Bok; Jeon, Beom S. [Samsung Medical Center, Seoul (Korea, Republic of); Lee, Kyung Han; Lee, Myung Chul [Seoul National University College of Medicine, Seoul (Korea, Republic of)
1996-03-15
Progressive supranuclear palsy (PSP) is a Parkinson-plus syndrome characterized clinically by supranuclear ophthalmoplegia, pseudobulbar palsy, axial rigidity, bradykinesia, postural instability and dementia. Presence of dementia and lack of cortical histopathology suggest the derangement of cortical function by pathological changes in subcortical structures in PSP, which is supported by the pattern of behavioral changes and measurement of brain metabolism using positron emission tomography. This study was done to examine whether there are specific changes of regional cerebral perfusion in PSP and whether there is a correlation between severity of motor abnormaility and degree of changes in cerebral perfusion. We measured regional cerebral perfusion indices in 5 cortical and 2 subcortical areas in 6 patients with a clinical diagnosis of PSP and 6 healthy age and sex matched controls using Tc-99m-HMPAO SPECT. Compared with age and sex matched controls, only superior frontal regional perfusion index was significantly decreased in PSP (p<0.05). There was no correlation between the severity of the motor abnormality and any of the regional cerebral perfusion indices (p>0.05). We affirm the previous reports that perfusion in superior frontal cortex is decreased in PSP. Based on our results that there was no correlation between severity of motor abnormality and cerebral perfusion in the superior frontal cortex, nonmotoric symptoms including dementia needs to be looked at whether there is a correlation with the perfusion abnormality in superior frontal cortex
Calcium-sensitivity of smooth muscle contraction in the isolated ...
African Journals Online (AJOL)
sensitivity of smooth muscle contraction were studied in the isolated perfused rat tail artery, employing the activators noradrenaline (NA) (3ìM) sand potassium chloride (KC1) (100mM). Experiments were conduced in Ca2+ - buffered saline.
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Ivanovska, Ana; Grolli, Stefano; Borghetti, Paolo; Ravanetti, Francesca; Conti, Virna; De Angelis, Elena; Macchi, Francesca; Ramoni, Roberto; Martelli, Paolo; Gazza, Ferdinando; Cacchioli, Antonio
2017-10-01
Immunophenotypical characterization of mesenchymal stem cells is fundamental for the design and execution of sound experimental and clinical studies. The scarce availability of species-specific antibodies for canine antigens has hampered the immunophenotypical characterization of canine mesenchymal stem cells (MSC). The aim of this study was to select a panel of species-specific direct antibodies readily useful for canine mesenchymal stem cells characterization. They were isolated from perivisceral and subcutaneous adipose tissue samples collected during regular surgeries from 8 dogs. Single color flow cytometric analysis of mesenchymal stem cells (P3) deriving from subcutaneous and perivisceral adipose tissue with a panel of 7 direct anti-canine antibodies revealed two largely homogenous cell populations with a similar pattern: CD29 + , CD44 + , CD73 + , CD90 + , CD34 - , CD45 - and MHC-II - with no statistically significant differences among them. Antibody reactivity was demonstrated on canine peripheral blood mononuclear cells. The similarities are reinforced by their in vitro cell morphology, trilineage differentiation ability and RT-PCR analysis (CD90 + , CD73 + , CD105 + , CD44 + , CD13 + , CD29 + , Oct-4 + gene and CD31 - and CD45 - expression). Our results report for the first time a comparison between the immunophenotypic profile of canine MSC deriving from perivisceral and subcutaneous adipose tissue. The substantial equivalence between the two populations has practical implication on clinical applications, giving the opportunity to choose the source depending on the patient needs. The results contribute to routine characterization of MSC populations grown in vitro, a mandatory process for the definition of solid and reproducible laboratory and therapeutic procedures. Copyright © 2017 Elsevier Ltd. All rights reserved.
De Haas, Alexander H.; Boddeke, Hendricus W. G. M.; Brouwer, Nieske; Biber, Knut
2007-01-01
Ex vivo analysis is an accurate and convenient way to study in vivo microglia phenotype and function. However, current microglia isolation protocols for ex vivo analysis show many differences in isolation steps (perfusion, removal of meninges and blood vessels, mechanical dissociation, enzymatic
Regional Cerebral Perfusion in Progressive Supranuclear Palsy
International Nuclear Information System (INIS)
Lee, Won Yong; Lee, Ki Hyeong; Yoon, Byung Woo; Lee, Sang Bok; Jeon, Beom S.; Lee, Kyung Han; Lee, Myung Chul
1996-01-01
Progressive supranuclear palsy (PSP) is a Parkinson-plus syndrome characterized clinically by supranuclear ophthalmoplegia, pseudobulbar palsy, axial rigidity, bradykinesia, postural instability and dementia. Presence of dementia and lack of cortical histopathology suggest the derangement of cortical function by pathological changes in subcortical structures in PSP, which is supported by the pattern of behavioral changes and measurement of brain metabolism using positron emission tomography. This study was done to examine whether there are specific changes of regional cerebral perfusion in PSP and whether there is a correlation between severity of motor abnormaility and degree of changes in cerebral perfusion. We measured regional cerebral perfusion indices in 5 cortical and 2 subcortical areas in 6 patients with a clinical diagnosis of PSP and 6 healthy age and sex matched controls using Tc-99m-HMPAO SPECT. Compared with age and sex matched controls, only superior frontal regional perfusion index was significantly decreased in PSP (p 0.05). We affirm the previous reports that perfusion in superior frontal cortex is decreased in PSP. Based on our results that there was no correlation between severity of motor abnormality and cerebral perfusion in the superior frontal cortex, nonmotoric symptoms including dementia needs to be looked at whether there is a correlation with the perfusion abnormality in superior frontal cortex
Computerized analysis of brain perfusion parameter images
International Nuclear Information System (INIS)
Turowski, B.; Haenggi, D.; Wittsack, H.J.; Beck, A.; Aurich, V.
