Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)
International Nuclear Information System (INIS)
Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.
1994-01-01
The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
The nucleotide sequence of a Polish isolate of Tomato torrado virus.
Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk
2008-12-01
A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.
Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G
2011-04-01
A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Directory of Open Access Journals (Sweden)
Budzanivska I. G.
2014-03-01
Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.
Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L
2001-01-01
Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
DEFF Research Database (Denmark)
Defoor, Els Marie Celine; Martinussen, Jan
A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...
Mukhopadhyaya, R; Sadaie, M R
1993-02-01
Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.
Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid
2012-07-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1
Energy Technology Data Exchange (ETDEWEB)
Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G
1988-03-25
Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
The International Nucleotide Sequence Database Collaboration.
Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu
2011-01-01
Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R
2012-10-01
To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.
Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H
2008-01-01
During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.
DEFF Research Database (Denmark)
Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.
1998-01-01
on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...
Draft Genome Sequences of Three Novel Low-Abundance Species Strains Isolated from Kefir Grain.
Kim, Yongkyu; Blasche, Sonja; Patil, Kiran R
2017-09-28
We report here the genome sequences of three novel bacterial species strains- Bacillus kefirresidentii Opo, Rothia kefirresidentii KRP, and Streptococcus kefirresidentii YK-isolated from kefir grains collected in Germany. The draft genomes of these isolates were remarkably dissimilar (average nucleotide identities, 77.80%, 89.01%, and 92.10%, respectively) to those of the previously sequenced strains. Copyright © 2017 Kim et al.
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J
1995-05-01
The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
Directory of Open Access Journals (Sweden)
Andréia B. Poletto
2008-01-01
Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.
Wen, Chiu-Ming
2017-08-01
An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel
2014-01-01
Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.
Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R
2017-09-14
The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.
Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan
Directory of Open Access Journals (Sweden)
Jenn-Tzong Chang
2017-11-01
Full Text Available The first human parechovirus 3 (HPeV3 VGHKS-2007 in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Sailaja, B; Anjum, Najreen; Patil, Yogesh K; Agarwal, Surekha; Malathi, P; Krishnaveni, D; Balachandran, S M; Viraktamath, B C; Mangrauthia, Satendra K
2013-12-01
In this study, complete genome of a south Indian isolate of Rice tungro spherical virus (RTSV) from Andhra Pradesh (AP) was sequenced, and the predicted amino acid sequence was analysed. The RTSV RNA genome consists of 12,171 nt without the poly(A) tail, encoding a putative typical polyprotein of 3,470 amino acids. Furthermore, cleavage sites and sequence motifs of the polyprotein were predicted. Multiple alignment with other RTSV isolates showed a nucleotide sequence identity of 95% to east Indian isolates and 90% to Philippines isolates. A phylogenetic tree based on complete genome sequence showed that Indian isolates clustered together, while Vt6 and PhilA isolates of Philippines formed two separate clusters. Twelve recombination events were detected in RNA genome of RTSV using the Recombination Detection Program version 3. Recombination analysis suggested significant role of 5' end and central region of genome in virus evolution. Further, AP and Odisha isolates appeared as important RTSV isolates involved in diversification of this virus in India through recombination phenomenon. The new addition of complete genome of first south Indian isolate provided an opportunity to establish the molecular evolution of RTSV through recombination analysis and phylogenetic relationship.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.
Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F
1992-12-01
The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.
Directory of Open Access Journals (Sweden)
Kouki Yonezawa
Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.
Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei
2013-10-01
The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.
Genome Sequences of Ilzat and Eleri, Two Phages Isolated Using Microbacterium foliorum NRRL B-24224
Ali, Ilzat; Jones, Acacia Eleri; Mohamed, Aleem
2018-01-01
ABSTRACT Bacteriophages Ilzat and Eleri are newly isolated Siphoviridae infecting Microbacterium foliorum NRRL B-24224. The phage genomes are similar in length, G+C content, and architecture and share 62.9% nucleotide sequence identity. PMID:29650566
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)
1993-01-01
textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Bancerz-Kisiel, Agata; Szczerba-Turek, Anna; Platt-Samoraj, Aleksandra; Michalczyk, Maria; Szweda, Wojciech
2017-03-01
Y. enterocolitica is the causative agent of yersiniosis. The objective of the article was a study of single nucleotide polymorphism in the ystB gene of Y. enterocolitica strains isolated from various wild animal species. High-resolution melting (HRM) analysis was applied to identify single nucleotide polymorphism (SNP) of ystB gene fragments of 88 Y. enterocolitica biotype 1A strains isolated from wild boar, roe deer, red deer and wild ducks. HRM analysis revealed 14 different melting profiles - 4 of them were defined as regular genotypes (G1, G2, G3, G4), whereas 10 as variations. 24 of the examined Y. enterocolitica strains were classified as G1, 18 strains as a G2, 21 strains as a G3, and 15 strains as a G4. Nucleotide sequences classified as G1 revealed 100% similarity with the Y. enterocolitica D88145.1 sequence (NCBI). Analysis of G2 revealed one point mutation - transition T111A. One mutation was also found in G3, but SNP was placed in a different gene region - transition G193A. Two SNPs - transitions G92C and T111A - were identified in G4. Direct sequencing of 10 variations revealed 5 new variants of the ystB nucleotide sequence: V1 - transition G129A (3 strains); V2 - transitions T111A and G193A (2 strains); V3 - transitions C118T and G193A (1 strain); V4 - transitions C141A and G193A (2 strains); and V5 characterized by 19 SNPs: G83A, T93A, A109G, G114T, C116T, A123G, T134C, T142G, T144C, A150C, G162A, T165G, T170G, T174A, T177G, G178A, A179G, A184G and G193A (2 strains). The predominant genotype in isolates from wild ducks was G1; in red deer G2; in wild boar G3; in roe deer G1 and G4. The proposed HRM method could be used to analyze Y. enterocolitica biotype 1A strains isolated from different sources, including humans.
Lee, Jong-Seung; Cho, Won Kyong; Kim, Mi-Kyeong; Kwak, Hae-Ryun; Choi, Hong-Soo; Kim, Kook-Hyung
2011-04-01
Tomato spotted wilt virus (TSWV) infects numerous host plants and has three genome segments, called L, M and S. Here, we report the complete genome sequences of three Korean TSWV isolates (TSWV-1 to -3) infecting tomato and pepper plants. Although the nucleotide sequence of TSWV-1 genome isolated from tomato is very different from those of TSWV-2 and TSWV-3 isolated from pepper, the deduced amino acid sequences of the five TSWV genes are highly conserved among all three TSWV isolates. In phylogenetic analysis, deduced RdRp protein sequences of TSWV-2 and TSWV-3 were clustered together with two previously reported isolates from Japan and Korea, while TSWV-1 grouped together with a Hawaiian isolate. A phylogenetic tree based on N protein sequences, however, revealed four distinct groups of TSWV isolates, and all three Korean isolates belonged to group II, together with many other isolates, mostly from Europe and Asia. Interestingly, most American isolates grouped together as group I. Together, these results suggested that these newly identified TSWV isolates might have originated from an Asian ancestor and undergone divergence upon infecting different host plants.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B
Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.; Afonso, Claudio L.
2017-01-01
ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
International Nuclear Information System (INIS)
Lo, A.; Yang, H.L.
1990-01-01
This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
DEFF Research Database (Denmark)
Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.
2000-01-01
and veal calf production units) in different years and from all confirmed outbreaks in Denmark within a short period. The results showed that identical viruses were isolated within a herd during outbreaks and that viruses from recurrent infections varied by up to 11% in sequence even in closed herds......The nucleotides coding for the extracellular part of the G glycoprotein and the full SH protein of bovine respiratory syncytial virus (BRSV) were sequenced from viruses isolated from numerous outbreaks of BRSV infection. The isolates included viruses isolated from the same herd (closed dairy farms....... It is possible that a quasispecies variant swarm of BRSV persisted in some of the calves in each herd and that a new and different highly fit virus type (master and consensus sequence) became dominant and spread from a single animal in connection with each new outbreak. Based on the high level of diversity...
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....
Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.
2017-01-01
ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related. PMID:28572332
Directory of Open Access Journals (Sweden)
Rawnak Laila
2017-01-01
Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
Energy Technology Data Exchange (ETDEWEB)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Directory of Open Access Journals (Sweden)
Sukdeb Nandi
2010-03-01
Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua
2015-10-01
Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.
D'Souza, T M; Boominathan, K; Reddy, C A
1996-01-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429
Deep sequencing as a method of typing bluetongue virus isolates.
Rao, Pavuluri Panduranga; Reddy, Yella Narasimha; Ganesh, Kapila; Nair, Shreeja G; Niranjan, Vidya; Hegde, Nagendra R
2013-11-01
Bluetongue (BT) is an economically important endemic disease of livestock in tropics and subtropics. In addition, its recent spread to temperate regions like North America and Northern Europe is of serious concern. Rapid serotyping and characterization of BT virus (BTV) is an essential step in the identification of origin of the virus and for controlling the disease. Serotyping of BTV is typically performed by serum neutralization, and of late by nucleotide sequencing. This report describes the near complete genome sequencing and typing of two isolates of BTV using Illumina next generation sequencing platform. Two of the BTV RNAs were multiplexed with ten other unknown samples. Viral RNA was isolated and fragmented, reverse transcribed, the cDNA ends were repaired and ligated with a multiplex oligo. The genome library was amplified using primers complementary to the ligated oligo and subjected to single and paired end sequencing. The raw reads were assembled using a de novo method and reference-based assembly was performed based on the contig data. Near complete sequences of all segments of BTV were obtained with more than 20× coverage, and single read sequencing method was sufficient to identify the genotype and serotype of the virus. The two viruses used in this study were typed as BTV-1 and BTV-9E. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
amirreza ebadi
2015-02-01
Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
Lee, Yookyung; Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan
2016-01-01
Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000. Keywords: Insect, Larval gut, Whole genome shot-gun sequencing
Gan, Han Ming; Rajasekaram, Ganeswrie; Eng, Wilhelm Wei Han; Kaniappan, Priyatharisni; Dhanoa, Amreeta
2017-08-10
We report the whole-genome sequences of two carbapenem-resistant clinical isolates of Klebsiella quasipneumoniae subsp. similipneumoniae obtained from two different patients. Both strains contained three different extended-spectrum β-lactamase genes and showed strikingly high pairwise average nucleotide identity of 99.99% despite being isolated 3 years apart from the same hospital. Copyright © 2017 Gan et al.
Zhao, Kaixi; Margaria, Paolo; Rosa, Cristina
2018-05-10
Impatiens necrotic spot orthotospovirus (INSV) can impact economically important ornamental plants and vegetables worldwide. Characterization studies on INSV are limited. For most INSV isolates, there are no complete genome sequences available. This lack of genomic information has a negative impact on the understanding of the INSV genetic diversity and evolution. Here we report the first complete nucleotide sequence of a US INSV isolate. INSV-UP01 was isolated from an impatiens in Pennsylvania, US. RT-PCR was used to clone its full-length genome and Vector NTI to assemble overlapping sequences. Phylogenetic trees were constructed by using MEGA7 software to show the phylogenetic relationships with other available INSV sequences worldwide. This US isolate has genome and biological features classical of INSV species and clusters in the Western Hemisphere clade, but its origin appears to be recent. Furthermore, INSV-UP01 might have been involved in a recombination event with an Italian isolate belonging to the Asian clade. Our analyses support that INSV isolates infect a broad plant-host range they group by geographic origin and not by host, and are subjected to frequent recombination events. These results justify the need to generate and analyze complete genome sequences of orthotospoviruses in general and INSV in particular.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H
2004-04-01
Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.
Lee, Yookyung; Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan
2016-03-01
Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-10-11
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR
Energy Technology Data Exchange (ETDEWEB)
D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)
1996-10-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.
Directory of Open Access Journals (Sweden)
Yookyung Lee
2016-03-01
Full Text Available Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000. Keywords: Insect, Larval gut, Whole genome shot-gun sequencing
Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L
2017-01-01
Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the
Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.
2017-01-01
Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the
Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J L
2017-08-31
Frog virus 3 was isolated from a strawberry poison frog ( Oophaga pumilio ) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op /2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. Copyright © 2017 Saucedo et al.
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
DEFF Research Database (Denmark)
Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili
2013-01-01
In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
Directory of Open Access Journals (Sweden)
Annemieke Smet
Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of
Ali, Akhtar
2017-01-12
In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.
Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng
2017-12-05
Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.
Wang, Xinwang; Wadl, Phillip A; Wood-Jones, Alicia; Windham, Gary; Trigiano, Robert N; Scruggs, Mary; Pilgrim, Candace; Baird, Richard
2012-12-01
Simple sequence repeat (SSR) markers were developed from Aspergillus flavus expressed sequence tag (EST) database to conduct an analysis of genetic relationships of Aspergillus isolates from numerous host species and geographical regions, but primarily from the United States. Twenty-nine primers were designed from 362 tri-nucleotide EST-SSR sequences. Eighteen polymorphic loci were used to genotype 96 Aspergillus species isolates. The number of alleles detected per locus ranged from 2 to 24 with a mean of 8.2 alleles. Haploid diversity ranged from 0.28 to 0.91. Genetic distance matrix was used to perform principal coordinates analysis (PCA) and to generate dendrograms using unweighted pair group method with arithmetic mean (UPGMA). Two principal coordinates explained more than 75 % of the total variation among the isolates. One clade was identified for A. flavus isolates (n = 87) with the other Aspergillus species (n = 7) using PCA, but five distinct clusters were present when the others taxa were excluded from the analysis. Six groups were noted when the EST-SSR data were compared using UPGMA. However, the latter PCA or UPGMA comparison resulted in no direct associations with host species, geographical region or aflatoxin production. Furthermore, there was no direct correlation to visible morphological features such as sclerotial types. The isolates from Mississippi Delta region, which contained the largest percentage of isolates, did not show any unusual clustering except for isolates K32, K55, and 199. Further studies of these three isolates are warranted to evaluate their pathogenicity, aflatoxin production potential, additional gene sequences (e.g., RPB2), and morphological comparisons.
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing
2010-01-01
Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses
Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun
2016-03-01
The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Directory of Open Access Journals (Sweden)
Barbara V Lago
Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.
Directory of Open Access Journals (Sweden)
Bannantine John P
2012-03-01
Full Text Available Abstract Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs. Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb. Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565 further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences.
Directory of Open Access Journals (Sweden)
Huaiyong Luo
Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.
Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng
2015-01-01
The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.
Genome analysis of environmental and clinical P. aeruginosa isolates from sequence type-1146.
Directory of Open Access Journals (Sweden)
David Sánchez
Full Text Available The genomes of Pseudomonas aeruginosa isolates of the new sequence type ST-1146, three environmental (P37, P47 and P49 and one clinical (SD9 isolates, with differences in their antibiotic susceptibility profiles have been sequenced and analysed. The genomes were mapped against P. aeruginosa PAO1-UW and UCBPP-PA14. The allelic profiles showed that the highest number of differences were in "Related to phage, transposon or plasmid" and "Secreted factors" categories. The clinical isolate showed a number of exclusive alleles greater than that for the environmental isolates. The phage Pf1 region in isolate SD9 accumulated the highest number of nucleotide substitutions. The ORF analysis of the four genomes assembled de novo indicated that the number of isolate-specific genes was higher in isolate SD9 (132 genes than in isolates P37 (24 genes, P47 (16 genes and P49 (21 genes. CRISPR elements were found in all isolates and SD9 showed differences in the spacer region. Genes related to bacteriophages F116 and H66 were found only in isolate SD9. Genome comparisons indicated that the isolates of ST-1146 are close related, and most genes implicated in pathogenicity are highly conserved, suggesting a genetic potential for infectivity in the environmental isolates similar to the clinical one. Phage-related genes are responsible of the main differences among the genomes of ST-1146 isolates. The role of bacteriophages has to be considered in the adaptation processes of isolates to the host and in microevolution studies.
Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel
2016-06-01
Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge
2006-12-01
The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
Directory of Open Access Journals (Sweden)
H Mirhendi
2008-12-01
Full Text Available Background: Approximately 85-90% of malaria infections in Iran are attributed to Plasmodium vivax, while little is known about the genetic of the parasite and its strain types in this region. This study was designed and performed for describing genetic characteristics of Plasmodium vivax population of Iran based on the merozoite surface protein-3α gene sequence. Methods: Through a descriptive study we analyzed partial P. vivax merozoite surface protein-3α gene sequences from 17 clinical P. vivax isolates collected from malarious areas of Iran. Genomic DNA was extracted by Q1Aamp® DNA blood mini kit, amplified through nested PCR for a partial nucleotide sequence of PvMSP-3 gene in P. vivax. PCR-amplified products were sequenced with an ABI Prism Perkin-Elmer 310 sequencer machine and the data were analyzed with clustal W software. Results: Analysis of PvMSP-3 gene sequences demonstrated extensive polymorphisms, but the sequence identity between isolates of same types was relatively high. We identified specific insertions and deletions for the types A, B and C variants of P. vivax in our isolates. In phylogenetic comparison of geographically separated isolates, there was not a significant geographical branching of the parasite populations. Conclusion: The highly polymorphic nature of isolates suggests that more investigations of the PvMSP-3 gene are needed to explore its vaccine potential.
Directory of Open Access Journals (Sweden)
Zhu Yuan-Mao
2011-12-01
Full Text Available Abstract Background Bovine adenovirus type 3 (BAV-3 belongs to the Mastadenovirus genus of the family Adenoviridae and is involved in respiratory and enteric infections of calves. The isolation of BAV-3 has not been reported prior to this study in China. In 2009, there were many cases in cattle showing similar clinical signs to BAV-3 infection and a virus strain, showing cytopathic effect in Madin-Darby bovine kidney cells, was isolated from a bovine nasal swab collected from feedlot cattle in Heilongjiang Province, China. The isolate was confirmed as a bovine adenovirus type 3 by PCR and immunofluorescence assay, and named as HLJ0955. So far only the complete genome sequence of prototype of BAV-3 WBR-1 strain has been reported. In order to further characterize the Chinese isolate HLJ0955, the complete genome sequence of HLJ0955 was determined. Results The size of the genome of the Chinese isolate HLJ0955 is 34,132 nucleotides in length with a G+C content of 53.6%. The coding sequences for gene regions of HLJ0955 isolate were similar to the prototype of BAV-3 WBR-1 strain, with 80.0-98.6% nucleotide and 87.5-98.8% amino acid identities. The genome of HLJ0955 strain contains 16 regions and four deletions in inverted terminal repeats, E1B region and E4 region, respectively. The complete genome and DNA binding protein gene based phylogenetic analysis with other adenoviruses were performed and the results showed that HLJ0955 isolate belonged to BAV-3 and clustered within the Mastadenovirus genus of the family Adenoviridae. Conclusions This is the first study to report the isolation and molecular characterization of BAV-3 from cattle in China. The phylogenetic analysis performed in this study supported the use of the DNA binding protein gene of adenovirus as an appropriate subgenomic target for the classification of different genuses of the family Adenoviridae on the molecular basis. Meanwhile, a large-scale pathogen and serological epidemiological
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Sequence analysis of sub-genotype D hepatitis B surface antigens isolated from Jeddah, Saudi Arabia
Directory of Open Access Journals (Sweden)
Sahar EL Hadad
2018-05-01
Full Text Available Little is known about the prevalence of HBV genotypes/sub-genotypes in Jeddah province, although the hepatitis B virus (HBV was identified as the most predominant type of hepatitis in Saudi Arabia. To characterize HBV genotypes/sub-genotypes, serum samples from 15 patients with chronic HBV were collected and subjected to HBsAg gene amplification and sequence analysis. Phylogenetic analysis of the HBsAg gene sequences revealed that 11 (48% isolates belonged to HBV/D while 4 (18% were associated with HBV/C. Notably, a HBV/D sub-genotype phylogenetic tree identified that eight current isolates (72% belonged to HBV/D1, whereas three isolates (28% appeared to be more closely related to HBV/D5, although they formed a novel cluster supported by a branch with 99% bootstrap value. Isolates belonging to D1 were grouped in one branch and seemed to be more closely related to various strains isolated from different countries. For further determination of whether the three current isolates belonged to HBV/D5 or represented a novel sub-genotype, HBV/DA, whole HBV genome sequences would be required. In the present study, we verified that HBV/D1 is the most prevalent HBV sub-genotype in Jeddah, and identified novel variant mutations suggesting that an additional sub-genotype designated HBV/DA should be proposed. Overall, the results of the present HBsAg sequence analyses provide us with insights regarding the nucleotide differences between the present HBsAg/D isolates identified in the populace of Jeddah, Saudi Arabia and those previously isolated worldwide. Additional studies with large numbers of subjects in other areas might lead to the discovery of the specific HBV strain genotypes or even additional new sub-genotypes that are circulating in Saudi Arabia. Keywords: Hepatitis B virus, HBV sub-genotypes, HBV/D, HBsAg, Viral isolates, Population studies
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo
2013-08-01
Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.
Directory of Open Access Journals (Sweden)
M. Ananda Chitra
2015-07-01
Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain
Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won
2011-09-01
Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.
Molecular characterization of Mycoplasma synoviae isolates from commercial chickens in Iran
Directory of Open Access Journals (Sweden)
Pourbakhsh
2014-05-01
Full Text Available Detection of Mycoplasma synoviae (MS by culture and polymerase chain reaction (PCR has been reported from commercial chicken farms in different provinces of Iran. In some reports the phylogenetic analysis of MS isolates based on 16S rRNA and variable lipoprotein hemagglutinin (vlhA genes have been carried out. The PCR product containing partial 16S rRNA genes of Iranain isolates was sequenced, and compared with 16S rRNA gene of MS sequences which were available in GenBank. Variations, polymorphisms, and differences between nucleotides of all isolates were observed. Phylogenetic analysis of these sequences showed that all MS isolates from Iran were most closely related to sequences of MS from Brazil. Sequence analysis of the N-terminal end of the hemagglutinin encoding gene vlhA were also used as an alternative for the detection and initial typing of field strains of MS in commercial poultry. The results showed that there was a complete concordance between all Iranian isolates nucleotide sequence and the 5́-vlhA region sequence remained unchanged in all MS isolates and demonstrated differentiation between Iranian isolates and live commercial MS-H vaccine strain. More recently, the single-copy domain of the conserved region of vlhA gene in MS was sequenced, analyzed and verified to type MS field isolates in Iran and live vaccine MS-H strain. In addition, a restriction fragment length polymorphism (RFLP method was established based on single nucleotide polymorphism that existed in all field isolates of Iran to differentiate between these field isolates and MS-H. This PCR-RFLP method allowed differentiating all MS field isolates from the vaccine strain.
Phylogenetic analysis of rabbit haemorrhagic disease virus (RHDV) strains isolated in Poland.
Fitzner, Andrzej; Niedbalski, Wieslaw
2017-10-01
The aim of this study was to characterise the nucleotide and amino acid sequence of complete genomes (7.5 kb) from RHDV strains isolated in Poland and estimate the genetic variability in different elements of the viral RNA. In addition, the sequence of Polish RHDV isolates isolated from 1988-2015 was compared with the sequences of other European RHDV, including the RHDVa and RHDV2/RHDVb subtypes. The complete sequence was developed by the compilation of partial nucleotide sequences. This sequence consisted of approximately 7428 nucleotides. For comparison of nucleotide sequences and the development of phylogenetic trees of Polish RHDV isolates and reference RHDV strains representing the main phylogenetic groups of classical RHDV, RHDVa and RHDV2 as well as the non-pathogenic rabbit lagovirus RCV, the BLAST software with blastn and MEGA6 with neighbour-joining method was applied. The complete nucleotide sequence of Polish isolates of RHDV has also been entered into GenBank. For comparative analysis, nineteen complete sequences representing the main RHDV genetic types available in GenBank were used. The results of phylogenetic analysis of Polish RHDV strains reveals the presence of three classical RHDV genogroups (G2, G4 and G5) and an RHDVa variant (G6). The oldest RHDV isolates (KGM 1988, PD 1989 and MAL 1994) belong to genogroup G2. It can be assumed that the elimination of these strains from the environment probably occurred at the turn of 1994 and 1995. Genogroup G2 was replaced by the phylogenetically younger BLA 1994 and OPO 2004 strains from genogroup G4, which probably originated from the G3 lineage, represented by the Italian strains BS89. The last representatives of classical RHDV in Poland are isolates GSK 1988 and ZD0 2000 from genogroup G5. A single clade contains the Polish RHDV strains from 2004-2015 (GRZ 2004, KRY 2004, L145 2004, W147 2005, SKO 2013, GLE 2013, RED1 2013, STR 2012, STR2 2013, STR 2014, BIE 2015) identified as RHDVa, which clustered
Song, Jae-Hyoung; Park, Kwisung; Shim, Aeri; Kwon, Bo-Eun; Ahn, Jae-Hee; Choi, Young Jin; Kim, Jae Kyung; Yeo, Sang-Gu; Yoon, Kyungah; Ko, Hyun-Jeong
2015-02-01
Coxsackievirus A group 16 strain (CVA16) is one of the predominant causative agents of hand, foot, and mouth disease (HFMD). Using a specimen from a male patient with HFMD, we isolated and performed sequencing of the Korean CVA16 strain and compared it with a G10 reference strain. Also, we were investigated the effects of medicinal plant extract on the cytopathic effects (CPE) by CPE reduction assay against Korean CVA16. Phylogenetic analysis showed that the Korean CVA16 isolate belonged to cluster B-1 and was closely related to the strain PM-15765-00 isolated in Malaysia in 2000. The Korean CVA16 isolate showed 73.2% nucleotide identity to the G10 prototype strain and 98.7% nucleotide identity to PM-15765-00. Next, we assessed whether the Korean CVA16 isolate could be used for in vitro screening of antiviral agents to treat HFMD infection. Vero cells infected with the Korean CVA16 isolate showed a cytopathic effect 2 days after the infection, and the treatment of cells with Cornus officinalis, Acer triflorum, Pulsatilla koreana, and Clematis heracleifolia var. davidiana Hemsl extracts exhibited strong antiviral activity against CVA16. Collectively, our work provides potential candidates for the development of vaccine and novel drugs to treat the CVA16 strain isolated from a Korean patient.
