WorldWideScience

Sample records for isolated nucleotide sequences

  1. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  2. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  3. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  5. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  6. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    Science.gov (United States)

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  7. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  8. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  9. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  10. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  11. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  12. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  13. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  14. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  15. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  16. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  17. Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

    Science.gov (United States)

    Mukhopadhyaya, R; Sadaie, M R

    1993-02-01

    Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

  18. Molecular study and nucleotide sequencing of Chlamydia abortus isolated from aborted sheep fetuses ewes of Alborz province

    Directory of Open Access Journals (Sweden)

    amirreza ebadi

    2015-02-01

    Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.

  19. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  20. Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

    Directory of Open Access Journals (Sweden)

    Annemieke Smet

    Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

  1. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  2. Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

    Science.gov (United States)

    Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

    2014-01-01

    Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

  3. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  4. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  5. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  6. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  7. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  8. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  9. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  10. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  11. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  12. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  13. Serological and genetic characterisation of bovine respiratory syncytial virus (BRSV) indicates that Danish isolates belong to the intermediate subgroup: no evidence of a selective effect on the variability of G protein nucleotide sequence by prior cell culture adaption and passages in cell culture

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.

    1998-01-01

    on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...

  14. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    Science.gov (United States)

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  15. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  16. Isolation and characterization of human glycophorin A cDNAs using a synthetic oligonucleotide approach: nucleotide sequence, mRNA structure and regulation by 12-O-tetradecanoylphorbol 13-acetate (TPA)

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription

  17. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  18. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  19. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  20. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  1. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  2. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  3. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  4. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  5. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  6. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  7. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  8. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  9. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  10. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  11. Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.

    Science.gov (United States)

    Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R

    2017-09-14

    The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.

  12. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  13. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  14. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  15. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  16. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  17. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    Science.gov (United States)

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  18. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  19. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  20. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  1. Genome Sequences of Ilzat and Eleri, Two Phages Isolated Using Microbacterium foliorum NRRL B-24224

    Science.gov (United States)

    Ali, Ilzat; Jones, Acacia Eleri; Mohamed, Aleem

    2018-01-01

    ABSTRACT Bacteriophages Ilzat and Eleri are newly isolated Siphoviridae infecting Microbacterium foliorum NRRL B-24224. The phage genomes are similar in length, G+C content, and architecture and share 62.9% nucleotide sequence identity. PMID:29650566

  2. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  3. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  4. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  5. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  6. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  7. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  8. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  9. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  10. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  11. Genetic characterization of Brazilian bovine viral diarrhea virus isolates by partial nucleotide sequencing of the 5'-UTR region Caracterização genética de amostras brasileiras do vírus da diarréia viral bovina através do seqüenciamento parcial da Região 5'UTR

    Directory of Open Access Journals (Sweden)

    Adriana Cortez

    2006-12-01

    Full Text Available Nineteen isolates of bovine viral diarrhea virus (BVDV from Brazil were genetically characterized through partial nucleotide sequencing and analysis of the 5'UTR region. The isolates were grouped as BVDV-1 (11/19, BVDV-2 (6/19 or "atypical" pestivirus (2/19. Among the BVDV-1, eight isolates were classified as subgenotype BVDV-1a, whereas most (4 out of 6 BVDV-2 belonged to subgenotype 2b. Two isolates from aborted fetuses were not classified into any genetic group, being considered atypical BVDVs. Genetic diversity among Brazilian BVDV isolates may be responsible for vaccination and diag-nostic failure and therefore may influence the control strategies for BVDV infection in the country.Dezenove amostras do vírus da diarréia viral bovina (BVDV foram caracterizadas geneticamente através do seqüenciamento parcial de nucleotídeos da Região 5'UTR. As amostras foram agrupadas em BVDV-1 (11/19, BVDV-2 (6/19 e num terceiro grupo de amostras denominadas "atípicas" (2/19. Das onze amostras genotipadas como BVDV-1, oito amostras foram sub-genotipadas como BVDV-1a, enquanto que a maioria (4/6 das amostras de BVDV-2 foi agrupada como BVDV-2b. Duas amostras provenientes de fetos bovinos abortados foram classificadas como atípicas, não BVDV-1 e 2. A presença da diversidade genética de BVDV detectada nas amostras estudadas pode ser responsável por falhas vacinais e de diagnóstico e deve influenciar nas estratégias de controle do BVDV aplicadas nas diferentes regiões brasileiras.

  12. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  13. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  14. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  15. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  16. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

    Science.gov (United States)

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-08-19

    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  17. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  18. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  19. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  20. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  1. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  2. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  3. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  4. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  5. Deep sequencing as a method of typing bluetongue virus isolates.

    Science.gov (United States)

    Rao, Pavuluri Panduranga; Reddy, Yella Narasimha; Ganesh, Kapila; Nair, Shreeja G; Niranjan, Vidya; Hegde, Nagendra R

    2013-11-01

    Bluetongue (BT) is an economically important endemic disease of livestock in tropics and subtropics. In addition, its recent spread to temperate regions like North America and Northern Europe is of serious concern. Rapid serotyping and characterization of BT virus (BTV) is an essential step in the identification of origin of the virus and for controlling the disease. Serotyping of BTV is typically performed by serum neutralization, and of late by nucleotide sequencing. This report describes the near complete genome sequencing and typing of two isolates of BTV using Illumina next generation sequencing platform. Two of the BTV RNAs were multiplexed with ten other unknown samples. Viral RNA was isolated and fragmented, reverse transcribed, the cDNA ends were repaired and ligated with a multiplex oligo. The genome library was amplified using primers complementary to the ligated oligo and subjected to single and paired end sequencing. The raw reads were assembled using a de novo method and reference-based assembly was performed based on the contig data. Near complete sequences of all segments of BTV were obtained with more than 20× coverage, and single read sequencing method was sufficient to identify the genotype and serotype of the virus. The two viruses used in this study were typed as BTV-1 and BTV-9E. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Draft Genome Sequences of Three Novel Low-Abundance Species Strains Isolated from Kefir Grain.

    Science.gov (United States)

    Kim, Yongkyu; Blasche, Sonja; Patil, Kiran R

    2017-09-28

    We report here the genome sequences of three novel bacterial species strains- Bacillus kefirresidentii Opo, Rothia kefirresidentii KRP, and Streptococcus kefirresidentii YK-isolated from kefir grains collected in Germany. The draft genomes of these isolates were remarkably dissimilar (average nucleotide identities, 77.80%, 89.01%, and 92.10%, respectively) to those of the previously sequenced strains. Copyright © 2017 Kim et al.

  7. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  8. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  9. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  10. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  11. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L

    2008-08-01

    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  12. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  13. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  14. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  15. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  16. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  17. Single nucleotide polymorphism analysis of the enterocin P structural gene of Enterococcus faecium strains isolated from nonfermented animal foods.