2007-01-01
Purpose: The development of a computerized method which allows a direct quantitative comparison of perfusion parameters. The display should allow a clear direct comparison of brain perfusion parameters in different vascular territories and over the course of time. The analysis is intended to be the basis for further evaluation of cerebral vasospasm after subarachnoid hemorrhage (SAH). The method should permit early diagnosis of cerebral vasospasm. Materials and Methods: The Angiotux 2D-ECCET software was developed with a close cooperation between computer scientists and clinicians. Starting from parameter images of brain perfusion, the cortex was marked, segmented and assigned to definite vascular territories. The underlying values were averages for each segment and were displayed in a graph. If a follow-up was available, the mean values of the perfusion parameters were displayed in relation to time. The method was developed under consideration of CT perfusion values but is applicable for other methods of perfusion imaging. Results: Computerized analysis of brain perfusion parameter images allows an immediate comparison of these parameters and follow-up of mean values in a clear and concise manner. Values are related to definite vascular territories. The tabular output facilitates further statistic evaluations. The computerized analysis is precisely reproducible, i. e., repetitions result in exactly the same output. (orig.)
Aktas, Munir; Ozubek, Sezayi
2017-06-01
Canine tick-borne apicomplexan parasites have emerged in recent years, showing a wider geographic distribution and increased global prevalence. A reverse line blot assay was performed on 219 blood samples collected from domestic dogs for simultaneous detection of all named canine piroplasm species as well as Hepatozoon canis. Ten samples hybridized to the Theileria/Babesia and Babesia catch all probes but did not hybridize to any species-specific probe tested, suggesting the presence of an unrecognized Babesia species or genotype. Sequencing results showed 91.5%, 91.9%, 92.4%, 92.4%, and 89.2% similarity to B. canis, B. vogeli, B. rossi, B. gibsoni, and B. conradae, respectively. The highest homology (98.1-98.5%) observed was with unnamed Babesia sp. isolates (Ludhiana and Malbazar) described in dogs, Babesia sp. of buffalo origin, Babesia sp. Kashi 2, and Babesia orientalis, along with Babesia occultans of cattle origin. The partial cox1 sequence indicated that this isolate was most similar to Babesia sp. 1 HG-2012, with an identity of 86.5%. The survey revealed high prevalence of haemoprotozoans in domestic dogs (57.5%, CI 50.7-64.2), with Hepatozoon canis the most prevalent (54.3%, CI 47.5-61.117%), followed by Babesia sp. (4.6%, CI 2.2-8.2), B. vogeli (1.4%; CI 0.3-3.9), and B. canis (0.4%, CI 0-2.5). Combined infection of Hepatozoon canis and Babesia sp. was detected in five (2.3%, CI 0.7-5.2) samples and of H. canis and B. vogeli in two (0.9%, CI 0.1-3.2) dogs. The study contributes insight into the distribution and phylogenetic diversity of canine piroplasms in Turkey. Copyright © 2017 Elsevier Ltd. All rights reserved.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Cytoplasmic binding and disposition kinetics of diclofenac in the isolated perfused rat liver
Weiss, Michael; Kuhlmann, Olaf; Hung, Daniel Y; Roberts, Michael S
2000-01-01
The binding kinetics of diclofenac to hepatocellular structures were evaluated in the perfused rat liver using the multiple indicator dilution technique and a stochastic model of organ transit time density.The single-pass, in situ rat liver preparation was perfused with buffer solution (containing 2% albumin) at 30 ml min−1. Diclofenac and [14C]-sucrose (extracellular reference) were injected simultaneously as a bolus dose into the portal vein (six experiments in three rats). An analogous series of experiments was performed with [14C]-diclofenac and [3H]-sucrose.The diclofenac outflow data were analysed using three models of intracellular distribution kinetics, assuming (1) instantaneous distribution and binding (well-mixed model), (2) ‘slow' binding at specific intracellular sites after instantaneous distribution throughout the cytosol (slow binding model), and (3) ‘slowing' of cytoplasmic diffusion due to instantaneous binding (slow diffusion model).The slow binding model provided the best description of the data. The rate constants for cellular influx and sequestration were 0.126±0.026 and 0.013±0.009 s−1, respectively. The estimated ratio of cellular initial distribution volume to extracellular volume of 2.82 indicates an almost instantaneous distribution in the cellular water space, while the corresponding ratio of 5.54 estimated for the apparent tissue distribution volume suggests a relatively high hepatocellular binding. The non-instantaneous intracellular equilibration process was characterized by time constants of the binding and unbinding process of 53.8 and 49.5 s, respectively. The single-pass availability of diclofenac was 86%. The results obtained with [14C]-diclofenac and [3H]-sucrose were not statistically different. PMID:10903973
Villous motility and unstirred water layers in canine intestine
International Nuclear Information System (INIS)
Mailman, D.; Womack, W.A.; Kvietys, P.R.; Granger, D.N.