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik
2016-12-01
Here, we present the 3,795,952 bp complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017580.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
Kumar, Ravi; Rajak, Kaushal Kishor; Chandra, Tribhuwan; Muthuchelvan, Dhanavelu; Saxena, Arpit; Chaudhary, Dheeraj; Kumar, Ajay; Pandey, Awadh Bihari
2015-09-01
This study was undertaken with the aim to compare and establish the genetic relatedness between classical swine fever virus (CSFV) genogroup 2.2 isolate and pestivirus reference strains. The available complete genome sequences of CSFV/IND/UK/LAL-290 strain and other pestivirus reference strains were retrieved from GenBank. The complete genome sequence, complete open reading frame, 5' and 3' non-coding region (NCR) sequences were analyzed and compared with reference pestiviruses strains. Clustal W model in MegAlign program of Lasergene 6.0 software was used for analysis of genetic heterogeneity. Phylogenetic analysis was carried out using MEGA 6.06 software package. The complete genome sequence alignment of CSFV/IND/UK/LAL-290 isolate and reference pestivirus strains showed 58.9-72% identities at the nucleotide level and 50.3-76.9% at amino acid level. Sequence homology of 5' and 3' NCRs was found to be 64.1-82.3% and 22.9-71.4%, respectively. In phylogenetic analysis, overall tree topology was found similar irrespective of sequences used in this study; however, whole genome phylogeny of pestivirus formed two main clusters, which further distinguished into the monophyletic clade of each pestivirus species. CSFV/IND/UK/LAL-290 isolate placed with the CSFV Eystrup strain in the same clade with close proximity to border disease virus and Aydin strains. CSFV/IND/UK/LAL-290 exhibited the analogous genomic organization to those of all reference pestivirus strains. Based on sequence identity and phylogenetic analysis, the isolate showed close homology to Aydin/04-TR virus and distantly related to Bungowannah virus.
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Formanová, Petra; Černý, Jiří; Bolfíková, Barbora Černá; Valdés, James J; Kozlova, Irina; Dzhioev, Yuri; Růžek, Daniel
2015-02-01
Tick-borne encephalitis virus (TBEV) causes tick-borne encephalitis (TBE), one of the most important human neuroinfections across Eurasia. Up to date, only three full genome sequences of human European TBEV isolates are available, mostly due to difficulties with isolation of the virus from human patients. Here we present full genome characterization of an additional five low-passage TBEV strains isolated from human patients with severe forms of TBE. These strains were isolated in 1953 within Central Bohemia in the former Czechoslovakia, and belong to the historically oldest human TBEV isolates in Europe. We demonstrate here that all analyzed isolates are distantly phylogenetically related, indicating that the emergence of TBE in Central Europe was not caused by one predominant strain, but rather a pool of distantly related TBEV strains. Nucleotide identity between individual sequenced TBEV strains ranged from 97.5% to 99.6% and all strains shared large deletions in the 3' non-coding region, which has been recently suggested to be an important determinant of virulence. The number of unique amino acid substitutions varied from 3 to 9 in individual isolates, but no characteristic amino acid substitution typical exclusively for all human TBEV isolates was identified when compared to the isolates from ticks. We did, however, correlate that the exploration of the TBEV envelope glycoprotein by specific antibodies were in close proximity to these unique amino acid substitutions. Taken together, we report here the largest number of patient-derived European TBEV full genome sequences to date and provide a platform for further studies on evolution of TBEV since the first emergence of human TBE in Europe. Copyright © 2014 Elsevier GmbH. All rights reserved.
Liu, Dong; Zhu, Guoli; Tang, Wenqiao; Yang, Jinquan; Guo, Hongyi
2012-01-01
Short interspersed nucleotide elements (SINEs), a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR). Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR). The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180-360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNA(Leu)-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.
Directory of Open Access Journals (Sweden)
Dong Liu
2012-02-01
Full Text Available Short interspersed nucleotide elements (SINEs, a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR. Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR. The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180–360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNALeu-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing
2009-08-01
Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers
Omaleki, Lida; Browning, Glenn F; Barber, Stuart R; Allen, Joanne L; Srikumaran, Subramaniam; Markham, Philip F
2014-11-07
Species within the genus Mannheimia are among the most important causes of ovine mastitis. Isolates of these species can express leukotoxin A (LktA), a primary virulence factor of these bacteria. To examine the significance of variation in the LktA, the sequences of the lktA genes in a panel of isolates from cases of ovine mastitis were compared. The cross-neutralising capacities of rat antisera raised against LktA of one Mannheimia glucosida, one haemolytic Mannheimia ruminalis, and two Mannheimia haemolytica isolates were also examined to assess the effect that variation in the lktA gene can have on protective immunity against leukotoxins with differing sequences. The lktA nucleotide distance between the M. haemolytica isolates was greater than between the M. glucosida isolates, with the M. haemolytica isolates divisible into two groups based on their lktA sequences. Comparison of the topology of phylogenetic trees of 16S rDNA and lktA sequences revealed differences in the relationships between some isolates, suggesting horizontal gene transfer. Cross neutralisation data obtained with monospecific anti-LktA rat sera were used to derive antigenic similarity coefficients for LktA from the four Mannheimia species isolates. Similarity coefficients indicated that LktA of the two M. haemolytica isolates were least similar, while LktA from M. glucosida was most similar to those for one of the M. haemolytica isolates and the haemolytic M. ruminalis isolate. The results suggested that vaccination with the M. glucosida leukotoxin would generate the greatest cross-protection against ovine mastitis caused by Mannheimia species with these alleles. Copyright © 2014 Elsevier B.V. All rights reserved.
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.
2016-01-01
Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II. PMID:27469959
Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.; Afonso, Claudio L.
2016-01-01
Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II.
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
Directory of Open Access Journals (Sweden)
Michal Strouhal
2017-09-01
Full Text Available Treponema pallidum subsp. pertenue (TPE is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier and one TPE strain (Fribourg-Blanc isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet.Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively. Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation.The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.
Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat
2017-09-01
To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.
Directory of Open Access Journals (Sweden)
Yunus E. Beyhan
2017-09-01
Full Text Available Objectives: To characterize the cutaneous leishmaniasis (CL isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR. Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.
Directory of Open Access Journals (Sweden)
Xiaolin Ji
Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
Directory of Open Access Journals (Sweden)
Mohammad AKRAM
2012-09-01
Full Text Available A disease of pea characterized by browning in veins, leaves and stems, mostly in growing tips, and brown circular spots on pods, was recorded in four districts of Uttar Pradesh, India. The causal agent of this disease was detected by reverse transcription-polymerase chain reaction (RT-PCR using primers pair HRP 26/HRP 28 and identified as Groundnut bud necrosis virus (GBNV on the basis of nucleocapsid protein (NP gene sequence. Virus isolates from Bareilly (BRY, Kanpur (KNP, Udham Singh Nagar (USN and Shahjahanpur (SJP were designated as GBNV-[Pea_BRY], GBNV-[Pea_KNP], GBNV-[Pea_USN] and GBNV-[Pea_SJP] and their NP genes sequenced. The sequence data of each isolate were deposited at NCBI database (JF281101-JF281104. The complete nucleotide sequence of the NP genes of all the GBNV isolates had a single open reading frame of 831 nucleotides and 276 amino acids. The isolates had among them 2% variability at amino acid level and 2‒3 variability at nucleotide level, but had variability with other GBNV isolates of fabaceous hosts in the range of 0‒6% at amino acid level and 1‒8% at nucleotide level. Though this variation in nucleotide sequences of GBNV isolates from fabaceous hosts is within the limits of species demarcation for tospoviruses, formation of a separate cluster within the GBNV isolates indicates the possibility of distinct variants in GBNV.
Sulaiman, Irshad M; Torres, Patricia; Simpson, Steven; Kerdahi, Khalil; Ortega, Ynes
2013-04-01
We have described the development of a 2-step nested PCR protocol based on the characterization of the 70-kDa heat shock protein (HSP70) gene for rapid detection of the human-pathogenic Cyclospora cayetanensis parasite. We tested and validated these newly designed primer sets by PCR amplification followed by nucleotide sequencing of PCR-amplified HSP70 fragments belonging to 16 human C. cayetanensis isolates from 3 different endemic regions that include Nepal, Mexico, and Peru. No genetic polymorphism was observed among the isolates at the characterized regions of the HSP70 locus. This newly developed HSP70 gene-based nested PCR protocol provides another useful genetic marker for the rapid detection of C. cayetanensis in the future.
Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.
Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego
2007-01-01
Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.
Sandoval-Azuara, Sarai Estrella; Muñiz-Salazar, Raquel; Perea-Jacobo, Ricardo; Robbe-Austerman, Suelee; Perera-Ortiz, Alejandro; López-Valencia, Gilberto; Bravo, Doris M; Sanchez-Flores, Alejandro; Miranda-Guzmán, Daniela; Flores-López, Carlos Alberto; Zenteno-Cuevas, Roberto; Laniado-Laborín, Rafael; de la Cruz, Fabiola Lafarga; Stuber, Tod P
2017-10-01
To determine genetic diversity by comparing the whole genome sequences of cattle and human Mycobacterium bovis isolates from Baja California. A whole genome sequencing strategy was used to obtain the molecular fingerprints of 172 isolates of M. bovis obtained from Baja California, Mexico; 155 isolates were from cattle and 17 isolates were from humans. Spoligotypes were characterized in silico and single nucleotide polymorphism (SNP) differences between the isolates were evaluated. A total of 12 M. bovis spoligotype patterns were identified in cattle and humans. Two predominant spoligotypes patterns were seen in both cattle and humans: SB0145 and SB1040. The SB0145 spoligotype represented 59% of cattle isolates (n=91) and 65% of human isolates (n=11), while the SB1040 spoligotype represented 30% of cattle isolates (n=47) and 30% of human isolates (n=5). When evaluating SNP differences, the human isolates were intimately intertwined with the cattle isolates. All isolates from humans had spoligotype patterns that matched those observed in the cattle isolates, and all human isolates shared common ancestors with cattle in Baja California based on SNP analysis. This suggests that most human tuberculosis caused by M. bovis in Baja California is derived from M. bovis circulating in Baja California cattle. These results reinforce the importance of bovine tuberculosis surveillance and control in this region. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Oscar Franzén
2009-08-01
Full Text Available Giardia intestinalis is a major cause of diarrheal disease worldwide and two major Giardia genotypes, assemblages A and B, infect humans. The genome of assemblage A parasite WB was recently sequenced, and the structurally compact 11.7 Mbp genome contains simplified basic cellular machineries and metabolism. We here performed 454 sequencing to 16x coverage of the assemblage B isolate GS, the only Giardia isolate successfully used to experimentally infect animals and humans. The two genomes show 77% nucleotide and 78% amino-acid identity in protein coding regions. Comparative analysis identified 28 unique GS and 3 unique WB protein coding genes, and the variable surface protein (VSP repertoires of the two isolates are completely different. The promoters of several enzymes involved in the synthesis of the cyst-wall lack binding sites for encystation-specific transcription factors in GS. Several synteny-breaks were detected and verified. The tetraploid GS genome shows higher levels of overall allelic sequence polymorphism (0.5 versus <0.01% in WB. The genomic differences between WB and GS may explain some of the observed biological and clinical differences between the two isolates, and it suggests that assemblage A and B Giardia can be two different species.
[Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].
Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong
2008-05-01
One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.
Directory of Open Access Journals (Sweden)
Trout-Yakel Keri M
2010-02-01
Full Text Available Abstract Background A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis (PFGE revealed two similar but distinct AscI PFGE patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during PFGE. Results The chromosomes were collinear, but differences included 28 single nucleotide polymorphisms (SNPs and three indels, including a 33 kbp prophage that accounted for the observed difference in AscI PFGE patterns. The distribution of these traits was assessed within further clinical, environmental and food isolates associated with the outbreak, and this comparison indicated that three distinct, but highly related strains may have been involved in this nationwide outbreak. Notably, these two isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes. Conclusions High-throughput genome sequencing provided a more detailed real-time assessment of genetic traits characteristic of the outbreak strains than could be achieved with routine subtyping methods. This study confirms that the latest generation of DNA sequencing technologies can be applied during high priority public health events, and laboratories need to prepare for this inevitability and assess how to properly analyze and interpret whole genome sequences in the context of molecular epidemiology.
Sánchez-Navarro, J A; Pallás, V
1997-01-01
The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.
Directory of Open Access Journals (Sweden)
Mayumi Kamada
Full Text Available Bacillus subtilis is the main component in the fermentation of soybeans. To investigate the genetics of the soybean-fermenting B. subtilis strains and its relationship with the productivity of extracellular poly-γ-glutamic acid (γPGA, we sequenced the whole genome of eight B. subtilis stains isolated from non-salted fermented soybean foods in Southeast Asia. Assembled nucleotide sequences were compared with those of a natto (fermented soybean food starter strain B. subtilis BEST195 and the laboratory standard strain B. subtilis 168 that is incapable of γPGA production. Detected variants were investigated in terms of insertion sequences, biotin synthesis, production of subtilisin NAT, and regulatory genes for γPGA synthesis, which were related to fermentation process. Comparing genome sequences, we found that the strains that produce γPGA have a deletion in a protein that constitutes the flagellar basal body, and this deletion was not found in the non-producing strains. We further identified diversity in variants of the bio operon, which is responsible for the biotin auxotrophism of the natto starter strains. Phylogenetic analysis using multilocus sequencing typing revealed that the B. subtilis strains isolated from the non-salted fermented soybeans were not clustered together, while the natto-fermenting strains were tightly clustered; this analysis also suggested that the strain isolated from "Tua Nao" of Thailand traces a different evolutionary process from other strains.
Harrison, Robert L; Rowley, Daniel L; Keena, Melody A
2016-06-01
Isolates of the baculovirus species Lymantria dispar multiple nucleopolyhedrovirus have been formulated and applied to suppress outbreaks of the gypsy moth, L. dispar. To evaluate the genetic diversity in this species at the genomic level, the genomes of three isolates from Massachusetts, USA (LdMNPV-Ab-a624), Spain (LdMNPV-3054), and Japan (LdMNPV-3041) were sequenced and compared with four previously determined LdMNPV genome sequences. The LdMNPV genome sequences were collinear and contained the same homologous repeats (hrs) and clusters of baculovirus repeat orf (bro) gene family members in the same relative positions in their genomes, although sequence identities in these regions were low. Of 146 non-bro ORFs annotated in the genome of the representative isolate LdMNPV 5-6, 135 ORFs were found in every other LdMNPV genome, including the 37 core genes of Baculoviridae and other genes conserved in genus Alphabaculovirus. Phylogenetic inference with an alignment of the core gene nucleotide sequences grouped isolates 3041 (Japan) and 2161 (Korea) separately from a cluster containing isolates from Europe, North America, and Russia. To examine phenotypic diversity, bioassays were carried out with a selection of isolates against neonate larvae from three European gypsy moth (Lymantria dispar dispar) and three Asian gypsy moth (Lymantria dispar asiatica and Lymantria dispar japonica) colonies. LdMNPV isolates 2161 (Korea), 3029 (Russia), and 3041 (Japan) exhibited a greater degree of pathogenicity against all L. dispar strains than LdMNPV from a sample of Gypchek. This study provides additional information on the genetic diversity of LdMNPV isolates and their activity against the Asian gypsy moth, a potential invasive pest of North American trees and forests. Published by Elsevier Inc.
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
Base Sequence Context Effects on Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
Yuqin Cai
2010-01-01
Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.
Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K
2010-03-09
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Molecular characterization of two isolates of sweet potato leaf curl ...
African Journals Online (AJOL)
Comparison analysis showed that DNA-A sequence of JS1 isolate was closely related to that of sweet potato leaf curl virus (SPLCV) from United States with nucleotide sequence identity of 97.0% and DNA-A of Y338 showed highest sequence identity at 97.8% with an isolate of SPLCV from China. Phylogenetic analysis ...
Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.
Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin
2008-01-01
The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.
Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y
1998-07-01
An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.
Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.
Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos
2004-08-01
Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd
Directory of Open Access Journals (Sweden)
Hae-Ryun Kwak
2015-12-01
Full Text Available Sweet potatoes (Ipomea batatas L. are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV, Sweet potato virus C (SPVC, Sweet potato virus G (SPVG, Sweet potato virus 2 (SPV2, and Sweet potato latent virus (SPLV, have been detected in sweet potato fields at a high (~95% incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88% nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.
Directory of Open Access Journals (Sweden)
N.L.P Indi Dharmayanti
2003-06-01
Full Text Available Infectious Bronchitis is a contagious and acute respiratory disease in chickens caused by infectious bronchitis virus (IBV.Antigenic differences in IBV are associated with changes in the sequence of the spike glycoprotein (S. The subunit S1 which demonstrates more sequence variability than S-2 have been identified as hypervariable region (HVR-1 and 2. There were several IB virus field isolates included I-37 have been identified in Indonesia by serum neutralization method. However, gene sequence variation in HVR subunit S-1 had not yet been identified. Isolate I-37 was close to the serotype Connecticut 46 (Conn 46. The aim of this study is to identify sequence variation of HVR subunit S-1 gene of isolate I-37 produced by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR and sequencing. Several procedures were carried out in the study including virus titration, propagation and was concentrated from the allantoic fluid infected with IBV. Then, RNA was extracted for RTPCR. urther the product was sequnced and its homology with IBV references from GenBank was compared by GenMac version 8.0. Result showed that isolate I-37 produced 515 bp of amplification product. Isolate I-37 and Conn 46 are same serotype, yet their HVR subunit S-1 nucleotides and amino acids (protein differ by 6.9% and 15.6% respectively. It might be concluded that isolate I-37 was variant of Conn 46.
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik
2017-03-01
The genus Microbacterium contains bacteria that are ubiquitously distributed in various environments and includes plant-associated bacteria that are able to colonize tissue of agricultural crop plants. Here, we report the 3,508,491 bp complete genome sequence of Microbacterium sp. strain BH-3-3-3, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017674.
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil
Directory of Open Access Journals (Sweden)
Thor Vinícius Martins Fajardo
2015-12-01
Full Text Available ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV, except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP and coat (CP protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of the MP and CP nucleotide sequences of a Brazilian PNRSV isolate from rose and others from this same host showed highest identities of 96.7% and 98.6%, respectively, and Rose-Br isolate was classified in PV32 group.
Isolation of a sex-linked DNA sequence in cranes.
Duan, W; Fuerst, P A
2001-01-01
A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.
Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1
Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for
Directory of Open Access Journals (Sweden)
Gilbert Gwendolyn L
2008-08-01
Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M
2008-08-19
Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
MULTILOCUS SEQUENCE TYPING OF BRUCELLA ISOLATES FROM THAILAND.
Chawjiraphan, Wireeya; Sonthayanon, Piengchan; Chanket, Phanita; Benjathummarak, Surachet; Kerdsin, Anusak; Kalambhaheti, Thareerat
2016-11-01
Although brucellosis outbreaks in Thailand are rare, they cause abortions and infertility in animals, resulting in significant economic loss. Because Brucella spp display > 90% DNA homology, multilocus sequence typing (MLST) was employed to categorize local Brucella isolates into sequence types (STs) and to determine their genetic relatedness. Brucella samples were isolated from vaginal secretion of cows and goats, and from blood cultures of infected individuals. Brucella species were determined by multiplex PCR of eight loci, in addition to MLST based on partial DNA sequences of nine house-keeping genes. MLST analysis of 36 isolates revealed 78 distinct novel allele types and 34 novel STs, while two isolates possessed the known ST8. Sequence alignments identified polymorphic sites in each allele, ranging from 2-6%, while overall genetic diversity was 3.6%. MLST analysis of the 36 Brucella isolates classified them into three species, namely, B. melitensis, B. abortus and B. suis, in agreement with multiplex PCR results. Genetic relatedness among ST members of B. melitensis and B. abortus determined by eBURST program revealed ST2 as founder of B. abortus isolates and ST8 the founder of B. melitensis isolates. ST 36, 41 and 50 of Thai Brucella isolates were identified as single locus variants of clonal cluster (CC) 8, while the majority of STs were diverse. The genetic diversity and relatedness identified using MLST revealed hitherto unexpected diversity among Thai Brucella isolates. Genetic classification of isolates could reveal the route of brucellosis transmission among humans and farm animals and also reveal their relationship with other isolates in the region and other parts of the world.
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase
International Nuclear Information System (INIS)
Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.
1987-01-01
A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants
Basavanna, Uma; Gonzalez-Escalona, Narjol; Timme, Ruth; Datta, Shomik; Schoen, Brianna; Brown, Eric W; Zink, Donald; Sharma, Shashi K
2013-01-01
Clostridium botulinum is a pathogen of concern for low-acid canned foods. Here we report draft genomes of a neurotoxin-producing C. botulinum strain isolated from water samples used for cooling low-acid canned foods at a canning facility. The genome sequence confirmed that this strain belonged to C. botulinum serotype B1, albeit with major differences, including thousands of unique single nucleotide polymorphisms (SNPs) compared to other genomes of the same serotype.
Basavanna, Uma; Gonzalez-Escalona, Narjol; Timme, Ruth; Datta, Shomik; Schoen, Brianna; Brown, Eric W.; Zink, Donald; Sharma, Shashi K.
2013-01-01
Clostridium botulinum is a pathogen of concern for low-acid canned foods. Here we report draft genomes of a neurotoxin-producing C.?botulinum strain isolated from water samples used for cooling low-acid canned foods at a canning facility. The genome sequence confirmed that this strain belonged to C.?botulinum serotype B1, albeit with major differences, including thousands of unique single nucleotide polymorphisms (SNPs) compared to other genomes of the same serotype.
Chauhan, Sushma
2018-04-22
Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp–2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas.
Directory of Open Access Journals (Sweden)
Emmanuel Haruna
2017-12-01
Full Text Available Here we report the draft genome sequence of an endophytic Paenibacillus tyrfis strain isolated from the Universiti Kebangsaan Malaysia reserve forest, Malaysia. The genome size was approximately 8.04 Mb, and the assembly consisted of 107 scaffolds with 168 contigs, and had a G + C content of 53%. Phylogenetic analysis of strain SUK123 using the 16S rRNA gene revealed that it belonged to the family Paenibacillaceae with the highest similarity to Paenibacillus elgii SDT (99%. Whole genome comparison of SUK123 with related species using average nucleotide identity (ANI analysis revealed a similarity of 98% to Paenibacillus tyrfis Mst1T, 94% to Paenibacillus elgii B69T, 91% to Paenibacillus ehimensis A2T, 68% to Paenibacillus polymyxa SC2T and 69% to Paenibacillus alvei DMS29T. The draft genome was deposited at the European Nucleotide Archive (PRJEB21373.
Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.
Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima
2017-10-16
Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Cloning and sequencing of the gene for human β-casein
International Nuclear Information System (INIS)
Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.
1990-01-01
Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression
Putaporntip, Chaturong; Hughes, Austin L; Jongwutiwes, Somchai
2013-01-01
The merozoite surface protein-1 (MSP-1) is a candidate target for the development of blood stage vaccines against malaria. Polymorphism in MSP-1 can be useful as a genetic marker for strain differentiation in malarial parasites. Although sequence diversity in the MSP-1 locus has been extensively analyzed in field isolates of Plasmodium falciparum and P. vivax, the extent of variation in its homologues in P. ovale curtisi and P. ovale wallikeri, remains unknown. Analysis of the mitochondrial cytochrome b sequences of 10 P. ovale isolates from symptomatic malaria patients from diverse endemic areas of Thailand revealed co-existence of P. ovale curtisi (n = 5) and P. ovale wallikeri (n = 5). Direct sequencing of the PCR-amplified products encompassing the entire coding region of MSP-1 of P. ovale curtisi (PocMSP-1) and P. ovale wallikeri (PowMSP-1) has identified 3 imperfect repeated segments in the former and one in the latter. Most amino acid differences between these proteins were located in the interspecies variable domains of malarial MSP-1. Synonymous nucleotide diversity (πS) exceeded nonsynonymous nucleotide diversity (πN) for both PocMSP-1 and PowMSP-1, albeit at a non-significant level. However, when MSP-1 of both these species was considered together, πS was significantly greater than πN (pdiversity at this locus prior to speciation. Phylogenetic analysis based on conserved domains has placed PocMSP-1 and PowMSP-1 in a distinct bifurcating branch that probably diverged from each other around 4.5 million years ago. The MSP-1 sequences support that P. ovale curtisi and P. ovale wallikeri are distinct species. Both species are sympatric in Thailand. The low level of sequence diversity in PocMSP-1 and PowMSP-1 among Thai isolates could stem from persistent low prevalence of these species, limiting the chance of outcrossing at this locus.
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Steenbergh, P.H.; Sussenbach, J.S.
The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the
Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.
Liljeström, P L; Liljeström, P
1987-01-01
Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...
Davis, Ronald L.; Davidson, Norman
1984-01-01
Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed w...
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Molecular characterization of Giardia psittaci by multilocus sequence analysis.
Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi
2012-12-01
Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.
1987-01-01
Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative
Identification of Turnip mosaic virus isolated from canola in northeast ...
African Journals Online (AJOL)
Phylogenetic analyses based on ClustalW multiple alignments with previously reported 33 isolates indicated 88 to 98% similarity in nucleotide and 94 to 99% in amino acid levels among isolates. TuMV-IRN GSK represented the highest identity to another Iranian isolate (IRN TRa6). Phylogenetic tree clustered all sequences ...
Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme
2013-07-01
The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.
Kumar, A; Kumar, J; Khan, J A
2010-04-01
Diseased cotton plants showing typical leaf curl symptoms were collected from experimental plot of Agriculture Research Station-Sriganganagar, Rajasthan. Complete DNA-A component from samples taken from two areas were amplified through rolling circle amplification (RCA) using templiphi kit (GE Healthcare) and characterized. DNA-A of one isolate consists of 2751 nucleotides and second isolate of 2759 nucleotide. Both sequences comprised six ORF's. Genome organization of DNA-A of one isolate shows high sequence similarity with other characterized local begomovirus isolates of Rajasthan, while other isolate shows high sequence similarity with CLCuV reported from Pakistan. The maximum similarity of first isolate, CLCuV-SG01, shows highest sequence identity with Cotton leaf curl Abohar (Rajasthan) virus, and second isolate, CLCuV-SG02, shows highest sequence identity with cotton leaf curl virus from Pakistan. Both isolates showed 85% similarities with each other. The sequence data revealed probable infiltration of some strains of Cotton leaf curl virus from Pakistan to India, or co-existence of different isolates under similar geographical conditions. While CLCuV-SG01 shows highest nt sequence similarity with CLCuV Rajasthan (Abohar), nt identity of V1 ORF (encoding coat protein) of SG01 shows the highest nt identity (100%) with CLCuV Multan (Bhatinda) and Abohar virus while AC1 region also showed difference. Complete nucleotide sequence of SG01 shows only 86% similarity with CLCuV Multan virus. Similarity search revealed significant difference in AV1 and AC1 regions with respect to DNA-A suggesting an evolutionary history of recombination. Computer based analysis, recombination detection Program (RDP) supports the recombination hypothesis, indicated that recombination with other begomoviruses had taken place within V1 ORF and AC1 ORF of CLCuV-SG01 and AC1 ORF of CLCuV-SG02 and also in noncoding intergenic region (IR).
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...