    Science.gov (United States)

    Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge

    2006-12-01

    The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.

  18. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  19. Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

    Science.gov (United States)

    Wen, Chiu-Ming

    2017-08-01

    An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

  20. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  1. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  2. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  3. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  4. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    OpenAIRE

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.; Afonso, Claudio L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related.

  5. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    Science.gov (United States)

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related. PMID:28572332

  6. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  7. Whole-genome sequence of Clostridium lituseburense L74, isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus.

    Science.gov (United States)

    Lee, Yookyung; Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan

    2016-03-01

    Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000.

  8. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  9. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  10. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Science.gov (United States)

    2010-07-01

    ... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

  11. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  12. PCR and magnetic bead-mediated target capture for the isolation of short interspersed nucleotide elements in fishes.

    Science.gov (United States)

    Liu, Dong; Zhu, Guoli; Tang, Wenqiao; Yang, Jinquan; Guo, Hongyi

    2012-01-01

    Short interspersed nucleotide elements (SINEs), a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR). Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR). The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180-360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNA(Leu)-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.

  13. PCR and Magnetic Bead-Mediated Target Capture for the Isolation of Short Interspersed Nucleotide Elements in Fishes

    Directory of Open Access Journals (Sweden)

    Dong Liu

    2012-02-01

    Full Text Available Short interspersed nucleotide elements (SINEs, a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR. Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR. The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180–360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNALeu-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.

  14. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  15. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  16. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  17. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  18. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  19. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  20. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  1. Extensive sequence divergence among bovine respiratory syncytial viruses isolated during recurrent outbreaks in closed herds

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

    2000-01-01

    and veal calf production units) in different years and from all confirmed outbreaks in Denmark within a short period. The results showed that identical viruses were isolated within a herd during outbreaks and that viruses from recurrent infections varied by up to 11% in sequence even in closed herds......The nucleotides coding for the extracellular part of the G glycoprotein and the full SH protein of bovine respiratory syncytial virus (BRSV) were sequenced from viruses isolated from numerous outbreaks of BRSV infection. The isolates included viruses isolated from the same herd (closed dairy farms....... It is possible that a quasispecies variant swarm of BRSV persisted in some of the calves in each herd and that a new and different highly fit virus type (master and consensus sequence) became dominant and spread from a single animal in connection with each new outbreak. Based on the high level of diversity...

  2. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  3. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  4. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  5. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  6. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  7. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    Science.gov (United States)

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  8. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  9. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  10. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  11. Whole-genome sequence of Clostridium lituseburense L74, isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus

    OpenAIRE

    Lee, Yookyung; Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan

    2016-01-01

    Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000. Keywords: Insect, Larval gut, Whole genome shot-gun sequencing

  12. Whole-genome sequence of Clostridium lituseburense L74, isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus

    Directory of Open Access Journals (Sweden)

    Yookyung Lee

    2016-03-01

    Full Text Available Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000. Keywords: Insect, Larval gut, Whole genome shot-gun sequencing

  13. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  14. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  15. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    Science.gov (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  16. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  17. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  18. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Science.gov (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  19. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  20. Whole exome sequencing identifies novel mutation in eight Chinese children with isolated tetralogy of Fallot.

    Science.gov (United States)

    Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng

    2017-12-05

    Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.

  1. First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States.

    Science.gov (United States)

    Ali, Akhtar

    2017-01-12

    In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

  2. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  3. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  4. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  5. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  6. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  7. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  8. Complete genome sequences of three tomato spotted wilt virus isolates from tomato and pepper plants in Korea and their phylogenetic relationship to other TSWV isolates.

    Science.gov (United States)

    Lee, Jong-Seung; Cho, Won Kyong; Kim, Mi-Kyeong; Kwak, Hae-Ryun; Choi, Hong-Soo; Kim, Kook-Hyung

    2011-04-01

    Tomato spotted wilt virus (TSWV) infects numerous host plants and has three genome segments, called L, M and S. Here, we report the complete genome sequences of three Korean TSWV isolates (TSWV-1 to -3) infecting tomato and pepper plants. Although the nucleotide sequence of TSWV-1 genome isolated from tomato is very different from those of TSWV-2 and TSWV-3 isolated from pepper, the deduced amino acid sequences of the five TSWV genes are highly conserved among all three TSWV isolates. In phylogenetic analysis, deduced RdRp protein sequences of TSWV-2 and TSWV-3 were clustered together with two previously reported isolates from Japan and Korea, while TSWV-1 grouped together with a Hawaiian isolate. A phylogenetic tree based on N protein sequences, however, revealed four distinct groups of TSWV isolates, and all three Korean isolates belonged to group II, together with many other isolates, mostly from Europe and Asia. Interestingly, most American isolates grouped together as group I. Together, these results suggested that these newly identified TSWV isolates might have originated from an Asian ancestor and undergone divergence upon infecting different host plants.

  9. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  10. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  11. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  12. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).

    Science.gov (United States)

    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco

    2013-04-01

    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  14. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  15. Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan

    Directory of Open Access Journals (Sweden)

    Jenn-Tzong Chang

    2017-11-01

    Full Text Available The first human parechovirus 3 (HPeV3 VGHKS-2007 in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection.

  16. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  17. Whole-Genome Sequences of Two Carbapenem-Resistant Klebsiella quasipneumoniae Strains Isolated from a Tertiary Hospital in Johor, Malaysia.

    Science.gov (United States)

    Gan, Han Ming; Rajasekaram, Ganeswrie; Eng, Wilhelm Wei Han; Kaniappan, Priyatharisni; Dhanoa, Amreeta

    2017-08-10

    We report the whole-genome sequences of two carbapenem-resistant clinical isolates of Klebsiella quasipneumoniae subsp. similipneumoniae obtained from two different patients. Both strains contained three different extended-spectrum β-lactamase genes and showed strikingly high pairwise average nucleotide identity of 99.99% despite being isolated 3 years apart from the same hospital. Copyright © 2017 Gan et al.

  18. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  19. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  20. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  1. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  2. Genome analysis of environmental and clinical P. aeruginosa isolates from sequence type-1146.

