WorldWideScience

Sample records for isolated perfused canine

  1. Testosterone biotransformation by the isolated perfused canine pancreas

    International Nuclear Information System (INIS)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.

    1991-01-01

    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

  2. Testosterone biotransformation by the isolated perfused canine pancreas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))

    1991-01-01

    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

  3. HYPERTHERMIC ISOLATED REGIONAL PERFUSION WITH CISPLATIN IN THE LOCAL TREATMENT OF SPONTANEOUS CANINE OSTEOSARCOMA - ASSESSMENT OF SHORT-TERM EFFECTS

    NARCIS (Netherlands)

    VANGINKEL, RJ; HOEKSTRA, HJ; MEUTSTEGE, FJ; OOSTERHUIS, JW; UGES, DRA; KOOPS, HS

    To increase the effect of cisplatin on locoregional osteosarcoma, the short-term effect of hyperthermic isolated regional perfusion (HIRP) with cisplatin (30 mg/L extremity volume) was studied in 28 dogs with spontaneous osteogenic sarcoma, using clinical, radiological, and histological parameters.

  4. Isolated limb perfusion.

    Science.gov (United States)

    Gillespie, Rosalyn; Chantier, Nariane

    1994-12-08

    Growing concern over the rising incidence of malignant melanoma has brought about a need for information on this disorder and the treatment available. Isolated limb perfusion is a relatively new technique used in only a few hospitals. An increased knowledge base will lead to a better understanding of the nursing care required and to a more in-depth care plan.

  5. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

    1995-12-31

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  6. Antigenic typing Polish isolates of canine parvovirus

    International Nuclear Information System (INIS)

    Mizak, B.; Plucienniczak, A.

    1995-01-01

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

  7. Phosphorus NMR of isolated perfused morris hepatomas

    International Nuclear Information System (INIS)

    Graham, R.A.; Meyer, R.A.; Brown, T.R.; Sauer, L.A.

    1986-01-01

    The authors are developing techniques for the study of perfused solid tumors by NMR. Tissue-isolated solid hepatomas were grown to 1-2 cm diameter as described previously. The arterial supply was isolated and the tumors perfused (0.5 - 1.0 ml/min) in vitro at 25 C with a 15% suspension of red blood cells in Krebs-Henseliet solution. 31 P-NMR spectra were acquired at 162 MHz in a specially-designed NMR probe using a solenoidal coil. Intracellular pH (monitored from the chemical shift of inorganic phosphate) and ATP levels were stable for up to 6 hrs during perfusion. During 30 min of global ischemia, ATP decreased by 75% and pH fell from 7.0 to 6.7. These changes were reversed by 1 hr reperfusion. In addition to ATP and phosphate, the spectra included a large resonance due to phosphomonoesters, as well as peaks consistent with glycerylphosphocholine, glyceryl-phosphoethanolamine, phosphocreatine, NAD, and UDPG. However, the most novel feature of the spectra was the presence of an unidentified peak in the phosphonate region (+ 16.9 ppm). The peak was not present in spectra of muscle, liver, brain, kidney, or fat tissues excised from the same animals. They are presently attempting to identify the compound that gives rise to this peak and to establish its metabolic origin

  8. Nuclear magnetic resonance of perfused tissue

    International Nuclear Information System (INIS)

    Harpen, M.D.; Allison, R.C.

    1986-01-01

    The effect of perfusion on the NMR signal observed in NMR imaging is studied in a phantom and in two isolated perfused canine lungs. It is observed that perfusion in tissue has little effect on longitudinal relaxation times. Transverse relaxation rates are observed to correlate linearly with rates of perfusion, in accordance with a model presented. (author)

  9. Phenotypic characterization of canine Malassezia spp., isolates

    Directory of Open Access Journals (Sweden)

    Angélica Hurtado-Suárez

    2016-09-01

    Full Text Available Objective. To characterize and identify yeasts of the genus Malassezia by phenotypic features. Materials and methods. First, the macroscopic and microscopic morphological characteristics were described. In addition we performed biochemical and physiological assays as Tweens and Cremophor, including more. Results. Our results evidenced of 105 isolates obtained from dogs diagnosed with external otitis, it was possible to identify two distinct species from 46 isolates within the Malassezia genus: 36.19% (n=38 were identified as M. pachydermatis and 7.62% (n=8 as M. furfur. According to phenotypic patterns the remaining 56.19% (n=59 were reported as Malassezia spp., possibly corresponding to M. furfur and/or M. pachydermatis. Conclusions. Results emphasize the necessity to characterize according to species. It is not feasible to define Malassezia by species based on morphological, biochemical, and physiological findings. Therefore, molecular genotyping should be performed to identify markers allowing a more precise isolate identification. This would broaden our epidemiological knowledge regarding different species involved in canine otitis pathologies.

  10. Characterizing potential heart agents with an isolated perfused heart system

    International Nuclear Information System (INIS)

    Pendleton, D.B.; Sands, H.; Gallagher, B.M.; Camin, L.L.

    1984-01-01

    The authors have used an isolated perfused heart system for characterizing potential myocardial perfusion radiopharamaceuticals. Rabbit or guinea pig (GP) hearts are removed and perfused through the aorta with a blood-free buffer. Heart rate and ventricular pressure are monitored as indices of viability. Tc-99m-MAA is 96-100% retained in these hearts, and Tc-99m human serum albumin shows less than 5% extraction. Tl-201 is 30-40% extracted. It is known that in-vivo, Tc-99m(dmpe)/sub 2/Cl/sub 2//sup +/ is taken up by rabbit heart but not by GP or human heart. Analogous results are obtained with the isolated perfused heart model, where the complex is extracted well by the isolated rabbit heart (24%) but not by the GP heart (<5%). Values are unchanged if human, rabbit or GP blood is mixed and co-injected with the complex. Tc-99m)dmpe)/sub 3//sup +/ is also taken up by rabbit but not by GP hearts in-vivo. However, isolated perfused hearts of both species extract this complex well (45-52%). Heart uptake is diminished to <7% if the complex is pre-equilibrated with human blood. GP blood produces a moderate inhibition (in GP hearts only) and rabbit blood has no effect. This suggests that a human or GP blood factor may have a significant effect on heart uptake of this complex. Tc-99m(CN-t-butyl)/sub 6//sup +/ is taken up well by both rabbit and GP hearts in-vivo, and is extracted 100% by both isolated perfused hearts. Heart retention remains high (73-75%) in the presence of human blood

  11. In vitro activity of difloxacin against canine bacterial isolates

    NARCIS (Netherlands)

    Hoven, van den J.R.; Wagenaar, J.A.; Walker, R.D.

    2000-01-01

    The in vitro activity of difloxacin against canine bacterial isolates from clinical cases was studied in the United States and The Netherlands. Minimal inhibitory concentrations (MIC), the postantibiotic effect, the effect of pH on antimicrobial activity, and the bacterial killing rate tests were

  12. desensitisation and calcium-sensitivity in the isolated perfused rat ...

    African Journals Online (AJOL)

    Dr Olaleye

    -induced desensitisation to noradrenaline were studied in the isolated perfused rat tail artery. Responses to the activators noradrenaline (NA). (3μM) and potassium chloride (KCl) (100mM) were obtained in Ca2+-buffered saline. Activators ...

  13. Isolated limb perfusion electrochemotherapy for the treatment of an ...

    African Journals Online (AJOL)

    After completing staging procedures, the lesion was approached with surgery and intraoperative electrochemotherapy (ECT) administration of bleomycin in isolated limb perfusion. A second session of surgery and ECT was performed one month later, followed by three additional monthly sessions of ECT. During periodic ...

  14. Complete inhibition of creatine kinase in isolated perfused rat hearts

    International Nuclear Information System (INIS)

    Fossel, E.T.; Hoefeler, H.

    1987-01-01

    Transient exposure of an isolated isovolumic perfused rat heart to low concentrations (0.5 mM) of perfusate-born iodoacetamide resulted in complete inhibition of creatine kinase and partial inhibition of glyceraldehyde-3-phosphate dehydrogenase in the heart. At low levels of developed pressure, hearts maintained mechanical function, ATP, and creatine phosphate levels at control values. However, iodoacetamide-inhibited hearts were unable to maintain control values of end diastolic pressure or peak systolic pressure as work load increased. Global ischemia resulted in loss of all ATP without loss of creatine phosphate, indicating lack of active creatine kinase. These results indicate that isovolumic perfused rat hearts are able to maintain normal function and normal levels of high-energy phosphates without active creatine kinase at low levels of developed pressure. 31 P-NMR of the heart was carried out

  15. Reactivity of the isolated perfused rat tail vascular bed

    Directory of Open Access Journals (Sweden)

    A.S. França

    1997-07-01

    Full Text Available Isolated segments of the perfused rat tail artery display a high basal tone when compared to other isolated arteries such as the mesenteric and are suitable for the assay of vasopressor agents. However, the perfusion of this artery in the entire tail has not yet been used for functional studies. The main purpose of the present study was to identify some aspects of the vascular reactivity of the rat tail vascular bed and validate this method to measure vascular reactivity. The tail severed from the body was perfused with Krebs solution containing different Ca2+ concentrations at different flow rates. Rats were anesthetized with sodium pentobarbital (65 mg/kg and heparinized (500 U. The tail artery was dissected near the tail insertion, cannulated and perfused with Krebs solution plus 30 µM EDTA at 36oC and 2.5 ml/min and the procedures were started after equilibration of the perfusion pressure. In the first group a dose-response curve to phenylephrine (PE (0.5, 1, 2 and 5 µg, bolus injection was obtained at different flow rates (1.5, 2.5 and 3.5 ml/min. The mean perfusion pressure increased with flow as well as PE vasopressor responses. In a second group the flow was changed (1.5, 2, 2.5, 3 and 3.5 ml/min at different Ca2+ concentrations (0.62, 1.25, 2.5 and 3.75 mM in the Krebs solution. Increasing Ca2+ concentrations did not alter the flow-pressure relationship. In the third group a similar protocol was performed but the rat tail vascular bed was perfused with Krebs solution containing PE (0.1 µg/ml. There was an enhancement of the effect of PE with increasing external Ca2+ and flow. PE vasopressor responses increased after endothelial damage with air and CHAPS, suggesting an endothelial modulation of the tone of the rat tail vascular bed. These experiments validate the perfusion of the rat tail vascular bed as a method to investigate vascular reactivity

  16. Phosphorus nuclear magnetic resonance in isolated perfused rat pancreas

    International Nuclear Information System (INIS)

    Matsumoto, Takehisa; Kanno, Tomio; Seo, Yoshiteru; Murakami, Masataka; Watari, Hiroshi

    1988-01-01

    Phosphorus nuclear magnetic resonance spectroscopy was applied to measure phosphorus energy metabolites in isolated perfused rat pancreas. The gland was perfused with a modified Krebs-Henseleit solution at room temperature (25 degree C). 31 P resonances of creatine phosphate (PCr), ATP, ADP, inorganic phosphate (P i ) and phosphomonoesters (PMEs) were observed in all the preparations of pancreas. In different individual preparations, the resonance of PCr varied, but those of ATP were almost the same. The initial levels of PCr and ATP in individual preparations, however, remained almost unchanged during perfusion with the standard solution for 2 h. When the perfusion was stopped, the levels of ATP and PCr decreased, while the levels of PME and P i increased. At that time, the P i resonance shfted to a higher magnetic field, indicating that the tissue pH decreased. On reperfusion, the tissue levels of phosphorus compounds and the tissue pH were restored to their initial resting levels. Continuous infusion of 0.1 μM acetylcholine caused marked and sustained increases in the flow of pancreatic juice and protein output. During the stimulation the tissue levels of phosphorus compounds remained unchanged, while the tissue pH was decreased slightly

  17. Secretion of neurotensin from isolated perfused porcine ileum

    DEFF Research Database (Denmark)

    Holst Pedersen, J; Knuthsen, S; Bernabei, M

    1988-01-01

    The secretion and molecular nature of immunoreactive neurotensin (NT) was studied following stimulation of an isolated perfused porcine ileal segment with glucose, triglyceride and intra-arterial infusion of gastrin-releasing peptide (GRP). Secreted peptides were separated using gel chromatography...... in doses from 10(-10) to 10(-8) M stimulated NT release in a dose-related manner. Following gel chromatography only the intact peptide and no smaller or larger molecular size immunoreactive components were observed. The study showed that both luminal and humoral stimuli release NT from the isolated pig...

  18. Application of myocardial perfusion quantitative imaging for the evaluation of therapeutic effect in canine with myocardial infarction

    International Nuclear Information System (INIS)

    Liang Hong; Chen Ju; Liu Sheng; Zeng Shiquan

    2000-01-01

    Myocardial blood perfusion (MBP) ECT and quantitative analysis were performed in 10 canines with experimental acute myocardial infarct (AMI). The accuracy of main myocardial quantitative index, including defect volume (DV) and defect fraction (DF), was estimated and correlated with histochemical staining (HS) of infarcted area. Other 21/AMI canines were divided into Nd:YAG laser trans-myocardial revascularization treated group LTMR and control group. All canines were performed MBP ECT after experimental AMI. Results found that the infarcted volume (IV) measured by HS has well correlated (r 0.88) with DV estimated by myocardial quantitative analysis. But the DF values calculated by both methods was not significantly different (t = 1.28 P > 0.05). In LTMR group 27.5% +- 3.9%, the DF is smaller than control group 32.1% +- 4.6% (t = 2.49 P 99m Tc-MIBI myocardial perfusion SPECT and quantitative study can accurately predict the myocardial blood flow and magnitude of injured myocardium. Nd:YAG LTMR could improve myocardial blood perfusion of ischemic myocardium and decrease effectively the infarct areas

  19. Concentration of (+/-)-propranolol in isolated, perfused lungs of rat.

    Science.gov (United States)

    Dollery, C T; Junod, A F

    1976-01-01

    1 The metabolism and the accumulation of (+/-)-propranolol have been studied in isolated lungs of the rat, perfused with an artificial medium. 2 Little or no metabolism took place during the perfusion periods (up to 10 minutes). 3 Accumulation was observed with high tissue/medium ratios for substrate concentrations of 0.2 muM to 1 mM; there was evidence for saturability, but no real plateau could be seen. The presence of two binding sites with different affinities was established. 4 Cold greatly inhibited the accumulation process at low substrate concentrations, but had no effect at 1 mM propranolol. 5 Inhibition of accumulation was measured in the presence of imipramine, desmethylimipramine, nortryptiline, chlorpromazine and of Na+-free medium. Cocaine, 5-hydroxytryptamine and noradrenaline had no effect. Lidocaine enhanced the accumulation process. Release of previously bound propranolol was accelerated in the presence of propranolol and imipramine, unaffected by a Na+-free medium and decreased by cold and by lidocaine. 6 Experiments on lung tissue slices yielded qualitatively similar results to those obtained with perfused lungs. Ouabain and KCN had no or little effect on propranolol accumulation. PMID:1276542

  20. Single-energy computed tomography-based pulmonary perfusion imaging: Proof-of-principle in a canine model

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Tokihiro, E-mail: toyamamoto@ucdavis.edu [Department of Radiation Oncology, University of California Davis School of Medicine, Sacramento, California 95817 (United States); Kent, Michael S.; Wisner, Erik R. [Department of Surgical and Radiological Sciences, University of California Davis School of Veterinary Medicine, Davis, California 95616 (United States); Johnson, Lynelle R.; Stern, Joshua A. [Department of Medicine and Epidemiology, University of California Davis School of Veterinary Medicine, Davis, California 95616 (United States); Qi, Lihong [Department of Public Health Sciences, University of California Davis, Davis, California 95616 (United States); Fujita, Yukio [Department of Radiation Oncology, Tokai University, Isehara, Kanagawa 259-1193 (Japan); Boone, John M. [Department of Radiology, University of California Davis School of Medicine, Sacramento, California 95817 (United States)

    2016-07-15

    Purpose: Radiotherapy (RT) that selectively avoids irradiating highly functional lung regions may reduce pulmonary toxicity, which is substantial in lung cancer RT. Single-energy computed tomography (CT) pulmonary perfusion imaging has several advantages (e.g., higher resolution) over other modalities and has great potential for widespread clinical implementation, particularly in RT. The purpose of this study was to establish proof-of-principle for single-energy CT perfusion imaging. Methods: Single-energy CT perfusion imaging is based on the following: (1) acquisition of end-inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast agents, (2) deformable image registration (DIR) for spatial mapping of those two CT image data sets, and (3) subtraction of the precontrast image data set from the postcontrast image data set, yielding a map of regional Hounsfield unit (HU) enhancement, a surrogate for regional perfusion. In a protocol approved by the institutional animal care and use committee, the authors acquired CT scans in the prone position for a total of 14 anesthetized canines (seven canines with normal lungs and seven canines with diseased lungs). The elastix algorithm was used for DIR. The accuracy of DIR was evaluated based on the target registration error (TRE) of 50 anatomic pulmonary landmarks per subject for 10 randomly selected subjects as well as on singularities (i.e., regions where the displacement vector field is not bijective). Prior to perfusion computation, HUs of the precontrast end-inspiratory image were corrected for variation in the lung inflation level between the precontrast and postcontrast end-inspiratory CT scans, using a model built from two additional precontrast CT scans at end-expiration and midinspiration. The authors also assessed spatial heterogeneity and gravitationally directed gradients of regional perfusion for normal lung subjects and diseased lung subjects using a two-sample two-tailed t

  1. Single-energy computed tomography-based pulmonary perfusion imaging: Proof-of-principle in a canine model.

    Science.gov (United States)

    Yamamoto, Tokihiro; Kent, Michael S; Wisner, Erik R; Johnson, Lynelle R; Stern, Joshua A; Qi, Lihong; Fujita, Yukio; Boone, John M

    2016-07-01

    Radiotherapy (RT) that selectively avoids irradiating highly functional lung regions may reduce pulmonary toxicity, which is substantial in lung cancer RT. Single-energy computed tomography (CT) pulmonary perfusion imaging has several advantages (e.g., higher resolution) over other modalities and has great potential for widespread clinical implementation, particularly in RT. The purpose of this study was to establish proof-of-principle for single-energy CT perfusion imaging. Single-energy CT perfusion imaging is based on the following: (1) acquisition of end-inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast agents, (2) deformable image registration (DIR) for spatial mapping of those two CT image data sets, and (3) subtraction of the precontrast image data set from the postcontrast image data set, yielding a map of regional Hounsfield unit (HU) enhancement, a surrogate for regional perfusion. In a protocol approved by the institutional animal care and use committee, the authors acquired CT scans in the prone position for a total of 14 anesthetized canines (seven canines with normal lungs and seven canines with diseased lungs). The elastix algorithm was used for DIR. The accuracy of DIR was evaluated based on the target registration error (TRE) of 50 anatomic pulmonary landmarks per subject for 10 randomly selected subjects as well as on singularities (i.e., regions where the displacement vector field is not bijective). Prior to perfusion computation, HUs of the precontrast end-inspiratory image were corrected for variation in the lung inflation level between the precontrast and postcontrast end-inspiratory CT scans, using a model built from two additional precontrast CT scans at end-expiration and midinspiration. The authors also assessed spatial heterogeneity and gravitationally directed gradients of regional perfusion for normal lung subjects and diseased lung subjects using a two-sample two-tailed t-test. The mean TRE

  2. Single-energy computed tomography-based pulmonary perfusion imaging: Proof-of-principle in a canine model

    International Nuclear Information System (INIS)

    Yamamoto, Tokihiro; Kent, Michael S.; Wisner, Erik R.; Johnson, Lynelle R.; Stern, Joshua A.; Qi, Lihong; Fujita, Yukio; Boone, John M.

    2016-01-01

    Purpose: Radiotherapy (RT) that selectively avoids irradiating highly functional lung regions may reduce pulmonary toxicity, which is substantial in lung cancer RT. Single-energy computed tomography (CT) pulmonary perfusion imaging has several advantages (e.g., higher resolution) over other modalities and has great potential for widespread clinical implementation, particularly in RT. The purpose of this study was to establish proof-of-principle for single-energy CT perfusion imaging. Methods: Single-energy CT perfusion imaging is based on the following: (1) acquisition of end-inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast agents, (2) deformable image registration (DIR) for spatial mapping of those two CT image data sets, and (3) subtraction of the precontrast image data set from the postcontrast image data set, yielding a map of regional Hounsfield unit (HU) enhancement, a surrogate for regional perfusion. In a protocol approved by the institutional animal care and use committee, the authors acquired CT scans in the prone position for a total of 14 anesthetized canines (seven canines with normal lungs and seven canines with diseased lungs). The elastix algorithm was used for DIR. The accuracy of DIR was evaluated based on the target registration error (TRE) of 50 anatomic pulmonary landmarks per subject for 10 randomly selected subjects as well as on singularities (i.e., regions where the displacement vector field is not bijective). Prior to perfusion computation, HUs of the precontrast end-inspiratory image were corrected for variation in the lung inflation level between the precontrast and postcontrast end-inspiratory CT scans, using a model built from two additional precontrast CT scans at end-expiration and midinspiration. The authors also assessed spatial heterogeneity and gravitationally directed gradients of regional perfusion for normal lung subjects and diseased lung subjects using a two-sample two-tailed t

  3. Polarographic measurement of ascorbate washout in isolated perfused rabbit hearts

    International Nuclear Information System (INIS)

    Arts, T.; Kuikka, J.T.; Reneman, R.S.; Bassingthwaighte, J.B.

    1985-01-01

    To study the myocardial washout of ascorbate, the applicability of polarographic detection of ascorbate ions by a platinum electrode (sensitive area 0.03 mm2) was investigated, in both a calibration setup (sampling flow along the electrode: 100 microliter X s-1) and isolated, retrogradely perfused rabbit hearts. In the calibration setup at pH 7.4, the sensitivity of the electrode was 70 microA/mol. This sensitivity increased moderately with increasing pH (13%/unit pH) and increasing sampling flow rate (14% at an increase from 100 to 150 microliter X s-1). In the isolated hearts, ascorbate infused into the aorta was detected in a right ventricular drain by the electrode as well as by the use of 14 C-labeled ascorbate. Both recorded time courses were similar except for a scaling factor dependent on flow velocity. During continuous infusion the arteriovenous difference of ascorbate was 2 +/- 2% (SD), indicating a relatively low consumption of ascorbate by the isolated heart. The authors conclude that polarographic measurement of ascorbate in the coronary effluent of an isolated rabbit heart can be performed on-line and relatively easily

  4. Isolation and phylogenetic characterization of Canine distemper virus from India.

    Science.gov (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

    2015-09-01

    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

  5. Release of galanin from isolated perfused porcine adrenal glands

    DEFF Research Database (Denmark)

    Holst, J J; Ehrhart-Bornstein, M; Messell, T

    1991-01-01

    We found a high concentration of galanin in extracts of porcine adrenal glands (114 pmol/g). By immunohistochemistry, galanin was localized to groups of medullary cells previously shown to produce norepinephrine. To study mechanisms for the release of galanin, we developed the following in vitro...... model: isolated perfused porcine adrenals with intact splanchnic nerve supply. When the nerves were electrically stimulated, epinephrine and norepinephrine secretion increased 276- and 291-fold, respectively, and galanin release increased up to 1,300-fold. Acetylcholine at 10(-6) M stimulated galanin...... release, and hexamethonium almost abolished the response to nerve stimulation. Galanin infusions had no effect on epinephrine and norepinephrine secretion in concentrations of 10(-8) and 10(-7) M, but increased both cortisol and aldosterone secretion (P less than 0.05). Splanchnic nerve stimulation...

  6. Multimodality functional imaging of spontaneous canine tumors using 64CU-ATSM and 18FDG PET/CT and dynamic contrast enhanced perfusion CT

    DEFF Research Database (Denmark)

    Hansen, Anders E; Kristensen, Annemarie T; Law, Ian

    2012-01-01

    To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated.......To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated....

  7. Isolated thoracic perfusion with chemofiltration for progressive malignant pleural mesothelioma

    Directory of Open Access Journals (Sweden)

    Aigner KR

    2017-06-01

    Full Text Available Karl Reinhard Aigner, Emir Selak, Sabine Gailhofer Department of Surgical Oncology, Medias Klinikum, Burghausen, Germany Introduction: Therapy of malignant pleural mesothelioma and especially the adequate role of surgery in this context remain the subject of controversial discussions. Radical surgery in particular, which is associated with substantial morbidity, failed to translate into a definite survival advantage. We report on interim results of an ongoing Phase II study of regional chemotherapy in terms of isolated thoracic perfusion with chemofiltration (ITP-F.Patients and methods: Twenty-eight patients (25 male, 3 female, mean age 63.4 years with advanced pleural mesothelioma were included in this study. Isolation of the chest was achieved by insertion of a venous and arterial stop-flow balloon catheter via a femoral access. The aorta and inferior vena cava were blocked at the level of the diaphragm and the upper arms were blocked by pneumatic cuffs. Chemotherapy, consisting of 60 mg/m² cisplatin and 15 mg/m² mitoxantrone, was administered directly into the aorta. The isolated circuit was maintained for 15 minutes followed by ~45 minutes of chemofiltration with a hemoprocessor until 5 L of filtrate were reached. The endpoints of the study were overall survival and quality of life (QoL.Results: Out of 28 patients enrolled in the study, 5 had prior surgeries, 10 patients had systemic chemotherapy, and 5 patients additional irradiation. In all patients in restaging, clinical progress was noted. In all, 162 cycles were administered. Due to chemofiltration, toxicity was within tolerable limits, revealing World Health Organization grade I leucopenia and thrombocytopenia in 9 patients and mucositis grade I in 6 patients. The major surgical complication was inguinal lymphatic fistula in 40% of the cases. Gastrointestinal toxicity and/or neurotoxicity were never observed. One-year survival was 49%, 2-year and 3-year survival was 31%, and 5

  8. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  9. Arterio-venous anastomoses in isolated, perfused rat lungs.

    Science.gov (United States)

    Conhaim, Robert L; Segal, Gilad S; Watson, Kal E

    2016-11-01

    Several studies have suggested that large-diameter (>25 μm) arterio-venous shunt pathways exist in the lungs of rats, dogs, and humans. We investigated the nature of these pathways by infusing specific-diameter fluorescent latex particles (4, 7, 15, 30, or 50 μm) into isolated, ventilated rat lungs perfused at constant pressure. All lungs received the same mass of latex (5 mg), which resulted in infused particle numbers that ranged from 1.7 × 10 7 4 μm particles to 7.5 × 10 4 50 μm particles. Particles were infused over 2 min. We used a flow cytometer to count particle appearances in venous effluent samples collected every 0.5 min for 12 min from the start of particle infusion. Cumulative percentages of infused particles that appeared in the samples averaged 3.17 ± 2.46% for 4 μm diameter particles, but ranged from 0.01% to 0.17% for larger particles. Appearances of 4 μm particles followed a rapid upslope beginning at 30 sec followed by a more gradual downslope that lasted for up to 12 min. All other particle diameters also began to appear at 30 sec, but followed highly irregular time courses. Infusion of 7 and 15 μm particles caused transient but significant perfusate flow reductions, while infusion of all other diameters caused insignificant reductions in flow. We conclude that small numbers of bypass vessels exist that can accommodate particle diameters of 7-to-50 μm. We further conclude that our 4 μm particle data are consistent with a well-developed network of serial and parallel perfusion pathways at the acinar level. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  10. The isolated perfused human skin flap model: A missing link in skin penetration studies?

    Science.gov (United States)

    Ternullo, Selenia; de Weerd, Louis; Flaten, Gøril Eide; Holsæter, Ann Mari; Škalko-Basnet, Nataša

    2017-01-01

    Development of effective (trans)dermal drug delivery systems requires reliable skin models to evaluate skin drug penetration. The isolated perfused human skin flap remains metabolically active tissue for up to 6h during in vitro perfusion. We introduce the isolated perfused human skin flap as a close-to-in vivo skin penetration model. To validate the model's ability to evaluate skin drug penetration the solutions of a hydrophilic (calcein) and a lipophilic (rhodamine) fluorescence marker were applied. The skin flaps were perfused with modified Krebs-Henseleit buffer (pH7.4). Infrared technology was used to monitor perfusion and to select a well-perfused skin area for administration of the markers. Flap perfusion and physiological parameters were maintained constant during the 6h experiments and the amount of markers in the perfusate was determined. Calcein was detected in the perfusate, whereas rhodamine was not detectable. Confocal images of skin cross-sections shoved that calcein was uniformly distributed through the skin, whereas rhodamine accumulated in the stratum corneum. For comparison, the penetration of both markers was evaluated on ex vivo human skin, pig skin and cellophane membrane. The proposed perfused flap model enabled us to distinguish between the penetrations of the two markers and could be a promising close-to-in vivo tool in skin penetration studies and optimization of formulations destined for skin administration. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Effects of Constant Flow vs. Constant Pressure Perfusion on Fluid Filtration in Severe Hypothermic Isolated Blood-Perfused Rat Lungs.

    Science.gov (United States)

    Halsøy, Kathrine; Kondratiev, Timofey; Tveita, Torkjel; Bjertnaes, Lars J

    2016-01-01

    Victims of severe accidental hypothermia are prone to fluid extravasation but rarely develop lung edema. We hypothesize that combined hypothermia-induced increase in pulmonary vascular resistance (PVR) and a concomitant fall in cardiac output protect the lungs against edema development. Our aim was to explore in hypothermic-isolated blood-perfused rat lungs whether perfusion at constant pressure influences fluid filtration differently from perfusion at constant flow. Isolated blood-perfused rat lungs were hanging freely in a weight transducer for measuring weight changes (ΔW). Fluid filtration coefficient (Kfc), was determined by transiently elevating left atrial pressure (Pla) by 5.8 mmHg two times each during normothermia (37°C) and during hypothermia (15°C). The lung preparations were randomized to two groups. One group was perfused with constant flow (Constant flow group) and the other group with constant pulmonary artery pressure (Constant PPA group). Microvascular pressure (Pmv) was determined before and during elevation of Pla (ΔPmv) by means of the double occlusion technique. Kfc was calculated with the formula Kfc = ΔW/ΔPmv/min. All Kfc values were normalized to predicted lung weight (P LW ), which was based on body weight (BW) according to the formula: P LW  = 0.0053 BW - 0.48 and presented as Kfc PLW in mg/min/mmHg/g. At cessation, bronchoalveolar lavage (BAL) fluid/perfusate protein concentration (B/P) ratio was determined photometrically. Data were analyzed with parametric or non-parametric tests as appropriate. p  Kfc PLW and B/P ratio increased significantly by more than 10-fold during hypothermia concerted by visible signs of edema in the trachea. Hemoglobin and hematocrit increased within the Constant flow group and between the groups at cessation of the experiments. In hypothermic rat lungs perfused at constant flow, fluid filtration coefficient per gram P LW and B/P ratio increased more than 10-fold concerted by increased

  12. Chronological analysis of canine parvovirus type 2 isolates in Japan.

    Science.gov (United States)

    Ohshima, Takahisa; Hisaka, Mitsuaki; Kawakami, Kazuo; Kishi, Masahiko; Tohya, Yukinobu; Mochizuki, Masami

    2008-08-01

    Fifty-five canine parvovirus type 2 (CPV) samples, 12 fecal specimens and 43 cell culture isolates, were examined for their genetic characteristics of VP2 gene. They were collected from the diseased dogs at various districts of Japan during 27 years from 1980 to 2006. A fragment of VP2 gene was analyzed by restriction fragment length polymorphism assay and DNA sequencing. The original antigenic type 2 of CPV (CPV-2) was no longer found in the samples since 1984, and two antigenic variants CPV-2a and CPV-2b replaced CPV-2 as predominant types for about 5 years from 1982. A new genetic variant of prototype CPV-2a with non-synonymous substitution at the VP2 amino acid residue 297 from Ser to Ala was first detected in 1987. New CPV-2b with the same amino acid substitution at position 297 as new CPV-2a was also detected from the samples collected in 1997. Since then new CPV-2b has been the predominant CPV over the field of Japan. Several additional amino acid substitutions were detected in the VP2 gene of some recent CPV strains. Neither CPV-2c(a), CPV-2c(b), nor "Glu-426" of the antigenic variants previously found outside the country was detected in any samples tested. Reactivity of new CPV-2a and 2b variants against antibodies produced by the current vaccine products was determined by a cross hemagglutination-inhibition test. The recent field CPV isolates reacted more efficiently to the antibodies produced in dogs vaccinated with the new CPV-2b vaccine strain than the conventional CPV-2 vaccine strain.

  13. Isolation of canine coronary sinus musculature from the atria by radiofrequency catheter ablation prevents induction of atrial fibrillation.

    Science.gov (United States)

    Morita, Hiroshi; Zipes, Douglas P; Morita, Shiho T; Wu, Jiashin

    2014-12-01

    The junction between the coronary sinus (CS) musculature and both atria contributes to initiation of atrial tachyarrhythmias. The current study investigated the effects of CS isolation from the atria by radiofrequency catheter ablation on the induction and maintenance of atrial fibrillation (AF). Using an optical mapping system, we mapped action potentials at 256 surface sites in 17 isolated and arterially perfused canine atrial tissues containing the entire musculature of the CS, right atrial septum, posterior left atrium, left inferior pulmonary vein, and vein of Marshal. Rapid pacing from each site before and after addition of acetylcholine (0.5 μmol/L) was applied to induce AF. Epicardial radiofrequency catheter ablation at CS-atrial junctions isolated the CS from the atria. Rapid pacing induced sustained AF in all tissues after acetylcholine. Microreentry within the CS drove AF in 88% of preparations. Reentries associated with the vein of Marshall (29%), CS-atrial junctions (53%), right atrium (65%), and pulmonary vein (76%) (frequently with 2-4 simultaneous circuits) were additional drivers of AF. Radiofrequency catheter ablation eliminated AF in 13 tissues before acetylcholine (Patrial tissue. The results suggest that CS can be a substrate of recurrent AF in patients after pulmonary vein isolation and that CS isolation might help prevent recurrent AF. © 2014 American Heart Association, Inc.

  14. Tissue distribution of enrofloxacin after intramammary or simulated systemic administration in isolated perfused sheep udders.

    Science.gov (United States)

    López Cadenas, Cristina; Fernández Martínez, Nélida; Sierra Vega, Matilde; Diez Liébana, Maria J; Gonzalo Orden, Jose M; Sahagún Prieto, Ana M; García Vieitez, Juan J

    2012-11-01

    To determine the tissue distribution of enrofloxacin after intramammary or simulated systemic administration in isolated perfused sheep udders by measuring its concentration at various sample collection sites. 26 udders (obtained following euthanasia) from 26 healthy lactating sheep. For each isolated udder, 1 mammary gland was perfused with warmed, gassed Tyrode solution. Enrofloxacin (1 g of enrofloxacin/5 g of ointment) was administered into the perfused gland via the intramammary route or systemically via the perfusion fluid (equivalent to a dose of 5 mg/kg). Samples of the perfusate were obtained every 30 minutes for 180 minutes; glandular tissue samples were obtained at 2, 4, 6, and 8 cm from the teat base after 180 minutes. The enrofloxacin content of the perfusate and tissue samples was analyzed via high-performance liquid chromatography with UV detection. After intramammary administration, maximun perfusate enrofloxacin concentration was detected at 180 minutes and, at this time, mean tissue enrofloxacin concentration was detected and mean tissue enrofloxacin concentration was 123.80, 54.48, 36.72, and 26.42 μg/g of tissue at 2, 4, 6, and 8 cm from the teat base, respectively. Following systemic administration, perfusate enrofloxacin concentration decreased with time and, at 180 minutes, tissue enrofloxacin concentrations ranged from 40.38 to 35.58 μg/g of tissue. By 180 minutes after administration via the intramammary or systemic route in isolated perfused sheep mammary glands, mean tissue concentration of enrofloxacin was greater than the minimum inhibitory concentration required to inhibit growth of 90% of many common mastitis pathogens in sheep. Use of either route of administration (or in combination) appears suitable for the treatment of acute mastitis in sheep.

  15. The effect of perfusion and irrigation flow rate variations on NaCl efflux from the isolated, perfused head of the marine teleost, Myoxocephalus octodecimspinosus

    International Nuclear Information System (INIS)

    Claiborne, J.B.; Evans, D.H.

    1981-01-01

    In vivo branchial blood pressure and unidirectional efflux values for NaCl were determined in the marine teleost, Myoxocephalus octodecimspinosus. Utilizing an isolated, perfused head preparation, perfused at in vivo pressure levels, NaCl efflux was measured and compared to in vivo values. The effect of variations in perfusion or irrigation rates on the ion efflux across the gills of the isolated head was also studied. The efflux of 22 Na from the isolated, perfused head was found to be similar to in vivo values and dependent on perfusion flow and pressure. In vitro 36 Cl efflux was lower than the efflux from intact animals and was determined to be flow/pressure independent. Irrigation rate changes at all rates tested did not affect the unidirectional efflux of either ion. (Auth.)

  16. Effect of perfusion and irrigation flow rate variations on NaCl efflux from the isolated, perfused head of the marine teleost, Myoxocephalus octodecimspinosus

    Energy Technology Data Exchange (ETDEWEB)

    Claiborne, J.B. (Miami Univ., Coral Gables, FL (USA)); Evans, D.H. (Mt. Desert Island Biological Laboratory, Salsbury Cove, ME, USA)

    1981-06-01

    In vivo branchial blood pressure and unidirectional efflux values for NaCl were determined in the marine teleost, Myoxocephalus octodecimspinosus. Utilizing an isolated, perfused head preparation, perfused at in vivo pressure levels, NaCl efflux was measured and compared to in vivo values. The effect of variations in perfusion or irrigation rates on the ion efflux across the gills of the isolated head was also studied. The efflux of /sup 22/Na from the isolated, perfused head was found to be similar to in vivo values and dependent on perfusion flow and pressure. In vitro /sup 36/Cl efflux was lower than the efflux from intact animals and was determined to be flow/pressure independent. Irrigation rate changes at all rates tested did not affect the unidirectional efflux of either ion.

  17. Management of isolated nonresectable liver metastases in colorectal cancer patients: a case-control study of isolated hepatic perfusion with melphalan versus systemic chemotherapy

    NARCIS (Netherlands)

    van Iersel, L. B. J.; Koopman, M.; van de Velde, C. J. H.; Mol, L.; van Persijn van Meerten, E. L.; Hartgrink, H. H.; Kuppen, P. J. K.; Vahrmeijer, A. L.; Nortier, J. W. R.; Tollenaar, R. A. E. M.; Punt, C.; Gelderblom, H.

    2010-01-01

    To compare the median overall survival of patients with isolated nonresectable liver metastases in comparable groups of patients treated with either isolated hepatic perfusion (IHP) with melphalan or systemic chemotherapy. Colorectal cancer patients with isolated liver metastases, who underwent IHP,

  18. Antimicrobial susceptibility profiles of Staphylococcus intermedius isolates from clinical cases of canine pyoderma in South Africa

    Directory of Open Access Journals (Sweden)

    Catherine A. Blunt

    2013-05-01

    Full Text Available Successful treatment of canine pyoderma has become compromised owing to the development of antimicrobial resistance with accompanying recurrence of infection. Canine skin samples submitted to a veterinary diagnostic laboratory for microbiological culture and sensitivity between January 2007 and June 2010, from which Staphylococcus intermedius was isolated, were selected for this investigation. Antimicrobial resistance of S. intermedius was most prevalent with reference to ampicillin followed by resistance to tetracycline and then potentiated sulphonamides. In general, antimicrobial resistance was low and very few methicillin-resistant isolates were detected. Temporal trends were not noted, except for ampicillin, with isolates becoming more susceptible, and potentiated sulphonamides (co-trimoxazole, with isolates becoming more resistant. In general, both the Kirby–Bauer disc diffusion and broth dilution minimum inhibitory concentration tests yielded similar results for the antimicrobial agents tested. The main difference was evident in the over-estimation of resistance by the Kirby–Bauer test for ampicillin, co-trimoxazole, penicillin and doxycycline. Knowledge of trends in bacterial resistance is important for veterinarians when presented with canine pyoderma. Analysis of antimicrobial susceptibility profiles of S. intermedius isolated from canine pyodermas will guide veterinarians’ use of the most appropriate agent and encourage prudent use of antimicrobials in companion animals.

  19. Sulphonylurea drugs reduce hypoxic damage in the isolated perfused rat kidney.

    Science.gov (United States)

    Engbersen, R; Moons, M M; Wouterse, A C; Dijkman, H B; Kramers, C; Smits, P; Russel, F G

    2000-08-01

    Sulphonylurea drugs have been shown to protect against hypoxic damage in isolated proximal tubules of the kidney. In the present study we investigated whether these drugs can protect against hypoxic damage in a whole kidney preparation. Tolbutamide (200 microM) and glibenclamide (10 microM) were applied to the isolated perfused rat kidney prior to changing the gassing from oxygen to nitrogen for 30 min. Hypoxic perfusions resulted in an increased fractional excretion of glucose (FE % glucose 14.3+/-1.5 for hypoxic perfusions vs 4.9+/-1.6 for normoxic perfusions, mean +/- s.e. mean, P<0.05), which could be completely restored by 200 microM tolbutamide (5.7+/-0.4 for tolbutamide vs 14.3+/-1.5 for untreated hypoxic kidneys, P<0.01). Furthermore, tolbutamide reduced the total amount of LDH excreted in the urine (220+/-100 mU for tolbutamide vs. 1220+/-160 mU for untreated hypoxic kidneys, P<0.01). Comparable results were obtained with glibenclamide (10 microM). In agreement with the effect on functional parameters, ultrastructural analysis of proximal tubules showed increased brush border preservation in tolbutamide treated kidneys compared to untreated hypoxic kidneys. We conclude that glibenclamide and tolbutamide are both able to reduce hypoxic damage to proximal tubules in the isolated perfused rat kidney when applied in the appropriate concentrations.

  20. A novel combination technique of cold crystalloid perfusion but not cold storage facilitates transplantation of canine hearts donated after circulatory death.

    Science.gov (United States)

    Rosenfeldt, Franklin; Ou, Ruchong; Salamonsen, Robert; Marasco, Silvana; Zimmet, Adam; Byrne, Joshua; Cosic, Filip; Saxena, Pankaj; Esmore, Donald

    2016-11-01

    Donation after circulatory death (DCD) represents a potential new source of hearts to increase the donor pool. We showed previously that DCD hearts in Greyhound dogs could be resuscitated and preserved by continuous cold crystalloid perfusion but not by cold static storage and could demonstrate excellent contractile and metabolic function on an in vitro system. In the current study, we demonstrate that resuscitated DCD hearts are transplantable. Donor Greyhound dogs (n = 12) were divided into perfusion (n = 8) and cold static storage (n = 4) groups. General anesthesia was induced and ventilation ceased for 30 minutes to achieve circulatory death. Donor cardiectomy was performed, and for 4 hours the heart was preserved by controlled reperfusion, followed by continuous cold perfusion with an oxygenated crystalloid perfusate or by static cold storage, after which orthotopic heart transplantation was performed. Recovery was assessed over 4 hours by hemodynamic monitoring. During cold perfusion, hearts showed continuous oxygen consumption and low lactate levels, indicating aerobic metabolism. The 8 dogs in the perfusion group were weaned off bypass, and 4 hours after bypass produced cardiac output of 4.73 ± 0.51 liters/min, left ventricular power of 7.63 ± 1.32 J/s, right ventricular power of 1.40 ± 0.43 J/s, and left ventricular fractional area shortening of 39.1% ± 5.2%, all comparable to pre-transplant values. In the cold storage group, 3 of 4 animals could not be weaned from cardiopulmonary bypass, and the fourth exhibited low-level function. Cold crystalloid perfusion, but not cold static storage, can resuscitate and preserve the DCD donor heart in a canine model of heart transplantation, thus rendering it transplantable. Controlled reperfusion and cold crystalloid perfusion have potential for clinical application in DCD transplantation. Copyright © 2016. Published by Elsevier Inc.

  1. The Use of Orthogonal Polarizations in Microwave Imagery of Isolated Canine Kidney

    Science.gov (United States)

    Larsen, L. E.; Jacobi, J. H.

    1980-06-01

    A method of imaging biological targets using microwave radiation at a frequency of 4 GHz is presented. Linearly polarized radiation is transmitted through an isolated canine kidney and received with co-polarized and cross-polarized antennas. Images are displayed as the spatial variation of the magnitude of the transmission scattering parameter S21 for each mode of polarization. The relationship between the spatial variation of the magnitude of S21 and canine renal anatomy is discussed. It is shown that within the kidney the cross-polarized image tends to emphasize linear or piecewise linear structures, whereas the co-polarized image balances renal cortical lobulations.

  2. Toxicity and Kinetics of (3H)Microcystin-LR in Isolated Perfused Rat Livers

    Science.gov (United States)

    1990-03-20

    with a Waters 490 multiwavelength detector, as described by Robinson et al. (1989). A C-18 column (Adsorbosphere HS, 4.6 x 250 mm, 5 Am, Alltech ...1988). The isolated perfused liver has several advantages over other model systems for the study of hepatotoxins. Unlike the in-vitro cell systems

  3. Major amputation for intractable extremity melanoma after failure of isolated limb perfusion

    NARCIS (Netherlands)

    Kapma, M. R.; Vrouenraets, B. C.; Nieweg, O. E.; van Geel, A. N.; Noorda, E. M.; Eggermont, A. M. M.; Kroon, B. B. R.

    2005-01-01

    AIM: The aim of this study was to analyse indications and results of amputation for intractable extremity melanoma after failure of isolated limb perfusion (ILP). METHODS: Between 1978 and 2001, 451 patients with loco-regional advanced extremity melanoma underwent 505 ILPs. Amputation of the

  4. Cell-swelling-induced taurine release from isolated perfused rat liver

    NARCIS (Netherlands)

    Brand, H. S.; Meijer, A. J.; Gustafson, L. A.; Jörning, G. G.; Leegwater, A. C.; Maas, M. A.; Chamuleau, R. A.

    1994-01-01

    Astrocytes and lymphocytes are able to release significant amounts of taurine during periods of hypotonicity to reduce the increase in cell volume. To investigate this mechanism in the liver, we studied the release of free amino acids from isolated perfused rat liver during hypotonicity. The

  5. Hypercapnic acidosis modulates inflammation, lung mechanics, and edema in the isolated perfused lung.

    Science.gov (United States)

    De Smet, Hilde R; Bersten, Andrew D; Barr, Heather A; Doyle, Ian R

    2007-12-01

    Low tidal volume (V(T)) ventilation strategies may be associated with permissive hypercapnia, which has been shown by ex vivo and in vivo studies to have protective effects. We hypothesized that hypercapnic acidosis may be synergistic with low V(T) ventilation; therefore, we studied the effects of hypercapnia and V(T) on unstimulated and lipopolysaccharide-stimulated isolated perfused lungs. Isolated perfused rat lungs were ventilated for 2 hours with low (7 mL/kg) or moderately high (20 mL/kg) V(T) and 5% or 20% CO(2), with lipopolysaccharide or saline added to the perfusate. Hypercapnia resulted in reduced pulmonary edema, lung stiffness, tumor necrosis factor alpha (TNF-alpha) and interleukin 6 (IL-6) in the lavage and perfusate. The moderately high V(T) did not cause lung injury but increased lavage IL-6 and perfusate IL-6 as well as TNF-alpha. Pulmonary edema and respiratory mechanics improved, possibly as a result of a stretch-induced increase in surfactant turnover. Lipopolysaccharide did not induce significant lung injury. We conclude that hypercapnia exerts a protective effect by modulating inflammation, lung mechanics, and edema. The moderately high V(T) used in this study stimulated inflammation but paradoxically improved edema and lung mechanics with an associated increase in surfactant release.

  6. Kinetics of reversible-sequestration of leukocytes by the isolated perfused rat lung

    Energy Technology Data Exchange (ETDEWEB)

    Goliaei, B.

    1980-08-01

    The kinetics and morphology of sequestration and margination of rat leukocytes were studied using an isolated perfused and ventilated rat lung preparation. Whole rat blood, bone marrow suspension, or leukocyte suspensions, were used to perfuse the isolated rat lung. The lung was also perfused with latex particle suspensions and the passage of particles through the lung capillaries was studied. When a leukocyte suspension was perfused through the lung in the single-pass mode, the rate of sequestration decreased as more cells were perfused. In contrast, latex particles of a size comparable to that of leukocytes were totally stopped by the lung. When the leukocyte suspension was recirculated through the lung, cells were rapidly removed from circulation until a steady state was reached, after which no net removal of cells by the lung occurred. These results indicate that leukocytes are reversibly sequestered from circulation. The sequestered cells marginated and attached to the luminal surface of the endothelium of post-capillary venules and veins. A mathematical model was developed based on the assumption that the attachment and detachment of leukocytes to blood vessel walls follows first-order kinetics. The model correctly predicts the following characteristics of the system: (a) the kinetics of the sequestration of leukocytes by the lung; (b) the existence of a steady state when a suspension of leukocytes is recirculated through the lung; and (c) the independence of the fraction of cells remaining in circulation from the starting concentration for all values of starting concentration. (ERB)

  7. Effects of vasopressin on the isolated perfused human collecting tubule.

    Science.gov (United States)

    Yanagawa, N; Trizna, W; Bar-Khayim, Y; Fine, L G

    1981-05-01

    Cortical collecting tubules (CCT) were dissected from the surviving normal tissue of human kidneys removed at operation for either carcinoma or calculus. These CCT's were perfused in vitro shortly after the nephrectomy was performed. Transtubular potential differences in different tubules varied from +3.2 to -2.0 mV and were reduced towards zero by lowering the temperature or by adding ouabain to the bath. In the absence of vasopressin, tubules were essentially impermeable to water with extremely low net water fluxes even in the presence of a transtubular osmotic gradient. Addition of vasopressin to the bath caused the transtubular osmotic water permeability coefficient to increase to values of 125, 175, and 155 X 10(-4) cm/sec in three tubules thus studied. These results demonstrate close similarities between the human CCT and the more extensively studied rabbit CCT.

  8. NMR study of damage on isolated perfused rat heart exposed to ischemia and hypoxia

    International Nuclear Information System (INIS)

    Luo Xuechun; Yan Yongbin; Zhang Riqing; Fan Lili

    2001-01-01

    Myocardial ischemia is the most common and primary cause of myocardium damage. Numerous conventional techniques and methods have been developed for ischemia and reperfusion studies. However, because of damage to the heart sample, most of these techniques can not be used to continuously monitor the full dynamic course of the myocardial metabolic pathway. The nuclear magnetic resonance (NMR) surface coil technique, which overcomes the limitations of conventional instrumentation, can be used to quantitatively study every stage of the perfused heart (especially after perfusion stoppage) continuously, dynamically, and without damage under normal or designed physiological conditions at the molecular level. In this paper, 31 P-NMR was used to study the effects of ischemia and hypoxia on isolated perfused hearts. The results show that complete hypoxia caused more severe functional damage to the myocardial cells than complete ischemia

  9. New method of isolation and perfusion of rat pancreas for phosphorus nucletic resonance study

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Takehisa; Kanno, Tomio; Murakami, Masataka; Watari, Hiroshi; Seo, Yoshiteru

    1988-02-01

    Phosphorus nuclear magnetic resonance (/sup 31/P-NMR) was applied to measure phosphorus metabolites in the pancreas. Rat pancreatic gland was isolated and perfused with a modified Krebs-Henseleit solution at room temperature (25 deg C). Removal of the duodenum from the pancreas made it possible to record /sup 31/P-NMR spectra only from the pancreatic tissue. /sup 31/P signals of creatine phosphate (PCr), ATP and inorganic phosphate (Pi) were observed in all the glands. In different individual glands, the Signal intensity of PCr varied, but those of ATP were almost the same. The initial levels of all the phosphorus metabolites in individual glands remained almost unchanged during perfusion with the standard solution for 2 hours. When the perfusion was stopped, signal intensity of ATP and PCr decreased while Pi resonance increased and shifted to a higher magnetic field, indicating tissue acidification. On re-perfusion, each resonance and tissue pH were restored to the respective initial resting levels. Continuous stimulation with 0.3 ..mu..M acetylcholine (ACh) or 0.1 nM CCK-8 caused a markedly larger increase in pancreatic exocrine secretion than that observed in the perfused pancreas which was prepared by the previous method. Continuous stimulation with 0.1 ..mu..M ACh caused a marked and sustained increase in pancreatic exocrine secretion. During the stimulation, the resonances of phosphorus energy metabolites and tissue pH remained almost unchanged. These results indicate that the isolated perfused rat pancreas which is prepared by our new method is a useful preparation for analysis of secretion-metabolism coupling in the exocrine pancreas.

  10. TU-CD-BRA-08: Single-Energy Computed Tomography-Based Pulmonary Perfusion Imaging: Proof-Of-Principle in a Canine Model

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, T; Boone, J [University of California Davis School of Medicine, Sacramento, CA (United States); Kent, M; Wisner, E [University of California Davis School of Veterinary Medicine, Davis, CA (United States); Fujita, Y [Tokai University, Isehara (Japan)

    2015-06-15

    Purpose: Pulmonary perfusion imaging has provided significant insights into pulmonary diseases, and can be useful in radiotherapy. The purpose of this study was to prospectively establish proof-of-principle in a canine model for single-energy CT-based perfusion imaging, which has the potential for widespread clinical implementation. Methods: Single-energy CT perfusion imaging is based on: (1) acquisition of inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast medium, (2) deformable image registration (DIR) of the two CT image data sets, and (3) subtraction of the pre-contrast image from post-contrast image, yielding a map of Hounsfield unit (HU) enhancement. These subtraction image data sets hypothetically represent perfused blood volume, a surrogate for perfusion. In an IACUC-approved clinical trial, we acquired pre- and post-contrast CT scans in the prone posture for six anesthetized, mechanically-ventilated dogs. The elastix algorithm was used for DIR. The registration accuracy was quantified using the target registration errors (TREs) for 50 pulmonary landmarks in each dog. The gradient of HU enhancement between gravity-dependent (ventral) and non-dependent (dorsal) regions was evaluated to quantify the known effect of gravity, i.e., greater perfusion in ventral regions. Results: The lung volume difference between the two scans was 4.3±3.5% on average (range 0.3%–10.1%). DIR demonstrated an average TRE of 0.7±1.0 mm. HU enhancement in lung parenchyma was 34±10 HU on average and varied considerably between individual dogs, indicating the need for improvement of the contrast injection protocol. HU enhancement in ventral (gravity-dependent) regions was found to be greater than in dorsal regions. A population average ventral-to-dorsal gradient of HU enhancement was strong (R{sup 2}=0.94) and statistically significant (p<0.01). Conclusion: This canine study demonstrated relatively accurate DIR and a strong ventral

  11. TU-CD-BRA-08: Single-Energy Computed Tomography-Based Pulmonary Perfusion Imaging: Proof-Of-Principle in a Canine Model

    International Nuclear Information System (INIS)

    Yamamoto, T; Boone, J; Kent, M; Wisner, E; Fujita, Y

    2015-01-01

    Purpose: Pulmonary perfusion imaging has provided significant insights into pulmonary diseases, and can be useful in radiotherapy. The purpose of this study was to prospectively establish proof-of-principle in a canine model for single-energy CT-based perfusion imaging, which has the potential for widespread clinical implementation. Methods: Single-energy CT perfusion imaging is based on: (1) acquisition of inspiratory breath-hold CT scans before and after intravenous injection of iodinated contrast medium, (2) deformable image registration (DIR) of the two CT image data sets, and (3) subtraction of the pre-contrast image from post-contrast image, yielding a map of Hounsfield unit (HU) enhancement. These subtraction image data sets hypothetically represent perfused blood volume, a surrogate for perfusion. In an IACUC-approved clinical trial, we acquired pre- and post-contrast CT scans in the prone posture for six anesthetized, mechanically-ventilated dogs. The elastix algorithm was used for DIR. The registration accuracy was quantified using the target registration errors (TREs) for 50 pulmonary landmarks in each dog. The gradient of HU enhancement between gravity-dependent (ventral) and non-dependent (dorsal) regions was evaluated to quantify the known effect of gravity, i.e., greater perfusion in ventral regions. Results: The lung volume difference between the two scans was 4.3±3.5% on average (range 0.3%–10.1%). DIR demonstrated an average TRE of 0.7±1.0 mm. HU enhancement in lung parenchyma was 34±10 HU on average and varied considerably between individual dogs, indicating the need for improvement of the contrast injection protocol. HU enhancement in ventral (gravity-dependent) regions was found to be greater than in dorsal regions. A population average ventral-to-dorsal gradient of HU enhancement was strong (R"2=0.94) and statistically significant (p<0.01). Conclusion: This canine study demonstrated relatively accurate DIR and a strong ventral

  12. Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies

    Directory of Open Access Journals (Sweden)

    R Puentes

    2012-09-01

    Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.

  13. Isolation, culture expansion and characterization of canine bone marrow derived mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    D Kazemi

    2016-07-01

    Full Text Available The purpose of the present study was to isolate, culture expand and characterize canine bone marrow derived mesenchymal stem cells. Bone marrow aspirates of 15 adult male dogs were collected to this end and their mononuclear cells isolated by centrifugation and cultured in standard media. The adherent cells were isolated and their mesenchymal origin was confirmed at 3rd passage by cellular morphology, expression of surface antigens and differentiation to osteogenic and adipogenic lineage. After 4 days, spindle shaped fibroblast like cells which were apparently bone marrow derived mesenchymal stem cells appeared in culture medium and their numbers increased over time. The cells reached 3rd passage with over 75% confluent after a mean of 22.89±5.75 days. Flow cytometric analysis revealed that the cells negatively expressed CD34 and CD45 antigens while positively expressing CD44 and CD105 antigens. Differentiation into osteogenic and adipogenic lineage had taken place after one month culture in induction medium. VDR, COL1A1, BGLAP and SPARC gene expression indicated that mesenchymal stem cells isolated from canine bone marrow had differentiated into osteogenic lineage. These findings can form the basis of any forthcoming clinical studies involving the use of canine mesenchymal stem cells particularly in the field of bone and cartilage regeneration.

  14. Uptake, incorporation and metabolism of (3H)triolein in the isolated perfused rabbit heart

    International Nuclear Information System (INIS)

    Weis, M.T.; Palazzo, A.J.; Williams, J.L. Jr.; Malik, K.U.