1990-01-01
The possibility that villous motility reduces the mucosal unstirred water layer by mechanical stirring was examined. The frequency of contraction of villi was measured by using videomicroscopic techniques while a segment of anesthetized canine jejunum or ileum with its nerve and blood supply intact was maintained in a sealed chamber through which Tyrode solution was perfused. Radioisotopically labeled inulin, H 2 O, and butyric and lauric acid were used to measure net and/or unidirectional fluxes from the chamber. The unidirectional absorptive transport of H 2 O and butyric acid but not lauric acid by jejunal segments was significantly correlated with flow through the chamber. Plasma volume expansion increased villous motility but decreased the absorption of H 2 O and lauric acid. Absorption of butyric acid from the ileum was little different than from the jejunum although the degree of villous motility was less and net water absorption was greater from the ileum. Absorption of butyric acid into dead tissue indicated that passive diffusion into the tissue accounted for between 7 and 25%, depending on flow rate, of the absorption in intact tissue and that nonspecific binding was low. It was concluded that villous motility did not stir the unstirred water layers and was not directly associated with altered transport
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
International Nuclear Information System (INIS)
Iwata, Kunihiro; Kubota, Makoto; Ogasawara, Katsuhiko
2008-01-01
We compared the diagnostic abilities of stress myocardial perfusion MRI (myocardial perfusion MRI) and myocardial perfusion single photon emission computed tomography (SPECT), using a meta-analysis method. We investigated the diagnostic abilities of MRI and SPECT in similar subject groups in reports written in English or Japanese. The reports to be used for analysis were selected according to a ''screening standard,'' which was established in advance. After consolidating the data from the selected reports, we compared the integrated odds ratio, the point estimation values of sensibility/specificity, and the summary receiver operating characteristic (ROC) curve. For the analysis, six reports were selected (subjects: 153, coronary-artery target sites: 447). Meta-analysis revealed that the diagnostic ability of myocardial perfusion MRI was superior to that of myocardial perfusion SPECT regarding each of the parameters. This is considered to be supportive evidence of the usefulness of myocardial perfusion MRI. (author)
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
International Nuclear Information System (INIS)
Bair, H.J.; Platsch, G.; Wolf, F.; Guenter, E.; Becker, D.; Rupprecht, H.; Neumayer, H.H.
1997-01-01
Aim: The clinical impact of perfusion scintigraphy versus color coded Duplex sonography was evaluated, with respect to their potential in assessing minimal allograft perfusion in vitally threatened kidney transplants, i.e. oligoanuric allografts suspected to have either severe rejection or thrombosis of the renal vein or artery. Methods: From July 1990 to August 1994 the grafts of 15 out of a total of 315 patients were vitally threatened. Technetium-99m DTPA scintigraphy and color coded Duplex sonography were performed in all patients. For scintigraphic evaluation of transplant perfusion analog scans up to 60 min postinjection, and time-activity curves over the first 60 sec after injection of 370-440 MBq Tc-99m diethylenetriaminepentaacetate acid (DTPA) were used and classified by a perfusion score, the time between renal and iliac artery peaks (TDiff) and the washout of the renogram curve. Additionally, evaluation of excretion function and assessment of vascular or urinary leaks were performed. By color coded Duplex sonography the perfusion in all sections of the graft as well as the vascular anastomoses were examined and the maximal blood flow velocity (Vmax) and the resistive index (RI) in the renal artery were determined by means of the pulsed Doppler device. Pathologic-anatomical diagnosis was achieved by either biopsy or post-explant histology in all grafts. Results: Scintigraphy and color coded Duplex sonography could reliably differentiate minimal (8/15) and not perfused (7/15) renal allografts. The results were confirmed either by angiography in digital subtraction technique (DSA) or the clinical follow up. Conclusion: In summary, perfusion scintigraphy and color coded Duplex sonography are comparable modalities to assess kidney graft perfusion. In clinical practice scintigraphy and colorcoded Doppler sonography can replace digital subtraction angiography in the evaluation of minimal allograft perfusion. (orig.) [de
Steward, M C; Seo, Y; Rawlings, J M; Case, R M
1990-01-01
1. The diffusive water permeability of epithelial cell membranes in the perfused rabbit mandibular salivary gland was measured at 37 degrees C by a 1H nuclear magnetic resonance relaxation method using an extracellular relaxation reagent, gadolinium diethylenetriaminepentaacetic acid (Gd(DTPA)). 2. In glands perfused with a HEPES-buffered solution containing 10 mmol l-1 Gd(DTPA), the spin-lattice (T1) relaxation of the water protons showed two exponential components. The water compartment responsible for the slower component corresponded in magnitude to 71 +/- 5% of the wet weight of the gland, and was attributed to the exchangeable intracellular water of the acinar cells. 3. The rate constant for water efflux from the cells was estimated to be 4.1 +/- 0.1 s-1 which would be consistent with a diffusive membrane permeability (Pd) of approximately 3 x 10(-3) cm s-1. Stimulation with acetylcholine (10(-6) mol l-1) did not cause any detectable change in membrane water permeability. 4. Since the basolateral membrane probably provides the main pathway for water efflux, the osmotic water permeability of this barrier (expressed per gland) was estimated to be less than 6.2 cm3 s-1. This would be insufficient to account for the generation of a near-isosmotic fluid at the flow rates observed during secretion, and suggests that a substantial fraction of the flow of water occurs via a paracellular route. PMID:1966053
Ong, Louis Jun Ye; Chong, Lor Huai; Jin, Lin; Singh, Pawan Kumar; Lee, Poh Seng; Yu, Hanry; Ananthanarayanan, Abhishek; Leo, Hwa Liang; Toh, Yi-Chin
2017-10-01
The practical application of microfluidic liver models for in vitro drug testing is partly hampered by their reliance on human primary hepatocytes, which are limited in number and have batch-to-batch variation. Human stem cell-derived hepatocytes offer an attractive alternative cell source, although their 3D differentiation and maturation in a microfluidic platform have not yet been demonstrated. We develop a pump-free microfluidic 3D perfusion platform to achieve long-term and efficient differentiation of human liver progenitor cells into hepatocyte-like cells (HLCs). The device contains a micropillar array to immobilize cells three-dimensionally in a central cell culture compartment flanked by two side perfusion channels. Constant pump-free medium perfusion is accomplished by controlling the differential heights of horizontally orientated inlet and outlet media reservoirs. Computational fluid dynamic simulation is used to estimate the hydrostatic pressure heads required to achieve different perfusion flow rates, which are experimentally validated by micro-particle image velocimetry, as well as viability and functional assessments in a primary rat hepatocyte model. We perform on-chip differentiation of HepaRG, a human bipotent progenitor cell, and discover that 3D microperfusion greatly enhances the hepatocyte differentiation efficiency over static 2D and 3D cultures. However, HepaRG progenitor cells are highly sensitive to the time-point at which microperfusion is applied. Isolated HepaRG cells that are primed as static 3D spheroids before being subjected to microperfusion yield a significantly higher proportion of HLCs (92%) than direct microperfusion of isolated HepaRG cells (62%). This platform potentially offers a simple and efficient means to develop highly functional microfluidic liver models incorporating human stem cell-derived HLCs. Biotechnol. Bioeng. 2017;114: 2360-2370. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Normal anatomy of lung perfusion SPECT scintigraphy
International Nuclear Information System (INIS)
Moskowitz, G.W.; Levy, L.M.