    Directory of Open Access Journals (Sweden)

    David Sánchez

    Full Text Available The genomes of Pseudomonas aeruginosa isolates of the new sequence type ST-1146, three environmental (P37, P47 and P49 and one clinical (SD9 isolates, with differences in their antibiotic susceptibility profiles have been sequenced and analysed. The genomes were mapped against P. aeruginosa PAO1-UW and UCBPP-PA14. The allelic profiles showed that the highest number of differences were in "Related to phage, transposon or plasmid" and "Secreted factors" categories. The clinical isolate showed a number of exclusive alleles greater than that for the environmental isolates. The phage Pf1 region in isolate SD9 accumulated the highest number of nucleotide substitutions. The ORF analysis of the four genomes assembled de novo indicated that the number of isolate-specific genes was higher in isolate SD9 (132 genes than in isolates P37 (24 genes, P47 (16 genes and P49 (21 genes. CRISPR elements were found in all isolates and SD9 showed differences in the spacer region. Genes related to bacteriophages F116 and H66 were found only in isolate SD9. Genome comparisons indicated that the isolates of ST-1146 are close related, and most genes implicated in pathogenicity are highly conserved, suggesting a genetic potential for infectivity in the environmental isolates similar to the clinical one. Phage-related genes are responsible of the main differences among the genomes of ST-1146 isolates. The role of bacteriophages has to be considered in the adaptation processes of isolates to the host and in microevolution studies.

  3. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  4. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  5. A study of single nucleotide polymorphism in the ystB gene of Yersinia enterocolitica strains isolated from various wild animal species.

    Science.gov (United States)

    Bancerz-Kisiel, Agata; Szczerba-Turek, Anna; Platt-Samoraj, Aleksandra; Michalczyk, Maria; Szweda, Wojciech

    2017-03-01

    Y. enterocolitica is the causative agent of yersiniosis. The objective of the article was a study of single nucleotide polymorphism in the ystB gene of Y. enterocolitica strains isolated from various wild animal species. High-resolution melting (HRM) analysis was applied to identify single nucleotide polymorphism (SNP) of ystB gene fragments of 88 Y. enterocolitica biotype 1A strains isolated from wild boar, roe deer, red deer and wild ducks. HRM analysis revealed 14 different melting profiles - 4 of them were defined as regular genotypes (G1, G2, G3, G4), whereas 10 as variations. 24 of the examined Y. enterocolitica strains were classified as G1, 18 strains as a G2, 21 strains as a G3, and 15 strains as a G4. Nucleotide sequences classified as G1 revealed 100% similarity with the Y. enterocolitica D88145.1 sequence (NCBI). Analysis of G2 revealed one point mutation - transition T111A. One mutation was also found in G3, but SNP was placed in a different gene region - transition G193A. Two SNPs - transitions G92C and T111A - were identified in G4. Direct sequencing of 10 variations revealed 5 new variants of the ystB nucleotide sequence: V1 - transition G129A (3 strains); V2 - transitions T111A and G193A (2 strains); V3 - transitions C118T and G193A (1 strain); V4 - transitions C141A and G193A (2 strains); and V5 characterized by 19 SNPs: G83A, T93A, A109G, G114T, C116T, A123G, T134C, T142G, T144C, A150C, G162A, T165G, T170G, T174A, T177G, G178A, A179G, A184G and G193A (2 strains). The predominant genotype in isolates from wild ducks was G1; in red deer G2; in wild boar G3; in roe deer G1 and G4. The proposed HRM method could be used to analyze Y. enterocolitica biotype 1A strains isolated from different sources, including humans.

  6. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  7. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    Directory of Open Access Journals (Sweden)

    Tess V Clendenen

    Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  8. Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

    Science.gov (United States)

    Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

    2013-10-01

    The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

  9. The complete genome sequence of a south Indian isolate of Rice tungro spherical virus reveals evidence of genetic recombination between distinct isolates.

    Science.gov (United States)

    Sailaja, B; Anjum, Najreen; Patil, Yogesh K; Agarwal, Surekha; Malathi, P; Krishnaveni, D; Balachandran, S M; Viraktamath, B C; Mangrauthia, Satendra K

    2013-12-01

    In this study, complete genome of a south Indian isolate of Rice tungro spherical virus (RTSV) from Andhra Pradesh (AP) was sequenced, and the predicted amino acid sequence was analysed. The RTSV RNA genome consists of 12,171 nt without the poly(A) tail, encoding a putative typical polyprotein of 3,470 amino acids. Furthermore, cleavage sites and sequence motifs of the polyprotein were predicted. Multiple alignment with other RTSV isolates showed a nucleotide sequence identity of 95% to east Indian isolates and 90% to Philippines isolates. A phylogenetic tree based on complete genome sequence showed that Indian isolates clustered together, while Vt6 and PhilA isolates of Philippines formed two separate clusters. Twelve recombination events were detected in RNA genome of RTSV using the Recombination Detection Program version 3. Recombination analysis suggested significant role of 5' end and central region of genome in virus evolution. Further, AP and Odisha isolates appeared as important RTSV isolates involved in diversification of this virus in India through recombination phenomenon. The new addition of complete genome of first south Indian isolate provided an opportunity to establish the molecular evolution of RTSV through recombination analysis and phylogenetic relationship.

  10. [Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

    Science.gov (United States)

    Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

    2008-05-01

    One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

  11. The genome sequence of four isolates from the family Lichtheimiaceae.

    Science.gov (United States)

    Chibucos, Marcus C; Etienne, Kizee A; Orvis, Joshua; Lee, Hongkyu; Daugherty, Sean; Lockhart, Shawn R; Ibrahim, Ashraf S; Bruno, Vincent M

    2015-07-01

    This study reports the release of draft genome sequences of two isolates of Lichtheimia corymbifera and two isolates of L. ramosa. Phylogenetic analyses indicate that the two L. corymbifera strains (CDC-B2541 and 008-049) are closely related to the previously sequenced L. corymbifera isolate (FSU 9682) while our two L. ramosa strains CDC-B5399 and CDC-B5792 cluster apart from them. These genome sequences will further the understanding of intraspecies and interspecies genetic variation within the Mucoraceae family of pathogenic fungi. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  13. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Sequence analysis of sub-genotype D hepatitis B surface antigens isolated from Jeddah, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Sahar EL Hadad

    2018-05-01

    Full Text Available Little is known about the prevalence of HBV genotypes/sub-genotypes in Jeddah province, although the hepatitis B virus (HBV was identified as the most predominant type of hepatitis in Saudi Arabia. To characterize HBV genotypes/sub-genotypes, serum samples from 15 patients with chronic HBV were collected and subjected to HBsAg gene amplification and sequence analysis. Phylogenetic analysis of the HBsAg gene sequences revealed that 11 (48% isolates belonged to HBV/D while 4 (18% were associated with HBV/C. Notably, a HBV/D sub-genotype phylogenetic tree identified that eight current isolates (72% belonged to HBV/D1, whereas three isolates (28% appeared to be more closely related to HBV/D5, although they formed a novel cluster supported by a branch with 99% bootstrap value. Isolates belonging to D1 were grouped in one branch and seemed to be more closely related to various strains isolated from different countries. For further determination of whether the three current isolates belonged to HBV/D5 or represented a novel sub-genotype, HBV/DA, whole HBV genome sequences would be required. In the present study, we verified that HBV/D1 is the most prevalent HBV sub-genotype in Jeddah, and identified novel variant mutations suggesting that an additional sub-genotype designated HBV/DA should be proposed. Overall, the results of the present HBsAg sequence analyses provide us with insights regarding the nucleotide differences between the present HBsAg/D isolates identified in the populace of Jeddah, Saudi Arabia and those previously isolated worldwide. Additional studies with large numbers of subjects in other areas might lead to the discovery of the specific HBV strain genotypes or even additional new sub-genotypes that are circulating in Saudi Arabia. Keywords: Hepatitis B virus, HBV sub-genotypes, HBV/D, HBsAg, Viral isolates, Population studies

  15. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  16. Complete genome sequence of frog virus 3, isolated from a strawberry poison frog (Oophaga pumilio) imported from nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  17. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  18. Complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from lettuce (Lactuca sativa) originating from a conventional field in Norway.