    1990-01-01

    The purpose of these experiments was to study the uptake and metabolism of exogenous triglyceride in the isolated perfused rabbit heart. When infused into the rabbit heart, [9,10-3H(N)]triolein was retained and incorporated into a lipid fraction that had the chromatographic mobility of authentic triolein. Incorporation of labeled triolein was not likely to be the result of a lipoprotein lipase-mediated lipolysis/resynthesis cycle, since: (i) The distribution of radioactivity following administration of [3H]oleic acid was markedly different from the distribution of radioactivity following the administration of [3H]triolein; (ii) heparin was administered to the rabbits at the time of sacrifice; and (iii) the hearts were perfused with a protein-free buffer for 20 min prior to the labelling period. When isoproterenol was administered to hearts labelled with [3H]triolein, there was an increased output of total radioactivity, composed of labelled free fatty acids, diacylglycerol and monoacylglycerol. In these same hearts, there was an increased output of glycerol in response to isoproterenol. However, following the administration of bradykinin or angiotensin II, neither the radioactivity nor the glycerol content of the perfusate was changed. These data suggest that [3H]triolein is selectively incorporated into the triglyceride pool of the isolated perfused rabbit heart. Furthermore, this [3H]triolein is available to hormonally-activated lipolytic enzymes

  15. Radiation exposure to surgical staff during hyperthermic isolated limb perfusion with 99m Technetium labeled red blood cells

    DEFF Research Database (Denmark)

    Kristoffersen, Ulrik Sloth; Straalman, Kristina; Schmidt, Grethe

    2009-01-01

    PURPOSE: Hyperthermic isolated limb perfusion (HILP) is an effective method in the treatment of recurrent melanomas and soft tissue sarcomas. To avoid systemic toxicity, leakage from the limb perfusate into the systemic circulation is real-time monitored by administration of a radioactive agent...

  16. EFFECT OF ETHANOL ON HEPATOBILIARY TRANSPORT OF CATIONIC DRUGS - A STUDY IN THE ISOLATED-PERFUSED RAT-LIVER, RAT HEPATOCYTES AND RAT MITOCHONDRIA

    NARCIS (Netherlands)

    STEEN, H; MEIJER, DKF; Merema, M.T.

    The effect of ethanol on the hepatic uptake of various cationic drugs was studied in isolated perfused rat livers, isolated rat hepatocytes and isolated rat liver mitochondria. In isolated rat hepatocytes and in isolated perfused rat livers, the uptake of the model organic cation

  17. Percutaneous Isolated Hepatic Perfusion for the Treatment of Unresectable Liver Malignancies

    Energy Technology Data Exchange (ETDEWEB)

    Burgmans, Mark C., E-mail: m.c.burgmans@lumc.nl [Leiden University Medical Centre, Department of Radiology (Netherlands); Leede, Eleonora M. de, E-mail: e.m.de-leede@lumc.nl [Leiden University Medical Centre, Department of Surgery (Netherlands); Martini, Christian H., E-mail: c.h.martini@lumc.nl [Leiden University Medical Centre, Department of Anesthesiology (Netherlands); Kapiteijn, Ellen, E-mail: h.w.kapiteijn@lumc.nl [Leiden University Medical Centre, Department of Medical Oncology (Netherlands); Vahrmeijer, Alexander L., E-mail: a.l.vahrmeijer@lumc.nl [Leiden University Medical Centre, Department of Surgery (Netherlands); Erkel, Arian R. van, E-mail: a.r.van-erkel@lumc.nl [Leiden University Medical Centre, Department of Radiology (Netherlands)

    2016-06-15

    Liver malignancies are a major burden of disease worldwide. The long-term prognosis for patients with unresectable tumors remains poor, despite advances in systemic chemotherapy, targeted agents, and minimally invasive therapies such as ablation, chemoembolization, and radioembolization. Thus, the demand for new and better treatments for malignant liver tumors remains high. Surgical isolated hepatic perfusion (IHP) has been shown to be effective in patients with various hepatic malignancies, but is complex, associated with high complication rates and not repeatable. Percutaneous isolated liver perfusion (PHP) is a novel minimally invasive, repeatable, and safer alternative to IHP. PHP is rapidly gaining interest and the number of procedures performed in Europe now exceeds 200. This review discusses the indications, technique and patient management of PHP and provides an overview of the available data.

  18. Percutaneous Isolated Hepatic Perfusion for the Treatment of Unresectable Liver Malignancies

    International Nuclear Information System (INIS)

    Burgmans, Mark C.; Leede, Eleonora M. de; Martini, Christian H.; Kapiteijn, Ellen; Vahrmeijer, Alexander L.; Erkel, Arian R. van

    2016-01-01

    Liver malignancies are a major burden of disease worldwide. The long-term prognosis for patients with unresectable tumors remains poor, despite advances in systemic chemotherapy, targeted agents, and minimally invasive therapies such as ablation, chemoembolization, and radioembolization. Thus, the demand for new and better treatments for malignant liver tumors remains high. Surgical isolated hepatic perfusion (IHP) has been shown to be effective in patients with various hepatic malignancies, but is complex, associated with high complication rates and not repeatable. Percutaneous isolated liver perfusion (PHP) is a novel minimally invasive, repeatable, and safer alternative to IHP. PHP is rapidly gaining interest and the number of procedures performed in Europe now exceeds 200. This review discusses the indications, technique and patient management of PHP and provides an overview of the available data.

  19. Metabolism of 1-[14C]nitropyrene in isolated perfused rat livers

    International Nuclear Information System (INIS)

    Bond, J.A.; Medinsky, M.A.; Dutcher, J.S.

    1984-01-01

    1-Nitropyrene (1-NP), a constituent of diesel exhaust, is carcinogenic to rats and is a bacterial and mammalian mutagen. Biliary and fecal excretion of 1-NP metabolites are the major routes of excretion in rats, suggesting that hepatic metabolism plays a dominant role in determining the biological fate of 1-NP. The purpose of this investigation was to quantitate 1-[14C]NP metabolites formed in isolated perfused rat livers and excreted in bile from rats. Perfused rat livers displayed a capacity for oxidation, reduction, acetylation, and conjugation of 1-NP (or its metabolites). Reduction of 1-NP followed by N-acetylation was the major metabolic pathway observed in the perfused livers. Acetylaminopyrene (AAP) was the major metabolite detected, with total quantities (150 nmol) accounting for about 60% of the total 1-[14C]NP dose (258 nmol) added to the perfusate. Considerably smaller quantities of aminopyrene and hydroxynitropyrenes were also detected. Livers perfused with 1-[14C]NP excreted about 36 nmol equivalents of 1-[14C]NP (12% of the total 1-NP dose) in bile after 60 min. Some of the biliary metabolites were tentatively identified as metabolites of the mercapturic acid pathway. The spectrum of biliary metabolites was qualitatively identical to that seen in bile from intact rats. Quantities of 14C covalently bound to hepatic macromolecules from perfused livers were 0.4 nmol 1-NP eq/g liver. The data from this study indicate that the liver may be an important site for metabolism of 1-NP

  20. Monitoring system for isolated limb perfusion based on a portable gamma camera

    International Nuclear Information System (INIS)

    Orero, A.; Muxi, A.; Rubi, S.; Duch, J.; Vidal-Sicart, S.; Pons, F.; Roe, N.; Rull, R.; Pavon, N.; Pavia, J.

    2009-01-01

    Background: The treatment of malignant melanoma or sarcomas on a limb using extremity perfusion with tumour necrosis factor (TNF-α) and melphalan can result in a high degree of systemic toxicity if there is any leakage from the isolated blood territory of the limb into the systemic vascular territory. Leakage is currently controlled by using radiotracers and heavy external probes in a procedure that requires continuous manual calculations. The aim of this work was to develop a light, easily transportable system to monitor limb perfusion leakage by controlling systemic blood pool radioactivity with a portable gamma camera adapted for intraoperative use as an external probe, and to initiate its application in the treatment of MM patients. Methods: A special collimator was built for maximal sensitivity. Software for acquisition and data processing in real time was developed. After testing the adequacy of the system, it was used to monitor limb perfusion leakage in 16 patients with malignant melanoma to be treated with perfusion of TNF-α and melphalan. Results: The field of view of the detector system was 13.8 cm, which is appropriate for the monitoring, since the area to be controlled was the precordial zone. The sensitivity of the system was 257 cps/MBq. When the percentage of leakage reaches 10% the associated absolute error is ±1%. After a mean follow-up period of 12 months, no patients have shown any significant or lasting side-effects. Partial or complete remission of lesions was seen in 9 out of 16 patients (56%) after HILP with TNF-α and melphalan. Conclusion: The detector system together with specially developed software provides a suitable automatic continuous monitoring system of any leakage that may occur during limb perfusion. This technique has been successfully implemented in patients for whom perfusion with TNF-α and melphalan has been indicated. (orig.)

  1. Monitoring system for isolated limb perfusion based on a portable gamma camera

    Energy Technology Data Exchange (ETDEWEB)

    Orero, A.; Muxi, A.; Rubi, S.; Duch, J. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); Vidal-Sicart, S.; Pons, F. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); Inst. d' Investigacions Biomediques August Pi i Sunyer (IDIBAPS), Barcelona (Spain); Red Tematica de Investigacion Cooperativa en Cancer (RTICC), Barcelona (Spain); Roe, N. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); CIBER de Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), Barcelona (Spain); Rull, R. [Servei de Cirurgia, Hospital Clinic, Barcelona (Spain); Pavon, N. [Inst. de Fisica Corpuscular, CSIC - UV, Valencia (Spain); Pavia, J. [Servei de Medicina Nuclear, Hospital Clinic, Barcelona (Spain); Inst. d' Investigacions Biomediques August Pi i Sunyer (IDIBAPS), Barcelona (Spain); CIBER de Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), Barcelona (Spain)

    2009-07-01

    Background: The treatment of malignant melanoma or sarcomas on a limb using extremity perfusion with tumour necrosis factor (TNF-{alpha}) and melphalan can result in a high degree of systemic toxicity if there is any leakage from the isolated blood territory of the limb into the systemic vascular territory. Leakage is currently controlled by using radiotracers and heavy external probes in a procedure that requires continuous manual calculations. The aim of this work was to develop a light, easily transportable system to monitor limb perfusion leakage by controlling systemic blood pool radioactivity with a portable gamma camera adapted for intraoperative use as an external probe, and to initiate its application in the treatment of MM patients. Methods: A special collimator was built for maximal sensitivity. Software for acquisition and data processing in real time was developed. After testing the adequacy of the system, it was used to monitor limb perfusion leakage in 16 patients with malignant melanoma to be treated with perfusion of TNF-{alpha} and melphalan. Results: The field of view of the detector system was 13.8 cm, which is appropriate for the monitoring, since the area to be controlled was the precordial zone. The sensitivity of the system was 257 cps/MBq. When the percentage of leakage reaches 10% the associated absolute error is {+-}1%. After a mean follow-up period of 12 months, no patients have shown any significant or lasting side-effects. Partial or complete remission of lesions was seen in 9 out of 16 patients (56%) after HILP with TNF-{alpha} and melphalan. Conclusion: The detector system together with specially developed software provides a suitable automatic continuous monitoring system of any leakage that may occur during limb perfusion. This technique has been successfully implemented in patients for whom perfusion with TNF-{alpha} and melphalan has been indicated. (orig.)

  2. Compartment analysis of 125I-labelled albumin washout from coronary vessels of isolated perfused hearts

    International Nuclear Information System (INIS)

    Cheng Eap Ng; Seh-Hoon Song

    1978-01-01

    Albumin labelled with 125 I was used as a tracer to investigate the washout kinetics of plasma from the coronary circulation of isolated perfused feline hearts. Compartmentalization with experimental results showed at least two compartments. The model was compared with a three-compartment model found previously for red blood cells. The results indicate that there is a separation of plasma and RBC in the coronary microcirculation. (author)

  3. Chamber-specific effects of hypokalaemia on ventricular arrhythmogenicity in isolated, perfused guinea-pig heart

    DEFF Research Database (Denmark)

    Osadchii, Oleg E; Bentzen, Bo Hjorth; Olesen, Søren-Peter

    2009-01-01

    of hypokalaemic perfusion (2.5 mm K(+) for 30 min) were assessed in isolated guinea-pig heart preparations using simultaneous recordings of volume-conducted electrocardiogram and monophasic action potentials from six ventricular epicardial sites. Effective refractory periods, ventricular fibrillation thresholds...... for re-entrant tachyarrhythmias. Taken together, these findings suggest that proarrhythmic effects of hypokalaemia are mostly attributed to increased LV arrhythmogenicity in the guinea-pig heart....

  4. Correlation between melphalan pharmacokinetics and hepatic toxicity following hyperthermic isolated liver perfusion for unresectable metastatic disease.

    Science.gov (United States)

    Mocellin, Simone; Pilati, Pierluigi; Da Pian, Pierpaolo; Forlin, Marco; Corazzina, Susanna; Rossi, Carlo Riccardo; Innocente, Federico; Ori, Carlo; Casara, Dario; Ujka, Francesca; Nitti, Donato; Lise, Mario

    2007-02-01

    In the present work, we report on the results of our pilot study of hyperthermic isolated hepatic perfusion (IHP) with melphalan alone for patients with unresectable metastatic liver tumors refractory to conventional treatments, with particular regard to the correlation between pharmacokinetic findings and hepatic toxicity. Inclusion criteria were unresectable liver metastases, hepatic parenchyma replacement isolation of the liver and drug distribution volumes of the perfusion circuit were assessed by a radiolabeled albumin-based method. Drug concentrations in perfusate and plasma were measured by means of high-performance liquid chromatography (HPLC). Twenty patients with unresectable liver metastases underwent IHP. No intraoperative mortality occurred. Treatment-related systemic toxicity was minimal and reversible. Three patients (15%) experienced grade 4 hepatic toxicity and died due to liver failure and subsequent multiorgan failure. Other six patients had significant (grade 3-4) but transitory hepatic toxicity. Complete and partial responses were observed in three and nine out of 17 evaluable patients, respectively (overall response rate = 70%). The pharmacokinetics study showed a 3% mean perfusate-to-plasma drug leakage (range 1-6%). Logistic regression analysis showed that drug concentration in the perfusate circuit, but not preoperative tests, significantly and independently correlated with hepatic toxicity (P = 0.028). Following melphalan-based IHP, objective tumor regression could be observed in a remarkable percentage of patients refractory to standard treatments. However, hepatic toxicity and related mortality were significant. Our findings suggest that drug dosage personalization based on the measurement of drug distribution volumes might minimize

  5. Isolation and identification of Helicobacter spp, from canine and feline gastric mucosa

    DEFF Research Database (Denmark)

    Jalava, K.; On, Stephen L.W.; VanDamme, P.A.R.

    1998-01-01

    It is known that virtually all healthy adult dogs and cats harbor spiral helicobacters in their gastric mucosa, Three species, Helicobacter felis, Helicobacter bizzozeronii, and Helicobacter salomonis have been isolated in vitro from the gastric mucosa of these animals. The aims of this study were...... conventional phenotypic tests, whole-cell protein profiling, and ultrastructural analysis in identifying the different species isolated from canine and feline gastric mucose. We cultured 95 and 22 gastric mucosal biopsies from dogs and cats, respectively. Twenty-one H. bizzozeronii strains, 8 H. felis strains......, 8 H. salomonis strains, 3 mixed cultures, 2 "Flexispira rappini"-like organisms, and 3 as get uncharacterized strains were isolated from the dogs, and 3 H. felis strains were isolated from the cats. The methods used here yielded Helicobacter isolation rates of 51% from dogs and 13.6% from cats...

  6. Initial intramuscular perfusion pressure predicts early skeletal muscle function following isolated tibial fractures

    Directory of Open Access Journals (Sweden)

    Haas Norbert P

    2008-04-01

    Full Text Available Abstract Background The severity of associated soft tissue trauma in complex injuries of the extremities guides fracture treatment and decisively determines patient's prognosis. Trauma-induced microvascular dysfunction and increased tissue pressure is known to trigger secondary soft tissue damage and seems to adversely affect skeletal muscle function. Methods 20 patients with isolated tibial fractures were included. Blood pressure and compartment pressure (anterior and deep posterior compartment were measured continuously up to 24 hours. Corresponding perfusion pressure was calculated. After 4 and 12 weeks isokinetic muscle peak torque and mean power of the ankle joint in dorsal and plantar flexion were measured using a Biodex dynamometer. Results A significant inverse correlation between the anterior perfusion pressure at 24 hours and deficit in dorsiflexion at 4 weeks was found for both, the peak torque (R = -0.83; p Conclusion The functional relationship between the decrease in intramuscular perfusion pressures and muscle performance in the early rehabilitation period indicate a causative and prognostic role of early posttraumatic microcirculatory derangements and skeletal muscle function. Therapeutic concepts aimed at effective muscle recovery, early rehabilitation, and decreased secondary tissue damage, should consider the maintenance of an adequate intramuscular perfusion pressure.

  7. Preliminary development of a live attenuated canine parvovirus vaccine from an isolate of British origin.

    Science.gov (United States)

    Churchill, A E

    1987-04-04

    Canine parvovirus isolated from a case of haemorrhagic enteritis in a breeding kennel in England was passaged and cloned in cultured feline and canine cells. No significant evidence of pathogenicity was found during six serial passages of the modified virus back through young dogs. The attenuated virus was excreted by inoculated animals and spread rapidly to uninoculated animals held in contact. When high titre attenuated virus was given to the six-week-old offspring of a seropositive dam a prompt seroconversion was observed. When the attenuated virus was used as an experimental vaccine in 108 pups in an infected breeding colony a highly significant improvement was obtained in the accumulated morbidity and mortality compared with a parallel group vaccinated with modified live feline panleucopenia virus.

  8. Isolated Liver Perfusion Using Percutaneous Methods:[ql An Experimental Study in the Pig

    International Nuclear Information System (INIS)

    Harnek, Jan; Cwikiel, Wojciech; Bergqvist, Lennart; Persson, Bo; Stridbeck, Hans

    1996-01-01

    Purpose: To develop a method for isolated perfusion of the liver using radiological methods. Methods: Twenty-one pigs, weighing about 20 kg, were divided into three groups. By transjugular and transfemoral approaches two occlusion balloons were placed in the inferior vena cava cranial and caudal, respectively, to the origin of the hepatic veins. One occlusion balloon was placed transfemorally in the common hepatic artery. Another occlusion balloon was inserted in the main branch of the portal vein via the transjugular-transhepatic approach in 11 pigs (groups 1 and 2), and in 10 pigs (group 3) by a percutaneous transhepatic route. After inflation of the balloons, patency of the isolated liver circulation was evaluated by recirculation of 99 Tc m -labelled human albumin during 30 min. Blood tests were obtained after 1, 3, 5, 10, 15, and 30 min to evaluate leakage from the liver to the systemic circulation. Results: Increasing leakage to the systemic circulation from the isolated liver circulation was observed in groups 1 and 2. In the third group the leakage was less than 10%. Conclusion: In an experimental animal model, isolated perfusion of the liver with minor leakage to the systemic circulation may be achieved using radiological methods

  9. Conversion of p-tyrosine to p-tyramine in the isolated perfused rat kidney: Modulation by perfusate concentrations of p-tyrosine

    International Nuclear Information System (INIS)

    Brier, M.E.; Bowsher, R.R.; Henry, D.P.; Mayer, P.R.

    1991-01-01

    The authors used the isolated perfused rat kidney to evaluate the role of renal decarboxylation of p-tyrosine as the source of urinary p-tyramine. Kidneys were perfused with concentrations of p-tyrosine ranging from 0.02 mM to 2.0 mM. p-Tyramine was measured by a sensitive and specific radioenzymatic assay. An increase in the perfusate concentration of p-tyrosine resulted in a significant increase in p-tyramine production that was blocked by the addition of NSD-1015, an inhibitor of aromatic-1-amino decarboxylase (AADC). They conclude p-tyrosine is the precursor for the renal production of p-tyramine, renal AADC catalyzes the formation of urinary p-tyramine, synthesized p-tyramine is predominantly excreted in the urine, and p-tyramine synthesis is modulated by the arterial delivery of p-tyrosine to the kidney

  10. Multimodality functional imaging of spontaneous canine tumors using 64Cu-ATSM and 18FDG PET/CT and dynamic contrast enhanced perfusion CT

    International Nuclear Information System (INIS)

    Hansen, Anders E.; Kristensen, Annemarie T.; Law, Ian; McEvoy, Fintan J.; Kjær, Andreas; Engelholm, Svend A.

    2012-01-01

    Purpose: To compare the distribution and uptake of the hypoxia tracer 64 Cu-diacetyl-bis(N 4 -methylthiosemicarbazone) ( 64 Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition 64 Cu-ATSM distribution over time was evaluated. Methods and materials: Nine spontaneous cancer-bearing dogs were prospectively enrolled. FDG (1 h pi.) and 64 Cu-ATSM (3 and 24 h pi.) PET/CT were performed over three consecutive days. DCE-pCT was performed on day 2. Tumor uptake of FDG and 64 Cu-ATSM was assessed semi-quantitatively and the distribution of FDG, 64 Cu-ATSM and CT perfusion parameters correlated. Results: 64 Cu-ATSM distribution on scans performed 24 h apart displayed moderate to strong correlation; however, temporal changes were observed. The spatial distribution pattern of 64 Cu-ATSM between scans was moderately to strongly positively correlated to FDG, whereas the correlation of CT perfusion parameters to FDG and to 64 Cu-ATSM yielded more varying results. Conclusions: 64 Cu-ATSM uptake was positively correlated to FDG. 64 Cu-ATSM was found to be relatively stable between PET scans performed at different time points, important temporal changes were however observed in hypo-perfused regions. These findings potentially indicate that prolonged uptake periods for 64 Cu-ATSM imaging may be needed. Although a moderate to strong correlation between 64 Cu-ATSM and FDG PET/CT is observed, the two tracers provide different biological information with an overlapping spatial distribution.

  11. Peroxynitrite-induced relaxation in isolated canine cerebral arteries and mechanisms of action

    International Nuclear Information System (INIS)

    Li Jianfeng; Li Wenyan; Altura, Bella T.; Altura, Burton M.

    2004-01-01

    The present study was undertaken to determine the vascular actions of peroxynitrite (ONOO - ), the product of superoxide and nitric oxide (NO), in isolated canine cerebral arteries and to gain insight into its potential mechanisms of action. In the absence of any vasoactive agent, ONOO - (from 10 -7 to 10 -6 M) was able to reduce the basal tension. In prostaglandin F2α-precontracted canine basilar arterial rings, ONOO - elicited concentration-dependent relaxation at concentrations from 10 -8 to 10 -5 M. The effective concentrations producing approximately 50% maximal relaxation (EC 50 ) to ONOO - were 4.06 x 10 -6 and 4.12 x 10 -6 M in intact and denuded rings, respectively (P > 0.05). No significant differences in relaxation responses were found in ring preparations with or without endothelium (P > 0.05). The presence of either 5 μM methylene blue (MB) or 5 μM 1H-[1,2,4]oxadiazolo-[4,3-α]quinoxalin-1-one (ODQ) significantly inhibited the relaxations induced by ONOO - . Tetraethylammonium chloride (T-2265) significantly decreased the ONOO - -induced relaxations in a concentration-dependent manner. However, ONOO - had no effect on rings precontracted by high KCL (P > 0.05). Addition of low concentrations of calyculin A (50 nM) was able to abolish the ONOO - -induced relaxation. Furthermore, ONOO - significantly inhibited calcium-induced contractions of K + -depolarized canine cerebral rings in a concentration-related manner. Lastly, a variety of pharmacological agents and antagonists including L-NMMA, L-arginine, indomethacin, atropine, naloxone, diphenhydramine, cimetine, glibenclamide, haloperidol, etc., did not influence the relaxant effects of ONOO - on the rings. Our new results suggest that ONOO - -triggered relaxation, on canine cerebral arteries, is mediated by elevation of cyclic guanosine monophosphate (cGMP) levels, membrane hyperpolarization via K+ channel activation, activation of myosin light chain phosphatase activity, and interference with

  12. Isolated hepatic perfusion as a treatment for uveal melanoma liver metastases (the SCANDIUM trial)

    DEFF Research Database (Denmark)

    Olofsson, Roger; Ny, Lars; Eilard, Malin Sternby

    2014-01-01

    for patients with liver metastases is between 6 and 12 months, and no treatment has in randomized trials ever been shown to prolong survival. A previous phase II trial using isolated hepatic perfusion (IHP) has suggested a 14-month increase in overall survival compared with a historic control group consisting...... of the longest surviving patients in Sweden during the same time period (26 versus 12 months). METHODS/DESIGN: This is the protocol for a multicenter phase III trial randomizing patients with isolated liver metastases of uveal melanoma to IHP or best alternative care (BAC). Inclusion criteria include liver....... The planned sample size is 78 patients throughout five years. DISCUSSION: Patients with isolated liver metastases of uveal melanoma origin have a short expected survival and no standard treatment option exists. This is the first randomized clinical trial to evaluate IHP as a treatment option with overall...

  13. Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells

    Science.gov (United States)

    Russell, Keith A.; Gibson, Thomas W. G.; Chong, Andrew; Co, Carmon; Koch, Thomas G.

    2015-01-01

    Background Mesenchymal stromal cells (MSC) are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS) is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL) has proven to be a suitable alternative to FBS for expansion of human MSC. Hypothesis and Objectives We hypothesized that canine adipose tissue (AT) and bone marrow (BM) MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1) isolation, 2) proliferation, 3) spontaneous differentiation, and 4) directed differentiation. Results 1) Medium with 10% PL was unable to isolate MSC. 2) MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT) or 30% (BM) enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3) Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4) MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis. Conclusions/Significance Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects. PMID:26353112

  14. Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells.

    Directory of Open Access Journals (Sweden)

    Keith A Russell

    Full Text Available Mesenchymal stromal cells (MSC are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL has proven to be a suitable alternative to FBS for expansion of human MSC.We hypothesized that canine adipose tissue (AT and bone marrow (BM MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1 isolation, 2 proliferation, 3 spontaneous differentiation, and 4 directed differentiation.1 Medium with 10% PL was unable to isolate MSC. 2 MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT or 30% (BM enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3 Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4 MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis.Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects.

  15. The isolation of canine parvovirus and pathological changes of infected dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2004-03-01

    Full Text Available The aims of this study are to isolate canine parvovirus (CPV from the field case and to evaluate its histological aspects in CPV infected dogs. Samples were collected from intestine, intestine contained and mucose, as well as dogs feses from diarrhoea and blood diarrhoea. The suspension of those specimen was inoculated into Feline Kidney cells and observed for cythopathic effect (CPE. The presence of CPE indicated that there was viral isolate and continued to further identification using Haemaglutination (HA test with pig red blood cells. Samples with positif in HA test were further identification using Haemaglutination Inhibition (HI test against reference CPV antisera. Isolation result showed that from 81 samples processed, 10 samples indicated CPE in cell cultures, and had agglutinated in pig red blood cells and neutralised reference CPV antisera as the same titer of reference CPV antisera. Nine isolates were obtained from feces and 1 isolate was obtained from Mucose intestine from bloody diarrhoea dogs. Those isolates were also obtained from 1 to 2 days post blood diarrhea clinical signs. Two from 10 cadavers examined showed histological changes to CPV infection. Isolate of CPV, originally from feces, was also obtained from one of the two cadavers. Based on the results it was concluded that more CPV viral isolates can be obtained from bloody diarrhea feces.

  16. Characterization of a new dog isolate of canine distemper virus from China.

    Science.gov (United States)

    Qiao, J; Meng, Q; Chen, C; Xia, X; Cai, X; Ren, Y; Zhang, H

    2011-01-01

    Canine distemper virus (CDV) is a highly contagious pathogen of dogs. Vaccination is an effective way to protect dogs from CDV infection, but occasionally fails. In the present study, a wild type (wt) CDV, named XJ2, was isolated from a dead vaccinated dog. The hemagglutinin (H) gene of the XJ2 was amplified and analyzed for the molecular characteristics including N-glycosylation sites, phylogenesis, hydrophobicity and epitopes. The data indicated that XJ2 was a genetic variant strain of CDV. CDV-sero-negative dogs were inoculated intranasally with XJ2, developed severe clinical symptoms and died, suggesting high virulence.

  17. Feasibility study on retinal vascular bypass surgery in isolated arterially perfused caprine eye model

    Science.gov (United States)

    Chen, Y; Wu, W; Zhang, X; Fan, W; Shen, L

    2011-01-01

    Purpose To investigate the feasibility of bypassing occluded segments of retinal venous main vessels in isolated, arterially perfused caprine eyes via the closed-sky vitrectomy approach using keratoprosthesis. Methods Isolated caprine eyes were used in this study. For each eye, the retinal vessel was perfused by Krebs solution via ophthalmic artery, and pars plana vitrectomy was performed using temporary keratoprosthesis. All retinal micro-vascular maneuvers were performed in a closed-sky eyeball. The main retinal vein was blocked by endodiathermy at the site of the vessel's first branching. Two openings, several millimeters apart, were created by vascular punctures in both the main vein and its branch vein wall straddling the induced occluded segment. Catheterization was achieved using a flexible polyimide tube, with each end inserted into the vessel wall opening. A sealed connection between the vessel and the tube was obtained by endodiathermy. Bypass of the occluded retinal vein segment was thus achieved, and the patency of this vascular bypass was confirmed by intravascular staining. Results Puncturing, catheterization, and endodiathermy were viable by closed-sky approach using keratoprosthesis. Bypassing of the occluded retinal main vein segment was accomplished with the combination of these maneuvers. Good results were obtained in 23 of 38 (60%) caprine eyes. Conclusions This study demonstrated that bypassing the occluded segment of retinal main vein can be successfully performed in a closed-sky eyeball model of isolated, arterially perfused caprine eye. This early work indicated that the more advanced retinal vascular bypass surgery in in vivo eye may be feasible in the future. PMID:21921946

  18. Kidney in potassium depletion. II. K+ handling by the isolated perfused rat kidney

    International Nuclear Information System (INIS)

    Hayashi, M.; Katz, A.I.

    1987-01-01

    In a companion paper the authors reported a large increment in Na + -K + -ATPase activity and [ 3 H]ouabain binding the inner stripe of outer medullary collecting tubules from K-depleted rats. To test the hypothesis that the increased number of Na + -K + pumps in these animals may be involved in potassium reabsorption they examined the effect of ouabain on K excretion by isolated, perfused kidneys from rats fed a K-free diet for 3 wk. Kidneys from K-depleted rats retain potassium avidly, both the fractional (FE/sub K/) and absolute K excretion being approximately fivefold lower than in control kidneys. Ouabain (5 mM) increased FE/sub K/ in kidneys from each K-depleted rat; similar results were obtained when kidneys were perfused with low and high potassium concentrations. In contrast, ouabain produced a variable effect in control kidneys, that depended on the perfusate potassium concentration. In K-depleted rats amiloride did not significantly alter K excretion and did not block the ouabain-induced kaliuresis, suggesting that the latter is not due to enhanced secretion secondary to increased distal fluid delivery. These results provide evidence for ouabain-sensitive potassium reabsorption in kidneys of chronically K-depleted rats, and suggest an explanation for the increased Na + -K + -ATPase observed in such animals

  19. [Dynamics of the amino acid composition of the medium during cultivation of isolated organs by the directed perfusion method].

    Science.gov (United States)

    Barashkov, V A; Gitel'zon, I I; Nefedov, V P; Trubachev, I N

    1975-07-01

    The dynamics of the amino acid composition of the medium under conditions of adequate perfusion of the isolated organs of a dog (sternum, kidney and liver) was studied. It was found that after a 6-hour perfusion of the complex of organs the amount in the perfusion medium of such amino acids as histidine, lysine, alanine, considerably increased, whereas the amount of arginine, serine, aspartic acid, threonine with glutamine, isoleucine, proline, leucine and valine decreased as compared with their initial concentration. The dynamics of the amino acid medium composition during a 4-hour perfusion was studied in experiments with the isolated sternum. The concentration of alanine, lysine and histidine increased in the medium. At the same time there was seen a decrease in the concentration of serine, aspartic acid, isoleucine, tyrosine and phenyl-alanine.

  20. [Cytostatic hyperthermic isolated limb perfusion (HILP) in VFN (General Faculty Hospital in Prague)].

    Science.gov (United States)

    Spacek, M; Mitás, P; Lacina, L; Krajsová, I; Hodková, G; Salmay, M; Spunda, R; Brlicová, L; Lindner, J

    2011-01-01

    Hyperthermic isolated limb perfusion (HILP) is a standardized method of treatment in selected patients with in-transient locoregional recurrence/methastasis of melanoma or, some other soft tissue tumors (incl. sarcoma etc.) Authors present history and current status of this treatment modality in General University Hospital in Prague. During one year period (7/2009-6/2010) 10 patients were indicated for this procedure. We performed 13 procedures (3x redo), 11 in lower extremity and 2 in upper extremity. There was no serious complication in this cohort of patiens. Multidisciplinar approach is indicated in melanoma patients care.

  1. The effect of age on outcomes after isolated limb perfusion for advanced extremity malignancies.

    Science.gov (United States)

    Smith, H G; Wilkinson, M J; Smith, M J F; Strauss, D C; Hayes, A J

    2018-06-22

    Isolated limb perfusion (ILP) is a well-established treatment for patients with advanced extremity malignancies unsuitable for limb-conserving surgery. However, little is known about the outcomes of this treatment in elderly patients. We sought to determine the effects of age on the tolerability and efficacy of ILP for advanced extremity malignancy. Patients undergoing ILP at our institution between January 2005 and January 2018 were identified from a prospectively maintained database. Patients were stratified by pathology (melanoma, soft-tissue sarcoma, other) and age (<75 years and ≥75 years). Outcomes of interest were perioperative morbidity and mortality, locoregional toxicities, response rates and oncological outcomes. During the study period, a total of 189 perfusions were attempted. Successful perfusions were performed in 179 patients, giving a technical success rate of 94.7%. No difference in perfusion success rates, severe locoregional toxicity and perioperative morbidity or mortality was noted between those aged <75 years and ≥75 years. The overall response rate in melanoma was 82.4%, and no difference in response rates or oncological outcomes between age groups was noted in these patients. The overall response rate in soft-tissue sarcoma was 63.5%, with no difference in response rates noted between age groups. However, patients aged <75 years with soft-tissue sarcoma had prolonged local recurrence-free survival compared with older patients (13 versus 6 months), possibly due to the prevalence of chemosensitive subtypes in the younger age group. ILP is an effective treatment for advanced extremity malignancies in the elderly, with comparable response rates and toxicities to younger patients. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  2. Activation patterns of Purkinje fibers during long-duration ventricular fibrillation in an isolated canine heart model.

    Science.gov (United States)

    Tabereaux, Paul B; Walcott, Greg P; Rogers, Jack M; Kim, Jong; Dosdall, Derek J; Robertson, Peter G; Killingsworth, Cheryl R; Smith, William M; Ideker, Raymond E

    2007-09-04

    The roles of Purkinje fibers (PFs) and focal wave fronts, if any, in the maintenance of ventricular fibrillation (VF) are unknown. If PFs are involved in VF maintenance, it should be possible to map wave fronts propagating from PFs into the working ventricular myocardium during VF. If wave fronts ever arise focally during VF, it should be possible to map them appearing de novo. Six canine hearts were isolated, and the left main coronary artery was cannulated and perfused. The left ventricular cavity was exposed, which allowed direct endocardial mapping of the anterior papillary muscle insertion. Nonperfused VF was induced, and 6 segments of data, each 5 seconds long, were analyzed during 10 minutes of VF. During 36 segments of data that were analyzed, 1018 PF or focal wave fronts of activation were identified. In 534 wave fronts, activation was mapped propagating from working ventricular myocardium to PF. In 142 wave fronts, activation was mapped propagating from PF to working ventricular myocardium. In 342 wave fronts, activation was mapped arising focally. More than 1 of these 3 patterns could occur in the same wave front. PFs are highly active throughout the first 10 minutes of VF. In addition to retrograde propagation from the working ventricular myocardium to PFs, antegrade propagation occurs from PFs to working ventricular myocardium, which suggests PFs are important in VF maintenance. Prior plunge needle recordings in dogs indicate activation propagates from the endocardium toward the epicardium after 1 minute of VF, which suggests that focal sites on the endocardium may represent foci and not breakthrough. If so, in addition to reentry, abnormal automaticity or triggered activity may also occur during VF.

  3. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Propofol attenuates oxidant-induced acute lung injury in an isolated perfused rabbit-lung model.

    Science.gov (United States)

    Yumoto, Masato; Nishida, Osamu; Nakamura, Fujio; Katsuya, Hirotada

    2005-01-01

    Reactive oxygen species have been strongly implicated in the pathogenesis of acute lung injury (ALI). Some animal studies suggest that free radical scavengers inhibit the onset of oxidant-induced ALI. Propofol (2,6-diisopropylphenol) is chemically similar to phenol-based free radical scavengers such as the endogenous antioxidant vitamin E. Both in vivo and in vitro studies have suggested that propofol has antioxidant potential. We hypothesized that propofol may attenuate ALI by acting as a free-radical scavenger. We investigated the effects of propofol on oxidant-induced ALI induced by purine and xanthine oxidase (XO), in isolated perfused rabbit lung, in two series of experiments. In series 1, we examined the relationship between the severity of ALI and the presence of hydrogen peroxide (H2O2). In series 2, we evaluated the effects of propofol on attenuating ALI and the dose dependence of these effects. The lungs were perfused for 90 min, and we evaluated the effects on the severity of ALI by monitoring the pulmonary capillary filtration coefficient (Kfc), pulmonary arterial pressure (Ppa), and the pulmonary capillary hydrostatic pressure (Ppc). In series 1, treatment with catalase (an H2O2 scavenger) prior to the addition of purine and XO resulted in complete prevention of ALI, suggesting that H2O2 may be involved closely in the pathogenesis of ALI. In series 2, pretreatment with propofol at concentrations in excess of 0.5 mM significantly inhibited the increases in the Kfc values, and that in excess of 0.75 mM significantly inhibited the increase in the Ppa values. Propofol attenuates oxidant-induced ALI in an isolated perfused rabbit lung model, probably due to its antioxidant action.

  5. Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011.

    Science.gov (United States)

    Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q

    2015-02-01

    Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.

  6. Isolation and phylogenetic analysis of canine distemper virus among domestic dogs in Vietnam.

    Science.gov (United States)

    Nguyen, Dung Van; Suzuki, Junko; Minami, Shohei; Yonemitsu, Kenzo; Nagata, Nao; Kuwata, Ryusei; Shimoda, Hiroshi; Vu, Chien Kim; Truong, Thuy Quoc; Maeda, Ken

    2017-01-20

    Canine distemper virus (CDV) is one of the most serious pathogens found in many species of carnivores, including domestic dogs. In this study, hemagglutinin (H) genes were detected in five domestic Vietnamese dogs with diarrhea, and two CDVs were successfully isolated from dogs positive for H genes. The complete genome of one isolate, CDV/dog/HCM/33/140816, was determined. Phylogenetic analysis showed that all Vietnamese CDVs belonged to the Asia-1 genotype. In addition, the H proteins of Vietnamese CDV strains were the most homologous to those of Chinese CDVs (98.4% to 99.3% identity). These results indicated that the Asia-1 genotype of CDV was the predominant genotype circulating among the domestic dog population in Vietnam and that transboundary transmission of CDV has occurred between Vietnam and China.

  7. Active Oxygen Metabolites and Thromboxane in Phorbol Myristate Acetate Toxicity to the Isolated, Perfused Rat Lung.

    Science.gov (United States)

    Carpenter, Laurie Jean

    When administered intravenously or intratracheally to rats, rabbits and sheep, phorbol myristate acetate (PMA) produces changes in lung morphology and function are similar to those seen in humans with the adult respiratory distress syndrome (ARDS). Therefore, it is thought that information about the mechanism of ARDS development can be gained from experiments using PMA-treated animals. Currently, the mechanisms by which PMA causes pneumotoxicity are unknown. Results from other studies in rabbits and in isolated, perfused rabbit lungs suggest that PMA-induced lung injury is mediated by active oxygen species from neutrophils (PMN), whereas studies in sheep and rats suggest that PMN are not required for the toxic response. The role of PMN, active oxygen metabolites and thromboxane (TxA_2) in PMA-induced injury to isolated, perfused rat lungs (IPLs) was examined in this thesis. To determine whether PMN were required for PMA to produce toxicity to the IPL, lungs were perfused for 30 min with buffer containing various concentrations of PMA (in the presence or absence of PMN). When concentrations >=q57 ng/ml were added to medium devoid of added PMN, perfusion pressure and lung weight increased. When a concentration of PMA (14-28 ng/ml) that did not by itself cause lungs to accumulate fluid was added to the perfusion medium containing PMN (1 x 10 ^8), perfusion pressure increased, and lungs accumulated fluid. These results indicate that high concentrations of PMA produce lung injury which is independent of PMN, whereas injury induced by lower concentrations is PMN-dependent. To examine whether active oxygen species were involved in mediating lung injury induced by PMA and PMN, lungs were coperfused with the oxygen radical scavengers SOD and/or catalase. Coperfusion with either or both of these enzymes totally protected lungs against injury caused by PMN and PMA. These results suggest that active oxygen species (the hydroxyl radical in particular), mediate lung injury in

  8. Double-Balloon Catheter for Isolated Liver Perfusion: An Experimental Study

    International Nuclear Information System (INIS)

    Cwikiel, Wojciech; Bergqvist, Lennart; Harnek, Jan

    2001-01-01

    Purpose: Further development of a previously described interventional method for isolated liver perfusion (ILP) with a new double-lumen balloon catheter, and evaluation of the side-effects of such isolation.Methods: In six pigs a double-balloon occlusion catheter was placed via the transjugular approach with its tip in the portal vein. One of the balloons was positioned in the inferior vena cava (IVC), cranial to the origin of the hepatic veins and the other balloon in the portal vein. By the transfemoral approach, a single-balloon occlusion catheter was placed in the IVC caudal to the origin of the hepatic veins. A third catheter was placed by the transfemoral route with the occlusion balloon in the proper hepatic artery. After inflation of all balloons 99 Tc m -labelled human serum albumin was recirculated through the liver. The isolation was evaluated by repeated measurement of radioactivity levels in peripheral blood. Laboratory tests of liver and pancreas function, and hemoglobin, were taken before, at the end of, and 3 days after the procedure. Blood gases were tested at the beginning and end of the procedure.Results: One pig died during the procedure due to technical failure and was excluded from the study. In the other pigs leakage from the isolated liver to the systemic circulation increased slowly, up to 9.7% (mean) during 30 min of recirculation of the perfusate through the liver. Laboratory tests were normal in all pigs except insignificant acidosis directly after the procedure and the slight elevation of s-ALAT after 3 days.Conclusions: Only minor leakage from the liver to the systemic circulation was noted during ILP performed with a new, double-balloon catheter. There were no serious side effects

  9. Inhibition of mirtazapine metabolism by Ecstasy (MDMA) in isolated perfused rat liver model.

    Science.gov (United States)

    Jamshidfar, Sanaz; Ardakani, Yalda H; Lavasani, Hoda; Rouini, Mohammadreza

    2017-06-28

    Nowadays MDMA (3,4-methylendioxymethamphetamine), known as ecstasy, is widely abused among the youth because of euphoria induction in acute exposure. However, abusers are predisposed to depression in chronic consumption of this illicit compound. Mirtazapine (MRZ), an antidepressant agent, may be prescribed in MDMA-induced depression. MRZ is extensively metabolized in liver by CYP450 isoenzymes. 8-hydroxymirtazapine (8-OH) is mainly produced by CYP2D6. N-desmethylmirtazapine (NDES) is generated by CYP3A4. MDMA is also metabolized by the mentioned isoenzymes and demonstrates mechanism-based inhibition (MBI) in association with CYP2D6. Several studies revealed that MDMA showed inhibitory effects on CYP3A4. In the present study, our aim was to evaluate the impact of MDMA on the metabolism of MRZ in liver. Therefore, isolated perfused rat liver model was applied as our model of choice in this assessment. The subjects of the study were categorized into two experimental groups. Rats in the control group received MRZ-containing Krebs-Henselit buffer (1 μg/ml). Rats in the treatment group received aqueous solution of 1 mg/ml MDMA (3 mg/kg) intraperitoneally 1 hour before receiving MRZ. Perfusate samples were analyzed by HPLC. Analyses of perfusate samples showed 80% increase in the parent drug concentrations and 50% decrease in the concentrations of both metabolites in our treatment group compared to the control group. In the treatment group compared to the control group, AUC (0-120) of the parent drug demonstrated 50% increase and AUC (0-120) of 8-OH and NDES showed 70% and 60% decrease, respectively. Observed decrease in metabolic ratios were 83% and 79% for 8-OH and NDES in treatment group compared to control group, respectively. Hepatic clearance (CL h ) and intrinsic clearance (Cl int ) showed 20% and 60% decrease in treatment group compared to control group. All findings prove the inhibitory effects of ecstasy on both CYP2D6 and CYP3A4 hepatic isoenzymes. In

  10. Detection of reactive oxygen species in isolated, perfused lungs by electron spin resonance spectroscopy

    Directory of Open Access Journals (Sweden)

    Schudt Christian

    2005-07-01

    Full Text Available Abstract Background The sources and measurement of reactive oxygen species (ROS in intact organs are largely unresolved. This may be related to methodological problems associated with the techniques currently employed for ROS detection. Electron spin resonance (ESR with spin trapping is a specific method for ROS detection, and may address some these technical problems. Methods We have established a protocol for the measurement of intravascular ROS release from isolated buffer-perfused and ventilated rabbit and mouse lungs, combining lung perfusion with the spin probe l-hydroxy-3-carboxy-2,2,5,5-tetramethylpyrrolidine (CPH and ESR spectroscopy. We then employed this technique to characterize hypoxia-dependent ROS release, with specific attention paid to NADPH oxidase-dependent superoxide formation as a possible vasoconstrictor pathway. Results While perfusing lungs with CPH over a range of inspired oxygen concentrations (1–21 %, the rate of CP• formation exhibited an oxygen-dependence, with a minimum at 2.5 % O2. Addition of superoxide dismutase (SOD to the buffer fluid illustrated that a minor proportion of this intravascular ROS leak was attributable to superoxide. Stimulation of the lungs by injection of phorbol-12-myristate-13-acetate (PMA into the pulmonary artery caused a rapid increase in CP• formation, concomitant with pulmonary vasoconstriction. Both the PMA-induced CPH oxidation and the vasoconstrictor response were largely suppressed by SOD. When the PMA challenge was performed at different oxygen concentrations, maximum superoxide liberation and pulmonary vasoconstriction occurred at 5 % O2. Using a NADPH oxidase inhibitor and NADPH-oxidase deficient mice, we illustrated that the PMA-induced superoxide release was attributable to the stimulation of NADPH oxidases. Conclusion The perfusion of isolated lungs with CPH is suitable for detection of intravascular ROS release by ESR spectroscopy. We employed this technique to

  11. The uptake and metabolism of cystamine and taurine by isolated, ventilated and perfused rat and rabbit lungs

    International Nuclear Information System (INIS)

    Sharma, R.; Kodavanti, U.P.; Smith, L.L.; Mehendale, H.M.

    1991-01-01

    Cystamine has been reported to be taken up by the lung slices and metabolized to taurine via hypotaurine through enzymatic processes. The objective of these studies was to determine whether intact isolated, ventilated and perfused rat and rabbit lungs also posses similar characteristics. The lungs were isolated from male New Zealand white rabbits and S-D rats and perfused with 20 μM [ 14 C] cystamine (Sp. Act., 16.4 mCi/mmol) for 60 min and 30 min, respectively. Cystamine and its metabolites in lung as well as in perfusate were separated by TLC and quantitated using scintillation spectrometry. Similar experiments were also conducted with 20 μM taurine to investigate its fate in perfused lungs. Significant pulmonary uptake of cystamine and taurine occurred during perfusion. Cystamine was metabolized to [ 14 C] hypotaurine and [ 14 C] taurine. No further metabolism of taurine was evident in rat or rabbit lungs. Inclusion of 1 nM GSH did not significantly alter the ability of lungs to sequester cystamine, but the metabolism of hypotaurine to taurine was decreased. It was evident that cystamine was metabolized to taurine by perfused lungs in the same way as in lung slices

  12. Evaluating the morphological changes of intracranial arteries and whole-brain perfusion in undetermined isolated vertigo.

    Science.gov (United States)

    Li, Wenxian; Feng, Youzhen; Lu, Weibiao; Xie, Xie; Xiong, Zhilin; Jing, Zhen; Cai, Xiangran; Huang, Li'an

    2016-11-15

    To determine the morphological changes of intracranial arteries and whole-brain perfusion in undetermined isolated vertigo (UIV) patients using 320-detector row computed tomography (CT). A total of 150 patients who underwent CT angiography (CTA) and CT perfusion (CTP) imaging were divided into UIV group and benign paroxysmal positional vertigo (BPPV) group. Sixty individuals with sex- and age-matched without vertigo and cerebral diseases served as the control. The morphological changes of intracranial arteries, perfusion parameters and vascular risk factors (VRFs) were analyzed, calculated and compared. In UIV patients, hypertension (HT), hyperlipidemia and number of VRFs≥3 occurred more commonly (P<0.0125, respectively). The incidence of vertebral artery dominance (VAD), vertebral artery stenosis (VAS) and basilar artery curvature (BAC) were significantly higher (P<0.0125, respectively). HT was an independent risk predictor of non-VAD (OR: 5.411, 95%CI: 1.401; 20.900, P=0.014). HT and VAD associated with BAC served as risk predictors (OR: 4.081, 95%CI: 1.056;15.775, P=0.041 and OR: 6.284, 95%CI: 1.848; 21.365, P=0.003, respectively). The absolute difference in relative values of CTP parameters from cerebellum and brainstem were significantly different (P<0.05), and hypoperfusion was found in the territories of the non-VAD side and the BAC cohort (P<0.05, respectively). On the basis of multiple VRFs, morphological changes of vertebrobasilar artery (VBA) and the unilateral hypoperfusion of the cerebellum and brainstem, that acts as a herald for IV occurrence, which should be paid cautious attention to UIV patients. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Perfusion-weighted magnetic resonance imaging detects recurrent isolated vertigo caused by cerebral hypoperfusion.

    Science.gov (United States)

    Xu, Xiaowei; Jiang, Li; Luo, Man; Li, Jiaoxing; Li, Weidong; Sheng, Wenli

    2015-06-01

    The etiology of isolated vertigo has been a substantial diagnostic challenge for both neurologists and otolaryngologists. This study was designed to detect recurrent isolated vertigo due to cerebral hypoperfusion using perfusion-weighted magnetic resonance imaging (PWI). We recruited isolated vertigo patients whose clinical condition was suspected to be caused by hypodynamics of the brain; these individuals formed the case group. We generated two additional groups: a negative group composed of vertigo patients whose symptoms were caused by problems associated with the ear and a healthy control group. Each subject underwent PWI, and seven regions of interest (ROIs) were chosen. The relative cerebral blood volume (rCBV), relative cerebral blood flow (rCBF), and mean transit time (MTT) were obtained from each ROI. We further calculated the absolute difference of relative parameter values between two mirrored ROIs. The significant difference in the relative MTT from the mirrored cerebellar ROI (|rMTTleft-right|) of the case group was larger than those from the negative and healthy control groups (p = 0.026 and p = 0.038, respectively). Signal differences in |rrCBVleft-right| and |rrCBFleft-right| were not found among the three groups. In summary, disequilibrium in the rMTT of the bilateral cerebellum in the case group implied that hypoperfusion of the posterior circulation could trigger recurrent isolated vertigo and could be shown efficiently using PWI.

  14. Isolation, culture, characterization, and osteogenic differentiation of canine endometrial mesenchymal stem cell

    Directory of Open Access Journals (Sweden)

    A. K. Sahoo

    2017-12-01

    Full Text Available Aim: In this study, the canine endometrium tissue is characterized for its stem cell properties such as adherence to tissue culture plate (plasticity, short population doubling time, serial clonal passaging, long-term culturing properties, stem cell marker expression, and multilineage differentiation potential. Materials and Methods: The present work describes a novel isolation protocol for obtaining mesenchymal stem cells from the uterine endometrium and is compared with cells derived from umbilical cord matrix as a positive control. These cells are clonogenic, can undergo several population doublings in vitro, and can be differentiated to the osteocytes in mature mesenchymal tissues when grown in osteogenic differentiation media as detected by Alizarin Red-S staining. Results: It is reported for the first time that the cells derived from the canine endometrium (e-multipotent stem cells [MSCs] were able to differentiate into a heterologous cell type: Osteocytes, thus demonstrating the presence of MSCs. Thus, the endometrium may be told as a potential source of MSCs which can be used for various therapeutic purposes. Conclusion: The endometrium can be used as a potential source of MSCs, which can be used for various therapeutic purposes.

  15. Characterisation of canine parvovirus strains isolated from cats with feline panleukopenia.

    Science.gov (United States)

    Decaro, Nicola; Buonavoglia, Domenico; Desario, Costantina; Amorisco, Francesca; Colaianni, Maria Loredana; Parisi, Antonio; Terio, Valentina; Elia, Gabriella; Lucente, Maria Stella; Cavalli, Alessandra; Martella, Vito; Buonavoglia, Canio

    2010-10-01

    Unlike the original canine parvovirus type 2 (CPV-2), CPV-2 variants have gained the ability to replicate in vivo in cats but there is limited information on the disease patterns induced by these variants in the feline host. During 2008, two distinct cases of parvoviral infection were diagnosed in our laboratories. A CPV-2a variant was identified in a 3-month-old Persian kitten displaying clinical sign of feline panleukopenia (FPL) (acute gastroenteritis and marked leukopenia) and oral ulcerations, that died eight days after the onset of the disease. Two pups living in the same pet shop as the cat were found to shed a CPV-2a strain genetically identical to the feline virus and were likely the source of infection. Also, non-fatal infection by a CPV-2c strain occurred in a 2.5-month-old European shorthair kitten displaying non-haemorrhagic diarrhoea and normal white blood cell counts. By sequence analysis of the major capsid protein (VP2) gene, the feline CPV-2c strain showed 100% identity to a recent canine type-2c isolate. Both kittens had been administered multivalent vaccines against common feline pathogens including FPL virus. Whether and to which extent the FPL vaccines can protect cats adequately from the antigenic variants of CPV-2 should be assessed. 2010 Elsevier Ltd. All rights reserved.

  16. Myocardial perfusion magnetic resonance imaging using sliding-window conjugate-gradient HYPR methods in canine with stenotic coronary arteries.

    Science.gov (United States)

    Ge, Lan; Kino, Aya; Lee, Daniel; Dharmakumar, Rohan; Carr, James C; Li, Debiao

    2010-01-01

    First-pass perfusion magnetic resonance imaging (MRI) is a promising technique for detecting ischemic heart disease. However, the diagnostic value of the method is limited by the low spatial coverage, resolution, signal-to-noise ratio (SNR), and cardiac motion-related image artifacts. A combination of sliding window and conjugate-gradient HighlY constrained back-PRojection reconstruction (SW-CG-HYPR) method has been proposed in healthy volunteer studies to reduce the acquisition window for each slice while maintaining the temporal resolution of 1 frame per heartbeat in myocardial perfusion MRI. This method allows for improved spatial coverage, resolution, and SNR. In this study, we use a controlled animal model to test whether the myocardial territory supplied by a stenotic coronary artery can be detected accurately by SW-CG-HYPR perfusion method under pharmacological stress. Results from 6 mongrel dogs (15-25 kg) studies demonstrate the feasibility of SW-CG-HYPR to detect regional perfusion defects. Using this method, the acquisition time per cardiac cycle was reduced by a factor of 4, and the spatial coverage was increased from 2 to 3 slices to 6 slices as compared with the conventional techniques including both turbo-Fast Low Angle Short (FLASH) and echoplanar imaging (EPI). The SNR of the healthy myocardium at peak enhancement with SW-CG-HYPR (12.68 ± 2.46) is significantly higher (P < 0.01) than the turbo-FLASH (8.65 ± 1.93) and EPI (5.48 ± 1.24). The spatial resolution of SW-CG-HYPR images is 1.2 × 1.2 × 8.0 mm, which is better than the turbo-FLASH (1.8 × 1.8 × 8.0 mm) and EPI (2.0 × 1.8 × 8.0 mm). Sliding-window CG-HYPR is a promising technique for myocardial perfusion MRI. This technique provides higher image quality with respect to significantly improved SNR and spatial resolution of the myocardial perfusion images, which might improve myocardial perfusion imaging in a clinical setting.

  17. Luminal and basolateral uptake of insulin in isolated perfused, proximal tubules

    International Nuclear Information System (INIS)

    Nielsen, S.; Nielsen, J.T.; Christensen, E.I.

    1987-01-01

    The present study was performed to quantitate compare the luminal and the peritubular uptake of 125 I-insulin in isolated, perfused, proximal tubules from rabbit kidneys. 125 I-insulin was added in physiological concentrations to either the perfusate or the bath fluid for 30 min. The luminal uptake in 30 min averaged 0.76 pg/mm at physiological concentrations and 18.0 pg/mm at high insulin concentrations. About 15-41% of the absorbed insulin was digested and 125 I-insulin at physiological and high concentrations in the bath was 0.136 and 0.318 pg, respectively. The data indicates that insulin is bound/absorbed at the basolateral membranes both by a saturable specific mechanism and a nonspecific, nonsaturable mechanism. The basolateral absorption constituted 15.2 and 1.8% of the total tubular extraction of insulin at physiological and high insulin concentrations, respectively. Electron microscope autoradiography showed that, after luminal as well as basolateral endocytosis, insulin was exclusively accumulated in endocytic vacuoles and lysosomes

  18. Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

    Directory of Open Access Journals (Sweden)

    Yamaguchi Ryoji

    2009-10-01

    Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

  19. Genome Sequence of Canine Parvovirus Strain SC02/2011, Isolated from a Puppy with Severe Diarrhea in South China

    Science.gov (United States)

    Cheng, Yi; Ji, Yikuan; Wang, Yu; Sun, Leilei; Huang, Jiaxin

    2012-01-01

    A widespread hemorrhagic gastroenteritis in young dogs occurred in South China. A virulent field canine parvovirus (CPV) strain, SC02/2011, was isolated from a puppy showing enteric signs in Guangdong, China. The genome of CPV strain SC02/2011 was sequenced and analyzed, which will promote a better understanding of the molecular epidemiology and genetic diversity of CPV field isolates in South China. PMID:23166228

  20. Radiation-induced increase in the release of amino acids by isolated, perfused skeletal muscle

    International Nuclear Information System (INIS)

    Schwenen, M.

    1989-01-01

    Local exposure of the hindquarter of the rat to 15Gy of gamma-radiation resulted, 4-6h after irradiation, in increased release of amino acids by the isolated, perfused hindquarter preparation, 70% of which is skeletal muscle. This increase in release involves not only alanine and glutamine, but also those amino acids not metabolized by muscle and, therefore, released in proportion to their occurrence in muscle proteins. Because metabolic parameters and content of energy-rich phosphate compounds in muscle remain unchanged, it is unlikely that general cellular damage is the underlying cause of the radiation-induced increase in amino acid release. The findings strongly favour the hypothesis that increased availability of amino acids results from enhanced protein break-down in skeletal muscle which has its onset shortly after irradiation. This radiation-induced disturbance in protein metabolism might be one of the pathogenetic factors in the aetiology of radiation myopathy. (author)

  1. Perfusion of the isolated rat brain with (/sup 14/C)-. delta. /sup 1/-tetrahydrocannabinol

    Energy Technology Data Exchange (ETDEWEB)

    Martin, B; Agurell, S [Dept. of Pharmacognosy, Faculty of Pharmacy, BMC, Uppsala (Sweden); Krieglstein, J; Rieger, H

    1977-12-01

    There is controversy over whether ..delta../sup 1/-tetrahydrocannabinol (..delta../sup 1/-THC) or its metabolites is responsible for the behavioural and cardiovascular effects of cannabis. It has been shown that, even in the absence of metabolism, ..delta../sup 1/-THC was capable of altering the EEG of isolated perfused rat brain, and must therefore contribute to the psychoactivity of cannabis. TLC studies showed no evidence for brain metabolism of (/sup 14/C)-..delta../sup 1/-THC, and in particular the 7-hydroxylated metabolite (7-OH-..delta../sup 1/-THC) could not be detected. A disproportionate amount of CNS activity in the rat cannot therefore be attributed to 7-OH-..delta../sup 1/-THC on the basis that it is formed at or near its locus of action.