1987-01-01
Ten patients studies for possible pulmonary embolic disease had normal lung perfusion planar and SPECT scintigraphy. A computer program was developed to superimpose the CT scans on corresponding SPECT images. Superimposition of CT scans on corresponding SPECT transaxial cross-sectional images, when available, provides the needed definition and relationships of adjacent organs. SPECT transaxial sections provide clear anatomic definition of perfusion defects without foreground and background lung tissue superimposed. The location, shape, and size of the perfusion defects can be readily assessed by SPECT. An algorithm was developed for the differentiation of abnormal pulmonary perfusion patterns from normal structures on variation
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Regional cortical hyper perfusion on perfusion CT during postical motor deficit: A case report
Energy Technology Data Exchange (ETDEWEB)
Baik, Hye Jin [Dept. of Radiology, Haeundae Paik Hospital, Inje University College of Medicine, Busan (Korea, Republic of)
2013-08-15
Postictal neurologic deficit is a well-known complication mimicking the manifestation of a stroke. We present a case of a patient with clinical evidence of Todd's paralysis correlating with reversible postictal parenchymal changes on perfusion CT and magnetic resonance (MR) imaging. In this case, perfusion CT and MR imaging were helpful in the differential diagnosis of stroke-mimicking conditions.
Ventilation and perfusion display in a single image
International Nuclear Information System (INIS)
Lima, J.J.P. de; Botelho, M.F.R.; Pereira, A.M.S.; Rafael, J.A.S.; Pinto, A.J.; Marques, M.A.T.; Pereira, M.C.; Baganha, M.F.; Godinho, F.
1991-01-01
A new method of ventilation and perfusion display onto a single image is presented. From the data on regions of interest of the lungs, three-dimensional histograms are created, containing as parameters X and Y for the position of the pixels, Z for the perfusion and colour for local ventilation. The perfusion value is supplied by sets of curves having Z proportional to the local perfusion count rate. Ventilation modulates colour. Four perspective views of the histogram are simultaneously displayed to allow visualization of the entire organ. Information about the normal ranges for both ventilation and perfusion is also provided in the histograms. (orig.)
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro
Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Ara?jo, Maria Jos? Abigail Mendes; B?falo, Michelle Cristiane; Sforcin, Jos? Maur?cio
2013-01-01
Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geop...
Fatal canine distemper virus infection of giant pandas in China.
Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu
2016-06-16
We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species.
Yi, Li; Cao, Zhigang; Tong, Mingwei; Cheng, Yuening; Yang, Yong; Li, Shuang; Wang, Jianke; Lin, Peng; Sun, Yaru; Zhang, Miao; Cheng, Shipeng
2017-09-29
The Nucleoprotein (NP) is the most abundant and highly immunogenic protein in canine distemper virus (CDV), playing an important role in CDV viral replication and assembly. In this study, a specific monoclonal antibody, named C8, was produced against the NP protein C terminal (amino acids 401-523). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis.The results indicated that 444 GDKYPIHFNDER 455 was the minimal linear epitope that could be recognized by mAb C8. Sequence alignments demonstrated that this linear epitope is less conserved among three CDV genotypes. We next analyzed the level of conservation of the defined epitope in19 Chinese CDV clinical isolates, and it has one site variation in amino acid among these CDV isolations. 2 isolates have the amino acid mutations F451L, while one has P448Ssubstitution.Phylogenetic analysis showed the two isolates with F451Lsubstitution had a closer relationship in a virulent strain ZJ-7, so the epitope may be a significant tag associated with virus virulence. This collection of mAb along with defined linear epitope may provide useful reagents for investigations of NP protein function and the development of CDV specific diagnostics.
Effects of Steroid Hormones on Sex Differences in Cerebral Perfusion.