    Science.gov (United States)

    Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

    2016-12-01

    Here, we present the 3,795,952 bp complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017580.

  19. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  20. Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

    Directory of Open Access Journals (Sweden)

    Bannantine John P

    2012-03-01

    Full Text Available Abstract Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs. Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb. Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565 further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences.

  1. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  2. Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

    Science.gov (United States)

    Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

    2004-04-01

    Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

  3. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  4. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  5. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  6. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  7. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  8. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  9. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  10. Whole genome sequencing of Mycobacterium bovis to obtain molecular fingerprints in human and cattle isolates from Baja California, Mexico.

    Science.gov (United States)

    Sandoval-Azuara, Sarai Estrella; Muñiz-Salazar, Raquel; Perea-Jacobo, Ricardo; Robbe-Austerman, Suelee; Perera-Ortiz, Alejandro; López-Valencia, Gilberto; Bravo, Doris M; Sanchez-Flores, Alejandro; Miranda-Guzmán, Daniela; Flores-López, Carlos Alberto; Zenteno-Cuevas, Roberto; Laniado-Laborín, Rafael; de la Cruz, Fabiola Lafarga; Stuber, Tod P

    2017-10-01

    To determine genetic diversity by comparing the whole genome sequences of cattle and human Mycobacterium bovis isolates from Baja California. A whole genome sequencing strategy was used to obtain the molecular fingerprints of 172 isolates of M. bovis obtained from Baja California, Mexico; 155 isolates were from cattle and 17 isolates were from humans. Spoligotypes were characterized in silico and single nucleotide polymorphism (SNP) differences between the isolates were evaluated. A total of 12 M. bovis spoligotype patterns were identified in cattle and humans. Two predominant spoligotypes patterns were seen in both cattle and humans: SB0145 and SB1040. The SB0145 spoligotype represented 59% of cattle isolates (n=91) and 65% of human isolates (n=11), while the SB1040 spoligotype represented 30% of cattle isolates (n=47) and 30% of human isolates (n=5). When evaluating SNP differences, the human isolates were intimately intertwined with the cattle isolates. All isolates from humans had spoligotype patterns that matched those observed in the cattle isolates, and all human isolates shared common ancestors with cattle in Baja California based on SNP analysis. This suggests that most human tuberculosis caused by M. bovis in Baja California is derived from M. bovis circulating in Baja California cattle. These results reinforce the importance of bovine tuberculosis surveillance and control in this region. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  12. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  13. MULTILOCUS SEQUENCE TYPING OF BRUCELLA ISOLATES FROM THAILAND.

    Science.gov (United States)

    Chawjiraphan, Wireeya; Sonthayanon, Piengchan; Chanket, Phanita; Benjathummarak, Surachet; Kerdsin, Anusak; Kalambhaheti, Thareerat

    2016-11-01

    Although brucellosis outbreaks in Thailand are rare, they cause abortions and infertility in animals, resulting in significant economic loss. Because Brucella spp display > 90% DNA homology, multilocus sequence typing (MLST) was employed to categorize local Brucella isolates into sequence types (STs) and to determine their genetic relatedness. Brucella samples were isolated from vaginal secretion of cows and goats, and from blood cultures of infected individuals. Brucella species were determined by multiplex PCR of eight loci, in addition to MLST based on partial DNA sequences of nine house-keeping genes. MLST analysis of 36 isolates revealed 78 distinct novel allele types and 34 novel STs, while two isolates possessed the known ST8. Sequence alignments identified polymorphic sites in each allele, ranging from 2-6%, while overall genetic diversity was 3.6%. MLST analysis of the 36 Brucella isolates classified them into three species, namely, B. melitensis, B. abortus and B. suis, in agreement with multiplex PCR results. Genetic relatedness among ST members of B. melitensis and B. abortus determined by eBURST program revealed ST2 as founder of B. abortus isolates and ST8 the founder of B. melitensis isolates. ST 36, 41 and 50 of Thai Brucella isolates were identified as single locus variants of clonal cluster (CC) 8, while the majority of STs were diverse. The genetic diversity and relatedness identified using MLST revealed hitherto unexpected diversity among Thai Brucella isolates. Genetic classification of isolates could reveal the route of brucellosis transmission among humans and farm animals and also reveal their relationship with other isolates in the region and other parts of the world.

  14. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  16. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  17. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  18. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  19. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  20. Whole-Genome Sequences of Thirteen Isolates of Borrelia burgdorferi

    Energy Technology Data Exchange (ETDEWEB)

    Schutzer S. E.; Dunn J.; Fraser-Liggett, C. M.; Casjens, S. R.; Qiu, W.-G.; Mongodin, E. F.; Luft, B. J.

    2011-02-01

    Borrelia burgdorferi is a causative agent of Lyme disease in North America and Eurasia. The first complete genome sequence of B. burgdorferi strain 31, available for more than a decade, has assisted research on the pathogenesis of Lyme disease. Because a single genome sequence is not sufficient to understand the relationship between genotypic and geographic variation and disease phenotype, we determined the whole-genome sequences of 13 additional B. burgdorferi isolates that span the range of natural variation. These sequences should allow improved understanding of pathogenesis and provide a foundation for novel detection, diagnosis, and prevention strategies.