  2. Perfusion of the isolated rat brain with [14C]-Δ1-tetrahydrocannabinol

    International Nuclear Information System (INIS)

    Martin, B.; Agurell, S.; Krieglstein, J.; Rieger, H.

    1977-01-01

    There is controversy over whether Δ 1 -tetrahydrocannabinol (Δ 1 -THC) or its metabolites is responsible for the behavioural and cardiovascular effects of cannabis. It has been shown that, even in the absence of metabolism, Δ 1 -THC was capable of altering the EEG of isolated perfused rat brain, and must therefore contribute to the psychoactivity of cannabis. TLC studies showed no evidence for brain metabolism of [ 14 C]-Δ 1 -THC, and in particular the 7-hydroxylated metabolite (7-OH-Δ 1 -THC) could not be detected. A disproportionate amount of CNS activity in the rat cannot therefore be attributed to 7-OH-Δ 1 -THC on the basis that it is formed at or near its locus of action. (U.K.)

  3. 31P nuclear magnetic resonance surface coil study of ischemic preconditioned isolated perfused rat heart

    International Nuclear Information System (INIS)

    Yan Yongbin; Luo Xuechun; Zhang Riqing; Wang Xiaoyin; Zuo Lin; Liu Wei

    2000-01-01

    ischemic preconditioning (IPC) will protect the heart from the damage caused by a subsequent long ischemia period. 31 P spectra of isolated perfused rat heart measured by the nuclear magnetic resonance (NMR) surface coil technique can be used to continually, dynamically and noninvasively obtain metabolism information. This paper explores the IPC mechanisms by NMR. This study shows that IPC has no effect on enhancing the ATP and PCr levels during reperfusion but makes significantly slows and smooths the changes of intracellular pH and ATP during ischemia periods. The ATP and PCr recovery rate of the IPC group after ischemia is significantly higher than that of the control group. In conclusion, the above results support that IPC can protect the rat heart by reducing damage during the ischemia period

  4. TNFa-based isolated limb perfusion in the rat : development of a model and analysis of efficacy determining factors

    NARCIS (Netherlands)

    E.R. Manusama (Eric)

    1998-01-01

    textabstractIsolated limb perfusion (lLP) with high dose TNFa in combination with IFNr and melphalan in patients with melanoma in transit metastases confined to the limb has recently been reported to result in much higher complete tumor response rates than after the standard therapy of ILP with

  5. Isolated lung perfusion with gemcitabine for the treatment of pulmonary metastases : Experimental study in a rat model

    NARCIS (Netherlands)

    Putte, B.P. van

    2003-01-01

    Isolated lung perfusion is an experimental surgical technique for the treatment of pulmonary metastases in order to improve the current 5-year survival of approximately 40 % after surgical resection of manually palpable metastases. Several drugs have been tested in animals models and five phase I

  6. The impact of short chain fatty acids on GLP-1 and PYY secretion from the isolated perfused rat colon

    DEFF Research Database (Denmark)

    Christiansen, Charlotte Bayer; Gabe, Maria Buur Nordskov; Svendsen, Berit

    2018-01-01

    chain fatty acids (SCFAs) produced by local bacterial fermentation are suggested to activate the colonic free fatty acid receptors FFAR2 (GPR43) and FFAR3 (GPR41), stimulating the colonic L-cells. We used the isolated perfused rat colon as a model of colonic endocrine secretion and studied the effects...

  7. The influence of Poly-Vinyl-Chloride tubing on the isolated perfused rat´s heart.

    NARCIS (Netherlands)

    Meijler, F.L.; Durrer, D.

    1950-01-01

    There are types of poly-vinyl-chloride tubing sold and used for medical and biological purposes which deteriorate heart action in a few minutes. A simple method for testing P.V.C. tubing can be found in the isolated rat's he art perfused according to Langendorff.

  8. Anionic and cationic drug secretion in the isolated perfused rat kidney after neonatal surgical induction of ureteric obstruction.

    NARCIS (Netherlands)

    Gier, R.P.E. de; Feitz, W.F.J.; Masereeuw, R.; Wouterse, A.C.; Smits, D.; Russel, F.G.M.

    2003-01-01

    OBJECTIVE: To study the pathophysiological changes of renal tubular drug transport mechanisms in congenital renal obstruction, by developing a model for perfusing the isolated kidney (IPK) after neonatal surgical induction of partial ureteric obstruction in Hanover Wistar rats. MATERIAL AND METHODS:

  9. Differential uptake of FDG and DG during post-ischaemic reperfusion in the isolated, perfused rat heart

    Energy Technology Data Exchange (ETDEWEB)

    Garlick, P.B.; Medina, R.A.; Southworth, R.; Marsden, P.K. [Department of Radiological Sciences, Guy' s, King' s and St. Thomas' School of Medicine, London (United Kingdom)

    1999-10-01

    Fluorine-18 2-fluoro-2-deoxyglucose (FDG) and 2-deoxyglucose (DG) are widely used as tracers of glucose uptake in the myocardium. Although there is agreement that the two analogues behave similarly to glucose under control conditions, there is growing evidence that some interventions (e.g. insulin stimulation or ischaemia/reperfusion) cause differential changes in their behaviour. The addition of a two-surface coil nuclear magnetic resonance (NMR) probe and a dual-perfusion cannula to our recently developed PET and NMR dual-acquisition (PANDA) system allows us to collect PET (FDG) images and phosphorus-31 NMR (2-deoxyglucose-6-phosphate) spectra simultaneously from each independently perfused coronary bed of the heart. We have used this technique to study the effect of regional ischaemia/reperfusion on FDG and DG uptake in the isolated, perfused rat heart. During control perfusion, FDG uptake was almost identical in both coronary beds. When one coronary bed was made ischaemic, FDG uptake ceased on that side but continued on the control side. Reperfusion failed to restore FDG uptake. In contrast, NMR spectra showed that, during reperfusion, the uptake and phosphorylation of DG did not differ between the two coronary beds. The results thus demonstrate that regional myocardial ischaemia/reperfusion has different effects on the uptake of FDG and DG in the isolated, perfused rat heart. (orig.)

  10. Differential uptake of FDG and DG during post-ischaemic reperfusion in the isolated, perfused rat heart

    International Nuclear Information System (INIS)

    Garlick, P.B.; Medina, R.A.; Southworth, R.; Marsden, P.K.

    1999-01-01

    Fluorine-18 2-fluoro-2-deoxyglucose (FDG) and 2-deoxyglucose (DG) are widely used as tracers of glucose uptake in the myocardium. Although there is agreement that the two analogues behave similarly to glucose under control conditions, there is growing evidence that some interventions (e.g. insulin stimulation or ischaemia/reperfusion) cause differential changes in their behaviour. The addition of a two-surface coil nuclear magnetic resonance (NMR) probe and a dual-perfusion cannula to our recently developed PET and NMR dual-acquisition (PANDA) system allows us to collect PET (FDG) images and phosphorus-31 NMR (2-deoxyglucose-6-phosphate) spectra simultaneously from each independently perfused coronary bed of the heart. We have used this technique to study the effect of regional ischaemia/reperfusion on FDG and DG uptake in the isolated, perfused rat heart. During control perfusion, FDG uptake was almost identical in both coronary beds. When one coronary bed was made ischaemic, FDG uptake ceased on that side but continued on the control side. Reperfusion failed to restore FDG uptake. In contrast, NMR spectra showed that, during reperfusion, the uptake and phosphorylation of DG did not differ between the two coronary beds. The results thus demonstrate that regional myocardial ischaemia/reperfusion has different effects on the uptake of FDG and DG in the isolated, perfused rat heart. (orig.)

  11. In vitro culture of functionally active buffalo hepatocytes isolated by using a simplified manual perfusion method.

    Directory of Open Access Journals (Sweden)

    Santanu Panda

    Full Text Available In farm animals, there is no suitable cell line available to understand liver-specific functions. This has limited our understanding of liver function and metabolism in farm animals. Culturing and maintenance of functionally active hepatocytes is difficult, since they survive no more than few days. Establishing primary culture of hepatocytes can help in studying cellular metabolism, drug toxicity, hepatocyte specific gene function and regulation. Here we provide a simple in vitro method for isolation and short-term culture of functionally active buffalo hepatocytes.Buffalo hepatocytes were isolated from caudate lobes by using manual enzymatic perfusion and mechanical disruption of liver tissue. Hepatocyte yield was (5.3 ± 0.66×107 cells per gram of liver tissue with a viability of 82.3 ± 3.5%. Freshly isolated hepatocytes were spherical with well contrasted border. After 24 hours of seeding onto fibroblast feeder layer and different extracellular matrices like dry collagen, matrigel and sandwich collagen coated plates, hepatocytes formed confluent monolayer with frequent clusters. Cultured hepatocytes exhibited typical cuboidal and polygonal shape with restored cellular polarity. Cells expressed hepatocyte-specific marker genes or proteins like albumin, hepatocyte nuclear factor 4α, glucose-6-phosphatase, tyrosine aminotransferase, cytochromes, cytokeratin and α1-antitrypsin. Hepatocytes could be immunostained with anti-cytokeratins, anti-albumin and anti α1-antitrypsin antibodies. Abundant lipid droplets were detected in the cytosol of hepatocytes using oil red stain. In vitro cultured hepatocytes could be grown for five days and maintained for up to nine days on buffalo skin fibroblast feeder layer. Cultured hepatocytes were viable for functional studies.We developed a convenient and cost effective technique for hepatocytes isolation for short-term culture that exhibited morphological and functional characteristics of active hepatocytes

  12. Synergistic antitumor activity of histamine plus melphalan in isolated limb perfusion: preclinical studies.

    Science.gov (United States)

    Brunstein, Flavia; Hoving, Saske; Seynhaeve, Ann L B; van Tiel, Sandra T; Guetens, Gunther; de Bruijn, Ernst A; Eggermont, Alexander M M; ten Hagen, Timo L M

    2004-11-03

    We have previously shown how tumor response of isolated limb perfusion (ILP) with melphalan was improved when tumor necrosis factor alpha (TNF-alpha) was added. Taking into account that other vasoactive drugs could also improve tumor response to ILP, we evaluated histamine (Hi) as an alternative to TNF-alpha. We used a rat ILP model to assess the combined effects of Hi and melphalan (n = 6) on tumor regression, melphalan uptake (n = 6), and tissue histology (n = 2) compared with Hi or melphalan alone. We also evaluated the growth of BN-175 tumor cells as well as apoptosis, necrosis, cell morphology, and paracellular permeability of human umbilical vein endothelial cells (HUVECs) after Hi treatment alone and in combination with melphalan. The antitumor effect of the combination of Hi and melphalan in vivo was synergistic, and Hi-dependent reduction in tumor volume was blocked by H1 and H2 receptor inhibitors. Tumor regression was observed in 66% of the animals treated with Hi and melphalan, compared with 17% after treatment with Hi or melphalan alone. Tumor melphalan uptake increased and vascular integrity in the surrounding tissue was reduced after ILP treatment with Hi and melphalan compared with melphalan alone. In vitro results paralleled in vivo results. BN-175 tumor cells were more sensitive to the cytotoxicity of combined treatment than HUVECs, and Hi treatment increased the permeability of HUVECs. Hi in combination with melphalan in ILP improved response to that of melphalan alone through direct and indirect mechanisms. These results warrant further evaluation in the clinical ILP setting and, importantly, in organ perfusion.

  13. Fatty acid myocardial imaging using 123I-β-methyl-iophenyl pentadecanoic acid (BMIPP): Comparison of myocardial perfusion and fatty acid utilization in canine myocardial infarction

    International Nuclear Information System (INIS)

    Nishimura, Tsunehiko; Sago, Masayoshi; Kihara, Koichi; Oka, Hisashi; Shimonagata, Tsuyoshi; Katabuchi, Tetsuro; Hayashi, Makoto; Uehara, Toshiisa; Hayashida, Kohei; Noda, Hiroyuki; Takano, Hisateru

    1989-01-01

    To evaluate the relationship between myocardial perfusion and fatty acid metabolism in canine myocardial infarction, 16 dogs were studied using thallium and 123 I-β-methyl-iodophenyl pentadecanoic acid (BMIPP). Eight dogs (group A) had left anterior coronary arterial occlusion (6 h ligation), 6 dogs (group B) had reperfusion (3 h ligation and 1 h reperfusion) and 2 dogs served as the normal control. Myocardial imaging with BMIPP was excellent, owing to its higher uptake and longer retention in myocardium and rapid blood disappearance in addition to diminished liver and lung uptake. The mean half time value which was generated from the BMIPP myocardial washout curve, was significantly larger in the reperfused myocardium. The gamma camera imaging showed uncoupling of BMIPP and thallium (BMIPP uptake greater than thallium uptake) in five dogs in group B. On the other hand, all dogs in group A had a persistent defect in BMIPP and thallium uptake. Our findings indicate that the combination of BMIPP and thallium for myocardial imaging supply different information about the zone of infarction and ischemia, which may be useful for the assessment of myocardial viability. (orig.)

  14. Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.

    Science.gov (United States)

    Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu

    2014-08-01

    Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.

  15. Phylogenetic analysis of VP2 gene of canine parvovirus and comparison with Indian and world isolates.

    Science.gov (United States)

    Kaur, G; Chandra, M; Dwivedi, P N

    2016-03-01

    Canine parvovirus (CPV) causes hemorrhagic enteritis, especially in young dogs, leading to high morbidity and mortality. It has four main antigenic types CPV-2, CPV-2a, CPV-2b and CPV-2c. Virus protein 2 (VP2) is the main capsid protein and mutations affecting VP2 gene are responsible for the evolution of various antigenic types of CPV. Full length VP2 gene from field isolates was amplified and cloned for sequence analysis. The sequences were submitted to the GenBank and were assigned Acc. Nos., viz. KP406928.1 for P12, KP406927.1 for P15, KP406930.1 for P32, KP406926.1 for Megavac-6 and KP406929.1 for NobivacDHPPi. Phylogenetic analysis indicated that the samples were forming a separate clad with vaccine strains. When the samples were compared with the world and Indian isolates, it was observed that samples formed a separate node indicating regional genetic variation in CPV.

  16. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Development of a novel vaccine against canine parvovirus infection with a clinical isolate of the type 2b strain

    OpenAIRE

    Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung

    2012-01-01

    Purpose In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. Materials and Methods We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. Result...

  18. The Hepatoprotective Effects of Corn Silk against Dose-induced Injury of Ecstasy (MDMA Using Isolated Rat Liver Perfusion System

    Directory of Open Access Journals (Sweden)

    Mohammad Karami

    2016-07-01

    Full Text Available Background: Corn silk (CS is widely used in Iranian traditional medicine. The aim of this study was to investigate hepatoprotective activity of CS by Isolated Rat Liver Perfusion System (IRLP. Methods: Hydro-alcoholic extract of corn silk (10, 20, 40, and 100 mg kg-1 was evaluated for its hepatoprotective activity by IRLP. Phenol and flavonoid contents of the extract were determined as gallic acid and quercetin equivalents from a calibration curve, respectively. IRLP system is ideal for studying biochemical alterations of chemicals with minimum neuro-hormonal effects. In this study, the liver was perfused with Kerbs-Henseleit buffer, containing different concentration of hydro-alcoholic extract of corn silk (10, 20, 40, 50,100mg/kg, added to the buffer, and perfused for 2 hours. During the perfusion, many factors, including amino-transferees activities and the level of GSH, were assessed as indicators of liver viability. Consequently, sections of liver tissues were examined for any histopathological changes. Results: Histopathological changes in liver tissues were related to hydro-alcoholic extract of corn silk concentrations in a dose-dependent manner. Also, 50 and 100mg/kg doses caused significant (P<0.05 histopathological changes. Level of GSH in samples perfused with hydro-alcoholic extract increased compared to the control group. Conclusion: Hepatoprotective effect of CS is due to decreased lipid peroxidation, although other mechanisms might also be involved.

  19. First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

    Directory of Open Access Journals (Sweden)

    Zhijun Zhong

    2014-07-01

    Full Text Available Canine parvovirus 2 (CPV-2 was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04% encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China.

  20. First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

    Science.gov (United States)

    Zhong, Zhijun; Liang, Luqi; Zhao, Juan; Xu, Xiaoyang; Cao, Xuefeng; Liu, Xuehan; Zhou, Ziyao; Ren, Zhihua; Shen, Liuhong; Geng, Yi; Gu, Xiaobin; Peng, Guangneng

    2014-01-01

    Canine parvovirus 2 (CPV-2) was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04%) encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China. PMID:25007818

  1. Regional MRI Perfusion Measures Predict Motor/Executive Function in Patients with Clinically Isolated Syndrome

    Directory of Open Access Journals (Sweden)

    Efrosini Z. Papadaki

    2014-01-01

    Full Text Available Background. Patients with clinically isolated syndrome (CIS demonstrate brain hemodynamic changes and also suffer from difficulties in processing speed, memory, and executive functions. Objective. To explore whether brain hemodynamic disturbances in CIS patients correlate with executive functions. Methods. Thirty CIS patients and forty-three healthy subjects, matched for age, gender, education level, and FSIQ, were administered tests of visuomotor learning and set shifting ability. Cerebral blood volume (CBV, cerebral blood flow (CBF, and mean transit time (MTT values were estimated in normal-appearing white matter (NAWM and normal-appearing deep gray Matter (NADGM structures, using a perfusion MRI technique. Results. CIS patients showed significantly elevated reaction time (RT on both tasks, while their CBV and MTT values were globally increased, probably due to inflammatory vasodilation. Significantly, positive correlation coefficients were found between error rates on the inhibition condition of the visuomotor learning task and CBV values in occipital, periventricular NAWM and both thalami. On the set shifting condition of the respective task significant, positive associations were found between error rates and CBV values in the semioval center and periventricular NAWM bilaterally. Conclusion. Impaired executive function in CIS patients correlated positively with elevated regional CBV values thought to reflect inflammatory processes.

  2. Effect of ADH on rubidium transport in isolated perfused rat cortical collecting tubules

    International Nuclear Information System (INIS)

    Schafer, J.A.; Troutman, S.L.

    1986-01-01

    Unidirectional fluxes of 86Rb+ were measured as an indicator of potassium transport in isolated rat cortical collecting tubules perfused and bathed at 38 degrees C with isotonic solutions in which Rb+ replaced K+. Under control conditions the lumen-to-bath flux (Jl----b) was significantly less than the bath-to-lumen flux (Jb----l), indicating net Rb+ secretion. Net secretion increased approximately 180% after addition of 100 microU/ml of arginine vasopressin (ADH) to the bathing solution, due to a rapid and reversible increase in Jb----l from 4.6 +/- 0.8 to 9.0 +/- 1.9 pmol X min-1 X mm-1 with no significant change in Jl----b. The ADH effect was completely inhibited by 2 mM luminal Ba2+. The average transepithelial voltage (Ve) was not significantly different from zero in the control period but became lumen negative (-5 to -10 mV) after ADH. With 10(-5) M amiloride in the lumen Ve was lumen positive (+2 to +4 mV) and was unaltered by ADH or Ba2+, yet ADH produced a significant but attentuated increase in Jb----l with no change in Jl----b. The results indicate that ADH augments net K+ secretion either by an increase in the Ba2+-sensitive conductance of the apical membrane or by an increase in the electrochemical potential driving force for net Rb+ secretion through this pathway

  3. Effect of adenosine1-receptor blockade on renin release from rabbit isolated perfused juxtaglomerular apparatus

    DEFF Research Database (Denmark)

    Weihprecht, H; Lorenz, J N; Schnermann, J

    1990-01-01

    Adenosine has been proposed to act within the juxtaglomerular apparatus (JGA) as a mediator of the inhibition of renin secretion produced by a high NaCl concentration at the macula densa. To test this hypothesis, we studied the effects of the adenosine1 (A1)-receptor blocker 8-cyclopentyl-1......,3-dipropylxanthine (CPX) on renin release from single isolated rabbit JGAs with macula densa perfused. The A1-receptor agonist, N6-cyclohexyladenosine (CHA), applied in the bathing solution at 10(-7) M, was found to inhibit renin secretion, an effect that was completely blocked by adding CPX (10(-5) M) to the bath....... Applied to the lumen, 10(-5) M CPX produced a modest stimulation of renin secretion rates suppressed by a high NaCl concentration at the macula densa (P less than 0.05). The effect of changing luminal NaCl concentration on renin secretion rate was examined in the presence of CPX (10(-7) and 10(-5) M...

  4. Biliary excretion of ouabain in isolated perfused rat liver after treatment with microsomal enzyme inducers

    International Nuclear Information System (INIS)

    Nevasaari, K.; Alakare, B.; Kaerki, N.T.

    1976-01-01

    The effect of pretreatment with spironolactone, phenobarbital and 3,4-benzpyrene on biliary excretion of ouabain was studied in isolated perfused rat liver system after a single dose of 3 H-ouabain. Spironolactone pretreatment (100 mg/kg intraperitoneally for 4 days) changed the time course of the excretion, thus accelerating the transport of ouabain into the bile. Phenobarbital pretreatment (75 mg/kg intraperitoneally for 4 days) enhanced bile flow and increased biliary excretion of ouabain only after 15 min. At longer time periods the increase in bile flow diluted the bile level of ouabain there being no difference in the amounts excreted into the bile between the treated and untreated groups. 3,4-benzpyrene pretreatment (20 mg/kg intraperitoneally for 4 days) was without efffect on biliary excretion of ouabain. The results suggest that spironolactone differs from phenobarbital in its enhancing effect on biliary excretion of ouabain, possibly through a specific effect on an unknown hepatic transport mechanism. (author)

  5. Short communication: isolation and phylogenetic analysis of an avian-origin H3N2 canine influenza virus in dog shelter, China.

    Science.gov (United States)

    Su, Shuo; Yuan, Ziguo; Chen, Jidang; Xie, Jiexiong; Li, Huatao; Huang, Zhen; Zhang, Minze; Du, Guohao; Chen, Zhongming; Tu, Liqing; Zou, Yufei; Miao, Junhao; Wang, Hui; Jia, Kun; Li, Shoujun

    2013-06-01

    A H3N2 canine influenza virus, A/canine/Guangdong/3/2011 (H3N2), was isolated from roaming dogs in rural China. Sequence and phylogenetic analysis of eight gene segments revealed that the A/canine/Guangdong/3/2011 (H3N2) was most similar to a recent H3N2 canine influenza virus isolated in cats from South Korea, which originated from an avian strain. To our knowledge, this is the first report of an avian-origin H3N2 CIV which was isolated from roaming dogs in China. The epidemiologic information provided herein suggests that continued study is required to determine if this virus could be established in the roaming dog population in rural China and pose potential threats to public health.

  6. Genetic characterization of the complete genome of a mutant canine parvovirus isolated in China.

    Science.gov (United States)

    Li, Chuanfeng; Tang, Jingyu; Chen, Zongyan; Li, Qi; Huang, Zhenhua; Wang, Quan; Meng, Chunchun; Wang, Yong; Liu, Guangqing

    2018-02-01

    A field canine parvovirus (CPV) strain, CPV-SH14, was previously isolated from an outbreak of severe gastroenteritis in Shanghai in 2014. The complete genome of CPV-SH14 was determined by using PCR with modified primers. When compared to other CPV-2 strains, several insertions, deletions, and point mutations were identified in the 5' and 3' UTR, with key amino acid (aa) mutations (K19R, E572K in NS1 and F267Y, Y324I and T440A in VP2) also being observed in the coding regions of CPV-SH14. These results indicated that significant and unique genetic variations have occurred at key sites or residues in the genome of CPV-SH14, suggesting the presence of a novel genetic variant of new CPV-2a. Phylogenetic analysis of the VP2 gene revealed that CPV-SH14 may have the potential to spread worldwide. In conclusion, CPV-SH14 may be a novel genetic variant of new CPV-2a, potentially with a selective advantage over other strains.

  7. Optical measurement of isolated canine lung filtration coefficients at normal hematocrits.

    Science.gov (United States)

    Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J

    1997-12-01

    In this study, lung filtration coefficient (Kfc) values were measured in eight isolated canine lung preparations at normal hematocrit values using three methods: gravimetric, blood-corrected gravimetric, and optical. The lungs were kept in zone 3 conditions and subjected to an average venous pressure increase of 10.24 +/- 0.27 (SE) cmH2O. The resulting Kfc (ml . min-1 . cmH2O-1 . 100 g dry lung wt-1) measured with the gravimetric technique was 0.420 +/- 0.017, which was statistically different from the Kfc measured by the blood-corrected gravimetric method (0.273 +/- 0.018) or the product of the reflection coefficient (sigmaf) and Kfc measured optically (0. 272 +/- 0.018). The optical method involved the use of a Cellco filter cartridge to separate red blood cells from plasma, which allowed measurement of the concentration of the tracer in plasma at normal hematocrits (34 +/- 1.5). The permeability-surface area product was measured using radioactive multiple indicator-dilution methods before, during, and after venous pressure elevations. Results showed that the surface area of the lung did not change significantly during the measurement of Kfc. These studies suggest that sigmafKfc can be measured optically at normal hematocrits, that this measurement is not influenced by blood volume changes that occur during the measurement, and that the optical sigmafKfc agrees with the Kfc obtained via the blood-corrected gravimetric method.

  8. Dietary red palm oil supplementation reduces myocardial infarct size in an isolated perfused rat heart model

    Directory of Open Access Journals (Sweden)

    Esterhuyse Adriaan J

    2010-06-01

    Full Text Available Abstract Background and Aims Recent studies have shown that dietary red palm oil (RPO supplementation improves functional recovery following ischaemia/reperfusion in isolated hearts. The main aim of this study was to investigate the effects of dietary RPO supplementation on myocardial infarct size after ischaemia/reperfusion injury. The effects of dietary RPO supplementation on matrix metalloproteinase-2 (MMP2 activation and PKB/Akt phosphorylation were also investigated. Materials and methods Male Wistar rats were divided into three groups and fed a standard rat chow diet (SRC, a SRC supplemented with RPO, or a SRC supplemented with sunflower oil (SFO, for a five week period, respectively. After the feeding period, hearts were excised and perfused on a Langendorff perfusion apparatus. Hearts were subjected to thirty minutes of normothermic global ischaemia and two hours of reperfusion. Infarct size was determined by triphenyltetrazolium chloride staining. Coronary effluent was collected for the first ten minutes of reperfusion in order to measure MMP2 activity by gelatin zymography. Results Dietary RPO-supplementation decreased myocardial infarct size significantly when compared to the SRC-group and the SFO-supplemented group (9.1 ± 1.0% versus 30.2 ± 3.9% and 27.1 ± 2.4% respectively. Both dietary RPO- and SFO-supplementation were able to decrease MMP2 activity when compared to the SRC fed group. PKB/Akt phosphorylation (Thr 308 was found to be significantly higher in the dietary RPO supplemented group when compared to the SFO supplemented group at 10 minutes into reperfusion. There was, however, no significant changes observed in ERK phosphorylation. Conclusions Dietary RPO-supplementation was found to be more effective than SFO-supplementation in reducing myocardial infarct size after ischaemia/reperfusion injury. Both dietary RPO and SFO were able to reduce MMP2 activity, which suggests that MMP2 activity does not play a major role in

  9. Development of a novel vaccine against canine parvovirus infection with a clinical isolate of the type 2b strain.

    Science.gov (United States)

    Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung

    2012-07-01

    In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. The attenuated isolate conferred complete protection against lethal homologous CPV infection in dogs such that they did not develop any clinical symptoms, and their antibody titers against CPV were significantly high at 7-11 days post infection. These results suggest that the virus isolate obtained after passaging can be developed as a novel vaccine against paroviral infection.

  10. Recombination between vaccine and field strains of canine parvovirus is revealed by isolation of virus in canine and feline cell cultures.

    Science.gov (United States)

    Mochizuki, Masami; Ohshima, Takahisa; Une, Yumi; Yachi, Akiko

    2008-12-01

    Canine parvovirus type 2 (CPV) is a pathogen that causes severe hemorrhagic gastroenteritis with a high fatality rate in pups worldwide. Since CPV emerged in the late 1970s, its origin has been explored with the conclusion that CPV originated from feline panleukopenia virus or a closely related virus. Both high mutation rate and recombination are assumed to be key factors in the evolution of parvoviruses. Here we provide evidence for natural recombination in CPV isolated from dogs in cell culture. Antigenic and genetic properties of isolates from 10 diseased pups were elucidated. Six pups had been vaccinated beforehand with live combined vaccine containing original antigenic type CPV (CPV-2). Six isolates recovered from 4 vaccinated pups in cell cultures were found to contain either CPV-2 or CPV-2-like viruses. The other isolates, including all those from non-vaccinated pups, were CPV-2b viruses. Antigenic typing of two CPV-2-like isolates, 03-029/M and 1887/f, with a monoclonal antibody panel suggested they were a mixture of CPV-2 and CPV-2a (03-029/M) and a recombinant of CPV-2 and CPV-2b (1887/f). Genetic analysis of the VP1 gene indicated that isolate 03-029/M was a mixture of CPV-2, CPV-2a and a recombinant of CPV-2 and CPV-2a viruses, while isolate 1887/f was composed of a recombinant of CPV-2 and CPV-2b viruses. This is the first demonstration of natural CPV recombination in the field and suggests that recombination in the evolution of CPV is a more frequent and important process than previously believed.

  11. Chemosaturation with Percutaneous Hepatic Perfusion for Unresectable Isolated Hepatic Metastases from Sarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Deneve, Jeremiah L., E-mail: Jeremiah.Deneve@Moffitt.org [Moffitt Cancer Center, Department of Cutaneous and Sarcoma Oncology (United States); Choi, Junsung [Moffitt Cancer Center, Department of Interventional Radiology (United States); Gonzalez, Ricardo J.; Conley, Anthony P.; Stewart, Steven; Han, Dale [Moffitt Cancer Center, Department of Cutaneous and Sarcoma Oncology (United States); Werner, Philip; Chaudhry, Tariq A. [Moffitt Cancer Center, Department of Anesthesia (United States); Zager, Jonathan S., E-mail: Jonathan.Zager@Moffitt.org [Moffitt Cancer Center, Department of Cutaneous and Sarcoma Oncology (United States)

    2012-12-15

    Purpose: Treatment of patients with unresectable liver metastases is challenging. Regional therapies to the liver have been developed that maximize treatment of the localized disease process without systemic toxic adverse effects. We discuss the procedural aspects of liver chemosaturation with percutaneous hepatic perfusion (CS-PHP). Methods: We present as an illustration of this technique a case report of the treatment of unresectable metastatic leiomyosarcoma of the liver. Results: A randomized phase III trial for unresectable liver metastases from melanoma was recently completed comparing CS-PHP with melphalan vs. best alternative care (BAC). When compared with BAC, CS-PHP was associated with a significant improvement in hepatic progression-free survival (8.0 months CS-PHP vs. 1.6 months BAC, p < 0.0001) and overall progression-free survival (6.7 months CS-PHP vs. 1.6 months BAC, p < 0.0001), respectively. On the basis of these results, and given our experience as one of the treating institutions for this phase III trial, we appealed for compassionate use of CS-PHP in a patient with isolated bilobar unresectable hepatic metastases from leiomyosarcoma. Four target lesions were identified and monitored to assess treatment response. A total of 4 CS-PHP procedures were performed, with a 25 % reduction in size of the largest lesion observed and 16 month hepatic progression-free survival. Toxicity was mild (neutropenia) and manageable on an outpatient basis. Conclusion: CS-PHP offers several advantages for unresectable hepatic sarcoma metastases. CS-PHP is minimally invasive and repeatable, and it has a predictable and manageable systemic toxicity profile. For appropriately selected patients, CS-PHP can delay tumor progression and could potentially improve survival.

  12. Chemosaturation with Percutaneous Hepatic Perfusion for Unresectable Isolated Hepatic Metastases from Sarcoma

    International Nuclear Information System (INIS)

    Deneve, Jeremiah L.; Choi, Junsung; Gonzalez, Ricardo J.; Conley, Anthony P.; Stewart, Steven; Han, Dale; Werner, Philip; Chaudhry, Tariq A.; Zager, Jonathan S.

    2012-01-01

    Purpose: Treatment of patients with unresectable liver metastases is challenging. Regional therapies to the liver have been developed that maximize treatment of the localized disease process without systemic toxic adverse effects. We discuss the procedural aspects of liver chemosaturation with percutaneous hepatic perfusion (CS-PHP). Methods: We present as an illustration of this technique a case report of the treatment of unresectable metastatic leiomyosarcoma of the liver. Results: A randomized phase III trial for unresectable liver metastases from melanoma was recently completed comparing CS-PHP with melphalan vs. best alternative care (BAC). When compared with BAC, CS-PHP was associated with a significant improvement in hepatic progression-free survival (8.0 months CS-PHP vs. 1.6 months BAC, p < 0.0001) and overall progression-free survival (6.7 months CS-PHP vs. 1.6 months BAC, p < 0.0001), respectively. On the basis of these results, and given our experience as one of the treating institutions for this phase III trial, we appealed for compassionate use of CS-PHP in a patient with isolated bilobar unresectable hepatic metastases from leiomyosarcoma. Four target lesions were identified and monitored to assess treatment response. A total of 4 CS-PHP procedures were performed, with a 25 % reduction in size of the largest lesion observed and 16 month hepatic progression-free survival. Toxicity was mild (neutropenia) and manageable on an outpatient basis. Conclusion: CS-PHP offers several advantages for unresectable hepatic sarcoma metastases. CS-PHP is minimally invasive and repeatable, and it has a predictable and manageable systemic toxicity profile. For appropriately selected patients, CS-PHP can delay tumor progression and could potentially improve survival.

  13. Calculating regional tissue volume for hyperthermic isolated limb perfusion: Four methods compared.

    Science.gov (United States)

    Cecchin, D; Negri, A; Frigo, A C; Bui, F; Zucchetta, P; Bodanza, V; Gregianin, M; Campana, L G; Rossi, C R; Rastrelli, M

    2016-12-01

    Hyperthermic isolated limb perfusion (HILP) can be performed as an alternative to amputation for soft tissue sarcomas and melanomas of the extremities. Melphalan and tumor necrosis factor-alpha are used at a dosage that depends on the volume of the limb. Regional tissue volume is traditionally measured for the purposes of HILP using water displacement volumetry (WDV). Although this technique is considered the gold standard, it is time-consuming and complicated to implement, especially in obese and elderly patients. The aim of the present study was to compare the different methods described in the literature for calculating regional tissue volume in the HILP setting, and to validate an open source software. We reviewed the charts of 22 patients (11 males and 11 females) who had non-disseminated melanoma with in-transit metastases or sarcoma of the lower limb. We calculated the volume of the limb using four different methods: WDV, tape measurements and segmentation of computed tomography images using Osirix and Oncentra Masterplan softwares. The overall comparison provided a concordance correlation coefficient (CCC) of 0.92 for the calculations of whole limb volume. In particular, when Osirix was compared with Oncentra (validated for volume measures and used in radiotherapy), the concordance was near-perfect for the calculation of the whole limb volume (CCC = 0.99). With methods based on CT the user can choose a reliable plane for segmentation purposes. CT-based methods also provides the opportunity to separate the whole limb volume into defined tissue volumes (cortical bone, fat and water). Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Normothermic extracorporeal perfusion of isolated porcine liver after warm ischaemia: a preliminary report.

    Science.gov (United States)

    Bellomo, Rinaldo; Suzuki, Satoshi; Marino, Bruno; Starkey, Graeme K; Chambers, Brenton; Fink, Michael A; Wang, Bao Zhong; Houston, Shane; Eastwood, Glenn; Calzavacca, Paolo; Glassford, Neil; Skene, Alison; Jones, Daryl A; Jones, Robert

    2012-09-01

    Liver transplantation is a major life-saving procedure, and donation after cardiac death (DCD) has increased the pool of potential liver donors. However, DCD livers are at increased risk of primary graft dysfunction and biliary tract ischaemia. Normothermic extracorporeal liver perfusion (NELP) may increase the ability to protect, evaluate and, in future, transplant DCD livers. We conducted proof-of-concept experiments using a DCD model in the pig to assess the short-term (4 hours) feasibility and functional efficacy of NELP. Using extracorporeal membrane oxygenation, parenteral nutrition, separate hepatic artery and portal vein perfusion, and physiological perfusion pressures, we achieved NELP and evidence of function (bile production, paracetamol removal, maintenance of normal ammonia and lactate levels) for 4 hours in pig livers subjected to 15 and 30 minutes of cardiac arrest before explantation. Our experiments justify further investigations of the feasibility and efficacy of human DCD liver preservation by ex-vivo perfusion.

  15. Extended normothermic extracorporeal perfusion of isolated human liver after warm ischaemia: a preliminary report.

    Science.gov (United States)

    Bellomo, Rinaldo; Marino, Bruno; Starkey, Graeme; Fink, Michael; Wang, Bao Zhong; Eastwood, Glenn M; Peck, Leah; Young, Helen; Houston, Shane; Skene, Alison; Opdam, Helen; Jones, Robert

    2014-09-01

    Donation after circulatory death (DCD) livers are at markedly increased risk of primary graft dysfunction and biliary tract ischaemia. Normothermic extracorporeal liver perfusion (NELP) may increase the ability to transplant DCD livers and may allow their use for artificial extracorporeal liver support of patients with fulminant liver failure. We conducted two proof-of-concept experiments using human livers after DCD to assess the feasibility and functional efficacy of NELP over an extended period. We applied extracorporeal membrane oxygenation, parenteral nutrition, separate hepatic artery and portal vein perfusion and physiological perfusion pressures to two livers obtained after DCD. We achieved NELP and evidence of liver function (bile production, paracetamol removal and maintenance of normal lactate levels) in both livers; one for 24 hours and the other for 43 hours. Histological examination showed areas of patchy ischaemia but preserved biliary ducts and canaliculi. Our experiments justify further investigations of the feasibility and efficacy of extended DCD liver preservation by ex-vivo perfusion.

  16. Cavitation enhances coagulated size during pulsed high-intensity focussed ultrasound ablation in an isolated liver perfusion system.

    Science.gov (United States)

    Zhao, Lu-Yan; Liu, Shan; Chen, Zong-Gui; Zou, Jian-Zhong; Wu, Feng

    2016-11-24

    To investigate whether cavitation enhances the degree of coagulation during pulsed high-intensity focussed ultrasound (HIFU) in an isolated liver perfusion system. Isolated liver was treated by pulsed HIFU or continuous-wave HIFU with different portal vein flow rates. The cavitation emission during exposure was recorded, and real-time ultrasound images were used to observe changes in the grey scale. The coagulation size was measured and calculated. HIFU treatment led to complete coagulation necrosis and total cell destruction in the target regions. Compared to exposure at a duty cycle (DC) of 100%, the mean volumes of lesions induced by 6 s exposure at DCs of 50% and 10% were significantly larger (P cavitation activity for the pulsed-HIFU (P > .05). For continuous-wave HIFU exposure, there was a significant decrease in the necrosis volume and cavitation activity for exposure times of 1, 2, 3, 4, and 6 s with increasing portal perfusion rates. Perfusion flow rates negatively influence cavitation activity and coagulation volume. Ablation is significantly enhanced during pulsed HIFU exposure compared with continuous-wave HIFU.

  17. Tissue ablation accelerated by peripheral scanning mode with high-intensity focused ultrasound: a study on isolated porcine liver perfusion.

    Science.gov (United States)

    Bu, Rui; Yin, Li; Yang, Han; Wang, Qi; Wu, Feng; Zou, Jian Zhong

    2013-08-01

    The aims of this study were to investigate the feasibility of accelerated tissue ablation using a peripheral scanning mode with high-intensity focused ultrasound (HIFU) and to explore the effect of flow rate on total energy consumption of the target tissues. Using a model of isolated porcine liver perfusion via the portal vein and hepatic artery, we conducted a scanning protocol along the periphery of the target tissues using linear-scanned HIFU to carefully adjust the varying focal depth, generator power, scanning velocity and line-by-line interval over the entire ablation range. Porcine livers were divided into four ablation groups: group 1, n = 12, with dual-vessel perfusion; group 2, n = 11, with portal vein perfusion alone; group 3, n = 10, with hepatic artery perfusion alone; and group 4, n = 11, control group with no-flow perfusion. The samples were cut open consecutively at a thickness of 3 mm, and the actual ablation ranges were calculated along the periphery of the target tissues after triphenyl tetrazolium chloride staining. Total energy consumption was calculated as the sum of the energy requirements at various focal depths in each group. On the basis of the pre-supposed scanning protocol, the peripheral region of the target tissue formed a complete coagulation necrosis barrier in each group with varying dose combinations, and the volume of the peripheral necrotic area did not differ significantly among the four groups (p > 0.05). Furthermore, total energy consumption in each group significantly decreased with the corresponding decrease in flow rate (p Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  18. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis

    Directory of Open Access Journals (Sweden)

    Gurpreet Kaur

    2015-01-01

    Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  19. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis.

    Science.gov (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S

    2015-01-01

    The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  20. Optical measurement of isolated canine lung filtration coefficients after alloxan infusion.

    Science.gov (United States)

    Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J

    1998-04-01

    In this study, lung filtration coefficient (Kfc) was measured in eight isolated canine lung preparations by using three methods: standard gravimetric (Std), blood-corrected gravimetric (BC), and optical. The lungs were held in zone III conditions and were subjected to an average venous pressure increase of 8.79 +/- 0.93 (mean +/- SD) cmH2O. The permeability of the lungs was increased with an infusion of alloxan (75 mg/kg). The resulting Kfc values (in milliliters . min-1 . cmH2O-1 . 100 g dry lung weight-1) measured by using Std and BC gravimetric techniques before vs. after alloxan infusion were statistically different: Std, 0.527 +/- 0.290 vs. 1. 966 +/- 0.283; BC, 0.313 +/- 0.290 vs. 1.384 +/- 0.290. However, the optical technique did not show any statistical difference between pre- and postinjury with alloxan, 0.280 +/- 0.305 vs. 0.483 +/- 0. 297, respectively. The alloxan injury, quantified by using multiple-indicator techniques, showed an increase in permeability and a corresponding decrease in reflection coefficient for albumin (sigmaf). Because the optical method measures the product of Kfc and sigmaf, this study shows that albumin should not be used as an intravascular optical filtration marker when permeability is elevated. However, the optical technique, along with another means of measuring Kfc (such as BC), can be used to calculate the sigmaf of a tracer (in this study, sigmaf of 0.894 at baseline and 0.348 after injury). Another important finding of this study was that the ratio of baseline-to-injury Kfc values was not statistically different for Std and BC techniques, indicating that the percent contribution of slow blood-volume increases does not change because of injury.

  1. Processing of pulse oximeter signals using adaptive filtering and autocorrelation to isolate perfusion and oxygenation components

    Science.gov (United States)

    Ibey, Bennett; Subramanian, Hariharan; Ericson, Nance; Xu, Weijian; Wilson, Mark; Cote, Gerard L.

    2005-03-01

    A blood perfusion and oxygenation sensor has been developed for in situ monitoring of transplanted organs. In processing in situ data, motion artifacts due to increased perfusion can create invalid oxygenation saturation values. In order to remove the unwanted artifacts from the pulsatile signal, adaptive filtering was employed using a third wavelength source centered at 810nm as a reference signal. The 810 nm source resides approximately at the isosbestic point in the hemoglobin absorption curve where the absorbance of light is nearly equal for oxygenated and deoxygenated hemoglobin. Using an autocorrelation based algorithm oxygenation saturation values can be obtained without the need for large sampling data sets allowing for near real-time processing. This technique has been shown to be more reliable than traditional techniques and proven to adequately improve the measurement of oxygenation values in varying perfusion states.

  2. Low pulmonary artery flush perfusion pressure combined with high positive end-expiratory pressure reduces oedema formation in isolated porcine lungs

    International Nuclear Information System (INIS)

    Schumann, Stefan; Schließmann, Stephan J; Wagner, Giskard; Goebel, Ulrich; Priebe, Hans-Joachim; Guttmann, Josef; Kirschbaum, Andreas

    2010-01-01

    Flush perfusion of the pulmonary artery with organ protection solution is a standard procedure before lung explantation. However, rapid flush perfusion may cause pulmonary oedema which is deleterious in the lung transplantation setting. In this study we tested the hypotheses that high pulmonary perfusion pressure contributes to the development of pulmonary oedema and positive end-expiratory pressure (PEEP) counteracts oedema formation. We expected oedema formation to increase weight and decrease compliance of the lungs on the basis of a decrease in alveolar volume as fluid replaces alveolar air spaces. The pulmonary artery of 28 isolated porcine lungs was perfused with a low-potassium dextrane solution at low (mean 27 mmHg) or high (mean 40 mmHg) pulmonary artery pressure (PAP) during mechanical ventilation at low (4 cmH 2 O) or high (8 cmH 2 O) PEEP, respectively. Following perfusion and storage, relative increases in lung weight were smaller (p < 0.05) during perfusion at low PAP (62 ± 32% and 42 ± 26%, respectively) compared to perfusion at high PAP (133 ± 54% and 87 ± 30%, respectively). Compared to all other PAP–PEEP combinations, increases in lung weight were smallest (44 ± 9% and 27 ± 12%, respectively), nonlinear intratidal lung compliance was largest (46% and 17% respectively, both p < 0.05) and lung histology showed least infiltration of mononuclear cells in the alveolar septa, and least alveolar destruction during the combination of low perfusion pressure and high PEEP. The findings suggest that oedema formation during pulmonary artery flush perfusion in isolated and ventilated lungs can be reduced by choosing low perfusion pressure and high PEEP. PAP–PEEP titration to minimize pulmonary oedema should be based on lung mechanics and PAP monitoring

  3. Computer assisted nuclear assessment of renal perfusion in a two kidney, one clip canine model of Goldblatt hypertension

    International Nuclear Information System (INIS)

    Clarke, H.St.C. Jr.

    1984-01-01

    This study was designed to evaluate ninety-second and fifteen-minute Technetium-DTPA (/sup 99m/Tc-DTPA) time-activity curves in acute unilateral renal artery stenosis (RAS). The /sup 99m/Tc-DTPA studies were compared to angiograms, PAH clearances (C/sup PAH/), and thirty-minute 131 I-Hippuran renograms in eight dogs prior to and after RAS. Renal artery stenosis resulted in a reduction of the renal blood flow ranging from 32% to 68%, as measured by electromagnetic flow probe and C/sub PAH/. The mean arterial pressure increased 21 mmHg. Changes in the ninety-second /sup 99m/Tc-DTPA curve were identified by eight computer isolated curve parameters. The fifteen minute /sup 99m/Tc-DTPA curves were interpreted according to the same criteria used in analyzing the 131 I-Hippuran renograms, specifically the time to maximum activity, ratios of peak activity, and time to return to baseline activity. Both the ninety-second and the fifteen-minute /sup 99m/Tc-DTPA studies were superior to the 131 I-Hippuran renogram in assessing RAS. It is concluded that (1) /sup 99m/Tc-DTPA studies are superior to 131 I-Hippuran renograms for detecting unilateral experimental RAS, and (2) /sup 99m/Tc-DTPA may be the radioisotope of choice for detection and follow-up of RAS

  4. Post ischemic reperfusion and anoxic perfusion in the isolated heart: alteration in distribution of radionuclides and in protein synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Schreiber, S S; Oratz, M; Rothschild, M A [Veterans Administration Hospital, New York (USA)

    1980-12-01

    Reperfusion after ischemia and perfusion with total anoxia were studied in the isolated guinea pig heart model, Deprivation of oxygen in both situations resulted in a marked shift of circulation from the left to the right ventricle, with markedly increased spaces of distribution of sup(99m)Tc radionuclides and albumin in the latter. In view of the complexities of measuring protein synthesis during ischemia, continuous anoxic perfusion was used to evaluate this parameter in anoxic induced arrest. There was a profound fall in protein synthesis associated with this arrest, accompanied by a fall in ATP, creatine phosphate, glycogen, potassium, and a rise in lactate production. The fall in protein synthesis was more marked in the left ventricle. The changes in synthesis were almost completely prevented by initiating cardiac arrest with high K/sup +/ (16 meq/l) at the same time as anoxia; energy metabolism remained near normal, and recovery of contractility was nearly complete. The studies demonstrated the differences in vascular distribution between the ventricles after ischemia or with perfusion anoxia, the possible difference in availability of substrate to the two ventricles under these conditions, as well as the difference in protein synthetic response, and further support the protective effect of potassium induced arrest on the hypoxic heart.

  5. Role of glycolysis in maintenance of the action potential duration and contractile activity in isolated perfused rat heart.

    Science.gov (United States)

    Opie, L H; Tuschmidt, R; Bricknell, O; Girardier, L

    1980-01-01

    1. Changing substrates from glucose to pyruvate in paced isolated rat hearts, perfused by the Langendorff technique at 65 cm H2O with a Krebs-Henseleit bicarbonate buffer, produced effects which are opposite to those of ouabain treatment: negative inotropy, decreased work efficiency, hyperpolarization, increased maximum rate of rise and amplitude of the action potential, increased conduction velocity. 2. All the effects resulting from perfusion with pyruvate can be reversed by adding ouabain at a concentration of 100 microM. 3. The correlation between various tissue metabolises and change in contractile force (delta F), rate of tension development [maximum + (dF/dt)] and rate of relaxation [maximum -(dF/dt)] was studied by multiple linear regression. No significant correlation was found with either glycogen content and tissue lactate or with cAMP and cGMP. A weak negative correlation was found with ATP and phosphocreatine. The strongest correlation was found 76 to 807 nM/g in passing from glucose- to pyruvate-containing perfusion solution. 4. In vitro tests performed with a solution containing high energy phosphates and magnesium at concentrations equal to their calculated values in the cytosol (pH 7.0) showed that a significant negative correlation exists between citrate concentration (range: 1 and 1500 M) and free calcium concentration in the micromole range. 5. It is concluded that the effects of pyruvate (non glucose substrate) perfusion could be mediated by a decrease in cytosolic-free calcium resulting from an increase in intracellular citrate. The observation that all these effects can be reversed by ouabain is taken as a circumstantial evidence of a common mechanism.

  6. Epicardial excitation pattern as observed in the isolated revived and perfused fetal human heart

    NARCIS (Netherlands)

    Durrer, D.; Büller, J.; Graaff, P.; Lo, G.I.; Meijler, F.L.

    1961-01-01

    The resuscitated fetal human heart can be used as an experimental tooI for the investigation of the excitatory process in the human heart. During perfusion the configuration of the epicardial electrocardiograms does not change appreciably. For accurate recording permitting a detailed analysis, the

  7. Canine gastritis.

    Science.gov (United States)

    Webb, Craig; Twedt, David C

    2003-09-01

    Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

  8. Canine Distemper in an isolated population of fishers (Martes pennanti) from California

    Science.gov (United States)

    Stefan m. Keller; Mourad Gabriel; Karen A. Terio; Edward J. Dubovi; Elizabeth Van Wormer; Rick Sweitzer; Reginald Barret; Craig Thompson; Kathryn Purcell; Linda Munson

    2012-01-01

    Four fishers (Martes pennanti) from an insular population in the southern Sierra Nevada Mountains, California, USA died as a consequence of an infection with canine distemper virus (CDV) in 2009. Three fishers were found in close temporal and spatial relationship; the fourth fisher died 4 mo later at a 70 km distance from the initial group. Gross...

  9. Effects of lysosomal inhibitors on 125I-insulin and 125I-asialofetuin degradation by the isolated, perfused rat liver and isolated rat hepatocytes

    International Nuclear Information System (INIS)

    Ward, W.F.; Moss, A.L.

    1985-01-01

    To further evaluate the role of the lysosomal system in insulin degradation, the authors have compared the effects of inhibitors of lysosomal function on the degradation of 125 I-insulin with 125 I-asialofetuin, a lysosomally targeted molecule, by the intact, perfused rat liver and the isolated rat hepatocyte. The inhibitors employed were chloroquine ( 125 microM), NH 4 Cl (10 mM), and leupeptin (50 micrograms/ml). In the intact, perfused liver the observed inhibition of 125 I-asialofetuin degradation at 30 min was as follows: chloroquine, 38%; NH 4 Cl, 32%; and leupeptin, 86%. Chloroquine also inhibited 125 I-insulin degradation in the intact, perfused liver (29%), but NH 4 Cl and leupeptin had no effect. Using the isolated hepatocyte, the observed values for inhibition of 125I-asialofetuin at 60 min were: chloroquine, 85%; NH 4 Cl, 76%; and leupeptin, 81%. Chloroquine produced a 28% inhibition of 125I-insulin degradation, while NH 4 Cl and leupeptin had no effect. Chloroquine and NH 4 Cl decreased cell-associated radioactivity when isolated hepatocytes were incubated with 125I-asialofetuin (leupeptin had no effect), whereas chloroquine caused a 107% increase in cell-associated radioactivity when 125I-insulin was added to the incubation media (NH 4 Cl and leupeptin had no effect). These results indicate that the effects of chloroquine on insulin degradation are an extralysosomal action and that lysosomes appear not to be involved in the physiologic degradation of the insulin molecule

  10. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China

    Directory of Open Access Journals (Sweden)

    Tan Bin

    2011-11-01

    Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  11. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China.

    Science.gov (United States)

    Tan, Bin; Wen, Yong-Jun; Wang, Feng-Xue; Zhang, Shu-Qin; Wang, Xiu-Dong; Hu, Jia-Xin; Shi, Xin-Chuan; Yang, Bo-Chao; Chen, Li-Zhi; Cheng, Shi-Peng; Wu, Hua

    2011-11-16

    A new isolate of canine distemper virus (CDV), named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N), phosphoprotein (P) and receptor binding haemagglutinin (H) gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  12. Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

    Science.gov (United States)

    Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

    2015-10-01

    Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

  13. Efficacy of an inactivated feline panleucopenia virus vaccine against a canine parvovirus isolated from a domestic cat.

    Science.gov (United States)

    Gamoh, K; Senda, M; Inoue, Y; Itoh, O

    2005-09-03

    Canine parvovirus type 2a (CPV-2a) and type 2b (CPV-2b) have recently been isolated from cats throughout the world, and CPV-2b strain FP84 has been reported to be virulent in domestic cats. Although live feline panleucopenia virus (FPLV) vaccines protect domestic cats from CPV infection, the efficacy of inactivated FPLV vaccines has not been established. In this study, two domestic cats were vaccinated with a commercial inactivated FPLV vaccine and challenged with CPV-2b strain FP84 isolated from a domestic cat. The cats were protected against CPV-2b strain FP84 infection and their clinical signs were suppressed, although the two unvaccinated cats showed the typical clinical signs of parvovirus infection.

  14. Radionuclide leakage monitoring during hyperthermic isolated limb perfusion for treatment of local melanoma metastasis in an extremity

    DEFF Research Database (Denmark)

    Paulsen, Ida F; Chakera, Annette Hougaard; Schmidt, Grethe

    2015-01-01

    (99m) Tc-labelled tracer infused into the isolated limb circulation. RESULTS: One hundred and sixteen of 131 procedures were completed. In 13%, a leakage of ≥10% was detected; in 6% (n = 8), the cytotoxic drug was never infused because of constant leakage; in 7% (n = 9), leakage ≥10% was measured......INTRODUCTION: The aim is to describe the importance of leakage monitoring in hyperthermic isolated limb perfusion (ILP). It is generally recommended that leakage should not exceed 10% because of risk of systemic toxicity. MATERIAL AND METHODS: Data retrieved by retrospective analysis of 131...... were observed in 14%. Three of the patients with leakage ≥10% were successfully treated in a repeated procedure. CONCLUSION: Leakage monitoring using a threshold of 10% during ILP saves the patients from systemic toxicity, however, at the expense of early termination or cancellation of ILP treatment...

  15. Biosynthesis of agmatine in isolated mitochondria and perfused rat liver: studies with 15N-labelled arginine

    Science.gov (United States)

    2005-01-01

    An important but unresolved question is whether mammalian mitochondria metabolize arginine to agmatine by the ADC (arginine decarboxylase) reaction. 15N-labelled arginine was used as a precursor to address this question and to determine the flux through the ADC reaction in isolated mitochondria obtained from rat liver. In addition, liver perfusion system was used to examine a possible action of insulin, glucagon or cAMP on a flux through the ADC reaction. In mitochondria and liver perfusion, 15N-labelled agmatine was generated from external 15N-labelled arginine. The production of 15N-labelled agmatine was time- and dose-dependent. The time-course of [U-15N4]agmatine formation from 2 mM [U-15N4]arginine was best fitted to a one-phase exponential curve with a production rate of approx. 29 pmol·min−1·(mg of protein)−1. Experiments with an increasing concentration (0– 40 mM) of [guanidino-15N2]arginine showed a Michaelis constant Km for arginine of 46 mM and a Vmax of 3.7 nmol·min−1·(mg of protein)−1 for flux through the ADC reaction. Experiments with broken mitochondria showed little changes in Vmax or Km values, suggesting that mitochondrial arginine uptake had little effect on the observed Vmax or Km values. Experiments with liver perfusion demonstrated that over 95% of the effluent agmatine was derived from perfusate [guanidino-15N2]arginine regardless of the experimental condition. However, the output of 15N-labelled agmatine (nmol·min−1·g−1) increased by approx. 2-fold (P<0.05) in perfusions with cAMP. The findings of the present study provide compelling evidence that mitochondrial ADC is present in the rat liver, and suggest that cAMP may stimulate flux through this pathway. PMID:15656789

  16. Tumour response after hyperthermic isolated limb perfusion for locally advanced melanoma

    DEFF Research Database (Denmark)

    Paulsen, Ida Felbo; Chakera, A H; Drejøe, Jennifer Berg

    2014-01-01

    AND METHODS: A total of 84 perfusions were performed (53 women, 31 men, median age 63 years) from 1993 to 2010. 95% of the perfusions were administered to the lower limbs and 5% to the upper limbs. The inclusion criteria were recurrent and/or clinically apparent cutaneous/subcutaneous extremity in....... Time from ILP to recurrence was a median of seven months (range 1-37 months) for patients with CR or PR. Survival was longer for patients with CR or PR than for patients showing NC or progression. Several patients had mild or moderate local toxicity reactions, two patients developed severe local...... to improve local disease control in patients with multiple and/or recurrent melanoma confined to an extremity if surgical excision is not possible. FUNDING: not relevant. TRIAL REGISTRATION: not relevant....