Ito, Hiroya; Takahashi, Sayaka; Asai, Tetsuo; Tamura, Yutaka; Yamamoto, Koshi
2018-01-01
An atypical urease-negative mutant of Actinobacillus pleuropneumoniae serovar 2 was isolated in Japan. Nucleotide sequence analysis of the urease gene cluster revealed that the insertion of a short DNA sequence into the cbiM gene was responsible for the urease-negative activity of the mutant. Veterinary diagnostic laboratories should be watchful for the presence of aberrant urease-negative A. pleuropneumoniae isolates.
Chauhan, Sushma; Rahman, Hifzur; Mastan, Shaik G; Pamidimarri, D V N Sudheer; Reddy, Muppala P
2018-07-20
Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp-2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas. Copyright © 2018 Elsevier B.V. All rights reserved.
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P
2005-05-01
The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
Phylogenetic Analysis of Apple scar skin viroid Isolates in Korea
Directory of Open Access Journals (Sweden)
Kang Hee Cho
2015-12-01
Full Text Available To identify genome sequences of Apple scar skin viroid (ASSVd isolates in Korea, the field survey was performed from ‘Hongro’ apple orchards located in eight sites in South Korea (Bongwha, Cheongsong, Dangjin, Gimchoen, Muju, Mungyeong, Suwon, and Yeongwol. ASSVd was detected by RT-PCR and PCR fragments were cloned into cloning vector. Full-length viral genomes of eight ASSVd isolates were sequenced and compared with 21 isolates reported previously from Korea, India, China, Japan and Greece. Eight isolates in this study showed 92.2-99.7% nucleotide sequence identities with those reported previously. Phylogenetic analysis showed that seven isolates reported in this study belong to the same group distinct from other groups.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
International Nuclear Information System (INIS)
Dinur, T.; Osiecki, K.M.; Legler, G.; Gatt, S.; Desnick, R.J.; Grabowski, G.A.
1986-01-01
Human acid β-glucosidase (D-glucosyl-N-acylsphingosine glucohydrolase, EC 3.2.1.45) cleaves the glucosidic bonds of glucosylceramide and synthetic β-glucosides. The deficient activity of this hydrolase is the enzymatic defect in the subtypes and variants of Gaucher disease, the most prevalent lysosomal storage disease. To isolate and characterize the catalytic site of the normal enzyme, brominated 3 H-labeled conduritol B epoxide ( 3 H-Br-CBE), which inhibits the enzyme by binding covalently to this site, was used as an affinity label. Under optimal conditions 1 mol of 3 H-Br-CBE bound to 1 mol of pure enzyme protein, indicating the presence of a single catalytic site per enzyme subunit. After V 8 protease digestion of the 3 H-Br-CBE-labeled homogeneous enzyme, three radiolabeled peptides, designated peptide A, B, or C, were resolved by reverse-phase HPLC. The partial amino acid sequence (37 residues) of peptide A (M/sub r/, 5000) was determined. The sequence of this peptide, which contained the catalytic site, had exact homology to the sequence near the carboxyl terminus of the protein, as predicted from the nucleotide sequence of the full-length cDNA encoding acid β-glucosidase
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L
2003-10-01
The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.
Directory of Open Access Journals (Sweden)
Yuki Furuse
2015-11-01
Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.
Molecular characterization of two prunus necrotic ringspot virus isolates from Canada.
Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming
2012-05-01
We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.
Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio
2005-12-20
Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.
Dingle, K.E.; Blaser, M.J.; Tu, Z.C.; Pruckler, J.; Fitzgerald, C.; Bergen, van M.A.P.; Lawson, A.J.; Owen, R.J.; Wagenaar, J.A.
2010-01-01
Reptile Campylobacter fetus isolates and closely related strains causing human disease were characterized by multilocus sequence typing. They shared similar to 90% nucleotide sequence identity with classical mammalian C. fetus, and there was evidence of recombination among members of these two
CPm gene diversity in field isolates of Citrus tristeza virus from Colombia.
Oliveros-Garay, Oscar Arturo; Martinez-Salazar, Natalhie; Torres-Ruiz, Yanneth; Acosta, Orlando
2009-01-01
The nucleotide sequence diversity of the CPm gene from 28 field isolates of Citrus tristeza virus (CTV) was assessed by SSCP and sequence analyses. These isolates showed two major shared haplotypes, which differed in distribution: A1 was the major haplotype in 23 isolates from different geographic regions, whereas R1 was found in isolates from a discrete region. Phylogenetic reconstruction clustered A1 within an independent group, while R1 was grouped with mild isolates T30 from Florida and T385 from Spain. Some isolates contained several minor haplotypes, which were very similar to, and associated with, the major haplotype.
Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen
2013-01-01
The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).
Directory of Open Access Journals (Sweden)
Elizabeth N. Krueger
2013-07-01
Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.
Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates
Heunis, Tiaan
2017-08-18
Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach we identified 59 peptides containing single amino acid variants, which covered ~9% of all total coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e. large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.
Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates
Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M.; van Helden, Paul D.; van der Merwe, Ruben G.; Gey van Pittius, Nicolaas C.; Pain, Arnab; Sampson, Samantha L.; Tabb, David L.
2017-01-01
Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach we identified 59 peptides containing single amino acid variants, which covered ~9% of all total coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e. large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.
Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.
Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L
2017-10-06
Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.
Chen, Hao; Dou, Yanguo; Tang, Yi; Zhang, Zhenjie; Zheng, Xiaoqiang; Niu, Xiaoyu; Yang, Jing; Yu, Xianglong; Diao, Youxiang
2015-01-01
A newly emerged duck parvovirus, which causes beak atrophy and dwarfism syndrome (BADS) in Cherry Valley ducks, has appeared in Northern China since March 2015. To explore the genetic diversity among waterfowl parvovirus isolates, the complete genome of an identified isolate designated SDLC01 was sequenced and analyzed in the present study. Genomic sequence analysis showed that SDLC01 shared 90.8%-94.6% of nucleotide identity with goose parvovirus (GPV) isolates and 78.6%-81.6% of nucleotide identity with classical Muscovy duck parvovirus (MDPV) isolates. Phylogenetic analysis of 443 nucleotides (nt) of the fragment A showed that SDLC01 was highly similar to a mule duck isolate (strain D146/02) and close to European GPV isolates but separate from Asian GPV isolates. Analysis of the left inverted terminal repeat regions revealed that SDLC01 had two major segments deleted between positions 160-176 and 306-322 nt compared with field GPV and MDPV isolates. Phylogenetic analysis of Rep and VP1 encoded by two major open reading frames of parvoviruses revealed that SDLC01 was distinct from all GPV and MDPV isolates. The viral pathogenicity and genome characterization of SDLC01 suggest that the novel GPV (N-GPV) is the causative agent of BADS and belongs to a distinct GPV-related subgroup. Furthermore, N-GPV sequences were detected in diseased ducks by polymerase chain reaction and viral proliferation was demonstrated in duck embryos and duck embryo fibroblast cells.
First complete genome sequence of parainfluenza virus 5 isolated from lesser panda.
Zhai, Jun-Qiong; Zhai, Shao-Lun; Lin, Tao; Liu, Jian-Kui; Wang, He-Xing; Li, Bing; Zhang, He; Zou, Shu-Zhan; Zhou, Xia; Wu, Meng-Fan; Chen, Wu; Luo, Man-Lin
2017-05-01
Parainfluenza virus 5 (PIV5) is widespread in mammals and humans. Up to now, there is little information about PIV5 infection in lesser pandas. In this study, a PIV5 variant (named ZJQ-221) was isolated from a lesser panda with respiratory disease in Guangzhou zoo in Guangdong province, southern China. The full-length genome of ZJQ-221 was found to be 15,246 nucleotides and consisted of seven non-overlapping genes encoding eight proteins (i.e., NP, V, P, M, F, SH, HN and L). Sequence alignment and genetic analysis revealed that ZJQ-221 shared a close relationship with a PIV5 strain of canine-origin (1168-1) from South Korea. The findings of this study confirm the presence of PIV5 in lesser panda and indicate this mammal as a possible natural reservoir. Furthermore they highlight the urgent need to strengthen viral surveillance and control of PIV5 in zoo animals.
The genome sequence of four isolates from the family Lichtheimiaceae.
Chibucos, Marcus C; Etienne, Kizee A; Orvis, Joshua; Lee, Hongkyu; Daugherty, Sean; Lockhart, Shawn R; Ibrahim, Ashraf S; Bruno, Vincent M
2015-07-01
This study reports the release of draft genome sequences of two isolates of Lichtheimia corymbifera and two isolates of L. ramosa. Phylogenetic analyses indicate that the two L. corymbifera strains (CDC-B2541 and 008-049) are closely related to the previously sequenced L. corymbifera isolate (FSU 9682) while our two L. ramosa strains CDC-B5399 and CDC-B5792 cluster apart from them. These genome sequences will further the understanding of intraspecies and interspecies genetic variation within the Mucoraceae family of pathogenic fungi. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
GALAVANI, Hossein; GHOLIZADEH, Saber; HAZRATI TAPPEH, Khosrow
2016-01-01
Background: Fascioliasis, caused by Fasciola hepatica and F. gigantica, has medical and economic importance in the world. Molecular approaches comparing traditional methods using for identification and characterization of Fasciola spp. are precise and reliable. The aims of current study were molecular characterization of Fasciola spp. in West Azerbaijan Province, Iran and then comparative analysis of them using GenBank sequences. Methods: A total number of 580 isolates were collected from different hosts in five cities of West Azerbaijan Province, in 2014 from 90 slaughtered cattle (n=50) and sheep (n=40). After morphological identification and DNA extraction, designing specific primer were used to amplification of ITS1, 5.8s and ITS2 regions, 50 samples were conducted to sequence, randomly. Result: Using morphometric characters 99.14% and 0.86% of isolates identified as F. hepatica and F. gigantica, respectively. PCR amplification of 1081 bp fragment and sequencing result showed 100% similarity with F. hepatica in ITS1 (428 bp), 5.8s (158 bp), and ITS2 (366 bp) regions. Sequence comparison among current study sequences and GenBank data showed 98% identity with 11 nucleotide mismatches. However, in phylogenetic tree F. hepatica sequences of West Azerbaijan Province, Iran, were in a close relationship with Iranian, Asian, and African isolates. Conclusions: Only F. hepatica species is distributed among sheep and cattle in West Azerbaijan Province Iran. However, 5 and 6 bp variation in ITS1 and ITS2 regions, respectively, is not enough to separate of Fasciola spp. Therefore, more studies are essential for designing new molecular markers to correct species identification. PMID:27095969
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M
1984-01-01
We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.
Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W
1989-01-01
A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...
Directory of Open Access Journals (Sweden)
Bingjun eDang
2016-02-01
Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.
The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses
Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.
2002-01-01
The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and
Multilocus Sequence Typing for Interpreting Blood Isolates of Staphylococcus epidermidis
Directory of Open Access Journals (Sweden)
Prannda Sharma
2014-01-01
Full Text Available Staphylococcus epidermidis is an important cause of nosocomial infection and bacteremia. It is also a common contaminant of blood cultures and, as a result, there is frequently uncertainty as to its diagnostic significance when recovered in the clinical laboratory. One molecular strategy that might be of value in clarifying the interpretation of S. epidermidis identified in blood culture is multilocus sequence typing. Here, we examined 100 isolates of this species (50 blood isolates representing true bacteremia, 25 likely contaminant isolates, and 25 skin isolates and the ability of sequence typing to differentiate them. Three machine learning algorithms (classification regression tree, support vector machine, and nearest neighbor were employed. Genetic variability was substantial between isolates, with 44 sequence types found in 100 isolates. Sequence types 2 and 5 were most commonly identified. However, among the classification algorithms we employed, none were effective, with CART and SVM both yielding only 73% diagnostic accuracy and nearest neighbor analysis yielding only 53% accuracy. Our data mirror previous studies examining the presence or absence of pathogenic genes in that the overlap between truly significant organisms and contaminants appears to prevent the use of MLST in the clarification of blood cultures recovering S. epidermidis.
Virulence and molecular polymorphism of Prunus necrotic ringspot virus isolates.
Hammond, R W; Crosslin, J M
1998-07-01
Prunus necrotic ringspot virus (PNRSV) occurs as numerous strains or isolates that vary widely in their pathogenic, biophysical and serological properties. Prior attempts to distinguish pathotypes based upon physical properties have not been successful; our approach was to examine the molecular properties that may distinguish these isolates. The nucleic acid sequence was determined from 1.65 kbp RT-PCR products derived from RNA 3 of seven distinct isolates of PNRSV that differ serologically and in pathology on sweet cherry. Sequence comparisons of ORF 3a (putative movement protein) and ORF 3b (coat protein) revealed single nucleotide and amino acid differences with strong correlations to serology and symptom types (pathotypes). Sequence differences between serotypes and pathotypes were also reflected in the overall phylogenetic relationships between the isolates.
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Molecular Variability Among Isolates of Prunus Necrotic Ringspot Virus from Different Prunus spp.
Aparicio, F; Myrta, A; Di Terlizzi, B; Pallás, V
1999-11-01
ABSTRACT Viral sequences amplified by polymerase chain reaction from 25 isolates of Prunus necrotic ringspot virus (PNRSV), varying in the symptomatology they cause in six different Prunus spp., were analyzed for restriction fragment polymorphisms. Most of the isolates could be discriminated by using a combination of three different restriction enzymes. The nucleotide sequences of the RNA 4 of 15 of these isolates were determined. Sequence comparisons and phylogenetic analyses of the RNA 4 and coat proteins (CPs) revealed that all of the isolates clustered into three different groups, represented by three previously sequenced PNRSV isolates: PV32, PE5, and PV96. The PE5-type group was characterized by a 5' untranslated region that was clearly different from that of the other two groups. The PV32-type group was characterized by an extra hexanucleotide consisting of a duplication of the six immediately preceding nucleotides. Although most of the variability was observed in the first third of the CP, the amino acid residues in this region, which were previously thought to be functionally important in the replication cycle of the virus, were strictly conserved. No clear correlation with the type of symptom or host specificity could be observed. The validity of this grouping was confirmed when other isolates recently characterized by other authors were included in these analyses.
Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong
2018-04-05
Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome
Characterization of race 65 of Colletotrichum lindemuthianum by sequencing ITS regions
Directory of Open Access Journals (Sweden)
Marcela Coelho
2016-09-01
Full Text Available The present work aimed characterize isolates of C. lindemuthianum race 65 from different regions in Brazil by ITS sequencing. A total of 17 isolates of race 65, collected in the states of Mato Grosso, Minas Gerais, Paraná, Santa Catarina and São Paulo, were studied. Analysis of the sequences of isolates 8, 9, 12, 14 and 15 revealed the presence of two single nucleotide polymorphisms (SNPs in the ITS1 region at the same positions. These isolates, when analyzed together with the sequence of isolate 17, revealed a SNP in the ITS2 region. The highest genetic dissimilarity, observed between isolates 11 and 3 and between isolates 11 and 10, was 0.772. In turn, isolates 7 and 2 were the most similar, with a value of 0.002 for genetic distance. The phylogenetic tree obtained based on the sequences of the ITS1 and ITS2 regions revealed the formation of two groups, one with a subgroup. The results reveal high molecular variability among isolates of race 65 of C. lindemuthianum.
Complete genome sequence of pronghorn virus, a pestivirus
The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
Hu, Beixia; Huang, Yanyan; He, Yefeng; Xu, Chuantian; Lu, Xishan; Zhang, Wei; Meng, Bin; Yan, Shigan; Zhang, Xiumei
2010-07-29
In order to determine the actual prevalence of avian influenza virus (AIV) and Newcastle disease virus (NDV) in ducks in Shandong province of China, extensive surveillance studies were carried out in the breeding ducks of an intensive farm from July 2007 to September 2008. Each month cloacal and tracheal swabs were taken from 30 randomly selected birds that appeared healthy. All of the swabs were negative for influenza A virus recovery, whereas 87.5% of tracheal swabs and 100% cloacal swabs collected in September 2007, were positive for Newcastle disease virus isolation. Several NDV isolates were recovered from tracheal and cloacal swabs of apparently healthy ducks. All of the isolates were apathogenic as determined by the MDT and ICPI. The HN gene and the variable region of F gene (nt 47-420) of four isolates selected at random were sequenced. A 374 bp region of F gene and the full length of HN gene were used for phylogenetic analysis. Four isolates were identified as the same isolate based on nucleotide sequences identities of 99.2-100%, displaying a closer phylogenetic relationship to lentogenic Class I viruses. There were 1.9-9.9% nucleotide differences between the isolates and other Class I virus in the variable region of F gene (nt 47-420), whereas there were 38.5-41.2% nucleotide difference between the isolates and Class II viruses. The amino acid sequences of the F protein cleavage sites in these isolates were 112-ERQERL-117. The full length of HN gene of these isolates was 1851 bp, coding 585 amino acids. The homology analysis of the nucleotide sequence of HN gene indicated that there were 2.0-4.2% nucleotide differences between the isolates and other Class I viruses, whereas there were 29.5-40.9% differences between the isolates and Class II viruses. The results shows that these isolates are not phylogenetically related to the vaccine strain (LaSota). This study adds to the understanding of the ecology of influenza viruses and Newcastle disease viruses in
Directory of Open Access Journals (Sweden)
Ebrahimi, M.
2014-11-01
Full Text Available The earliest evidences on circulation of Avian Influenza (AI virus on the Iranian poultry farms date back to 1998. Great economic losses through dramatic drop in egg production and high mortality rates are characteristically attributed to H9N2 AI virus. In the present work non-structural (NS genes of 10 Iranian H9N2 chicken AI viruses collected during 1998-2007 were fully sequenced and subjected to a phylogenetic analysis. The observations proved allele A was the single-detectable type of the NS gene within the studied isolates. All the examined Iranian isolates fell into the Korean sublineage with a relatively broad sequence homology (91.6-98% in nucleotide construction of the NS genes. The motif for PDZ ligand recognition of the group one isolates was either EDEV (N=6 or ESEV (N=1 While all viruses as group two contained a PL motif “KSEV” (N=3. The present work provides useful epidemiological data at molecular level on source and contemporary evolution of H9N2 virus population in Iran.
Sudeep, A B; Bondre, V P; Gurav, Y K; Gokhale, M D; Sapkal, G N; Mavale, M S; George, R P; Mishra, A C
2014-05-01
An outbreak of acute encephalitis syndrome was reported from Vidarbha region of Maharashtra s0 tate, India, during July 2012. Anti-IgM antibodies against Chandipura virus (CHPV) were detected in clinical samples. Sandfly collections were done to determine their role in CHPV transmission. Twenty nine pools of Sergentomyia spp. comprising 625 specimens were processed for virus isolation in Vero E6 cell line. Diagnostic RT-PCR targeting N-gene was carried out with the sample that showed cytopathic effects (CPE). The PCR product was sequenced, analysed and the sequences were deposited in Genbank database. CPE in Vero E6 cell line infected with three pools was detected at 48 h post infection. However, virus could be isolated only from one pool. RT-PCR studies demonstrated 527 nucleotide product that confirmed the agent as CHPV. Sequence analysis of the new isolate showed difference in 10-12 nucleotides in comparison to earlier isolates. This is perhaps the first isolation of CHPV from Sergentomyia spp. in India and virus isolation during transmission season suggests their probable role in CHPV transmission. Further studies need to be done to confirm the precise role of Sargentomyia spp. in CHPV transmission.
Completed sequence and corrected annotation of the genome of maize Iranian mosaic virus.
Ghorbani, Abozar; Izadpanah, Keramatollah; Dietzgen, Ralf G
2018-03-01
Maize Iranian mosaic virus (MIMV) is a negative-sense single-stranded RNA virus that is classified in the genus Nucleorhabdovirus, family Rhabdoviridae. The MIMV genome contains six open reading frames (ORFs) that encode in 3΄ to 5΄ order the nucleocapsid protein (N), phosphoprotein (P), putative movement protein (P3), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). In this study, we determined the first complete genome sequence of MIMV using Illumina RNA-Seq and 3'/5' RACE. MIMV genome ('Fars' isolate) is 12,426 nucleotides in length. Unexpectedly, the predicted N gene ORF of this isolate and of four other Iranian isolates is 143 nucleotides shorter than that of the MIMV coding-complete reference isolate 'Shiraz 1' (Genbank NC_011542), possibly due to a minor error in the previous sequence. Genetic variability among the N, P, P3 and G ORFs of Iranian MIMV isolates was limited, but highest in the G gene ORF. Phylogenetic analysis of complete nucleorhabdovirus genomes demonstrated a close evolutionary relationship between MIMV, maize mosaic virus and taro vein chlorosis virus.
Directory of Open Access Journals (Sweden)
Ellis David
2009-08-01
Full Text Available Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA-based method to detect a series of mutations in the C. albicans ERG11 gene using "reference" azole-resistant isolates with known mutations. The method was then used to estimate the frequency of ERG11 mutations and their type in 25 Australian clinical C. albicans isolates with reduced susceptibility to fluconazole and in 23 fluconazole-susceptible isolates. RCA results were compared DNA sequencing. Results The RCA assay correctly identified all ERG11 mutations in eight "reference" C. albicans isolates. When applied to 48 test strains, the RCA method showed 100% agreement with DNA sequencing where an ERG11 mutation-specific probe was used. Of 20 different missense mutations detected by sequencing in 24 of 25 (96% isolates with reduced fluconazole susceptibility, 16 were detected by RCA. Five missense mutations were detected by both methods in 18 of 23 (78% fluconazole-susceptible strains. DNA sequencing revealed that mutations in non-susceptible isolates were all due to homozygous nucleotide changes. With the exception of the mutations leading to amino acid substitution E266D, those in fluconazole-susceptible strains were heterozygous. Amino acid substitutions common to both sets of isolates were D116E, E266D, K128T, V437I and V488I. Substitutions unique to isolates with reduced fluconazole susceptibility were G464 S (n = 4 isolates, G448E (n = 3, G307S (n = 3, K143R (n = 3 and Y123H, S405F and R467K (each n = 1. DNA sequencing revealed a novel substitution, G450V, in one isolate. Conclusion The sensitive RCA
First complete genome sequence of canine bocavirus 2 in mainland China
Directory of Open Access Journals (Sweden)
S.-L. Zhai
2017-07-01
Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.
Guo, D; Maiss, E; Adam, G; Casper, R
1995-05-01
The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.
Directory of Open Access Journals (Sweden)
LANGKAH SEMBIRING
2009-09-01
Full Text Available Intrageneric diversity of 556 streptomycetes isolated from the rhizosphere of tropical legume was determined by using molecular taxonomic method based on 16S rDNA. A total of 46 isolates were taken to represent 37 colour groups of the isolates. 16S rDNA were amplified and subsequently sequenced and the sequences data were aligned with streptomycete sequences retrieved from the ribosomal data base project (RDP data. Phylogenetic trees were generated by using the PHYLIP software package and the matrix of nucleotide similarity and nucleotide difference were generated by using PHYDIT software. The results confirmed and extended the value of 16S rDNA sequencing in streptomycete systematic. The 16S rDNA sequence data showed that most of the tested colour group representatives formed new centers of taxonomic variation within the genus Streptomyces. The generic assignment of these organisms was underpinned by 16S rDNA sequence data which also suggested that most of the strains represented new centers of taxonomic variation. The taxonomic data indicate that diverse populations of streptomycetes are associated with the roots of tropical legume (P. falcataria. Therefore, the combination of selective isolation and molecular taxonomic procedures used in this study provide a powerful way of uncovering new centers of taxonomic variation within the genus Streptomyces.
Variability of geographically distinct isolates of maize rayado fino virus in Latin America.
Hammond, R W; Kogel, R; Ramirez, P
1997-12-01
We have examined the molecular epidemiology of the leafhopper-borne maize rayado fino virus (MRFV) in Latin America. The coat protein gene and 3' non-translated region of 14 isolates of MRFV collected from Latin America and the United States were sequenced and phylogenetic relationships examined. The nucleotide sequence revealed remarkable conservation, with a sequence similarity of 88-99%. Phylogenetic analysis of sequence data obtained from a 633 bp fragment showed that MRFV has diverged into three main clusters, i.e. the geographically distinct northern and southern isolates and the Colombian isolates. Significant differences between the isolates collected from Colombia, previously named maize rayado colombiana virus, based upon differences in symptomatology and serological relationships to MRFV, and the other MRFV isolates, provides additional evidence supporting its designation as a unique strain of MRFV.
Benmansour, A.; Bascuro, B.; Monnier, A.F.; Vende, P.; Winton, J.R.; de Kinkelin, P.
1997-01-01
To evaluate the genetic diversity of viral haemorrhagic septicaemia virus (VHSV), the sequence of the glycoprotein genes (G) of 11 North American and European isolates were determined. Comparison with the G protein of representative members of the family Rhabdoviridae suggested that VHSV was a different virus species from infectious haemorrhagic necrosis virus (IHNV) and Hirame rhabdovirus (HIRRV). At a higher taxonomic level, VHSV, IHNV and HIRRV formed a group which was genetically closest to the genus Lyssavirus. Compared with each other, the G genes of VHSV displayed a dissimilar overall genetic diversity which correlated with differences in geographical origin. The multiple sequence alignment of the complete G protein, showed that the divergent positions were not uniformly distributed along the sequence. A central region (amino acid position 245-300) accumulated substitutions and appeared to be highly variable. The genetic heterogeneity within a single isolate was high, with an apparent internal mutation frequency of 1.2 x 10(-3) per nucleotide site, attesting the quasispecies nature of the viral population. The phylogeny separated VHSV strains according to the major geographical area of isolation: genotype I for continental Europe, genotype II for the British Isles, and genotype III for North America. Isolates from continental Europe exhibited the highest genetic variability, with sub-groups correlated partially with the serological classification. Neither neutralizing polyclonal sera, nor monoclonal antibodies, were able to discriminate between the genotypes. The overall structure of the phylogenetic tree suggests that VHSV genetic diversity and evolution fit within the model of random change and positive selection operating on quasispecies.
Tóbiás, István; Palkovics, László
2003-04-01
Zucchini yellow mosaic virus (ZYMV) has emerged as an important pathogen of cucurbits within the last few years in Hungary. The Hungarian isolates show a high biological variability, have specific nucleotide and amino acid sequences in the N-terminal region of coat protein and form a distinct branch in the phylogenetic tree. The virus is spread very efficiently in the field by several aphid species in a non-persistent manner. It can be transmitted by seed in holl-less seeded oil pumpkin (Cucurbita pepo (L) var Styriaca), although at a very low rate. Three isolates from seed transmission assay experiments were chosen and their nucleotide sequences of coat proteins have been compared with the available CP sequences of ZYMV. According to the sequence analysis, the Hungarian isolates belong to the Central European branch in the phylogenetic tree and, together with the ZYMV isolates from Austria and Slovenia, share specific amino acids at positions 16, 17, 27 and 37 which are characteristic only to these isolates. The phylogenetic tree suggests the common origin of distantly distributed isolates which can be attributed to widespread seed transmission.