  1. Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

    Science.gov (United States)

    Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

    2015-10-01

    Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

  2. Multilocus Sequence Typing for Interpreting Blood Isolates of Staphylococcus epidermidis

    Directory of Open Access Journals (Sweden)

    Prannda Sharma

    2014-01-01

    Full Text Available Staphylococcus epidermidis is an important cause of nosocomial infection and bacteremia. It is also a common contaminant of blood cultures and, as a result, there is frequently uncertainty as to its diagnostic significance when recovered in the clinical laboratory. One molecular strategy that might be of value in clarifying the interpretation of S. epidermidis identified in blood culture is multilocus sequence typing. Here, we examined 100 isolates of this species (50 blood isolates representing true bacteremia, 25 likely contaminant isolates, and 25 skin isolates and the ability of sequence typing to differentiate them. Three machine learning algorithms (classification regression tree, support vector machine, and nearest neighbor were employed. Genetic variability was substantial between isolates, with 44 sequence types found in 100 isolates. Sequence types 2 and 5 were most commonly identified. However, among the classification algorithms we employed, none were effective, with CART and SVM both yielding only 73% diagnostic accuracy and nearest neighbor analysis yielding only 53% accuracy. Our data mirror previous studies examining the presence or absence of pathogenic genes in that the overlap between truly significant organisms and contaminants appears to prevent the use of MLST in the clarification of blood cultures recovering S. epidermidis.

  3. Characterization of the first complete genome sequence of an Impatiens necrotic spot orthotospovirus isolate from the United States and worldwide phylogenetic analyses of INSV isolates.

    Science.gov (United States)

    Zhao, Kaixi; Margaria, Paolo; Rosa, Cristina

    2018-05-10

    Impatiens necrotic spot orthotospovirus (INSV) can impact economically important ornamental plants and vegetables worldwide. Characterization studies on INSV are limited. For most INSV isolates, there are no complete genome sequences available. This lack of genomic information has a negative impact on the understanding of the INSV genetic diversity and evolution. Here we report the first complete nucleotide sequence of a US INSV isolate. INSV-UP01 was isolated from an impatiens in Pennsylvania, US. RT-PCR was used to clone its full-length genome and Vector NTI to assemble overlapping sequences. Phylogenetic trees were constructed by using MEGA7 software to show the phylogenetic relationships with other available INSV sequences worldwide. This US isolate has genome and biological features classical of INSV species and clusters in the Western Hemisphere clade, but its origin appears to be recent. Furthermore, INSV-UP01 might have been involved in a recombination event with an Italian isolate belonging to the Asian clade. Our analyses support that INSV isolates infect a broad plant-host range they group by geographic origin and not by host, and are subjected to frequent recombination events. These results justify the need to generate and analyze complete genome sequences of orthotospoviruses in general and INSV in particular.

  4. Isolation of a sex-linked DNA sequence in cranes.

    Science.gov (United States)

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  5. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands.

    Science.gov (United States)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J L

    2017-08-31

    Frog virus 3 was isolated from a strawberry poison frog ( Oophaga pumilio ) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op /2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. Copyright © 2017 Saucedo et al.

  6. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  7. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  8. Partial Sequence Analysis of Merozoite Surface Proteine-3α Gene in Plasmodium vivax Isolates from Malarious Areas of Iran

    Directory of Open Access Journals (Sweden)

    H Mirhendi

    2008-12-01

    Full Text Available Background: Approximately 85-90% of malaria infections in Iran are attributed to Plasmodium vivax, while little is known about the genetic of the parasite and its strain types in this region. This study was designed and performed for describing genetic characteristics of Plasmodium vivax population of Iran based on the merozoite surface protein-3α gene sequence. Methods: Through a descriptive study we analyzed partial P. vivax merozoite surface protein-3α gene sequences from 17 clinical P. vivax isolates collected from malarious areas of Iran. Genomic DNA was extracted by Q1Aamp® DNA blood mini kit, amplified through nested PCR for a partial nucleotide sequence of PvMSP-3 gene in P. vivax. PCR-amplified products were sequenced with an ABI Prism Perkin-Elmer 310 sequencer machine and the data were analyzed with clustal W software. Results: Analysis of PvMSP-3 gene sequences demonstrated extensive polymorphisms, but the sequence identity between isolates of same types was relatively high. We identified specific insertions and deletions for the types A, B and C variants of P. vivax in our isolates. In phylogenetic comparison of geographically separated isolates, there was not a significant geo­graphical branching of the parasite populations. Conclusion: The highly polymorphic nature of isolates suggests that more investigations of the PvMSP-3 gene are needed to explore its vaccine potential.

  9. Isolation, identification, and complete genome sequence of a bovine adenovirus type 3 from cattle in China

    Directory of Open Access Journals (Sweden)

    Zhu Yuan-Mao

    2011-12-01

    Full Text Available Abstract Background Bovine adenovirus type 3 (BAV-3 belongs to the Mastadenovirus genus of the family Adenoviridae and is involved in respiratory and enteric infections of calves. The isolation of BAV-3 has not been reported prior to this study in China. In 2009, there were many cases in cattle showing similar clinical signs to BAV-3 infection and a virus strain, showing cytopathic effect in Madin-Darby bovine kidney cells, was isolated from a bovine nasal swab collected from feedlot cattle in Heilongjiang Province, China. The isolate was confirmed as a bovine adenovirus type 3 by PCR and immunofluorescence assay, and named as HLJ0955. So far only the complete genome sequence of prototype of BAV-3 WBR-1 strain has been reported. In order to further characterize the Chinese isolate HLJ0955, the complete genome sequence of HLJ0955 was determined. Results The size of the genome of the Chinese isolate HLJ0955 is 34,132 nucleotides in length with a G+C content of 53.6%. The coding sequences for gene regions of HLJ0955 isolate were similar to the prototype of BAV-3 WBR-1 strain, with 80.0-98.6% nucleotide and 87.5-98.8% amino acid identities. The genome of HLJ0955 strain contains 16 regions and four deletions in inverted terminal repeats, E1B region and E4 region, respectively. The complete genome and DNA binding protein gene based phylogenetic analysis with other adenoviruses were performed and the results showed that HLJ0955 isolate belonged to BAV-3 and clustered within the Mastadenovirus genus of the family Adenoviridae. Conclusions This is the first study to report the isolation and molecular characterization of BAV-3 from cattle in China. The phylogenetic analysis performed in this study supported the use of the DNA binding protein gene of adenovirus as an appropriate subgenomic target for the classification of different genuses of the family Adenoviridae on the molecular basis. Meanwhile, a large-scale pathogen and serological epidemiological

  10. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

  11. Sequence characterization of heat shock protein gene of Cyclospora cayetanensis isolates from Nepal, Mexico, and Peru.

    Science.gov (United States)

    Sulaiman, Irshad M; Torres, Patricia; Simpson, Steven; Kerdahi, Khalil; Ortega, Ynes

    2013-04-01

    We have described the development of a 2-step nested PCR protocol based on the characterization of the 70-kDa heat shock protein (HSP70) gene for rapid detection of the human-pathogenic Cyclospora cayetanensis parasite. We tested and validated these newly designed primer sets by PCR amplification followed by nucleotide sequencing of PCR-amplified HSP70 fragments belonging to 16 human C. cayetanensis isolates from 3 different endemic regions that include Nepal, Mexico, and Peru. No genetic polymorphism was observed among the isolates at the characterized regions of the HSP70 locus. This newly developed HSP70 gene-based nested PCR protocol provides another useful genetic marker for the rapid detection of C. cayetanensis in the future.