  17. Presence of infectious RD-114 virus in a proportion of canine parvovirus isolates.

    Science.gov (United States)

    Yoshikawa, Rokusuke; Sato, Eiji; Miyazawa, Takayuki

    2012-03-01

    We recently found that certain canine live attenuated vaccines produced using `non-feline' cell lines were contaminated with an infectious feline endogenous retrovirus, termed RD-114 virus. We suspected that RD-114 virus may have contaminated the seed stock of canine parvovirus (CPV) during the production of the contaminated vaccines. In this study, we collected stock viruses of CPVs propagated in a feline cell line, and checked the presence of infectious RD-114 virus. Consequently, we found that RD-114 viral RNA was present in all stock viruses, and 7 out of 18 stock viruses were contaminated with infectious RD-114 virus. We also found that RD-114 virus was stable physically and is capable of retaining its infectivity for a long period at -80°C.

  18. Prevalence and pattern of abnormal myocardial perfusion in patients with isolated coronary artery ectasia: study by 99mTc-sestamibi radionuclide scintigraphy.

    Science.gov (United States)

    Ismail, Ahmed M; Rayan, Mona; Adel, Amr; Demerdash, Salah; Atef, Mohamed; Abdallah, Mohamed; Nammas, Wail

    2014-02-01

    We explored the prevalence and pattern of abnormal myocardial perfusion in patients with isolated coronary artery ectasia (CAE), as demonstrated by (99m)Tc-sestamibi scintigraphy. Prospectively, we enrolled 35 patients with angiographically documented CAE and no significant coronary obstruction, who underwent elective coronary angiography. Patients underwent Stress-rest (99m)Tc-sestamibi scintigraphy within 4 days of coronary angiography. They were divided into 2 groups: group I: with normal perfusion scan; and group II: with reversible perfusion defects. The mean age was 49.6 ± 6.9 years; 34 (97.1 %) were males. Seventy-nine (75.2 %) arteries were affected by CAE. Among 79 arteries affected by CAE, affection was diffuse in 37 (46.8 %). Thirteen (37.1 %) patients had normal perfusion scan (group I), whereas 22 (62.9 %) had reversible perfusion defects (group II). Among 22 patients with reversible perfusion defects, 20 (90.9 %) had mild and 2 (9.1 %) had moderate ischemia. Among 49 myocardial segments with reversible perfusion defects, 22 (44.9 %) were basal, 18 (36.7 %) mid-, and 9 (18.4 %) apical segments. Diffuse CAE was significantly more prevalent in group II versus group I, in all 3 major coronary arteries (p < 0.05 for all). In patients with isolated CAE who underwent elective coronary angiography, reversible perfusion defects demonstrated by (99m)Tc-sestamibi scintigraphy were rather prevalent, mostly mild, more likely to affect the basal and mid-segments of the myocardium, and more frequently associated with diffuse ectasia.

  19. Myocardial Creatine Levels Do Not Influence Response to Acute Oxidative Stress in Isolated Perfused Heart

    Science.gov (United States)

    Aksentijević, Dunja; Zervou, Sevasti; Faller, Kiterie M. E.; McAndrew, Debra J.; Schneider, Jurgen E.; Neubauer, Stefan; Lygate, Craig A.

    2014-01-01

    Background Multiple studies suggest creatine mediates anti-oxidant activity in addition to its established role in cellular energy metabolism. The functional significance for the heart has yet to be established, but antioxidant activity could contribute to the cardioprotective effect of creatine in ischaemia/reperfusion injury. Objectives To determine whether intracellular creatine levels influence responses to acute reactive oxygen species (ROS) exposure in the intact beating heart. We hypothesised that mice with elevated creatine due to over-expression of the creatine transporter (CrT-OE) would be relatively protected, while mice with creatine-deficiency (GAMT KO) would fare worse. Methods and Results CrT-OE mice were pre-selected for creatine levels 20–100% above wild-type using in vivo 1H–MRS. Hearts were perfused in isovolumic Langendorff mode and cardiac function monitored throughout. After 20 min equilibration, hearts were perfused with either H2O2 0.5 µM (30 min), or the anti-neoplastic drug doxorubicin 15 µM (100 min). Protein carbonylation, creatine kinase isoenzyme activities and phospho-PKCδ expression were quantified in perfused hearts as markers of oxidative damage and apoptotic signalling. Wild-type hearts responded to ROS challenge with a profound decline in contractile function that was ameliorated by co-administration of catalase or dexrazoxane as positive controls. In contrast, the functional deterioration in CrT-OE and GAMT KO hearts was indistinguishable from wild-type controls, as was the extent of oxidative damage and apoptosis. Exogenous creatine supplementation also failed to protect hearts from doxorubicin-induced dysfunction. Conclusions Intracellular creatine levels do not influence the response to acute ROS challenge in the intact beating heart, arguing against creatine exerting (patho-)physiologically relevant anti-oxidant activity. PMID:25272153

  20. Water permeability of acinar cell membranes in the isolated perfused rabbit mandibular salivary gland.

    Science.gov (United States)

    Steward, M C; Seo, Y; Rawlings, J M; Case, R M

    1990-01-01

    1. The diffusive water permeability of epithelial cell membranes in the perfused rabbit mandibular salivary gland was measured at 37 degrees C by a 1H nuclear magnetic resonance relaxation method using an extracellular relaxation reagent, gadolinium diethylenetriaminepentaacetic acid (Gd(DTPA)). 2. In glands perfused with a HEPES-buffered solution containing 10 mmol l-1 Gd(DTPA), the spin-lattice (T1) relaxation of the water protons showed two exponential components. The water compartment responsible for the slower component corresponded in magnitude to 71 +/- 5% of the wet weight of the gland, and was attributed to the exchangeable intracellular water of the acinar cells. 3. The rate constant for water efflux from the cells was estimated to be 4.1 +/- 0.1 s-1 which would be consistent with a diffusive membrane permeability (Pd) of approximately 3 x 10(-3) cm s-1. Stimulation with acetylcholine (10(-6) mol l-1) did not cause any detectable change in membrane water permeability. 4. Since the basolateral membrane probably provides the main pathway for water efflux, the osmotic water permeability of this barrier (expressed per gland) was estimated to be less than 6.2 cm3 s-1. This would be insufficient to account for the generation of a near-isosmotic fluid at the flow rates observed during secretion, and suggests that a substantial fraction of the flow of water occurs via a paracellular route. PMID:1966053

  1. Localisation and neural control of the release of calcitonin gene-related peptide (CGRP) from the isolated perfused porcine ileum

    DEFF Research Database (Denmark)

    Rasmussen, T N; Schmidt, P; Poulsen, S S

    2001-01-01

    was abolished by infusion of hexamethonium (3x10(-5) M). Infusion of capsaicin (10(-5) M) caused a significant increase in the release of CGRP-LI to 485+/-82% of basal output (n=5). Our results suggest a dual origin of CGRP innervation of the porcine ileum (intrinsic and extrinsic). The intrinsic CGRP neurons...... extracts, CGRP-LI corresponded entirely to porcine CGRP plus smaller amounts of oxidised CGRP. Using isolated vascularly perfused segments of the ileum, we studied the release of CGRP-LI in response to electrical stimulation of the mixed extrinsic periarterial nerves and to infusion of different...... receive excitatory input by parasympathetic, possibly vagal, preganglionic fibres, via release of acetylcholine acting on nicotinic receptors. The stimulatory effect of capsaicin suggests that CGRP is also released from extrinsic sensory neurons....

  2. Effect of myocardial perfusion and metabolic interventions on cardiac kinetics of phenylpentadecanoic acid (IPPA) I 123

    Energy Technology Data Exchange (ETDEWEB)

    Reske, S.N.; Schoen, S.; Schmitt, W.; Knopp, R.; Winkler, C.; Machulla, H.J.

    1986-08-01

    The effect of regional myocardial perfusion and flow-independent adrenergic stimulation, as well as lactate-mediated inhibition of cardiac lipolysis, on cardiac IPPA uptake and metabolism was examined in canine hearts (flow studies) and in the isolated perfused Langendorff rat heart (metabolic interventions). In both normal and ischaemic myocardium, local perfusion is a major determinant of cardiac IPPA uptake. In pacing-induced hyperaemia, the strict flow-dependence of cardiac IPPA uptake is not preserved. Adrenergic stimulation raises the rate of oxidation of both palmitic acid /sup 14/C and IPPA. This change is reflected by increased metabolite production released into the perfusate and radioactivity clearance recorded externally. Lactate in high concentrations exerts the opposite effect on cardiac free fatty acid oxidation. IPPA is stored in this condition preferentially in tissue phospholipids and triglycerides.

  3. Effect of myocardial perfusion and metabolic interventions on cardiac kinetics of phenylpentadecanoic acid (IPPA) I 123

    International Nuclear Information System (INIS)

    Reske, S.N.; Schoen, S.; Schmitt, W.; Knopp, R.; Winkler, C.; Machulla, H.J.

    1986-01-01

    The effect of regional myocardial perfusion and flow-independent adrenergic stimulation, as well as lactate-mediated inhibition of cardiac lipolysis, on cardiac IPPA uptake and metabolism was examined in canine hearts (flow studies) and in the isolated perfused Langendorff rat heart (metabolic interventions). In both normal and ischaemic myocardium, local perfusion is a major determinant of cardiac IPPA uptake. In pacing-induced hyperaemia, the strict flow-dependence of cardiac IPPA uptake is not preserved. Adrenergic stimulation raises the rate of oxidation of both palmitic acid 14 C and IPPA. This change is reflected by increased metabolite production released into the perfusate and radioactivity clearance recorded externally. Lactate in high concentrations exerts the opposite effect on cardiac free fatty acid oxidation. IPPA is stored in this condition preferentially in tissue phospholipids and triglycerides. (orig.)

  4. Isolated limb perfusion with tumor necrosis factor alpha and melphalan for locally advanced soft tissue sarcoma : Three time periods at risk for amputation

    NARCIS (Netherlands)

    van Ginkel, Robert J.; Thijssens, Katja M. J.; Pras, Elisabeth; van der Graaf, Winette T. A.; Suurmeijer, Albert J. H.; Hoekstra, Harald J.

    Background: The aim of this study was to investigate the long-term limb salvage rate and overall survival after isolated limb perfusion (ILP) with tumor necrosis factor alpha and melphalan for locally advanced soft tissue sarcoma (STS). Methods: From 1991 to 2003, 73 patients (36 men, 37 women,

  5. Isolated limb perfusion with tumor necrosis factor alpha and melphalan for locally advanced soft tissue sarcoma : The value of adjuvant radiotherapy

    NARCIS (Netherlands)

    Thijssens, KMJ; van Ginkel, RJ; Pras, E; Suurmeijer, AJH; Hoekstra, HJ

    Background: The aim was to investigate the value of adjuvant radiotherapy for locally advanced soft tissue sarcoma after hyperthermic isolated limb perfusion (ILP) with tumor necrosis factor alpha and melphalan followed by limb-saving surgery. Methods: From 1991 to 2003, 73 patients (median age, 54

  6. The effect of adrenaline and high Ca2+ on the mechanical performance and oxygen consumption of the isolated perfused trout (Oncorhynchus mykiss) heart

    DEFF Research Database (Denmark)

    Rytter, Dorte; Gesser, Hans

    2007-01-01

    In heart muscle from mammals, catecholamines frequently evoke an oxygen waste and reduce efficiency. It was examined if this also applies to fish in which heart muscle activity is often restricted by oxygen availability. In the isolated perfused heart from rainbow trout, adrenaline (0.5 micro...

  7. Cytoplasmic binding and disposition kinetics of diclofenac in the isolated perfused rat liver

    Science.gov (United States)

    Weiss, Michael; Kuhlmann, Olaf; Hung, Daniel Y; Roberts, Michael S

    2000-01-01

    The binding kinetics of diclofenac to hepatocellular structures were evaluated in the perfused rat liver using the multiple indicator dilution technique and a stochastic model of organ transit time density.The single-pass, in situ rat liver preparation was perfused with buffer solution (containing 2% albumin) at 30 ml min−1. Diclofenac and [14C]-sucrose (extracellular reference) were injected simultaneously as a bolus dose into the portal vein (six experiments in three rats). An analogous series of experiments was performed with [14C]-diclofenac and [3H]-sucrose.The diclofenac outflow data were analysed using three models of intracellular distribution kinetics, assuming (1) instantaneous distribution and binding (well-mixed model), (2) ‘slow' binding at specific intracellular sites after instantaneous distribution throughout the cytosol (slow binding model), and (3) ‘slowing' of cytoplasmic diffusion due to instantaneous binding (slow diffusion model).The slow binding model provided the best description of the data. The rate constants for cellular influx and sequestration were 0.126±0.026 and 0.013±0.009 s−1, respectively. The estimated ratio of cellular initial distribution volume to extracellular volume of 2.82 indicates an almost instantaneous distribution in the cellular water space, while the corresponding ratio of 5.54 estimated for the apparent tissue distribution volume suggests a relatively high hepatocellular binding. The non-instantaneous intracellular equilibration process was characterized by time constants of the binding and unbinding process of 53.8 and 49.5 s, respectively. The single-pass availability of diclofenac was 86%. The results obtained with [14C]-diclofenac and [3H]-sucrose were not statistically different. PMID:10903973

  8. Distribution of extracellular potassium and electrophysiologic changes during two-stage coronary ligation in the isolated, perfused canine heart

    NARCIS (Netherlands)

    Coronel, R.; Fiolet, J. W.; Wilms-Schopman, J. G.; Opthof, T.; Schaapherder, A. F.; Janse, M. J.

    1989-01-01

    We studied the relation between [K+]o and the electrophysiologic changes during a "Harris two-stage ligation," which is an occlusion of a coronary artery, preceded by a 30-minute period of 50% reduction of flow through the artery. This two-stage ligation has been reported to be antiarrhythmic. Local

  9. DQ High genotypic diversity among methicillin-resistant Staphylococcus pseudintermedius isolated from canine infections in Denmark

    DEFF Research Database (Denmark)

    Damborg, Peter; Moodley, Arshnee; Aalbaek, Bent

    2016-01-01

    genotypic diversity and antimicrobial resistance of clinical MRSP isolates obtained from dogs, including dogs sampled on multiple occasions, in Denmark over a six-year period. For that purpose a total of 46 clinical MRSP isolates obtained from 36 dogs between 2009 and 2014 were subjected to antimicrobial...... susceptibility testing, multilocus-sequence typing (MLST) and SCCmec typing. Results: Twenty-three sequence types were identified with ST71, mostly associated with SCCmec II-III, as the most common occurring in 13 dogs. Among the remaining 33 isolates, 19 belonged to clonal complex (CC) 258 comprising ST258...... resistant and almost all CC258 isolates being susceptible. Sixteen of the 19 CC258 isolates had oxacillin MICs of 0.5 g/L, whereas MICs for CC71 isolates were consistently above 4 g/L. Four of five dogs representing multiple isolates had distinct STs on different sampling events. Conclusions: The overall...

  10. Inhibitory effect of high [Mg2+] on the vasopressin-stimulated hydroosmotic permeability of the isolated perfused cortical collecting duct

    Directory of Open Access Journals (Sweden)

    Falkenstein D.

    1999-01-01

    Full Text Available High magnesium concentration inhibits the effect of arginine vasopressin (AVP on smooth muscle contraction and platelet aggregation and also influences hepatocyte AVP receptor binding. The aim of this study was to determine the role of magnesium concentration [Mg2+] in AVP-stimulated water transport in the kidney collecting duct. The effect of low and high peritubular [Mg2+] on the AVP-stimulated osmotic water permeability coefficient (Pf was evaluated in the isolated perfused rabbit cortical collecting duct (CCD. Control tubules bathed and perfused with standard Ringer bicarbonate solution containing 1 mM Mg2+ presented a Pf of 223.9 ± 27.2 µm/s. When Mg2+ was not added to the bathing solution, an increase in the AVP-stimulated Pf to 363.1 ± 57.2 µm/s (P<0.05 was observed. An elevation of Mg2+ to 5 mM resulted in a decrease in Pf to 202.9 ± 12.6 µm/s (P<0.05. This decrease in the AVP-stimulated Pf at 5 mM Mg2+ persisted when the CCDs were returned to 1 mM Mg2+, Pf = 130.2 ± 20.3 µm/s, and was not normalized by the addition of 8-[4-chlorophenylthio]-adenosine 3',5'-cyclic monophosphate, a cAMP analogue, to the preparation. These data indicate that magnesium may play a modulatory role in the action of AVP on CCD osmotic water permeability, as observed in other tissues.

  11. Activation of rho is involved in the mechanism of hydrogen-peroxide-induced lung edema in isolated perfused rabbit lung.

    Science.gov (United States)

    Chiba, Y; Ishii, Y; Kitamura, S; Sugiyama, Y

    2001-09-01

    Acute lung injury is attributed primarily to increased vascular permeability caused by reactive oxygen species derived from neutrophils, such as hydrogen peroxide (H2O2). Increased permeability is accompanied by the contraction and cytoskeleton reorganization of endothelial cells, resulting in intercellular gap formation. The Rho family of Ras-like GTPases is implicated in the regulation of the cytoskeleton and cell contraction. We examined the role of Rho in H2O2-induced pulmonary edema with the use of isolated perfused rabbit lungs. To our knowledge, this is the first study to examine the role of Rho in increased vascular permeability induced by H2O2 in perfused lungs. Vascular permeability was evaluated on the basis of the capillary filtration coefficient (Kfc, ml/min/cm H2O/100 g). We found that H2O2 (300 microM) increased lung weight, Kfc, and pulmonary capillary pressure. These effects of H2O2 were abolished by treatment with Y-27632 (50 microM), an inhibitor of the Rho effector p160 ROCK. In contrast, the muscular relaxant papaverine inhibited the H2O2-induced rise in pulmonary capillary pressure, but did not suppress the increases in lung weight and Kfc. These findings indicate that H2O2 causes pulmonary edema by elevating hydrostatic pressure and increasing vascular permeability. Y-27632 inhibited the formation of pulmonary edema by blocking both of these H2O2-induced effects. Our results suggest that Rho-related pathways have a part in the mechanism of H2O2-induced pulmonary edema. Copyright 2001 Academic Press.

  12. Testing the biocompatibility of a glutathione-containing intra-ocular irrigation solution by using an isolated perfused bovine retina organ culture model - an alternative to animal testing.

    Science.gov (United States)

    Januschowski, Kai; Zhour, Ahmad; Lee, Albert; Maddani, Ramin; Mueller, Sebastien; Spitzer, Martin S; Schnichels, Sven; Schultheiss, Maximilian; Doycheva, Deshka; Bartz-Schmidt, Karl-Ulrich; Szurman, Peter

    2012-03-01

    The effects of a glutathione-containing intra-ocular irrigation solution, BSS Plus©, on retinal function and on the survival of ganglion cells in whole-mount retinal explants were studied. Evidence is provided that the perfused ex vivo bovine retina can serve as an alternative to in vivo animal testing. Isolated bovine retinas were prepared and perfused with an oxygen-saturated standard irrigation solution, and an electroretinogram was recorded to assess retinal function. After stable b-waves were detected, the isolated retinas were perfused with BSS Plus for 45 minutes. To investigate the effects of BSS Plus on photoreceptor function, 1mM aspartate was added to the irrigation solution in order to obtain a-waves, and the ERG trace was monitored for 75 minutes. For histological analysis, isolated whole retinal mounts were stored for 24 hours at 4°C, in the dark. The percentages of cell death in the retinal ganglion cell layer and in the outer and inner nuclear layers were estimated by using an ethidium homodimer-1 stain and the TUNEL assay. General swelling of the retina was examined with high-resolution optical coherence tomography. During perfusion with BSS Plus, no significant changes in a-wave and b-wave amplitudes were recorded. Retinas stored for 24 hours in BSS Plus showed a statistically significant smaller percentage (52.6%, standard deviation [SD] = 16.1%) of cell death in the retinal ganglion cell layer compared to the control group (69.6%, SD = 3.9, p = 0.0031). BSS Plus did not seem to affect short-term retinal function, and had a beneficial effect on the survival of retinal ganglion cells. This method for analysing the isolated perfused retina represents a valuable alternative for testing substances for their retinal biocompatibility and toxicity. 2012 FRAME.

  13. Glucose metabolism of isolated perfused rat hemidiaphragms stimulated via the phrenic nerve

    International Nuclear Information System (INIS)

    Bassett, D.J.P.; Bowen-Kelly, E.; Bierkamper, G.

    1986-01-01

    Few investigations using indirect electrical stimulation of diaphragm muscles have measured metabolic pathways involved in energy production. In this study, hemidiaphragm (HD) glucose catabolism was determined while resting and during stimulation with trains of either five (T5) or fifteen (T15) 50 Hz bursts per second. Tissues were perfused and bathed in HEPES buffer pH 7.4 equilibrated with 100% O 2 , and containing 11mM [U- 14 C][5- 3 H] D-glucose. Resting glucose catabolism via the Emden-Meyerhof pathway was indicated by a 3 H 2 O production rate of 1.45 +/- 0.07 μmol/h/HD (+/- S.E.M., n = 3), of which 47% was recovered as 14 C lactate. Following an initial decline in peak isometric tension from 100 g within the first 30 min, T5 and T15 stimulation gave constant tensions of 48 and 22 g during the next 60 min, respectively. These tensions were associated with linear rates of 3 H 2 O production of 2.93 +/- 0.41 and 2.84 +/- 0.25 μmol/h/HD (+/- S.E.M., n = 3). Since T5 and T15 stimulation had no significant effect on lactate formation from either exogenous or endogenous sources, the observed increased glycolytic rate was assumed to be associated with enhanced mitochondrial oxidation of glucose carbons to CO 2 . Increased oxidative catabolism of glucose could therefore be correlated with the increased energy demands of a stimulated diaphragm

  14. Glucose metabolism of isolated perfused rat hemidiaphragms stimulated via the phrenic nerve

    Energy Technology Data Exchange (ETDEWEB)

    Bassett, D.J.P.; Bowen-Kelly, E.; Bierkamper, G.

    1986-03-01

    Few investigations using indirect electrical stimulation of diaphragm muscles have measured metabolic pathways involved in energy production. In this study, hemidiaphragm (HD) glucose catabolism was determined while resting and during stimulation with trains of either five (T5) or fifteen (T15) 50 Hz bursts per second. Tissues were perfused and bathed in HEPES buffer pH 7.4 equilibrated with 100% O/sub 2/, and containing 11mM (U-/sup 14/C)(5-/sup 3/H) D-glucose. Resting glucose catabolism via the Emden-Meyerhof pathway was indicated by a /sup 3/H/sub 2/O production rate of 1.45 +/- 0.07 ..mu..mol/h/HD (+/- S.E.M., n = 3), of which 47% was recovered as /sup 14/C lactate. Following an initial decline in peak isometric tension from 100 g within the first 30 min, T5 and T15 stimulation gave constant tensions of 48 and 22 g during the next 60 min, respectively. These tensions were associated with linear rates of /sup 3/H/sub 2/O production of 2.93 +/- 0.41 and 2.84 +/- 0.25 ..mu..mol/h/HD (+/- S.E.M., n = 3). Since T5 and T15 stimulation had no significant effect on lactate formation from either exogenous or endogenous sources, the observed increased glycolytic rate was assumed to be associated with enhanced mitochondrial oxidation of glucose carbons to CO/sub 2/. Increased oxidative catabolism of glucose could therefore be correlated with the increased energy demands of a stimulated diaphragm.

  15. Evaluation of (99)  (m)TcN-MPO as a new myocardial perfusion imaging agent in normal dogs and in an acute myocardial infarction canine model: comparison with (99)  (m)Tc-sestamibi.

    Science.gov (United States)

    Bu, Lihong; Li, Renfei; Jin, Zhongnan; Wen, Xiaofei; Liu, Shuang; Yang, Baofeng; Shen, Baozhong; Chen, Xiaoyuan

    2011-02-01

    (99)  (m)TcN-MPO ([(99)  (m)TcN(mpo)(PNP5)](+): mpo = 2-mercaptopyridine oxide and PNP5 = N-ethoxyethyl-N,N-bis[2-(bis(3-methoxypropyl)phosphino)ethyl]amine) is a cationic (99)  (m)Tc-nitrido complex, which has favorable biodistribution and myocardial uptake with rapid liver clearance in Sprague Dawley rats. The objective of this study was to compare the biodistribution and pharmacokinetics of (99)  (m)TcN-MPO and (99)  (m)Tc-Sestamibi in normal dogs, and to evaluate the potential of (99)  (m)TcN-MPO as a myocardial perfusion agent in canines with acute myocardial infarction. Five normal mongrel dogs were injected intravenously with (99)  (m)TcN-MPO. Venous blood samples were collected via a femoral vein catheter at 0.5, 1, 2, 3, 4, 5, 10, 20, 30, 40, 60, and 90 min post-injection (p.i.). Anterior-posterior planar images were acquired by γ-camera at 10, 20, 30, 60, 90, and 120 min p.i. Regions of interest (ROIs) were drawn around the heart, liver, and lungs. The heart/liver and heart/lung ratios were calculated by dividing the mean counts in heart ROI by the mean counts in the liver and lung ROI, respectively. For comparison, (99)  (m)Tc-sestamibi was also evaluated in the same five dogs. The interval period between the two examinations was 1 week to eliminate possible interference between these two radiotracers. In addition, single positron emission computed tomography (SPECT) images in the canine infarct model were collected 24 h after myocardial infarction at 30 and 60 min after the administration of (99)  (m)TcN-MPO (n = 4) or (99)  (m)Tc-Sestamibi (n = 4). It was found that (99)  (m)TcN-MPO and (99)  (m)Tc-Sestamibi displayed very similar blood clearance characteristics during the first 90 min p.i. Both (99)  (m)TcN-MPO and (99)  (m)Tc-Sestamibi had a rapid blood clearance with less than 50% of initial radioactivity remaining at 1 min and less than 5% at 30 min p.i. (99)  (m)TcN-MPO and (99)  (m)Tc-Sestamibi both showed good

  16. Hepatic bilirubin uptake in the isolated perfused rat liver is not facilitated by albumin binding

    International Nuclear Information System (INIS)

    Stollman, Y.R.; Gaertner, U.; Theilmann, L.; Ohmi, N.; Wolkoff, A.W.

    1983-01-01

    Bilirubin uptake by the liver has kinetic characteristics which suggest carrier-mediation. Bilirubin is readily bound to albumin. A liver cell surface receptor for albumin has been postulated. The present study was designed to examine directly whether albumin facilitates the hepatic uptake of bilirubin and whether uptake of bilirubin depends on binding to albumin. Rat liver was perfused with a protein-free fluorocarbon medium, and single-pass uptake of 1, 10, or 200 nmol of [ 3 H]bilirubin was determined after injection as an equimolar complex with 125 I-albumin, with 125 I-ligandin, or free with only a [ 14 C]sucrose reference. Uptake of 10 nmol of [ 3 H]bilirubin was 67.5 +/- 3.7% of the dose when injected with 125 I-albumin, 67.4 +/- 6.5% when injected with 125 I-ligandin, and 74.9 +/- 2.4% when injected with [ 14 C]sucrose (P greater than 0.1). At 200 nmol, uptake fell to 46.4 +/- 3.1% ( 125 I-albumin) and 63.3 +/- 3.4% [( 14 C]sucrose) of injected [ 3 H]bilirubin (P less than 0.01), which suggests saturation of the uptake mechanism. When influx was quantitated by the model of Goresky, similar results were obtained. When [ 3 H]bilirubin was injected simultaneously with equimolar 125 I-albumin and a [ 14 C]sucrose reference, there was no delay in 125 I-albumin transit as compared with that of [ 14 C]sucrose. This suggested that the off-rate of albumin from a putative hepatocyte receptor would have to be very rapid, which is unusual for high affinity receptor-ligand interaction. There was no evidence for facilitation of bilirubin uptake by binding to albumin or for interaction of albumin with a liver cell surface receptor. These results suggest that the hepatic bilirubin uptake mechanism is one of high affinity which can extract bilirubin from circulating carriers such as albumin, ligandin, or fluorocarbon

  17. Isolated limb perfusion electrochemotherapy for the treatment of an advanced squamous cell carcinoma of the hoof in a mare

    Directory of Open Access Journals (Sweden)

    Enrico Pierluigi Spugnini

    2017-06-01

    Full Text Available A twenty-year-old female saddle horse was referred for evaluation of a seven month, non-healing erosive lesion of the right hind hoof with proliferation and bleeding of the underlying soft tissues. This lesion had been twice surgically treated as a canker but rapidly recurred. Histological examination of the second excision revealed a well-differentiated squamous cell carcinoma. At presentation, the horse was mildly depressed, lame and partially non-weight-bearing on the right hind leg, which exhibited a 10 x 10 cm erosive and proliferative lesion remodeling the hoof. After completing staging procedures, the lesion was approached with surgery and intraoperative electrochemotherapy (ECT administration of bleomycin in isolated limb perfusion. A second session of surgery and ECT was performed one month later, followed by three additional monthly sessions of ECT. During periodic recheck, the mare showed continuous improvement. One year after presentation, the mare was in complete remission and her gait markedly improved. ECT was well-tolerated and resulted in improved local control of a tumor in a challenging anatomical district.

  18. Percutaneous Isolated Hepatic Perfusion as a Treatment for Isolated Hepatic Metastases of Uveal Melanoma: Patient Outcome and Safety in a Multi-centre Study

    Energy Technology Data Exchange (ETDEWEB)

    Vogl, Thomas J., E-mail: t.vogl@em.uni-frankfurt.de; Koch, Silvia A., E-mail: silvia.koch@web.de [University Hospital Frankfurt, Department of Diagnostic and Interventional Radiology (Germany); Lotz, Gösta, E-mail: goesta.lotz@kgu.de [University Hospital Frankfurt, Department of Anesthesiology, Intensive-Care Medicine and Pain Therapy (Germany); Gebauer, Bernhard, E-mail: bernhard.gebauer@charite.de [Universitätsmedizin Berlin, Department of Diagnostic and Interventional Radiology, Campus Charité Mitte (Germany); Willinek, Winfried, E-mail: w.willinek@bk-trier.de [Brüderkrankenhaus Trier, Department of Diagnostic and Interventional Radiology (Germany); Engelke, Christoph, E-mail: engelke@ekweende.de [Evangelisches Krankenhaus Göttingen-Weende gGmbH, Department of Diagnostic and Interventional Radiology (Germany); Brüning, Roland, E-mail: r.bruening@asklepios.com; Zeile, Martin, E-mail: m.zeile@asklepios.com [Asklepios Klinik Barmbek, Department of Diagnostic and Interventional Radiology (Germany); Wacker, Frank, E-mail: wacker.frank@mh-hannover.de [Medizinische Hochschule Hannover, Department of Diagnostic and Interventional Radiology (Germany); Vogel, Arndt, E-mail: vogel.arndt@mh-hannover.de [Medizinische Hochschule Hannover, Department of Gastroenterology, Hepatology and Endocrinology (Germany); Radeleff, Boris, E-mail: boris.radeleff@med.uni-heidelberg.de [Heidelberg University Hospital, Department of Diagnostic and Interventional Radiology (Germany); Scholtz, Jan-Erik, E-mail: janerikscholtz@gmail.com [University Hospital Frankfurt, Department of Diagnostic and Interventional Radiology (Germany)

    2017-06-15

    PurposePercutaneous isolated hepatic perfusion (PIHP) with Melphalan has been developed as a treatment for patients with isolated hepatic metastases of uveal melanoma. We discuss patient outcome and safety in a retrospective multi-centre study.Materials and MethodsBetween 2012 and 2016 18 patients with un-resectable isolated hepatic metastases of uveal melanoma received single or repeated PIHP with Melphalan (n = 35) at seven sites. Progression-free time, overall survival time (OS) and tumour response by means of RECIST 1.1 criteria were evaluated. Peri- and post-procedural adverse events (AE) were registered. Patients’ life quality was assessed using four-point scale questionnaires.ResultsOf 18 patients, initial PIHP treatment resulted in partial response (PR) in eight, stable disease (SD) in seven and progressive disease (PD) in three cases. Nine patients underwent second PIHP with PR in eight cases and PD in one case. Six patients were evaluated after third PIHP with PR in five patients and SD in one patient. Two patients received fourth PIHP with PD in both cases. Median OS was 9.6 months (range 1.6–41.0 months). Median progression-free survival time was 12.4 months (range 0.9–41.0 months) with 1-year survival of 44%. Most common post-procedural AE grade 3 and 4 were temporary leukopenia (n = 11) and thrombocytopenia (n = 8). Patients’ self-assessments showed good ratings for overall health and quality of life with only slight changes after PIHP, and a high degree of satisfaction with PIHP treatment.ConclusionPIHP with Melphalan proved to be a relatively safe, minimal-invasive and repeatable treatment for patients with non-resectable hepatic metastases of uveal melanoma.

  19. Percutaneous Isolated Hepatic Perfusion as a Treatment for Isolated Hepatic Metastases of Uveal Melanoma: Patient Outcome and Safety in a Multi-centre Study

    International Nuclear Information System (INIS)

    Vogl, Thomas J.; Koch, Silvia A.; Lotz, Gösta; Gebauer, Bernhard; Willinek, Winfried; Engelke, Christoph; Brüning, Roland; Zeile, Martin; Wacker, Frank; Vogel, Arndt; Radeleff, Boris; Scholtz, Jan-Erik

    2017-01-01

    PurposePercutaneous isolated hepatic perfusion (PIHP) with Melphalan has been developed as a treatment for patients with isolated hepatic metastases of uveal melanoma. We discuss patient outcome and safety in a retrospective multi-centre study.Materials and MethodsBetween 2012 and 2016 18 patients with un-resectable isolated hepatic metastases of uveal melanoma received single or repeated PIHP with Melphalan (n = 35) at seven sites. Progression-free time, overall survival time (OS) and tumour response by means of RECIST 1.1 criteria were evaluated. Peri- and post-procedural adverse events (AE) were registered. Patients’ life quality was assessed using four-point scale questionnaires.ResultsOf 18 patients, initial PIHP treatment resulted in partial response (PR) in eight, stable disease (SD) in seven and progressive disease (PD) in three cases. Nine patients underwent second PIHP with PR in eight cases and PD in one case. Six patients were evaluated after third PIHP with PR in five patients and SD in one patient. Two patients received fourth PIHP with PD in both cases. Median OS was 9.6 months (range 1.6–41.0 months). Median progression-free survival time was 12.4 months (range 0.9–41.0 months) with 1-year survival of 44%. Most common post-procedural AE grade 3 and 4 were temporary leukopenia (n = 11) and thrombocytopenia (n = 8). Patients’ self-assessments showed good ratings for overall health and quality of life with only slight changes after PIHP, and a high degree of satisfaction with PIHP treatment.ConclusionPIHP with Melphalan proved to be a relatively safe, minimal-invasive and repeatable treatment for patients with non-resectable hepatic metastases of uveal melanoma.

  20. Effects of Scirpusin B, a polyphenol in passion fruit seeds, on the coronary circulation of the isolated perfused rat heart

    Directory of Open Access Journals (Sweden)

    Yutaka Matsumoto, Nozomi Gotoh, Shoko Sano, Kenkichi Sugiyama, Tatsuhiko Ito, Yohei Abe, Yumi Katano, Akira Ishihata

    2014-07-01

    Full Text Available Objective: Piceatannol, a polyphenol which is contained in passion fruits seed, is a derivative of resveratrol and is known to have antioxidant, anti-inflammatory and vasorelaxing activities. Passion fruits seed also contains a dimer of Piceatannol, Scirpusin B. The aim of this study was to investigate the effect of Scirpusin B on the coronary circulation of the isolated rat heart. Methods: Hearts were isolated from male Fischer 344 rats (5 – 6 months old, and perfused with modified Krebs-Henseleit solution aerated with 95% O2 and 5% CO2 (37 °C at constant pressure (75 cmH2O by Langendorff’s method. Piceatannol or Scirpusin B (10, 30 and 100 μM was injected as a bolus into the aortic cannula and coronary flow (CF was continuously measured by the electromagnetic flow meter. In some experiments, rat hearts were pretreated with L-NAME (an inhibitor of nitric oxide synthase or Diclofenac (an inhibitor of cyclooxygenase to reveal the possible involvement of nitric oxide (NO and vasodilating prostanoids in the effect of Scirpusin B. Results: Scirpusin B increased CF up to 108.2 % of the initial value, while Piceatannol did not increase CF. In addition; Scirpusin B increased CF concentration-dependently. Pretreatment with L-NAME or Diclofenac significantly attenuated the Scirpusin B-induced coronary vasodilatation. Scirpusin B did not change the heart rate either left ventricular pressure. Conclusion: This study shows that Scirpusin B could increase CF via production of NO and vasodilating prostanoids.

  1. Identification and antimicrobial susceptibility patterns of Staphylococcus spp. isolated from canine chronic otitis externa

    Directory of Open Access Journals (Sweden)

    Silva N.

    2001-01-01

    Full Text Available Swab samples obtained from 96 dogs with chronic otitis externa were cultured for the isolation of Staphylococcus species. Of 57 staphylococcal strains, 41 (72% were coagulase-negative (CNS. The identification of staphylococci strains was made by standard procedures for the routine identification of staphylococci in clinical practice. S. sciuri was the most frequent species isolated (22.8% from chronic otitis externa in dogs followed by S. intermedius (12.3%, S. auricularis (10.5% and S. aureus (8.8%. Three (5.2% CNS strains could not be identified. Bacterial isolates were susceptible to enrofloxacin, gentamicin, cephalothin, chloramphenicol and neomycin. Resistance was most common to penicillin G, oxacillin and ampicillin.

  2. The Hepatoprotection Provided by Taurine and Glycine against Antineoplastic Drugs Induced Liver Injury in an Ex Vivo Model of Normothermic Recirculating Isolated Perfused Rat Liver

    Directory of Open Access Journals (Sweden)

    Reza Heidari

    2016-03-01

    Full Text Available Taurine (2-aminoethane sulfonic acid is a non-protein amino acid found in high concentration in different tissues. Glycine (Amino acetic acid is the simplest amino acid incorporated in the structure of proteins. Several investigations indicate the hepatoprotective properties of these amino acids. On the other hand, antineoplastic agents-induced serum transaminase elevation and liver injury is a clinical complication. The current investigation was designed to screen the possible hepatoprotective properties of taurine and glycine against antineoplastic drugs-induced hepatic injury in an ex vivo model of isolated perfused rat liver. Rat liver was perfused with different concentration (10 μM, 100 μM and 1000 μM of antineoplastic drugs (Mitoxantrone, Cyclophosphamide, Cisplatin, 5 Fluorouracil, Doxorubicin and Dacarbazine via portal vein. Taurine and glycine were administered to drug-treated livers and liver perfusate samples were collected for biochemical measurements (ALT, LDH, AST, and K+. Markers of oxidative stress (reactive oxygen species formation, lipid peroxidation, total antioxidant capacity and glutathione were also assessed in liver tissue. Antineoplastic drugs caused significant pathological changes in perfusate biochemistry. Furthermore, markers of oxidative stress were significantly elevated in drug treated livers. It was found that taurine (5 and 10 mM and glycine (5 and 10 mM administration significantly mitigated the biomarkers of liver injury and attenuated drug induced oxidative stress. Our data indicate that taurine and glycine supplementation might help as potential therapeutic options to encounter anticancer drugs-induced liver injury.

  3. Isolation of Aureimonas altamirensis, a Brucella canis-like bacterium, from an edematous canine testicle.

    Science.gov (United States)

    Reilly, Thomas J; Calcutt, Michael J; Wennerdahl, Laura A; Williams, Fred; Evans, Tim J; Ganjam, Irene K; Bowman, Jesse W; Fales, William H

    2014-11-01

    Microbiological and histological analysis of a sample from a swollen testicle of a 2-year-old Border Collie dog revealed a mixed infection of the fungus Blastomyces dermatitidis and the Gram-negative bacterium Aureimonas altamirensis. When subjected to an automated microbial identification system, the latter isolate was provisionally identified as Psychrobacter phenylpyruvicus, but the organism shared several biochemical features with Brucella canis and exhibited agglutination, albeit weakly, with anti-B. canis antiserum. Unequivocal identification of the organism was only achieved by 16S ribosomal RNA gene sequencing, ultimately establishing the identity as A. altamirensis. Since its first description in 2006, this organism has been isolated infrequently from human clinical samples, but, to the authors' knowledge, has not been reported from a veterinary clinical sample. While of unknown clinical significance with respect to the pathology observed for the polymicrobial infection described herein, it highlights the critical importance to unambiguously identify the microbe for diagnostic, epidemiological, infection control, and public health purposes. © 2014 The Author(s).

  4. Action of the isolated canine diaphragm on the lower ribs at high lung volumes.

    Science.gov (United States)

    De Troyer, André; Wilson, Theodore A

    2014-10-15

    The normal diaphragm has an inspiratory action on the lower ribs, but subjects with chronic obstructive pulmonary disease commonly have an inward displacement of the lateral portions of the lower rib cage during inspiration. This paradoxical displacement, conventionally called 'Hoover's sign', has traditionally been attributed to the direct action of radially oriented diaphragmatic muscle fibres. In the present study, the inspiratory intercostal muscles in all interspaces in anaesthetized dogs were severed so that the diaphragm was the only muscle active during inspiration. The displacements of the lower ribs along the craniocaudal and laterolateral axes and the changes in pleural pressure (∆Ppl) and transdiaphragmatic pressure were measured during occluded breaths and mechanical ventilation at different lung volumes between functional residual capacity (FRC) and total lung capacity. From these data, the separate effects on rib displacement of ∆Ppl and of the force exerted by the diaphragm on the ribs were determined. Isolated spontaneous diaphragm contraction at FRC displaced the lower ribs cranially and outward, but this motion was progressively reversed into a caudal and inward motion as lung volume increased. However, although the force exerted by the diaphragm on the ribs decreased with increasing volume, it continued to displace the ribs cranially and outward. These observations suggest that Hoover's sign is usually caused by the decrease in the zone of apposition and, thus, by the dominant effect of ∆Ppl on the lower ribs, rather than an inward pull from the diaphragm. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

  5. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  6. Study of therapeutic and histopathologic effects of corn silk\\'s aqueous and metanolic extract against dosage induced by MDMA in isolated rat liver perfusion system

    Directory of Open Access Journals (Sweden)

    Mohammad Karami

    2014-04-01

    Full Text Available Background: Corn silk is obtained from the plant Zea mays L. A traditional herbal medicine is in China. This has been used in many parts of the world to treat edema, kidney infections, gout, kidney stones, kidney diseases and prostate. Reports of the antioxidant effects of this material are available. Although little scientific resources are available to confirm its efficacy. In this study we tried to find out the antioxidant effect and preventing of hepatotoxicity effect of Corn silk with IRLP Isolated Rat Liver Perfusion system. Material and Methods: The aqueous and methanol extracts of dried Corn silk doses (10, 20, 40, 50 and 100 mg/kg was used. Albino Rats weighing 220-180 g were examined after anesthesia by diethyl ether, the abdominal cavity of the animal T-shaped pattern excision in the abdomen and around is opened.Then portal vein connected to the perfusion flow by using small scalp Vienna (No. 23 into the portal vein. After reaching perfusion flow rate to 20 ml per minute, extracts and fraction with above doses were added to perfusion buffer. Fluid outflows from the inferior vena cava, were collected for measurement of glutathione. One sample of the liver was removed for glutathione measurement and one sample was maintained in 10% formalin for histopathological examination. Differences between group means were estimated using oneway ANOVA followed by Duncan’s multiple range test. Results: The results showed that reduced glutathione level increased significantly by aqueous and methanol extract in comparison with controls. Pathology results confirmed that by increasing dose of extracts, severity of tissue damage (hemorrhage, fibrosis, and necrosis is reduced. In samples taken at intervals of 120 minutes, changes in the glutathione of case groups showed significant difference in comparison with the control group (p<0.01. Conclusion: Findings indicated that aqueous and methanolic extracts of corn fiber, reduced hepatic damages of MDMA

  7. Measurement of canine pancreatic perfusion using dynamic computed tomography: Influence of input-output vessels on deconvolution and maximum slope methods

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Miori, E-mail: miori@mx6.et.tiki.ne.jp [Department of Clinical Veterinary Science, Obihiro University of Agriculture and Veterinary Medicine, Nishi 2-11 Inada-cho, Obihiro 080-8555 (Japan); Tsuji, Yoshihisa, E-mail: y.tsuji@extra.ocn.ne.jp [Department of Gastroenterology and Hepatology, Kyoto University Graduate School of Medicine, Shogoinkawara-cho 54, Sakyo-ku 606-8507 (Japan); Katabami, Nana; Shimizu, Junichiro; Lee, Ki-Ja [Department of Clinical Veterinary Science, Obihiro University of Agriculture and Veterinary Medicine, Nishi 2-11 Inada-cho, Obihiro 080-8555 (Japan); Iwasaki, Toshiroh [Department of Veterinary Internal Medicine, Tokyo University of Agriculture and Technology, Saiwai-cho, 3-5-8, Fuchu 183-8509 (Japan); Miyake, Yoh-Ichi [Department of Clinical Veterinary Science, Obihiro University of Agriculture and Veterinary Medicine, Nishi 2-11 Inada-cho, Obihiro 080-8555 (Japan); Yazumi, Shujiro [Digestive Disease Center, Kitano Hospital, 2-4-20 Ougi-machi, Kita-ku, Osaka 530-8480 (Japan); Chiba, Tsutomu [Department of Gastroenterology and Hepatology, Kyoto University Graduate School of Medicine, Shogoinkawara-cho 54, Sakyo-ku 606-8507 (Japan); Yamada, Kazutaka, E-mail: kyamada@obihiro.ac.jp [Department of Clinical Veterinary Science, Obihiro University of Agriculture and Veterinary Medicine, Nishi 2-11 Inada-cho, Obihiro 080-8555 (Japan)

    2011-01-15

    Objective: We investigated whether the prerequisite of the maximum slope and deconvolution methods are satisfied in pancreatic perfusion CT and whether the measured parameters between these algorithms are correlated. Methods: We examined nine beagles injected with iohexol (200 mgI kg{sup -1}) at 5.0 ml s{sup -1}. The abdominal aorta and splenic and celiac arteries were selected as the input arteries and the splenic vein, the output veins. For the maximum slope method, we determined the arterial contrast volume of each artery by measuring the area under the curve (AUC) and compared the peak enhancement time in the pancreas with the contrast appearance time in the splenic vein. For the deconvolution method, the artery-to-vein collection rate of contrast medium was calculated. We calculated the pancreatic tissue blood flow (TBF), tissue blood volume (TBV), and mean transit time (MTT) using both algorithms and investigated their correlation based on vessel selection. Results: The artery AUC significantly decreased as it neared the pancreas (P < 0.01). In all cases, the peak time of the pancreas (11.5 {+-} 1.6) was shorter than the appearance time (14.1 {+-} 1.6) in the splenic vein. The splenic artery-vein combination exhibited the highest collection rate (91.1%) and was the only combination that was significantly correlated between TBF, TBV, and MTT in both algorithms. Conclusion: Selection of a vessel nearest to the pancreas is considered as a more appropriate prerequisite. Therefore, vessel selection is important in comparison of the semi-quantitative parameters obtained by different algorithms.

  8. Measurement of canine pancreatic perfusion using dynamic computed tomography: Influence of input-output vessels on deconvolution and maximum slope methods

    International Nuclear Information System (INIS)

    Kishimoto, Miori; Tsuji, Yoshihisa; Katabami, Nana; Shimizu, Junichiro; Lee, Ki-Ja; Iwasaki, Toshiroh; Miyake, Yoh-Ichi; Yazumi, Shujiro; Chiba, Tsutomu; Yamada, Kazutaka

    2011-01-01

    Objective: We investigated whether the prerequisite of the maximum slope and deconvolution methods are satisfied in pancreatic perfusion CT and whether the measured parameters between these algorithms are correlated. Methods: We examined nine beagles injected with iohexol (200 mgI kg -1 ) at 5.0 ml s -1 . The abdominal aorta and splenic and celiac arteries were selected as the input arteries and the splenic vein, the output veins. For the maximum slope method, we determined the arterial contrast volume of each artery by measuring the area under the curve (AUC) and compared the peak enhancement time in the pancreas with the contrast appearance time in the splenic vein. For the deconvolution method, the artery-to-vein collection rate of contrast medium was calculated. We calculated the pancreatic tissue blood flow (TBF), tissue blood volume (TBV), and mean transit time (MTT) using both algorithms and investigated their correlation based on vessel selection. Results: The artery AUC significantly decreased as it neared the pancreas (P < 0.01). In all cases, the peak time of the pancreas (11.5 ± 1.6) was shorter than the appearance time (14.1 ± 1.6) in the splenic vein. The splenic artery-vein combination exhibited the highest collection rate (91.1%) and was the only combination that was significantly correlated between TBF, TBV, and MTT in both algorithms. Conclusion: Selection of a vessel nearest to the pancreas is considered as a more appropriate prerequisite. Therefore, vessel selection is important in comparison of the semi-quantitative parameters obtained by different algorithms.

  9. Effect of phenobarbital pretreatment on benzene biotransformation in the rat. Pt. 2. 9. 000 g supernatant and isolated perfused liver versus living rat

    Energy Technology Data Exchange (ETDEWEB)

    Gut, I.; Hatle, K.; Zizkova, L.

    1981-03-01

    Factors responsible for different quantitative effect of phenobarbital (PB) pretreatment on benzene metabolism to phenol in vivo and in vitro were studied in male Wistar rats. A more than 4-fold increase of benzene metabolism was observed with 9,000 g supernatant of liver homogenate, 2.8- to 4-fold increase with isolated perfused liver; phenol formation in vivo after oral benzene was increased by PB 2-fold, but only shortly following benzene administration and the enhancement rapidly diminished to 1.15-fold increase in the total excreted phenol. Benzene concentrations in 9,000 g supernatant incubations were 2 mM, those with isolated perfused livers were up to 4 mM, but those in blood in vivo were below 0.3 mM; the effect of PB induction in vivo disappeared along with decreasing benzene and increasing phenol blood concentrations which surpassed benzene 2-3 h after oral benzene administration. The effect of benzene concentration on the manifestation of PB induction is also supported by almost a 2-fold increased phenol formation in PB rats over controls in vivo after repeated administration of benzene. The elimination of radioactive metabolites of orally administered benzene-/sup 14/C, in urine was markedly inhibited by intraperitoneal administration of phenol, but not by pyrocatechol, resorcinol or hydroquinol suggesting that phenol might inhibit benzene metabolism in vivo especially when its concentration exceeds that of benzene.

  10. The VGF-Derived Neuropeptide TLQP-21 Shows No Impact on Hormone Secretion in the Isolated Perfused Rat Pancreas

    DEFF Research Database (Denmark)

    Christiansen, Charlotte Bayer; Svendsen, B; Holst, Jens Juul

    2015-01-01

    investigated the impact of TLQP-21 on insulin, glucagon, and somatostatin secretion in the perfused rat pancreas. We found that administration of 5 and 50 nM TLQP-21 had no impact on pancreatic hormone secretion at 3.5 or 8 mM glucose levels. Increasing TLQP-21 (200 nM) and glucose concentration (3.5 and 16 m...

  11. Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

    Science.gov (United States)

    Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

    2013-08-01

    Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

  12. Decreased antimony uptake and overexpression of genes of thiol metabolism are associated with drug resistance in a canine isolate of Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Verónica Gómez Pérez

    2016-08-01

    Full Text Available Visceral leishmaniasis (VL caused by the protozoan parasite Leishmania infantum, is one of the most important zoonotic diseases affecting dogs and humans in the Mediterranean area. The presence of infected dogs as the main reservoir host of L. infantum is regarded as the most significant risk for potential human infection. We have studied the susceptibility profile to antimony and other anti-leishmania drugs (amphotericin B, miltefosine, paromomycin in Leishmania infantum isolates extracted from a dog before and after two therapeutic interventions with meglumine antimoniate (subcutaneous Glucantime®, 100 mg/kg/day for 28 days. After the therapeutic intervention, these parasites were significantly less susceptible to antimony than pretreatment isolate, presenting a resistance index of 6-fold to SbIII for promastigotes and >3-fold to SbIII and 3-fold to SbV for intracellular amastigotes. The susceptibility profile of this resistant L. infantum line is related to a decreased antimony uptake due to lower aquaglyceroporin-1 expression levels. Additionally, other mechanisms including an increase in thiols and overexpression of enzymes involved in thiol metabolism, such as ornithine decarboxylase, trypanothione reductase, mitochondrial tryparedoxin and mitochondrial tryparedoxin peroxidase, could contribute to the resistance as antimony detoxification mechanisms. A major contribution of this study in a canine L. infantum isolate is to find an antimony-resistant mechanism similar to that previously described in other human clinical isolates.

  13. Induction of chagasic-like arrhythmias in the isolated beating hearts of healthy rats perfused with Trypanosoma cruzi-conditioned medium

    Directory of Open Access Journals (Sweden)

    H. Rodriguez-Angulo

    2013-01-01

    Full Text Available Chagas' myocardiopathy, caused by the intracellular protozoan Trypanosoma cruzi, is characterized by microvascular alterations, heart failure and arrhythmias. Ischemia and arrythmogenesis have been attributed to proteins shed by the parasite, although this has not been fully demonstrated. The aim of the present investigation was to study the effect of substances shed by T. cruzi on ischemia/reperfusion-induced arrhythmias. We performed a triple ischemia-reperfusion (I/R protocol whereby the isolated beating rat hearts were perfused with either Vero-control or Vero T. cruzi-infected conditioned medium during the different stages of ischemia and subsequently reperfused with Tyrode's solution. ECG and heart rate were recorded during the entire experiment. We observed that triple I/R-induced bradycardia was associated with the generation of auricular-ventricular blockade during ischemia and non-sustained nodal and ventricular tachycardia during reperfusion. Interestingly, perfusion with Vero-infected medium produced a delay in the reperfusion-induced recovery of heart rate, increased the frequency of tachycardic events and induced ventricular fibrillation. These results suggest that the presence of parasite-shed substances in conditioned media enhances the arrhythmogenic effects that occur during the I/R protocol.

  14. Effect of phenobarbital on 131I-bromosulfophthalein metabolism of isolated perfused liver of rats with alpha-naphthylisothiocyanate-induced chloestasis

    International Nuclear Information System (INIS)

    Tapalaga, D.; Suciu, A.; Schvartz, M.; Duca, S.

    1979-01-01

    In order to establish whether the increased bromosulfophthalein (BSP) secretion in the bile following phenobarbital administration is the consequence of change in the bile output or of the enzymatic induction, the dynamics of the elimination of 131 I-BSP was studied in animals treated with alpha-naphthylisothiocyanate (ANIT) and pehnobarbital in the conditions of isolated perfused liver. At the same time the levels of the conjugation enzyme of BSP were also determined. It was noted that after phenobarbital the biliary elimination of 131 I-BSP is in correlation with the important increase of the output; in the animals treated with ANIT, on the other hand, the biliary excretion of BSP is minimal. The biliary elimination is directly proportional to the increase of the bile output and reflects the changes found in the perfusate. Our findings allow us to assume that the increased biliary BSP excretion is the consequence of the increase of the bile output and in a smaller extent the result of the stimulation of the BSP, conjugation with glutathion. (author)

  15. Pomegranate Extract Enhances Endothelium-Dependent Coronary Relaxation in Isolated Perfused Hearts from Spontaneously Hypertensive Ovariectomized Rats

    Science.gov (United States)

    Delgado, Nathalie T. B.; Rouver, Wender do N.; Freitas-Lima, Leandro C.; de Paula, Tiago D.-C.; Duarte, Andressa; Silva, Josiane F.; Lemos, Virgínia S.; Santos, Alexandre M. C.; Mauad, Helder; Santos, Roger L.; Moysés, Margareth R.

    2017-01-01

    Decline in estrogen levels promotes endothelial dysfunction and, consequently, the most prevalent cardiovascular diseases in menopausal women. The use of natural therapies such as pomegranate can change these results. Pomegranate [Punica granatum L. (Punicaceae)] is widely used as a phytotherapeutic agent worldwide, including in Brazil. We hypothesized that treatment with pomegranate hydroalcoholic extract (PHE) would improve coronary vascular reactivity and cardiovascular parameters. At the beginning of treatment, spontaneously hypertensive female rats were divided into Sham and ovariectomized (OVX) groups, which received pomegranate extract (PHE) (250 mg/kg) or filtered water (V) for 30 days by gavage. Systolic blood pressure was measured by tail plethysmography. After euthanasia, the heart was removed and coronary vascular reactivity was assessed by Langendorff retrograde perfusion technique. A dose-response curve for bradykinin was performed, followed by L-NAME inhibition. The protein expression of p-eNOS Ser1177, p-eNOS Thr495, total eNOS, p-AKT Ser473, total AKT, SOD-2, and catalase was quantified by Western blotting. The detection of coronary superoxide was performed using the protocol of dihydroethidium (DHE) staining Plasma nitrite measurement was analyzed by Griess method. Systolic blood pressure increased in both Sham-V and OVX-V groups, whereas it was reduced after treatment in Sham-PHE and OVX-PHE groups. The baseline coronary perfusion pressure was reduced in the Sham-PHE group. The relaxation was significantly higher in the treated group, and L-NAME attenuated the relaxation in all groups. The treatment has not changed p-eNOS (Ser1177), total eNOS, p-AKT (Ser473) and total AKT in any groups. However, in Sham and OVX group the treatment reduced the p-eNOS (Thr495) and SOD-2. The ovariectomy promoted an increasing in the superoxide anion levels and the treatment was able to prevent this elevation and reducing oxidative stress. Moreover, the treatment

  16. Efeitos hemodinâmicos e metabólicos iniciais da perfusão hipotérmica intestinal in situ.: avaliação de um novo modelo canino de autotransplante intestinal Initial hemodynamic and metabolic effects of intestinal hypothermic perfusion in situ: an alternative model of canine intestinal autotransplantation

    Directory of Open Access Journals (Sweden)

    Ruy Jorge Cruz Junior

    2004-08-01

    , hemoglobina assim como na temperatura central. CONCLUSÃO: O modelo de autotransplante intestinal é extremamente útil e de fácil execução, para a avaliação inicial de soluções de preservação e/ou drogas antioxidantes, comumente utilizadas no transplante de intestino.Intestinal transplantation is an acceptable therapy for children and adults with short bowel syndrome. The great majority of large animal experimental models of intestinal transplantation are complex and take a lot of time to be performed. In this study, we developed an alternative model of intestinal autotransplantation and evaluate the initial impact of isolated hypothermic intestinal perfusion with Ringer’s lactate solution on hemodynamic and metabolic parameters. METHODS: Six pentobarbital anesthetized mongrel dogs were used in this study (22,8±1,4 Kg. Systemic hemodynamic were evaluated through a Swan-Ganz and arterial catheters; while gastrointestinal tract perfusion by superior mesenteric vein blood flow (SMVBF, ultrasonic flowprobe and intestinal mucosal pCO2 (pCO2-int and pCO2-gap, gas tonometry. Initially, the proximal jejunum and distal ileum were transected; at the basis of the mesentery excepting the superior mesenteric artery and vein. The small bowel was then perfused in situ with cold (4ºC Ringer’s lactate solution for 30 minutes, with an automatic pump. The animals where observed for 120 minutes after reperfusion. Blood samples were collected from thoracic aorta for gas blood analysis. RESULTS: Hypothermic intestinal perfusion induced a partial reduction on SMVBF, only in the first 30 min of reperfusion (398±102,8 to 587±70,9 ml/min and an increase on pCO2-gap (2±2,7 to 29,8±6 mmHg. During the experimental protocol, we did not observe significant alterations on systemic hemodynamic or metabolic parameters (MAP, CO, pH, base excess and hemoglobin levels as well as on central core temperature. CONCLUSION: The model of intestinal transplantation is very useful to test different

  17. Lincosamide resistance is less frequent in Denmark in Staphylococcus pseudintermedius from first-time canine superficial pyoderma compared with skin isolates from clinical samples with unknown clinical background.