Bartels, Mette Damkjær; Petersen, Andreas; Worning, Peder; Nielsen, Jesper Boye; Larner-Svensson, Hanna; Johansen, Helle Krogh; Andersen, Leif Percival; Jarløv, Jens Otto; Boye, Kit; Larsen, Anders Rhod; Westh, Henrik
2014-12-01
spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and an in-house analysis pipeline determines the spa types. Due to national surveillance, all MRSA isolates are sent to Statens Serum Institut, where the spa type is determined by PCR and Sanger sequencing. The purpose of this study was to evaluate the reliability of the spa types obtained by 150-bp paired-end Illumina WGS. MRSA isolates from new MRSA patients in 2013 (n = 699) in the capital region of Denmark were included. We found a 97% agreement between spa types obtained by the two methods. All isolates achieved a spa type by both methods. Nineteen isolates differed in spa types by the two methods, in most cases due to the lack of 24-bp repeats in the whole-genome-sequenced isolates. These related but incorrect spa types should have no consequence in outbreak investigations, since all epidemiologically linked isolates, regardless of spa type, will be included in the single nucleotide polymorphism (SNP) analysis. This will reveal the close relatedness of the spa types. In conclusion, our data show that WGS is a reliable method to determine the spa type of MRSA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
[Analysis of COX1 sequences of Taenia isolates from four areas of Guangxi].
Yang, Yi-Chao; Ou-Yang, Yi; Su, Ai-Rong; Wan, Xiao-Ling; Li, Shu-Lin
2012-06-01
To analyze the COX1 sequences of Taenia isolates from four areas of Guangxi Zhuang Autonomous Region, and to understand the distribution of Taenia asiatica in Guangxi. Patients with taeniasis in Luzhai, Rongshui, Tiandong and Sanjiang in Guangxi were treated by deworming, and the Taenia isolates were collected. Cyclooxygenase-1 (COX1) sequences of these isolates were amplified by PCR, and the PCR products were sequenced by T-A clone sequencing. The homogeneities and genetic distances were calculated and analyzed, and the phylogenic trees were constructed by some softwares. Meanwhile, the COX1 sequences of the isolates from the 4 areas were compared separately with the sequences of Taenia species in GenBank. The COX1 sequence of the 5 Taenia isolates collected had the same length of 444 bp. There were 5 variable positions between the Luzhai isolate and Taenia asiatica, the homogeneity was 98.87% and their genetic distance was 0.011. The phylogenetic tree analysis revealed that the Luzhai isolate and Taenia asiatica locating at the same node had a close relationship. The homogeneity between Rongshui isolate A and Taenia solium was 100%, while the homogeneity of Rongshui isolate B with Taeniasis saginata and Taenia asiatica were 98.20% and 96.17%, respectively. The homogeneities of the Tiandong and Sanjiang isolates with Taenia solium were 99.55% and 96.40%, respectively, and the genetic distances were 0.005 and 0.037, respectively. The homogeneity between the Luzhai isolate and Taeniasis saginate was 96.40%. Taenia asiatica exists in Luzhai and Taenia solium and Taenia saginata coexist in Rongshui, Guangxi Zhuang Autonomous Region.
DEFF Research Database (Denmark)
Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.
2004-01-01
The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....
Molecular cloning and nucleotide sequence of cDNA for human liver arginase
International Nuclear Information System (INIS)
Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.
1987-01-01
Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Directory of Open Access Journals (Sweden)
Patrick J Biggs
Full Text Available Campylobacter jejuni ST-474 is the most important human enteric pathogen in New Zealand, and yet this genotype is rarely found elsewhere in the world. Insight into the evolution of this organism was gained by a whole genome comparison of two ST-474, flaA SVR-14 isolates and other available C. jejuni isolates and genomes. The two isolates were collected from different sources, human (H22082 and retail poultry (P110b, at the same time and from the same geographical location. Solexa sequencing of each isolate resulted in ~1.659 Mb (H22082 and ~1.656 Mb (P110b of assembled sequences within 28 (H22082 and 29 (P110b contigs. We analysed 1502 genes for which we had sequences within both ST-474 isolates and within at least one of 11 C. jejuni reference genomes. Although 94.5% of genes were identical between the two ST-474 isolates, we identified 83 genes that differed by at least one nucleotide, including 55 genes with non-synonymous substitutions. These covered 101 kb and contained 672 point differences. We inferred that 22 (3.3% of these differences were due to mutation and 650 (96.7% were imported via recombination. Our analysis estimated 38 recombinant breakpoints within these 83 genes, which correspond to recombination events affecting at least 19 loci regions and gives a tract length estimate of ~2 kb. This includes a ~12 kb region displaying non-homologous recombination in one of the ST-474 genomes, with the insertion of two genes, including ykgC, a putative oxidoreductase, and a conserved hypothetical protein of unknown function. Furthermore, our analysis indicates that the source of this recombined DNA is more likely to have come from C. jejuni strains that are more closely related to ST-474. This suggests that the rates of recombination and mutation are similar in order of magnitude, but that recombination has been much more important for generating divergence between the two ST-474 isolates.
First Report of Cucumber mosaic virus Isolated from Wild Vigna angularis var. nipponensis in Korea
Directory of Open Access Journals (Sweden)
Mi-Kyeong Kim
2014-06-01
Full Text Available A viral disease causing severe mosaic, necrotic, and yellow symptoms on Vigna angularis var. nipponensis was prevalent around Suwon area in Korea. The causal virus was characterized as Cucumber mosaic virus (CMV on the basis of biological and nucleotide sequence properties of RNAs 1, 2 and 3 and named as CMV-wVa. CMV-wVa isolate caused mosaic symptoms on indicator plants, Nicotiana tabacum cv. Xanthi-nc, Petunia hybrida, and Cucumis sativus. Strikingly, CMV-wVa induced severe mosaic and malformation on Cucurbita pepo, and Solanum lycopersicum. Moreover, it caused necrotic or mosaic symptoms on V. angularis and V. radiate of Fabaceae. Symptoms of necrotic local or pin point were observed on inoculated leaves of V. unguiculata, Vicia fava, Pisum sativum and Phaseolus vulgaris. However, CMV-wVa isolate failed to infect in Glycine max cvs. ‘Sorok’, ‘Sodam’ and ‘Somyeong’. To assess genetic variation between CMV-wVa and the other known CMV isolates, phylogenetic analysis using 16 complete nucleotide sequences of CMV RNA1, RNA2, and RNA3 including CMV-wVa was performed. CMV-wVa was more closely related to CMV isolates belonging to CMV subgroup I showing about 85.1–100% nucleotide sequences identity to those of subgroup I isolates. This is the first report of CMV as the causal virus infecting wild Vigna angularis var. nipponensis in Korea.
Yoo, Ran Hee; Lee, Seung-Won; Lim, Seungmo; Zhao, Fumei; Igori, Davaajargal; Baek, Dasom; Hong, Jin-Sung; Lee, Su-Heon; Moon, Jae Sun
2017-12-01
Two novel viruses, isolated in Bonghwa, Republic of Korea, from an Ixeridium dentatum plant with yellowing mottle symptoms, have been provisionally named Ixeridium yellow mottle-associated virus 1 (IxYMaV-1) and Ixeridium yellow mottle-associated virus 2 (IxYMaV-2). IxYMaV-1 has a genome of 6,017 nucleotides sharing a 56.4% sequence identity with that of cucurbit aphid-borne yellows virus (genus Polerovirus). The IxYMaV-2 genome of 4,196 nucleotides has a sequence identity of less than 48.3% with e other species classified within the genus Umbravirus. Genome properties and phylogenetic analysis suggested that IxYMaV-1 and -2 are representative isolates of new species classifiable within the genus Polerovirus and Umbravirus, respectively.
Rhaese, H J; Hoch, J A; Groscurth, R
1977-03-01
To test our model on the mechanism of initiation of differentiation in Bacillus subtilis, we tested early blocked (stage 0) sporulation mutants for their ability to synthesize highly phosphorylated nucleotides. We also isolated early blocked asporogenous mutants with the aid of the intercalating drug tilorone. Among all mutants tested we found that the spo0F-bearing strain was unable to synthesize adenosine 3'(2')-triphosphate 5'-triphosphate, pppAppp. A revertant of this mutant regained the ability to both sporulate and synthesize pppAppp. Ribosomes of the asporogenous mutant isolated at T2 (2 hr after the end of logarithmic growth) of sporulation, in contrast to the wild type, do not synthesize adenosine 3'(2')-diphosphate 5'-diphosphate, ppApp, or adenosine 3'(2')-diphosphate 5'-triphosphate, pppApp, but synthesize guanosine 3'(2')-diphosphate 5'-diphosphate, ppGpp, and guanosine 3'(2')-diphosphate 5'-triphosphate, pppGpp. This behavior is characteristic of ribosomes from vegetative, not sporulating, cells. Ribosomes from the sporogenous revertant behave like those of the wild type. The results suggest that the spo0F mutation may be a mutation in the structural gene for pppAppp synthetase. The inability to synthesize pppAppp in this strain also prevents the formation of "sporulation-specific ribosomes," i.e., ribosomes that synthetize ppApp and pppApp. The present experiments suggest that the nucleotide pppAppp participates in the initiation of sporulation by triggering a sequencies of events required for the production of heat-resistant spores.
Lasserre, Moira; Fresia, Pablo; Greif, Gonzalo; Iraola, Gregorio; Castro-Ramos, Miguel; Juambeltz, Arturo; Nuñez, Álvaro; Naya, Hugo; Robello, Carlos; Berná, Luisa
2018-01-02
Bovine tuberculosis (bTB) poses serious risks to animal welfare and economy, as well as to public health as a zoonosis. Its etiological agent, Mycobacterium bovis, belongs to the Mycobacterium tuberculosis complex (MTBC), a group of genetically monomorphic organisms featured by a remarkably high overall nucleotide identity (99.9%). Indeed, this characteristic is of major concern for correct typing and determination of strain-specific traits based on sequence diversity. Due to its historical economic dependence on cattle production, Uruguay is deeply affected by the prevailing incidence of Mycobacterium bovis. With the world's highest number of cattle per human, and its intensive cattle production, Uruguay represents a particularly suited setting to evaluate genomic variability among isolates, and the diversity traits associated to this pathogen. We compared 186 genomes from MTBC strains isolated worldwide, and found a highly structured population in M. bovis. The analysis of 23 new M. bovis genomes, belonging to strains isolated in Uruguay evidenced three groups present in the country. Despite presenting an expected highly conserved genomic structure and sequence, these strains segregate into a clustered manner within the worldwide phylogeny. Analysis of the non-pe/ppe differential areas against a reference genome defined four main sources of variability, namely: regions of difference (RD), variable genes, duplications and novel genes. RDs and variant analysis segregated the strains into clusters that are concordant with their spoligotype identities. Due to its high homoplasy rate, spoligotyping failed to reflect the true genomic diversity among worldwide representative strains, however, it remains a good indicator for closely related populations. This study introduces a comprehensive population structure analysis of worldwide M. bovis isolates. The incorporation and analysis of 23 novel Uruguayan M. bovis genomes, sheds light onto the genomic diversity of this
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-08-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.
Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J
2015-01-01
Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required
High depth, whole-genome sequencing of cholera isolates from Haiti and the Dominican Republic.
Sealfon, Rachel; Gire, Stephen; Ellis, Crystal; Calderwood, Stephen; Qadri, Firdausi; Hensley, Lisa; Kellis, Manolis; Ryan, Edward T; LaRocque, Regina C; Harris, Jason B; Sabeti, Pardis C
2012-09-11
Whole-genome sequencing is an important tool for understanding microbial evolution and identifying the emergence of functionally important variants over the course of epidemics. In October 2010, a severe cholera epidemic began in Haiti, with additional cases identified in the neighboring Dominican Republic. We used whole-genome approaches to sequence four Vibrio cholerae isolates from Haiti and the Dominican Republic and three additional V. cholerae isolates to a high depth of coverage (>2000x); four of the seven isolates were previously sequenced. Using these sequence data, we examined the effect of depth of coverage and sequencing platform on genome assembly and identification of sequence variants. We found that 50x coverage is sufficient to construct a whole-genome assembly and to accurately call most variants from 100 base pair paired-end sequencing reads. Phylogenetic analysis between the newly sequenced and thirty-three previously sequenced V. cholerae isolates indicates that the Haitian and Dominican Republic isolates are closest to strains from South Asia. The Haitian and Dominican Republic isolates form a tight cluster, with only four variants unique to individual isolates. These variants are located in the CTX region, the SXT region, and the core genome. Of the 126 mutations identified that separate the Haiti-Dominican Republic cluster from the V. cholerae reference strain (N16961), 73 are non-synonymous changes, and a number of these changes cluster in specific genes and pathways. Sequence variant analyses of V. cholerae isolates, including multiple isolates from the Haitian outbreak, identify coverage-specific and technology-specific effects on variant detection, and provide insight into genomic change and functional evolution during an epidemic.
High depth, whole-genome sequencing of cholera isolates from Haiti and the Dominican Republic
Directory of Open Access Journals (Sweden)
Sealfon Rachel
2012-09-01
Full Text Available Abstract Background Whole-genome sequencing is an important tool for understanding microbial evolution and identifying the emergence of functionally important variants over the course of epidemics. In October 2010, a severe cholera epidemic began in Haiti, with additional cases identified in the neighboring Dominican Republic. We used whole-genome approaches to sequence four Vibrio cholerae isolates from Haiti and the Dominican Republic and three additional V. cholerae isolates to a high depth of coverage (>2000x; four of the seven isolates were previously sequenced. Results Using these sequence data, we examined the effect of depth of coverage and sequencing platform on genome assembly and identification of sequence variants. We found that 50x coverage is sufficient to construct a whole-genome assembly and to accurately call most variants from 100 base pair paired-end sequencing reads. Phylogenetic analysis between the newly sequenced and thirty-three previously sequenced V. cholerae isolates indicates that the Haitian and Dominican Republic isolates are closest to strains from South Asia. The Haitian and Dominican Republic isolates form a tight cluster, with only four variants unique to individual isolates. These variants are located in the CTX region, the SXT region, and the core genome. Of the 126 mutations identified that separate the Haiti-Dominican Republic cluster from the V. cholerae reference strain (N16961, 73 are non-synonymous changes, and a number of these changes cluster in specific genes and pathways. Conclusions Sequence variant analyses of V. cholerae isolates, including multiple isolates from the Haitian outbreak, identify coverage-specific and technology-specific effects on variant detection, and provide insight into genomic change and functional evolution during an epidemic.
Bifidobacterium aquikefiri sp. nov., isolated from water kefir.
Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter
2016-03-01
A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Differentiation of sheep pox and goat poxviruses by sequence analysis and PCR-RFLP of P32 gene.
Hosamani, Madhusudan; Mondal, Bimalendu; Tembhurne, Prabhakar A; Bandyopadhyay, Santanu Kumar; Singh, Raj Kumar; Rasool, Thaha Jamal
2004-08-01
Sheep pox and Goat pox are highly contagious viral diseases of small ruminants. These diseases were earlier thought to be caused by a single species of virus, as they are serologically indistinguishable. P32, one of the major immunogenic genes of Capripoxvirus, was isolated and Sequenced from two Indian isolates of goat poxvirus (GPV) and a vaccine strain of sheep poxvirus (SPV). The sequences were compared with other P32 sequences of capripoxviruses available in the database. Sequence analysis revealed that sheep pox and goat poxviruses share 97.5 and 94.7% homology at nucleotide and amino acid level, respectively. A major difference between them is the presence of an additional aspartic acid at 55th position of P32 of sheep poxvirus that is absent in both goat poxvirus and lumpy skin disease virus. Further, six unique neutral nucleotide substitutions were observed at positions 77, 275, 403, 552, 867 and 964 in the sequence of goat poxvirus, which can be taken as GPV signature residues. Similar unique nucleotide signatures could be identified in SPV and LSDV sequences also. Phylogenetic analysis showed that members of the Capripoxvirus could be delineated into three distinct clusters of GPV, SPV and LSDV based on the P32 genomic sequence. Using this information, a PCR-RFLP method has been developed for unequivocal genomic differentiation of SPV and GPV.
Oliveros, R; Cutillas, C; De Rojas, M; Arias, P
2000-12-01
Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).
First Complete Genome Sequence of Suakwa aphid-borne yellows virus from East Timor
Maina, Solomon; Edwards, Owain R.; de Almeida, Luis; Ximenes, Abel
2016-01-01
We present here the first complete genomic RNA sequence of the polerovirus Suakwa aphid-borne yellows virus (SABYV), from East Timor. The isolate sequenced came from a virus-infected pumpkin plant. The East Timorese genome had a nucleotide identity of 86.5% with the only other SABYV genome available, which is from Taiwan. PMID:27469955
Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X
2008-01-01
Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.
Jaradat, Ziad W; Ababneh, Qotaiba O; Saadoun, Ismail M; Samara, Nawal A; Rashdan, Abrar M
2009-10-27
Cronobacter spp. (formerly Enterobacter sakazakii), are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%). The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (alpha-MUG, DFI and EsPM) and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences), 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable method for confirmation of the identity of the isolates
Directory of Open Access Journals (Sweden)
Samara Nawal A
2009-10-01
Full Text Available Abstract Background Cronobacter spp. (formerly Enterobacter sakazakii, are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%. The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (α-MUG, DFI and EsPM and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences, 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Conclusion Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable
Singh, Satyendra K; Prasad, Kashi N; Singh, Aloukick K; Gupta, Kamlesh K; Chauhan, Ranjeet S; Singh, Amrita; Singh, Avinash; Rai, Ravi P; Pati, Binod K
2016-10-01
Taenia solium is the major cause of taeniasis and cysticercosis/neurocysticercosis (NCC) in the developing countries including India, but the existence of other Taenia species and genetic variation have not been studied in India. So, we studied the existence of different Taenia species, and sequence variation in Taenia isolates from human (proglottids and cysticerci) and swine (cysticerci) in North India. Amplification of cytochrome c oxidase subunit 1 gene (cox1) was done by polymerase chain reaction (PCR) followed by sequencing and phylogenetic analysis. We identified two species of Taenia i.e. T. solium and Taenia asiatica in our isolates. T. solium isolates showed similarity with Asian genotype and nucleotide variations from 0.25 to 1.01 %, whereas T. asiatica displayed nucleotide variations ranged from 0.25 to 0.5 %. These findings displayed the minimal genetic variations in North Indian isolates of T. solium and T. asiatica.
DEFF Research Database (Denmark)
Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.
2013-01-01
Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...
Directory of Open Access Journals (Sweden)
A B Sudeep
2014-01-01
Full Text Available Background & objectives: An outbreak of acute encephalitis syndrome was reported from Vidarbha region of Maharashtra s0 tate, India, during July 2012. Anti-IgM antibodies against Chandipura virus (CHPV were detected in clinical samples. Sandfly collections were done to determine their role in CHPV transmission. Methods: Twenty nine pools of Sergentomyia spp. comprising 625 specimens were processed for virus isolation in Vero E6 cell line. Diagnostic RT-PCR targeting N-gene was carried out with the sample that showed cytopathic effects (CPE. The PCR product was sequenced, analysed and the sequences were deposited in Genbank database. Results: CPE in Vero E6 cell line infected with three pools was detected at 48 h post infection. However, virus could be isolated only from one pool. RT-PCR studies demonstrated 527 nucleotide product that confirmed the agent as CHPV. Sequence analysis of the new isolate showed difference in 10-12 nucleotides in comparison to earlier isolates. Interpretation & conclusions: This is perhaps the first isolation of CHPV from Sergentomyia spp. in India and virus isolation during transmission season suggests their probable role in CHPV transmission. Further studies need to be done to confirm the precise role of Sargentomyia spp. in CHPV transmission.
Evaluation of whole genome sequencing for outbreak detection of Salmonella enterica
DEFF Research Database (Denmark)
Leekitcharoenphon, Pimlapas; Nielsen, Eva M.; Kaas, Rolf Sommer
2014-01-01
Salmonella enterica is a common cause of minor and large food borne outbreaks. To achieve successful and nearly ‘real-time’ monitoring and identification of outbreaks, reliable sub-typing is essential. Whole genome sequencing (WGS) shows great promises for using as a routine epidemiological typing....... Enteritidis and 5 S. Derby were also sequenced and used for comparison. A number of different bioinformatics approaches were applied on the data; including pan-genome tree, k-mer tree, nucleotide difference tree and SNP tree. The outcome of each approach was evaluated in relation to the association...... of the isolates to specific outbreaks. The pan-genome tree clustered 65% of the S. Typhimurium isolates according to the pre-defined epidemiology, the k-mer tree 88%, the nucleotide difference tree 100% and the SNP tree 100% of the strains within S. Typhimurium. The resulting outcome of the four phylogenetic...
Sun, Zichen; Stack, Colin; Šlapeta, Jan
2012-05-25
In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.
Novel avian paramyxovirus (APMV-15 isolated from a migratory bird in South America.
Directory of Open Access Journals (Sweden)
Luciano Matsumiya Thomazelli
Full Text Available A novel avian paramyxovirus (APMV isolated from a migratory bird cloacal swab obtained during active surveillance in April 2012 in the Lagoa do Peixe National Park, Rio Grande do Sul state, South of Brazil was biologically and genetically characterized. The nucleotide sequence of the full viral genome was completed using a next-generation sequencing approach. The genome was 14,952 nucleotides (nt long, with six genes (3'-NP-P-M-F-HN-L-5' encoding 7 different proteins, typical of APMV. The fusion (F protein gene of isolate RS-1177 contained 1,707 nucleotides in a single open reading frame encoding a protein of 569 amino acids. The F protein cleavage site contained two basic amino acids (VPKER↓L, typical of avirulent strains. Phylogenetic analysis of the whole genome indicated that the virus is related to APMV-10, -2 and -8, with 60.1% nucleotide sequence identity to the closest APMV-10 virus, 58.7% and 58.5% identity to the closest APMV-8 and APMV-2 genome, respectively, and less than 52% identity to representatives of the other APMVs groups. Such distances are comparable to the distances observed among other previously identified APMVs serotypes. These results suggest that unclassified/calidris_fuscicollis/Brazil/RS-1177/2012 is the prototype strain of a new APMV serotype, APMV-15.
Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai.
Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D; Paris, Daniel H; Richards, Allen L; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P J; Graves, Stephen; Stenos, John
2010-12-01
In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name "Orientia chuto," and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected.
Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23
International Nuclear Information System (INIS)
Ghaffari, S.H.; Olson, M.O.J.
1986-01-01
Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved
Energy Technology Data Exchange (ETDEWEB)
Hatch, C L; Bonner, W M
1988-02-11
The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin.
Draft Whole-Genome Sequences of Three Lactobacillus plantarum Food Isolates
Fernández Ramírez, Mónica D; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Abee, Tjakko; Nierop Groot, Masja N
2016-01-01
Lactobacillus plantarum is a widespread member of the Lactobacillus genus and frequently isolated from spoiled acidified food products. Here, we report the draft genome sequences of three L. plantarum food isolates.
Draft whole-genome sequences of three Lactobacillus plantarum food isolates
Fernandez Ramirez, Monica; Boekhorst, Jos; Jong, de Anne; Kuipers, Oscar P.; Abee, Tjakko; Nierop Groot, Masja
2016-01-01
Lactobacillus plantarum is a widespread member of the Lactobacillus genus and frequently isolated from spoiled acidified food products. Here, we report the draft genome sequences of three L. plantarum food isolates.
The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.
Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun
2016-07-01
The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
DEFF Research Database (Denmark)
Toplak, Ivan; Hostnik, Peter; Rihtaric, Danijela
2010-01-01
and clinical signs of VHS were observed among the diseased fish. VHSV was confirmed by virus isolation, immunoperoxidase test, reverse transcriptase polymerase chain reaction (RT-PCR) and phylogenetic analysis. Based on 1 complete (1524 nucleotides [nt]) and 9 partial (600 nt) glycoprotein gene nucleotide...... sequences, 9 VHSV isolates from the 6 VHS outbreaks were genetically closely related (99 to 100% identity), and were classified into the Subgroup I-a of Genotype I, most closely related to the German isolates Dstg21-07, Dstg36-06, and Dstg54-1-07 (99 to 100% identity). Phylogenetic analysis...
Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.
2013-01-01
Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619
Chromobacterium sphagni sp. nov., an insecticidal bacterium isolated from Sphagnum bogs.
Blackburn, Michael B; Farrar, Robert R; Sparks, Michael E; Kuhar, Daniel; Mitchell, Ashaki; Gundersen-Rindal, Dawn E
2017-09-01
Sixteen isolates of Gram-reaction-negative, motile, violet-pigmented bacteria were isolated from Sphagnum bogs in West Virginia and Maine, USA. 16S rRNA gene sequences and fatty acid analysis revealed a high degree of relatedness among the isolates, and genome sequencing of two isolates, IIBBL 14B-1T and IIBBL 37-2 (from West Virginia and Maine, respectively), revealed highly similar genomic sequences. The average nucleotide identity (gANI) calculated for these two isolates was found to be in excess of 99 %, but did not exceed 88 % when comparing either isolate with genomic sequences of Chromobacterium violaceum ATCC 12472T, C. haemolyticum DSM 19808T, C. piscinae ND17, C. subtsugae PRAA4-1T, C. vaccinii MWU205T or C. amazonense CBMAI 310T. Collectively, gANI and 16S rRNA gene sequence comparisons suggested that isolates IIBBL 14B-1T and IIBBL 37-2 were most closely related to C. subtsugae, but represented a distinct species. We propose the name Chromobacterium sphagni sp. nov. for this taxon; the type strain is IIBBL 14B-1T (=NRRL B-67130T=JCM 31882T).
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
Isolation of a Novel Orientia Species (O. chuto sp. nov.) from a Patient Infected in Dubai ▿
Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D.; Paris, Daniel H.; Richards, Allen L.; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P. J.; Graves, Stephen; Stenos, John
2010-01-01
In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name “Orientia chuto,” and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected. PMID:20926708
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
Oppentocht, JE; van Delden, W; van de Zande, L
The nucleotide sequences of the Adh and Adhr genes of Drosophila kuntzei were derived from combined overlapping sequences of clones isolated from a genomic library and from cloned PCR and inverse-PCR fragments. Only a proximal promoter was detected upstream of the Adh gene, indicating that D.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C
2012-06-01
Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.