  12. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  13. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  14. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  15. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus

    OpenAIRE

    Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline

    2016-01-01

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.

  16. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus.

    Science.gov (United States)

    Spence, Robert J; Noune, Christopher; Hauxwell, Caroline

    2016-06-30

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length. Copyright © 2016 Spence et al.

  17. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  18. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    Science.gov (United States)

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II. PMID:27469959

  19. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    OpenAIRE

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II.

  20. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  1. High-throughput genome sequencing of two Listeria monocytogenes clinical isolates during a large foodborne outbreak

    Directory of Open Access Journals (Sweden)

    Trout-Yakel Keri M

    2010-02-01

    Full Text Available Abstract Background A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis (PFGE revealed two similar but distinct AscI PFGE patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during PFGE. Results The chromosomes were collinear, but differences included 28 single nucleotide polymorphisms (SNPs and three indels, including a 33 kbp prophage that accounted for the observed difference in AscI PFGE patterns. The distribution of these traits was assessed within further clinical, environmental and food isolates associated with the outbreak, and this comparison indicated that three distinct, but highly related strains may have been involved in this nationwide outbreak. Notably, these two isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes. Conclusions High-throughput genome sequencing provided a more detailed real-time assessment of genetic traits characteristic of the outbreak strains than could be achieved with routine subtyping methods. This study confirms that the latest generation of DNA sequencing technologies can be applied during high priority public health events, and laboratories need to prepare for this inevitability and assess how to properly analyze and interpret whole genome sequences in the context of molecular epidemiology.

  2. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  3. Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

    Science.gov (United States)

    Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

    2008-01-01

    Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

  4. Chemical rationale for selection of isolates for genome sequencing

    DEFF Research Database (Denmark)

    Rank, Christian; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    The advances in gene sequencing will in the near future enable researchers to affordably acquire the full genomes of handpicked isolates. We here present a method to evaluate the chemical potential of an entire species and select representatives for genome sequencing. The selection criteria for new...... strains to be sequenced can be manifold, but for studying the functional phenotype, using a metabolome based approach offers a cheap and rapid assessment of critical strains to cover the chemical diversity. We have applied this methodology on the complex A. flavus/A. oryzae group. Though these two species...... are in principal identical, they represent two different phenotypes. This is clearly presented through a correspondence analysis of selected extrolites, in which the subtle chemical differences are visually dispersed. The results points to a handful of strains, which, if sequenced, will likely enhance our...

  5. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-01-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  6. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian

    2018-04-10

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  7. Complete sequence analysis and antiviral screening of medicinal plants for human coxsackievirus a16 isolated in Korea.

    Science.gov (United States)

    Song, Jae-Hyoung; Park, Kwisung; Shim, Aeri; Kwon, Bo-Eun; Ahn, Jae-Hee; Choi, Young Jin; Kim, Jae Kyung; Yeo, Sang-Gu; Yoon, Kyungah; Ko, Hyun-Jeong

    2015-02-01

    Coxsackievirus A group 16 strain (CVA16) is one of the predominant causative agents of hand, foot, and mouth disease (HFMD). Using a specimen from a male patient with HFMD, we isolated and performed sequencing of the Korean CVA16 strain and compared it with a G10 reference strain. Also, we were investigated the effects of medicinal plant extract on the cytopathic effects (CPE) by CPE reduction assay against Korean CVA16. Phylogenetic analysis showed that the Korean CVA16 isolate belonged to cluster B-1 and was closely related to the strain PM-15765-00 isolated in Malaysia in 2000. The Korean CVA16 isolate showed 73.2% nucleotide identity to the G10 prototype strain and 98.7% nucleotide identity to PM-15765-00. Next, we assessed whether the Korean CVA16 isolate could be used for in vitro screening of antiviral agents to treat HFMD infection. Vero cells infected with the Korean CVA16 isolate showed a cytopathic effect 2 days after the infection, and the treatment of cells with Cornus officinalis, Acer triflorum, Pulsatilla koreana, and Clematis heracleifolia var. davidiana Hemsl extracts exhibited strong antiviral activity against CVA16. Collectively, our work provides potential candidates for the development of vaccine and novel drugs to treat the CVA16 strain isolated from a Korean patient.

  8. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  9. Sequence diversity, cytotoxicity and antigenic similarities of the leukotoxin of isolates of Mannheimia species from mastitis in domestic sheep.

    Science.gov (United States)

    Omaleki, Lida; Browning, Glenn F; Barber, Stuart R; Allen, Joanne L; Srikumaran, Subramaniam; Markham, Philip F

    2014-11-07

    Species within the genus Mannheimia are among the most important causes of ovine mastitis. Isolates of these species can express leukotoxin A (LktA), a primary virulence factor of these bacteria. To examine the significance of variation in the LktA, the sequences of the lktA genes in a panel of isolates from cases of ovine mastitis were compared. The cross-neutralising capacities of rat antisera raised against LktA of one Mannheimia glucosida, one haemolytic Mannheimia ruminalis, and two Mannheimia haemolytica isolates were also examined to assess the effect that variation in the lktA gene can have on protective immunity against leukotoxins with differing sequences. The lktA nucleotide distance between the M. haemolytica isolates was greater than between the M. glucosida isolates, with the M. haemolytica isolates divisible into two groups based on their lktA sequences. Comparison of the topology of phylogenetic trees of 16S rDNA and lktA sequences revealed differences in the relationships between some isolates, suggesting horizontal gene transfer. Cross neutralisation data obtained with monospecific anti-LktA rat sera were used to derive antigenic similarity coefficients for LktA from the four Mannheimia species isolates. Similarity coefficients indicated that LktA of the two M. haemolytica isolates were least similar, while LktA from M. glucosida was most similar to those for one of the M. haemolytica isolates and the haemolytic M. ruminalis isolate. The results suggested that vaccination with the M. glucosida leukotoxin would generate the greatest cross-protection against ovine mastitis caused by Mannheimia species with these alleles. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  11. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  12. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  13. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  14. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  15. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  16. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  17. Characterization of expressed sequence tag-derived simple sequence repeat markers for Aspergillus flavus: emphasis on variability of isolates from the southern United States.