    Science.gov (United States)

    Larsen, Rikke; Boysen, Lene; Berg, June; Guardabassi, Luca; Damborg, Peter

    2015-06-01

    Antimicrobial resistance may be overestimated in bacterial isolates from clinical samples because veterinarians often submit samples in cases of treatment failure or recurrent cases, which are more frequently associated with resistant strains. To assess to what extent the prevalence of antimicrobial resistance in Staphylococcus pseudintermedius isolated from first-time superficial pyoderma differs from canine skin isolates from clinical samples with unknown clinical background. Two study groups were enrolled in Denmark between March 2012 and October 2013: 57 dogs with first-time superficial pyoderma and no prior antimicrobial treatment (Group A); and 289 different dogs for which skin specimens were submitted for culture during the study (Group B). One S. pseudintermedius isolate from each dog was confirmed by MALDI-TOF mass spectrometry and tested for antimicrobial susceptibility by broth microdilution. Resistance levels in the two groups were compared by Fisher's exact test. Clindamycin resistance was less frequent in Group A (14%) than in Group B (27%) (P = 0.02). Similar trends were observed for amoxicillin-clavulanic acid (1.8 versus 4.8%), chloramphenicol (8.8 versus 14.5%), enrofloxacin (1.8 versus 3.5%), oxacillin (1.8 versus 4.8%) and trimethoprim/sulfamethoxazole (3.5 versus 5.9%). Oxacillin resistance was significantly associated with resistance to six of seven non-β-lactams. The prevalence of lincosamide resistance is markedly influenced by patients' clinical and antimicrobial treatment history. To limit selection of multidrug-resistant bacteria, lincosamides are appropriate empirical choices for treatment of first-time superficial pyoderma even though resistance is not infrequent. Culture and susceptibility testing are, however, recommended for all pyoderma patients. © 2015 ESVD and ACVD.

  18. Characterization of two recent Japanese field isolates of canine distemper virus and examination of the avirulent strain utility as an attenuated vaccine.

    Science.gov (United States)

    Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko

    2014-12-05

    Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

  20. Renal perfusion scintiscan

    Science.gov (United States)

    ... Radionuclide renal perfusion scan; Perfusion scintiscan - renal; Scintiscan - renal perfusion Images Kidney anatomy Kidney - blood and urine flow Intravenous pyelogram References Rottenberg G, Andi AC. Renal ...

  1. Isolation and sequence analysis of the complete NS1 and VP2 genes of canine parvovirus from domestic dogs in 2013 and 2014 in China.

    Science.gov (United States)

    Wang, Hualei; Jin, Hongli; Li, Qian; Zhao, Guoxing; Cheng, Nan; Feng, Na; Zheng, Xuexing; Wang, Jianzhong; Zhao, Yongkun; Li, Ling; Cao, Zengguo; Yan, Feihu; Wang, Lina; Wang, Tiecheng; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu

    2016-02-01

    Canine parvovirus (CPV) can cause severe disease in animals and continuously generates new variant and recombinant strains in dogs that have a strong impact on sanitation. It is therefore necessary to investigate epidemic CPV strains to improve our understanding of CPV transmission and epidemic behavior. However, most studies have focused on the analysis of VP2, and therefore, information about recombination and relationships between strains is still lacking. Here, 14 strains of CPV were isolated from domestic dogs suspected of hosting CPV between 2013 and 2014 in China. The complete NS1 and VP2 genes were sequenced and analyzed. The results suggest that the new CPV-2a and new CPV-2b types are the prevalent strains in China. In addition to a few mutations (residues 19, 544, 545, 572 and 583 of NS1 and residues 267, 370, 377 and 440 of VP2) that were preserved during transmission, new mutations (residues 60, 630 of NS1, and residues 21, 310 of VP2) were found in the isolated strains. A phylogenetic tree based on VP2 sequences illustrated that the new CPV-2a and new CPV-2b strains from China form single clusters that are distinct from lineages from other countries. Moreover, recombination between the new CPV-2a and new CPV-2b types was also identified in the isolated strains. Due to differences in selection pressures or recombination, there were a small number of inconsistencies between the phylogenetic trees for VP2 and NS1, which indicated that phylogenetic relationships based on VP2 might not be representative of those based on NS1. The data indicated that mutations and recombination are constantly occurring along with the spread of CPV in China.

  2. Development of an Assay Based on the Effects of PGBx on the Isolated Perfused Rat Heart and Rat Skeletal Muscle.

    Science.gov (United States)

    1980-09-01

    had no effect on discphe- nol induced alterations in spontaneous heart rate, but did appear to prevent the increase in coronary flow caused by...Phosphorylase a i -24 activity was also the same in each of the groups examined (Table 2-4). DISCUSSION The ability of PGBx to prevent 2,4-dinitrophenol-induced...euthyroid and hyperthyroid rats. Eur. J. Pharmac. 19, 12-17. Aronson, C. E. and Serlick, E. R. (1977a) Effects of chlorpromazine on the isolated

  3. Vascular, but not luminal, activation of FFAR1 (GPR40) stimulates GLP-1 secretion from isolated perfused rat small intestine

    DEFF Research Database (Denmark)

    Christensen, Louise Wulff; Kuhre, Rune Ehrenreich; Janus, Charlotte

    2015-01-01

    -protein-cou- pled receptor, FFAR1 (previously GPR40), expressed on L cells and activated by long-chain fatty acids (LCFAs) is a potential target. A link between FFAR1 activation and GLP-1 secretion has been demonstrated in cellular models and small-molecule FFAR1 agonists have been developed. In this study, we exam......- ined the effect of FFAR1 activation on GLP-1 secretion using isolated, per- fused small intestines from rats, a physiologically relevant model allowing distinction between direct and indirect effects of FFAR1 activation. The endogenous FFAR1 ligand, linoleic acid (LA), and four synthetic FFAR1 ago...

  4. Continuing evolution of canine parvovirus in China: Isolation of novel variants with an Ala5Gly mutation in the VP2 protein.

    Science.gov (United States)

    Wang, Jianke; Lin, Peng; Zhao, Hang; Cheng, Yuening; Jiang, Zhong; Zhu, Hongwei; Wu, Hua; Cheng, Shipeng

    2016-03-01

    Canine parvovirus (CPV) type 2c is a new antigenic variant of CPV-2. Since the year 2000 it has spread to several countries, causing severe hemorrhagic enteritis in dogs. In 2014 and 2015, 58 fecal samples were collected from dogs in Beijing with suspected CPV infection. Regardless of the vaccination status of the dogs, 43 samples were found positive for CPV according to PCR results; i.e., 18, 7, and 18 respectively belonged to antigenic types new CPV-2a, new CPV-2b, and CPV-2c. A phylogenetic tree based on their VP2 gene sequences indicated that the Chinese CPV-2c strains form a separate cluster. In addition to synonymous mutations, the CPV-2c strains also contain a unique coding mutation in VP2 that leads to glycine at residue 5, instead of the highly conserved alanine at this position in all other CPV-2c strains sequenced to date. Using F81 cells, several novel isolates of CPV-2c, each with the Ala5Gly mutation, were obtained. One of these was used to infect experimentally beagle dogs, which subsequently developed the typical clinical symptoms of CPV infection. Hence, it appears that CPV-2c is still evolving in China, a finding that warrants continuous surveying and the eventual adaptation of current vaccines. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. The Unculturables: targeted isolation of bacterial species associated with canine periodontal health or disease from dental plaque.

    Science.gov (United States)

    Davis, Ian J; Bull, Christopher; Horsfall, Alexander; Morley, Ian; Harris, Stephen

    2014-08-01

    The current inability to culture the entirety of observed bacteria is well known and with the advent of ever more powerful molecular tools, that can survey bacterial communities at previously unattainable depth, the gap in our capacity to culture and define all of these species increases exponentially. This gap has essentially become the rate limiting step in determining how the knowledge of which species are present in a sample can be applied to understand the role of these species in an ecosystem or disease process. A case in point is periodontal disease, which is the most widespread oral disease in dogs. If untreated the disease results in significant pain, eventual loss of the dentition and potentially an increased risk of systemic diseases. Previous molecular based studies have identified the bacterial species associated with periodontal disease in dogs; however without cultured strains from many of these species it has not been possible to study whether they play a role in the disease process. Using a quantitative polymerase chain reaction (qPCR) directed approach a range of microbiological media were screened and optimized to enrich for previously uncultivated target species. A systematic screening methodology was then employed to isolate the species of interest. In cases where the target species were not cultivable in isolation, helper strains grown underneath a nitrocellulose membrane were used to provide the necessary growth factors. This guided media optimization approach enabled the purification of 14 species, 8 of which we had previously been unable to cultivate in isolation. It is also applicable to the targeted isolation of isolates from species that have previously been cultured (for example to study intra-species variation) as demonstrated by the successful isolation of 6 targeted isolates of already cultured species. To our knowledge this is the first time this combination of qPCR guided media optimization, strategic screening and helper strain

  6. Going skin deep: A direct comparison of penetration potential of lipid-based nanovesicles on the isolated perfused human skin flap model.

    Science.gov (United States)

    Ternullo, Selenia; de Weerd, Louis; Holsæter, Ann Mari; Flaten, Gøril Eide; Škalko-Basnet, Nataša

    2017-12-01

    Phospholipid-based nanocarriers are attractive drug carriers for improved local skin therapy. In the present study, the recently developed isolated perfused human skin flap (IPHSF) model was used to directly compare the skin penetration enhancing potential of the three commonly used nanocarriers, namely conventional liposomes (CLs), deformable liposomes (DLs) and solid lipid nanoparticles (SLNs). Two fluorescent markers, calcein (hydrophilic) or rhodamine (lipophilic), were incorporated individually in the three nanosystems. The nanocarrier size ranged between 200 and 300nm; the surface charge and entrapment efficiency for both markers were dependent on the lipid composition and the employed surfactant. Both carrier-associated markers could not penetrate the full thickness human skin, confirming their suitability for dermal drug delivery. CLs exhibited higher retention of both markers on the skin surface compared to DLs and SLNs, indicating a depo formation. DLs and SLNs enabled the deeper penetration of the two markers into the skin layers. In vitro and ex vivo skin penetration studies performed on the cellophane membrane and full thickness pig/human skin, respectively, confirmed the findings. In conclusion, efficient dermal drug delivery can be achieved by optimization of a lipid nanocarrier on the suitable skin-mimicking model to assure system's accumulation in the targeted skin layer. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Comparison of the virulence of three H3N2 canine influenza virus isolates from Korea and China in mouse and Guinea pig models.

    Science.gov (United States)

    Xie, Xing; Na, Woonsung; Kang, Aram; Yeom, Minjoo; Yuk, Heejun; Moon, Hyoungjoon; Kim, Sung-Jae; Kim, Hyun-Woo; Kim, Jeong-Ki; Pang, Maoda; Wang, Yongshan; Liu, Yongjie; Song, Daesub

    2018-05-02

    Avian-origin H3N2 canine influenza virus (CIV) has been the most common subtype in Korea and China since 2007. Here, we compared the pathogenicity and transmissibility of three H3N2 CIV strains [Chinese CIV (JS/10), Korean CIV (KR/07), and Korean recombinant CIV between the classic H3N2 CIV and the pandemic H1N1 virus (MV/12)] in BALB/c mouse and guinea pig models. The pandemic H1N1 (CA/09) strain served as the control. BALB/c mice infected with H1N1 had high mortality and obvious body weight loss, whereas no overt disease symptoms were observed in mice inoculated with H3N2 CIV strains. The viral titers were higher in the group MV/12 than those in groups JS/10 and KR/07, while the mice infected with JS/10 showed higher viral titers in all tissues (except for the lung) than the mice infected with KR/07. The data obtained in guinea pigs also demonstrated that group MV/12 presented the highest loads in most of the tissues, followed by group JS/10 and KR/07. Also, direct contact transmissions of all the three CIV strains could be observed in guinea pigs, and for the inoculated and the contact groups, the viral titer of group MV/12 and KR/07 was higher than that of group JS/10 in nasal swabs. These findings indicated that the matrix (M) gene obtained from the pandemic H1N1 may enhance viral replication of classic H3N2 CIV; JS/10 has stronger viral replication ability in tissues as compared to KR/07, whereas KR/07 infected guinea pigs have more viral shedding than JS/10 infected guinea pigs. There exists a discrepancy in pathobiology among CIV isolates. Reverse genetics regarding the genomes of CIV isolates will be helpful to further explain the virus characteristics.

  8. Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

    Science.gov (United States)

    Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

    2016-08-02

    In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

  9. Some processes of energy saving and expenditure occurring during ethanol perfusion in the isolated liver of fed rats; a Nuclear Magnetic Resonance study.

    Directory of Open Access Journals (Sweden)

    Gin Henri

    2004-03-01

    Full Text Available Abstract Background In the isolated liver of fed rats, a 10 mM ethanol perfusion rapidly induced a rapid 25% decrease in the total ATP content, the new steady state resulting from both synthesis and consumption. The in situ rate of mitochondrial ATP synthesis without activation of the respiration was increased by 27%, implying an increased energy demand. An attempt to identify the ethanol-induced ATP-consuming pathways was performed using 31P and 13C Nuclear Magnetic Resonance. Results Ethanol (i transiently increased sn-glycerol-3-phosphate formation whereas glycogenolysis was continuously maintained; (ii decreased the glycolytic ATP supply and (iii diminished the intracellular pH in a dose-dependent manner in a slight extend. Although the cytosolic oxidation of ethanol largely generated H+ (and NADH, intracellular pHi was maintained by (i the large and passive excretion of cellular acetic acid arising from ethanol oxidation (evidenced by exogenous acetate administration, without energetic cost or (ii proton extrusion via the Na+-HCO3- symport (implying the indirect activation of the Na+-K+-ATPase pump and thus an energy use, demonstrated during the addition of their specific inhibitors SITS and ouabaïn, respectively. Conclusion Various cellular mechanisms diminish the cytosolic concentration of H+ and NADH produced by ethanol oxidation, such as (i the large but transient contribution of the dihydroxyacetone phosphate / sn-glycerol-3-phosphate shuttle between cytosol and mitochondria, mainly implicated in the redox state and (ii the major participation of acetic acid in passive proton extrusion out of the cell. These processes are not ATP-consuming and the latter is a cellular way to save some energy. Their starting in conjunction with the increase in mitochondrial ATP synthesis in ethanol-perfused whole liver was however insufficient to alleviate either the inhibition of glycolytic ATP synthesis and/or the implication of Na+-HCO3- symport and

  10. Extracts from the Mongolian traditional medicinal plants Dianthus versicolorFisch. and Lilium pumilum Delile stimulate bile flow in an isolated perfused rat liver model.

    Science.gov (United States)

    Obmann, Astrid; Tsendayush, Damba; Thalhammer, Theresia; Zehl, Martin; Vo, Thanh Phuong Nha; Purevsuren, Sodnomtseren; Natsagdorj, Damdinsuren; Narantuya, Samdan; Kletter, Christa; Glasl, Sabine

    2010-10-05

    Dianthus versicolor (Caryophyllaceae) and Lilium pumilum (Liliaceae) are two medicinal plants used in traditional Mongolian medicine to treat hepatic and gastrointestinal disorders. In this study aqueous (AE) and methanolic (ME) extracts of Dianthus versicolor and Lilium pumilum were investigated for their influence on the bile flow. The aqueous extracts of both plants were tested in absence and presence of 10 μM taurocholic acid at three different concentrations (100, 250, and 500 mg/L). The aqueous extract of Dianthus versicolor was further purified in order to locate the active principles. Two resulting fractions, one enriched in flavonoids and the other in sugars, were investigated for their influence on the bile flow in absence of taurocholic acid at 10, 20, and 40 mg/L. The aqueous extracts of both plants were analysed qualitatively by LC-MS(n) and quantitatively by UV-spectrophotometry. The bile flow experiments were performed in the isolated perfused rat liver. The compounds were identified by LC-DAD-MS(n) and TLC using references. The UV-spectrophotometric analysis was based on the monograph "Passiflorae herba" of the European Pharmacopoeia, and the total flavonoid contents were calculated and expressed as vitexin. AE and ME of both plants increased the bile flow dose-dependently (between 9% and 30%), and no hepatotoxic effect was seen even during longer perfusions. Stimulation of bile secretion was comparable in the presence and in the absence of taurocholic acid. The flavonoid fraction of Dianthus versicolor increased the bile flow by 18% (pDianthus versicolor AE (total flavonoid content 1.78%) revealed the presence of the isovitexin derivative saponarin. In the AE of Lilium pumilum (total flavonoid content 1.04%) the flavonoids rutoside, kaempferol-3-O-rutinoside, and isorhamnetin-3-O-rutinoside were detected. The results show that choleresis under extract application is due to a stimulation of the bile-salt-independent bile flow which might be caused

  11. Dissociation between cardiomyocyte function and remodeling with beta-adrenergic receptor blockade in isolated canine mitral regurgitation.

    Science.gov (United States)

    Pat, Betty; Killingsworth, Cheryl; Denney, Thomas; Zheng, Junying; Powell, Pamela; Tillson, Michael; Dillon, A Ray; Dell'Italia, Louis J

    2008-12-01

    The low-pressure volume overload of isolated mitral regurgitation (MR) is associated with increased adrenergic drive, left ventricular (LV) dilatation, and loss of interstitial collagen. We tested the hypothesis that beta1-adrenergic receptor blockade (beta1-RB) would attenuate LV remodeling after 4 mo of MR in the dog. beta1-RB did not attenuate collagen loss or the increase in LV mass in MR dogs. Using MRI and three-dimensional (3-D) analysis, there was a 70% increase in the LV end-diastolic (LVED) volume-to-LV mass ratio, a 23% decrease in LVED midwall circumferential curvature, and a >50% increase in LVED 3-D radius/wall thickness in MR dogs that was not attenuated by beta1-RB. However, beta1-RB caused a significant increase in LVED length from the base to apex compared with untreated MR dogs. This was associated with an increase in isolated cardiomyocyte length (171+/-5 microm, P<0.05) compared with normal (156+/-3 microm) and MR (165+/-4 microm) dogs. Isolated cardiomyocyte fractional shortening was significantly depressed in MR dogs compared with normal dogs (3.73+/-0.31 vs. 5.02+/-0.26%, P<0.05) and normalized with beta1-RB (4.73+/-0.48%). In addition, stimulation with the beta-adrenergic receptor agonist isoproterenol (25 nM) increased cardiomyocyte fractional shortening by 215% (P<0.05) in beta1-RB dogs compared with normal (56%) and MR (50%) dogs. In summary, beta1-RB improved LV cardiomyocyte function and beta-adrenergic receptor responsiveness despite further cell elongation. The failure to attenuate LV remodeling associated with MR could be due to a failure to improve ultrastructural changes in extracellular matrix organization.

  12. Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

    Science.gov (United States)

    Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

    2002-08-01

    Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

  13. The kinetics of {beta}-methyl-substituted labelled fatty acids in ischaemic myocardium: an analysis in man and with a blood-perfused isolated heart model

    Energy Technology Data Exchange (ETDEWEB)

    Marie, P.Y.; Ayalew, A.; Hassan, N.; Olivier, P.; Karcher, G.; Bertrand, A. [Dept. of Nuclear Medicine, UPRES EA, Nancy (France); Menu, P. [Dept. of Hematology and Physiology, University Henri Poincare, Nancy (France); Angioi, M.; Mertes, P.M.; Danchin, N. [Dept. of Cardiology, UPRES EA, Nancy (France); Fagret, D. [Dept. of Nuclear Medicine, Grenoble (France); Pasqualini, R. [CIS Bio International, Gif-sur-Yvette (France)

    1999-05-01

    {beta}-Methyl-substituted free fatty acids (FFAs) have been developed for myocardial single-photon emission tomography (SPET) imaging, but little is known about their kinetics in ischaemic conditions. The aim of this study was to determine the changes in the myocardial kinetics of a {beta}-methyl-branched FFA, [{sup 123}I]16-iodo-3-methyl-hexadecanoic acid (MIHA), under ischaemic conditions. The kinetics of MIHA were analysed: (a) using a blood-perfused isolated heart model subjected to moderate ischaemia (50% flow reduction) and (b) in patients who had an exercise thallium-201 SPET defect corresponding to either necrotic (n = 13) or chronically ischaemic and viable (n = 15) myocardium, and who underwent two consecutive SPET studies after MIHA injection. In animals, the myocardial early retention fraction of MIHA, but not its clearance rate, was dependent on coronary flow, the early retention fraction being higher in ischaemic than in normoxic conditions (0.24{+-}0.10 vs 0.14{+-}0.04, P = 0.004). In the patient SPET studies, the uptake of MIHA calculated in ischaemic and viable areas (G1: 74%{+-}9% of maximal left ventricular value) was different from that calculated in necrotic (G2: 59%{+-}7%, P<0.001) or normal (G3: 88{+-}6%, P<0.001) areas. By contrast, MIHA-clearance calculated between the two consecutive SPET studies was not different in G1, G2 and G3. Unlike in the case of other FFAs, the myocardial clearance of MIHA is not decreased by ischaemia. However, the early retention of MIHA is increased in the case of a moderate reduction in coronary flow, a property which might help in the detection of viability in chronically ischaemic myocardium. (orig.) With 5 figs., 3 tabs., 44 refs.

  14. Randomized multicenter trial of hyperthermic isolated limb perfusion with melphalan alone compared with melphalan plus tumor necrosis factor: American College of Surgeons Oncology Group Trial Z0020.

    Science.gov (United States)

    Cornett, Wendy R; McCall, Linda M; Petersen, Rebecca P; Ross, Merrick I; Briele, Henry A; Noyes, R Dirk; Sussman, Jeffrey J; Kraybill, William G; Kane, John M; Alexander, H Richard; Lee, Jeffrey E; Mansfield, Paul F; Pingpank, James F; Winchester, David J; White, Richard L; Chadaram, Vijaya; Herndon, James E; Fraker, Douglas L; Tyler, Douglas S

    2006-09-01

    To determine in a randomized prospective multi-institutional trial whether the addition of tumor necrosis factor alpha (TNF-alpha) to a melphalan-based hyperthermic isolated limb perfusion (HILP) treatment would improve the complete response rate for locally advanced extremity melanoma. Patients with locally advanced extremity melanoma were randomly assigned to receive melphalan or melphalan plus TNF-alpha during standard HILP. Patient randomization was stratified according to disease/treatment status and regional nodal disease status. The intervention was completed in 124 patients of the 133 enrolled. Grade 4 adverse events were observed in 14 (12%) of 129 patients, with three (4%) of 64 in the melphalan-alone arm and 11 (16%) of 65 in the melphalan-plus-TNF-alpha arm (P = .0436). There were two toxicity-related lower extremity amputations in the melphalan-plus-TNF-alpha arm, and one disease progression-related upper extremity amputation in the melphalan-alone arm. There was no treatment-related mortality in either arm of the study. One hundred sixteen patients were assessable at 3 months postoperatively. Sixty-four percent of patients (36 of 58) in the melphalan-alone arm and 69% of patients (40 of 58) in the melphalan-plus-TNF-alpha arm showed a response to treatment at 3 months, with a complete response rate of 25% (14 of 58 patients) in the melphalan-alone arm and 26% (15 of 58 patients) in the melphalan-plus-TNF-alpha arm (P = .435 and P = .890, respectively). In locally advanced extremity melanoma treated with HILP, the addition of TNF-alpha to melphalan did not demonstrate a significant enhancement of short-term response rates over melphalan alone by the 3-month follow-up, and TNF-alpha plus melphalan was associated with a higher complication rate.

  15. Action of ouabain and an amino-cardenolide on Na+-pump function and contractility of isolated canine heart cells

    International Nuclear Information System (INIS)

    Porterfield, L.M.; Songu-Mize, E.; Chryssanthis, T.; Caldwell, R.W.

    1986-01-01

    Viable, rod-shaped, Ca ++ -tolerant cells were isolated from the cardiac ventricle of adult mongrel dogs, a digitalis-sensitive species. These cells do not contract spontaneously but contractions were driven by electrical field stimulation. Changes in contractile amplitude were assessed by computer-assisted analysis of recorded phase contrast images. Addition of a polar aminocardenolide (AC), ASI-222, produced a dose-related increase in contractility with a concentration producing a 50% maximal response (RC 50 ) of 4 x 10 -8 M. For ouabain (OB) the RC 50 was 7 x 10 -7 M. Cellular Na + -pump (NaP) function was determined as digitalis-sensitive 86 Rb + -uptake. Addition of AC and OB to these cells produced a dose-related decrease in 86 Rb + -uptake; concentrations which produced a 50% inhibition (IC 50 ) of NaP function were of 6 x 10 -8 M and 1.2 x 10 -6 M for AC and OB, respectively. Their data indicates that in isolated dog heart cells AC is both a more potent inotropic agent and an inhibitor of NaP function by 15-20 fold than OB. The RC 50 and IC 50 for these processes correlate for each glycoside

  16. High-fat diet-induced insulin resistance does not increase plasma anandamide levels or potentiate anandamide insulinotropic effect in isolated canine islets.

    Directory of Open Access Journals (Sweden)

    Orison O Woolcott

    Full Text Available Obesity has been associated with elevated plasma anandamide levels. In addition, anandamide has been shown to stimulate insulin secretion in vitro, suggesting that anandamide might be linked to hyperinsulinemia.To determine whether high-fat diet-induced insulin resistance increases anandamide levels and potentiates the insulinotropic effect of anandamide in isolated pancreatic islets.Dogs were fed a high-fat diet (n = 9 for 22 weeks. Abdominal fat depot was quantified by MRI. Insulin sensitivity was assessed by the euglycemic-hyperinsulinemic clamp. Fasting plasma endocannabinoid levels were analyzed by liquid chromatography-mass spectrometry. All metabolic assessments were performed before and after fat diet regimen. At the end of the study, pancreatic islets were isolated prior to euthanasia to test the in vitro effect of anandamide on islet hormones. mRNA expression of cannabinoid receptors was determined in intact islets. The findings in vitro were compared with those from animals fed a control diet (n = 7.Prolonged fat feeding increased abdominal fat content by 81.3±21.6% (mean±S.E.M, P<0.01. In vivo insulin sensitivity decreased by 31.3±12.1% (P<0.05, concomitant with a decrease in plasma 2-arachidonoyl glycerol (from 39.1±5.2 to 15.7±2.0 nmol/L but not anandamide, oleoyl ethanolamide, linoleoyl ethanolamide, or palmitoyl ethanolamide. In control-diet animals (body weight: 28.8±1.0 kg, islets incubated with anandamide had a higher basal and glucose-stimulated insulin secretion as compared with no treatment. Islets from fat-fed animals (34.5±1.3 kg; P<0.05 versus control did not exhibit further potentiation of anandamide-induced insulin secretion as compared with control-diet animals. Glucagon but not somatostatin secretion in vitro was also increased in response to anandamide, but there was no difference between groups (P = 0.705. No differences in gene expression of CB1R or CB2R between groups were found.In canines, high-fat diet

  17. Cirurgia do arco aórtico com perfusão cerebral bilateral pelo isolamento do tronco braquiocefálico e da artéria carótida esquerda Aortic arch surgery with bilateral cerebral perfusion by isolation of brachiocephalic trunk and left carotid artery

    Directory of Open Access Journals (Sweden)

    Valdo José Carreira

    2008-03-01

    Full Text Available OBJETIVO: Estudar os resultados da técnica descrita por Carreira et al. com utilização de perfusão cerebral seletiva bilateral (PCSAB pelo isolamento do tronco braquiocefálico e artéria carótida esquerda. MÉTODOS: Quinze pacientes foram operados consecutivamente entre de junho de 2005 e setembro de 2007. Os dados foram analisados por programa informatizado Epi Info e significância estatística com p0,05. CONCLUSÃO: A técnica de PCSAB é reprodutível e apresenta resultados semelhantes aos da literatura mundial. A excelente evolução neurológica e o fácil controle de sangramentos nas linhas de sutura podem ter contribuído com os resultados obtidos.OBJECTIVE: To evaluate the results of a technique described by Carreira et al. using bilateral antegrade selective cerebral perfusion by isolating the brachiocephalic trunk and the left carotid artery. METHODS: Fifteen patients were operated between June 2005 and September 2007. Data analysis were performed using Epi Info and statistical significance was set at p0.05. CONCLUSION: The technique of bilateral selective cerebral perfusion described by Carreira et al. can be performed by others and presents similar results to the international literature. The excellent neurological outcome and easy bleeding control on surgical sutures lines are the major advantages of this new procedure.

  18. Increased sinusoidal volume and solute extraction during retrograde liver perfusion

    International Nuclear Information System (INIS)

    Bass, N.M.; Manning, J.A.; Weisiger, R.A.

    1989-01-01

    Retrograde isolated liver perfusion has been used to probe acinar functional heterogeneity, but the hemodynamic effects of backward flow have not been characterized. In this study, extraction of a long-chain fatty acid derivative, 12-N-methyl-7-nitrobenzo-2-oxa-1,3-diazol-amino stearate (12-NBDS), was greater during retrograde than during anterograde perfusion of isolated rat liver. To determine whether hemodynamic differences between anterograde and retrograde perfused livers could account for this finding, the hepatic extracellular space was measured for both directions of flow by means of [ 14 C]sucrose washout during perfusion as well as by direct measurement of [ 14 C]sucrose entrapped during perfusion. A three- to fourfold enlargement of the total hepatic extracellular space was found during retrograde perfusion by both approaches. Examination of perfusion-fixed livers by light microscopy and morphometry revealed that marked distension of the sinusoids occurred during retrograde perfusion and that this accounts for the observed increase in the [ 14 C]sucrose space. These findings support the hypothesis that maximum resistance to perfusate flow in the isolated perfused rat liver is located at the presinusoidal level. In addition, increased transit time of perfusate through the liver and greater sinusoidal surface area resulting from sinusoidal distension may account for the higher extraction of 12-NBDS and possibly other compounds by retrograde perfused liver

  19. Fractures after multimodality treatment of soft tissue sarcomas with isolated limb perfusion and radiation; likely to occur and hard to heal.

    Science.gov (United States)

    Seinen, J M; Jutte, P C; Been, L B; Pras, E; Hoekstra, H J

    2018-04-24

    Treatment associated fractures (TAFs) are known severe side effects after surgery and radiotherapy for soft tissue sarcoma (STS). There is no literature about TAF after multimodality treatment with isolated limb perfusion (ILP) for locally advanced STS. This study aimed to analyze predictive factors, treatment and outcome for TAF after multimodality treatment with ILP. Out of 126 consecutive patients undergoing ILP after 1991 till now, 25 patients were excluded due to no surgery or direct amputation at initial surgery. Therefore, 101 patients were at risk and 12 developed a TAF (12%). The majority of tumors was located at the upper leg and knee (N = 60), and 11 patients developed a TAF (18%) after median 28 (5-237) months. Twenty-five tumors were located at the lower leg, and 1 patient developed a TAF after 12 months (4%). No patients with a tumor at the upper extremities (N = 16) developed a TAF. Ten out of 12 patients with a fracture received adjuvant RT with a dose of 50 Gy, and a median boost dose of 18 (10-20) Gy. Predictive factors were periosteal stripping, age over 65 years at time of treatment and tumor size after ILP ≥10 cm. Multivariate analysis showed periosteal stripping and tumor size after ILP ≥10 cm as significant predictive factors. The majority of the fractures were treated with intramedullary nailing. Only one of 12 patients without radiotherapy reached bone union (8%). The median survival after developing TAF was 18 (1-195) months. The overall risk of TAF after multimodality treatment with ILP was relatively high with 15% at ten years. The incidence of TAF for patients with tumors located at the thigh and knee after resection with periosteal stripping and radiotherapy was even >50%. The treatment of these fractures is challenging due to the high non-union rate, requiring an extensive orthopedic oncological TAF experience. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical

  20. Utilization by the isolated perfused rat liver of N-acetyl-D-(1-/sup 14/C)galactosamine and N-brace/sup 3/H)-acetyl-D-galactosamine for the biosynthesis of glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    MacNicoll, A D; Wusteman, F S; Powell, G M; Curtis, C G [University Coll., Cardiff (UK)

    1978-08-15

    The isolated perfused rat liver system has been used to monitor the utilization of N-(/sup 3/H)acetyl-D-galactosamine and N-acetyl-D-(1-/sup 14/C)galactosamine for the biosynthesis of radiolabeled glycoproteins, which are subsequently secreted into the plasma. Both radiolabels appear in a number of different glycoproteins, predominantly as sialic acid and N-acetylglucosamine. The ratio of labelled sialic acid to labelled N-acetylglucosamine varies for different glycoproteins, but the bulk of N-acetyl-D-galactosamine is incorporated without deacetylation.

  1. [Dynamics of the amino acid composition of the medium during cultivation of isolated liver and kidney by the controlled perfusion method].

    Science.gov (United States)

    Barashkov, V A; Gitel'zon, I I; Nefedov, V P; Trubachev, I N

    1975-11-01

    The dynamics of the medium amino acid composition was studied during a 6-hour perfusion of dog kidney and liver by a mixture of autogenic plasma and medium 199 (a ratio of 2 : 3). In comparison to the initial level the amount of histidine during 6-hour cultivation of the kidney was found to increase 2.2 times, that of glutamic acid--1.7 times, and of alanine and lysine--1.6 times. At the same time the amount of arginine, serine and asparagic acid became 3.3 times and of glutamine and threonine--2.5 times lower. With the liver perfusion the level of glutaminic acid became 2.9 times, of alanine--2.3 times, of cystine--2 times and of glycine--1.5 times higher. With the liver perfusion the level of arginine decreased so rapidly that none was found in the medium after a 2-hour perfusion. The described method of amino acid analysis during the cultivation of the organs could serve as means for elaborating and correcting the culture media.

  2. Beneficial effects of hyperosmotic perfusion in the myocardium after ischemia/reperfusion injury in isolated rat hearts Efeitos benéficos da perfusão hiperosmótica no miocárdio após lesão isquemia/reperfusão em corações isolados de ratos

    Directory of Open Access Journals (Sweden)

    Yong Cao

    2013-03-01

    Full Text Available OBJECTIVE: A simple method to reduce the ischemia/reperfusion injury that can accompany cardiac surgery would have great clinical value. This study was to investigate the effect of hyperosmotic perfusion on ischemia/reperfusion injury in isolated perfused rat hearts. METHOD: Forty male Sprague-Dawley rats were randomly divided either to have their isolated hearts perfused with normal osmotic buffer or buffer made hyperosmotic by addition of glucose. Hearts were then subjected to 30 min ischemia followed by 30 min reperfusion. Coronary flow, time to ischemic arrest, reperfusion arrhythmia, and ventricular function were recorded. Creatine phosphokinase leakage into the coronary artery, and myocardial content and activity of superoxide dismutase and catalase were also examined. RESULTS: Rat hearts with hyperosmotic perfusion showed higher coronary flow, a prolonged time to ischemic arrest (10.60 vs. 5.63 min, POBJETIVO: Um método simples para reduzir a lesão de isquemia/reperfusão que pode acompanhar a cirurgia cardíaca teria grande valor clínico. O objetivo deste estudo foi investigar o efeito da perfusão hiperosmótica na isquemia/reperfusão em corações isolados de ratos perfundidos. MÉTODOS: Quarenta ratos machos Sprague-Dawley foram divididos aleatoriamente e tiveram os seus corações isolados perfundidos com tampão osmótico normal ou tampão hiperosmótico com a adição de glucose. Os corações foram então submetidos a 30 minutos de isquemia, seguida de 30 min de reperfusão. O fluxo coronariano, tempo de parada isquêmica, arritmia de reperfusão e da função ventricular foram registrados. Vazamento creatinofosfoquinase na artéria coronária, o miocárdio e atividade de superóxido dismutase e catalase foram também examinados. RESULTADOS: Crações de ratos com perfusão hiperosmótica apresentaram maior fluxo coronariano, tempo prolongado de parada isquêmica (10,60 vs. 5,63 min, P<0,005, menor pontuação de reperfus

  3. Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

    Science.gov (United States)

    Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

    2000-12-01

    To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

  4. Characterization of an Isolated Kidney's Vasculature for Use in Bio-Thermal Modeling

    Science.gov (United States)

    Payne, Allison H.; Parker, Dennis L.; Moellmer, Jeff; Roemer, Robert B.; Clifford, Sarah

    2007-05-01

    Accurate bio-thermal modeling requires site-specific modeling of discrete vascular anatomy. Presented herewith are several steps that have been developed to describe the vessel network of isolated canine and bovine kidneys. These perfused, isolated kidneys provide an environment to repeatedly test and improve acquisition methods to visualize the vascular anatomy, as well as providing a method to experimentally validate discrete vasculature thermal models. The organs are preserved using a previously developed methodology that keeps the vasculature intact, allowing for the organ to be perfused. It also allows for the repeated fixation and re-hydration of the same organ, permitting the comparison of various methods and models. The organ extraction, alcohol preservation, and perfusion of the organ are described. The vessel locations were obtained through a high-resolution time-of-flight (TOF) magnetic resonance angiography (MRA) technique. Sequential improvements of both the experimental setup used for this acquisition, as well as MR sequence development are presented. The improvements in MR acquisition and experimental setup improved the number of vessels seen in both the raw data and segmented images by 50%. An automatic vessel centerline extraction algorithm describes both vessel location and genealogy. Centerline descriptions also allows for vessel diameter and flow rate determination, providing valuable input parameters for the discrete vascular thermal model. Characterized vessels networks of both canine and bovine kidneys are presented. While these tools have been developed in an ex vivo environment, all steps can be applied to in vivo applications.

  5. Perfusão pulmonar anterógrada "versus" retrógrada na preservação pulmonar para transplante em modelo canino de viabilidade pulmonar pós-morte Antegrade versus retrograde lung perfusion in pulmonary preservation for transplantation in a canine model of post-mortem lung viability

    Directory of Open Access Journals (Sweden)

    Jean Carlo Kohmann

    1999-04-01

    Full Text Available A doação pulmonar após parada cardiocirculatória tem sido estudada experimentalmente na obtenção de órgãos para transplante, porém a severa lesão isquêmica/reperfusão exigem métodos de preservação que permitam viabilidade pulmonar. A perfusão do enxerto com solução cristalóide hipotérmica via anterógrada (artéria pulmonar é o método de preservação mais utilizado, porém esta via não perfunde a circulação brônquica, permitindo a retenção sanguínea neste território capaz de desencadear fenômenos de lesão de reperfusão. Isto nos levou a testar os efeitos da perfusão anterógrada versus retrógrada (via átrio esquerdo, capaz de perfundir a circulação brônquica em modelo canino de transplante unilateral cujos pulmões foram extraídos 3 horas após parada cardiorrespiratória. Doze cães doadores foram sacrificados com tiopental sódico e mantidos à temperatura ambiente sob ventilação mecânica durante 3 horas, após as quais os animais foram randomizados e os blocos cardiopulmonares perfundidos via retrógrada (n = 6 ou anterógrada (n = 6 com solução de Euro-Collins modificada e extraídos. Os receptores (n = 12 foram anestesiados, pneumonectomizados e submetidos a transplante pulmonar esquerdo recebendo enxertos perfundidos por via retrógrada (grupo I ou anterógrada (grupo II. Após a reperfusão do enxerto, os animais foram mantidos sob ventilação mecânica (FiO2 = 1 por 6 horas, sendo então sacrificados. Durante este período obtiveram-se medidas hemodinâmicas e gasometrias arteriais, além de amostras de tecido pulmonar para dosagem de ATP intracelular. As medidas hemodinâmicas não diferiram entre os grupos. Nos animais do grupo I a PaO2 e PaCO2 foram superiores às do grupo II (p = 0,016 e p = 0,008, respectivamente. O ATP intracelular não diferiu entre os grupos, embora tenha se reduzido nas amostras obtidas na extração do enxerto do doador quando comparados aos valores após a

  6. Vaccine-induced canine distemper in a lesser panda.

    Science.gov (United States)

    Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

    1976-11-01

    A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

  7. The Ondersteport Canine distemper virus strain and measles ...

    African Journals Online (AJOL)

    Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

  8. Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

    Science.gov (United States)

    Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

    2017-06-01

    Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

  9. Identification of a novel linear B-cell epitope using a monoclonal antibody against the carboxy terminus of the canine distemper virus nucleoprotein and sequence analysis of the identified epitope in different CDV isolates.

    Science.gov (United States)

    Yi, Li; Cao, Zhigang; Tong, Mingwei; Cheng, Yuening; Yang, Yong; Li, Shuang; Wang, Jianke; Lin, Peng; Sun, Yaru; Zhang, Miao; Cheng, Shipeng

    2017-09-29

    The Nucleoprotein (NP) is the most abundant and highly immunogenic protein in canine distemper virus (CDV), playing an important role in CDV viral replication and assembly. In this study, a specific monoclonal antibody, named C8, was produced against the NP protein C terminal (amino acids 401-523). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis.The results indicated that 444 GDKYPIHFNDER 455 was the minimal linear epitope that could be recognized by mAb C8. Sequence alignments demonstrated that this linear epitope is less conserved among three CDV genotypes. We next analyzed the level of conservation of the defined epitope in19 Chinese CDV clinical isolates, and it has one site variation in amino acid among these CDV isolations. 2 isolates have the amino acid mutations F451L, while one has P448Ssubstitution.Phylogenetic analysis showed the two isolates with F451Lsubstitution had a closer relationship in a virulent strain ZJ-7, so the epitope may be a significant tag associated with virus virulence. This collection of mAb along with defined linear epitope may provide useful reagents for investigations of NP protein function and the development of CDV specific diagnostics.

  10. Perfusion-induced changes in cardiac contractility depend on capillary perfusion.

    Science.gov (United States)

    Dijkman, M A; Heslinga, J W; Sipkema, P; Westerhof, N

    1998-02-01

    The perfusion-induced increase in cardiac contractility (Gregg phenomenon) is especially found in heart preparations that lack adequate coronary autoregulation and thus protection of changes in capillary pressure. We determined in the isolated perfused papillary muscle of the rat whether cardiac muscle contractility is related to capillary perfusion. Oxygen availability of this muscle is independent of internal perfusion, and perfusion may be varied or even stopped without loss of function. Muscles contracted isometrically at 27 degrees C (n = 7). During the control state stepwise increases in perfusion pressure resulted in all muscles in a significant increase in active tension. Muscle diameter always increased with increased perfusion pressure, but muscle segment length was unaffected. Capillary perfusion was then obstructed by plastic microspheres (15 microns). Flow, at a perfusion pressure of 66.6 +/- 26.2 cmH2O, reduced from 17.6 +/- 5.4 microliters/min in the control state to 3.2 +/- 1.3 microliters/min after microspheres. Active tension developed by the muscle in the unperfused condition before microspheres and after microspheres did not differ significantly (-12.8 +/- 29.4% change). After microspheres similar perfusion pressure steps as in control never resulted in an increase in active tension. Even at the two highest perfusion pressures (89.1 +/- 28.4 and 106.5 +/- 31.7 cmH2O) that were applied a significant decrease in active tension was found. We conclude that the Gregg phenomenon is related to capillary perfusion.

  11. Canine thymoma

    International Nuclear Information System (INIS)

    Aronsohn, M.

    1985-01-01

    Thymoma is an uncommon canine neoplasm of thymic epithelial cells. It is seen in various breeds but may occur more frequently in German Shepherd Dogs. Middle-aged or older dogs can be affected and no sex predilection exists. A paraneoplastic syndrome of myasthenia gravis, nonthymic malignant tumors, and/or polymyositis occurs in a significant number of dogs with thymoma. Clinical signs are variable and are related to a space-occupying cranial mediastinal mass and/or manifestations of the paraneo-plastic syndrome. Dyspnea is the most common presenting clinical sign. Thoracic radiographs usually show a cranial mediastinal mass. Lymphoma is the main differential diagnosis. A definitive diagnosis may be made by closed biopsy but is more likely to be confirmed by thoracotomy. Thymomas may be completely contained within the thymic capsule or may spread by local invasion or metastasis. A staging system allows for an accurate prognosis and a therapeutic plan. Surgical removal of encapsulated thymomas may result in long-term survival or cure. Invasive or metastatic thymomas carry a guarded prognosis. Manifestations of the paraneoplastic syndrome complicate treatment. Adjuvant radiation and chemotherapy may be of value for advanced cases; however, adequate clinical trials have not been done in the dog

  12. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

  13. Short-term memory and electrical restitution in the canine transmural ventricle

    International Nuclear Information System (INIS)

    Zhang, Hong; Ueyama, Takeshi; Lin, Shien-Fong; Wang, Juan; Wu, Rui-Juan

    2011-01-01

    Cardiac short-term memory is an intrinsic property of paced myocardium that reflects the influence of pacing history. Using an optical mapping method to record membrane voltage and intracellular calcium (Ca 2+ i ), this study investigated the properties and mechanisms of short-term memory in isolated and perfused canine wedge preparations. In addition to the dynamic and S1S2 pacing protocols, a perturbed downsweep pacing protocol was used to get a complete overview of the restitution portrait. Abrupt changes in basic cycle length (BCL) were applied to investigate the accommodation process of action potential duration (APD). The results showed unobvious differences of memory among the epi-, mid- and endo-myocytes, implying an insignificant memory-induced transient heterogeneity in APD across the transmural canine hearts. With the decrease of pacing rate S1, memory gradually elevated and achieved a maximum around 400 ms, and then reduced as S1 decreased further, indicating a non-monotonic relationship between memory and the pacing rate. After suppressing the Ca 2+ i transient with ryanodine (3 µmol l −1 ), the accommodation process of APD to a new BCL significantly abbreviated (τ = 37.41 ± 4.42 stimuli before ryanodine, τ = 15.84 ± 4.74 stimuli after ryanodine, p < 0.01). Therefore, Ca 2+ i cycling was suggested to play an important role in memory during dynamic pacing

  14. The beneficial in vitro effects of lovastatin and chelerythrine on relaxatory response to acetylcholine in the perfused mesentric bed isolated from diabetic rats.

    Science.gov (United States)

    Fatehi-Hassanabad, Zahra; Imen-Shahidi, Mohsen; Fatehi, Mohammad; Farrokhfall, Khadijeh; Parsaeei, Heidar

    2006-03-27

    Diabetes mellitus is associated with an increased risk of cardiovascular disease. Endothelial dysfunction (i.e. decreased endothelium-dependent vasorelaxation) plays a key role in the pathogenesis of diabetic vascular disease. The present study was undertaken to determine whether diabetes induced by streptozotocin alters mesenteric responses to vasodilators and, if so, to study the acute in vitro effects of lovastatin and chelerythrine. Endothelial function was assessed in constantly perfused preparation removed from rats, 12 weeks after treatment with either saline or streptozotocin (45 mg/kg, intraperitoneally). In pre-contracted mesenteric beds (with 100 microM phenylephrine) removed from diabetic rats, the concentration response curve to acetylcholine, but not to sodium nitroprusside, was significantly reduced. Perfusion with lovastatin (10 microM for 20 min) or chelerythrine (1 microM for 20 min) significantly improved the acetylcholine-mediated relaxation in preparations removed from diabetic but not control rats. Pre-incubation of tissue with N(G)-nitro-L-argenine methyl ester hydrochloride (10 microM for 20 min) inhibited the beneficial effect of lovastatin but not chelerythrine. Pre-treatment of tissue with indomethacin (10 microM for 20 min) did not modify the effects of lovastatin or chelerythrine on acetylcholine responses. The present results demonstrate that endothelial dysfunction induced by diabetes (in a resistant vasculature, such as rat mesenteric bed) may be improved by an acute exposure to either lovastatin or chelerythrine. Furthermore, our results suggest that the beneficial effect of lovastatin is mediated via the nitric oxide pathway.

  15. Histamine combined with melphalan in isolated limb perfusion for the treatment of locally advanced soft tissue sarcomas: preclinical studies in rats Histamina combinada ao melfalano na perfusão de membro isolado para o tratamento de sarcomas de partes moles localmente avançado: estudos pré-clínicos em ratos

    Directory of Open Access Journals (Sweden)

    Flavia Brunstein

    2005-08-01

    Full Text Available PURPOSE: To evaluate the potential benefit of histamine combined with melphalan in the isolated limb perfusion (ILP as an alternative to TNF-alfa and melphalan combination, for the treatment of irressectable soft tissue sarcomas of the limbs in Brown Norway (BN rats. METHODS: 20 BN rats had small fragments of syngeneic BN-175 fibosarcoma inserted on the right hind limb. In 7-10 days the tumor reached a median diameter of 12-15 mm and they were randomly divided in four groups (sham, melphalan, histamine and escalating doses of histamine combined to melphalan being submitted to experimental ILP for 30 minutes. Tumors were measured daily with a caliper and the volume was calculated. RESULTS: Response curves showed a significant effect of the combination of histamine 200 mg/mL with melphalan, with 66% overall response, including 33% complete responses (pOBJETIVO: Avaliar o potencial benéfico da histamina combinada ao melfalano, na perfusão de membro isolado (PMI, como alternativa à combinação TNF-alfa mais melfalano, no tratamento de sarcomas de partes moles irressecaveis em extremidades, em ratos de linhagem Brown Norway (BN. MÉTODOS: 20 ratos BN foram submetidos a implantação de fragmentos de fibrosarcoma singênico BN-175 na pata traseira direita. Em cerca de 7-10 dias o tumor atingiu um diâmetro médio de 12-15 mm e foram aleatóriamente divididos em quatro grupos (controle, melfalano, histamina em doses progessivas combinada ao melfalano e histamina sendo submetidos a PMI experimental por 30 minutos. Os tumores foram então medidos diariamente com o uso de paquímetro e o volume tumoral calculado. RESULTADOS: As curvas de resposta mostram um efeito significativo da combinação de Histamina na concentração de 200 mg/mL ao melfalano, com 66% de resposta global incluindo 33% de respostas completas (p < 0.01. Não houve efeitos colaterais sistêmicos e localmente apenas edema leve e transitório nos animais tratados com histamine

  16. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  17. Ultrastructural study of the mycelial phase of clinical isolates of Sporothrix schenckii obtained from feline, canine and human cases of sporotrichosis

    Directory of Open Access Journals (Sweden)

    Isabel Martins Madrid

    2011-09-01

    Full Text Available Using transmission electron microscopy, we studied the presence of melanin and cell wall thickness of clinical isolates of Sporothrix schenckii obtained from cats, dogs and humans as compared to reference strains. We detected differences regarding presence of the melanin among the clinical isolates of S. schenckii and a correlation between presence of melanin and cell wall thickness.

  18. Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.

    Science.gov (United States)

    Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano

    2004-10-01

    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

  19. Isolation and characterization of canine parvovirus type 2c circulating in Uruguay Isolamento e caracterização da cepa tipo 2c do parvovirus canino circulante no Uruguai

    Directory of Open Access Journals (Sweden)

    Andrea Blanc Pintos

    2011-08-01

    Full Text Available This research reports the first CPV-2c isolation in cell culture (canine fibroma cell line A-72 in Uruguay. The isolates were obtained from 13 rectal swabs of Uruguayan dogs with parvovirosis. Samples were submitted to PCR with two sets of primers, restriction fragment length polymorphism (RFLP, partial sequencing of the gene encoding for VP2 capsid protein and phylogenetic characterization. The strain isolated was confirmed as CPV-2c. These results contribute to a better knowledge of CPV strains circulating in Uruguay and promote an evaluation of the efficacy of heterologous vaccines used to protect against the circulating strains.Este trabalho relata o primeiro isolamento do CPV-2c em cultura de células (linhagem celular de fibroma canino A-72, no Uruguai. Os isolados foram obtidos a partir de 13 suabes retais de cães uruguaios com parvovirose. As amostras foram submetidas à reação em cadeia da polimerase (PCR com dois pares de primers, polimorfismo de comprimento de fragmentos de restrição (RFLP, sequenciamento parcial do gene que codifica a proteína capsidial VP2 e caracterização filogenética. A cepa isolada foi confirmada como CPV-2c. Os resultados contribuem para um melhor conhecimento das cepas do CPV circulantes no Uruguai e incitam uma maior investigação sobre a eficácia das vacinas produzidas com cepas heterólogas utilizadas atualmente para proteger contra cepas circulantes.

  20. Perfusion dyssynchrony analysis

    NARCIS (Netherlands)

    Chiribiri, A.; Villa, A.D.M.; Sammut, E.; Breeuwer, M.; Nagel, E.

    2015-01-01

    AIMS: We sought to describe perfusion dyssynchrony analysis specifically to exploit the high temporal resolution of stress perfusion CMR. This novel approach detects differences in the temporal distribution of the wash-in of contrast agent across the left ventricular wall. METHODS AND RESULTS:

  1. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

    1974-01-01

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  2. Laser doppler perfusion imaging

    International Nuclear Information System (INIS)

    Waardell, K.

    1992-01-01

    Recording of tissue perfusion is important in assessing the influence of peripheral vascular diseases on the microcirculation. This thesis reports on a laser doppler perfusion imager based on dynamic light scattering in tissue. When a low power He-Ne laser beam sequentally scans the tissue, moving blood cells generate doppler components in the back-scattered light. A fraction of this light is detected by a photodetector and converted into an electrical signal. In the processor, a signal proportional to the tissue perfusion at each measurement site is calculated and stored. When the scanning procedure is completed, a color-coded perfusion image is presented on a monitor. To convert important aspects of the perfusion image into more quantitative parameters, data analysis functions are implemented in the software. A theory describing the dependence of the distance between individual measurement points and detector on the system amplification factor is proposed and correction algorithms are presented. The performance of the laser doppler perfusion imager was evaluated using a flow simulator. A linear relationship between processor output signal and flow through the simulator was demonstrated for blood cell concentrations below 0.2%. The median sampling depth of the laser beam was simulated by a Monte Carlo technique and estimated to 235 μm. The perfusion imager has been used in the clinic to study perfusion changes in port wine stains treated with argon laser and to investigate the intensity and extension of the cutaneous axon reflex response after electrical nerve stimulation. The fact that perfusion can be visualized without touching the tissue implies elimination of sterilization problems, thus simplifying clinical investigations of perfusion in association with diagnosis and treatment of peripheral vascular diseases. 22 refs

  3. SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

    Science.gov (United States)

    Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

    2017-10-01

    Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

  4. Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

    Science.gov (United States)

    Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2005-01-01

    A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

  5. Pulmonary perfusion ''without ventilation''

    International Nuclear Information System (INIS)

    Chapman, C.N.; Sziklas, J.J.; Spencer, R.P.; Rosenberg, R.J.

    1983-01-01

    An 88-yr-old man, with prior left upper lobectomy and phrenic nerve injury, had a ventilation/perfusion lung image. Both wash-in and equilibrium ventilation images showed no radioactive gas in the left lung. Nevertheless, the left lung was perfused. A similar result was obtained on a repeat study 8 days later. Delayed images, during washout, showed some radioactive gas in the left lung. Nearly absent ventilation (but continued perfusion) of that lung might have been related to altered gas dynamics brought about by the prior lobectomy, a submucosal bronchial lesion, phrenic nerve damage, and limited motion of the left part of the diaphragm. This case raises the issue of the degree of ventilation (and the phase relationship between the lungs) required for the entry of radioactive gas into a diseased lung, and the production of a ''reversed ventilation/perfusion mismatch.''

  6. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

    2010-01-01

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  7. Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

    Directory of Open Access Journals (Sweden)

    Mehdi Mohebali

    2016-10-01

    Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

  8. Genome Sequence of Canine Polyomavirus in Respiratory Secretions of Dogs with Pneumonia of Unknown Etiology.

    Science.gov (United States)

    Delwart, Eric; Kapusinszky, Beatrix; Pesavento, Patricia A; Estrada, Marko; Seguin, M Alexis; Leutenegger, Christian M

    2017-07-20

    We report here the first canine polyomavirus genome, identified by metagenomics in respiratory secretions of two dogs with severe pneumonia, which tested negative for all canine respiratory pathogens except Mycoplasma cynos The isolate, Canis familiaris polyomavirus 1 (DogPyV-1), is a beta polyomavirus whose closest known LT antigen relatives are primate polyomaviruses. Copyright © 2017 Delwart et al.

  9. High-fat diet-induced insulin resistance does not increase plasma anandamide levels or potentiate anandamide insulinotropic effect in isolated canine islets.

    Science.gov (United States)

    Woolcott, Orison O; Richey, Joyce M; Kabir, Morvarid; Chow, Robert H; Iyer, Malini S; Kirkman, Erlinda L; Stefanovski, Darko; Lottati, Maya; Kim, Stella P; Harrison, L Nicole; Ionut, Viorica; Zheng, Dan; Hsu, Isabel R; Catalano, Karyn J; Chiu, Jenny D; Bradshaw, Heather; Wu, Qiang; Kolka, Cathryn M; Bergman, Richard N

    2015-01-01

    Obesity has been associated with elevated plasma anandamide levels. In addition, anandamide has been shown to stimulate insulin secretion in vitro, suggesting that anandamide might be linked to hyperinsulinemia. To determine whether high-fat diet-induced insulin resistance increases anandamide levels and potentiates the insulinotropic effect of anandamide in isolated pancreatic islets. Dogs were fed a high-fat diet (n = 9) for 22 weeks. Abdominal fat depot was quantified by MRI. Insulin sensitivity was assessed by the euglycemic-hyperinsulinemic clamp. Fasting plasma endocannabinoid levels were analyzed by liquid chromatography-mass spectrometry. All metabolic assessments were performed before and after fat diet regimen. At the end of the study, pancreatic islets were isolated prior to euthanasia to test the in vitro effect of anandamide on islet hormones. mRNA expression of cannabinoid receptors was determined in intact islets. The findings in vitro were compared with those from animals fed a control diet (n = 7). Prolonged fat feeding increased abdominal fat content by 81.3±21.6% (mean±S.E.M, Pcanines, high-fat diet-induced insulin resistance does not alter plasma anandamide levels or further potentiate the insulinotropic effect of anandamide in vitro.