Directory of Open Access Journals (Sweden)
Carmen Ghisleni
Full Text Available Sex differences in the brain appear to play an important role in the prevalence and progression of various neuropsychiatric disorders, but to date little is known about the cerebral mechanisms underlying these differences. One widely reported finding is that women demonstrate higher cerebral perfusion than men, but the underlying cause of this difference in perfusion is not known. This study investigated the putative role of steroid hormones such as oestradiol, testosterone, and dehydroepiandrosterone sulphate (DHEAS as underlying factors influencing cerebral perfusion. We acquired arterial spin labelling perfusion images of 36 healthy adult subjects (16 men, 20 women. Analyses on average whole brain perfusion levels included a multiple regression analysis to test for the relative impact of each hormone on the global perfusion. Additionally, voxel-based analyses were performed to investigate the sex difference in regional perfusion as well as the correlations between local perfusion and serum oestradiol, testosterone, and DHEAS concentrations. Our results replicated the known sex difference in perfusion, with women showing significantly higher global and regional perfusion. For the global perfusion, DHEAS was the only significant predictor amongst the steroid hormones, showing a strong negative correlation with cerebral perfusion. The voxel-based analyses revealed modest sex-dependent correlations between local perfusion and testosterone, in addition to a strong modulatory effect of DHEAS in cortical, subcortical, and cerebellar regions. We conclude that DHEAS in particular may play an important role as an underlying factor driving the difference in cerebral perfusion between men and women.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Isolated Left Pulmonary Artery Agenesis: A Case Report
Directory of Open Access Journals (Sweden)
Tansel Ansal Balcı
2012-08-01
Full Text Available Unilateral pulmonary artery agenesis without any cardiovascular malformation is a rare anomaly. We present the imaging findings of a patient who was diagnosed as isolated left pulmonary artery agenesis. A 27-year-old female patient was admitted to our hospital due to dyspnea during exercise for five years. Chest X-ray revealed minimally small left pulmonary hilum and left lung. She was admitted to our clinic with the suspicion of pulmonary artery pathology. Absent perfusion of the left lung with normal ventilation was visualized on scintigraphy. MDCT angiography of pulmonary arteries showed absent left main pulmonary artery with systemic collaterals around left hemithorax. Pulmonary artery agenesis can be asymptomatic and isolated until adulthood. Both scintigraphy and CT angiography images of pulmonary artery agenesis of a patient are rare in the literature. Pulmonary ventilation- perfusion scintigraphy can be used not only for pulmonary embolism but also pathologies involving pulmonary artery and its branches. (MIRT 2012;21:80-83
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
International Nuclear Information System (INIS)
Komemushi, Atsushi; Tanigawa, Noboru; Kojima, Hiroyuki; Kariya, Shuji; Sawada, Satoshi
2003-01-01
The purpose of this study was to quantify pure arterial blood perfusion of liver tumor and parenchyma by using CT perfusion during selective hepatic arteriography. A total of 44 patients underwent liver CT perfusion study by injection of contrast medium via the hepatic artery. CT-perfusion parameters including arterial blood flow, arterial blood volume, and arterial mean transit time in the liver parenchyma and liver tumor were calculated using the deconvolution method. The CT-perfusion parameters and vascularity of the tumor were compared. A complete analysis could be performed in 36 of the 44 patients. For liver tumor and liver parenchyma, respectively, arterial blood flow was 184.6±132.7 and 41.0±27.0 ml/min/100 g, arterial blood volume was 19.4±14.6 and 4.8±4.2 ml/100 g, and arterial mean transit time was 8.9±4.2 and 10.2±5.3 sec. Arterial blood flow and arterial blood volume correlated significantly with the vascularity of the tumor; however no correlation was detected between arterial mean transit time and the vascularity of the tumor. This technique could be used to quantify pure hepatic arterial blood perfusion. (author)
Quantitative perfusion imaging in magnetic resonance imaging
International Nuclear Information System (INIS)
Zoellner, F.G.; Gaa, T.; Zimmer, F.; Ong, M.M.; Riffel, P.; Hausmann, D.; Schoenberg, S.O.; Weis, M.
2016-01-01
Magnetic resonance imaging (MRI) is recognized for its superior tissue contrast while being non-invasive and free of ionizing radiation. Due to the development of new scanner hardware and fast imaging techniques during the last decades, access to tissue and organ functions became possible. One of these functional imaging techniques is perfusion imaging with which tissue perfusion and capillary permeability can be determined from dynamic imaging data. Perfusion imaging by MRI can be performed by two approaches, arterial spin labeling (ASL) and dynamic contrast-enhanced (DCE) MRI. While the first method uses magnetically labelled water protons in arterial blood as an endogenous tracer, the latter involves the injection of a contrast agent, usually gadolinium (Gd), as a tracer for calculating hemodynamic parameters. Studies have demonstrated the potential of perfusion MRI for diagnostics and also for therapy monitoring. The utilization and application of perfusion MRI are still restricted to specialized centers, such as university hospitals. A broad application of the technique has not yet been implemented. The MRI perfusion technique is a valuable tool that might come broadly available after implementation of standards on European and international levels. Such efforts are being promoted by the respective professional bodies. (orig.) [de
Rosas, Cristina; Van de Walle, Gerlinde R; Metzger, Stephan M; Hoelzer, Karin; Dubovi, Edward J; Kim, Sung G; Parrish, Colin R; Osterrieder, Nikolaus
2008-05-02
In 2004, canine influenza virus (CIV) was identified as a respiratory pathogen of dogs for the first time and found to be closely related to H3N8 equine influenza virus (EIV). We generated a recombinant vectored vaccine that expresses H3 of a recent isolate of EIV using equine herpesvirus type 1 (EHV-1) as the delivery vehicle. This EHV-1 vectored vaccine exhibited robust and stable EIV H3 expression and induced a strong influenza virus-specific response in both mice and dogs upon intranasal or subcutaneous administration. Furthermore, upon challenge with the recent CIV isolate A/canine/PA/10915-07, protection of vaccinated dogs could be demonstrated by a significant reduction in clinical sings, and, more importantly, by a significant reduction in virus shedding. We concluded that the EHV-1/H3 recombinant vector can be a valuable alternative for protection of dogs against clinical disease induced by CIV and can significantly reduce virus spread.