    Science.gov (United States)

    Wang, Xinwang; Wadl, Phillip A; Wood-Jones, Alicia; Windham, Gary; Trigiano, Robert N; Scruggs, Mary; Pilgrim, Candace; Baird, Richard

    2012-12-01

    Simple sequence repeat (SSR) markers were developed from Aspergillus flavus expressed sequence tag (EST) database to conduct an analysis of genetic relationships of Aspergillus isolates from numerous host species and geographical regions, but primarily from the United States. Twenty-nine primers were designed from 362 tri-nucleotide EST-SSR sequences. Eighteen polymorphic loci were used to genotype 96 Aspergillus species isolates. The number of alleles detected per locus ranged from 2 to 24 with a mean of 8.2 alleles. Haploid diversity ranged from 0.28 to 0.91. Genetic distance matrix was used to perform principal coordinates analysis (PCA) and to generate dendrograms using unweighted pair group method with arithmetic mean (UPGMA). Two principal coordinates explained more than 75 % of the total variation among the isolates. One clade was identified for A. flavus isolates (n = 87) with the other Aspergillus species (n = 7) using PCA, but five distinct clusters were present when the others taxa were excluded from the analysis. Six groups were noted when the EST-SSR data were compared using UPGMA. However, the latter PCA or UPGMA comparison resulted in no direct associations with host species, geographical region or aflatoxin production. Furthermore, there was no direct correlation to visible morphological features such as sclerotial types. The isolates from Mississippi Delta region, which contained the largest percentage of isolates, did not show any unusual clustering except for isolates K32, K55, and 199. Further studies of these three isolates are warranted to evaluate their pathogenicity, aflatoxin production potential, additional gene sequences (e.g., RPB2), and morphological comparisons.

  18. Complete genome sequence of the biofilm-forming Microbacterium sp. strain BH-3-3-3, isolated from conventional field-grown lettuce (Lactuca sativa) in Norway.

    Science.gov (United States)

    Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

    2017-03-01

    The genus Microbacterium contains bacteria that are ubiquitously distributed in various environments and includes plant-associated bacteria that are able to colonize tissue of agricultural crop plants. Here, we report the 3,508,491 bp complete genome sequence of Microbacterium sp. strain BH-3-3-3, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017674.

  19. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  20. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  1. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  2. First complete genome sequence of parainfluenza virus 5 isolated from lesser panda.

    Science.gov (United States)

    Zhai, Jun-Qiong; Zhai, Shao-Lun; Lin, Tao; Liu, Jian-Kui; Wang, He-Xing; Li, Bing; Zhang, He; Zou, Shu-Zhan; Zhou, Xia; Wu, Meng-Fan; Chen, Wu; Luo, Man-Lin

    2017-05-01

    Parainfluenza virus 5 (PIV5) is widespread in mammals and humans. Up to now, there is little information about PIV5 infection in lesser pandas. In this study, a PIV5 variant (named ZJQ-221) was isolated from a lesser panda with respiratory disease in Guangzhou zoo in Guangdong province, southern China. The full-length genome of ZJQ-221 was found to be 15,246 nucleotides and consisted of seven non-overlapping genes encoding eight proteins (i.e., NP, V, P, M, F, SH, HN and L). Sequence alignment and genetic analysis revealed that ZJQ-221 shared a close relationship with a PIV5 strain of canine-origin (1168-1) from South Korea. The findings of this study confirm the presence of PIV5 in lesser panda and indicate this mammal as a possible natural reservoir. Furthermore they highlight the urgent need to strengthen viral surveillance and control of PIV5 in zoo animals.

  3. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  4. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

    Science.gov (United States)

    Han, S S; Karasev, A V; Ieki, H; Iwanami, T

    2002-11-01

    Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

  5. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  6. Studies on the control of development: isolation of Bacillus subtilis mutants blocked early in sporulation and defective in synthesis of highly phosphorylated nucleotides.

    Science.gov (United States)

    Rhaese, H J; Hoch, J A; Groscurth, R

    1977-03-01

    To test our model on the mechanism of initiation of differentiation in Bacillus subtilis, we tested early blocked (stage 0) sporulation mutants for their ability to synthesize highly phosphorylated nucleotides. We also isolated early blocked asporogenous mutants with the aid of the intercalating drug tilorone. Among all mutants tested we found that the spo0F-bearing strain was unable to synthesize adenosine 3'(2')-triphosphate 5'-triphosphate, pppAppp. A revertant of this mutant regained the ability to both sporulate and synthesize pppAppp. Ribosomes of the asporogenous mutant isolated at T2 (2 hr after the end of logarithmic growth) of sporulation, in contrast to the wild type, do not synthesize adenosine 3'(2')-diphosphate 5'-diphosphate, ppApp, or adenosine 3'(2')-diphosphate 5'-triphosphate, pppApp, but synthesize guanosine 3'(2')-diphosphate 5'-diphosphate, ppGpp, and guanosine 3'(2')-diphosphate 5'-triphosphate, pppGpp. This behavior is characteristic of ribosomes from vegetative, not sporulating, cells. Ribosomes from the sporogenous revertant behave like those of the wild type. The results suggest that the spo0F mutation may be a mutation in the structural gene for pppAppp synthetase. The inability to synthesize pppAppp in this strain also prevents the formation of "sporulation-specific ribosomes," i.e., ribosomes that synthetize ppApp and pppApp. The present experiments suggest that the nucleotide pppAppp participates in the initiation of sporulation by triggering a sequencies of events required for the production of heat-resistant spores.

  7. Geographic isolates of Lymantria dispar multiple nucleopolyhedrovirus: Genome sequence analysis and pathogenicity against European and Asian gypsy moth strains.

    Science.gov (United States)

    Harrison, Robert L; Rowley, Daniel L; Keena, Melody A

    2016-06-01

    Isolates of the baculovirus species Lymantria dispar multiple nucleopolyhedrovirus have been formulated and applied to suppress outbreaks of the gypsy moth, L. dispar. To evaluate the genetic diversity in this species at the genomic level, the genomes of three isolates from Massachusetts, USA (LdMNPV-Ab-a624), Spain (LdMNPV-3054), and Japan (LdMNPV-3041) were sequenced and compared with four previously determined LdMNPV genome sequences. The LdMNPV genome sequences were collinear and contained the same homologous repeats (hrs) and clusters of baculovirus repeat orf (bro) gene family members in the same relative positions in their genomes, although sequence identities in these regions were low. Of 146 non-bro ORFs annotated in the genome of the representative isolate LdMNPV 5-6, 135 ORFs were found in every other LdMNPV genome, including the 37 core genes of Baculoviridae and other genes conserved in genus Alphabaculovirus. Phylogenetic inference with an alignment of the core gene nucleotide sequences grouped isolates 3041 (Japan) and 2161 (Korea) separately from a cluster containing isolates from Europe, North America, and Russia. To examine phenotypic diversity, bioassays were carried out with a selection of isolates against neonate larvae from three European gypsy moth (Lymantria dispar dispar) and three Asian gypsy moth (Lymantria dispar asiatica and Lymantria dispar japonica) colonies. LdMNPV isolates 2161 (Korea), 3029 (Russia), and 3041 (Japan) exhibited a greater degree of pathogenicity against all L. dispar strains than LdMNPV from a sample of Gypchek. This study provides additional information on the genetic diversity of LdMNPV isolates and their activity against the Asian gypsy moth, a potential invasive pest of North American trees and forests. Published by Elsevier Inc.