  10. Ultrasonographic evaluation of the canine shoulder.

    Science.gov (United States)

    Long, C D; Nyland, T G

    1999-01-01

    The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

  11. Reverse ventilation--perfusion mismatch

    International Nuclear Information System (INIS)

    Palmaz, J.C.; Barnett, C.A.; Reich, S.B.; Krumpe, P.E.; Farrer, P.A.

    1984-01-01

    Patients having lobar airway obstruction or consolidation usually have decreases of both ventilation and perfusion on lung scans. We report three patients in whom hypoxic vasoconstriction was apparently incomplete, resulting in a ''reversed'' ventilation-perfusion mismatch. Perfusion of the hypoxic lobe on the radionuclide scan was associated with metabolic alkalosis, pulmonary venous and pulmonary arterial hypertension in these patients

  12. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  13. Canine Parvovirus: Current Perspective

    OpenAIRE

    Nandi, S.; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

  14. A Review of Liver Perfusion Method in Toxicology Studies

    Directory of Open Access Journals (Sweden)

    M karami

    2014-06-01

    Full Text Available Introduction: The isolated perfused rat liver is an accepted method in toxicology studies. The isolated perfused rat liver (IPRL is a useful experimental system for evaluating hepatic function without the influence of other organ systems, undefined plasma constituents, and neural-hormonal effects. Methods: The untreated male rats (180-220gr body weight were anesthetised with ether and then surgery with proper method. The abdomen was opened through a midline and one transversal incision and the bile duct was cannulated. Heparin sodium solution (0.5 ml; 500 U/ml in 0.9% NaCl was injected via the abdominal vena cava to prevent blood clotting. The liver inferior venacava was cannulated with PE-10 tubing and secured. The portal vein was immediately cannulated with an 23gr catheter which was secured and then liver was perfused in situ by Krebs- Henseleit buffer (pH 7.4; saturated with 95% O2 and 5% CO2; 37°C at a flow rate of 20 ml/min for 3hr. Temperature, perfusion pressure, flow rate and perfusion fluid pH were closely monitored during the perfusion. Results: Transferase enzymes (ALT, AST alterations can be widely used as a measure of biochemical alterations in order to assess liver damage due to use of drugs such as isoniazid (INH and animal and plant toxins. Accumulated material in gallbladder are valuable samples to assess the level of Glutathione (GSH. Sections of perfused liver tissue can also be effectively analyzed for pathological aspects such as necrosis, fibrosis, cellularity. Conclusion: The isolated perfused rat liver (IPRL is a useful and Sutible experimental system for evaluating hepatic function. In this system, the effects of adjacent organs, on the liver is minimized

  15. Hepatic artery perfusion imaging

    International Nuclear Information System (INIS)

    Thrall, J.H.; Gyves, J.W.; Ziessman, H.A.; Ensminger, W.D.

    1985-01-01

    Organ and region-selective intra-arterial chemotherapy have been used for more than two decades to treat malignant neoplasms in the extremities, head and neck region, pelvis, liver, and other areas. Substantial evidence of improved response to regional chemotherapy now exists, but there are stringent requirements for successful application of the regional technique. First, the chemotherapeutic agent employed must have appropriate pharmacokinetic and pharmacodynamic properties. Second, the drug must be reliably delivered to the tumor-bearing area. This typically requires an arteriographic assessment of the vascular supply of the tumor, followed by placement of a therapeutic catheter and confirmation that the ''watershed'' perfusion distribution from the catheter truly encompasses the tumor. Optimal catheter placement also minimizes perfusion of nontarget organs. Radionuclide perfusion imaging with technetium 99m-labeled particles, either microspheres or macroaggregates of albumin, has become the method of choice for making these assessments. Catheter placement itself is considered by many to represent a type of ''therapeutic'' intervention. However, once the catheter is in the hepatic artery the radionuclide perfusion technique can be used to assess adjunctive pharmacologic maneuvers designed to further exploit the regional approach to chemotherapy. This chapter presents the technetium Tc 99m macroaggregated albumin method for assessing catheter placement and the pharmacokinetic rationale for regional chemotherapy, and discusses two promising avenues for further intervention

  16. Extremity perfusion for sarcoma

    NARCIS (Netherlands)

    Hoekstra, Harald Joan

    2008-01-01

    For more than 50 years, the technique of extremity perfusion has been explored in the limb salvage treatment of local, recurrent, and multifocal sarcomas. The "discovery" of tumor necrosis factor-or. in combination with melphalan was a real breakthrough in the treatment of primarily irresectable

  17. Feasibility and efficacy of external beam radiotherapy after hyperthermic isolated limb perfusion with TNF-α and melphalan for limb-saving treatment in locally advanced extremity soft-tissue sarcoma

    International Nuclear Information System (INIS)

    Olieman, Annette F.T.; Pras, Elisabeth; Ginkel, Robert J. van; Molenaar, Willemina M.; Koops, Heimen Schraffordt; Hoekstra, Harald J.

    1998-01-01

    Purpose: Hyperthermic isolated limb perfusion (HILP) with tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), and melphalan is associated with a dramatic antitumor effect in locally advanced extremity soft-tissue sarcomas (STS). The aim of this study was to demonstrate the feasibility and efficacy of adjuvant radiotherapy after HILP with TNF-α, IFN-γ, and melphalan and delayed surgical resection. Methods and Materials: Between 1991 and 1995, 34 patients--16 males and 18 females, median age 50 (range 18-80) years--underwent HILP for locally advanced extremity STS. Resection of the residual tumor mass was performed in most patients after 6-8 weeks. Fifteen patients with histopathological viable tumor after resection received adjuvent 60-70 Gy external beam radiotherapy (EBRT) (44%, HILP + EBRT group). Nineteen patients received HILP without adjuvent EBRT (56%, HILP-only group). Five patients in the HILP-only group had also distant metastases (15%) and received HILP as a palliative treatment. Treatment morbidity, local recurrences, and regional and distant metastases were scored. Results: During a median follow-up of 34 months (range 8-54), limb salvage was achieved in 29 patients (85%): 14 patients after HILP + EBRT and 15 patients after HILP only. None of the patients from the HILP + EBRT group developed local recurrences; however, five patients from the HILP-only did (26%) (p < 0.05). Regional metastases were observed in one patient from the HILP + EBRT group (7%) and in two patients from the HILP-only group who were treated with curative intent (14%). Distant metastases occurred in four patients after HILP + EBRT (27%) and in four patients after HILP only with curative intent (29%). The mean morbidity (subjective, objective, medical management, and analytical evaluation) score in both groups was, respectively, 0.33 for skin and subcutaneous tissue and for muscle and soft tissue, 0.34 (HILP + EBRT group) and 0.33 (HILP-only group). Conclusion: Adjuvent

  18. Prognostic relevance of {sup 18}F-FDG PET uptake in patients with locally advanced, extremity soft tissue sarcomas undergoing neoadjuvant isolated limb perfusion with TNF-α and melphalan

    Energy Technology Data Exchange (ETDEWEB)

    Andreou, Dimosthenis [Muenster University Hospital, Department of General Orthopedics and Tumor Orthopedics, Muenster (Germany); HELIOS Klinikum Berlin-Buch, Department of Orthopedic Oncology, Sarcoma Center Berlin-Brandenburg, Berlin (Germany); Boldt, Henrike [HELIOS Klinikum Berlin-Buch, Department of Nuclear Medicine, Berlin (Germany); Pink, Daniel [HELIOS Klinikum Bad Saarow, Department of Hematology, Oncology and Palliative Care, Sarcoma Center Berlin-Brandenburg, Bad Saarow (Germany); Jobke, Bjoern [HELIOS Klinikum Berlin-Buch, Department of Radiology, Berlin (Germany); Werner, Mathias [HELIOS Klinikum Emil von Behring, Department of Pathology, Sarcoma Center Berlin-Brandenburg, Berlin (Germany); Schuler, Markus [University Hospital Carl Gustav Carus Dresden, Department of Internal Medicine I, Dresden (Germany); Reichardt, Peter [HELIOS Klinikum Berlin-Buch, Department of Interdisciplinary Oncology, Sarcoma Center Berlin-Brandenburg, Berlin (Germany); Tunn, Per-Ulf [HELIOS Klinikum Berlin-Buch, Department of Orthopedic Oncology, Sarcoma Center Berlin-Brandenburg, Berlin (Germany)

    2014-06-15

    The objective of this study was to determine whether {sup 18}F-fluorodeoxyglucose (FDG) positron emission tomography (PET) can adequately assess the risk of systemic disease progression in patients with primary, localized, high-grade soft tissue sarcomas of the extremities undergoing neoadjuvant isolated limb perfusion (ILP) with tumour necrosis factor and melphalan. This was a retrospective analysis of the files of 35 patients who underwent a PET or PET/CT scan prior to and after ILP followed by surgical resection with curative intent between 2006 and 2012. SUV{sub max1} was defined as the maximum standardized uptake value (SUV) at diagnosis, SUV{sub max2} as the maximum SUV after ILP and ΔSUV{sub max} as the percentage difference between SUV{sub max1} and SUV{sub max2}. The median follow-up was 40 months for all patients. The median SUV{sub max1} amounted to 7.6, while the median SUV{sub max2} was 4.7. The median ΔSUV{sub max} was -44 %. Overall survival (OS) probability at 2 and 5 years amounted to 78 and 70 %, respectively, while metastasis-free survival (MFS) probability at 2 and 5 years was 67 and 64 %, respectively. Receiver-operating characteristic (ROC) curve analysis showed that both SUV{sub max2} and ΔSUV{sub max} could predict systemic disease progression, while SUV{sub max1} could not adequately identify patients who went on to develop metastatic disease. The optimal cut-off value was 6.9 for SUV{sub max2} and -31 % for ΔSUV{sub max}. Patients with an SUV{sub max2} <6.9 had a 2-year MFS of 80 %, compared to 31 % for patients with an SUV{sub max2} ≥ 6.9 (p < 0.001). Patients with a ΔSUV{sub max} < -31 %, i.e. patients with a higher metabolic response, had an MFS of 76 % at 2 years, compared to 42 % for patients with a ΔSUV{sub max} ≥ -31 % (p = 0.050). SUV{sub max} after ILP for primary, locally advanced, non-metastatic high-grade soft tissue sarcomas of the extremities appears to be significantly correlated with prognosis. Whether patients

  19. Microangiographic study of the canine dental tissues: a preliminary report

    International Nuclear Information System (INIS)

    Miyabayashi, T.; Morgan, J.P.

    1987-01-01

    A microangiographic study of the dental tissues was performed on one adult mongrel dog to examine the usefulness of the technique. This preliminary study used 30% wt/vol Micropaque suspension which was perfused into the common carotid arteries. After the complete perfusion, the specimen was fixed into a mixture of 10% buffered neutral formalin solution and 95% ethyl alcohol. The mandibular bone with teeth in situ was decalcified. The specimen was embedded in methyl methacrylate. One mm slab sections were made, and then the microangiographs were made. Adequate filling of arterioles was evident on the microangiographs. This technique is shown to be useful in characterizing the nature of the blood supply to the bone and teeth that might be involved in the pathogenesis of radiation-induced injury in the canine dental and periodontal tissues

  20. The effect of pregnancy and estradiol-17 beta treatment on the biliary transport maximum of dibromosulfophthalein, and the glucuronide conjugates of 5-phenyl-5-p-hydroxyphenyl[14C]hydantoin and [14C]morphine in the isolated perfused rat liver

    International Nuclear Information System (INIS)

    Auansakul, A.C.; Vore, M.

    1982-01-01

    The biliary transport maximum (Tm) of three organic axions was determined in the isolated perfused livers of untreated female (control), estradiol-17 beta (E2)-treated female (1 mg/kg/day, s.c. for 14 days), and pregnant (19-21 days of gestation) rats. Dibromosulfophthalein (DBSP), 5-phenyl-5-p-hydroxyphenyl[ 14 C]hydantoin (HPPH) and [ 14 C]morphine were infused continuously into the perfusate for a total dose of 41.2, 18, or 40.5 mumol, respectively. The concentration of [ 14 C]HPPH and [ 14 C]morphine declined in the perfusate, whereas the concentrations of [ 14 C]HPPH glucuronide and [ 14 C]morphine glucuronide increased during the 90-min experiment, indicating that the rate of formation of the glucuronide exceeded its rate of excretion in bile. E2 treatment decreased the Tm (nmol/min/g liver) for [ 14 C]HPPH glucuronide and [ 14 C]morphine glucuronide but not for DBSP, whereas pregnancy decreased the Tm for all three organic anions. Pregnancy, and to a lesser extent E2 treatment, increased liver weight. When expressed per whole liver, the Tm was not altered by pregnancy for any of three organic anions. E2 treatment increased the Tm for DBSP, had no effect on the Tm for HPPH glucuronide and decreased the Tm for [ 14 C]morphine glucuronide. These data suggest the presence of multiple carriers for organic anions which are differentially affected by estrogen treatment and pregnancy

  1. MR-based assessment of pulmonary ventilation-perfusion in animal models

    International Nuclear Information System (INIS)

    Yang Jian; Wan Mingxi; Guo Youmin

    2003-01-01

    Objective: To show the feasibility and value in the diagnosis of airway obstruction and pulmonary embolism with MR oxygen-enhanced ventilation combined with pulmonary perfusion imaging. Methods: Eight canines were implemented for peripheral pulmonary embolism by intravenous injection of gelfoam granules at pulmonary segmental arterial level, and five of them were formed airway obstruction models by inserting self-made balloon catheter at second-bronchia. The oxygen-enhanced MR ventilation imaging was introduced by subtracting the images of pre- and post- inhaled pure oxygen. The MR pulmonary perfusion imaging was achieved by the first-pass contrast agent method. Moreover, the manifestation of MR ventilation and perfusion imaging was observed and contradistinguished with that of general pathologic anatomy, ventilation-perfusion scintigraphy, and pulmonary angiography. Results: The manifestations of airway obstruction regions in MR ventilation and perfusion imaging were matched, but those of pulmonary embolism regions were dismatched. The defect range of airway obstruction in MR ventilation image was smaller than that in ventilation scintigraphy. The abnormal perfusion regions of pulmonary embolism were divided into defect regions and reduce regions based on the time courses of signal intensity changes. The sensitivity and specificity of diagnosis on pulmonary embolism by MR ventilation combined with perfusion technique were 75.0% and 98.1%. The diagnostic results were in good coherence with ventilation-perfusion scintigraphy and pulmonary angiography (K=0.743, 0.899). Conclusion: The MR oxygen-enhanced ventilation combined with pulmonary perfusion imaging can be used to diagnose the airway and vascular abnormity in lung. This technique resembles the ventilation-perfusion scintigraphy. It can provide quantitative functional information and better spatial and temporal resolution, and possesses the value of clinical application

  2. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  3. Canine distemper virus in Lake Baikal seals (Phoca sibirica).

    NARCIS (Netherlands)

    L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)

    1996-01-01

    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

  4. Molecular characterisation of canine parvovirus strains circulating in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... Canine parvovirus (CPV) was first isolated at 1978 in the USA. Analysis of ... Japan, Australia, Italy and Africa although the proportions of CPV-2a ... T/A clone PCR product cloning Kit (Takara, DaLian, China). Sequencing was ...

  5. Clinical manifestations of canine distemper in Nigerian dogs ...

    African Journals Online (AJOL)

    Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

  6. Genetic variant of canine distemper virus from clinical cases in ...

    African Journals Online (AJOL)

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

  7. Canine distemper associated with generalized oedema in Nigerian ...

    African Journals Online (AJOL)

    Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

  8. PET imaging of cerebral perfusion and oxygen metabolism in stroke

    Energy Technology Data Exchange (ETDEWEB)

    Pointon, O.; Yasaka, M.; Berlangieri, S.U.; Newton, M.R.; Thomas, D.L.; Chan, C.G.; Egan, G.F.; Tochon-Danguy, H.J.; O``Keefe, G.; Donnan, G.A.; McKay, W.J. [Austin Hospital, Melbourne, VIC (Australia). Centre for PET and Depts of Nuclear Medicine and Neurology

    1998-03-01

    Full text: Stroke remains a devastating clinical event with few therapeutic options. In patients with acute stroke, we studied the cerebral perfusion and metabolic patterns with {sup 15}O-CO{sub 2} or H{sub 2}O and {sup 15}O-O{sub 2} positron emission tomography and correlated these findings to the clinical background. Forty three patients underwent 45 studies 0-23 days post-stroke (mean 7 days). Fifteen patients showed luxury perfusion (Group A), 10 had matched low perfusion and metabolism (B) and 3 showed mixed pattern including an area of misery perfusion (C). Seventeen showed no relevant abnormality (D) and there were no examples of isolated misery perfusion. Twelve of the 15 in Group A had either haemorrhagic transformation on CT, re-opening on angiography, or a cardioembolic mechanism. In contrast only 5/10 in Group B, 0/3 in Group C and 2/17 in Group D had these features. Although 7/10 in group B had moderate or large size infarcts on CT the incidence of haemorrhagic transformation was low (2/10) and significant carotid stenoses were more common in those studied (5/8) compared with the other groups. Misery perfusion was not seen beyond five days. Thus, luxury perfusion seems to be related to a cardio-embolic mechanism or reperfusion. Matched low perfusion and metabolism was associated with a low rate of haemorrhagic transformation despite a high incidence of moderate to large size infarcts. Misery perfusion is an early phenomenon in the evolution of ischaemic stroke.

  9. Hydrogen ion changes and contractile behavior in the perfused rat heart

    NARCIS (Netherlands)

    Cingolani, H.E.; Maas, A.H.J.; Zimmerman, A.N.E.; Meijler, F.L.

    1975-01-01

    The effect of acid-base alterations was analyzed using isolated rat hearts perfused at constant coronary perfusion pressure, and stimulated to contract at constant rate. The amount of shortening in the major axis and its derivative were measured to assess myocardial contractility. Both the

  10. Ecology of genus Porphyromonas in canine periodontal disease.

    Science.gov (United States)

    Isogai, H; Kosako, Y; Benno, Y; Isogai, E

    1999-09-01

    Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.

  11. Canine parvovirus: current perspective.

    Science.gov (United States)

    Nandi, S; Kumar, Manoj

    2010-06-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  12. Perfusion based cell culture chips

    DEFF Research Database (Denmark)

    Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin

    2010-01-01

    Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....

  13. American Canine Hepatozoonosis

    Science.gov (United States)

    Ewing, S. A.; Panciera, R. J.

    2003-01-01

    American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

  14. Production of acetone and conversion of acetone to acetate in the perfused rat liver

    International Nuclear Information System (INIS)

    Gavino, V.C.; Somma, J.; Philbert, L.; David, F.; Garneau, M.; Belair, J.; Brunengraber, H.

    1987-01-01

    The utilization of millimolar concentrations of [2- 14 C]acetone and the production of acetone from acetoacetate were studied in perfused livers from 48-h starved rats. We devised a procedure for determining, in a perfused liver system, the first-order rate constant for the decarboxylation of acetoacetate (0.29 +/- 0.09 h-1, S.E., n = 8). After perfusion of livers with [2- 14 C]acetone, labeled acetate was isolated from the perfusion medium and characterized as [1- 14 C]acetate. No radioactivity was found in lactate or 3-hydroxybutyrate. After 90 min of perfusion with [2- 14 C]acetone, the specific activity of acetate was 30 +/- 4% (n = 13) of the initial specific activity of acetone. We conclude that, in perfused livers from 2-day starved rats, acetone metabolism occurs for the most part via free acetate

  15. Gammagraphy of cerebral perfusion

    International Nuclear Information System (INIS)

    Vazquez, Silvia

    2003-01-01

    Important aspects of the gammagraphy of cerebral perfusion and the diverse clinical applications in the neurological diseases are comment in this article. We focus in the usefulness of the photon emission cerebral tomography (SPECT) and its capacity to cross the hemato encephalic barrier through the use of radiopharmacons like 99 mTc-H M-PAO and 99mTc-EDC, thus managing to offer functional data on the captantes neurons of the radiopharmacon. The clinical applications of SPECT are studied; cerebrovascular disease, transient ischemic attacks, dementias, Alzheimer disease, as well as other neurological diseases are referred. (The author)

  16. Bilateral supernumerary primary maxillary canines

    Directory of Open Access Journals (Sweden)

    Santanu Mukhopadhyay

    2018-01-01

    Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

  17. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

    Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...

  18. Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Cintia Xavier de Mello

    2014-12-01

    Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

  19. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  20. Distinct fermentation and antibiotic sensitivity profiles exist in salmonellae of canine and human origin.

    Science.gov (United States)

    Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C

    2018-02-26

    Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.

  1. Purification and partial characterization of canine S100A12.

    Science.gov (United States)

    Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

    2010-12-01

    Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

  2. Canine obesity: an overview.

    Science.gov (United States)

    Gossellin, J; Wren, J A; Sunderland, S J

    2007-08-01

    Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

  3. Peracute Infectious Canine Hepatitis

    Directory of Open Access Journals (Sweden)

    A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

    2012-05-01

    Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

  4. Radioresistant canine hematopoietic cells

    International Nuclear Information System (INIS)

    Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

    1987-01-01

    Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

  5. Brain perfusion: computed tomography applications

    International Nuclear Information System (INIS)

    Miles, K.A.

    2004-01-01

    Within recent years, the broad introduction of fast multi-detector computed tomography (CT) systems and the availability of commercial software for perfusion analysis have made cerebral perfusion imaging with CT a practical technique for the clinical environment. The technique is widely available at low cost, accurate and easy to perform. Perfusion CT is particularly applicable to those clinical circumstances where patients already undergo CT for other reasons, including stroke, head injury, subarachnoid haemorrhage and radiotherapy planning. Future technical developments in multi-slice CT systems may diminish the current limitations of limited spatial coverage and radiation burden. CT perfusion imaging on combined PET-CT systems offers new opportunities to improve the evaluation of patients with cerebral ischaemia or tumours by demonstrating the relationship between cerebral blood flow and metabolism. Yet CT is often not perceived as a technique for imaging cerebral perfusion. This article reviews the use of CT for imaging cerebral perfusion, highlighting its advantages and disadvantages and draws comparisons between perfusion CT and magnetic resonance imaging. (orig.)

  6. A randomized clinical study of two interceptive approaches to palatally displaced canines.

    Science.gov (United States)

    Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela

    2008-08-01

    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

  7. Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions.

    Science.gov (United States)

    Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu

    2011-10-01

    The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

  8. Perfusion CT in acute stroke

    International Nuclear Information System (INIS)

    Eckert, Bernd; Roether, Joachim; Fiehler, Jens; Thomalla, Goetz

    2015-01-01

    Modern multislice CT scanners enable multimodal protocols including non-enhanced CT, CT angiography, and CT perfusion. A 64-slice CT scanner provides 4-cm coverage. To cover the whole brain, a 128 - 256-slice scanner is needed. The use of perfusion CT requires an optimized scan protocol in order to reduce exposure to radiation. As compared to non-enhanced CT and CT angiography, the use of CT perfusion increases detection rates of cerebral ischemia, especially small cortical ischemic lesions, while the detection of lacunar and infratentorial stroke lesions remains limited. Perfusion CT enables estimation of collateral flow in acute occlusion of large intra- or extracranial arteries. Currently, no established reliable thresholds are available for determining infarct core and penumbral tissue by CT perfusion. Moreover, perfusion parameters depend on the processing algorithms and the software used for calculation. However, a number of studies point towards a reduction of cerebral blood volume (CBV) below 2 ml/100 g as a critical threshold that identifies infarct core. Large CBV lesions are associated with poor outcome even in the context of recanalization. The extent of early ischemic signs on non-enhanced CT remains the main parameter from CT imaging to guide acute reperfusion treatment. Nevertheless, perfusion CT increases diagnostic and therapeutic certainty in the acute setting. Similar to stroke MRI, perfusion CT enables the identification of tissue at risk of infarction by the mismatch between infarct core and the larger area of critical hypoperfusion. Further insights into the validity of perfusion parameters are expected from ongoing trials of mechanical thrombectomy in stroke.

  9. Placental perfusion - a human alternative

    DEFF Research Database (Denmark)

    Mose, Tina; Knudsen, Lisbeth E

    2006-01-01

    Foetal exposures to environmental and medicinal products have impact on the growth of the foetus (e.g. cigarette smoke) and development of organs (e.g. methylmercury and Thalidomide). Perfusion studies of the human term placenta enable investigation of placental transport of chemical substances...... between the mother and foetus. Dual perfusion of a single cotyledon in the human placenta can contribute to a better understanding of the placental barrier, transport rate and mechanisms of different substances and placental metabolism. The perfusion system has recently been established in Copenhagen...

  10. Quantitative lung perfusion evaluation using Fourier decomposition perfusion MRI.

    Science.gov (United States)

    Kjørstad, Åsmund; Corteville, Dominique M R; Fischer, Andre; Henzler, Thomas; Schmid-Bindert, Gerald; Zöllner, Frank G; Schad, Lothar R

    2014-08-01

    To quantitatively evaluate lung perfusion using Fourier decomposition perfusion MRI. The Fourier decomposition (FD) method is a noninvasive method for assessing ventilation- and perfusion-related information in the lungs, where the perfusion maps in particular have shown promise for clinical use. However, the perfusion maps are nonquantitative and dimensionless, making follow-ups and direct comparisons between patients difficult. We present an approach to obtain physically meaningful and quantifiable perfusion maps using the FD method. The standard FD perfusion images are quantified by comparing the partially blood-filled pixels in the lung parenchyma with the fully blood-filled pixels in the aorta. The percentage of blood in a pixel is then combined with the temporal information, yielding quantitative blood flow values. The values of 10 healthy volunteers are compared with SEEPAGE measurements which have shown high consistency with dynamic contrast enhanced-MRI. All pulmonary blood flow (PBF) values are within the expected range. The two methods are in good agreement (mean difference = 0.2 mL/min/100 mL, mean absolute difference = 11 mL/min/100 mL, mean PBF-FD = 150 mL/min/100 mL, mean PBF-SEEPAGE = 151 mL/min/100 mL). The Bland-Altman plot shows a good spread of values, indicating no systematic bias between the methods. Quantitative lung perfusion can be obtained using the Fourier Decomposition method combined with a small amount of postprocessing. Copyright © 2013 Wiley Periodicals, Inc.

  11. Hepatic perfusion during hepatic artery infusion chemotherapy: Evaluation with perfusion CT and perfusion scintigraphy

    International Nuclear Information System (INIS)

    Miller, D.L.; Carrasquillo, J.A.; Lutz, R.J.; Chang, A.E.

    1989-01-01

    The standard method for the evaluation of hepatic perfusion during hepatic artery infusion (HAI) chemotherapy is planar hepatic artery perfusion scintigraphy (HAPS). Planar HAPS was performed with 2 mCi of [99mTc] macroaggregated albumin infused at 1 ml/min and compared with single photon emission CT (SPECT) HAPS and with a new study, CT performed during the slow injection of contrast material through the HAI catheter (HAI-CT). Thirteen patients underwent 16 HAI-CT studies, 14 planar HAPS studies, and 9 SPECT HAPS studies. In 13 of 14 studies (93%) HAI-CT and planar HAPS were in complete agreement as to the perfusion pattern of intrahepatic metastases and normal liver. In nine studies where all modalities were performed, the findings identified by HAI-CT and planar HAPS agreed in all cases, whereas the results of two SPECT scans disagreed with the other studies. With respect to perfusion of individual metastases, 14 of 14 HAI-CT studies, 12 of 13 planar HAPS studies, and 9 of 9 SPECT HAPS studies correctly demonstrated the perfusion status of individual lesions as indicated by the pattern of changes in tumor size determined on CT obtained before and after the perfusion studies. Hepatic artery infusion CT was superior for delineation of individual metastases, particularly small lesions, and for the evaluation of nonperfused portions of the liver. Planar HAPS detected extrahepatic perfusion in four patients, and this was not detected by HAI-CT. We conclude that HAI-CT and scintigraphy are complementary techniques. Hepatic artery infusion CT has advantages for the evaluation of intrahepatic perfusion, and planar HAPS is superior to HAI-CT for the detection of extrahepatic perfusion

  12. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi

    2017-09-01

    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  13. Podoplanin Expression in Canine Melanoma

    OpenAIRE

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-01-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

  14. Use of corrosion casting techniques to evaluate coronary collateral vessels and anastomoses in hearts of canine cadavers.

    Science.gov (United States)

    Noestelthaller, Arne; Probst, Alexander; Koenig, Horst E

    2005-10-01

    To study and investigate branching patterns of the canine coronary arteries and collateral circulation by use of corrosion casting techniques. 31 hearts obtained from cadavers of clinically normal dogs of various ages and breeds and of either sex. 3-dimensional reproduction of coronary arteries was achieved by postmortem injection and perfusion with casting materials into the aortic sinus via the ascending aorta. Perfused hearts were macerated and carefully irrigated; the air-dried specimens were examined macroscopically and with a magnifying headset. Collateral arteries and inter- and intra-arterial anastomoses were successfully detected in 8 corrosion cast specimens. In total, 9 coronary collateral arteries and 3 interarterial anastomoses were found. Our finding of coronary collateral arteries in canine hearts is in agreement with recent findings in coronary flow study. On the basis of our results, vasodilation treatment to improve collateral vessel remodeling in dogs with myocardial dysfunction may be warranted.

  15. Hydrostatic determinants of cerebral perfusion

    International Nuclear Information System (INIS)

    Wagner, E.M.; Traystman, R.J.

    1986-01-01

    We examined the cerebral blood flow response to alterations in perfusion pressure mediated through decreases in mean arterial pressure, increases in cerebrospinal fluid (CSF) pressure, and increases in jugular venous (JV) pressure in 42 pentobarbital anesthetized dogs. Each of these three pressures was independently controlled. Cerebral perfusion pressure was defined as mean arterial pressure minus JV or CSF pressure, depending on which was greater. Mean hemispheric blood flow was measured with the radiolabeled microsphere technique. Despite 30-mm Hg reductions in mean arterial pressure or increases in CSF or JV pressure, CBF did not change as long as the perfusion pressure remained greater than approximately 60 mm Hg. However, whenever perfusion pressure was reduced to an average of 48 mm Hg, cerebral blood flow decreased 27% to 33%. These results demonstrate the capacity of the cerebral vascular bed to respond similarly to changes in the perfusion pressure gradient obtained by decreasing mean arterial pressure, increasing JV pressure or increasing CSF pressure, and thereby support the above definition of cerebral perfusion pressure

  16. Canine parvovirus effect on wolf population change and pup survival

    Science.gov (United States)

    Mech, L.D.; Goyal, S.M.

    1993-01-01

    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  17. Effect of Japanese Green Tea Extract on Canine Periodontal Diseases

    OpenAIRE

    Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.

    2011-01-01

    Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...

  18. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  19. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

    2011-01-01

    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  20. Canine parvovirus in asymptomatic feline carriers.

    Science.gov (United States)

    Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

    2012-05-25

    Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

  1. Compartmented pyruvate in perfused working heart

    International Nuclear Information System (INIS)

    Buenger, R.

    1985-01-01

    Pyruvate compartmentation and lactate dehydrogenase (LDH) were studied in isolated perfused working guinea pig hearts. The mean intracellular pyruvate (Pyr) contents increased with perfusate Pyr (0-2 mM) but varied only slightly with glucose (0-10 mM) and additional insulin (0.04-5 U/l), respectively. With 5-10 mM glucose plus 5 U/l insulin, but not with Pyr or lactate (Lac) as substrates, a near equilibrium between the LDH and the glycerol-3-phosphate dehydrogenase seemed to exist. Evidence for an inhibitory effect of Pyr on the activity of the LDH system of the perfused hearts was not obtained. With [U- 14 C]glucose as sole substrate, the specific activity of coronary venous Lac was near half that of precursor glucose. 14 CO 2 production was thus in quantitative agreement with rates of pyruvate oxidation that were determined as glucose uptake minus (Pyr + Lac) release. In contrast, with 0.2 mM [1- 14 C]Pyr plus 5 mM glucose, the ratio of 14 CO 2 production to specific activity of Lac overestimated Pyr oxidation judged from myocardial substrate balances and O 2 uptake, respectively; here, at least three pools of [ 14 C]HCO-3 and [ 14 C]lac, respectively, were kinetically demonstrable during washout of trace amounts of 14 C-labeled Pyr. Evidently, the specific activity of Lac was equivalent to that of mitochondrial oxidized Pyr provided [ 14 C]glucose was the sole or major precursor of cellular pyruvate. However, exogenously applied [1- 14 C]Pyr of high specific activity seemed to induce intracellular formation of both a highly and lowly labeled Pyr; the latter Pyr compartment did not seem in ready equilibrium with the cell physiologically prevailing highly labeled Pyr pool

  2. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  3. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    OpenAIRE

    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

    2017-01-01

    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  4. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    International Nuclear Information System (INIS)

    Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.

    2011-01-01

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

  5. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

    2011-03-30

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

  6. Canine oral melanoma.

    Science.gov (United States)

    Bergman, Philip J

    2007-05-01

    Melanoma is the most common oral malignancy in the dog. Oral and/or mucosal melanoma has been routinely considered an extremely malignant tumor with a high degree of local invasiveness and high metastatic propensity. Primary tumor size has been found to be extremely prognostic. The World Health Organization staging scheme for dogs with oral melanoma is based on size, with stage I = or = 4cm tumor and/or lymph node metastasis, and stage IV = distant metastasis. Median survival times for dogs with oral melanoma treated with surgery are approximately 17 to 18, 5 to 6, and 3 months with stage I, II, and III disease, respectively. Significant negative prognostic factors include stage, size, evidence of metastasis, and a variety of histologic criteria. Standardized treatments such as surgery, coarse-fractionation radiation therapy, and chemotherapy have afforded minimal to modest stage-dependent clinical benefits and death is usually due to systemic metastasis. Numerous immunotherapeutic strategies have been employed to date with limited clinical efficacy; however, the use of xenogeneic DNA vaccines may represent a leap forward in clinical efficacy. Oral melanoma is a spontaneous syngeneic cancer occurring in outbred, immunocompetent dogs and appears to be a more clinically faithful therapeutic model for human melanoma; further use of canine melanoma as a therapeutic model for human melanoma is strongly encouraged. In addition, the development of an expanded but clinically relevant staging system incorporating the aforementioned prognostic factors is also strongly encouraged.

  7. Dynamic CT myocardial perfusion imaging

    International Nuclear Information System (INIS)

    Caruso, Damiano; Eid, Marwen; Schoepf, U. Joseph; Jin, Kwang Nam; Varga-Szemes, Akos; Tesche, Christian; Mangold, Stefanie

    2016-01-01

    Highlights: • CT myocardial perfusion provides functional assessment of the myocardium. • CCTA is limited in determining the hemodynamic significance of coronary stenosis. • CT-MPI can accurately detect hemodynamically significant coronary artery stenosis. - Abstract: Non-invasive cardiac imaging has rapidly evolved during the last decade due to advancements in CT based technologies. Coronary CT angiography has been shown to reliably assess coronary anatomy and detect high risk coronary artery disease. However, this technique is limited to anatomical assessment, thus non-invasive techniques for functional assessment of the heart are necessary. CT myocardial perfusion is a new CT based technique that provides functional assessment of the myocardium and allows for a comprehensive assessment of coronary artery disease with a single modality when combined with CTA. This review aims to discuss dynamic CT myocardial perfusion as a new technique in the assessment of CAD.

  8. Dynamic CT myocardial perfusion imaging

    Energy Technology Data Exchange (ETDEWEB)

    Caruso, Damiano [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Radiological Sciences, Oncological and Pathological Sciences, University of Rome “Sapienza”, Latina (Italy); Eid, Marwen [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Schoepf, U. Joseph, E-mail: schoepf@musc.edu [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Division of Cardiology, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States); Jin, Kwang Nam [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Radiology, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, Seoul (Korea, Republic of); Varga-Szemes, Akos [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Tesche, Christian [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Cardiology and Intensive Care Medicine, Heart Center Munich-Bogenhausen, Munich (Germany); Mangold, Stefanie [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Diagnostic and Interventional Radiology, University Hospital of Tuebingen, Tuebingen (Germany); and others

    2016-10-15

    Highlights: • CT myocardial perfusion provides functional assessment of the myocardium. • CCTA is limited in determining the hemodynamic significance of coronary stenosis. • CT-MPI can accurately detect hemodynamically significant coronary artery stenosis. - Abstract: Non-invasive cardiac imaging has rapidly evolved during the last decade due to advancements in CT based technologies. Coronary CT angiography has been shown to reliably assess coronary anatomy and detect high risk coronary artery disease. However, this technique is limited to anatomical assessment, thus non-invasive techniques for functional assessment of the heart are necessary. CT myocardial perfusion is a new CT based technique that provides functional assessment of the myocardium and allows for a comprehensive assessment of coronary artery disease with a single modality when combined with CTA. This review aims to discuss dynamic CT myocardial perfusion as a new technique in the assessment of CAD.

  9. Lung perfusion scintigraphy by SPECT

    International Nuclear Information System (INIS)

    Hirayama, Takanobu

    1990-01-01

    The initial study reports the characteristic performance using lung segmental phantom filled in Tc-99m pertechnetate. To evaluate the segmental defect in lung perfusion scintigraphy, we applied Bull's-eye analysis in addition to planar image set. Bull's-eye analysis especially facilitated the interpretation in both middle and lower lobes. Subsequently, to evolute the clinical application of Bull's-eye analysis, pulmonary scintigraphy was performed on 10 normal subjects and 60 patients with several pulmonary diseases. Of interest, Bull's-eye analysis, however, encouraged the interpretation in both lower lobes. To calculate the extention and severity of perfusion defect, the present study describes Bull's-eye analysis. Quantitative scoring showed higher in patients with lung cancer than those with pulmonary tuberculosis. The present study focus that Bull's-eye analysis can be useful for evaluating perfusion in patients with a couple of pulmonary diseases. (author)

  10. Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.

    Directory of Open Access Journals (Sweden)

    Kinga Majchrzak

    Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs

  11. Evaluation in dogs of a new double-dose technique for imaging changes in myocardial perfusion

    International Nuclear Information System (INIS)

    Rothendler, J.A.; Okada, R.D.; Strauss, H.W.; Chesler, D.A.; Pohost, G.M.

    1984-01-01

    Assessment of myocardial perfusion with thallium immediately before and after an intervention that alters blood flow has been difficult due to presence of residual activity from the first tracer dose at the time of the second imaging. In a canine model the authors investigated a technique using two separate thallium injections during an intervention and after its reversal. Images were obtained after each injection, and a difference image was obtained by subtracting the first from the second image to correct for tracer persisting from the first injection. Interventions on coronary blood flow included: transient occlusion, subcritical stenosis with dipyridamole infusion, and permanent occlusion. The first images showed defects corresponding to the occlusion or stenosis, while the ''difference'' images correlated with myocardial perfusion at the time of the second injection

  12. Podoplanin Expression in Canine Melanoma.

    Science.gov (United States)

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-12-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

  13. Approaches to canine health surveillance.

    Science.gov (United States)

    O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

    2014-01-01

    Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

  14. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  15. Dynamic CT myocardial perfusion imaging identifies early perfusion abnormalities in diabetes and hypertension : Insights from a multicenter registry

    NARCIS (Netherlands)

    Vliegenthart, Rozemarijn; De Cecco, Carlo N.; Wichmann, Julian L.; Meinel, Felix G.; Pelgrim, Gert Jan; Tesche, Christian; Ebersberger, Ullrich; Pugliese, Francesca; Bamberg, Fabian; Choe, Yeon Hyeon; Wang, Yining; Schoepf, U. Joseph

    2016-01-01

    Background: To identify patients with early signs of myocardial perfusion reduction, a reference base for perfusion measures is needed. Objective: To analyze perfusion parameters derived from dynamic computed tomography perfusion imaging (CTPI) in patients with suspected coronary artery disease

  16. Automatic assessment of cardiac perfusion MRI

    DEFF Research Database (Denmark)

    Ólafsdóttir, Hildur; Stegmann, Mikkel Bille; Larsson, Henrik B.W.

    2004-01-01

    In this paper, a method based on Active Appearance Models (AAM) is applied for automatic registration of myocardial perfusion MRI. A semi-quantitative perfusion assessment of the registered image sequences is presented. This includes the formation of perfusion maps for three parameters; maximum up...

  17. The Duration of Immunity to an Inactivated Adjuvanted Canine Parvovirus Vaccine. A 52 and 64 Week Postvaccination Challenge Study

    OpenAIRE

    Povey, R. C.; Carman, P. S.; Ewert, E.

    1983-01-01

    Dogs were successfully isolated for a period of either 52 or 64 weeks following vaccination with an inactivated, adjuvanted canine parvovirus-2 vaccine. Antibody persisted in all ten vaccinated dogs, although in one case by 52 weeks postvaccination only virus neutralizing antibody, and not hemagglutination-inhibiting antibody, could be detected. Sentinel unvaccinated dogs housed alongside the vaccinated dogs throughout the study remained free of canine parvovirus-2 antibody until challenged. ...

  18. Canine and feline colostrum.

    Science.gov (United States)

    Chastant-Maillard, S; Aggouni, C; Albaret, A; Fournier, A; Mila, H

    2017-04-01

    Puppy and kitten survival over the first weeks is particularly dependent on colostrum, a specific secretion of the mammary gland produced during the first 2 days post-partum. Colostrum is a source of nutrients and immunoglobulins. It also contributes to the digestive tract maturation. Colostrum differentiates from milk mainly based on its concentration in immunoglobulins G: 20-30 g/L in dog colostrum, 40-50 g/L in cats' vs <1 g/L in milk. IgG concentration rapidly drops after parturition (-50% in 24 hr). Immune quality of colostrum is highly variable between bitches, with no relationship with maternal blood IgG level, dam's age, breed size or litter size. In addition to systemic immune protection, colostrum also plays a major role for local digestive protection, due to IgA, lysozyme, lactoferrin, white blood cells and various cytokines. Energetic concentration of canine and feline colostrum is not superior to that of mature milk. It depends on colostrum fat concentration and is affected by breed size (higher in breeds <10 kg adult body weight). As puppies and kittens are almost agammaglobulinemic at birth, transfer of IgG from their digestive tract into their bloodstream is crucial for their survival, IgG absorption ending at 12-16 hr after birth. Energetic supply over the two first days of life, as evidenced by growth rate over the two first days of life, also affects risk of neonatal mortality. Early and sufficient suckling of colostrum is thus the very first care to be provided to newborns for their later health and survival. © 2016 Blackwell Verlag GmbH.

  19. Pulmonary ventilation/perfusion scan

    Science.gov (United States)

    ... to stop eating (fast), be on a special diet, or take any medicines before the test. A chest x-ray is usually done before or after a ventilation and perfusion scan. You wear a hospital gown or comfortable clothing that does not have ...

  20. Phosphorus-31 nuclear magnetic resonance spectroscopic study of the canine pancreas: applications to acute alcoholic pancreatitis

    International Nuclear Information System (INIS)

    Janes, N.; Clemens, J.A.; Glickson, J.D.; Cameron, J.L.

    1988-01-01

    The first nuclear magnetic resonance spectroscopic study of the canine pancreas is described. Both in-vivo, ex-vivo protocols and NMR observables are discussed. The stability of the ex-vivo preparation based on the NMR observables is established for at least four hours. The spectra obtained from the in-vivo and ex-vivo preparations exhibited similar metabolite ratios, further validating the model. Metabolite levels were unchanged by a 50% increase in perfusion rate. Only trace amounts of phosphocreatine were observed either in the intact gland or in extracts. Acute alcoholic pancreatitis was mimicked by free fatty acid infusion. Injury resulted in hyperamylasemia, edema (weight gain), increased hematocrit and perfusion pressure, and depressed levels of high energy phosphates

  1. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

  2. Immunohistochemical Characterization of Canine Lymphomas

    Directory of Open Access Journals (Sweden)

    Roxana CORA

    2017-11-01

    Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

  3. Virus isolation and molecular characterization of canine distemper virus by RT-PCR from a mature dog with multifocal encephalomyelit Isolamento e caracterização molecular do vírus da cinomose canina por RT-PCR a partir de um cão adulto com encefalomielite multifocal

    Directory of Open Access Journals (Sweden)

    Alexandre Mendes Amude

    2007-06-01

    Full Text Available A case of multifocal distemper encephalomyelitis in a mature dog is described. In the presented case the ante mortem clinical diagnosis of canine distemper virus (CDV infection could not be ideally performed due to the absence of typical signs of distemper, such as myoclonus and systemic signs accompanying the nervous signs. The definitive diagnosis of distemper encephalomyelitis was only carried out at post mortem through virus isolation in cell culture from fresh central nervous system (CNS fragments and CDV nucleoprotein gene detection in the CNS by RT-PCR.Descreve-se um caso de encefalomielite multifocal pela cinomose em um cão adulto. No caso apresentado o diagnóstico clínico da infecção pelo vírus da cinomose canina (CDV não pode ser adequadamente realizado devido à ausência de sinais típicos da enfermidade, tais como mioclonia e sinais sistêmicos. O diagnóstico definitivo somente foi possível post mortem pelo isolamento do CDV em cultivo celular a partir dos fragmentos frescos do sistema nervoso central (SNC e pela detecção do gene da nucleoproteína do CDV em fragmentos do SNC por meio da RT-PCR.

  4. Ontogeny of canine dimorphism in extant hominoids.

    Science.gov (United States)

    Schwartz, G T; Dean, C

    2001-07-01

    Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

  5. Contralateral thalamic hypoperfusion on brain perfusion SPECT

    International Nuclear Information System (INIS)

    Lee, Seok Mo; Bae, Sang Kyun; Yoo, Kyung Moo; Yum, Ha Yong

    2000-01-01

    Brain perfusion single photon emission computed tomography (SPECT) is useful for the localization of cerebrovascular lesion and sometimes reveals more definite lesion than radiologic imaging modality such as CT or MRI does. The purpose of this study was to evaluate the diagnostic usefulness of brain perfusion SPECT in patients with hemisensory impairment. Thirteen consecutive patients (M:F= 8:5, mean age = 48) who has hemisensory impairment were included. Brain perfusion SPECT was performed after intravenous injection of 1110 MBq of Tc-99m ECD. The images were obtained using a dual-head gamma camera with ultra-high resolution collimator. Semiquantitative analysis was performed after placing multiple ROIs on cerebral cortex, basal ganglia, thalamus and cerebellum. There were 10 patients with left hemisensory impairment and 3 patients with right-sided symptom. Only 2 patients revealed abnormal signal change in the thalamus on MRI. But brain perfusion SPECT showed decreased perfusion in the thalamus in 9 patients. Six patients among 10 patients with left hemisensory impairment revealed decreased perfusion in the contralateral thalamus on brain SPECT. The other 4 patients revealed no abnormality. Two patients among 3 patients with right hemisensory impairment also showed decreased perfusion in the contralateral thalamus on brain SPECT. One patients with right hemisensory impairment showed ipsilateral perfusion decrease. Two patients who had follow-up brain perfusion SEPCT after treatment revealed normalization of perfusion in the thalamus. Brain perfusion SPECT might be a useful tool in diagnosing patients with hemisensory impairment

  6. Magnetic resonance perfusion imaging without contrast media

    International Nuclear Information System (INIS)

    Martirosian, Petros; Graf, Hansjoerg; Schick, Fritz; Boss, Andreas; Schraml, Christina; Schwenzer, Nina F.; Claussen, Claus D.

    2010-01-01

    Principles of magnetic resonance imaging techniques providing perfusion-related contrast weighting without administration of contrast media are reported and analysed systematically. Especially common approaches to arterial spin labelling (ASL) perfusion imaging allowing quantitative assessment of specific perfusion rates are described in detail. The potential of ASL for perfusion imaging was tested in several types of tissue. After a systematic comparison of technical aspects of continuous and pulsed ASL techniques the standard kinetic model and tissue properties of influence to quantitative measurements of perfusion are reported. For the applications demonstrated in this paper a flow-sensitive alternating inversion recovery (FAIR) ASL perfusion preparation approach followed by true fast imaging with steady precession (true FISP) data recording was developed and implemented on whole-body scanners operating at 0.2, 1.5 and 3 T for quantitative perfusion measurement in various types of tissue. ASL imaging provides a non-invasive tool for assessment of tissue perfusion rates in vivo. Images recorded from kidney, lung, brain, salivary gland and thyroid gland provide a spatial resolution of a few millimetres and sufficient signal to noise ratio in perfusion maps after 2-5 min of examination time. Newly developed ASL techniques provide especially high image quality and quantitative perfusion maps in tissues with relatively high perfusion rates (as also present in many tumours). Averaging of acquisitions and image subtraction procedures are mandatory, leading to the necessity of synchronization of data recording to breathing in abdominal and thoracic organs. (orig.)

  7. Perfusion device for liver preservation ex vivo before transplantation: first experimental study

    Directory of Open Access Journals (Sweden)

    O. N. Reznik

    2017-01-01

    Full Text Available Introduction. Successful liver transplantation including from donors with a sudden irreversible cardiac arrest requires the use of modern hardware and technical support to maintain, select and sustain organ viability for the period from harvesting to transplantation to the recipient.Materials and methods. Hardware-software system (HSS developed by the Russian State Scientific Center for Robotics and Technical Cybernetics (RTC was used for testing of normothermic perfusion of donor’s liver ex vivo. The experiment was conducted on the isolated pig liver (Duroc breed in accordance with the ethical principles.Result. During perfusion spontaneous recovery of bile outflow through the cannula installed in the common bile duct (volume of bile released – 240 ml was observed, and the color and uniformity of the perfused liver did not differ from the normal parameters. Biochemical indicators were stabilized at the physiological values after 40 minutes of perfusion procedure.Conclusion. Isolated liver transplant was completely restored after 30 minutes of warm ischemia and was functioning well due to ex vivo perfusion procedure on the new perfusion device. The first case of the new device usage for normothermic liver ex vivo demonstrated hopeful results to be further investigated.

  8. Fatal vaccine-induced canine distemper virus infection in black-footed ferrets

    Science.gov (United States)

    Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.

    1976-01-01

    Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.

  9. First complete genome sequence of canine bocavirus 2 in mainland China

    Directory of Open Access Journals (Sweden)

    S.-L. Zhai

    2017-07-01

    Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.

  10. Differential effects of the transient outward K(+) current activator NS5806 in the canine left ventricle

    DEFF Research Database (Denmark)

    Calloe, Kirstine; Soltysinska, Ewa; Jespersen, Thomas

    2009-01-01

    To examine the electrophysiological and molecular properties of the transient outward current (I(to)) in canine left ventricle using a novel I(to) activator, NS5806, I(to) was measured in isolated epicardial (Epi), midmyocardial (Mid) and endocardial (Endo) cells using whole-cell patch-clamp tech...

  11. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  12. Genetics of Human and Canine Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-01-01

    Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  13. Genetics of Human and Canine Dilated Cardiomyopathy.

    Science.gov (United States)

    Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  14. Hyperventilation, cerebral perfusion, and syncope

    DEFF Research Database (Denmark)

    Immink, R V; Pott, F C; Secher, N H

    2014-01-01

    dioxide (PaCO2) and oxygen (PaO2) partial pressures so that hypercapnia/hypoxia increases and hypocapnia/hyperoxia reduces global cerebral blood flow. Cerebral hypoperfusion and TLOC have been associated with hypocapnia related to HV. Notwithstanding pronounced cerebrovascular effects of PaCO2...... the contribution of a low PaCO2 to the early postural reduction in middle cerebral artery blood velocity is transient. HV together with postural stress does not reduce cerebral perfusion to such an extent that TLOC develops. However when HV is combined with cardiovascular stressors like cold immersion or reduced...... cardiac output brain perfusion becomes jeopardized. Whether, in patients with cardiovascular disease and/or defect, cerebral blood flow cerebral control HV-induced hypocapnia elicits cerebral hypoperfusion, leading to TLOC, remains to be established....

  15. Myocardial perfusion modeling using MRI

    DEFF Research Database (Denmark)

    Larsson, H B; Fritz-Hansen, T; Rostrup, Egill

    1996-01-01

    In the present study, it is shown that it is possible to quantify myocardial perfusion using magnetic resonance imaging in combination with gadolinium diethylenetriaminopentaacetic acid (Gd-DTPA). Previously, a simple model and method for measuring myocardial perfusion using an inversion recovery...... turbo-FLASH (fast low-angle shot) sequence and Gd-DTPA has been presented. Here, an extension of the model is presented taking into account fast and slow water exchange between the compartments, enabling the calculation of the unidirectional influx constant (Ki) for Gd-DTPA, the distribution volume...... of Gd-DTPA (lambda), the vascular blood volume (Vb), and the time delay through the coronary arteries (delta T). The model was evaluated by computer simulation and used on experimental results from seven healthy subjects. The results in the healthy volunteers for a region of interest placed...

  16. Dosimetry in myocardial perfusion imaging

    Energy Technology Data Exchange (ETDEWEB)

    Toledo, Janine M.; Trindade, Bruno; Ribeiro, Tarcisio P.C. [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte (Brazil). Dept. de Engenharia Nuclear. Programa de Pos-Graduacao em Ciencias e Tecnicas Nucleares

    2011-07-01

    This paper conducts a dosimetric investigation on the myocardial perfusion image protocol, together with a literature reviewing, motivated by the significant statistic increasing on mortality, morbidity and disability associated with cardiovascular disease, surpassing infectious diseases. Nuclear Cardiology plays a role n the diagnostic functional evaluation of the heart and in the prognostic of patients with suspected or known cardiac ischemia. In the context of unstable myocardial ischemic syndrome, myocardial perfusion scintigraphy is a non-invasive procedure performed by administering a radiopharmaceutical targeted to the heart. As tool for this study are that the images obtained by thoracic angiotomography and abdominal aorta as a anatomic and functional information for model reproduction in SISCODES - System of Codes for Absorbed Dose Calculations based on Stochastic Methods. Data were manipulated in order to create a voxel computational model of the heart to be running in MCNP - Monte Carlo Neutron Particle Code. . It was assumed a homogeneous distribution of Tl-201 in cardiac muscle. Simulations of the transport of particles through the voxel and the interaction with the heart tissue were performed. As a result, the isodose curves in the heart model are displayed as well as the dose versus volume histogram of the heart muscle. We conclude that the present computational tools can generate doses distributed in myocardial perfusion. (author)

  17. Dosimetry in myocardial perfusion imaging

    International Nuclear Information System (INIS)

    Toledo, Janine M.; Trindade, Bruno; Ribeiro, Tarcisio P.C.

    2011-01-01

    This paper conducts a dosimetric investigation on the myocardial perfusion image protocol, together with a literature reviewing, motivated by the significant statistic increasing on mortality, morbidity and disability associated with cardiovascular disease, surpassing infectious diseases. Nuclear Cardiology plays a role n the diagnostic functional evaluation of the heart and in the prognostic of patients with suspected or known cardiac ischemia. In the context of unstable myocardial ischemic syndrome, myocardial perfusion scintigraphy is a non-invasive procedure performed by administering a radiopharmaceutical targeted to the heart. As tool for this study are that the images obtained by thoracic angiotomography and abdominal aorta as a anatomic and functional information for model reproduction in SISCODES - System of Codes for Absorbed Dose Calculations based on Stochastic Methods. Data were manipulated in order to create a voxel computational model of the heart to be running in MCNP - Monte Carlo Neutron Particle Code. . It was assumed a homogeneous distribution of Tl-201 in cardiac muscle. Simulations of the transport of particles through the voxel and the interaction with the heart tissue were performed. As a result, the isodose curves in the heart model are displayed as well as the dose versus volume histogram of the heart muscle. We conclude that the present computational tools can generate doses distributed in myocardial perfusion. (author)

  18. Preserved regulation of renal perfusion pressure by small and intermediate conductance K-Ca channels in hypertensive mice with or without renal failure

    DEFF Research Database (Denmark)

    Waeckel, L.; Bertin, F.; Clavreul, N.

    2015-01-01

    -transgenic female mice expressing human angiotensinogen and renin (AR) genes received either control or a high-salt diet associated to a nitric oxide (NO) synthase inhibitor treatment (BLSL and ARSL). Changes in renal perfusion pressure (RPP) were measured in isolated perfused kidneys. BLSL and AR were moderately...

  19. First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh

    DEFF Research Database (Denmark)

    Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh

    2016-01-01

    AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...

  20. Perfusion abnormalities in congenital and neoplastic pulmonary disease: comparison of MR perfusion and multislice CT imaging

    International Nuclear Information System (INIS)

    Boll, Daniel T.; Lewin, Jonathan S.; Young, Philip; Gilkeson, Robert C.; Siwik, Ernest S.

    2005-01-01

    The aim of this work was to assess magnetic resonance (MR) perfusion patterns of chronic, nonembolic pulmonary diseases of congenital and neoplastic origin and to compare the findings with results obtained with pulmonary, contrast-enhanced multislice computed tomography (CT) imaging to prove that congenital and neoplastic pulmonary conditions require MR imaging over the pulmonary perfusion cycle to successfully and directly detect changes in lung perfusion patterns. Twenty-five patients underwent concurrent CT and MR evaluation of chronic pulmonary diseases of congenital (n=15) or neoplastic (n=10) origin. Analysis of MR perfusion and contrast-enhanced CT datasets was realized by defining pulmonary and vascular regions of interest in corresponding positions. MR perfusion calculated time-to-peak enhancement, maximal enhancement and the area under the perfusion curve. CT datasets provided pulmonary signal-to-noise ratio measurements. Vessel centerlines of bronchial arteries were determined. Underlying perfusion type, such as pulmonary arterial or systemic arterial supply, as well as regions with significant variations in perfusion were determined statistically. Analysis of the pulmonary perfusion pattern detected pulmonary arterial supply in 19 patients; six patients showed systemic arterial supply. In pulmonary arterial perfusion, MR and multislice CT imaging consistently detected the perfusion type and regions with altered perfusion patterns. In bronchial arterial supply, MR perfusion and CT imaging showed significant perfusion differences. Patients with bronchial arterial supply had bronchial arteries ranging from 2.0 to 3.6 mm compared with submillimeter diameters in pulmonary arterial perfusion. Dynamic MR imaging of congenital and neoplastic pulmonary conditions allowed characterization of the pulmonary perfusion type. CT imaging suggested the presence of systemic arterial perfusion by visualizing hypertrophied bronchial arteries. (orig.)

  1. Jaundice and bilirubinemia as manifestations of canine distemper in raccoons and ferrets

    Science.gov (United States)

    Kilham, L.; Habermann, R.T.; Herman, C.M.

    1956-01-01

    1) Two strains of distemper virus have been isolated from wild raccoons and one strain from ferrets. 2) All strains isolated have induced bilirubinemia in raccoons and ferrets. Many raccoons with bilirubinemia also had jaundice. 3) Identification of these strains as members of the canine distemper virus complex has been by clinical and pathological findings consistent with this diagnosis as well as by cross-immunity tests.

  2. Cryopreservation of microencapsulated canine sperm.

    Science.gov (United States)

    Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

    2011-03-01

    The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  4. A monograph proposing the use of canine mammary tumours as a model for the study of hereditary breast cancer susceptibility genes in humans.