Runcharoen, Chakkaphan; Raven, Kathy E; Reuter, Sandra; Kallonen, Teemu; Paksanont, Suporn; Thammachote, Jeeranan; Anun, Suthatip; Blane, Beth; Parkhill, Julian; Peacock, Sharon J; Chantratita, Narisara
2017-09-06
Tackling multidrug-resistant Escherichia coli requires evidence from One Health studies that capture numerous potential reservoirs in circumscribed geographic areas. We conducted a survey of extended β-lactamase (ESBL)-producing E. coli isolated from patients, canals and livestock wastewater in eastern Thailand between 2014 and 2015, and analyzed isolates using whole genome sequencing. The bacterial collection of 149 isolates consisted of 84 isolates from a single hospital and 65 from the hospital sewer, canals and farm wastewater within a 20 km radius. E. coli ST131 predominated the clinical collection (28.6%), but was uncommon in the environment. Genome-based comparison of E. coli from infected patients and their immediate environment indicated low genetic similarity overall between the two, although three clinical-environmental isolate pairs differed by ≤ 5 single nucleotide polymorphisms. Thai E. coli isolates were dispersed throughout a phylogenetic tree containing a global E. coli collection. All Thai ESBL-positive E. coli isolates were multidrug resistant, including high rates of resistance to tobramycin (77.2%), gentamicin (77.2%), ciprofloxacin (67.8%) and trimethoprim (68.5%). ESBL was encoded by six different CTX-M elements and SHV-12. Three isolates from clinical samples (n = 2) or a hospital sewer (n = 1) were resistant to the carbapenem drugs (encoded by NDM-1, NDM-5 or GES-5), and three isolates (clinical (n = 1) and canal water (n = 2)) were resistant to colistin (encoded by mcr-1); no isolates were resistant to both carbapenems and colistin. Tackling ESBL-producing E. coli in this setting will be challenging based on widespread distribution, but the low prevalence of resistance to carbapenems and colistin suggests that efforts are now required to prevent these from becoming ubiquitous.
Nath, B Surendra; Gupta, S K; Bajpai, A K
2012-12-01
The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.
AgdbNet – antigen sequence database software for bacterial typing
Directory of Open Access Journals (Sweden)
Maiden Martin CJ
2006-06-01
Full Text Available Abstract Background Bacterial typing schemes based on the sequences of genes encoding surface antigens require databases that provide a uniform, curated, and widely accepted nomenclature of the variants identified. Due to the differences in typing schemes, imposed by the diversity of genes targeted, creating these databases has typically required the writing of one-off code to link the database to a web interface. Here we describe agdbNet, widely applicable web database software that facilitates simultaneous BLAST querying of multiple loci using either nucleotide or peptide sequences. Results Databases are described by XML files that are parsed by a Perl CGI script. Each database can have any number of loci, which may be defined by nucleotide and/or peptide sequences. The software is currently in use on at least five public databases for the typing of Neisseria meningitidis, Campylobacter jejuni and Streptococcus equi and can be set up to query internal isolate tables or suitably-configured external isolate databases, such as those used for multilocus sequence typing. The style of the resulting website can be fully configured by modifying stylesheets and through the use of customised header and footer files that surround the output of the script. Conclusion The software provides a rapid means of setting up customised Internet antigen sequence databases. The flexible configuration options enable typing schemes with differing requirements to be accommodated.
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P
2010-09-01
The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.
1985-01-01
The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy
Ali, Asho; Hasan, Zahra; McNerney, Ruth; Mallard, Kim; Hill-Cawthorne, Grant A.; Coll, Francesc; Nair, Mridul; Pain, Arnab; Clark, Taane G.; Hasan, Rumina
2015-01-01
Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91-94 codons in 81% of strains; four strains had only gyr B mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded
Ali, Asho
2015-02-26
Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91-94 codons in 81% of strains; four strains had only gyr B mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded
Molecular cloning of cellulase genes from indigenous bacterial isolates
International Nuclear Information System (INIS)
Jong Bor Chyan; Pauline Liew Woan Ying; Mat Rasol Awang
2006-01-01
Indigenous cellulolytic bacterial isolates having high activities in degrading carboxymethyl cellulose (CMC) were isolated from local environments. Identification of these isolates were performed by molecular techniques. By using polymerase chain reaction (PCR) techniques, PCR products encoding cellulase gene were amplified from the total genomic DNAs. Purified PCR product was successfully cloned and expressed in Escherichia coli host system. The complete nucleotide sequences of the cellulase genes determined. The analysis of amino acid sequences deduced from the genes indicated that the cloned DNA fragments show high homology to those of endoglucanase genes of family GH5. All cloned genes consist of an N-terminal signal peptide, a catalytic domain of family 5 glycosyl hydrolase and a cellulose-binding domain of family III. (Author)
Niu, Qingli; Valentin, Charlotte; Bonsergent, Claire; Malandrin, Laurence
2014-12-01
Rhoptry-associated-protein 1 (RAP-1) is considered as a potential vaccine candidate due to its involvement in red blood cell invasion by parasites in the genus Babesia. We examined its value as a vaccine candidate by studying RAP-1 conservation in isolates of Babesia sp. BQ1 Ningxian, Babesia sp. Tianzhu and Babesia sp. Hebei, responsible for ovine babesiosis in different regions of China. The rap-1 locus in these isolates has very similar features to those described for Babesia sp. BQ1 Lintan, another Chinese isolate also in the B. motasi-like phylogenetic group, namely the presence of three types of rap-1 genes (rap-1a, rap-1b and rap-1c), multiple conserved rap-1b copies (5) interspaced with more or less variable rap-1a copies (6), and the 3' localization of one rap-1c. The isolates Babesia sp. Tianzhu, Babesia sp. BQ1 Lintan and Ningxian were almost identical (average nucleotide identity of 99.9%) over a putative locus of about 31 Kb, including the intergenic regions. Babesia sp. Hebei showed a similar locus organization but differed in the rap-1 locus sequence, for each gene and intergenic region, with an average nucleotide identity of 78%. Our results are in agreement with 18S rDNA phylogenetic studies performed on these isolates. However, in extremely closely related isolates the rap-1 locus seems more conserved (99.9%) than the 18S rDNA (98.7%), whereas in still closely related isolates the identities are much lower (78%) compared with the 18S rDNA (97.7%). The particularities of the rap-1 locus in terms of evolution, phylogeny, diagnosis and vaccine development are discussed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Isolation and phylogenetic characterization of Canine distemper virus from India.
Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek
2015-09-01
Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.
Genomic characterization of Zika virus isolated from Indonesia.
Yudhaputri, Frilasita A; Trimarsanto, Hidayat; Perkasa, Aditya; Yohan, Benediktus; Haryanto, Sotianingsih; Wiyatno, Ageng; Soebandrio, Amin; Myint, Khin Saw; Ledermann, Jeremy P; Rosenberg, Ronald; Powers, Ann M; Sasmono, R Tedjo
2017-10-01
Zika virus (ZIKV) JMB-185 strain was isolated from a febrile patient in Jambi, Indonesia in 2014. To understand its genetic characteristics, we performed whole genome sequencing using the Ion Torrent PGM platform on the supernatant of the first passage. The phylogenetic analysis showed that the isolate was not closely related to the Brazilian ZIKV associated with microcephaly or isolates from the recent Singapore Zika outbreak. Molecular evolution analysis indicated that JMB-185 strain may have been circulating in the Southeast Asia region, including Indonesia since 2000. We observed high nucleotide sequence identity between Indonesia, Thailand, Singapore, and American strains although unique amino acid substitutions were also observed. This report provides information on the genomic characteristics of Indonesian ZIKV which may be used for further studies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Alexander C Outhred
Full Text Available Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways.We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants.Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade.Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster.
Giangaspero, Massimo; Harasawa, Ryô
2011-06-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the
Serological and molecular characterization of Syrian Tomato spotted wilt virus isolates
Directory of Open Access Journals (Sweden)
Faiz ISMAEIL
2015-04-01
Full Text Available Thirty four Syrian isolates of Tomato spotted wilt virus (TSWV collected from tomato and pepper were tested against five specific monoclonal antibodies using TAS-ELISA. The isolates were in two serogroups. Fourteen tomato and sixteen pepper isolates were similar in their reaction with MAb-2, MAb-4, MAb-5 and MAb-6, but did not react with MAb-7 (Serogroup 1. Meanwhile, four isolates collected from pepper reacted with all the MAbs used (Serogroup 2. The expected 620 bp DNA fragment was obtained by RT-PCR from six samples using a specific primer pair designed to amplify the nucleocapsid protein (NP gene of TSWV. The PCR products were sequenced and a phylogenetic tree was constructed. Sequence analysis revealed that the Syrian TSWV isolates were very similar at the nucleotide (97.74 to 99.84% identity and amino acid (96.17 to 99.03% identity sequences levels. The phylogenetic tree showed high similarity of Syrian TSWV isolates with many other representative isolates from different countries.
Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil.
FAJARDO, T. V. M.; NASCIMENTO, M. B.; EIRAS, M.; NICKEL, O.; PIO-RIBEIRO, G.
2016-01-01
ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV), except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP) and coat (CP) protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of...
Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.
Le Gall, O; Candresse, T; Dunez, J
1988-02-01
Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.
Directory of Open Access Journals (Sweden)
Peter Norberg
Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.
DEFF Research Database (Denmark)
Duvnjak, Sanja; Spicic, Silvio; Kusar, Darja
2017-01-01
Brucella spp. that cause marine brucellosis are becoming more important, as the disease appears to be more widespread than originally thought. Here, we report a whole and annotated genome sequence of Brucella ceti CRO350, a sequence type 27 strain isolated from a bottlenose dolphin carcass found...
Zhang, Xiao-Yan; Xiang, Hai-Ying; Zhou, Cui-Ji; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2014-08-01
For brassica yellows virus (BrYV), proposed to be a member of a new polerovirus species, two clearly distinct genotypes (BrYV-A and BrYV-B) have been described. In this study, the complete nucleotide sequences of two BrYV isolates from radish and Chinese cabbage were determined. Sequence analysis suggested that these isolates represent a new genotype, referred to here as BrYV-C. The full-length sequences of the two BrYV-C isolates shared 93.4-94.8 % identity with BrYV-A and BrYV-B. Further phylogenetic analysis showed that the BrYV-C isolates formed a subgroup that was distinct from the BrYV-A and BrYV-B isolates based on all of the proteins except P5.
Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T
2005-04-01
ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.
Whole-Genome Sequences of Thirteen Isolates of Borrelia burgdorferi
Energy Technology Data Exchange (ETDEWEB)
Schutzer S. E.; Dunn J.; Fraser-Liggett, C. M.; Casjens, S. R.; Qiu, W.-G.; Mongodin, E. F.; Luft, B. J.
2011-02-01
Borrelia burgdorferi is a causative agent of Lyme disease in North America and Eurasia. The first complete genome sequence of B. burgdorferi strain 31, available for more than a decade, has assisted research on the pathogenesis of Lyme disease. Because a single genome sequence is not sufficient to understand the relationship between genotypic and geographic variation and disease phenotype, we determined the whole-genome sequences of 13 additional B. burgdorferi isolates that span the range of natural variation. These sequences should allow improved understanding of pathogenesis and provide a foundation for novel detection, diagnosis, and prevention strategies.
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha
Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.
1989-01-01
We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Molecular Characterization of Geographically Different Banana bunchy top virus Isolates in India.
Selvarajan, R; Mary Sheeba, M; Balasubramanian, V; Rajmohan, R; Dhevi, N Lakshmi; Sasireka, T
2010-10-01
Banana bunchy top disease (BBTD) caused by Banana bunchy top virus (BBTV) is one of the most devastating diseases of banana and poses a serious threat for cultivars like Hill Banana (Syn: Virupakshi) and Grand Naine in India. In this study, we have cloned and sequenced the complete genome comprised of six DNA components of BBTV infecting Hill Banana grown in lower Pulney hills, Tamil Nadu State, India. The complete genome sequence of this hill banana isolate showed high degree of similarity with the corresponding sequences of BBTV isolates originating from Lucknow, Uttar Pradesh State, India, and from Fiji, Egypt, Pakistan, and Australia. In addition, sixteen coat protein (CP) and thirteen replicase genes (Rep) sequences of BBTV isolates collected from different banana growing states of India were cloned and sequenced. The replicase sequences of 13 isolates showed high degree of similarity with that of South Pacific group of BBTV isolates. However, the CP gene of BBTV isolates from Shervroy and Kodaikanal hills of Tamil Nadu showed higher amino acid sequence variability compared to other isolates. Another hill banana isolate from Meghalaya state had 23 nucleotide substitutions in the CP gene but the amino acid sequence was conserved. This is the first report of the characterization of a complete genome of BBTV occurring in the high altitudes of India. Our study revealed that the Indian BBTV isolates with distinct geographical origins belongs to the South Pacific group, except Shervroy and Kodaikanal hill isolates which neither belong to the South Pacific nor the Asian group.
International Nuclear Information System (INIS)
Garcia Pineda, M. D.; Pacheco Lopez, J.
1978-01-01
A method is described for the preparation and analysis of adenylic, uri dilic, cytidi- 11c and guanylic acids, labelled with 14 C . Escherichia coli cells have been labelled by growing them in a medi dia containing glucose-14 C as their only source of carbon. RNA is isolated from the cells, and after hydrolysis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the Isolated nucleotides is determined, and also its specific radioactivity. (Author) 30 refs
Draft genome sequence of Phomopsis longicolla isolate MSPL 10-6
Directory of Open Access Journals (Sweden)
Shuxian Li
2015-03-01
Full Text Available Phomopsis longicolla is the primary cause of Phomopsis seed decay in soybean. This disease severely affects soybean seed quality by reducing seed viability and oil content, altering seed composition, and increasing frequencies of moldy and/or split beans. It is one of the most economically important soybean diseases. Here, we report the de novo assembled draft genome sequence of the P. longicolla isolate MSPL10-6, which was isolated from field-grown soybean seed in Mississippi, USA. This study represents the first reported genome sequence of a seedborne fungal pathogen in the Diaporthe–Phomopsis complex. The P. longicolla genome sequence will enable research into the genetic basis of fungal infection of soybean seed and provide information for the study of soybean–fungal interactions. The genome sequence will also be valuable for molecular genetic marker development, manipulation of pathogenicity-related genes and development of new control strategies for this pathogen.
Draft genome sequence of the intestinal parasite Blastocystis subtype 4-isolate WR1
Wawrzyniak, Ivan; Courtine, Damien; Osman, Marwan; Hubans-Pierlot, Christine; Cian, Amandine; Nourrisson, Céline; Chabe, Magali; Poirier, Philippe; Bart, Aldert; Polonais, Valérie; Delgado-Viscogliosi, Pilar; El Alaoui, Hicham; Belkorchia, Abdel; van Gool, Tom; Tan, Kevin S. W.; Ferreira, Stéphanie; Viscogliosi, Eric; Delbac, Frédéric
2015-01-01
(ST1-ST17) described to date. Only the whole genome of a human ST7 isolate was previously sequenced. Here we report the draft genome sequence of Blastocystis ST4-WR1 isolated from a laboratory rodent at Singapore. (C) 2015 The Authors. Published by Elsevier Inc
Characterization of sequence diversity in Plasmodium falciparum SERA5 from Indian isolates
Directory of Open Access Journals (Sweden)
Rahul C.N
2015-06-01
Full Text Available Objective: To characterize the sequence diversity of blood-stage Plasmodium falciparum serine repeat antigen-5 (PfSERA5 which is lacking in a malaria-endemic country like India. Methods: In this study, parasitic DNA was obtained from field isolates collected from various geographic regions. Subsequently, PfSERA5 gene sequence was PCR amplified and DNA sequenced. Results: We reported the existence of unique repeat polymorphisms and novel haplotypes for both the octamer repeat (OR and serine repeat (SR regions of the N-terminal fragment of PfSERA5 from Indian isolates. Several isolates from India were identical to low-frequency African haplotypes. Unique finding of our study was an Indian isolate showing deletion in a perfectly conserved 14 mer sequence within octamer repeat. Indian haplotypes reported in this study were found to be distributed into the three earlier classified allelic clusters of FCR3, K1 and Honduras showcasing broad diversity as compared to worldwide haplotypes. Conclusions: This study is the first report on genetic diversity of PfSERA5 antigen from India. Further evaluation of these haplotypes by serotyping would provide useful information for investigating variant-specific immunity and aid in malaria vaccine research.
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
Coscollá, Mireia; Gosalbes, María José; Catalán, Vicente; González-Candelas, Fernando
2006-06-01
Legionella pneumophila is associated to recurrent outbreaks in several Comunidad Valenciana (Spain) localities, especially in Alcoi, where social and climatic conditions seem to provide an excellent environment for bacterial growth. We have analysed the nucleotide sequences of three loci from 25 environmental isolates from Alcoi and nearby locations sampled over 3 years. The analysis of these isolates has revealed a substantial level of genetic variation, with consistent patterns of variability across loci, and comparable to that found in a large, European-wide sampling of clinical isolates. Among the tree loci studied, fliC showed the highest level of nucleotide diversity. The analysis of isolates sampled in different years revealed a clear differentiation, with samples from 2001 being significantly distinct from those obtained in 2002 and 2003. Furthermore, although linkage disequilibrium measures indicate a clonal nature for population structure in this sample, the presence of some recombination events cannot be ruled out.
Gong, Xianzhe; Skrivergaard, Stig; Korsgaard, Benjamin Smed; Schreiber, Lars; Marshall, Ian P G; Finster, Kai; Schramm, Andreas
2017-01-01
Strain S3-2 T , isolated from sediment of a frozen freshwater pond, shares 99% 16S rRNA gene sequence identity with strains of the genus Janthinobacterium . Strain S3-2 T is a facultative anaerobe that lacks the ability to produce violacein but shows antibiotic resistance, psychrotolerance, incomplete denitrification, and fermentation. The draft genome of strain S3-2 T has a size of ~5.8 Mbp and contains 5,297 genes, including 115 RNA genes. Based on the phenotypic properties of the strain, the low in silico DNA-DNA hybridization (DDH) values with related genomes (<35%), and the low whole genome-based average nucleotide identity (ANI) (<86%) with other strains within the genus Janthinobacterium, we propose that strain S3-2 T is the type strain (= DSM 102223 = LMG 29653) of a new species within this genus. We propose the name Janthinobacterium psychrotolerans sp. nov. to emphasize the capability of the strain to grow at low temperatures.
Wang, Xiaodan; Ma, Dehong; Huang, Xinwei; Li, Lihua; Li, Duo; Zhao, Yujiao; Qiu, Lijuan; Pan, Yue; Chen, Junying; Xi, Juemin; Shan, Xiyun; Sun, Qiangming
2017-06-15
In the past few decades, dengue has spread rapidly and is an emerging disease in China. An unexpected dengue outbreak occurred in Xishuangbanna, Yunnan, China, resulting in 1331 patients in 2013. In order to obtain the complete genome information and perform mutation and evolutionary analysis of causative agent related to this largest outbreak of dengue fever. The viruses were isolated by cell culture and evaluated by genome sequence analysis. Phylogenetic trees were then constructed by Neighbor-Joining methods (MEGA6.0), followed by analysis of nucleotide mutation and amino acid substitution. The analysis of the diversity of secondary structure for E and NS1 protein were also performed. Then selection pressures acting on the coding sequences were estimated by PAML software. The complete genome sequences of two isolated strains (YNSW1, YNSW2) were 10,710 and 10,702 nucleotides in length, respectively. Phylogenetic analysis revealed both strain were classified as genotype II of DENV-3. The results indicated that both isolated strains of Xishuangbanna in 2013 and Laos 2013 stains (KF816161.1, KF816158.1, LC147061.1, LC147059.1, KF816162.1) were most similar to Bangladesh (AY496873.2) in 2002. After comparing with the DENV-3SS (H87) 62 amino acid substitutions were identified in translated regions, and 38 amino acid substitutions were identified in translated regions compared with DENV-3 genotype II stains Bangladesh (AY496873.2). 27(YNSW1) or 28(YNSW2) single nucleotide changes were observed in structural protein sequences with 7(YNSW1) or 8(YNSW2) non-synonymous mutations compared with AY496873.2. Of them, 4 non-synonymous mutations were identified in E protein sequences with (2 in the β-sheet, 2 in the coil). Meanwhile, 117(YNSW1) or 115 (YNSW2) single nucleotide changes were observed in non-structural protein sequences with 31(YNSW1) or 30 (YNSW2) non-synonymous mutations. Particularly, 14 single nucleotide changes were observed in NS1 sequences with 4/14 non
Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas
Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; Ludergnani, Nicholas; McMullen, Allison
2017-01-01
ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends.
DEFF Research Database (Denmark)
Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens
1999-01-01
We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...
Draft Genome Sequences of Four Hospital-Associated Pseudomonas putida Isolates.
Mustapha, Mustapha M; Marsh, Jane W; Ezeonwuka, Chinelo D; Pasculle, Anthony W; Pacey, Marissa P; Querry, Ashley M; Muto, Carlene A; Harrison, Lee H
2016-09-29
We present here the draft genome sequences of four Pseudomonas putida isolates belonging to a single clone suspected for nosocomial transmission between patients and a bronchoscope in a tertiary hospital. The four genome sequences belong to a single lineage but contain differences in their mobile genetic elements. Copyright © 2016 Mustapha et al.
Hyndman, Timothy H; Marschang, Rachel E; Wellehan, James F X; Nicholls, Philip K
2012-10-01
This paper describes the isolation and molecular identification of a novel paramyxovirus found during an investigation of an outbreak of neurorespiratory disease in a collection of Australian pythons. Using Illumina® high-throughput sequencing, a 17,187 nucleotide sequence was assembled from RNA extracts from infected viper heart cells (VH2) displaying widespread cytopathic effects in the form of multinucleate giant cells. The sequence appears to contain all the coding regions of the genome, including the following predicted paramyxoviral open reading frames (ORFs): 3'--Nucleocapsid (N)--putative Phosphoprotein (P)--Matrix (M)--Fusion (F)--putative attachment protein--Polymerase (L)--5'. There is also a 540 nucleotide ORF between the N and putative P genes that may be an additional coding region. Phylogenetic analyses of the complete N, M, F and L genes support the clustering of this virus within the family Paramyxoviridae but outside both of the current subfamilies: Paramyxovirinae and Pneumovirinae. We propose to name this new virus, Sunshine virus, after the geographic origin of the first isolate--the Sunshine Coast of Queensland, Australia. Copyright © 2012 Elsevier B.V. All rights reserved.
Kutz, Russell; Okwumabua, Ogi
2008-10-01
The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.
Saturnispora bothae sp. nov., isolated from rotting wood.
Morais, Camila G; Lara, Carla A; Borelli, Beatriz M; Cadete, Raquel M; Moreira, Juliana D; Lachance, Marc-André; Rosa, Carlos A
2016-10-01
Two strains representing a novel species of the genus Saturnispora were isolated from rotting wood samples collected in an Atlantic Rainforest site in Brazil. Analyses of the sequences of the D1/D2 domains of the rRNA gene showed that this novel species belongs to a subclade in the Saturnispora clade formed by Saturnispora sanitii, Saturnispora sekii, Saturnispora silvae and Saturnisporasuwanaritii. The novel species differed in D1/D2 sequences by 60 or more nucleotide substitutions from these species. The strains produced asci with one to four hemispherical ascospores. A novel species named Saturnispora bothae sp. nov. is proposed to accommodate these isolates. The type strain is UFMG-CM-Y292T (=CBS 13484T). The MycoBank number is MB 817127.
Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana
2016-05-01
Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Directory of Open Access Journals (Sweden)
Stuart F. McDaniel
2013-04-01
Full Text Available Premise of the study: We developed and tested primers for 218 nuclear loci for studying population genetics, phylogeography, and genome evolution in bryophytes. Methods and Results: We aligned expressed sequence tags (ESTs from Ceratodon purpureus to the Physcomitrella patens genome sequence, and designed primers that are homologous to conserved exons but span introns in the P. patens genome. We tested these primers on four isolates from New York, USA; Otavalo, Ecuador; and two laboratory isolates from Austria (WT4 and GG1. The median genome-wide nucleotide diversity was 0.008 substitutions/site, but the range was large (0–0.14, illustrating the among-locus heterogeneity in the species. Conclusions: These loci provide a valuable resource for finely resolved, genome-wide population genetic and species-level phylogenetic analyses of C. purpureus and its relatives.
Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas
Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; McMullen, Allison; Mirza, Sohail A.; Thrift, Noah; Vaughan, Donald P.; Worley, Grace; Ejikemeuwa, Amara; Zaw, May; Albritton, Claude F.; Bertrand, Sarah C.; Chaudhry, Shanzay S.; Cheema, Vzair A.; Do, Camilla; Do, Michael L.; Duong, Huyen M.; El-Desoky, Dalia H.; Green, Kelsey M.; Lee, Rhea N.; Thornton, Lauren A.; Vu, James M.; Zahra, Mah Noor; Stoner, Ty H.; Garlena, Rebecca A.; Jacobs-Sera, Deborah; Russell, Daniel A.
2017-01-01
ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends. PMID:29122864
Draft genome sequence of the intestinal parasite Blastocystis subtype 4-isolate WR1
Directory of Open Access Journals (Sweden)
Ivan Wawrzyniak
2015-06-01
Full Text Available The intestinal protistan parasite Blastocystis is characterized by an extensive genetic variability with 17 subtypes (ST1–ST17 described to date. Only the whole genome of a human ST7 isolate was previously sequenced. Here we report the draft genome sequence of Blastocystis ST4-WR1 isolated from a laboratory rodent at Singapore.
Zhou, Yan-Xia; Wang, Chao; Du, Zong-Jun; Chen, Guan-Jun
2015-08-01
A novel Gram-stain-negative, facultatively anaerobic, rod-shaped, agar-digesting bacterial strain, designated HQM9T, was isolated from the surface of the marine red alga Gelidium amansii collected from the intertidal zone of Weihai, China. Cells of HQM9T were 3.0-4.0 μm long and 0.2-0.3 μm wide and lacked flagella. The new isolate grew optimally at 28-30 °C, at pH 7.0-7.5, and in the presence of 2.5-3.0% NaCl. The predominant cellular fatty acids were iso-C15 : 0 and iso-C17 : 0 3-OH. The sole menaquinone was MK-6. The DNA G+C content was 33 mol%. The major polar lipids were comprised of phosphatidylethanolamine and four unknown polar lipids. Based on the 16S rRNA gene sequence, the closest relative was Aquimarina agarilytica ZC1T with 97.16% sequence similarity, with which strain HQM9T formed a distinct cluster belonging to the genus Aquimarina in a phylogenetic tree. Moreover, average nucleotide identity and estimated DNA-DNA hybridization values between strains HQM9T and ZC1T were 78.7% and 12.50 ± 2.95%, respectively. On the basis of phenotypic, chemotaxonomic and phylogenetic analysis, strain HQM9T represents the type strain of a novel species within the genus Aquimarina in the family Flavobacteriaceae, phylum Bacteroidetes, for which the name Aquimarina agarivorans sp. nov. is proposed. The type strain is HQM9T ( = ATCC BAA-2612T = CICC 10835T).