Perfusion-weighted MR imaging of uterine leiomyoma
Energy Technology Data Exchange (ETDEWEB)
Takase, Hiroyasu; Munechika, Hirotsugu [Showa Univ., Tokyo (Japan). School of Medicine
2001-06-01
Serial images of uterine leiomyoma in gradient-echo, echo-planar, magnetic resonance imaging were taken to draw a {delta}R2{sup *} curve after intravenous bolus injection of Gd-DTPA. The {delta}R2{sup *} integral was calculated from a {delta}R2{sup *} curve to have relative perfusion of uterine leiomyoma. We then, evaluated the amount of perfusion correlated with MR findings, size and number of leiomyoma or the clinical symptoms and established that perfusion was correlated positively with the findings of T2 weighted images and clinical symptoms but not with other MR findings or size and number of leiomyoma. In conclusion, we presumed that the clinical symptoms could be reduced by decreasing of an amount of perfusion of uterine leiomyoma in some means. However, it remained uncertain why severe clinical symptoms were associated with a high amount of perfusion in uterine leiomyomas. (author)
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Regional myocardial perfusion of cardioplegic solutions
International Nuclear Information System (INIS)
Eugene, J.; Lyons, K.P.; Ott, R.A.; Gelezunas, V.L.; Chang, C.W.; Kowall, M.G.; Haiduc, N.J.
1987-01-01
We compared the regional myocardial perfusion of blood cardioplegic solution (BCP) and crystalloid cardioplegic solution (CCP) in 14 mongrel dogs. Cardiopulmonary bypass was established at 28 degrees C, and a hydraulic occluder was placed around the proximal left anterior descending (LAD) coronary artery. In group 1 (N = 7) collateral coronary arteries were ligated; in group 2 (N = 7) collateral coronary arteries were left in situ. After the aorta was clamped, BCP and CCP were alternately perfused at 200 ml/min. The occluder was inflated to produce moderate, severe, and critical LAD stenosis, and regional perfusion was measured by xenon-133 washout with the Silicon Avalanche Radiation Detector. BCP infusion produced a consistently higher aortic pressure, but CCP flow was better than BCP flow under all conditions, particularly without coronary collaterals. Regional myocardial perfusion of CCP is superior to BCP
International Nuclear Information System (INIS)
Paeng, Jin Chul; Lim, Il Han; Kim, Ki Bong; Lee, Dong Soo
2008-01-01
Although automatic quantification software of myocardial perfusion SPECT provides highly objective and reproducible quantitative measurements, there is still some limitation in the direct use of quantitative measurements. In this study we derived parameters using normal variation of perfusion measurements, and tried to test the usefulness of these parameters. In order to calculate normal variation of perfusion measurements on myocardial perfusion SPECT, 55 patients (M:F=28:27) of low-likelihood for coronary artery disease were enrolled and 201 Tl rest / 99m Tc-MIBI stress SPECT studies were performed. Using 20-segment model, mean (m) and standard deviation (SD) of perfusion were calculated in each segment. As a myocardial viability assessment group, another 48 patients with known coronary artery disease, who underwent coronary artery bypass graft surgery (CABG) were enrolled. 201 Tl rest / 99m Tc-MIBI stress / 201 Tl 24-hr delayed SPECT was performed before CABG and SPECT was followed up 3 months after CABG. From the preoperative 24-hr delayed SPECT, Q delay (perfusion measurement), Δ delay (Q delay .m) and Z delay ((Q delay .m)/SD) were defined and diagnostic performances of them for myocardial viability were evaluated using area under curve (AUC) on receiver operating characteristic (ROC) curve analysis. Segmental perfusion measurements showed considerable normal variations among segments. In men, the lowest segmental perfusion measurement was 51.8±6.5 and the highest segmental perfusion was 87.0±5.9, and they are 58.7±8.1 and 87.3±6.0, respectively in women. In the viability assessment, Q delay showed AUC of 0.633, while those for Δ delay and Z delay were 0.735 and 0.716, respectively. The AUCs of Δ delay and Z delay were significantly higher than that of Q delay (p=0.001 and 0.018, respectively). The diagnostic performance of Δ delay , which showed highest AUC, was 85% of sensitivity and 53% of specificity at the optimal cutoff of -24.7. On automatic
Hepatic artery perfusion imaging
International Nuclear Information System (INIS)
Thrall, J.H.; Gyves, J.W.; Ziessman, H.A.; Ensminger, W.D.