    Science.gov (United States)

    Goebel, Katie; Merner, Nancy D

    2017-05-01

    Canines are excellent models for cancer studies due to their similar physiology and genomic sequence to humans, companion status and limited intra-breed heterogeneity. Due to their affliction to mammary cancers, canines can serve as powerful genetic models of hereditary breast cancers. Variants within known human breast cancer susceptibility genes only explain a fraction of familial cases. Thus, further discovery is necessary but such efforts have been thwarted by genetic heterogeneity. Reducing heterogeneity is key, and studying isolated human populations have helped in the endeavour. An alternative is to study dog pedigrees, since artificial selection has resulted in extreme homogeneity. Identifying the genetic predisposition to canine mammary tumours can translate to human discoveries - a strategy currently underutilized. To explore this potential, we reviewed published canine mammary tumour genetic studies and proposed benefits of next generation sequencing canine cohorts to facilitate moving beyond incremental advances.

  5. Molecular characterization of canine parvovirus in Vientiane, Laos.

    Science.gov (United States)

    Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn

    2017-05-01

    The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.

  6. Escherichia coli : host interactions in the pathogenesis of canine pyometra

    OpenAIRE

    Henriques, Sofia Correia Rosa de Barros

    2016-01-01

    Tese de Doutoramento em Ciências Veterinárias na Especialidade de Ciências Biológicas e Biomédicas Canine pyometra develops as a result of a complex interaction of etiological and physiopathological factors, such as the virulence and type of the bacteria and the individual host defence mechanisms. Since Escherichia coli is the most common bacterium isolated from uterus of bitches with pyometra, one main objective of this work was to characterize E. coli virulence potential, and...

  7. Pulmonary artery perfusion versus no pulmonary perfusion during cardiopulmonary bypass in patients with COPD

    DEFF Research Database (Denmark)

    Buggeskov, Katrine B; Sundskard, Martin M; Jonassen, Thomas

    2016-01-01

    INTRODUCTION: Absence of pulmonary perfusion during cardiopulmonary bypass (CPB) may be associated with reduced postoperative oxygenation. Effects of active pulmonary artery perfusion were explored in patients with chronic obstructive pulmonary disease (COPD) undergoing cardiac surgery. METHODS: 90...... perfusion with normothermic oxygenated blood during cardiopulmonary bypass appears to improve postoperative oxygenation in patients with COPD undergoing cardiac surgery. Pulmonary artery perfusion with hypothermic HTK solution does not seem to improve postoperative oxygenation. TRIAL REGISTRATION NUMBER...

  8. Experimental tumor growth of canine osteosarcoma cell line on chick embryo chorioallantoic membrane (in vivo studies).

    Science.gov (United States)

    Walewska, Magdalena; Dolka, Izabella; Małek, Anna; Wojtalewicz, Anna; Wojtkowska, Agata; Żbikowski, Artur; Lechowski, Roman; Zabielska-Koczywąs, Katarzyna

    2017-05-12

    The chick embryo chorioallantoic membrane (CAM) model is extensively used in human medicine in preclinical oncological studies. The CAM model has several advantages: low cost, simple experimental approach, time saving and following "3R principles". Research has shown that the human osteosarcoma cell lines U2OS, MMNG-HOS, and SAOS can form tumors on the CAM. In veterinary medicine, this has been described only for feline fibrosarcomas, feline mammary carcinomas and canine osteosarcomas. However, in case of canine osteosarcomas, it has been shown that only non-adherent osteosarcoma stem cells isolated from KTOSA5 and CSKOS cell lines have the ability to form microtumors on the CAM after an incubation period of 5 days, in contrast to adherent KTOSA5 and CSKOS cells. In the presented study, we have proven that the commercial adherent canine osteosarcoma cell line (D-17) can form vascularized tumors on the CAM after the incubation period of 10 days.

  9. Normal anatomy of lung perfusion SPECT scintigraphy

    International Nuclear Information System (INIS)

    Moskowitz, G.W.; Levy, L.M.

    1987-01-01

    Ten patients studies for possible pulmonary embolic disease had normal lung perfusion planar and SPECT scintigraphy. A computer program was developed to superimpose the CT scans on corresponding SPECT images. Superimposition of CT scans on corresponding SPECT transaxial cross-sectional images, when available, provides the needed definition and relationships of adjacent organs. SPECT transaxial sections provide clear anatomic definition of perfusion defects without foreground and background lung tissue superimposed. The location, shape, and size of the perfusion defects can be readily assessed by SPECT. An algorithm was developed for the differentiation of abnormal pulmonary perfusion patterns from normal structures on variation

  10. Two zero-flow pressure intercepts exist in autoregulating isolated skeletal muscle.

    Science.gov (United States)

    Braakman, R; Sipkema, P; Westerhof, N

    1990-06-01

    The autoregulating vascular bed of the isolated canine extensor digitorum longus muscle was investigated for the possible existence of two positive zero-flow pressure axis intercepts, a tone-dependent one and a tone-independent one. An isolated preparation, perfused with autologous blood, was used to exclude effects of collateral flow and nervous and humoral regulation while autoregulation was left intact [mean autoregulatory gain 0.50 +/- 0.24 (SD)]. In a first series of experiments, the steady-state (zero flow) pressure axis intercept [mean 8.9 +/- 2.6 (SD) mmHg, tone independent] and the instantaneous (zero flow) pressure axis intercept [mean 28.5 +/- 9.9 (SD) mmHg, tone dependent] were determined as a function of venous pressure (range: 0-45 mmHg) and were independent of venous pressure until the venous pressure exceeded their respective values. Beyond this point the relations between the venous pressure and the steady-state and instantaneous pressure axis intercept followed the line of identity. The findings agree with the predictions of the vascular waterfall model. In a second series it was shown by means of administration of vasoactive drugs that the instantaneous pressure axis intercept is tone dependent, whereas the steady-state pressure axis intercept is not. It is concluded that there is a (proximal) tone-dependent zero-flow pressure at the arteriolar level and a (distal) tone-independent zero-flow pressure at the venous level.

  11. Effects of perfusion pressure and insulin on (3H) cytochalasin B (CB) binding to control and diabetic rat hearts

    International Nuclear Information System (INIS)

    Pleta, M.; Chan, T.

    1987-01-01

    Using ( 3 H) CB, they attempted to quantitate the changes in the amount of glucose transporters in the plasma membrane (PM) and intracellular membranes (HSP) prepared from rat hearts perfused with insulin, under low and high pressure. Membranes isolated from non-perfused hearts showed a PM/HSP ratio of (0.593). Hearts perfused with low pressure showed a lower ratio of (0.474). Perfusion with insulin increased the ratio to (1.8), almost a 3-4 fold increase from low perfusion pressure. These data correlate with insulin effects in glucose transport and CB binding in the fat cells. High pressure perfusion increased the PM/HSP ratio by 1-2 fold. ( 3 H) 2-DG transport indicates a comparable increase in glucose uptake with high pressure, but with insulin only a 1.5 fold increase was observed. Initial data obtained from streptozotocin (STZ) injected diabetic rats indicate low CB binding in the PM fraction. Only insulin, but not high perfusion pressure increased PM/HSP ratio in the STZ-diabetic hearts. Their data imply that while both caused apparent translocation of glucose transporters, influences on cardiac glucose metabolism by work load are different. Furthermore, STZ induced diabetes affected only the high perfusion pressure-induced and not the insulin-stimulated change in CB binding

  12. Intra-peritoneal administration of interleukin-1 beta induces impaired insulin release from the perfused rat pancreas

    DEFF Research Database (Denmark)

    Wogensen, L; Helqvist, S; Pociot, F

    1990-01-01

    Previous studies have demonstrated a stimulatory effect of interleukin-1 beta (IL-1 beta) on insulin and glucagon release from the perfused rat pancreas, accompanied by selective lysis of 20% of beta-cells as assessed by electronmicroscopy. However, we have not observed an inhibitory action of IL-1...... beta on insulin release from the perfused pancreas as shown for isolated islets. To test whether periodical exposure of the endocrine pancreas to circulating IL-1 beta in vivo affects insulin release from the intact perfused pancreas, rats were treated with daily intraperitoneal injections of 4...

  13. The administration of a single dose of a multivalent (DHPPiL4R) vaccine prevents clinical signs and mortality following virulent challenge with canine distemper virus, canine adenovirus or canine parvovirus

    OpenAIRE

    Stephen Wilson; Joanna Illambas; Elisabeth Siedek; Anne Thomas; Vickie King; Catrina Stirling; Edita Plevová; Jeremy Salt; Gordon Sture

    2014-01-01

    Four challenge studies following vaccination of dogs with a multivalent vaccine containing canine parvovirus (CPV-2b), adenovirus (CAV-1/-2) and distemper (CDV) are described. Six week old puppies received a single vaccination while non-vaccinated control dogs received water. In each respective trial, groups of dogs were challenged 21 days after vaccination with heterologous viral isolates. Clinical observations, rectal temperature measurements, and blood and swab samples for analysis were co...

  14. Blood perfusion and pH monitoring in organs by laser-induced fluorescence spectroscopy

    Science.gov (United States)

    Vari, Sandor G.; Papazoglou, Theodore G.; Pergadia, Vani R.; Stavridi, Marigo; Snyder, Wendy J.; Papaioannou, Thanassis; Duffy, J. T.; Weiss, Andrew B.; Thomas, Reem; Grundfest, Warren S.

    1994-01-01

    Sensitivity of laser-induced fluorescence spectroscopy (LIFS) in detecting a change in tissue pH, and blood perfusion was determined. Rabbits were anesthetized, paralyzed, and mechanically ventilated. The arterial and venous blood supplies of the kidney were isolated and ligated to alter the perfusion. The femoral artery was cannulated to extract samples for blood gas analysis. A 308-nm XeCl was used as an excitation source. A 600 micrometers core diameter fiber was used for fluorescence acquisition, and the spectra analyzed by an optical multichannel analyzer (EG & G, OMA III). the corresponding intensity ratio R equals INADH / ICOLL was used as an index for respiratory acidosis. Blood perfusion was assessed using the following algorithm: (IELAS minus ICOLL) divided by (INADH minus ICOLL). The intensity ratio linearly decreased with the reduction of blood perfusion. When we totally occluded the artery the ratio decreased tenfold when compared to the ratio of a fully perfused kidney. Results of monitoring blood acidosis by laser-induced fluorescence spectroscopy shows a significant trend between pH and intensity ratio. Since all the slopes were negative, there is an obvious significant correlation between the pH and NADH.COLLAGEN RATIO. Blue-light-induced fluorescence measurements and ratio fluorometry is a sensitive method for monitoring blood perfusion and acidity or alkalinity of an organ.

  15. Pulmonary O2 transfer during pulsatile and non-pulsatile perfusion.

    Science.gov (United States)

    Hauge, A; Nicolaysen, G

    1980-07-01

    The importance of the perfusion pattern for the oxygen transfer has been examined in isolated rabbit lungs perfused with plasma at constant volume inflow. The lungs were ventilated with constant tidal volume and constant end-expiratory pressure. Following a standardized rise in FIO2 the rate of rise in pulmonary venous PO2 (delta PO2/delta t) was measured during alternately pulsatile and non-pulsatile perfusion in normal lungs and in lungs made edematous by elevation of left atrial pressure. In normal lungs there was no difference in delta PO2/delta t when the two modes of perfusion were compared. In edematous lungs delta PO/delta t was statistically higher during pulsatile perfusion, indicating a beneficial effect of flow- and pressure pulsations, e.g. a better distribution of V/Q ratios throughout the lungs. In a separate series of expts. the advancement of a high O2 front through the airways was measured, and the two perfusion patterns compared. Since no difference was found, we suggest that the phenomenon of "cardiogenic gas mixing" in the airways in vivo is a result of a direct action of the heart on the lungs rather than arterial pulsations.

  16. Molecular epidemiology of canine parvovirus in southern India

    Directory of Open Access Journals (Sweden)

    V. M. Vivek Srinivas,

    2013-08-01

    Full Text Available Aim: The present study was conducted to isolate and characterize canine parvovirus circulating in Southern India by genetic analysis of VP2 capsid protein gene.Materials and Methods: In this study, 128 samples were collected from nine different locations covering five Southern Indian states (Pondicherry, Tamil Nadu, Kerala, Andhra Pradesh and Karnataka . Out of 128 samples, 69 samples were found to be positive by PCR assay. Out of 69 positive samples, 36 were randomly selected and processed for virus isolation. Twenty viruses could be isolated successfully and 18 randomly selected isolate were subjected to VP2 gene sequence analysis along with 6 random clinical samples.Result: Seventeen isolates and 5 clinical samples were characterized as New CPV-2a (CPV2a with 297-Ser→Ala. But one isolate and one clinical sample had amino acids variations which were characteristics of New CPV-2b. The phylogenetic analysis revealed that one of the field isolates was found to be phylogenetically closely related to New CPV-2b strains of India; rest other sequences was found to share ancestral origins with New CPV-2a reference strains of Japan, China, Thailand and India.Conclusion: The present study revealed that the predominant CPV strain circulating in Southern India is New CPV-2a. There is also enough indication of New CPV-2b strain from different states of Southern India.

  17. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

  18. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  19. The effect of dexmedetomidine on cerebral perfusion and oxygenation in healthy piglets with normal and lowered blood pressure anaesthetized with propofol-remifentanil total intravenous anaesthesia

    DEFF Research Database (Denmark)

    Mikkelsen, Mai Louise Grandsgaard; Ambrus, Rikard; Rasmussen, Rune

    2017-01-01

    Background During anaesthesia and surgery, in particular neurosurgery, preservation of cerebral perfusion and oxygenation (CPO) is essential for normal postoperative brain function. The isolated effects on CPO of either individual anaesthetic drugs or entire anaesthetic protocols are of importance...

  20. Michaëlis--Menten kinetics of phenazone elimination in the perfused pig liver

    DEFF Research Database (Denmark)

    Andreasen, B; Tonnesen, K; Rabol, A

    1977-01-01

    The purpose of the present study was to define the elimination kinetics of phenazone (NFN) in the isolated perfused pig liver. In five experiments phenazone was administered as constant infusion to obtain steady-state periods over a wide range of concentrations. The elimination of phenazone follo...

  1. 50 Years of renal physiology from one man and the perfused tubule: Maurice B. Burg.

    Science.gov (United States)

    Hamilton, Kirk L; Moore, Antoni B

    2016-08-01

    Technical advancements in research techniques in science are made in slow increments. Even so, large advances from insight and hard work of an individual with a single technique can have astonishing ramifications. Here, we examine the impact of Dr. Maurice B. Burg and the isolated perfused renal tubule technique and celebrate the 50th anniversary of the publication by Dr. Burg and his colleagues of their landmark paper in the American Journal of Physiology in 1966. In this study, we have taken a scientific visualization approach to study the scientific contributions of Dr. Burg and the isolated perfused tubule preparation as determining research impact by the number of research students, postdoctoral fellows, visiting scientists, and national and international collaborators. Additionally, we have examined the research collaborations (first and second generation scientists), established the migrational visualization of the first generation scientists who worked directly with Dr. Burg, quantified the metrics indices, identified and quantified the network of coauthorship of the first generation scientists with their second generation links, and determined the citations analyses of outputs of Dr. Burg and/or his first generation collaborators as coauthors. We also review the major advances in kidney physiology that have been made with the isolated perfused tubule technique. Finally, we are all waiting for the discoveries that the isolated perfused preparation technique will bring during the next 50 years. Copyright © 2016 the American Physiological Society.

  2. Effects of thyroid state on respiration of perfused rat and guinea pig hearts

    International Nuclear Information System (INIS)

    Read, L.C.; Wallace, P.G.; Berry, M.N.

    1987-01-01

    The effects of thyroid state on the respiration of the isolated heart were investigated using retrograde perfused rat and guinea pig hearts. In both species, hypothyroidism caused a marked depression in circulating thyroid hormone concentrations and in the respiration of the isolated, retrograde perfused heart. Hypothyroidism was caused by injecting animals with Na 131 I. The effects on myocardial respiration could be attributed to changes in the contraction frequency and in the oxygen consumption per beat, with little contribution from basal respiration. Treatment of animals with thyroxine elevated plasma thyroid hormones to a similar extent in rats and guinea pigs. In the latter, thyroxine treatment was associated with substantial increases in the contraction frequency and the oxygen consumption per beat of the isolated heart. In contrast, only small changes were apparent in the retrograde perfused rat heart, observations that were confirmed in rat hearts perfused at near physiological work loads. It was concluded that rat hearts isolated from normal animals function at near maximal thyroid state, in contrast to the guinea pig heart, which requires higher circulating concentrations of thyroid hormones to attain maximal responses

  3. Canine scent detection of canine cancer: a feasibility study

    Directory of Open Access Journals (Sweden)

    Dorman DC

    2017-10-01

    Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

  4. New and emerging pathogens in canine infectious respiratory disease.

    Science.gov (United States)

    Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

    2014-03-01

    Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

  5. Inhibition of gluconeogenesis in the perfusing liver of irradiated rats

    International Nuclear Information System (INIS)

    Borovikova, G.V.; Dokshina, G.A.; Ermakova, G.N.; Mashkova, N.Yu.

    1981-01-01

    It was shown on the perfusing liver taken from rats on the 1st and 3d days after irradiation in a dose of 18.06x10 -2 C/kg that insulin (400 μunits/ml) and taurine (40 mg%) exerted an inhibiting action on the rate of gluconeogenesi.s and transamination, catalyzed by alanine aminoferase and aspartate aminoferase, in a soluble fraction of the irradiated rat liver. The gluconeogenic capacity and the reactivity of the isolated organ were shown to decrease on the 3d day after irradiation [ru

  6. Canine sporotrichosis: report of 15 advanced cases

    Directory of Open Access Journals (Sweden)

    Mariana B. Mascarenhas

    Full Text Available ABSTRACT: Sporotrichosis is a chronic, granulomatous and usually lymphocutaneous infection of animals and humans, caused by a dimorphic fungus, Sporothrix schenckii complex. The disease in dogs is considered rare, however, in the last years a crescent registration of cases was observed in Brazil, especially in the city of Rio de Janeiro. Fifteen dogs with ulcerated cutaneous lesions were seen at the Dermatology Service in the Small Animal’s Hospital at Universidade Federal Rural do Rio de Janeiro, between January 2014 and October 2015. Most lesions were located on the head, mainly the nose. Lesions were even seen on the chest, disseminated on the body and on the limbs. Three dogs (20% exhibited the cutaneous-lymphatic form, with lesions initially on the distal aspect of one leg and ascending via lymphatics up the leg to the trunk and head. It was not ruled out the disseminated form in at least 3 dogs (20%. They had consistent signs of generalized or disseminated disease exhibiting respiratory symptoms (nasal discharge, sneezing, stertorous breathing, anorexia and weight loss. Draining tracts and cellulitis were very common. Some had large areas of skin necrosis with exposure of muscle and bone. Definitive diagnosis was obtained by cytological examination of exudates, histological examination, and/or isolation of S. schenckii complex by fungal culture. Because of the severity of the lesions that mimic other disorders like neoplasms or autoimmune skin diseases, and due to the difficulties of getting an accurate diagnosis, this study describes 15 advanced cases of canine sporotrichosis.

  7. Cryopreservation of canine ovarian and testicular fibroblasts.

    Science.gov (United States)

    Yu, Il-Jeoung; Leibo, S P; Songsasen, Nucharin; Dresser, Betsy L; Kim, In-Shik

    2009-01-01

    To derive a practical procedure to store canine somatic cells, fibroblasts isolated from testicular or ovarian tissues were cryopreserved in 1.2 M ethylene glycol or in 1.2 M dimethylsulfoxide prepared in Dulbecco's Modified Eagle Medium as cryoprotectants, and were frozen either in plastic straws or vials. Thawed cells were cultured for 24 hr at 38.5 degree C in a humidified atmosphere of 5 percent CO2 95 percent air, and then their membrane integrity was assayed with a double fluorescent stain, Fertilight. In addition, frozen-thawed fibroblasts were cultured for 4 days, and then their functional survival was measured after staining small colonies with trypan blue. After freezing and thawing, membrane integrity of testicular fibroblasts was 55-70 percent and functional survival ranged from 20-40 percent. With frozen-thawed ovarian cells, the average membrane integrity was 55-75 percent and the average functional survival was 35-40 percent. When frozen in ethylene glycol, functional survival of ovarian fibroblasts was significantly higher than that of testicular cells (P less than 0.05). These methods should prove useful to preserve cells collected from canids in the wild.

  8. Quality assessment of a placental perfusion protocol

    DEFF Research Database (Denmark)

    Mathiesen, Line; Mose, Tina; Mørck, Thit Juul

    2010-01-01

    mlh(-1) from the fetal reservoir) when adding 2 (n=7) and 20mg (n=9) FITC-dextran/100ml fetal perfusion media. Success rate of the Copenhagen placental perfusions is provided in this study, including considerations and quality control parameters. Three checkpoints suggested to determine success rate...

  9. Regional Cerebral Perfusion in Progressive Supranuclear Palsy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Won Yong; Lee, Ki Hyeong; Yoon, Byung Woo; Lee, Sang Bok; Jeon, Beom S. [Samsung Medical Center, Seoul (Korea, Republic of); Lee, Kyung Han; Lee, Myung Chul [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1996-03-15

    Progressive supranuclear palsy (PSP) is a Parkinson-plus syndrome characterized clinically by supranuclear ophthalmoplegia, pseudobulbar palsy, axial rigidity, bradykinesia, postural instability and dementia. Presence of dementia and lack of cortical histopathology suggest the derangement of cortical function by pathological changes in subcortical structures in PSP, which is supported by the pattern of behavioral changes and measurement of brain metabolism using positron emission tomography. This study was done to examine whether there are specific changes of regional cerebral perfusion in PSP and whether there is a correlation between severity of motor abnormaility and degree of changes in cerebral perfusion. We measured regional cerebral perfusion indices in 5 cortical and 2 subcortical areas in 6 patients with a clinical diagnosis of PSP and 6 healthy age and sex matched controls using Tc-99m-HMPAO SPECT. Compared with age and sex matched controls, only superior frontal regional perfusion index was significantly decreased in PSP (p<0.05). There was no correlation between the severity of the motor abnormality and any of the regional cerebral perfusion indices (p>0.05). We affirm the previous reports that perfusion in superior frontal cortex is decreased in PSP. Based on our results that there was no correlation between severity of motor abnormality and cerebral perfusion in the superior frontal cortex, nonmotoric symptoms including dementia needs to be looked at whether there is a correlation with the perfusion abnormality in superior frontal cortex

  10. Computed Tomography (CT) Perfusion in Abdominal Cancer

    DEFF Research Database (Denmark)

    Hansen, Martin Lundsgaard; Norling, Rikke; Lauridsen, Carsten

    2013-01-01

    Computed Tomography (CT) Perfusion is an evolving method to visualize perfusion in organs and tissue. With the introduction of multidetector CT scanners, it is now possible to cover up to 16 cm in one rotation, and thereby making it possible to scan entire organs such as the liver with a fixed...

  11. Clinical application of cerebral dynamic perfusion studies

    International Nuclear Information System (INIS)

    DeLand, F.H.

    1975-01-01

    Radionuclide cerebral perfusion studies are assuming a far greater importance in the detection and differential diagnosis of cerebral lesions. Perfusion studies not only contribute to the differential diagnosis of lesions but in certain cases are the preferred methods by which more accurate clinical interpretations can be made. The characteristic blood flow of arterio-venous malformations readily differentiates this lesion from neoplasms. The decreased perfusion or absent perfusion observed in cerebral infarctions is diagnostic without concurrent evidence from static images. Changes in rates and direction of blood flow contribute fundamental information to the status of stenosis and vascular occlusion and, in addition, offer valuable information on the competency and routes of collateral circulation. The degree of cerebral perfusion after cerebral vascular accidents appears to be directly related to patient recovery, particularly muscular function. Cerebral perfusion adds a new parameter in the diagnosis of subdural haematomas and concussion and in the differentiation of obscuring radioactivity from superficial trauma. Although pictorial displays of perfusion blood flow will offer information in most cerebral vascular problems, the addition of computer analysis better defines temporal relationships of regional blood flow, quantitative changes in flow and the detection of the more subtle increases or decreases in cerebral blood flow. The status of radionuclide cerebral perfusion studies has taken on an importance making it the primary modality for the diagnosis of cerebral lesions. (author)

  12. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  13. Epizootic canine distemper virus infection among wild mammals.

    Science.gov (United States)

    Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken

    2012-01-27

    In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Frequency, antimicrobial susceptibility and clonal distribution of methicillin-resistant Staphylococcus pseudintermedius in canine clinical samples submitted to a veterinary diagnostic laboratory in Italy: A 3-year retrospective investigation

    DEFF Research Database (Denmark)

    Ventrella, G.; Moodley, A.; Grandolfo, E.

    2017-01-01

    In the last decade there has been a rapid global spread of methicillin-resistant Staphylococcus pseudintermedius (MRSP) clones displaying multidrug resistance in dogs. We investigated prevalence, antimicrobial susceptibility and clonal distribution of MRSP isolated from clinical canine samples be...

  15. Methodology for ventilation/perfusion SPECT

    DEFF Research Database (Denmark)

    Bajc, Marika; Neilly, Brian; Miniati, Massimo

    2010-01-01

    radiolabeled liquid aerosols are not restricted to the presence of obstructive lung disease. Radiolabeled macroaggregated human albumin is the imaging agent of choice for perfusion scintigraphy. An optimal combination of nuclide activities and acquisition times for ventilation and perfusion, collimators......Ventilation/perfusion single-photon emission computed tomography (V/Q SPECT) is the scintigraphic technique of choice for the diagnosis of pulmonary embolism and many other disorders that affect lung function. Data from recent ventilation studies show that the theoretic advantages of Technegas over......, and imaging matrix yields an adequate V/Q SPECT study in approximately 20 minutes of imaging time. The recommended protocol based on the patient remaining in an unchanged position during the initial ventilation study and the perfusion study allows presentation of matching ventilation and perfusion slices...

  16. Brain Perfusion Changes in Intracerebral Hemorrhage

    International Nuclear Information System (INIS)

    Mititelu, R.; Mazilu, C.; Ghita, S.; Rimbu, A.; Marinescu, G.; Codorean, I.; Bajenaru, O.

    2006-01-01

    Full text: Purpose: Despite the latest advances in medical treatment and neuro critical care, patients suffering spontaneous intracerebral hemorrhage (SICH) still have a very poor prognosis, with a greater mortality and larger neurological deficits at the survivors than for ischemic stroke. Many authors have shown that there are many mechanisms involved in the pathology of SICH: edema, ischemia, inflammation, apoptosis. All of these factors are affecting brain tissue surrounding hematoma and are responsible of the progressive neurological deterioration; most of these damages are not revealed by anatomical imaging techniques. The aim of our study was to asses the role of brain perfusion SPECT in demonstrating perfusion changes in SICH patients. Method: 17 SICH pts were studied. All pts underwent same day CT and brain SPECT with 99mTcHMPAO, 24h-5d from onset of stroke. Results: 14/17 pts showed a larger perfusion defect than expected after CT. In 2 pts hematoma diameter was comparable on CT and SPECT; 1pt had quasinormal aspect of SPECT study. In pts with larger defects, SPECT revealed a large cold spot with similar size compared with CT, and a surrounding hypo perfused area. 6/17 pts revealed cortical hyper perfusion adjacent to hypo perfused area and corresponding to a normal-appearing brain tissue on CT. In 3 pts we found crossed cerebellar diaskisis.In 2 pts we found cortical hypo perfused area in the contralateral cortex, with normal appearing brain tissue on CT. Conclusions: Brain perfusion SPECT revealed different types of perfusion changes in the brain tissue surrounding hematoma. These areas contain viable brain tissue that may be a target for future ne uroprotective strategies. Further studies are definitely required to demonstrate prognostic significance of these changes, but we can conclude that brain perfusion SPECT can play an important role in SICH, by early demonstrating functional changes responsible of clinical deterioration, thus allowing prompt

  17. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  18. Characterization of the canine urinary proteome.

    Science.gov (United States)

    Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

    2014-06-01

    Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  19. Military veterans and canine assistance for post-traumatic stress disorder: A narrative review of the literature.

    Science.gov (United States)

    Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni

    2016-12-01

    Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi

  20. Calcium-sensitivity of smooth muscle contraction in the isolated ...

    African Journals Online (AJOL)

    sensitivity of smooth muscle contraction were studied in the isolated perfused rat tail artery, employing the activators noradrenaline (NA) (3ìM) sand potassium chloride (KC1) (100mM). Experiments were conduced in Ca2+ - buffered saline.

  1. Radioimmunoassay of canine growth hormone

    International Nuclear Information System (INIS)

    Eigenmann, J.E.; Eigenmann, R.Y.

    1981-01-01

    A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

  2. Surgical construction of a novel simulated carotid siphon in canines

    International Nuclear Information System (INIS)

    Tan Huaqiao; Li Minghua; Zhu Yueqi; Fang Chun; Wang Jue; Wu Chungen; Cheng Yingsheng; Xie Jian; Zhang He

    2008-01-01

    Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

  3. Vasoactive mediators and splanchnic perfusion.

    Science.gov (United States)

    Reilly, P M; Bulkley, G B

    1993-02-01

    To provide an overview of the splanchnic hemodynamic response to circulatory shock. Previous studies performed in our own laboratory, as well as a computer-assisted search of the English language literature (MEDLINE, 1966 to 1991), followed by a selective review of pertinent articles. Studies were selected that demonstrated relevance to the splanchnic hemodynamic response to circulatory shock, either by investigating the pathophysiology or documenting the sequelae. Article selection included clinical studies as well as studies in appropriate animal models. Pertinent data were abstracted from the cited articles. The splanchnic hemodynamic response to circulatory shock is characterized by a selective vasoconstriction of the mesenteric vasculature mediated largely by the renin-angiotensin axis. This vasospasm, while providing a natural selective advantage to the organism in mild-to-moderate shock (preserving relative perfusion of the heart, kidneys, and brain), may, in more severe shock, cause consequent loss of the gut epithelial barrier, or even hemorrhagic gastritis, ischemic colitis, or ischemic hepatitis. From a physiologic standpoint, nonpulsatile cardiopulmonary bypass, a controlled form of circulatory shock, has been found experimentally to significantly increase circulating levels of angiotensin II, the hormone responsible for this selective splanchnic vasoconstriction. While angiotensin II has been viewed primarily as the mediator responsible for the increased total vascular resistance seen during (and after) cardiopulmonary bypass, it may also cause the disproportionate decrease in mesenteric perfusion, as measured in human subjects by intraluminal gastric tonometry and galactose clearance by the liver, as well as the consequent development of the multiple organ failure syndrome seen in 1% to 5% of patients after cardiac surgery.

  4. Regional Cerebral Perfusion in Progressive Supranuclear Palsy

    International Nuclear Information System (INIS)

    Lee, Won Yong; Lee, Ki Hyeong; Yoon, Byung Woo; Lee, Sang Bok; Jeon, Beom S.; Lee, Kyung Han; Lee, Myung Chul

    1996-01-01

    Progressive supranuclear palsy (PSP) is a Parkinson-plus syndrome characterized clinically by supranuclear ophthalmoplegia, pseudobulbar palsy, axial rigidity, bradykinesia, postural instability and dementia. Presence of dementia and lack of cortical histopathology suggest the derangement of cortical function by pathological changes in subcortical structures in PSP, which is supported by the pattern of behavioral changes and measurement of brain metabolism using positron emission tomography. This study was done to examine whether there are specific changes of regional cerebral perfusion in PSP and whether there is a correlation between severity of motor abnormaility and degree of changes in cerebral perfusion. We measured regional cerebral perfusion indices in 5 cortical and 2 subcortical areas in 6 patients with a clinical diagnosis of PSP and 6 healthy age and sex matched controls using Tc-99m-HMPAO SPECT. Compared with age and sex matched controls, only superior frontal regional perfusion index was significantly decreased in PSP (p 0.05). We affirm the previous reports that perfusion in superior frontal cortex is decreased in PSP. Based on our results that there was no correlation between severity of motor abnormality and cerebral perfusion in the superior frontal cortex, nonmotoric symptoms including dementia needs to be looked at whether there is a correlation with the perfusion abnormality in superior frontal cortex

  5. Computerized analysis of brain perfusion parameter images

    International Nuclear Information System (INIS)

    Turowski, B.; Haenggi, D.; Wittsack, H.J.; Beck, A.; Aurich, V.

    2007-01-01

    Purpose: The development of a computerized method which allows a direct quantitative comparison of perfusion parameters. The display should allow a clear direct comparison of brain perfusion parameters in different vascular territories and over the course of time. The analysis is intended to be the basis for further evaluation of cerebral vasospasm after subarachnoid hemorrhage (SAH). The method should permit early diagnosis of cerebral vasospasm. Materials and Methods: The Angiotux 2D-ECCET software was developed with a close cooperation between computer scientists and clinicians. Starting from parameter images of brain perfusion, the cortex was marked, segmented and assigned to definite vascular territories. The underlying values were averages for each segment and were displayed in a graph. If a follow-up was available, the mean values of the perfusion parameters were displayed in relation to time. The method was developed under consideration of CT perfusion values but is applicable for other methods of perfusion imaging. Results: Computerized analysis of brain perfusion parameter images allows an immediate comparison of these parameters and follow-up of mean values in a clear and concise manner. Values are related to definite vascular territories. The tabular output facilitates further statistic evaluations. The computerized analysis is precisely reproducible, i. e., repetitions result in exactly the same output. (orig.)

  6. Myocardial kinetics of thallium-201 after stress in normal and perfusion-reduced canine myocardium

    International Nuclear Information System (INIS)

    Okada, R.D.

    1985-01-01

    Despite the emerging use of quantitative computer programs for assessing myocardial thallium uptake and clearance after exercise, little is known about the kinetics of thallium after exercise stress. Accordingly, 11 mongrel dogs with experimental left anterior descending coronary stenoses were given thallium during norepinephrine infusion to simulate exercise. The infusion was discontinued and thallium activity was monitored regionally using miniature radiation detectors for 3 hours. Heart rate, arterial pressure and double product all increased significantly during norepinephrine infusion. The mean fractional myocardial thallium clearance was lower (0.47 +/- 0.03 [+/- standard error of the mean]) for the stenosis zone than for the no-stenosis zone (0.57 +/- 0.03) (p less than 0.0001). The stress blood flow ratio (stenosis/no-stenosis zone = 0.27 +/- 0.06) was significantly lower than the final thallium activity ratio (0.68 +/- 0.07) (p less than 0.001), consistent with thallium redistribution occurring over the 3-hour period. Myocardial thallium activity in the stenosis zone peaked in a mean of 2.2 minutes, then washed out biexponentially with a final decay constant of 0.0035 +/- 0.0005 min-1. Myocardial thallium activity in the no-stenosis zone peaked within 1 minute in all dogs, then washed out biexponentially, with a final decay constant of 0.0043 +/- 0.0003 (p less than 0.001 compared with stenosis zone). In conclusion, fractional clearance of thallium can differentiate myocardium distal to a coronary artery stenosis from that supplied by a normal coronary vessel

  7. Villous motility and unstirred water layers in canine intestine

    International Nuclear Information System (INIS)

    Mailman, D.; Womack, W.A.; Kvietys, P.R.; Granger, D.N.

    1990-01-01

    The possibility that villous motility reduces the mucosal unstirred water layer by mechanical stirring was examined. The frequency of contraction of villi was measured by using videomicroscopic techniques while a segment of anesthetized canine jejunum or ileum with its nerve and blood supply intact was maintained in a sealed chamber through which Tyrode solution was perfused. Radioisotopically labeled inulin, H 2 O, and butyric and lauric acid were used to measure net and/or unidirectional fluxes from the chamber. The unidirectional absorptive transport of H 2 O and butyric acid but not lauric acid by jejunal segments was significantly correlated with flow through the chamber. Plasma volume expansion increased villous motility but decreased the absorption of H 2 O and lauric acid. Absorption of butyric acid from the ileum was little different than from the jejunum although the degree of villous motility was less and net water absorption was greater from the ileum. Absorption of butyric acid into dead tissue indicated that passive diffusion into the tissue accounted for between 7 and 25%, depending on flow rate, of the absorption in intact tissue and that nonspecific binding was low. It was concluded that villous motility did not stir the unstirred water layers and was not directly associated with altered transport

  8. Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

    Science.gov (United States)

    Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

    2004-10-13

    Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

  9. Regulation of gut hormone secretion. Studies using isolated perfused intestines

    DEFF Research Database (Denmark)

    Svendsen, Berit; Holst, Jens Juul.

    2016-01-01

    hormones is highly increased after gastric bypass operations, which have turned out to be an effective therapy of not only obesity but also type 2 diabetes. These effects are likely to be due, at least in part, to increases in the secretion of these gut hormones (except GIP). Therefore, stimulation...... of the endogenous hormone represents an appealing therapeutic strategy, which has spurred an interest in understanding the regulation of gut hormone secretion and a search for particularly GLP-1 and PYY secretagogues. The secretion of the gut hormones is stimulated by oral intake of nutrients often including...

  10. Dynamic contrast enhanced MRI for perfusion quantification

    DEFF Research Database (Denmark)

    Andersen, Irene Klærke

    2002-01-01

    Magnetic resonance imaging, during bolus passage of a paramagnetic contrast agent, is used world-wide to obtain parameters that reflect the pathological state of tissue. Abnormal perfusion occurs in diseases such as stoke and tumour. Consequently, perfusion quantication could have signi cant...... clinical value both in diagnosis and treatment of such pathologies. One approach for perfusion quanti cation involves using the contrast mechanism that a ects the transverse relaxation rates of the magnetization, R2 or R 2 , since this provides the most pronounced effect. However, the linearity between...

  11. The functional state of perfused liver tissue in X-ray irradiated rats

    International Nuclear Information System (INIS)

    Borovikova, G.V.; Dokshina, G.A.; Lapteva, T.A.

    1981-01-01

    The results of studying the functional state of perfused liver tissue isolated from rates after irradiation in the 18.06x10 - 2 Kl/kg dose, which has been estimated by transamination process rate catalized alanine-(KF 2.6x1.2, ALT and aspartate by aminotransferases (KF 2.6x1.1, ACT), gluconeogenesis and urea production intensity presented. When comparing the results obtained on the perfused liver deprived of homeostatic body effects it has been found that the liver isolated from the body for the first 24 hours of the radiation sickness development possesses a higher radiation activity which manifests itself in intensification of the processes of gluconeogenesis and transamination with substrate addition. The third 24 hours upon irradiation in the isolated liver the intensity of the gluconeogenesis and transamination processes is attenuated

  12. Functional state of perfused liver tissue in X-ray irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Borovikova, G.V.; Dokshina, G.A.; Lapteva, T.A. (Tomskij Gosudarstvennyj Univ. (USSR). Nauchno-Issledovatel' skij Inst. Biologii i Biofiziki)

    1981-01-01

    The results of studying the functional state of perfused liver tissue isolated from rats after irradiation in the 18.06x10/sup -2/ Kl/kg dose, which has been estimated by transamination process rate catalized alanine-(KF 2.6x1.2, ALT and aspartate by aminotransferases (KF 2.6x1.1, ACT), gluconeogenesis and urea production intensity presented. When comparing the results obtained on the perfused liver deprived of homeostatic body effects it has been found that the liver isolated from the body for the first 24 hours of the radiation sickness development possesses a higher radiation activity which manifests itself in intensification of the processes of gluconeogenesis and transamination with substrate addition. The third 24 hours upon irradiation in the isolated liver the intensity of the gluconeogenesis and transamination processes is attenuated.

  13. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

    Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

  14. Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)

    International Nuclear Information System (INIS)

    Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.

    1986-01-01

    Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain

  15. Varied clinico-radiological presentations of transmigrated canines

    Directory of Open Access Journals (Sweden)

    Ishita Gupta

    2015-01-01

    Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

  16. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  17. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

  18. Treatment modalities of palatal impacted canines

    OpenAIRE

    Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

    2012-01-01

    Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

  19. Orthodontic Traction of Impacted Canine Using Cantilever

    OpenAIRE

    Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

    2016-01-01

    The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

  20. Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

    Science.gov (United States)

    Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

    2016-02-01

    To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A

    2001-06-01

    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  2. Platelets Inhibit Migration of Canine Osteosarcoma Cells.

    Science.gov (United States)

    Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

    2017-01-01

    The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

  3. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă

    2013-08-01

    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  4. CANINE: a robotic mine dog

    Science.gov (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag

    2013-01-01

    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  5. Ultrasonography of the canine pancreas

    Directory of Open Access Journals (Sweden)

    Michelle L Avante

    2018-01-01

    Full Text Available This study describes the ultrasonographic techniques currently used in the evaluation of the canine pancreas. Ultrasonography was the first method to enable direct visualization of the pancreas in humans and it has been subsequently applied to animals. Currently, it is the method of choice for pancreatic evaluation and is essential as a diagnostic tool in the detection of abnormalities, especially tumors. Innovative equipment technology has led to the emergence of techniques complementary to B-mode ultrasound; such as Doppler, elastography, and contrast-enhanced ultrasonography, which have enabled more accurate diagnosis. Doppler provides information on vascular architecture and the hemodynamic aspect of blood vessels in multiple organs. ARFI elastography provides detailed images of the alterations detected by conventional examination (qualitative method and assists in differentiating between benign and malignant processes (quantitative method. Microbubble contrast agents determine parameters related to homogeneous and heterogeneous filling of organs with microbubbles, mainly nodular areas, thus defining high and low intensity patterns.

  6. Myocardial perfusion scintigraphy - possibilities of diagnosing CAD

    International Nuclear Information System (INIS)

    Tsonevska, A.

    1998-01-01

    A reviewing the diagnostic methods used in the intricate process of evaluating CAD patients in a attempt to establish the role played by radionuclide methods in the diagnostic strategy is done. The perfusion cardiotropic radiopharmaceuticals used and the various methods of evaluating myocardial are discussed. Although 210 Tl-chloride is the most widely used myocardial perfusion agent, recently 99m Tc-MIBI is proposed as an alternative because of its advantages. Myocardial perfusion assessment is done by various techniques depending on the specific aim, each of them having its proper advantages and shortcomings. The inference is reached that regardless of the routine practical implementation of myocardial perfusion scintigraphy and comprehensive studies along this line in course, there are problems still not well enough clarified awaiting solution

  7. Regional myocardial perfusion of cardioplegic solutions

    International Nuclear Information System (INIS)

    Eugene, J.; Lyons, K.P.; Ott, R.A.; Gelezunas, V.L.; Chang, C.W.; Kowall, M.G.; Haiduc, N.J.

    1987-01-01

    We compared the regional myocardial perfusion of blood cardioplegic solution (BCP) and crystalloid cardioplegic solution (CCP) in 14 mongrel dogs. Cardiopulmonary bypass was established at 28 degrees C, and a hydraulic occluder was placed around the proximal left anterior descending (LAD) coronary artery. In group 1 (N = 7) collateral coronary arteries were ligated; in group 2 (N = 7) collateral coronary arteries were left in situ. After the aorta was clamped, BCP and CCP were alternately perfused at 200 ml/min. The occluder was inflated to produce moderate, severe, and critical LAD stenosis, and regional perfusion was measured by xenon-133 washout with the Silicon Avalanche Radiation Detector. BCP infusion produced a consistently higher aortic pressure, but CCP flow was better than BCP flow under all conditions, particularly without coronary collaterals. Regional myocardial perfusion of CCP is superior to BCP

  8. MRI of pulmonary perfusion; MRT der Lungenperfusion

    Energy Technology Data Exchange (ETDEWEB)

    Fink, C. [Klinikum Grosshadern der Ludwig-Maximilians-Universitaet Muenchen (Germany). Institut fuer Klinische Radiologie; Deutsches Krebsforschungszentrum (DKFZ), Abteilung Radiologie, Heidelberg (Germany); Risse, F.; Semmler, W. [Deutsches Krebsforschungszentrum (DKFZ), Abteilung Medizinische Physik in der Radiologie, Heidelberg (Germany); Schoenberg, S.O.; Reiser, M.F. [Klinikum Grosshadern der Ludwig-Maximilians-Universitaet Muenchen (Germany). Institut fuer Klinische Radiologie; Kauczor, H.-U. [Deutsches Krebsforschungszentrum (DKFZ), Abteilung Radiologie, Heidelberg (Germany)

    2006-04-15

    Lung perfusion is a crucial prerequisite for effective gas exchange. Quantification of pulmonary perfusion is important for diagnostic considerations and treatment planning in various diseases of the lungs. Besides disorders of pulmonary vessels such as acute pulmonary embolism and pulmonary hypertension, these also include diseases of the respiratory tract and lung tissue as well as pulmonary tumors. This contribution presents the possibilities and technical requirements of MRI for diagnostic work-up of pulmonary perfusion. (orig.) [German] Die Perfusion der Lunge ist eine entscheidende Voraussetzung fuer einen effektiven Gasaustausch. Die Bestimmung der Lungenperfusion ist bei verschiedenen Erkrankungen der Lunge fuer Diagnostik und Therapieplanung bedeutsam. Hierzu zaehlen neben Erkrankungen der Lungengefaesse wie akute Lungenembolie und pulmonale Hypertension ebenso Erkrankungen der Atemwege, des Lungengeruests und Lungentumoren. In diesem Beitrag werden die Moeglichkeiten und technischen Voraussetzungen der MRT zur Diagnostik der Lungenperfusion dargestellt. (orig.)

  9. Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas

    OpenAIRE

    Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

    2017-01-01

    In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenu...

  10. Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

    OpenAIRE

    Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Ara?jo, Maria Jos? Abigail Mendes; B?falo, Michelle Cristiane; Sforcin, Jos? Maur?cio

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geop...

  11. MRI-based quantification of Duchenne muscular dystrophy in a canine model

    Science.gov (United States)

    Wang, Jiahui; Fan, Zheng; Kornegay, Joe N.; Styner, Martin A.

    2011-03-01

    Duchenne muscular dystrophy (DMD) is a progressive and fatal X-linked disease caused by mutations in the DMD gene. Magnetic resonance imaging (MRI) has shown potential to provide non-invasive and objective biomarkers for monitoring disease progression and therapeutic effect in DMD. In this paper, we propose a semi-automated scheme to quantify MRI features of golden retriever muscular dystrophy (GRMD), a canine model of DMD. Our method was applied to a natural history data set and a hydrodynamic limb perfusion data set. The scheme is composed of three modules: pre-processing, muscle segmentation, and feature analysis. The pre-processing module includes: calculation of T2 maps, spatial registration of T2 weighted (T2WI) images, T2 weighted fat suppressed (T2FS) images, and T2 maps, and intensity calibration of T2WI and T2FS images. We then manually segment six pelvic limb muscles. For each of the segmented muscles, we finally automatically measure volume and intensity statistics of the T2FS images and T2 maps. For the natural history study, our results showed that four of six muscles in affected dogs had smaller volumes and all had higher mean intensities in T2 maps as compared to normal dogs. For the perfusion study, the muscle volumes and mean intensities in T2FS were increased in the post-perfusion MRI scans as compared to pre-perfusion MRI scans, as predicted. We conclude that our scheme successfully performs quantitative analysis of muscle MRI features of GRMD.

  12. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

  13. Vicarious audiovisual learning in perfusion education.

    Science.gov (United States)

    Rath, Thomas E; Holt, David W

    2010-12-01

    Perfusion technology is a mechanical and visual science traditionally taught with didactic instruction combined with clinical experience. It is difficult to provide perfusion students the opportunity to experience difficult clinical situations, set up complex perfusion equipment, or observe corrective measures taken during catastrophic events because of patient safety concerns. Although high fidelity simulators offer exciting opportunities for future perfusion training, we explore the use of a less costly low fidelity form of simulation instruction, vicarious audiovisual learning. Two low fidelity modes of instruction; description with text and a vicarious, first person audiovisual production depicting the same content were compared. Students (n = 37) sampled from five North American perfusion schools were prospectively randomized to one of two online learning modules, text or video.These modules described the setup and operation of the MAQUET ROTAFLOW stand-alone centrifugal console and pump. Using a 10 question multiple-choice test, students were assessed immediately after viewing the module (test #1) and then again 2 weeks later (test #2) to determine cognition and recall of the module content. In addition, students completed a questionnaire assessing the learning preferences of today's perfusion student. Mean test scores from test #1 for video learners (n = 18) were significantly higher (88.89%) than for text learners (n = 19) (74.74%), (p audiovisual learning modules may be an efficacious, low cost means of delivering perfusion training on subjects such as equipment setup and operation. Video learning appears to improve cognition and retention of learned content and may play an important role in how we teach perfusion in the future, as simulation technology becomes more prevalent.

  14. Improved exercise myocardial perfusion during lidoflazine therapy

    International Nuclear Information System (INIS)

    Shapiro, W.; Narahara, K.A.; Park, J.

    1983-01-01

    Lidoflazine is a synthetic drug with calcium-channel blocking effects. In a study of 6 patients with severe classic angina pectoris, single-blind administration of lidoflazine was associated with improved myocardial perfusion during exercise as determined by thallium-201 stress scintigraphy. These studies demonstrate that lidoflazine therapy is associated with relief of angina, an increased physical work capacity, and improved regional myocardial perfusion during exercise

  15. Measurement of myocardial perfusion using magnetic resonance

    DEFF Research Database (Denmark)

    Fritz-Hansen, T.; Jensen, L.T.; Larsson, H.B.

    2008-01-01

    Cardiac magnetic resonance imaging (MRI) has evolved rapidly. Recent developments have made non-invasive quantitative myocardial perfusion measurements possible. MRI is particularly attractive due to its high spatial resolution and because it does not involve ionising radiation. This paper reviews...... myocardial perfusion imaging with MR contrast agents: methods, validation and experiences from clinical studies. Unresolved issues still restrict the use of these techniques to research although clinical applications are within reach Udgivelsesdato: 2008/12/8...

  16. Ventilation-perfused studies using SPECT

    International Nuclear Information System (INIS)

    Zwijnenburg, A.

    1989-01-01

    A method for the quantitative analysis of ventilation-perfusion SPECT studies is decribed and an effort is made to evaluate its usefullness. The technical details of the emthod are described. In the the transaxial reconstructions of the tomographic studies the contour of the lungs is detected and regional values of lung volume, ventilation, perfusion and ventilation-perfusion ratios are calculated. The method is operator independent. The lung volume calculations from the SPECT studies are validated by comparing them with lung volume measurements using the helium dilution technique. A good correlation (r=0.91) was found between the two volumes. SPECT volume was greater than the volume measured with helium dilution, which was attributed to non-gas-containing structures in the. lungs. The use of ventilation-perfusion ratio SPECT is described to evaluate the effect of ionizing radiation on the lungs in patients treated with mantle field irradiation for Hodgkin's disease. Perfusion changes appear as early as 2 months after the start of irradiation. Ventilation changes appear later and relatively minor. No changes are seen outside the radiation portals. The ventilation-perfusion inequality in pulmonary sarcoidosis is treated. It is suggested that the decrease D LCO in these patients may be partly due to an even distribution of ventilation perfusion ratios. An effort is made to establish the properties of a new tracer used for the assessment of the metabolic function of the pulmonary endothelium. The lung uptake of I-123 IMP mimics the distribution of a perfusion tracer and it is suggested that this tracer may be useful for the early detection of pulmonary vascular damage, even when blood flow is still intact. Some aspects of the use of Kr-81m as a ventilation tracer are discussed as well as the effect of noise on Kr-81m SPECT reconstructions. (author). 146 refs.; 39 figs.; 8 tabs

  17. Myogenic potential of canine craniofacial satellite cells

    Directory of Open Access Journals (Sweden)

    Rita Maria Laura La Rovere

    2014-05-01

    Full Text Available The skeletal fibres have different embryological origin; the extraocular and jaw-closer muscles develop from prechordal mesoderm while the limb and trunk muscles from somites. These different origins characterise also the adult muscle stem cells, known as satellite cells (SCs and responsible for the fibre growth and regeneration. The physiological properties of presomitic SCs and their epigenetics are poorly studied despite their peculiar characteristics to preserve muscle integrity during chronic muscle degeneration. Here we isolated SCs from canine somitic (SDM: vastus lateralis, rectus abdominus, gluteus superficialis, biceps femoris, psoas and presomitic (PSDM: lateral rectus, temporalis and retractor bulbi muscles as myogenic progenitor cells from young and old animals. In addition, SDM and PSDM satellite cells were obtained also from Golden retrievers affected by muscular dystrophy (GRMD. We characterised the lifespan, the myogenic potential and functions and oxidative stress of both somitic and presomitic SCs with the aim to reveal differences with ageing and between healthy and dystrophic animals. The different proliferation rate was consistent with higher telomerase activity in PSDM-SCs compared to SDM-SCs, although restricted at early passages. SDM-SCs express early (Pax7, MyoD and late (MyHC, Myogenin myogenic markers differently from PSDM-SCs resulting in a more efficient and faster cell differentiation. Taken together our results showed that PSDM-SCs elicit a stronger stem cell phenotype compared to SDM ones. Finally, myomiR expression profile reveals a unique epigenetic signature in GRMD satellite cells and miR-206, highly expressed in dystrophic SCs, seems to play a critical role in muscle degeneration. Thus, miR-206 could represent a potential target for novel therapeutic approaches.

  18. Variation in Perfusion Strategies for Neonatal and Infant Aortic Arch Repair: Contemporary Practice in the STS Congenital Heart Surgery Database.

    Science.gov (United States)

    Meyer, David B; Jacobs, Jeffrey P; Hill, Kevin; Wallace, Amelia S; Bateson, Brian; Jacobs, Marshall L

    2016-09-01

    Regional cerebral perfusion (RCP) is used as an adjunct or alternative to deep hypothermic circulatory arrest (DHCA) for neonates and infants undergoing aortic arch repair. Clinical studies have not demonstrated clear superiority of either strategy, and multicenter data regarding current use of these strategies are lacking. We sought to describe the variability in contemporary practice patterns for use of these techniques. The Society of Thoracic Surgeons Congenital Heart Surgery Database (2010-2013) was queried to identify neonates and infants whose index operation involved aortic arch repair with cardiopulmonary bypass. Perfusion strategy was classified as isolated DHCA, RCP (with less than or equal to ten minutes of DHCA), or mixed (RCP with more than ten minutes of DHCA). Data were analyzed for the entire cohort and stratified by operation subgroups. Overall, 4,523 patients (105 centers) were identified; median age seven days (interquartile range: 5.0-13.0). The most prevalent perfusion strategy was RCP (43%). Deep hypothermic circulatory arrest and mixed perfusion accounted for 32% and 16% of cases, respectively. In all, 59% of operations involved some period of RCP. Regional cerebral perfusion was the most prevalent perfusion strategy for each operation subgroup. Neither age nor weight was associated with perfusion strategy, but reoperations were less likely to use RCP (31% vs 45%, P RCP and DHCA in the RCP group was longer than the DHCA time in the DHCA group (45 vs 36 minutes, P neonates and infants. In contemporary practice, RCP is the most prevalent perfusion strategy for these procedures. Use of DHCA is also common. Further investigation is warranted to ascertain possible relative merits of the various perfusion techniques. © The Author(s) 2016.

  19. Multiple-indicator dilution technique for characterization of normal and retrograde flow in once-through rat liver perfusions

    International Nuclear Information System (INIS)

    St-Pierre, M.V.; Schwab, A.J.; Goresky, C.A.; Lee, W.F.; Pang, K.S.

    1989-01-01

    The technique of normal and retrograde rat liver perfusion has been widely used to probe zonal differences in drug-metabolizing activities. The validity of this approach mandates the same tissue spaces being accessed by substrates during both normal and retrograde perfusions. Using the multiple-indicator dilution technique, we presently examine the extent to which retrograde perfusion alters the spaces accessible to noneliminated references. A bolus dose of 51Cr-labeled red blood cells, 125I-albumin, 14C-sucrose and 3H2O was injected into the portal (normal) or hepatic (retrograde) vein of rat livers perfused at 10 ml per min per liver. The outflow perfusate was serially collected over 220 sec to characterize the transit times and the distribution spaces of the labels. During retrograde perfusion, red blood cells, albumin and sucrose profiles peaked later and lower than during normal perfusion, whereas the water curves were similar. The transit times of red blood cells, albumin and sucrose were longer (p less than 0.005), whereas those for water did not change. Consequently, retrograde flow resulted in significantly larger sinusoidal blood volumes (45%), albumin Disse space (42%) and sucrose Disse space (25%) than during normal flow, whereas the distribution spaces for total and intracellular water remained unaltered. The distension of the vascular tree was confirmed by electron microscopy, by which occasional isolated foci of widened intercellular recesses and spaces of Disse were observed. Cellular ultrastructure was otherwise unchanged, and there was no difference found between normal and retrograde perfusion for bile flow rates, AST release, perfusion pressure, oxygen consumption and metabolic removal of ethanol, a substrate with flow-limited distribution, which equilibrates rapidly with cell water (hepatic extraction ratios were virtually identical: normal vs. retrograde, 0.50 vs. 0.48 at 6 to 7.4 mM input concentration)

  20. Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

    Science.gov (United States)

    Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

    2017-06-03

    Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

  1. Quantitative perfusion imaging in magnetic resonance imaging

    International Nuclear Information System (INIS)

    Zoellner, F.G.; Gaa, T.; Zimmer, F.; Ong, M.M.; Riffel, P.; Hausmann, D.; Schoenberg, S.O.; Weis, M.

    2016-01-01

    Magnetic resonance imaging (MRI) is recognized for its superior tissue contrast while being non-invasive and free of ionizing radiation. Due to the development of new scanner hardware and fast imaging techniques during the last decades, access to tissue and organ functions became possible. One of these functional imaging techniques is perfusion imaging with which tissue perfusion and capillary permeability can be determined from dynamic imaging data. Perfusion imaging by MRI can be performed by two approaches, arterial spin labeling (ASL) and dynamic contrast-enhanced (DCE) MRI. While the first method uses magnetically labelled water protons in arterial blood as an endogenous tracer, the latter involves the injection of a contrast agent, usually gadolinium (Gd), as a tracer for calculating hemodynamic parameters. Studies have demonstrated the potential of perfusion MRI for diagnostics and also for therapy monitoring. The utilization and application of perfusion MRI are still restricted to specialized centers, such as university hospitals. A broad application of the technique has not yet been implemented. The MRI perfusion technique is a valuable tool that might come broadly available after implementation of standards on European and international levels. Such efforts are being promoted by the respective professional bodies. (orig.) [de

  2. Insulin degradation products from perfused rat kidney

    International Nuclear Information System (INIS)

    Duckworth, W.C.; Hamel, F.G.; Liepnieks, J.; Peavy, D.; Frank, B.; Rabkin, R.