DEFF Research Database (Denmark)
Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter
1987-01-01
We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...
Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.
2005-01-01
The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that
Complete genome sequence of a recent panzootic virulent Newcastle disease virus from Pakistan
Complete genome sequence of a new strain of Newcastle disease virus (NDV) (chicken/Pak/Lahore-611/2013) is reported. The strain was isolated from a vaccinated chicken flock in Pakistan in 2013 and has panzootic features. The genome is 15192 nucleotides in length and is classified as sub-genotype V...
Isolation and amino acid sequence of corticotropin-releasing factor from pig hypothalami.
Patthy, M; Horvath, J; Mason-Garcia, M; Szoke, B; Schlesinger, D H; Schally, A V
1985-01-01
A polypeptide was isolated from acid extracts of porcine hypothalami on the basis of its high ability to stimulate the release of corticotropin from superfused rat pituitary cells. After an initial separation by gel filtration on Sephadex G-25, further purification was carried out by reversed-phase HPLC. The isolated material was homogeneous chromatographically and by N-terminal sequencing. Based on automated gas-phase sequencing of the intact and CNBr-cleaved peptide and on carboxypeptidase ...
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
Directory of Open Access Journals (Sweden)
Izedin Goga
2014-03-01
Full Text Available Three serum samples positive in Antigen ELISA BVDV have been tested to characterise genetic diversity of bovine viral diarrhea virus (BVDV in Kosovo. Samples were obtained in 2011 from heifers and were amplified by reverse transcription-polymerase chain reaction, sequenced and analysed by computer-assisted phylogenetic analysis. Amplified products and nucleotide sequence showed that all 3 isolates belonged to BVDV 1 genotype and 1b sub genotype. These results enrich the extant knowledge of BVDV and represent the first documented data about Kosovo BVDV isolates.
Complete Genome Sequence of the Campylobacter ureolyticus Clinical Isolate RIGS 9880
DEFF Research Database (Denmark)
Miller, William G; Yee, Emma; On, Stephen L W
2015-01-01
The emerging pathogen Campylobacter ureolyticus has been isolated from human and animal genital infections, human periodontal disease, domestic and food animals, and from cases of human gastroenteritis. We report the whole-genome sequence of the human clinical isolate RIGS 9880, which is the first...
Vaartjes, W.J.; Breejen, J.N. den; Geelen, M.J.H.; Bergh, S.G. van den
1980-01-01
1. Preincubation of isolated rat-liver mitochondria in the presence of adenine nucleotides or Ca2+ results in definite and persistent changes in the initial rate of pyruvate transport. 2. These changes in the rate of pyruvate transport are accompanied by equally persistent changes in the opposite
Directory of Open Access Journals (Sweden)
Maël Bessaud
2016-08-01
Full Text Available Enteroviruses are among the most common viruses infecting humans and can cause diverse clinical syndromes ranging from minor febrile illness to severe and potentially fatal diseases. Enterovirus species C (EV-C consists of more than 20 types, among which the 3 serotypes of polioviruses, the etiological agents of poliomyelitis, are included. Biodiversity and evolution of EV-C genomes are shaped by frequent recombination events. Therefore, identification and characterization of circulating EV-C strains require the sequencing of different genomic regions.A simple method was developed to sequence quickly the entire genome of EV-C isolates. Four overlapping fragments were produced separately by RT-PCR performed with generic primers. The four amplicons were then pooled and purified prior to be sequenced by high-throughput technique.The method was assessed on a panel of EV-Cs belonging to a wide-range of types. It can be used to determine full-length genome sequences through de novo assembly of thousands of reads. It was also able to discriminate reads from closely related viruses in mixtures.By decreasing the workload compared to classical Sanger-based techniques, this method will serve as a precious tool for sequencing large panels of EV-Cs isolated in cell cultures during environmental surveillance or from patients, including vaccine-derived polioviruses.
International Nuclear Information System (INIS)
Garcia Pineda, D.; Pacheco Lopez, J.
1978-01-01
A method is described for the preparation and analysis of adenilic, uridilic, cytidylic and guanilic acids, labelled with carbon 14. Escherichia coli cells have been labelled by growing them in media containing glucose-carbon 14 as their only source of carbon. RNA is isolated from the cells, and after hydrolisis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the isolated nucleotides is determined and also its specific radioactivity. The distribution of radioactivity incorporated in the cell among different groups of molecular species is analyse. (author)
Gennip, van H.G.P.; Widjojoatmodjo, M.N.; Smit, de A.J.; Moormann, R.J.M.
1999-01-01
A pig pestivirus isolate, strain H, was characterized by using reverse transcription-PCR (RT-PCR) and direct sequencing of the amplicons. A duplication of 74 nucleotides was found at the 5' terminus of the 5' noncoding (NC) region, which was also found in RNA isolates from tonsils from two other
Directory of Open Access Journals (Sweden)
Nian-Zhang Zhang
2014-01-01
Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Directory of Open Access Journals (Sweden)
Jieming Shi
Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
Yun, Ki Wook; Choi, Eun Hwa; Lee, Hoan Jong
2017-01-01
Pneumococcal surface protein A (PspA) is an important virulence factor of pneumococci and has been investigated as a primary component of a capsular serotype-independent pneumococcal vaccine. Thus, we sought to determine the genetic diversity of PspA to explore its potential as a vaccine candidate. Among the 190 invasive pneumococcal isolates collected from Korean children between 1991 and 2016, two (1.1%) isolates were found to have no pspA by multiple polymerase chain reactions. The full length pspA genes from 185 pneumococcal isolates were sequenced. The length of pspA varied, ranging from 1,719 to 2,301 base pairs with 55.7-100% nucleotide identity. Based on the sequences of the clade-defining regions, 68.7% and 49.7% were in PspA family 2 and clade 3/family 2, respectively. PspA clade types were correlated with genotypes using multilocus sequence typing and divided into several subclades based on diversity analysis of the N-terminal α-helical regions, which showed nucleotide sequence identities of 45.7-100% and amino acid sequence identities of 23.1-100%. Putative antigenicity plots were also diverse among individual clades and subclades. The differences in antigenicity patterns were concentrated within the N-terminal 120 amino acids. In conclusion, the N-terminal α-helical domain, which is known to be the major immunogenic portion of PspA, is genetically variable and should be further evaluated for antigenic differences and cross-reactivity between various PspA types from pneumococcal isolates.
Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi
2017-04-01
Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.
Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates
Directory of Open Access Journals (Sweden)
Soudabeh Heidari
2013-09-01
Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.
Zhang, Chenhua; Zheng, Hongying; Yan, Dankan; Han, Kelei; Song, Xijiao; Liu, Yong; Zhang, Dongfang; Chen, Jianping; Yan, Fei
2017-08-01
Cowpea and broad bean plants showing severe stunting and leaf rolling symptoms were observed in Hefei city, Anhui province, China, in 2014. Symptomatic plants from both species were shown to be infected with milk vetch dwarf virus (MDV) by PCR. The complete genomes of MDV isolates from cowpea and broad bean were sequenced. Each of them had eight genomic DNAs that differed between the two isolates by 10.7% in their overall nucleotide sequences. In addition, the MDV genomes from cowpea and broad bean were associated with two and three alphasatellite DNAs, respectively. This is the first report of MDV on cowpea in China and the first complete genome sequences of Chinese MDV isolates.
International Nuclear Information System (INIS)
Han, J.H.; Stratowa, C.; Rutter, W.J.
1987-01-01
The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase
Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.
Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F
2000-08-01
Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.
Directory of Open Access Journals (Sweden)
Björn A Espedido
Full Text Available Whole genome sequencing was used to characterize the resistome of intensive care unit (ICU outbreak-associated carbapenem-resistant K. pneumoniae isolates. Importantly, and of particular concern, the carbapenem-hydrolyzing β-lactamase gene bla(OXA-48 and the extended-spectrum β-lactamase gene bla(CTX-M-14, were identified on a single broad host-range conjugative plasmid. This represents the first report of bla(OXA-48 in Australia and highlights the importance of resistance gene surveillance, as such plasmids can silently spread amongst enterobacterial populations and have the potential to drastically limit treatment options. Furthermore, the in vivo evolution of these isolates was also examined after 18 months of intra-abdominal carriage in a patient that transited through the ICU during the outbreak period. Reflecting the clonality of K. pneumoniae, only 11 single nucleotide polymorphisms (SNPs were accumulated during this time-period and many of these were associated with genes involved in tolerance/resistance to antibiotics, metals or organic solvents, and transcriptional regulation. Collectively, these SNPs are likely to be associated with changes in virulence (at least to some extent that have refined the in vivo colonization capacity of the original outbreak isolate.
Espedido, Björn A.; Steen, Jason A.; Ziochos, Helen; Grimmond, Sean M.; Cooper, Matthew A.; Gosbell, Iain B.; van Hal, Sebastiaan J.; Jensen, Slade O.
2013-01-01
Whole genome sequencing was used to characterize the resistome of intensive care unit (ICU) outbreak-associated carbapenem-resistant K. pneumoniae isolates. Importantly, and of particular concern, the carbapenem-hydrolyzing β-lactamase gene bla OXA-48 and the extended-spectrum β-lactamase gene bla CTX-M-14, were identified on a single broad host-range conjugative plasmid. This represents the first report of bla OXA-48 in Australia and highlights the importance of resistance gene surveillance, as such plasmids can silently spread amongst enterobacterial populations and have the potential to drastically limit treatment options. Furthermore, the in vivo evolution of these isolates was also examined after 18 months of intra-abdominal carriage in a patient that transited through the ICU during the outbreak period. Reflecting the clonality of K. pneumoniae, only 11 single nucleotide polymorphisms (SNPs) were accumulated during this time-period and many of these were associated with genes involved in tolerance/resistance to antibiotics, metals or organic solvents, and transcriptional regulation. Collectively, these SNPs are likely to be associated with changes in virulence (at least to some extent) that have refined the in vivo colonization capacity of the original outbreak isolate. PMID:23555831
Bande, Faruku; Arshad, Siti Suri; Omar, Abdul Rahman
2016-01-01
Avian leukosis virus (ALV) belongs to the family Retroviridae and causes considerable economic losses to the poultry industry. Following an outbreak associated with high mortality in a broiler flock in northern part of Malaysia, kidney tissues from affected chickens were submitted for virus isolation and identification in chicken embryonated egg and MDCK cells. Evidence of virus growth was indicated by haemorrhage and embryo mortality in egg culture. While viral growth in cell culture was evidenced by the development of cytopathic effects. The isolated virus was purified by sucrose gradient and identified using negative staining transmission electron microscopy. Further confirmation was achieved through next-generation sequencing and nucleotide sequence homology search. Analysis of the viral sequences using the NCBI BLAST tool revealed 99-100% sequence homology with exogenous ALV viral envelope protein. Phylogenetic analysis based on partial envelope sequences showed the Malaysian isolate clustered with Taiwanese and Japanese ALV strains, which were closer to ALV subgroup J, ALV subgroup E, and recombinant A/E isolates. Based on these findings, ALV was concluded to be associated with the present outbreak. It was recommended that further studies should be conducted on the molecular epidemiology and pathogenicity of the identified virus isolate.
Hostnik, Peter; Picard-Meyer, Evelyne; Rihtarič, Danijela; Toplak, Ivan; Cliquet, Florence
2014-04-01
Oral vaccination campaigns to eliminate fox rabies were initiated in Slovenia in 1995. In May 2012, a young fox (Vulpes vulpes) with typical rabies signs was captured. Its brain and salivary gland tissues were found to contain vaccine strain SAD B19. The Basic Logical Alignment Search Tool alignment of 589 nucleotides determined from the N gene of the virus isolated from the brain and salivary glands of the affected fox was 100% identical to the GenBank reference SAD B19 strain. Sequence analysis of the N and M genes (4,351 nucleotides) showed two nucleotide modifications at position 1335 (N gene) and 3114 (M gene) in the KC522613 isolate identified in the fox compared to SAD B19.
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Directory of Open Access Journals (Sweden)
Maria Verônyca Coelho-Melo
2014-07-01
Full Text Available The shrimp Litopenaeus vannamei, one of the most important species in world aquaculture, has seriously affected by infectious myonecrosis virus (IMNV that causes up to 70% mortalities. With the aim of improving the development of new strategies for rapid and reliable diagnosis, we isolated IMNV, from L. vannamei farmed in Brazil, through a discontinuous sucrose gradient, and sequenced cDNA fragment encoding the major capsid protein from this virus. Nucleotides sequences corresponding to the viral capsid protein was obtained by RT-PCR and confirmed by automatic sequencing. Comparison with sequences which encode the capsid protein obtained from Indonesia isolates showed a high identity.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Precise detection of de novo single nucleotide variants in human genomes.
Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael
2018-05-07
The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.
Genome-wide sequence variations among Mycobacterium avium subspecies paratuberculosis.
Directory of Open Access Journals (Sweden)
Chung-Yi eHsu
2011-12-01
Full Text Available Mycobacterium avium subspecies paratuberculosis (M. ap, the causative agent of Johne’s disease (JD, infects many farmed ruminants, wildlife animals and humans. To better understand the molecular pathogenesis of these infections, we analyzed the whole genome sequences of several M. ap and M. avium subspecies avium (M. avium strains isolated from various hosts and environments. Using Next-generation sequencing technology, all 6 M. ap isolates showed a high percentage of homology (98% to the reference genome sequence of M. ap K-10 isolated from cattle. However, 2 M. avium isolates (DT 78 and Env 77 showed significant sequence diversity from the reference strain M. avium 104. The genomes of M. avium isolates DT 78 and Env 77 exhibited only 87% and 40% homology, respectively, to the M. avium 104 reference genome. Within the M. ap isolates, genomic rearrangements (insertions/deletions, Indels were not detected, and only unique single nucleotide polymorphisms (SNPs were observed among the 6 M. ap strains. While most of the SNPs (~100 in M. ap genomes were non-synonymous, a total of ~ 6000 SNPs were detected among M. avium genomes, most of them were synonymous suggesting a differential selective pressure between M. ap and M. avium isolates. In addition, SNPs-based phylo-genomic analysis showed that isolates from goat and Oryx are closely related to the cattle (K-10 strain while the human isolate (M. ap 4B is closely related to the environmental strains, indicating environmental source to human infections. Overall, SNPs were the most common variations among M. ap isolates while SNPs in addition to Indels were prevalent among M. avium isolates. Genomic variations will be useful in designing host-specific markers for the analysis of mycobacterial evolution and for developing novel diagnostics directed against Johne’s disease in animals.
Draft Genome Sequences of Six Ruminant Coxiella burnetii Isolates of European Origin
DEFF Research Database (Denmark)
Sidi-Boumedine, Karim; Ellis, Richard J.; Adam, Gilbert
2014-01-01
Coxiella burnetii is responsible for Q fever, a worldwide zoonosis attributed to the inhalation of aerosols contaminated by livestock birth products. Six draft genome sequences of European C. burnetii isolates from ruminants are presented here. The availability of these genomes will help in under......Coxiella burnetii is responsible for Q fever, a worldwide zoonosis attributed to the inhalation of aerosols contaminated by livestock birth products. Six draft genome sequences of European C. burnetii isolates from ruminants are presented here. The availability of these genomes will help...
Draft Genome Sequences of 17 Isolates of the Plant Pathogenic Bacterium Dickeya
Pritchard, Leighton; Humphris, Sonia; Saddler, Gerry S.; Elphinstone, John G.; Pirhonen, Minna; Toth, Ian K.
2013-01-01
Dickeya (formerly Erwinia chrysanthemi) species cause diseases on a wide range of crops and ornamental plants worldwide. Here we present the draft sequences of 17 Dickeya isolates spanning four Dickeya species, including five isolates that are currently unassigned to a species.
Draft genome sequences of 17 isolates of the plant pathogenic bacterium dickeya.
Pritchard, Leighton; Humphris, Sonia; Saddler, Gerry S; Elphinstone, John G; Pirhonen, Minna; Toth, Ian K
2013-11-21
Dickeya (formerly Erwinia chrysanthemi) species cause diseases on a wide range of crops and ornamental plants worldwide. Here we present the draft sequences of 17 Dickeya isolates spanning four Dickeya species, including five isolates that are currently unassigned to a species.
Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco
2013-04-01
Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Ai, L; Weng, Y B; Elsheikha, H M; Zhao, G H; Alasaad, S; Chen, J X; Li, J; Li, H L; Wang, C R; Chen, M X; Lin, R Q; Zhu, X Q
2011-09-27
The present study examined sequence variability in a portion of the mitochondrial cytochrome c oxidase subunit 1 (pcox1) and NADH dehydrogenase subunits 4 and 5 (pnad4 and pnad5) among 39 isolates of Fasciola spp., from different hosts from China, Niger, France, the United States of America, and Spain; and their phylogenetic relationships were re-constructed. Intra-species sequence variations were 0.0-1.1% for pcox1, 0.0-2.7% for pnad4, and 0.0-3.3% for pnad5 for Fasciola hepatica; 0.0-1.8% for pcox1, 0.0-2.5% for pnad4, and 0.0-4.2% for pnad5 for Fasciola gigantica, and 0.0-0.9% for pcox1, 0.0-0.2% for pnad4, and 0.0-1.1% for pnad5 for the intermediate Fasciola form. Whereas, nucleotide differences were 2.1-2.7% for pcox1, 3.1-3.3% for pnad4, and 4.2-4.8% for pnad5 between F. hepatica and F. gigantica; were 1.3-1.5% for pcox1, 2.1-2.9% for pnad4, 3.1-3.4% for pnad5 between F. hepatica and the intermediate form; and were 0.9-1.1% for pcox1, 1.4-1.8% for pnad4, 2.2-2.4% for pnad5 between F. gigantica and the intermediate form. Phylogenetic analysis based on the combined sequences of pcox1, pnad4 and pnad5 revealed distinct groupings of isolates of F. hepatica, F. gigantica, or the intermediate Fasciola form irrespective of their origin, demonstrating the usefulness of the mtDNA sequences for the delineation of Fasciola species, and reinforcing the genetic evidence for the existence of the intermediate Fasciola form. Copyright © 2011 Elsevier B.V. All rights reserved.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Complete Genome Sequence of a Rhodococcus Species Isolated from the Winter Skate Leucoraja ocellata.
Wiens, Julia; Ho, Ryan; Fernando, Dinesh; Kumar, Ayush; Loewen, Peter C; Brassinga, Ann Karen C; Anderson, W Gary
2016-09-01
We report here a genome sequence for Rhodococcus sp. isolate UM008 isolated from the renal/interrenal tissue of the winter skate Leucoraja ocellata Genome sequence analysis suggests that Rhodococcus bacteria may act in a novel mutualistic relationship with their elasmobranch host, serving as biocatalysts in the steroidogenic pathway of 1α-hydroxycorticosterone. Copyright © 2016 Wiens et al.
Mitochondrial DNA analysis reveals a low nucleotide diversity of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.
Directory of Open Access Journals (Sweden)
Kenji Sonomoto
2006-03-01
Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Tedim, Ana P.; Lanza, Val F.; Manrique, Marina; Pareja, Eduardo; Ruiz-Garbajosa, Patricia; Cantón, Rafael; Baquero, Fernando; Tobes, Raquel
2017-01-01
ABSTRACT The emergence of nosocomial infections by multidrug-resistant sequence type 117 (ST117) Enterococcus faecium has been reported in several European countries. ST117 has been detected in Spanish hospitals as one of the main causes of bloodstream infections. We analyzed genome variations of ST117 strains isolated in Madrid and describe the first ST117 closed genome sequences. PMID:28360174
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Genomic 3' terminal sequence comparison of three isolates of rabbit haemorrhagic disease virus.
Milton, I D; Vlasak, R; Nowotny, N; Rodak, L; Carter, M J
1992-05-15
Comparison of sequence data is necessary in older to investigate virus origins, identify features common to virulent strains, and characterize genomic organization within virus families. A virulent caliciviral disease of rabbits recently emerged in China. We have sequenced 1100 bases from the 3' ends of two independent European isolates of this virus, and compared these with previously determined calicivirus sequences. Rabbit caliciviruses were closely related, despite the different countries in which isolation was made. This supports the rapid spread of a new virus across Europe. The capsid protein sequences of these rabbit viruses differ markedly from those determined for feline calicivirus, but a hypothetical 3' open reading frame is relatively well conserved between the caliciviruses of these two different hosts and argues for a functional role.
Whole genome sequence of an unusual Borrelia burgdorferi sensu lato isolate
Energy Technology Data Exchange (ETDEWEB)
Casjens, S.R.; Dunn, J.; Fraser-Liggett, C. M.; Mongodin, E. F.; Qiu, W. G.; Luft, B. J.; Schutzer, S. E.
2011-03-01
Human Lyme disease is caused by a number of related Borrelia burgdorferi sensu lato species. We report here the complete genome sequence of Borrelia sp. isolate SV1 from Finland. This isolate is to date the closest known relative of B. burgdorferi sensu stricto, but it is sufficiently genetically distinct from that species that it and its close relatives warrant its candidacy for new-species status. We suggest that this isolate should be named 'Borrelia finlandensis.'
DEFF Research Database (Denmark)
Afzal, Mamuna; Abidi, Soad; Mikkelsen, Heidi
We have sequenced a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007. The strain was isolated from faecal material of a 48 month old second parity Danish Holstein cow, with clinical symptoms of chronic diarrhoea and emaciation. The cultures were grown on Löwen......We have sequenced a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007. The strain was isolated from faecal material of a 48 month old second parity Danish Holstein cow, with clinical symptoms of chronic diarrhoea and emaciation. The cultures were grown......, consisting of 4317 unique gene families. Comparison with M. avium paratuberculosis strain K10 revealed only 3436 genes in common (~70%). We have used GenomeAtlases to show conserved (and unique) regions along the Ejlskov2007 chromosome, compared to 2 other Mycobacterium avium sequenced genomes. Pan......-genome analyses of the sequenced Mycobacterium genomes reveal a surprisingly open and diverse set of genes for this bacterial genera....
Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang
2016-05-01
Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus)
Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya
2011-01-01
The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% iden...
Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk.
Jiménez, Esther; Villar-Tajadura, M Antonia; Marín, María; Fontecha, Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M
2012-07-01
Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties.
Luo, Shanshan; Hipler, Uta-Christina; Münzberg, Christin; Skerka, Christine; Zipfel, Peter F
2015-01-01
Candida albicans, the important human fungal pathogen uses multiple evasion strategies to control, modulate and inhibit host complement and innate immune attack. Clinical C. albicans strains vary in pathogenicity and in serum resistance, in this work we analyzed sequence polymorphisms and variations in the expression levels of two central fungal complement evasion proteins, Gpm1 (phosphoglycerate mutase 1) and Pra1 (pH-regulated antigen 1) in thirteen clinical C. albicans isolates. Four nucleotide (nt) exchanges, all representing synonymous exchanges, were identified within the 747-nt long GPM1 gene. For the 900-nt long PRA1 gene, sixteen nucleotide exchanges were identified, which represented synonymous, as well as non-synonymous exchanges. All thirteen clinical isolates had a homozygous exchange (A to G) at position 73 of the PRA1 gene. Surface levels of Gpm1 varied by 8.2, and Pra1 levels by 3.3 fold in thirteen tested isolates and these differences influenced fungal immune fitness. The high Gpm1/Pra1 expressing candida strains bound the three human immune regulators more efficiently, than the low expression strains. The difference was 44% for Factor H binding, 51% for C4BP binding and 23% for plasminogen binding. This higher Gpm1/Pra1 expressing strains result in enhanced survival upon challenge with complement active, Factor H depleted human serum (difference 40%). In addition adhesion to and infection of human endothelial cells was increased (difference 60%), and C3b surface deposition was less effective (difference 27%). Thus, variable expression levels of central immune evasion protein influences immune fitness of the human fungal pathogen C. albicans and thus contribute to fungal virulence.
Brown, Steven D; Utturkar, Sagar M; Klingeman, Dawn M; Johnson, Courtney M; Martin, Stanton L; Land, Miriam L; Lu, Tse-Yuan S; Schadt, Christopher W; Doktycz, Mitchel J; Pelletier, Dale A
2012-11-01
To aid in the investigation of the Populus deltoides microbiome, we generated draft genome sequences for 21 Pseudomonas strains and 19 other diverse bacteria isolated from Populus deltoides roots. Genome sequences for isolates similar to Acidovorax, Bradyrhizobium, Brevibacillus, Caulobacter, Chryseobacterium, Flavobacterium, Herbaspirillum, Novosphingobium, Pantoea, Phyllobacterium, Polaromonas, Rhizobium, Sphingobium, and Variovorax were generated.
Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan
2013-04-01
A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.
Woo, Mi Kyung; Kim, Kyeong Ah; Kim, JuYeon; Oh, Jun Seo; Han, Eun Taek; An, Seong Soo A; Lim, Chae Seung
2013-05-01
Nucleotide sequence analyses of the Pvs48/45 and Pvs47 genes were conducted in 46 malaria patients from the Republic of Korea (ROK) (n = 40) and returning travellers from India (n = 3) and Indonesia (n = 3). The domain structures, which were based on cysteine residue position and secondary protein structure, were similar between Plasmodium vivax (Pvs48/45 and Pvs47) and Plasmodium falciparum (Pfs48/45 and Pfs47). In comparison to the Sal-1 reference strain (Pvs48/45, PVX_083235 and Pvs47, PVX_083240), Korean isolates revealed seven polymorphisms (E35K, H211N, K250N, D335Y, A376T, I380T and K418R) in Pvs48/45. These isolates could be divided into five haplotypes with the two major types having frequencies of 47.5% and 20%, respectivelfy. In Pvs47, 10 polymorphisms (F22L, F24L, K27E, D31N, V230I, M233I, E240D, I262T, I273M and A373V) were found and they could be divided into four haplotypes with one major type having a frequency of 75%. The Pvs48/45 isolates from India showed a unique amino acid substitution site (K26R). Compared to the Sal-1 and ROK isolates, the Pvs47 isolates from travellers returning from India and Indonesia had amino acid substitutions (S57T and I262K). The current data may contribute to the development of the malaria transmission-blocking vaccine in future clinical trials.