1985-01-01
Organ and region-selective intra-arterial chemotherapy have been used for more than two decades to treat malignant neoplasms in the extremities, head and neck region, pelvis, liver, and other areas. Substantial evidence of improved response to regional chemotherapy now exists, but there are stringent requirements for successful application of the regional technique. First, the chemotherapeutic agent employed must have appropriate pharmacokinetic and pharmacodynamic properties. Second, the drug must be reliably delivered to the tumor-bearing area. This typically requires an arteriographic assessment of the vascular supply of the tumor, followed by placement of a therapeutic catheter and confirmation that the ''watershed'' perfusion distribution from the catheter truly encompasses the tumor. Optimal catheter placement also minimizes perfusion of nontarget organs. Radionuclide perfusion imaging with technetium 99m-labeled particles, either microspheres or macroaggregates of albumin, has become the method of choice for making these assessments. Catheter placement itself is considered by many to represent a type of ''therapeutic'' intervention. However, once the catheter is in the hepatic artery the radionuclide perfusion technique can be used to assess adjunctive pharmacologic maneuvers designed to further exploit the regional approach to chemotherapy. This chapter presents the technetium Tc 99m macroaggregated albumin method for assessing catheter placement and the pharmacokinetic rationale for regional chemotherapy, and discusses two promising avenues for further intervention
Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)
International Nuclear Information System (INIS)
Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.
1986-01-01
Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Larsen, Rikke; Boysen, Lene; Berg, June; Guardabassi, Luca; Damborg, Peter
2015-06-01
Antimicrobial resistance may be overestimated in bacterial isolates from clinical samples because veterinarians often submit samples in cases of treatment failure or recurrent cases, which are more frequently associated with resistant strains. To assess to what extent the prevalence of antimicrobial resistance in Staphylococcus pseudintermedius isolated from first-time superficial pyoderma differs from canine skin isolates from clinical samples with unknown clinical background. Two study groups were enrolled in Denmark between March 2012 and October 2013: 57 dogs with first-time superficial pyoderma and no prior antimicrobial treatment (Group A); and 289 different dogs for which skin specimens were submitted for culture during the study (Group B). One S. pseudintermedius isolate from each dog was confirmed by MALDI-TOF mass spectrometry and tested for antimicrobial susceptibility by broth microdilution. Resistance levels in the two groups were compared by Fisher's exact test. Clindamycin resistance was less frequent in Group A (14%) than in Group B (27%) (P = 0.02). Similar trends were observed for amoxicillin-clavulanic acid (1.8 versus 4.8%), chloramphenicol (8.8 versus 14.5%), enrofloxacin (1.8 versus 3.5%), oxacillin (1.8 versus 4.8%) and trimethoprim/sulfamethoxazole (3.5 versus 5.9%). Oxacillin resistance was significantly associated with resistance to six of seven non-β-lactams. The prevalence of lincosamide resistance is markedly influenced by patients' clinical and antimicrobial treatment history. To limit selection of multidrug-resistant bacteria, lincosamides are appropriate empirical choices for treatment of first-time superficial pyoderma even though resistance is not infrequent. Culture and susceptibility testing are, however, recommended for all pyoderma patients. © 2015 ESVD and ACVD.
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Persufflation (or gaseous oxygen perfusion) as a method of organ preservation.
Suszynski, Thomas M; Rizzari, Michael D; Scott, William E; Tempelman, Linda A; Taylor, Michael J; Papas, Klearchos K
2012-06-01
Improved preservation techniques have the potential to improve transplant outcomes by better maintaining donor organ quality and by making more organs available for allotransplantation. Persufflation, (PSF, gaseous oxygen perfusion) is potentially one such technique that has been studied for over a century in a variety of tissues, but has yet to gain wide acceptance for a number of reasons. A principal barrier is the perception that ex vivo PSF will cause in vivo embolization post-transplant. This review summarizes the extensive published work on heart, liver, kidney, small intestine and pancreas PSF, discusses the differences between anterograde and retrograde PSF, and between PSF and other conventional methods of organ preservation (static cold storage, hypothermic machine perfusion). Prospective implications of PSF within the broader field of organ transplantation, and in the specific application with pancreatic islet isolation and transplant are also discussed. Finally, key issues that need to be addressed before PSF becomes a more widely utilized preservation strategy are summarized and discussed. Copyright © 2012 Elsevier Inc. All rights reserved.
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells
Directory of Open Access Journals (Sweden)
Grassi Rici Rose
2012-02-01
Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Validation of an in vitro contractility assay using canine ventricular myocytes
Energy Technology Data Exchange (ETDEWEB)
Harmer, A.R., E-mail: alex.harmer@astrazeneca.com; Abi-Gerges, N.; Morton, M.J.; Pullen, G.F.; Valentin, J.P.; Pollard, C.E.
2012-04-15
Measurement of cardiac contractility is a logical part of pre-clinical safety assessment in a drug discovery project, particularly if a risk has been identified or is suspected based on the primary- or non-target pharmacology. However, there are limited validated assays available that can be used to screen several compounds in order to identify and eliminate inotropic liability from a chemical series. We have therefore sought to develop an in vitro model with sufficient throughput for this purpose. Dog ventricular myocytes were isolated using a collagenase perfusion technique and placed in a perfused recording chamber on the stage of a microscope at ∼ 36 °C. Myocytes were stimulated to contract at a pacing frequency of 1 Hz and a digital, cell geometry measurement system (IonOptix™) was used to measure sarcomere shortening in single myocytes. After perfusion with vehicle (0.1% DMSO), concentration–effect curves were constructed for each compound in 4–30 myocytes taken from 1 or 2 dog hearts. The validation test-set was 22 negative and 8 positive inotropes, and 21 inactive compounds, as defined by their effect in dog, cynolomolgous monkey or humans. By comparing the outcome of the assay to the known in vivo contractility effects, the assay sensitivity was 81%, specificity was 75%, and accuracy was 78%. With a throughput of 6–8 compounds/week from 1 cell isolation, this assay may be of value to drug discovery projects to screen for direct contractility effects and, if a hazard is identified, help identify inactive compounds. -- Highlights: ► Cardiac contractility is an important physiological function of the heart. ► Assessment of contractility is a logical part of pre-clinical drug safety testing. ► There are limited validated assays that predict effects of compounds on contractility. ► Using dog myocytes, we have developed an in vitro cardiac contractility assay. ► The assay predicted the in vivo contractility with a good level of accuracy.