    1989-01-01

    The kidney is a major site for insulin metabolism, but the enzymes involved and the products generated have not been established. To examine the products, we have perfused rat kidneys with insulin specifically iodinated on either the A14 or the B26 tyrosine. Labeled material from both the perfusate and kidney extract was examined by Sephadex G50 and high-performance liquid chromatography (HPLC). In perfusate from a filtering kidney, 22% of the insulin-sized material was not intact insulin on HPLC. With the nonfiltering kidney, 10.6% was not intact insulin. Labeled material from HPLC was sulfitolyzed and reinjected on HPLC. By use of 125 I-iodo(A14)-insulin, almost all the degradation products contained an intact A-chain. By use of 125 I-iodo(B26)-insulin, several different B-chain-cleaved products were obtained. The material extracted from the perfused kidney was different from perfusate products but similar to intracellular products from hepatocytes, suggesting that cellular metabolism by kidney and liver are similar. The major intracellular product had characteristics consistent with a cleavage between the B16 and B17 amino acids. This product and several of the perfusate products are also produced by insulin protease suggesting that this enzyme is involved in the degradation of insulin by kidney

  3. CT perfusion study of neck lymph nodes

    International Nuclear Information System (INIS)

    Zhong Jin; Liu Jun; Hua Rui; Qiao Hui; Gong Yi

    2011-01-01

    Objective: To study the CT perfusion features of various lymph nodes in the neck. Methods: Dynamic perfusion CT scanning was performed in 83 neck lymph nodes proved by pathology, including tuberculosis lymph nodes, lymphoma and metastatic lymph nodes. The shapes, blood flow modes, and perfusion parameters of these lymph nodes were compared among 3 groups. Statistical analysis of L/T and CT perfusion parameters was performed by one-way ANOVA and LSD test. Results: The values of MTT of tuberculosis lymph nodes, lymphoma and metastatic lymph nodes were (28.13±5.08), (31.08±5.82), and (11.24±5.31) s, respectively. The MTT of metastatic lymph nodes was statistically lower than that of tuberculosis lymph nodes and lymphoma (P -1 · 100 g -1 , respectively. The values of BV were (24.68±2.84), (25.30±3.16), and (25.15± 8.81) ml·100 g -1 respectively. The values of TTP were (40.90±8.85), (40.67±6.45), and (40.98±6.62) s, respectively. There were no significant differences in L/T, BF, BV and TTP among tuberculosis lymph nodes, lymphoma and metastatic lymph nodes (P>0.05). Conclusion: CT perfusion, especially combination functional imaging with perfusion images may be helpful in judging the nature of neck lymph nodes. (authors)

  4. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  5. Canine osteosarcoma cell lines contain stem-like cancer cells: biological and pharmacological characterization.

    Science.gov (United States)

    Gatti, Monica; Wurth, Roberto; Vito, Guendalina; Pattarozzi, Alessandra; Campanella, Chiara; Thellung, Stefano; Maniscalco, Lorella; De Maria, Raffaella; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Bajetto, Adriana; Ratto, Alessandra; Ferrari, Angelo; Barbieri, Federica; Florio, Tullio

    2016-05-01

    Cancer stem cells (CSCs) represent a small subpopulation of cells responsible for tumor formation and progression, drug resistance, tumor recurrence and metastasization. CSCs have been identified in many human tumors including osteosarcoma (OSA). CSC distinctive properties are the expression of stem cell markers, sustained growth, self-renewal and tumorigenicity. Here we report the isolation of stem-like cells from two canine OSA cultures, characterized by self-renewal, evaluated by sphere formation ability, differential marker expression, and in vitro proliferation when cultured in a medium containing EGF and bFGF. Current therapies for OSA increased survival time, but prognosis remains poor, due to the development of drug resistance and metastases. Chemotherapy shrinks the tumor mass but CSCs remain unaffected, leading to tumor recurrence. Metformin, a drug for type 2 diabetes, has been shown to possess antitumor properties affecting CSC survival in different human and animal cancers. Here we show that metformin has a significant antiproliferative effect on canine OSA stem-like cells, validating this in vitro model for further pre-clinical drug evaluations. In conclusion, our results demonstrate the feasibility of obtaining CSC-enriched cultures from primary canine OSA cells as a promising model for biological and pharmacological studies of canine and human OSAs.

  6. Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

    Science.gov (United States)

    Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

    2009-12-10

    Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

  7. Ex vivo perfusion of human spleens maintains clearing and processing functions.

    Science.gov (United States)

    Buffet, Pierre A; Milon, Geneviève; Brousse, Valentine; Correas, Jean-Michel; Dousset, Bertrand; Couvelard, Anne; Kianmanesh, Reza; Farges, Olivier; Sauvanet, Alain; Paye, François; Ungeheuer, Marie-Noëlle; Ottone, Catherine; Khun, Huot; Fiette, Laurence; Guigon, Ghislaine; Huerre, Michel; Mercereau-Puijalon, Odile; David, Peter H

    2006-05-01

    The spleen plays a central role in the pathophysiology of several potentially severe diseases such as inherited red cell membrane disorders, hemolytic anemias, and malaria. Research on these diseases is hampered by ethical constraints that limit human spleen tissue explorations. We identified a surgical situation--left splenopancreatectomy for benign pancreas tumors--allowing spleen retrieval at no risk for patients. Ex vivo perfusion of retrieved intact spleens for 4 to 6 hours maintained a preserved parenchymal structure, vascular flow, and metabolic activity. Function preservation was assessed by testing the ability of isolated-perfused spleens to retain Plasmodium falciparum-infected erythrocytes preexposed to the antimalarial drug artesunate (Art-iRBCs). More than 95% of Art-iRBCs were cleared from the perfusate in 2 hours. At each transit through isolated-perfused spleens, parasite remnants were removed from 0.2% to 0.23% of Art-iRBCs, a proportion consistent with the 0.02% to 1% pitting rate previously established in artesunate-treated patients. Histologic analysis showed that more than 90% of Art-iRBCs were retained and processed in the red pulp, providing the first direct evidence of a zone-dependent parasite clearance by the human spleen. Human-specific physiologic or pathophysiologic mechanisms involving clearing or processing functions of the spleen can now be experimentally explored in a human tissue context.

  8. Evaluation of post-vaccination immunity to canine distemper and ...

    African Journals Online (AJOL)

    SERVER

    2007-08-20

    Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

  9. Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.

    Science.gov (United States)

    Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S

    2016-04-01

    In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.

  10. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  11. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-09-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  12. Regional cortical hyper perfusion on perfusion CT during postical motor deficit: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Baik, Hye Jin [Dept. of Radiology, Haeundae Paik Hospital, Inje University College of Medicine, Busan (Korea, Republic of)

    2013-08-15

    Postictal neurologic deficit is a well-known complication mimicking the manifestation of a stroke. We present a case of a patient with clinical evidence of Todd's paralysis correlating with reversible postictal parenchymal changes on perfusion CT and magnetic resonance (MR) imaging. In this case, perfusion CT and MR imaging were helpful in the differential diagnosis of stroke-mimicking conditions.

  13. The Groningen hypothermic liver perfusion pump : Functional evaluation of a new machine perfusion system

    NARCIS (Netherlands)

    van der Plaats, A.; Maathuis, M. H. J.; Hart, N. A. 't; Bellekom, A. A.; Hofker, H. S.; van der Houwen, E. B.; Verkerke, G. J.; Leuvenink, H. G. D.; Verdonck, P.; Ploeg, R. J.; Rakhorst, G.

    2006-01-01

    To improve preservation of donor livers, we have developed a portable hypothermic machine perfusion (HMP) system as an alternative for static cold storage. A prototype of the system was built and evaluated on functionality. Evaluation criteria included 24 h of adequate pressure controlled perfusion,

  14. Effects of Steroid Hormones on Sex Differences in Cerebral Perfusion.

    Directory of Open Access Journals (Sweden)

    Carmen Ghisleni

    Full Text Available Sex differences in the brain appear to play an important role in the prevalence and progression of various neuropsychiatric disorders, but to date little is known about the cerebral mechanisms underlying these differences. One widely reported finding is that women demonstrate higher cerebral perfusion than men, but the underlying cause of this difference in perfusion is not known. This study investigated the putative role of steroid hormones such as oestradiol, testosterone, and dehydroepiandrosterone sulphate (DHEAS as underlying factors influencing cerebral perfusion. We acquired arterial spin labelling perfusion images of 36 healthy adult subjects (16 men, 20 women. Analyses on average whole brain perfusion levels included a multiple regression analysis to test for the relative impact of each hormone on the global perfusion. Additionally, voxel-based analyses were performed to investigate the sex difference in regional perfusion as well as the correlations between local perfusion and serum oestradiol, testosterone, and DHEAS concentrations. Our results replicated the known sex difference in perfusion, with women showing significantly higher global and regional perfusion. For the global perfusion, DHEAS was the only significant predictor amongst the steroid hormones, showing a strong negative correlation with cerebral perfusion. The voxel-based analyses revealed modest sex-dependent correlations between local perfusion and testosterone, in addition to a strong modulatory effect of DHEAS in cortical, subcortical, and cerebellar regions. We conclude that DHEAS in particular may play an important role as an underlying factor driving the difference in cerebral perfusion between men and women.

  15. Perfusion MRI in CNS disease: current concepts

    International Nuclear Information System (INIS)

    Essig, M.; Giesel, F.; Le-Huu, M.; Stieltjes, B.; Tengg, H. von; Weber, M.-A.

    2004-01-01

    Today there are several indications for cerebral perfusion MRI. The major indications routinely used in increasing numbers of imaging centers include cerebrovascular disease, tumor imaging and recently psychiatric disorders. Perfusion MRI is based on the injection of a gadolinium chelate and the rapid acquisition of images as the bolus of contrast agent passes through the blood vessels in the brain. The contrast agent causes a signal change; this signal change over time can be analysed to measure cerebral hemodynamics. The quality of brain perfusion studies is very dependent on the contrast agent used: a robust and strong signal decrease with a compact bolus is needed. MultiHance (gadobenate dimeglumine, Gd-BOPTA) is the first of a new class of paramagnetic MR contrast agents with a weak affinity for serum proteins. Due to the interaction of Gd-BOPTA with serum albumin, MultiHance presents with significantly higher T1- and T2-relaxivities enabling a sharper bolus profile. This article reviews the indications of perfusion MRI and the performance of MultiHance in MR perfusion of different diseases. Previous studies using perfusion MRI for a variety of purposes required the use of double dose of contrast agent to achieve a sufficiently large signal drop to enable the acquisition of a clear input function and the calculation of perfusion rCBV and rCBF maps of adequate quality. Recent studies with Multi-Hance suggest that only a single dose of this agent is needed to cause a signal drop of about 30% which is sufficient to allow the calculation of high quality rCBV and rCBF maps. (orig.)

  16. 9 CFR 113.317 - Parvovirus Vaccine (Canine).

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

  17. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

    Science.gov (United States)

    2010-01-01

    ... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

  18. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.

    1993-01-01

    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  19. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Boretti, Felicitos; Reusch, C.E.

    2010-01-01

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered ) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  20. Leishmania spp. Epidemiology of Canine Leishmaniasis in the Yucatan Peninsula

    Directory of Open Access Journals (Sweden)

    A. López-Céspedes

    2012-01-01

    Full Text Available Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico. A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  1. The first reported case of canine subcutaneous Cryptococcus flavescens infection.

    Science.gov (United States)

    Kano, Rui; Ishida, Rinei; Nakane, Shinsuke; Sekiguchi, Maiko; Hasegawa, Atsuhiko; Kamata, Hiroshi

    2012-03-01

    This report describes the first documented case of subcutaneous infection due to Cryptococcus flavescens in a dog. The chief symptoms of the patient dog were abscessed lesions on the dorsal muzzle, right eyelid, and lower jaw. Biopsy specimens from the lesions on the dorsal muzzle and lower jaw showed pyogranulomatous inflammation with numerous yeast cells. The patient dog was diagnosed with a subcutaneous fungal infection and orally received 5 mg/kg itraconazole once a day for 2 months, the abscesses disappeared. After 1 month at the end of treatment, the skin lesions did not redevelop. Isolates from the biopsy specimens were identified as C. flavescens by molecular analysis as well as morphologic and biochemical examination, indicating that C. flavescens is a potential canine pathogen.

  2. Leishmania spp. epidemiology of canine leishmaniasis in the Yucatan Peninsula.

    Science.gov (United States)

    López-Céspedes, A; Longoni, S S; Sauri-Arceo, C H; Sánchez-Moreno, M; Rodríguez-Vivas, R I; Escobedo-Ortegón, F J; Barrera-Pérez, M A; Bolio-González, M E; Marín, C

    2012-01-01

    Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico). A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  3. CANINE DISTEMPER IN A VACCINATED SNOW LEOPARD ( PANTHERA UNCIA).

    Science.gov (United States)

    Chinnadurai, Sathya K; Kinsel, Michael J; Adkesson, Michael J; Terio, Karen

    2017-12-01

    A 6-yr-old male snow leopard ( Panthera uncia) presented with acute seizures, hyperthermia, and tachypnea. Because of a diagnosis of anuric renal failure, the animal was euthanized. On histopathologic examination, numerous intralesional intracytoplasmic and intranuclear inclusions were found in the lungs, lymph nodes, and stomach. Positive immunohistochemical staining for canine distemper virus (CDV) was found in the lungs and, to a lesser extent, in the lymph nodes and brain. Molecular testing yielded a CDV H gene sequence that was closely related to CDV isolates concurrently found in wild raccoons from adjacent forested areas. The leopard had been vaccinated once against CDV with the use of a recombinant canarypox-vectored live vaccine during a routine wellness examination 12 wk prior to death. Serial serum neutralization titers performed on banked serum collected between vaccination and death showed poor serologic response to the vaccine. This case demonstrates a probable failure of protection against naturally occurring CDV.

  4. 31P-NMR studies on perfused mouse liver

    International Nuclear Information System (INIS)

    McLaughlin, A.C.; Takeda, H.; Chance, B.

    1978-01-01

    From a metabolic viewpoint, the most important organ in the body is the liver. In contrast to more specialized organs such as heart and kidney which perform only one major function, the liver performs a number of major metabolic functions. Two of the most important functions are the catabolism and storage of foodstuffs (in the form of glycogen) and the control of most of the constituents of the blood (in particular, the blood glucose level). Most of these functions are localized within a single type of cell. One way that the liver is able to regulate these diverse reactions is by the control of the ATP level in the cell. Encouraged by the recent success of many groups in using 31 P-NMR to provide a continuous and non-destructive monitor of ATP levels in isolated cells, skeletal muscle, and perfused organs such as heart and kidney, 31 P-NMR was used to investigate ATP levels in perfused liver of mice

  5. Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

    2011-09-01

    Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

  6. Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

    2012-08-01

    Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  7. Heterogeneity in stabilization phenomena in FLT PET images of canines

    International Nuclear Information System (INIS)

    Simoncic, Urban; Jeraj, Robert

    2014-01-01

    3'-( 18 F)fluoro-3'-deoxy-L-thymidine (FLT) is a PET marker of cellular proliferation. Its tissue uptake rate is often quantified with a Standardized Uptake Value (SUV), although kinetic analysis provides a more accurate quantification. The purpose of this study is to investigate the heterogeneity in FLT stabilization phenomena. The study was done on 15 canines with spontaneously occurring sinonasal tumours. They were imaged dynamically for 90 min with FLT PET/CT twice; before and during the radiotherapy. Images were analyzed for kinetics on a voxel basis through compartmental analysis. Stabilization curves were calculated as a time-dependant correlation between the time-dependant SUV and the kinetic parameters (voxel values within the tumour were correlated). Stabilization curves were analyzed for stabilization speed, maximal correlation and correlation decrease following the maximal correlation. These stabilization parameters were correlated with the region-averaged kinetic parameters. The FLT SUV was highly correlated with vasculature fraction immediately post-injection, followed by maximum in correlation with the perfusion/permeability. At later times post-injection the FLT SUV was highly correlated (Pearson correlation coefficient above 0.95) with the FLT influx parameter for cases with tumour-averaged SUV 30–50 min above 2, while others were indeterminate (correlation coefficients from 0.1 to 0.97). All cases with highly correlated SUV and FLT influx parameter had correlation coefficient within 0.5% of its maximum in the period of 30–50 min post-injection. Stabilization time was inversely proportional to the FLT influx rate. Correlation between the FLT SUV and FLT influx parameter dropped at later times post-injection with drop being proportional to the dephosphorylation rate. The FLT was found to be metabolically stable in canines. FLT PET imaging protocol should define minimal and maximal FLT uptake period, which would be 30–50

  8. Orthodontic Traction of Impacted Canine Using Cantilever

    Directory of Open Access Journals (Sweden)

    Cláudia Nakandakari

    2016-01-01

    Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

  9. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

    2014-01-01

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  10. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

    Science.gov (United States)

    Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

    2011-12-15

    Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. [An automatic system controlled by microcontroller for carotid sinus perfusion].

    Science.gov (United States)

    Yi, X L; Wang, M Y; Fan, Z Z; He, R R

    2001-08-01

    To establish a new method for controlling automatically the carotid perfusion pressure. A cheap practical automatic perfusion unit based on AT89C2051 micro controller was designed. The unit, LDB-M perfusion pump and the carotid sinus of an animal constituted an automatic perfusion system. This system was able to provide ramp and stepwise updown perfusion pattern and has been used in the research of baroreflex. It can insure the precision and reproducibility of perfusion pressure curve, and improve the technical level in corresponding medical field.

  12. Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

    Science.gov (United States)

    Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2006-01-01

    Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

  13. Myocardial perfusion imaging with dual energy CT

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Kwang Nam [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Radiology, SMG-SNU Boramae Medical Center, Seoul (Korea, Republic of); De Cecco, Carlo N. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Caruso, Damiano [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Radiological Sciences, Oncology and Pathology, University of Rome “Sapienza”, Rome (Italy); Tesche, Christian [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Cardiology and Intensive Care Medicine, Heart Center Munich-Bogenhausen, Munich (Germany); Spandorfer, Adam; Varga-Szemes, Akos [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Schoepf, U. Joseph, E-mail: schoepf@musc.edu [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Division of Cardiology, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States)

    2016-10-15

    Highlights: • Stress dual-energy sCTMPI offers the possibility to directly detect the presence of myocardial perfusion defects. • Stress dual-energy sCTMPI allows differentiating between reversible and fixed myocardial perfusion defects. • The combination of coronary CT angiography and dual-energy sCTMPI can improve the ability of CT to detect hemodynamically relevant coronary artery disease. - Abstract: Dual-energy CT (DECT) enables simultaneous use of two different tube voltages, thus different x-ray absorption characteristics are acquired in the same anatomic location with two different X-ray spectra. The various DECT techniques allow material decomposition and mapping of the iodine distribution within the myocardium. Static dual-energy myocardial perfusion imaging (sCTMPI) using pharmacological stress agents demonstrate myocardial ischemia by single snapshot images of myocardial iodine distribution. sCTMPI gives incremental values to coronary artery stenosis detected on coronary CT angiography (CCTA) by showing consequent reversible or fixed myocardial perfusion defects. The comprehensive acquisition of CCTA and sCTMPI offers extensive morphological and functional evaluation of coronary artery disease. Recent studies have revealed that dual-energy sCTMPI shows promising diagnostic accuracy for the detection of hemodynamically significant coronary artery disease compared to single-photon emission computed tomography, invasive coronary angiography, and cardiac MRI. The aim of this review is to present currently available DECT techniques for static myocardial perfusion imaging and recent clinical applications and ongoing investigations.

  14. Ultrasonographic description of canine mastitis.

    Science.gov (United States)

    Trasch, Katja; Wehrend, Axel; Bostedt, Hartwig

    2007-01-01

    Ultrasonographic images were acquired of the mammary glands of 40 bitches with physiologically lactating (n = 20) or inflamed glands (n = 20). Echogenicity, structure, homogeneity, thickness, and distinguishability of each tissue layer were assessed. Additionally, overall echogenicity was noted. In the normal lactating gland, different tissues could be differentiated easily. The parenchyma was, without exception, separated from adjacent tissues and was visible as medium echogenic tissue with a coarse-grained structure. The tissue always had some echogenic lines and anechoic areas and was slightly heterogeneous. The loss of distinct layering of the tissue was characteristic of an inflamed mammary gland and inflamed regions had reduced echogenicity. Additionally in five bitches with mastitis, the ultrasound examination was repeated five times for documentation of the progress of the illness and associated changes, supplemented with a color Doppler sonogram to assess changes in blood vessel density. Information from the examinations carried out via B-mode did not allow treatment success to be predicted. Two bitches with reduced blood vessel density centrally had a poor outcome whereas three bitches with increased blood vessel density had a good outcome. Thus, Doppler sonography might be a useful tool to obtain information of the prognosis in acute canine mastitis.

  15. Canine Intracranial Meningioma: Case report

    Directory of Open Access Journals (Sweden)

    José Ricardo Gomes de Carvalho

    2016-11-01

    Full Text Available ABSTRACT. Carvalho J.R.G., Vasconcellos C.H.C., Bastos I. P.B., Trajano F.L.C., Costa T.S. & Fernandes J.I [Canine Intracranial Meningioma: Case report.] Meningioma intracraniano canino: Relato de caso. Revista Brasileira de Medicina Veterinária, 38(supl. 3:1- 7, 2016. Programa de Pós-Graduação em Ciências Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465 Km 7, Seropédica, RJ 23.897-000, Brasil, E-mail: vetjulio@yahoo.com.br Intracranial neoplasms usually show their signals in a moderate way, revealing a long background of nonspecific signs, making the diagnosis more difficult. The meningioma is the most common intracranial neoplasm in dogs and cats. Along the years, the Veterinary Medicine has experienced important technological improvements, making it possible the diagnosis of a lot of diseases. Therefore, diseases considered not common in the past, started being diagnosed more frequently, for instance, brain lesions. The objective of this research is to report a case of intracranial meningioma in a Boxer dog that arrived at the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, highlighting its clinical improvement, diagnosis and treatment.

  16. Standardized perfusion value of the esophageal carcinoma and its correlation with quantitative CT perfusion parameter values

    Energy Technology Data Exchange (ETDEWEB)

    Djuric-Stefanovic, A., E-mail: avstefan@eunet.rs [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Unit of Digestive Radiology (First University Surgical Clinic), Center of Radiology and MR, Clinical Center of Serbia, Belgrade (Serbia); Saranovic, Dj., E-mail: crvzve4@gmail.com [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Unit of Digestive Radiology (First University Surgical Clinic), Center of Radiology and MR, Clinical Center of Serbia, Belgrade (Serbia); Sobic-Saranovic, D., E-mail: dsobic2@gmail.com [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Center of Nuclear Medicine, Clinical Center of Serbia, Belgrade (Serbia); Masulovic, D., E-mail: draganmasulovic@yahoo.com [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Unit of Digestive Radiology (First University Surgical Clinic), Center of Radiology and MR, Clinical Center of Serbia, Belgrade (Serbia); Artiko, V., E-mail: veraart@beotel.rs [Faculty of Medicine, University of Belgrade, Belgrade (Serbia); Center of Nuclear Medicine, Clinical Center of Serbia, Belgrade (Serbia)

    2015-03-15

    Purpose: Standardized perfusion value (SPV) is a universal indicator of tissue perfusion, normalized to the whole-body perfusion, which was proposed to simplify, unify and allow the interchangeability among the perfusion measurements and comparison between the tumor perfusion and metabolism. The aims of our study were to assess the standardized perfusion value (SPV) of the esophageal carcinoma, and its correlation with quantitative CT perfusion measurements: blood flow (BF), blood volume (BV), mean transit time (MTT) and permeability surface area product (PS) of the same tumor volume samples, which were obtained by deconvolution-based CT perfusion analysis. Methods: Forty CT perfusion studies of the esophageal cancer were analyzed, using the commercial deconvolution-based CT perfusion software (Perfusion 3.0, GE Healthcare). The SPV of the esophageal tumor and neighboring skeletal muscle were correlated with the corresponding mean tumor and muscle quantitative CT perfusion parameter values, using Spearman's rank correlation coefficient (r{sub S}). Results: Median SPV of the esophageal carcinoma (7.1; range: 2.8–13.4) significantly differed from the SPV of the skeletal muscle (median: 1.0; range: 0.4–2.4), (Z = −5.511, p < 0.001). The cut-off value of the SPV of 2.5 enabled discrimination of esophageal cancer from the skeletal muscle with sensitivity and specificity of 100%. SPV of the esophageal carcinoma significantly correlated with corresponding tumor BF (r{sub S} = 0.484, p = 0.002), BV (r{sub S} = 0.637, p < 0.001) and PS (r{sub S} = 0.432, p = 0.005), and SPV of the skeletal muscle significantly correlated with corresponding muscle BF (r{sub S} = 0.573, p < 0.001), BV (r{sub S} = 0.849, p < 0.001) and PS (r{sub S} = 0.761, p < 0.001). Conclusions: We presented a database of the SPV for the esophageal cancer and proved that SPV of the esophageal neoplasm significantly differs from the SPV of the skeletal muscle, which represented a sample of healthy

  17. Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2008-04-15

    Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion.

  18. Changes in Maxillary Canine Pulpal Blood Flow During Dentoalveolar Distraction Osteogenesis.

    Science.gov (United States)

    Ersahan, Seyda; Sabuncuoglu, Fidan Alakus

    2016-05-01

    The aim of this study was to assess the effects of dentoalveolar distraction osteogenesis (DD) on the pulpal blood flow (PBF) of maxillary canines. A laser Doppler flowmeter (LDF) was used to measure PBF in maxillary canines of 10 patients undergoing DD (study group) and 10 nonsurgical subjects who received no orthodontic treatment (control group). PBF was measured at baseline, at 4 and 7 days postoperatively, at the end of distraction and at the end of consolidation in the study group and at similar time-points in nonsurgical control subjects. Data were analyzed using paired and Student t tests, with the significance level set at 0.05. Study findings showed that baseline PBF values did not differ significantly between groups. PBF in the control group did not vary over time; however, in the study group, an initial decrease in PBF was observed at 4 days postoperatively and was followed by a gradual increase to preoperative levels at the end of distraction. During the DD latency period, there appears to be a short-lived ischemic phase when perfusion of pulp tissue declines; however, blood-flow returns to normal by the end of distraction.

  19. Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model

    International Nuclear Information System (INIS)

    Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo

    2008-01-01

    Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion

  20. Interventional model establishment and computed tomography perfusion imaging for early diagnosis of acute cerebral infarction in dogs

    International Nuclear Information System (INIS)

    Shi Haibin; Liu Sheng; Ji Libiao; Li Lingsun; Huang Jun

    2005-01-01

    Objective: To establish interventionally a new canine model of focal cerebral infarction suitable to the study of imaging diagnosis and thrombolytic therapy, and to evaluate the application of computed tomography perfusion (CTP) in super acute ischemic cerebrovascular disease. Methods: Ten beagle adult dogs with self white thrombi of venous blood, injected into the left internal carotid arteries through 4F headhunter catheter selectively were created under fluoroscopic guidance. The cerebral angiography was performed before and after the embolization and the patency of the occluded cerebral arteries was observed with angiography at 1, 2 and 5 hours after the procedure. The CTP was performed at 2 hours after embolization. These dogs were sacrificed and their cerebra were taken out for pathologic study at 24th hour. Results: The occlusions of middle cerebral artery were shown angiographically in all 10 dogs with additional other cerebral arteries occlusion in 4. All occluded arteries were not recanalized at 2 hours after embolization, but the occluded arteries of 2 canines were partly recanalized at 5 hours. The regional cerebral blood flow (rCBF) was decreased to 48.3% ± 13.2% (33.7%-69.2%) in CTP of 9 canines showing no significant difference between digital subtraction angiography (DSA) and CTP (P>0.05). All dogs were survived at 24 hours without any severe complications. The cerebral infarction was found in deep part of cerebrum of all dogs. Conclusions: The establishment of acute cerebral infarction model in dogs with interventional technique is simple, micro invasive and reliable, for investigating CTP as a fast, accurate and no invasive method in evaluating the canine super acute ischemic cerebrovascular disease. (authors)

  1. Early canine plaque biofilms: characterization of key bacterial interactions involved in initial colonization of enamel.

    Directory of Open Access Journals (Sweden)

    Lucy J Holcombe

    Full Text Available Periodontal disease (PD is a significant problem in dogs affecting between 44% and 63.6% of the population. The main etiological agent for PD is plaque, a microbial biofilm that colonizes teeth and causes inflammation of the gingiva. Understanding how this biofilm initiates on the tooth surface is of central importance in developing interventions against PD. Although the stages of plaque development on human teeth have been well characterized little is known about how canine plaque develops. Recent studies of the canine oral microbiome have revealed distinct differences between the canine and human oral environments and the bacterial communities they support, particularly with respect to healthy plaque. These differences mean knowledge about the nature of plaque formation in humans may not be directly translatable to dogs. The aim of this study was to identify the bacterial species important in the early stages of canine plaque formation in vivo and then use isolates of these species in a laboratory biofilm model to develop an understanding of the sequential processes which take place during the initial colonization of enamel. Supra-gingival plaque samples were collected from 12 dogs at 24 and 48 hour time points following a full mouth descale and polish. Pyrosequencing of the 16S rDNA identified 134 operational taxonomic units after statistical analysis. The species with the highest relative abundance were Bergeyella zoohelcum, Neisseria shayeganii and a Moraxella species. Streptococcal species, which tend to dominate early human plaque biofilms, had very low relative abundance. In vitro testing of biofilm formation identified five primary colonizer species, three of which belonged to the genus Neisseria. Using these pioneer bacteria as a starting point, viable two and three species communities were developed. Combining in vivo and in vitro data has led us to construct novel models of how the early canine plaque biofilm develops.

  2. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F

    2011-01-01

    Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  3. Cyclooxygenase-2-dependent bronchoconstriction in perfused rat lungs exposed to endotoxin.

    OpenAIRE

    Uhlig, S.; Nüsing, R.; von Bethmann, A.; Featherstone, R. L.; Klein, T.; Brasch, F.; Müller, K. M.; Ullrich, V.; Wendel, A.

    1996-01-01

    BACKGROUND: Lipopolysaccharides (LPS), widely used to study the mechanisms of gram-negative sepsis, increase airway resistance by constriction of terminal bronchioles. The role of the cyclooxygenase (COX) isoenzymes and their prostanoid metabolites in this process was studied. MATERIALS AND METHODS: Pulmonary resistance, the release of thromboxane (TX) and the expression of COX-2 mRNA were measured in isolated blood-free perfused rat lungs exposed to LPS. RESULTS: LPS induced the release of T...

  4. Dynamic perfusion patterns in temporal lobe epilepsy

    International Nuclear Information System (INIS)

    Dupont, Patrick; Paesschen, Wim van; Zaknun, John J.; Maes, Alex; Tepmongkol, Supatporn; Locharernkul, Chaichon; Vasquez, Silvia; Carpintiero, Silvina; Bal, C.S.; Dondi, Maurizio

    2009-01-01

    To investigate dynamic ictal perfusion changes during temporal lobe epilepsy (TLE). We investigated 37 patients with TLE by ictal and interictal SPECT. All ictal injections were performed within 60 s of seizure onset. Statistical parametric mapping was used to analyse brain perfusion changes and temporal relationships with injection time and seizure duration as covariates. The analysis revealed significant ictal hyperperfusion in the ipsilateral temporal lobe extending to subcortical regions. Hypoperfusion was observed in large extratemporal areas. There were also significant dynamic changes in several extratemporal regions: ipsilateral orbitofrontal and bilateral superior frontal gyri and the contralateral cerebellum and ipsilateral striatum. The study demonstrated early dynamic perfusion changes in extratemporal regions probably involved in both propagation of epileptic activity and initiation of inhibitory mechanisms. (orig.)

  5. Dynamic perfusion patterns in temporal lobe epilepsy

    Energy Technology Data Exchange (ETDEWEB)

    Dupont, Patrick; Paesschen, Wim van [KU Leuven/UZ Gasthuisberg, Nuclear Medicine, Medical Imaging Center and Neurology, Leuven (Belgium); Zaknun, John J. [International Atomic Energy Agency (IAEA), Nuclear Medicine Section, Division of Human Health, Wagramer Strasse 5, PO BOX 200, Vienna (Austria); University Hospital of Innsbruck, Department of Nuclear Medicine, Innsbruck (Austria); Maes, Alex [KU Leuven/UZ Gasthuisberg, Nuclear Medicine, Medical Imaging Center and Neurology, Leuven (Belgium); AZ Groeninge, Nuclear Medicine, Kortrijk (Belgium); Tepmongkol, Supatporn; Locharernkul, Chaichon [Chulalongkorn University, Nuclear Medicine and Neurology, Bangkok (Thailand); Vasquez, Silvia; Carpintiero, Silvina [Fleni Instituto de Investigaciones Neurologicas, Nuclear Medicine, Buenos Aires (Argentina); Bal, C.S. [All India Institute of Medical Sciences, Nuclear Medicine, New Delhi (India); Dondi, Maurizio [International Atomic Energy Agency (IAEA), Nuclear Medicine Section, Division of Human Health, Wagramer Strasse 5, PO BOX 200, Vienna (Austria); Ospedale Maggiore, Nuclear Medicine, Bologna (Italy)

    2009-05-15

    To investigate dynamic ictal perfusion changes during temporal lobe epilepsy (TLE). We investigated 37 patients with TLE by ictal and interictal SPECT. All ictal injections were performed within 60 s of seizure onset. Statistical parametric mapping was used to analyse brain perfusion changes and temporal relationships with injection time and seizure duration as covariates. The analysis revealed significant ictal hyperperfusion in the ipsilateral temporal lobe extending to subcortical regions. Hypoperfusion was observed in large extratemporal areas. There were also significant dynamic changes in several extratemporal regions: ipsilateral orbitofrontal and bilateral superior frontal gyri and the contralateral cerebellum and ipsilateral striatum. The study demonstrated early dynamic perfusion changes in extratemporal regions probably involved in both propagation of epileptic activity and initiation of inhibitory mechanisms. (orig.)

  6. Cardiac tissue engineering using perfusion bioreactor systems

    Science.gov (United States)

    Radisic, Milica; Marsano, Anna; Maidhof, Robert; Wang, Yadong; Vunjak-Novakovic, Gordana

    2009-01-01

    This protocol describes tissue engineering of synchronously contractile cardiac constructs by culturing cardiac cell populations on porous scaffolds (in some cases with an array of channels) and bioreactors with perfusion of culture medium (in some cases supplemented with an oxygen carrier). The overall approach is ‘biomimetic’ in nature as it tends to provide in vivo-like oxygen supply to cultured cells and thereby overcome inherent limitations of diffusional transport in conventional culture systems. In order to mimic the capillary network, cells are cultured on channeled elastomer scaffolds that are perfused with culture medium that can contain oxygen carriers. The overall protocol takes 2–4 weeks, including assembly of the perfusion systems, preparation of scaffolds, cell seeding and cultivation, and on-line and end-point assessment methods. This model is well suited for a wide range of cardiac tissue engineering applications, including the use of human stem cells, and high-fidelity models for biological research. PMID:18388955

  7. Studies on manifestations of canine distemper virus infection in an urban dog population.

    Science.gov (United States)

    Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P

    1993-10-01

    An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.

  8. Bioeffects of albumin-encapsulated microbubbles and real-time myocardial contrast echocardiography in an experimental canine model

    Directory of Open Access Journals (Sweden)

    P.M.M. Dourado

    2006-06-01

    Full Text Available Myocardial contrast echocardiography has been used for assessing myocardial perfusion. Some concerns regarding its safety still remain, mainly regarding the induction of microvascular alterations. We sought to determine the bioeffects of microbubbles and real-time myocardial contrast echocardiography (RTMCE in a closed-chest canine model. Eighteen mongrel dogs were randomly assigned to two groups. Nine were submitted to continuous intravenous infusion of perfluorocarbon-exposed sonicated dextrose albumin (PESDA plus continuous imaging using power pulse inversion RTMCE for 180 min, associated with manually deflagrated high-mechanical index impulses. The control group consisted of 3 dogs submitted to continuous imaging using RTMCE without PESDA, 3 dogs received PESDA alone, and 3 dogs were sham-operated. Hemodynamics and cardiac rhythm were monitored continuously. Histological analysis was performed on cardiac and pulmonary tissues. No hemodynamic changes or cardiac arrhythmias were observed in any group. Normal left ventricular ejection fraction and myocardial perfusion were maintained throughout the protocol. Frequency of mild and focal microhemorrhage areas in myocardial and pulmonary tissue was similar in PESDA plus RTMCE and control groups. The percentages of positive microscopical fields in the myocardium were 0.4 and 0.7% (P = NS in the PESDA plus RTMCE and control groups, respectively, and in the lungs they were 2.1 and 1.1%, respectively (P = NS. In this canine model, myocardial perfusion imaging obtained with PESDA and RTMCE was safe, with no alteration in cardiac rhythm or left ventricular function. Mild and focal myocardial and pulmonary microhemorrhages were observed in both groups, and may be attributed to surgical tissue manipulation.

  9. Epidemiology of canine distemper virus in wild raccoon dogs (Nyctereutes procyonoides) from South Korea.

    Science.gov (United States)

    Cha, Se-Yeoun; Kim, Eun-Ju; Kang, Min; Jang, Sang-Ho; Lee, Hae-Beom; Jang, Hyung-Kwan

    2012-09-01

    Raccoon dogs (Nyctereutes procyonoides) are widespread and common in South Korea. In 2011, we obtained serum samples from 102 wild raccoon dogs to survey their exposure to canine distemper virus (CDV). Forty-five of the 102 animals (44.1%) were seropositive. Field cases of canine distemper in wild raccoon dogs from 2010 to 2011 were investigated. Fourteen cases of CDV infection were identified by a commercially available CDV antigen detection kit. These cases were used for virus isolation and molecular analysis. Sequence analysis of hemagglutinin genes indicated that all viruses isolated belonged to the Asia-2 genotype. H protein residues which are related to the receptor and host specificity (residues 530 and 549) were analyzed. A glutamic acid (E) residue is present at 530 in all isolates. At 549, a histidine (H) residue was found in five isolates and tyrosine (Y) residue was found in 6 isolates. Our study demonstrated that CDV infection was widespread in wild raccoon dogs in South Korea. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Optimization of perfusion studies using Atropine

    International Nuclear Information System (INIS)

    Alvarado, A.N.; Valle, V.M.; Montoya, M.J.; Eskenazi, E.S.; Montiel, M.L.; Cueto, C.C.

    2002-01-01

    The studies of myocardial perfusion require an adequate stress; exercise or pharmacological. Every day, more pharmacological studies are performed, specially in some group of patients (women, AMI, etc). There some drugs that are used for this purpose, as adenosine and dobutamine. However, their cost and the lack of availability and infrastructure in our country do not allow there routinely use. We performed dipyridamol as a pharmacological stress, however in some patients there is a doubt regarding if the pharmacological effect was adequate. Atropine is a drug that is frequently used for different purpose and it is well know its tachycardic response. We present and alternative technique, using dipyridamol-atropine as a protocol of stress perfusion study. Our goal was to correlate the standard dipyridamol -thallium perfusion study and the dipyridamol -atropine-perfusion in patients with chronic coronary disease. We evaluated 6 patients (5 males) with stable angina and chronic coronary disease. A standard dipyridamol-thallium study was performed in all of them. Dipyridamole was administered intravenously at a rate of 0.14 mg/kg/min over 6 min for a total of 0.84 mg/kg body weight. Blood pressure, heart rate, EKG and symptoms were monitored before, during and after the pharmacological infusion. Two minutes after the infusion was completed, the radiotracer was injected intravenously. In the next 6 months, without any modification of the clinical situation (symptoms and therapy) a new dipyridamol study was performed, using 1 mg of atropine after the administration of dipyridamol. There were no differences in the collateral effects and we observed and average increase of 30% in the heart rate in relation with the study using dipyridamol alone. The addition of atropine to the standard dipyridamol perfusion study is safe, cheaper and improved the detection of perfusion defects in patients with coronary artery disease

  11. Cerebral perfusion imaging in HIV positive patients

    International Nuclear Information System (INIS)

    Kundley, Kshama; Chowdhury, D.; Lele, V.R.; Lele, R.D.

    1998-01-01

    Full text: Twelve human immunodeficiency virus (HIV) positive patients were studied by SPECT cerebral perfusion imaging 1 hour post injection of 15 mCi of 99m Tc-ECD under ideal conditions with a triple head gamma camera (Prism 3000 X P LEUHR), fanbeam collimators followed by Folstein Mini Mental Status Examination (FMMSE) and AIDS dementia complex (ADC) staging on the same day. All 12 patients were male, in the age range of 23-45 y (mean 31 y). The infected status was diagnosed by ELISA (10 patients) or Western blot (5 patients). The interval between diagnosis and imaging ranged from 1 month - 35 months (mean 15.3 months). Two patients were alcoholic and 2 were smokers. None of them had CNS disorder clinically. ADC staging and FMMSE could be performed in 4 patients. Two patients were normal (stage 0) and 2 were subclinical (stage 0.5) on ADC staging. FMMSE revealed normal or near normal status (mean score 35; maximum score 36). Cerebral perfusion images were interpreted simultaneously by 3 observers blind towards history and examination using semi-quantitative and quantitative methods by consensus. It revealed multiple areas of hypoperfusion, viz. temporal (11 patients (91 %), parietal 10 patients (83%), frontal 9 patients (75%, pre and post central gyrus 7 patients (58%), occipital 6 patients (50%) cingulate gyrus and cerebellum 5 patients (41%) and thalamic in 2 patients (16%). Hyper perfusion in caudate nuclei was noted in 10 patients (83%). The study reveals presence of multiple perfusion abnormalities on cerebral perfusion imaging in HIV positive patients who have normal/near normal mental status suggesting precedence of perfusion abnormality over clinically apparent mental deficit

  12. Genetics of Human and Canine Dilated Cardiomyopathy

    OpenAIRE

    Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

  13. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Capik, I.; Ledecky, V.; Sevcik, A.

    2001-01-01

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  14. Abnormal perfusion on myocardial perfusion SPECT in patients with Wolff-Parkinson-White syndrome

    International Nuclear Information System (INIS)

    Kang, Do Young; Cha, Kwang Soo; Han, Seung Ho; Park, Tae Ho; Kim, Moo Hyun; Kim, Young Dae

    2005-01-01

    Abnormal myocardial perfusion may be caused by ventricular preexcitation, but its location, extent, severity and correlation with accessory pathway (AP) are not established. We evaluated perfusion patterns on myocardial perfusion SPECT and location of AP in patients with WPW (Wolff-Parkison-White) syndrome. Adenosine Tc-99m MIBI or Tl-201 myocardial perfusion SPECT was performed in 11 patients with WPW syndrome. Perfusion defects (PD) were compared to AP location based on ECT with Fitzpatrick's algorithm of electrophysiologic study and radiofrequency catheter ablation. Patients had atypical chest discomfort or no symptom. Risk of coronary artery disease (CAD) was below 0.1 in 11 patients using the nomogram to estimate the probability of CAD. Coronary angiography was performed in 4 patients(mid-LAD 50% in one, normal in others). In 4 patients, AP localization was done by electrophysiologic study and radiofrequency catheter ablation (RFCA). Small to large extent (11.0 ± 8.5%, range:3 ∼ 35%) and mild to moderate severity (-71 ± 42.7%, range:-217 ∼ -39%) of reversible (n=9) or fixed (n=1) perfusion defects were noted. One patients with right free wall (right lateral) AP showed normal. PD locations were variable following the location of AP. One patient with left lateral wall AP was followed 6 weeks after RFCA and showed significantly decreased PD on SPECT with successful ablation. Myocardial perfusion defect showed variable extent, severity and location in patients with WPW syndrome. Abnormal perfusion defect showed in most of all patients, but if did not seem to be correlated specifically with location of accessory pathway and coronary artery disease. Therefore myocardial perfusion SPECT should be interpreted carefully in patients with WPW syndrome

  15. Abnormal perfusion on myocardial perfusion SPECT in patients with Wolff-Parkinson-White syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Do Young; Cha, Kwang Soo; Han, Seung Ho; Park, Tae Ho; Kim, Moo Hyun; Kim, Young Dae [Donga University College of Medicine, Busan (Korea, Republic of)

    2005-02-15

    Abnormal myocardial perfusion may be caused by ventricular preexcitation, but its location, extent, severity and correlation with accessory pathway (AP) are not established. We evaluated perfusion patterns on myocardial perfusion SPECT and location of AP in patients with WPW (Wolff-Parkison-White) syndrome. Adenosine Tc-99m MIBI or Tl-201 myocardial perfusion SPECT was performed in 11 patients with WPW syndrome. Perfusion defects (PD) were compared to AP location based on ECT with Fitzpatrick's algorithm of electrophysiologic study and radiofrequency catheter ablation. Patients had atypical chest discomfort or no symptom. Risk of coronary artery disease (CAD) was below 0.1 in 11 patients using the nomogram to estimate the probability of CAD. Coronary angiography was performed in 4 patients(mid-LAD 50% in one, normal in others). In 4 patients, AP localization was done by electrophysiologic study and radiofrequency catheter ablation (RFCA). Small to large extent (11.0 {+-} 8.5%, range:3 {approx} 35%) and mild to moderate severity (-71 {+-} 42.7%, range:-217 {approx} -39%) of reversible (n=9) or fixed (n=1) perfusion defects were noted. One patients with right free wall (right lateral) AP showed normal. PD locations were variable following the location of AP. One patient with left lateral wall AP was followed 6 weeks after RFCA and showed significantly decreased PD on SPECT with successful ablation. Myocardial perfusion defect showed variable extent, severity and location in patients with WPW syndrome. Abnormal perfusion defect showed in most of all patients, but if did not seem to be correlated specifically with location of accessory pathway and coronary artery disease. Therefore myocardial perfusion SPECT should be interpreted carefully in patients with WPW syndrome.

  16. Reliability of mandibular canines as indicators for sexual dichotomy.

    Science.gov (United States)

    Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

    2013-02-01

    Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

  17. Meta-Analysis of Stress Myocardial Perfusion Imaging

    Science.gov (United States)

    2017-06-06

    Coronary Disease; Echocardiography; Fractional Flow Reserve, Myocardial; Hemodynamics; Humans; Magnetic Resonance Imaging; Myocardial Perfusion Imaging; Perfusion; Predictive Value of Tests; Single Photon Emission Computed Tomography; Positron Emission Tomography; Multidetector Computed Tomography; Echocardiography, Stress; Coronary Angiography

  18. Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.

    Directory of Open Access Journals (Sweden)

    Nicola Decaro

    Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.

  19. In vitro evaluation of three different biomaterials as scaffolds for canine mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    Oduvaldo Câmara Marques Pereira-Junior

    2013-05-01

    Full Text Available PURPOSE: To evaluate in vitro ability the of three different biomaterials - purified hydroxyapatite, demineralized bone matrix and castor oil-based polyurethane - as biocompatible 3D scaffolds for canine bone marrow mesenchymal stem cell (MSC intending bone tissue engineering. METHODS: MSCs were isolated from canine bone marrow, characterized and cultivated for seven days with the biomaterials. Cell proliferation and adhesion to the biomaterial surface were evaluated by scanning electron microscopy while differentiation into osteogenic lineage was evaluated by Alizarin Red staining and Sp7/Osterix surface antibody marker. RESULTS: The biomaterials allowed cellular growth, attachment and proliferation. Osteogenic differentiation occurred in the presence of hydroxyapatite, and matrix deposition commenced in the presence of the castor oil-based polyurethane. CONCLUSION: All the tested biomaterials may be used as mesenchymal stem cell scaffolds in cell-based orthopedic reconstructive therapy.

  20. Global gene expression analysis of canine osteosarcoma stem cells reveals a novel role for COX-2 in tumour initiation.

    Science.gov (United States)

    Pang, Lisa Y; Gatenby, Emma L; Kamida, Ayako; Whitelaw, Bruce A; Hupp, Ted R; Argyle, David J

    2014-01-01

    Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs), which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05), and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.

  1. Global gene expression analysis of canine osteosarcoma stem cells reveals a novel role for COX-2 in tumour initiation.

    Directory of Open Access Journals (Sweden)

    Lisa Y Pang

    Full Text Available Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs, which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05, and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.

  2. Improved visualization of delayed perfusion in lung MRI

    International Nuclear Information System (INIS)

    Risse, Frank; Eichinger, Monika; Kauczor, Hans-Ulrich; Semmler, Wolfhard; Puderbach, Michael

    2011-01-01

    Introduction: The investigation of pulmonary perfusion by three-dimensional (3D) dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) was proposed recently. Subtraction images are generated for clinical evaluation, but temporal information is lost and perfusion defects might therefore be masked in this process. The aim of this study is to demonstrate a simple analysis strategy and classification for 3D-DCE-MRI perfusion datasets in the lung without omitting the temporal information. Materials and methods: Pulmonary perfusion measurements were performed in patients with different lung diseases using a 1.5 T MR-scanner with a time-resolved 3D-GRE pulse sequence. 25 3D-volumes were acquired after iv-injection of 0.1 mmol/kg KG Gadolinium-DTPA. Three parameters were determined for each pixel: (1) peak enhancement S n,max normalized to the arterial input function to detect regions of reduced perfusion; (2) time between arterial peak enhancement in the large pulmonary artery and tissue peak enhancement τ to visualize regions with delayed bolus onset; and (3) ratio R = S n,max /τ was calculated to visualize impaired perfusion, irrespectively of whether related to reduced or delayed perfusion. Results: A manual selection of peak perfusion images is not required. Five different types of perfusion can be found: (1) normal perfusion; (2) delayed non-reduced perfusion; (3) reduced non-delayed perfusion; (4) reduced and delayed perfusion; and (5) no perfusion. Types II and IV could not be seen in subtraction images since the temporal information is necessary for this purpose. Conclusions: The analysis strategy in this study allows for a simple and observer-independent visualization and classification of impaired perfusion in dynamic contrast-enhanced pulmonary perfusion MRI by using the temporal information of the datasets.

  3. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

    Science.gov (United States)

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  4. Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

    Science.gov (United States)

    1981-06-05

    anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

  5. Evaluation of mRNA expression levels and electrophysiological function of neuron-like cells derived from canine bone marrow stromal cells.

    Science.gov (United States)

    Nakano, Rei; Edamura, Kazuya; Sugiya, Hiroshi; Narita, Takanori; Okabayashi, Ken; Moritomo, Tadaaki; Teshima, Kenji; Asano, Kazushi; Nakayama, Tomohiro

    2013-10-01

    To investigate the in vitro differentiation of canine bone marrow stromal cells (BMSCs) into functional, mature neurons. Bone marrow from 6 adult dogs. BMSCs were isolated from bone marrow and chemically induced to develop into neurons. The morphology of the BMSCs during neuronal induction was monitored, and immunocytochemical analyses for neuron markers were performed after the induction. Real-time PCR methods were used to evaluate the mRNA expression levels of markers for neural stem or progenitor cells, neurons, and ion channels, and western blotting was used to assess the expression of neuronal proteins before and after neuronal induction. The electrophysiological properties of the neuron-like cells induced from canine BMSCs were evaluated with fluorescent dye to monitor Ca(2)+ influx. Canine BMSCs developed a neuron-like morphology after neuronal induction. Immunocytochemical analysis revealed that these neuron-like cells were positive for neuron markers. After induction, the cells' mRNA expression levels of almost all neuron and ion channel markers increased, and the protein expression levels of nestin and neurofilament-L increased significantly. However, the neuron-like cells derived from canine BMSCs did not have the Ca(2)+ influx characteristic of spiking neurons. Although canine BMSCs had neuron-like morphological and biochemical properties after induction, they did not develop the electrophysiological characteristics of neurons. Thus, these results have suggested that canine BMSCs could have the capacity to differentiate into a neuronal lineage, but the differentiation protocol used may have been insufficient to induce development into functional neurons.

  6. Automatic Detection of Myocardial Boundaries in MR Cardio Perfusion Images

    NARCIS (Netherlands)

    Spreeuwers, Luuk; Breeuwer, Marcel

    2001-01-01

    Cardiovascular diseases often result in reduced blood perfusion of the myocardium (MC). Recent advances in MR allow fast recordingof contrast enhanced myocardial perfusion scans. For perfusion analysis the myocardial boundaries must be traced. Currently this is done manually. In this paper a method

  7. An experimental in-vivo canine model for adult shunt infection

    Directory of Open Access Journals (Sweden)

    Procop Gary

    2008-10-01

    Full Text Available Abstract Background Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional "human" shunts, and that a shunt infection could be established so that further studies could then be planned. Methods Hydrocephalus was induced in seven dogs (Canis familiaris by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison. Results All the dogs remained well after shunting. Examination of removed shunt components revealed S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three "negative" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source. Conclusion Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection.

  8. Distribution of coronary arterial capacitance in a canine model.

    Science.gov (United States)

    Lader, A S; Smith, R S; Phillips, G C; McNamee, J E; Abel, F L

    1998-03-01

    The capacitative properties of the major left coronary arteries, left main (LM), left anterior descending (LAD), and left circumflex (LCX), were studied in 19 open-chest isolated dog hearts. Capacitance was determined by using ramp perfusion and a left ventricular-to-coronary shunt diastolic decay method; both methods gave similar results, indicating a minimal systolic capacitative component. Increased pericardial pressure (PCP), 25 mmHg, was used to experimentally alter transmural wall pressure. The response to increased PCP was different in the LAD vs. LCX; increasing PCP decreased capacitance in the LCX but increased capacitance in the LAD. This may have been due to the different intramural vs. epicardial volume distribution of these vessels and a decrease in intramural tension during increased PCP. Increased PCP decreased LCX capacitance by approximately 13%, but no changes in conductance or zero flow pressure intercept occurred in any of the three vessels, i. e., evidence against the waterfall theory of vascular collapse at these levels of PCP. Coronary arterial capacitance was also linearly related to perfusion pressure.

  9. Myocardial perfusion scintigraphy in the detection of silent ischemia in asymptomatic diabetic patients

    Energy Technology Data Exchange (ETDEWEB)

    Oki, Glaucia Celeste Rossatto [Clinica Diagnoson and Hospital Aristides Maltez, Salvador, BA (Brazil). Servicos de Medicina Nuclear; Pavin, Elizabeth Joao; Parisi, Maria Candida R. [Universidade Estadual de Campinas (Unicamp), Campinas, SP (Brazil). Department of Internal Medicine. Service of Endocrinology; Coelho, Otavio Rizzi; Almeida, Raitany C. [Universidade Estadual de Campinas (Unicamp), Campinas, SP (Brazil). Department of Internal Medicine. Service of Cardiology; Etchebehere, Elba Cristina Sa de Camargo; Ramos, Celso Dario, E-mail: cdramos@unicamp.br [Universidade Estadual de Campinas (Unicamp), Campinas, SP (Brazil). Department of Radiology. Service of Nuclear Medicine; Camargo, Edwaldo Eduardo [Hospital Sirio-Libanes, Campinas, SP (Brazil). Service of Nuclear Medicine

    2013-01-15

    Objective: This study was aimed to evaluate myocardial perfusion in asymptomatic patients with type 1 (DM1) and type 2 diabetes mellitus (DM2) without previous diagnoses of coronary artery disease (CAD) or cerebral infarction. Materials and Methods: Fifty-nine consecutive asymptomatic patients (16 DM1, 43 DM2) underwent myocardial perfusion scintigraphy with {sup 99m}Tc-sestamibi (MPS). They were evaluated for body mass index, metabolic control of DM, type of therapy, systemic arterial hypertension, dyslipidemia, nephropathy, retinopathy, peripheral neuropathy, smoking, and familial history of CAD. Results: MPS was abnormal in 15 patients (25.4%): 12 (20.3%) with perfusion abnormalities, and 3 with isolated left ventricular dysfunction. The strongest predictors for abnormal myocardial perfusion were: age 60 years and above (p = 0.017; odds ratio [OR] = 6.0), peripheral neuropathy (p = 0.028; OR = 6.1), nephropathy (p = 0.031; OR = 5.6), and stress ECG positive for ischemia (p = 0.049; OR = 4.08). Conclusion: Silent myocardial ischemia occurs in more than one in five asymptomatic diabetic patients. The strongest predictors of ischemia in this study were: patient age, peripheral neuropathy, nephropathy, retinopathy and a stress ECG positive for ischemia. (author)

  10. Myocardial perfusion scintigraphy in the detection of silent ischemia in asymptomatic diabetic patients

    International Nuclear Information System (INIS)

    Oki, Glaucia Celeste Rossatto; Pavin, Elizabeth Joao; Parisi, Maria Candida R.; Coelho, Otavio Rizzi; Almeida, Raitany C.; Etchebehere, Elba Cristina Sa de Camargo; Ramos, Celso Dario; Camargo, Edwaldo Eduardo

    2013-01-01

    Objective: This study was aimed to evaluate myocardial perfusion in asymptomatic patients with type 1 (DM1) and type 2 diabetes mellitus (DM2) without previous diagnoses of coronary artery disease (CAD) or cerebral infarction. Materials and Methods: Fifty-nine consecutive asymptomatic patients (16 DM1, 43 DM2) underwent myocardial perfusion scintigraphy with 99m Tc-sestamibi (MPS). They were evaluated for body mass index, metabolic control of DM, type of therapy, systemic arterial hypertension, dyslipidemia, nephropathy, retinopathy, peripheral neuropathy, smoking, and familial history of CAD. Results: MPS was abnormal in 15 patients (25.4%): 12 (20.3%) with perfusion abnormalities, and 3 with isolated left ventricular dysfunction. The strongest predictors for abnormal myocardial perfusion were: age 60 years and above (p = 0.017; odds ratio [OR] = 6.0), peripheral neuropathy (p = 0.028; OR = 6.1), nephropathy (p = 0.031; OR = 5.6), and stress ECG positive for ischemia (p = 0.049; OR = 4.08). Conclusion: Silent myocardial ischemia occurs in more than one in five asymptomatic diabetic patients. The strongest predictors of ischemia in this study were: patient age, peripheral neuropathy, nephropathy, retinopathy and a stress ECG positive for ischemia. (author)

  11. Fabrication and perfusion culture of anatomically shaped artificial bone using stereolithography

    International Nuclear Information System (INIS)

    Du, Dajiang; Asaoka, Teruo; Ushida, Takashi; Furukawa, Katsuko S

    2014-01-01

    Because patient bone defects are usually varied and complicated in geometry, it would be preferred to fabricate custom-made artificial bone grafts that are anatomically specific to individual patient defects. Using a rabbit femoral segment as a bone reconstruction model, we successfully produced customized ceramic scaffolds by stereolithography, which not only had an anatomically correct external shape according to computed tomography data but also contained an interconnecting internal network of channels designed for perfusion culture. Rabbit bone marrow stromal cells were isolated and cultured with these scaffolds using a novel oscillatory perfusion system that was stereolithographically fabricated to fit well to the unique scaffold shapes. After five days of three-dimensional culture with oscillatory perfusion, the cells attached and proliferated homogenously in the scaffolds. However, control cells inside the scaffolds cultured under static conditions were dead after prolonged in vitro culture. Cellular DNA content and alkaline phosphatase activities were significantly higher in the perfusion group versus the static group. Therefore, anatomically correct artificial bone can be successfully constructed using stereolithography and oscillatory culture technology, and could be useful for bone engraftment and defect repair. (paper)

  12. Cardiac involvement in canine babesiosis : review article

    Directory of Open Access Journals