Chemical rationale for selection of isolates for genome sequencing
DEFF Research Database (Denmark)
Rank, Christian; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian
The advances in gene sequencing will in the near future enable researchers to affordably acquire the full genomes of handpicked isolates. We here present a method to evaluate the chemical potential of an entire species and select representatives for genome sequencing. The selection criteria for new...... strains to be sequenced can be manifold, but for studying the functional phenotype, using a metabolome based approach offers a cheap and rapid assessment of critical strains to cover the chemical diversity. We have applied this methodology on the complex A. flavus/A. oryzae group. Though these two species...... are in principal identical, they represent two different phenotypes. This is clearly presented through a correspondence analysis of selected extrolites, in which the subtle chemical differences are visually dispersed. The results points to a handful of strains, which, if sequenced, will likely enhance our...
Biological and molecular characterization of Brazilian isolates of Zucchini yellow mosaic virus
Directory of Open Access Journals (Sweden)
David Marques de Almeida Spadotti
2015-02-01
Full Text Available Zucchini yellow mosaic virus (ZYMV causes substantial economic losses in cucurbit crops. Although ZYMV has been present in Brazil for more than 20 years, there is little information about the biological and molecular characteristics of the isolates found in the country. This study aimed to characterize the experimental hosts, pathotypes and genetic diversity of a collection of eleven Brazilian ZYMV isolates within the coat protein gene. For biological analysis, plant species from Amaranthaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Solanaceae, and Pedaliaceae were mechanically inoculated and pathotypes were identified based on the reaction of a resistant Cucumis melo, accession PI414723. All of the cucurbit species/varieties and Sesamum indicum were systemically infected with all isolates. The nucleotide sequence variability of the coat protein gene ranged from 82 % to 99 % compared to the corresponding sequences of ZYMV isolates from different geographical locations. No recombination event was detected in the coat protein gene of the isolates.
Directory of Open Access Journals (Sweden)
Qun Wang
2012-12-01
Full Text Available Microsatellites are simple sequence repeats with a high degree of polymorphism in the genome; they are used as DNA markers in many molecular genetic studies. Using traditional methods such as the magnetic beads enrichment method, only a few microsatellite markers have been isolated from the Chinese mitten crab Eriocheir sinensis, as the crab genome sequence information is unavailable. Here, we have identified a large number of microsatellites from the Chinese mitten crab by taking advantage of Solexa genomic surveying. A total of 141,737 SSR (simple sequence repeats motifs were identified via analysis of 883 Mb of the crab genomic DNA information, including mono-, di-, tri-, tetra-, penta- and hexa-nucleotide repeat motifs. The number of di-nucleotide repeat motifs was 82,979, making this the most abundant type of repeat motif (58.54%; the second most abundant were the tri-nucleotide repeats (42,657, 30.11%. Among di-nucleotide repeats, the most frequent repeats were AC motifs, accounting for 67.55% of the total number. AGG motifs were the most frequent (59.32% of the tri-nucleotide motifs. A total of 15,125 microsatellite loci had a flanking sequence suitable for setting the primer of a polymerase chain reaction (PCR. To verify the identified SSRs, a subset of 100 primer pairs was randomly selected for PCR. Eighty two primer sets (82% produced strong PCR products matching expected sizes, and 78% were polymorphic. In an analysis of 30 wild individuals from the Yangtze River with 20 primer sets, the number of alleles per locus ranged from 2–14 and the mean allelic richness was 7.4. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy-Weinberg equilibrium test showed significant deviation in four of the 20 microsatellite loci after sequential Bonferroni corrections. This method is cost- and time-effective in comparison to traditional approaches for the isolation of microsatellites.
Paleogenomics in a temperate environment: shotgun sequencing from an extinct Mediterranean caprine.
Directory of Open Access Journals (Sweden)
Oscar Ramírez
Full Text Available BACKGROUND: Numerous endemic mammals, including dwarf elephants, goats, hippos and deers, evolved in isolation in the Mediterranean islands during the Pliocene and Pleistocene. Most of them subsequently became extinct during the Holocene. Recently developed high-throughput sequencing technologies could provide a unique tool for retrieving genomic data from these extinct species, making it possible to study their evolutionary history and the genetic bases underlying their particular, sometimes unique, adaptations. METHODOLOGY/PRINCIPALS FINDINGS: A DNA extraction of a approximately 6,000 year-old bone sample from an extinct caprine (Myotragus balearicus from the Balearic Islands in the Western Mediterranean, has been subjected to shotgun sequencing with the GS FLX 454 platform. Only 0.27% of the resulting sequences, identified from alignments with the cow genome and comprising 15,832 nucleotides, with an average length of 60 nucleotides, proved to be endogenous. CONCLUSIONS: A phylogenetic tree generated with Myotragus sequences and those from other artiodactyls displays an identical topology to that generated from mitochondrial DNA data. Despite being in an unfavourable thermal environment, which explains the low yield of endogenous sequences, our study demonstrates that it is possible to obtain genomic data from extinct species from temperate regions.
Machado, Gabriel Esquitini; Matsumoto, Cristianne Kayoko; Chimara, Erica; Duarte, Rafael da Silva; de Freitas, Denise; Palaci, Moises; Hadad, David Jamil; Lima, Karla Valéria Batista; Lopes, Maria Luiza; Ramos, Jesus Pais; Campos, Carlos Eduardo; Caldas, Paulo César; Heym, Beate
2014-01-01
Outbreaks of infections by rapidly growing mycobacteria following invasive procedures, such as ophthalmological, laparoscopic, arthroscopic, plastic, and cardiac surgeries, mesotherapy, and vaccination, have been detected in Brazil since 1998. Members of the Mycobacterium chelonae-Mycobacterium abscessus group have caused most of these outbreaks. As part of an epidemiological investigation, the isolates were typed by pulsed-field gel electrophoresis (PFGE). In this project, we performed a large-scale comparison of PFGE profiles with the results of a recently developed multilocus sequence typing (MLST) scheme for M. abscessus. Ninety-three isolates were analyzed, with 40 M. abscessus subsp. abscessus isolates, 47 M. abscessus subsp. bolletii isolates, and six isolates with no assigned subspecies. Forty-five isolates were obtained during five outbreaks, and 48 were sporadic isolates that were not associated with outbreaks. For MLST, seven housekeeping genes (argH, cya, glpK, gnd, murC, pta, and purH) were sequenced, and each isolate was assigned a sequence type (ST) from the combination of obtained alleles. The PFGE patterns of DraI-digested DNA were compared with the MLST results. All isolates were analyzable by both methods. Isolates from monoclonal outbreaks showed unique STs and indistinguishable or very similar PFGE patterns. Thirty-three STs and 49 unique PFGE patterns were identified among the 93 isolates. The Simpson's index of diversity values for MLST and PFGE were 0.69 and 0.93, respectively, for M. abscessus subsp. abscessus and 0.96 and 0.97, respectively, for M. abscessus subsp. bolletii. In conclusion, the MLST scheme showed 100% typeability and grouped monoclonal outbreak isolates in agreement with PFGE, but it was less discriminative than PFGE for M. abscessus. PMID:24899019
Energy Technology Data Exchange (ETDEWEB)
Brown, Steven D [ORNL; Utturkar, Sagar M [ORNL; Klingeman, Dawn Marie [ORNL; Johnson, Courtney M [ORNL; Martin, Stanton [ORNL; Land, Miriam L [ORNL; Lu, Tse-Yuan [ORNL; Schadt, Christopher Warren [ORNL; Doktycz, Mitchel John [ORNL; Pelletier, Dale A [ORNL
2012-01-01
To aid in the investigation of the Populus deltoides microbiome we generated draft genome sequences for twenty one Pseudomonas and twenty one other diverse bacteria isolated from Populus deltoides roots. Genome sequences for isolates similar to Acidovorax, Bradyrhizobium, Brevibacillus, Burkholderia, Caulobacter, Chryseobacterium, Flavobacterium, Herbaspirillum, Novosphingobium, Pantoea, Phyllobacterium, Polaromonas, Rhizobium, Sphingobium and Variovorax were generated.
US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...
Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.
Directory of Open Access Journals (Sweden)
Heike Hadrys
Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.
Directory of Open Access Journals (Sweden)
Kojić M.
2012-01-01
Full Text Available The isolation and molecular characterization of bacterial strains isolated from water sources in the Vlasina Mountain in southeast Serbia, confirmed the presence of a new species Chryseobacterium vrystaatense ST1. This Gram- negative species showed an extremely low level of biochemical reactivity in biochemical tests. The gene for 16S rRNA was amplified by PCR using universal primers and sequenced. Comparison of 16S rRNA gene sequence and phenotypic features indicated that the isolate ST belonged to Chryseobacterium vrystaatense. A BLAST search of sequenced 1088 nucleotides of the 16S rRNA gene with all sequences deposited in the NCBI collection showed the highest similarity (98% with the strain Chryseobacterium vrystaatense sp. nov., designated as strain R-23533. The very high homology of these two strains allowed classification of our strain at the species level, but some differences indicate, and indirectly confirm, that the isolate ST is an authentic representative. On the basis of these results, we could conclude that Chryseobacterium vrystaatense ST was for first time isolated in Serbia, which is particularly important when one bears in mind that there are only three sequences of this species deposited in the NCBI collection.
Directory of Open Access Journals (Sweden)
Jens H. Kuhn
2014-09-01
Full Text Available Sequence determination of complete or coding-complete genomes of viruses is becoming common practice for supporting the work of epidemiologists, ecologists, virologists, and taxonomists. Sequencing duration and costs are rapidly decreasing, sequencing hardware is under modification for use by non-experts, and software is constantly being improved to simplify sequence data management and analysis. Thus, analysis of virus disease outbreaks on the molecular level is now feasible, including characterization of the evolution of individual virus populations in single patients over time. The increasing accumulation of sequencing data creates a management problem for the curators of commonly used sequence databases and an entry retrieval problem for end users. Therefore, utilizing the data to their fullest potential will require setting nomenclature and annotation standards for virus isolates and associated genomic sequences. The National Center for Biotechnology Information’s (NCBI’s RefSeq is a non-redundant, curated database for reference (or type nucleotide sequence records that supplies source data to numerous other databases. Building on recently proposed templates for filovirus variant naming [
Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.
Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent
2016-03-22
Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.
Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk
Jiménez, Esther; Villar-Tajadura, M. Antonia; Marín, María; Fontecha, F. Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M.
2012-01-01
Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties. © 2012, American Society for Microbiology.
Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H
1995-01-01
Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes
Directory of Open Access Journals (Sweden)
Faruku Bande
2016-01-01
Full Text Available Avian leukosis virus (ALV belongs to the family Retroviridae and causes considerable economic losses to the poultry industry. Following an outbreak associated with high mortality in a broiler flock in northern part of Malaysia, kidney tissues from affected chickens were submitted for virus isolation and identification in chicken embryonated egg and MDCK cells. Evidence of virus growth was indicated by haemorrhage and embryo mortality in egg culture. While viral growth in cell culture was evidenced by the development of cytopathic effects. The isolated virus was purified by sucrose gradient and identified using negative staining transmission electron microscopy. Further confirmation was achieved through next-generation sequencing and nucleotide sequence homology search. Analysis of the viral sequences using the NCBI BLAST tool revealed 99-100% sequence homology with exogenous ALV viral envelope protein. Phylogenetic analysis based on partial envelope sequences showed the Malaysian isolate clustered with Taiwanese and Japanese ALV strains, which were closer to ALV subgroup J, ALV subgroup E, and recombinant A/E isolates. Based on these findings, ALV was concluded to be associated with the present outbreak. It was recommended that further studies should be conducted on the molecular epidemiology and pathogenicity of the identified virus isolate.
Izedin Goga; Kristaq Berxholi; Beqe Hulaj; Driton Sylejmani; Boris Yakobson; Yehuda Stram
2014-01-01
Three serum samples positive in Antigen ELISA BVDV have been tested to characterise genetic diversity of bovine viral diarrhea virus (BVDV) in Kosovo. Samples were obtained in 2011 from heifers and were amplified by reverse transcription-polymerase chain reaction, sequenced and analysed by computer-assisted phylogenetic analysis. Amplified products and nucleotide sequence showed that all 3 isolates belonged to BVDV 1 genotype and 1b sub genotype. These results enrich the extant knowledge of B...
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Black, PA
2015-10-24
Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic diversity
Wang, Gang; Sun, Yanwei; Xu, Ruirui; Qu, Jing; Tee, Chuansia; Jiang, Xiyuan; Ye, Jian
2014-04-01
Jatropha curcas mosaic disease (JcMD) is a newly emerging disease that has been reported in Africa and India. Here, we report the complete nucleotide sequence of a new Indian cassava mosaic virus isolate (ICMV-SG) from Singapore. Infection of ICMV-SG showed more severe JcMD in Jatropha curcas and Nicotiana benthamiana than the other ICMV isolates reported previously, though ICMV-SG shares high sequence identity with the other ICMV isolates. Agroinfectious DNA-A alone sufficiently induced systemic symptoms in N. benthamiana, but not in J. curcas. Results from agroinfection assays showed that systemic infection of ICMV-SG in J. curcas required both DNA-A and DNA-B components.
Machado, Gabriel Esquitini; Matsumoto, Cristianne Kayoko; Chimara, Erica; Duarte, Rafael da Silva; de Freitas, Denise; Palaci, Moises; Hadad, David Jamil; Lima, Karla Valéria Batista; Lopes, Maria Luiza; Ramos, Jesus Pais; Campos, Carlos Eduardo; Caldas, Paulo César; Heym, Beate; Leão, Sylvia Cardoso
2014-08-01
Outbreaks of infections by rapidly growing mycobacteria following invasive procedures, such as ophthalmological, laparoscopic, arthroscopic, plastic, and cardiac surgeries, mesotherapy, and vaccination, have been detected in Brazil since 1998. Members of the Mycobacterium chelonae-Mycobacterium abscessus group have caused most of these outbreaks. As part of an epidemiological investigation, the isolates were typed by pulsed-field gel electrophoresis (PFGE). In this project, we performed a large-scale comparison of PFGE profiles with the results of a recently developed multilocus sequence typing (MLST) scheme for M. abscessus. Ninety-three isolates were analyzed, with 40 M. abscessus subsp. abscessus isolates, 47 M. abscessus subsp. bolletii isolates, and six isolates with no assigned subspecies. Forty-five isolates were obtained during five outbreaks, and 48 were sporadic isolates that were not associated with outbreaks. For MLST, seven housekeeping genes (argH, cya, glpK, gnd, murC, pta, and purH) were sequenced, and each isolate was assigned a sequence type (ST) from the combination of obtained alleles. The PFGE patterns of DraI-digested DNA were compared with the MLST results. All isolates were analyzable by both methods. Isolates from monoclonal outbreaks showed unique STs and indistinguishable or very similar PFGE patterns. Thirty-three STs and 49 unique PFGE patterns were identified among the 93 isolates. The Simpson's index of diversity values for MLST and PFGE were 0.69 and 0.93, respectively, for M. abscessus subsp. abscessus and 0.96 and 0.97, respectively, for M. abscessus subsp. bolletii. In conclusion, the MLST scheme showed 100% typeability and grouped monoclonal outbreak isolates in agreement with PFGE, but it was less discriminative than PFGE for M. abscessus. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Cassemiro, Klécia M S M; Burlandy, Fernanda M; da Silva, Edson E
2016-07-01
A natural type 3/type 2 intertypic capsid recombinant vaccine-related poliovirus was isolated from an acute flaccid paralytic case in Brazil. Genome sequencing revealed the uncommon location of the crossover site in the VP1 coding region (nucleotides 3251-3258 of Sabin 3 genome). The Sabin 2 donor sequence replaced the last 118 nt of VP1, resulting in the substitution of the complete antigenic site IIIa by PV2-specific amino acids. The low overall number of nucleotide substitutions in P1 region indicated that the predicted replication time of the isolate was about 8-9 weeks. Two of the principal determinants of attenuation in Sabin 3 genomes were mutated (U472C and C2493U), but the temperature-sensitive phenotype of the isolate was preserved. Our results support the theory that there exists a PV3/PV2 recombination hotspot site in the tail region of the VP1 capsid protein and that the recombination may occur soon after oral poliovirus vaccine administration.
Genome Sequences of Two Copper-Resistant Escherichia coli Strains Isolated from Copper-Fed Pigs
DEFF Research Database (Denmark)
Lüthje, Freja L.; Hasman, Henrik; Aarestrup, Frank Møller
2014-01-01
The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances.......The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances....
Applications of High Throughput Nucleotide Sequencing
DEFF Research Database (Denmark)
Waage, Johannes Eichler
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Directory of Open Access Journals (Sweden)
Qicheng Zhang
Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.
Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming
2013-01-01
Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.
Murray, Lee; Mobegi, Victor A; Duffy, Craig W; Assefa, Samuel A; Kwiatkowski, Dominic P; Laman, Eugene; Loua, Kovana M; Conway, David J
2016-05-12
In regions where malaria is endemic, individuals are often infected with multiple distinct parasite genotypes, a situation that may impact on evolution of parasite virulence and drug resistance. Most approaches to studying genotypic diversity have involved analysis of a modest number of polymorphic loci, although whole genome sequencing enables a broader characterisation of samples. PCR-based microsatellite typing of a panel of ten loci was performed on Plasmodium falciparum in 95 clinical isolates from a highly endemic area in the Republic of Guinea, to characterize within-isolate genetic diversity. Separately, single nucleotide polymorphism (SNP) data from genome-wide short-read sequences of the same samples were used to derive within-isolate fixation indices (F ws), an inverse measure of diversity within each isolate compared to overall local genetic diversity. The latter indices were compared with the microsatellite results, and also with indices derived by randomly sampling modest numbers of SNPs. As expected, the number of microsatellite loci with more than one allele in each isolate was highly significantly inversely correlated with the genome-wide F ws fixation index (r = -0.88, P 10 % had high correlation (r > 0.90) with the index derived using all SNPs. Different types of data give highly correlated indices of within-infection diversity, although PCR-based analysis detects low-level minority genotypes not apparent in bulk sequence analysis. When whole-genome data are not obtainable, quantitative assay of ten or more SNPs can yield a reasonably accurate estimate of the within-infection fixation index (F ws).
Sequence analysis of the Czech potato mop-top virus (PMTV) isolate Korneta-Nemilkov
Czech Academy of Sciences Publication Activity Database
Čeřovská, Noemi; Pečenková, Tamara; Filigarová, Marie; Dědič, P.
2007-01-01
Roč. 52, č. 1 (2007), s. 61-64 ISSN 0015-5632 R&D Projects: GA ČR GA522/04/1329; GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje Keywords : SPONGOSPORA-SUBTERRANEA * NUCLEOTIDE-SEQUENCE * GENOME ORGANIZATION Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.989, year: 2007 http://www.cssm.info/priloha/fm2007_061.pdf
Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells
International Nuclear Information System (INIS)
Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada
1988-01-01
HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription
Directory of Open Access Journals (Sweden)
Harsi Dewantari Kusumaningrum
2016-08-01
Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2, the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.
Directory of Open Access Journals (Sweden)
Siya Liu
2017-09-01
Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.
DEFF Research Database (Denmark)
Eriksen, J.; Hermann, N.V.; Darvann, Tron Andre
2006-01-01
Objective: Analysis of early postnatal mandibular size and growth velocity in children with untreated isolated cleft palate (ICP), nonsyndromic Robin sequence (RS), and a control group of children with unilateral incomplete cleft lip (UICL). Material: 114 children (66 isolated cleft palate, 7 Robin...... and mandibular growth velocity (mm/year) was calculated. Cleft width was measured on the casts at 2 months of age. Results: Mean mandibular length and posterior height were significantly smaller in isolated cleft palate and Robin sequence, compared with unilateral incomplete cleft lip. Mandibular length in Robin...... sequence was also significantly shorter, compared with isolated cleft palate. No significant difference was found between mean mandibular growth velocities in the three groups. No significant correlation was found between mandibular length and cleft width in either isolated cleft palate or Robin sequence...
Directory of Open Access Journals (Sweden)
Reza Ranjbar
2017-09-01
Full Text Available Background: Salmonella enterica serovar Typhimurium is one of the most important serovars of Salmonella enterica and is associated with human salmonellosis worldwide. Many epidemiological studies have focused on the characteristics of Salmonella Typhimurium in many countries as well as in Asia. This study was conducted to investigate the genetic characteristics of Salmonella Typhimurium using multilocus sequence typing (MLST. Methods: Clinical samples (urine, blood, and stool were collected from patients, who were admitted to 2 hospitals in Tehran between April and September, 2015. Salmonella Typhimurium strains were identified by conventional standard biochemical and serological testing. The antibiotic susceptibility patterns of the Salmonella Typhimurium isolates against 16 antibiotics was determined using the disk diffusion assay. The clonal relationship between the strains of Salmonella Typhimurium was analyzed using MLST. Results: Among the 68 Salmonella isolates, 31% (n=21 were Salmonella Typhimurium. Of the total 21 Salmonella Typhimurium isolates, 76% (n=16 were multidrug-resistant and showed resistance to 3 or more antibiotic families. The Salmonella Typhimurium isolates were assigned to 2 sequence types: ST19 and ST328. ST19 was more common (86%. Both sequence types were further assigned to 1 eBURST group. Conclusion: This is the first study of its kind in Iran to determine the sequence types of the clinical isolates of Salmonella Typhimurium in Tehran hospitals using MLST. ST19 was detected as the major sequence type of Salmonella Typhimurium.
DEFF Research Database (Denmark)
Liu, Siyang; Huang, Shujia; Rao, Junhua
2015-01-01
present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...
Chockalingam, Ashok K; Chander, Yogesh; Halvorson, David A; Goyal, Sagar M
2010-06-01
The glycoprotein (G) gene sequences of avian metapneumovirus (aMPV) subtypes A, B, C, and D are variable in size and number of nucleotides. The G gene of early U.S. turkey isolates of aMPV-C have been reported to be 1798 nucleotides (nt) (585 aa) in length, whereas the G genes of more recent turkey isolates have been reported to be 783 nucleotides. In some studies, the G gene of aMPV-C turkey isolates was found to be truncated to a smaller G gene of 783 nt (261 aa) upon serial passages in Vero cells. This is believed to be due to the deletion of 1015 nt near the end of the open reading frame. The purpose of this study was to determine variation, if any, in the G gene of an aMPV-C isolated from a wild bird (Canada goose [Branta canadensis]) following serial passages in Vero cells. No size variation was observed for up to 50 passages, except for a few amino acid changes in the extracellular domain at the 50th passage level. The G gene of this wild bird isolate appears to be unique from subtype C metapneumoviruses of turkeys.
Fiore, Nicola; Fajardo, Thor V M; Prodan, Simona; Herranz, María Carmen; Aparicio, Frederic; Montealegre, Jaime; Elena, Santiago F; Pallás, Vicente; Sánchez-Navarro, Jesús
2008-01-01
Prunus necrotic ringspot virus (PNRSV) is distributed worldwide, but no molecular data have been previously reported from South American isolates. The nucleotide sequences corresponding to the movement (MP) and coat (CP) proteins of 23 isolates of PNRSV from Chile, Brazil, and Uruguay, and from different Prunus species, have been obtained. Phylogenetic analysis performed with full-length MP and CP sequences from all the PNRSV isolates confirmed the clustering of the isolates into the previously reported PV32-I, PV96-II and PE5-III phylogroups. No association was found between specific sequences and host, geographic origin or symptomatology. Comparative analysis showed that both MP and CP have phylogroup-specific amino acids and all of the motifs previously characterized for both proteins. The study of the distribution of synonymous and nonsynonymous changes along both open reading frames revealed that most amino acid sites are under the effect of negative purifying selection.
Yazdani, D; Zainal Abidin, M A; Tan, Y H; Kamaruzaman, S
2011-01-01
Thirty milled rice samples were collected from retailers in 4 provinces of Malaysia. These samples were evaluated for Aspergillus spp. infection by direct plating on malt extract salt agar (MESA). All Aspergillus holomorphs were isolated and identified using nucleotide sequences of ITS 1 and ITS 2 of rDNA. Five anamorphs (Aspergillus flavus, A. oryzae, A. tamarii, A. fumigatus and A. niger) and 5 teleomorphs (Eurotium rubrum, E. amstelodami, E. chevalieri, E. cristatum and E. tonophilum) were identified. The PCR-sequencing based technique for sequences of ITS 1 and ITS 2 is a fast technique for identification of Aspergillus and Eurotium species, although it doesn't work flawlessly for differentiation of Eurotium species. All Aspergillus and Eurotium isolates were screened for their ability to produce aflatoxin and ochratoxin A (OTA) by HPLC and TLC techniques. Only A. flavus isolate UPM 89 was able to produce aflatoxins B1 and B2.
FASH: A web application for nucleotides sequence search
Directory of Open Access Journals (Sweden)
Chew Paul
2008-05-01
Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website
Carolina Rojas, O; León-Cachón, Rafael B R; Pérez-Maya, Antonio Alí; Aguirre-Garza, Marcelino; Moreno-Treviño, María G; González, Gloria M
2015-05-01
Chromoblastomycosis is a chronic granulomatous disease caused frequently by fungi of the Fonsecaea genus. The objective of this study was the phenotypic and molecular identification of F. pedrosoi strains isolated from chromoblastomycosis patients in Mexico and Venezuela. Ten strains were included in this study. For phenotypic identification, we used macroscopic and microscopic morphologies, carbohydrate assimilation test, urea hydrolysis, cixcloheximide tolerance, proteolitic activity and the thermotolerance test. The antifungal activity of five drugs was evaluated against the isolates. Molecular identification was performed by sequencing the internal transcribed spacer (ITS) ribosomal DNA regions of the isolated strains. The physiological analysis and morphological features were variable and the precise identification was not possible. All isolates were susceptible to itraconazole, terbinafine, voriconazole and posaconazole. Amphotericin B was the least effective drug. The alignment of the 559-nucleotide ITS sequences from our strains compared with sequences of GenBank revealed high homology with F. pedrosoi (EU285266.1). In this study, all patients were from rural areas, six from Mexico and four from Venezuela. Ten isolates were identified by phenotypic and molecular analysis, using ITS sequence and demonstrated that nine isolates from Mexico and Venezuela were 100% homologous and one isolate showed a small genetic distance. © 2015 Blackwell Verlag GmbH.
Molecular cloning and characterization of genes required for nucleotide excision repair in yeast
International Nuclear Information System (INIS)
Friedberg, E.C.
1987-01-01
Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies
International Nuclear Information System (INIS)
Black, C.G.; Fyfe, J.A.M.; Davies, J.K.