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
[An automatic system controlled by microcontroller for carotid sinus perfusion].
Yi, X L; Wang, M Y; Fan, Z Z; He, R R
2001-08-01
To establish a new method for controlling automatically the carotid perfusion pressure. A cheap practical automatic perfusion unit based on AT89C2051 micro controller was designed. The unit, LDB-M perfusion pump and the carotid sinus of an animal constituted an automatic perfusion system. This system was able to provide ramp and stepwise updown perfusion pattern and has been used in the research of baroreflex. It can insure the precision and reproducibility of perfusion pressure curve, and improve the technical level in corresponding medical field.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Heterogeneity in stabilization phenomena in FLT PET images of canines
International Nuclear Information System (INIS)
Simoncic, Urban; Jeraj, Robert
2014-01-01
3'-( 18 F)fluoro-3'-deoxy-L-thymidine (FLT) is a PET marker of cellular proliferation. Its tissue uptake rate is often quantified with a Standardized Uptake Value (SUV), although kinetic analysis provides a more accurate quantification. The purpose of this study is to investigate the heterogeneity in FLT stabilization phenomena. The study was done on 15 canines with spontaneously occurring sinonasal tumours. They were imaged dynamically for 90 min with FLT PET/CT twice; before and during the radiotherapy. Images were analyzed for kinetics on a voxel basis through compartmental analysis. Stabilization curves were calculated as a time-dependant correlation between the time-dependant SUV and the kinetic parameters (voxel values within the tumour were correlated). Stabilization curves were analyzed for stabilization speed, maximal correlation and correlation decrease following the maximal correlation. These stabilization parameters were correlated with the region-averaged kinetic parameters. The FLT SUV was highly correlated with vasculature fraction immediately post-injection, followed by maximum in correlation with the perfusion/permeability. At later times post-injection the FLT SUV was highly correlated (Pearson correlation coefficient above 0.95) with the FLT influx parameter for cases with tumour-averaged SUV 30–50 min above 2, while others were indeterminate (correlation coefficients from 0.1 to 0.97). All cases with highly correlated SUV and FLT influx parameter had correlation coefficient within 0.5% of its maximum in the period of 30–50 min post-injection. Stabilization time was inversely proportional to the FLT influx rate. Correlation between the FLT SUV and FLT influx parameter dropped at later times post-injection with drop being proportional to the dephosphorylation rate. The FLT was found to be metabolically stable in canines. FLT PET imaging protocol should define minimal and maximal FLT uptake period, which would be 30–50
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
2014-01-01
Background Canine parvovirus 2 (CPV 2) is a major infectious cause of mortality in puppies. The characteristic symptom of CPV 2 disease is intestinal hemorrhage with severe bloody diarrhea. Soon after CPV was first recognized in the late 1970s, the original virus, CPV 2, was replaced in the canine population by strains carrying minor antigenic variants (termed 2a, 2b, and 2c) of the VP2 gene that could be distinguished using monoclonal antibodies and molecular analyses. Here, we provide an updated molecular characterization of the CPV 2 circulating in Taiwan. Methods In this study, 28 isolates of CPV 2 from 144 dogs with suspected CPV infection were obtained from northern, central, and southern Taiwan from 2008 to 2012 and screened by PCR. The 28 isolates were sequenced, and a phylogenetic analysis of the VP2 gene was performed. Results Of the 28 Taiwanese CPV 2 isolates, 15 were identified as new CPV 2a, and 13 were identified as new CPV 2b. Compared to the reference CPV 2a, all 15 of the CPV 2a sequences collected in this study contain an Ile324 mutation caused by a TAT to ATT mutation at nucleotides 970–972 of the VP2 gene. Conclusion Our VP2 sequence data revealed that both types are currently prevalent CPV 2 field strains circulating in Taiwan, and a unique Ile324 VP2 mutation was found in our Taiwanese CPV 2a isolates and recent Asian isolates. CPV 2c was not observed in this study. PMID:24568207
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Insulin degradation products from perfused rat kidney
International Nuclear Information System (INIS)
Duckworth, W.C.; Hamel, F.G.; Liepnieks, J.; Peavy, D.; Frank, B.; Rabkin, R.
1989-01-01
The kidney is a major site for insulin metabolism, but the enzymes involved and the products generated have not been established. To examine the products, we have perfused rat kidneys with insulin specifically iodinated on either the A14 or the B26 tyrosine. Labeled material from both the perfusate and kidney extract was examined by Sephadex G50 and high-performance liquid chromatography (HPLC). In perfusate from a filtering kidney, 22% of the insulin-sized material was not intact insulin on HPLC. With the nonfiltering kidney, 10.6% was not intact insulin. Labeled material from HPLC was sulfitolyzed and reinjected on HPLC. By use of 125 I-iodo(A14)-insulin, almost all the degradation products contained an intact A-chain. By use of 125 I-iodo(B26)-insulin, several different B-chain-cleaved products were obtained. The material extracted from the perfused kidney was different from perfusate products but similar to intracellular products from hepatocytes, suggesting that cellular metabolism by kidney and liver are similar. The major intracellular product had characteristics consistent with a cleavage between the B16 and B17 amino acids. This product and several of the perfusate products are also produced by insulin protease suggesting that this enzyme is involved in the degradation of insulin by kidney
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...