1997-01-01
A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
Directory of Open Access Journals (Sweden)
Mi Kyung Woo
2013-05-01
Full Text Available Nucleotide sequence analyses of the Pvs48/45 and Pvs47 genes were conducted in 46 malaria patients from the Republic of Korea (ROK (n = 40 and returning travellers from India (n = 3 and Indonesia (n = 3. The domain structures, which were based on cysteine residue position and secondary protein structure, were similar between Plasmodium vivax (Pvs48/45 and Pvs47 and Plasmodium falciparum (Pfs48/45 and Pfs47. In comparison to the Sal-1 reference strain (Pvs48/45, PVX_083235 and Pvs47, PVX_083240, Korean isolates revealed seven polymorphisms (E35K, H211N, K250N, D335Y, A376T, I380T and K418R in Pvs48/45. These isolates could be divided into five haplotypes with the two major types having frequencies of 47.5% and 20%, respectivelfy. In Pvs47, 10 polymorphisms (F22L, F24L, K27E, D31N, V230I, M233I, E240D, I262T, I273M and A373V were found and they could be divided into four haplotypes with one major type having a frequency of 75%. The Pvs48/45 isolates from India showed a unique amino acid substitution site (K26R. Compared to the Sal-1 and ROK isolates, the Pvs47 isolates from travellers returning from India and Indonesia had amino acid substitutions (S57T and I262K. The current data may contribute to the development of the malaria transmission-blocking vaccine in future clinical trials.
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...
Genetic diversity of clinical isolates of Bacillus cereus using multilocus sequence typing
Directory of Open Access Journals (Sweden)
Pruckler James M
2008-11-01
Full Text Available Abstract Background Bacillus cereus is most commonly associated with foodborne illness (diarrheal and emetic but is also an opportunistic pathogen that can cause severe and fatal infections. Several multilocus sequence typing (MLST schemes have recently been developed to genotype B. cereus and analysis has suggested a clonal or weakly clonal population structure for B. cereus and its close relatives B. anthracis and B. thuringiensis. In this study we used MLST to determine if B. cereus isolates associated with illnesses of varying severity (e.g., severe, systemic vs. gastrointestinal (GI illness were clonal or formed clonal complexes. Results A retrospective analysis of 55 clinical B. cereus isolates submitted to the Centers for Disease Control and Prevention between 1954 and 2004 was conducted. Clinical isolates from severe infections (n = 27, gastrointestinal (GI illness (n = 18, and associated isolates from food (n = 10 were selected for analysis using MLST. The 55 isolates were diverse and comprised 38 sequence types (ST in two distinct clades. Of the 27 isolates associated with serious illness, 13 clustered in clade 1 while 14 were in clade 2. Isolates associated with GI illness were also found throughout clades 1 and 2, while no isolates in this study belonged to clade 3. All the isolates from this study belonging to the clade 1/cereus III lineage were associated with severe disease while isolates belonging to clade1/cereus II contained isolates primarily associated with severe disease and emetic illness. Only three STs were observed more than once for epidemiologically distinct isolates. Conclusion STs of clinical B. cereus isolates were phylogenetically diverse and distributed among two of three previously described clades. Greater numbers of strains will need to be analyzed to confirm if specific lineages or clonal complexes are more likely to contain clinical isolates or be associated with specific illness, similar to B. anthracis and
Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.
Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset
2018-03-01
The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.
Tenjimbayashi, Yuri; Onuki, Mamiko; Hirose, Yusuke; Mori, Seiichiro; Ishii, Yoshiyuki; Takeuchi, Takamasa; Tasaka, Nobutaka; Satoh, Toyomi; Morisada, Tohru; Iwata, Takashi; Miyamoto, Shingo; Matsumoto, Koji; Sekizawa, Akihiko; Kukimoto, Iwao
2017-01-01
Human papillomavirus genotypes 52 and 58 (HPV52/58) are frequently detected in patients with cervical intraepithelial neoplasia (CIN) and invasive cervical cancer (ICC) in East Asian countries including Japan. As with other HPV genotypes, HPV52/58 consist of multiple lineages of genetic variants harboring less than 10% differences between complete genome sequences of the same HPV genotype. However, site variations of nucleotide and amino acid sequences across the viral whole-genome have not been fully examined for HPV52/58. The aim of this study was to investigate genetic variations of HPV52/58 prevalent among Japanese women by analyzing the viral whole-genome sequences. The entire genomic region of HPV52/58 was amplified by long-range PCR with total cellular DNA extracted from cervical exfoliated cells isolated from Japanese patients with CIN or ICC. The amplified DNA was subjected to next generation sequencing to determine the complete viral genome sequences. Phylogenetic analyses were performed with the whole-genome sequences to assign variant lineages/sublineages to the HPV52/58 isolates. The variability in amino acid sequences of viral proteins was assessed by calculating the Shannon entropy scores at individual amino acid positions of HPV proteins. Among 52 isolates of HPV52 (CIN1, n = 20; CIN2/3, n = 21; ICC, n = 11), 50 isolates belonged to lineage B (sublineage B2) and two isolates belonged to lineage A (sublineage A1). Among 48 isolates of HPV58 (CIN1, n = 21; CIN2/3, n = 19; ICC, n = 8), 47 isolates belonged to lineage A (sublineages A1/A2/A3) and one isolate belonged to lineage C. Single nucleotide polymorphisms specific for individual variant lineages were determined throughout the viral genome based on multiple sequence alignments of the Japanese HPV52/58 isolates and reference HPV52/58 genomes. Entropy analyses revealed that the E1 protein was relatively variable among the HPV52 isolates, whereas the E7, E4, and L2 proteins showed
DEFF Research Database (Denmark)
Karczmarczyk, M.; Martins, M.; McCusker, M.
2010-01-01
Ninety-three Salmonella isolates recovered from commercial foods and exotic animals in Colombia were studied. The serotypes, resistance profiles and where applicable the quinolone resistance genes were determined. Salmonella Anatum (n=14), Uganda (19), Braenderup (10) and Newport (10) were the most...... plasmids, two of which were completely sequenced. These exhibited 97% (serovar 6,7:d:- isolate) and 100% (serovar Infantis isolate) nucleotide sequence identity with previously identified ColE-like plasmids. This study demonstrates the occurrence of the qnrB19 gene associated with small ColE plasmids...
Whole-Genome Sequences of Two Borrelia afzelii and Two Borrelia garinii Lyme Disease Agent Isolates
Energy Technology Data Exchange (ETDEWEB)
Casjens, S.R.; Dunn, J.; Mongodin, E. F.; Qiu, W.-G.; Luft, B. J.; Fraser-Liggett, C. M.; Schutzer, S. E.
2011-12-01
Human Lyme disease is commonly caused by several species of spirochetes in the Borrelia genus. In Eurasia these species are largely Borrelia afzelii, B. garinii, B. burgdorferi, and B. bavariensis sp. nov. Whole-genome sequencing is an excellent tool for investigating and understanding the influence of bacterial diversity on the pathogenesis and etiology of Lyme disease. We report here the whole-genome sequences of four isolates from two of the Borrelia species that cause human Lyme disease, B. afzelii isolates ACA-1 and PKo and B. garinii isolates PBr and Far04.
Chicas, Mauricio; Caviedes, Mario; Hammond, Rosemarie; Madriz, Kenneth; Albertazzi, Federico; Villalobos, Heydi; Ramírez, Pilar
2007-06-01
Maize rayado fino virus (MRFV) infects maize and appears to be restricted to, yet widespread in, the Americas. MRFV was previously unreported from Ecuador. Maize plants exhibiting symptoms of MRFV infection were collected at the Santa Catalina experiment station in Quito, Ecuador. RT-PCR reactions were performed on total RNA extracted from the symptomatic leaves using primers specific for the capsid protein (CP) gene and 3' non-translated region of MRFV and first strand cDNA as a template. Nucleotide sequence comparisons to previously sequenced MRFV isolates from other geographic regions revealed 88-91% sequence identity. Phylogenetic trees constructed using Maximum Likelihood, UPGMA, Minimal Evolution, Neighbor Joining, and Maximum Parsimony methods separated the MRFV isolates into four groups. These groups may represent geographic isolation generated by the mountainous chains of the American continent. Analysis of the sequences and the genetic distances among the different isolates suggests that MRFV may have originated in Mexico and/or Guatemala and from there it dispersed to the rest of the Americas.
Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea
Directory of Open Access Journals (Sweden)
Ji-Sun Park
2015-01-01
Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.
Isolation of Bokeloh bat lyssavirus in Myotis nattereri in France.
Picard-Meyer, Evelyne; Servat, Alexandre; Robardet, Emmanuelle; Moinet, Marie; Borel, Christophe; Cliquet, Florence
2013-11-01
Bokeloh bat lyssavirus (BBLV) was found in Myotis nattereri for the first time in northeastern France in July 2012. The complete genome sequence of the virus from the infected Natterer's bat was determined by whole-genome sequencing and compared to that of the first BBLV strain isolated in 2010 in Germany and with those of all currently identified lyssaviruses. The French isolate [KC169985] showed 98.7 % nucleotide sequence identity to the German BBLV strain [JF311903]. Several organs of the infected French bat were examined by classical rabies diagnostic methods: fluorescent antibody test, cell culture inoculation test and RT-qPCR. Antigen, infectious virus and high viral RNA levels were found in both the brain and salivary glands. Traces of genomic RNA were detected in the bladder, kidney and lung tissue. The results of an investigation of the distribution of lyssaviruses with the detection of infectious virus in the salivary glands suggest a possible mode of transmission of the virus.
Directory of Open Access Journals (Sweden)
Sun Yu
2011-11-01
Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.
Rizotto, La?s S.; Scagion, Guilherme P.; Cardoso, Tereza C.; Sim?o, Raphael M.; Caserta, Leonardo C.; Benassi, Julia C.; Keid, Lara B.; Oliveira, Tr?cia M. F. de S.; Soares, Rodrigo M.; Arns, Clarice W.; Van Borm, Steven; Ferreira, Helena L.
2017-01-01
ABSTRACT We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A.
DEFF Research Database (Denmark)
Lilje, Berit; Rasmussen, Rasmus Vedby; Dahl, Anders
2017-01-01
Most Staphylococcus aureus isolates can cause invasive disease given the right circumstances, but it is unknown if some isolates are more likely to cause severe infections than others. S. aureus bloodstream isolates from 120 patients with definite infective endocarditis and 121 with S. aureus...... bacteraemia without infective endocarditis underwent whole-genome sequencing. Genome-wide association analysis was performed using a variety of bioinformatics approaches including SNP analysis, accessory genome analysis and k-mer based analysis. Core and accessory genome analyses found no association...... with either of the two clinical groups. In this study, the genome sequences of S. aureus bloodstream isolates did not discriminate between bacteraemia and infective endocarditis. Based on our study and the current literature, it is not convincing that a specific S. aureus genotype is clearly associated...
Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan
Directory of Open Access Journals (Sweden)
Hanan Aref Hasan
2018-04-01
Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.
Directory of Open Access Journals (Sweden)
L Rupa
2016-01-01
Full Text Available Context: Two novel proteins/genes Rv0679c and Rv0180c of Mycobacterium tuberculosis (MTB H37Rv were classified as a hypothetical membrane and transmembrane proteins which might have a role in the invasion. Molecular analysis of these genes in human clinical isolates of pulmonary tuberculosis (PTB patients was not well characterised. Aims: To assess the molecular diversity of Rv0679c and Rv0180c genes of MTB from clinical isolates of PTB patients. Settings and Design: DNA from 97 clinical isolates was extracted and subjected to amplification using selective primers by polymerase chain reaction (PCR. The PCR product obtained was sequenced commercially. Patients and Methods: Clinical isolates obtained from tuberculosis patients were investigated for polymorphisms in the Rv0679c and Rv0180c genes by PCR and DNA sequencing. Genomic DNA isolated by cetyltrimethylammonium bromide method was used for amplification of genes. Results: Rv0679c gene was highly conserved in 61 out of 65 clinical isolates assessed for sequence homology with wild-type H37Rv gene and was identical using ClustalW. Fifty-five out of 78 (70.5% clinical isolates assessed for Rv0180c were positive for single nucleotide polymorphism (SNP at 258th position where the nucleotide G was replaced with T (G to T. In clinical isolates of untreated cases, the frequency was 54.5% for SNP at 258th position which is low compared to cases undergoing treatment where the frequency was 73.1%. Conclusions: Molecular analysis of Rv0180c in clinical isolates of PTB assessed in this study was the first report, where an SNP at 258th position G to T was identified within the gene. Rv0679c gene was highly conserved (94%, within Indian clinical isolates as compared to reports from other nations.
The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences
Directory of Open Access Journals (Sweden)
Ivan V. Stepanyan
2017-01-01
Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.
Directory of Open Access Journals (Sweden)
Vakharia Vikram N
2009-10-01
Full Text Available Abstract Background Viral hemorrhagic septicemia virus (VHSV is a highly contagious viral disease of fresh and saltwater fish worldwide. VHSV caused several large scale fish kills in the Great Lakes area and has been found in 28 different host species. The emergence of VHS in the Great Lakes began with the isolation of VHSV from a diseased muskellunge (Esox masquinongy caught from Lake St. Clair in 2003. VHSV is a member of the genus Novirhabdovirus, within the family Rhabdoviridae. It has a linear single-stranded, negative-sense RNA genome of approximately 11 kbp, with six genes. VHSV replicates in the cytoplasm and produces six monocistronic mRNAs. The gene order of VHSV is 3'-N-P-M-G-NV-L-5'. This study describes molecular characterization of the Great Lakes VHSV strain (MI03GL, and its phylogenetic relationships with selected European and North American isolates. Results The complete genomic sequences of VHSV-MI03GL strain was determined from cloned cDNA of six overlapping fragments, obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of MI03GL comprises 11,184 nucleotides (GenBank GQ385941 with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. The first 4 nucleotides at the termini of the VHSV genome are complementary and identical to other novirhadoviruses genomic termini. Sequence homology and phylogenetic analysis show that the Great Lakes virus is closely related to the Japanese strains JF00Ehi1 (96% and KRRV9822 (95%. Among other novirhabdoviruses, VHSV shares highest sequence homology (62% with snakehead rhabdovirus. Conclusion Phylogenetic tree obtained by comparing 48 glycoprotein gene sequences of different VHSV strains demonstrate that the Great Lakes VHSV is closely related to the North American and Japanese genotype IVa, but forms a distinct genotype IVb, which is clearly different from the three European genotypes. Molecular
Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf
2014-01-01
The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2
Energy Technology Data Exchange (ETDEWEB)
Dash, Paban Kumar, E-mail: pabandash@rediffmail.com; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana
2013-07-05
Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a
Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2
International Nuclear Information System (INIS)
Dash, Paban Kumar; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana
2013-01-01
Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a
Using msa-2b as a molecular marker for genotyping Mexican isolates of Babesia bovis.
Genis, Alma D; Perez, Jocelin; Mosqueda, Juan J; Alvarez, Antonio; Camacho, Minerva; Muñoz, Maria de Lourdes; Rojas, Carmen; Figueroa, Julio V
2009-12-01
Variable merozoite surface antigens of Babesia bovis are exposed glycoproteins having a role in erythrocyte invasion. Members of this gene family include msa-1 and msa-2 (msa-2c, msa-2a(1), msa-2a(2) and msa-2b). To determine the sequence variation among B. bovis Mexican isolates using msa-2b as a genetic marker, PCR amplicons corresponding to msa-2b were cloned and plasmids carrying the corresponding inserts were purified and sequenced. Comparative analysis of nucleotide and deduced amino acid sequences revealed distinct degrees of variability and identity among the coding gene sequences obtained from 16 geographically different Mexican B. bovis isolates and a reference strain. Clustal-W multiple alignments of the MSA-2b deduced amino acid sequences performed with the 17 B. bovis Mexican isolates, revealed the identification of three genotypes with a distinct set each of amino acid residues present at the variable region: Genotype I represented by the MO7 strain (in vitro culture-derived from the Mexico isolate) as well as RAD, Chiapas-1, Tabasco and Veracruz-3 isolates; Genotype II, represented by the Jalisco, Mexico and Veracruz-2 isolates; and Genotype III comprising the sequences from most of the isolates studied, Tamaulipas-1, Chiapas-2, Guerrero-1, Nayarit, Quintana Roo, Nuevo Leon, Tamaulipas-2, Yucatan and Guerrero-2. Moreover, these three genotypes could be discriminated against each other by using a PCR-RFLP approach. The results suggest that occurrence of indels within the variable region of msa-2b sequences can be useful markers for identifying a particular genotype present in field populations of B. bovis isolated from infected cattle in Mexico.
Whole genome sequencing of Mycobacterium tuberculosis SB24 isolated from Sabah, Malaysia
Directory of Open Access Journals (Sweden)
Noraini Philip
2016-09-01
Full Text Available Mycobacterium tuberculosis (M. tuberculosis is the causative agent of tuberculosis (TB that causes millions of death every year. We have sequenced the genome of M. tuberculosis isolated from cerebrospinal fluid (CSF of a patient diagnosed with tuberculous meningitis (TBM. The isolated strain was referred as M. tuberculosis SB24. Genomic DNA of the M. tuberculosis SB24 was extracted and subjected to whole genome sequencing using PacBio platform. The draft genome size of M. tuberculosis SB24 was determined to be 4,452,489 bp with a G + C content of 65.6%. The whole genome shotgun project has been deposited in NCBI SRA under the accession number SRP076503.
Rizotto, Laís S; Scagion, Guilherme P; Cardoso, Tereza C; Simão, Raphael M; Caserta, Leonardo C; Benassi, Julia C; Keid, Lara B; Oliveira, Trícia M F de S; Soares, Rodrigo M; Arns, Clarice W; Van Borm, Steven; Ferreira, Helena L
2017-07-20
We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A. Copyright © 2017 Rizotto et al.
Behera, Bijay Kumar; Baisvar, Vishwamitra Singh; Kunal, Swaraj Priyaranjan; Meena, Dharmendra Kumar; Panda, Debarata; Pakrashi, Sudip; Paria, Prasenjit; Das, Pronob; Bhakta, Dibakar; Debnath, Dipesh; Roy, Suvra; Suresh, V R; Jena, J K
2018-03-01
The population structure and genetic diversity of Rohu (Labeo rohita Hamilton, 1822) was studied by analysis of the partial sequences of mitochondrial DNA cytochrome b region. We examined 133 samples collected from six locations in three geographically isolated rivers of India. Analysis of 11 haplotypes showed low haplotype diversity (0.00150), nucleotide diversity (π) (0.02884) and low heterogeneity value (0.00374). Analysis of molecular variance (AMOVA) revealed the genetic diversity of L. rohita within population is very high than between the populations. The Fst scores (-0.07479 to 0.07022) were the indication of low genetic structure of L. rohita populations of three rivers of India. Conspicuously, Farakka-Bharuch population pair Fst score of 0.0000, although the sampling sites are from different rivers. The phylogenetic reconstruction of unique haplotypes revealed sharing of a single central haplotype (Hap_1) by all the six populations with a point mutations ranging from 1-25 nucleotides.
Umene, Kenichi; Shiraishi, Atsushi
2013-06-01
"Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.
Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.
Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C
1997-12-01
Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.
International Nuclear Information System (INIS)
Mardis, E.R.; Roe, B.A.
1989-01-01
Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data
L’Haridon, Stéphane
2018-01-17
We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.
L’ Haridon, Sté phane; Corre, Erwan; Guan, Yue; Vinu, Manikandan; La Cono, Violetta; Yakimov, Michail; Stingl, Ulrich; Toffin, Laurent; Jebbar, Mohamed
2018-01-01
We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.
Platonov, A E; Mironov, K O; Iatsyshina, S B; Koroleva, I S; Platonova, O V; Gushchin, A E; Shipulin, G A
2003-01-01
Haemophilius influenzae, type b (Hib) bacteria, were genotyped by multilocus sequence typing (MLST) using 5 loci (adk, fucK, mdh, pgi, recA). 42 Moscow Hib strains (including 38 isolates form cerebrospinal fluid of children, who had purulent meningitis in 1999-2001, and 4 strains isolated from healthy carriers of Hib), as well as 2 strains from Yekaterinburg were studied. In MLST a strain is characterized, by alleles and their combinations (an allele profile) referred to also as sequence-type (ST). 9 Sts were identified within the Russian Hib bacteria: ST-1 was found in 25 strains (57%), ST-12 was found in 8 strains (18%), ST-11 was found in 4 strains (9%) and ST-15 was found in 2 strains (4.5%); all other STs strains (13, 14, 16, 17, 51) were found in isolated cases (2.3%). A comparison of allelic profiles and of nucleotide sequences showed that 93% of Russian isolates, i.e. strain with ST-1, 11, 12, 13, 15 and 17, belong to one and the same clonal complex. 2 isolates from Norway and Sweden from among 7 foreign Hib strains studied up to now can be described as belonging to the same clonal complex; 5 Hib strains were different from the Russian ones.
Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.
Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai
2018-01-09
Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of
DEFF Research Database (Denmark)
Leonardsen, L; DeClue, J E; Lybaek, H
1996-01-01
The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....
Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M
2015-01-01
The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.
Ciardo, Diana E; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V; Böttger, Erik C
2010-08-01
The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory.
Masters, N; Christie, M; Katouli, M; Stratton, H
2015-06-01
We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.
Isolation of Bartonella henselae from a serologically negative cat in Bloemfontein, South Africa
Directory of Open Access Journals (Sweden)
A-M Pretorius
1999-07-01
Full Text Available Sera collected from apparently healthy 6-12-month-old cats (n = 31 presented to the Society for the Prevention of Cruelty to Animals Veterinary Clinic in Bloemfontein for neutering were tested for antibodies reactive to Bartonella henselae (Houston-1 strain by indirect fluorescent antibody testing. Whole blood collected from the cats was used in isolation experiments and subsequent identification of Bartonella species was based on comparison of the nucleotide base sequence of polymerase chain reaction-amplified citrate synthase gene fragments. While none of the cats had antibodies reactive with B. henselae at titres > 1/64, an organism with a partial citrate synthase gene sequence identical to that of B. henselae (Houston-1 was isolated from 1 cat.
RANDNA: a random DNA sequence generator.
Piva, Francesco; Principato, Giovanni
2006-01-01
Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.
Sequence of a cloned cDNA encoding human ribosomal protein S11
Energy Technology Data Exchange (ETDEWEB)
Lott, J B; Mackie, G A
1988-02-11
The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.
The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).
Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya
2011-05-01
The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.
Directory of Open Access Journals (Sweden)
Tess V Clendenen
Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.
Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan
2016-01-01
Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.
Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus
Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline
2016-01-01
Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.
Directory of Open Access Journals (Sweden)
V.L. Quadros
2006-07-01
Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were
Linares, Daniel M; Arboleya, Silvia; Ross, R Paul; Stanton, Catherine
2017-04-27
Here is presented the whole-genome sequence of Streptococcus thermophilus APC151, isolated from a marine fish. This bacterium produces gamma-aminobutyric acid (GABA) in high yields and is biotechnologically suitable to produce naturally GABA-enriched biofunctional yogurt. Its complete genome comprises 2,097 genes and 1,839,134 nucleotides, with an average G+C content of 39.1%. Copyright © 2017 Linares et al.
Jaschob, Daniel; Davis, Trisha N; Riffle, Michael
2015-03-07
Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.
DEFF Research Database (Denmark)
Lund, Lars Christian; Sydenham, Thomas Vognbjerg; Høgh, Silje Vermedal
2015-01-01
"Terrisporobacter othiniensis" (proposed species) was isolated from a blood culture. Genomic DNA was sequenced using a MiSeq benchtop sequencer (Illumina) and assembled using the SPAdes genome assembler. This resulted in a draft genome sequence comprising 3,980,019 bp in 167 contigs containing 3...
Directory of Open Access Journals (Sweden)
Li Xuehui
2012-10-01
Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs
Directory of Open Access Journals (Sweden)
Wang Ting
2011-04-01
Full Text Available Abstract Backgroud Foot-and-mouth disease virus (FMDV serotype Asia1 generally infects cattle and sheep, while its infection of pigs is rarely reported. In 2005-2007, FMD outbreaks caused by Asia1 type occurred in many regions of China, as well as some parts of East Asia countries. During the outbreaks, there was not any report that pigs were found to be clinically infected. Results In this study, a strain of FMDV that isolated from pigs was identified as serotype Asia1, and designated as "Asia1/WHN/CHA/06". To investigate the genomic feature of the strain, complete genome of Asia1/WHN/CHA/06 was sequenced and compared with sequences of other FMDVs by phylogenetic and recombination analysis. The complete genome of Asia1/WHN/CHA/06 was 8161 nucleotides (nt in length, and was closer to JS/CHA/05 than to all other strains. Potential recombination events associated with Asia1/WHN/CHA/06 were found between JS/CHA/05 and HNK/CHA/05 strains with partial 3B and 3C fragments. Conclusion This is the first report of the isolation and identification of a strain of FMDV type Asia1 from naturally infected pigs. The Asia1/WHN/CHA/06 strain may evolve from the recombination of JS/CHA/05 and HNK/CHA/05 strains.
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
Pyrosequencing as a tool for the identification of common isolates of Mycobacterium sp.
Tuohy, Marion J; Hall, Gerri S; Sholtis, Mary; Procop, Gary W
2005-04-01
Pyrosequencing technology, sequencing by addition, was evaluated for categorization of mycobacterial isolates. One hundred and eighty-nine isolates, including 18 ATCC and Trudeau Mycobacterial Culture Collection (TMC) strains, were studied. There were 38 Mycobacterium tuberculosis complex, 27 M. kansasii, 27 MAI complex, 21 M. marinum, 14 M. gordonae, 20 M. chelonae-abscessus group, 10 M. fortuitum, 5 M. xenopi, 3 M. celatum, 2 M. terrae complex, 20 M. mucogenicum, and 2 M. scrofulaceum. Nucleic acid extracts were prepared from solid media or MGIT broth. Traditional PCR was performed with one of the primers biotinylated; the assay targeted a portion of the 16S rRNA gene that contains a hypervariable region, which has been previously shown to be useful for the identification of mycobacteria. The PSQ Sample Preparation Kit was used, and the biotinylated PCR product was processed to a single-stranded DNA template. The sequencing primer was hybridized to the DNA template in a PSQ96 plate. Incorporation of the complementary nucleotides resulted in light generation peaks, forming a pyrogram, which was evaluated by the instrument software. Thirty basepairs were used for isolate categorization. Manual interpretation of the sequences was performed if the quality of the 30-bp sequence was in doubt or if more than 4 bp homopolymers were recognized. Sequences with more than 5 bp of bad quality were deemed unacceptable. When blasted against GenBank, 179 of 189 sequences (94.7%) assigned isolates to the correct molecular genus or group. Ten M. gordonae isolates had more than 5 bp of bad quality sequence and were not accepted. Pyrosequencing of this hypervariable region afforded rapid and acceptable characterization of common, routinely isolated clinical Mycobacterium sp. Algorithms are recommended for further differentiation with an additional sequencing primer or additional biochemicals.
Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.
Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard
2015-09-01
Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.