  8. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  9. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  10. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  11. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  12. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.

    1986-01-01

    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  13. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  14. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  15. Whole genome sequencing of the monomorphic pathogen Mycobacterium bovis reveals local differentiation of cattle clinical isolates.

    Science.gov (United States)

    Lasserre, Moira; Fresia, Pablo; Greif, Gonzalo; Iraola, Gregorio; Castro-Ramos, Miguel; Juambeltz, Arturo; Nuñez, Álvaro; Naya, Hugo; Robello, Carlos; Berná, Luisa

    2018-01-02

    Bovine tuberculosis (bTB) poses serious risks to animal welfare and economy, as well as to public health as a zoonosis. Its etiological agent, Mycobacterium bovis, belongs to the Mycobacterium tuberculosis complex (MTBC), a group of genetically monomorphic organisms featured by a remarkably high overall nucleotide identity (99.9%). Indeed, this characteristic is of major concern for correct typing and determination of strain-specific traits based on sequence diversity. Due to its historical economic dependence on cattle production, Uruguay is deeply affected by the prevailing incidence of Mycobacterium bovis. With the world's highest number of cattle per human, and its intensive cattle production, Uruguay represents a particularly suited setting to evaluate genomic variability among isolates, and the diversity traits associated to this pathogen. We compared 186 genomes from MTBC strains isolated worldwide, and found a highly structured population in M. bovis. The analysis of 23 new M. bovis genomes, belonging to strains isolated in Uruguay evidenced three groups present in the country. Despite presenting an expected highly conserved genomic structure and sequence, these strains segregate into a clustered manner within the worldwide phylogeny. Analysis of the non-pe/ppe differential areas against a reference genome defined four main sources of variability, namely: regions of difference (RD), variable genes, duplications and novel genes. RDs and variant analysis segregated the strains into clusters that are concordant with their spoligotype identities. Due to its high homoplasy rate, spoligotyping failed to reflect the true genomic diversity among worldwide representative strains, however, it remains a good indicator for closely related populations. This study introduces a comprehensive population structure analysis of worldwide M. bovis isolates. The incorporation and analysis of 23 novel Uruguayan M. bovis genomes, sheds light onto the genomic diversity of this

  16. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  17. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  18. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  19. Draft genome sequence of an endophytic bacterium, Paenibacillus tyrfis strain SUK123, isolated from Santiria apiculata stem

    Directory of Open Access Journals (Sweden)

    Emmanuel Haruna

    2017-12-01

    Full Text Available Here we report the draft genome sequence of an endophytic Paenibacillus tyrfis strain isolated from the Universiti Kebangsaan Malaysia reserve forest, Malaysia. The genome size was approximately 8.04 Mb, and the assembly consisted of 107 scaffolds with 168 contigs, and had a G + C content of 53%. Phylogenetic analysis of strain SUK123 using the 16S rRNA gene revealed that it belonged to the family Paenibacillaceae with the highest similarity to Paenibacillus elgii SDT (99%. Whole genome comparison of SUK123 with related species using average nucleotide identity (ANI analysis revealed a similarity of 98% to Paenibacillus tyrfis Mst1T, 94% to Paenibacillus elgii B69T, 91% to Paenibacillus ehimensis A2T, 68% to Paenibacillus polymyxa SC2T and 69% to Paenibacillus alvei DMS29T. The draft genome was deposited at the European Nucleotide Archive (PRJEB21373.

  20. Whole-Genome Sequencing and Comparative Genome Analysis of Bacillus subtilis Strains Isolated from Non-Salted Fermented Soybean Foods.

    Directory of Open Access Journals (Sweden)

    Mayumi Kamada

    Full Text Available Bacillus subtilis is the main component in the fermentation of soybeans. To investigate the genetics of the soybean-fermenting B. subtilis strains and its relationship with the productivity of extracellular poly-γ-glutamic acid (γPGA, we sequenced the whole genome of eight B. subtilis stains isolated from non-salted fermented soybean foods in Southeast Asia. Assembled nucleotide sequences were compared with those of a natto (fermented soybean food starter strain B. subtilis BEST195 and the laboratory standard strain B. subtilis 168 that is incapable of γPGA production. Detected variants were investigated in terms of insertion sequences, biotin synthesis, production of subtilisin NAT, and regulatory genes for γPGA synthesis, which were related to fermentation process. Comparing genome sequences, we found that the strains that produce γPGA have a deletion in a protein that constitutes the flagellar basal body, and this deletion was not found in the non-producing strains. We further identified diversity in variants of the bio operon, which is responsible for the biotin auxotrophism of the natto starter strains. Phylogenetic analysis using multilocus sequencing typing revealed that the B. subtilis strains isolated from the non-salted fermented soybeans were not clustered together, while the natto-fermenting strains were tightly clustered; this analysis also suggested that the strain isolated from "Tua Nao" of Thailand traces a different evolutionary process from other strains.

  1. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  3. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  4. Full genome sequences and molecular characterization of tick-borne encephalitis virus strains isolated from human patients.

    Science.gov (United States)

    Formanová, Petra; Černý, Jiří; Bolfíková, Barbora Černá; Valdés, James J; Kozlova, Irina; Dzhioev, Yuri; Růžek, Daniel

    2015-02-01

    Tick-borne encephalitis virus (TBEV) causes tick-borne encephalitis (TBE), one of the most important human neuroinfections across Eurasia. Up to date, only three full genome sequences of human European TBEV isolates are available, mostly due to difficulties with isolation of the virus from human patients. Here we present full genome characterization of an additional five low-passage TBEV strains isolated from human patients with severe forms of TBE. These strains were isolated in 1953 within Central Bohemia in the former Czechoslovakia, and belong to the historically oldest human TBEV isolates in Europe. We demonstrate here that all analyzed isolates are distantly phylogenetically related, indicating that the emergence of TBE in Central Europe was not caused by one predominant strain, but rather a pool of distantly related TBEV strains. Nucleotide identity between individual sequenced TBEV strains ranged from 97.5% to 99.6% and all strains shared large deletions in the 3' non-coding region, which has been recently suggested to be an important determinant of virulence. The number of unique amino acid substitutions varied from 3 to 9 in individual isolates, but no characteristic amino acid substitution typical exclusively for all human TBEV isolates was identified when compared to the isolates from ticks. We did, however, correlate that the exploration of the TBEV envelope glycoprotein by specific antibodies were in close proximity to these unique amino acid substitutions. Taken together, we report here the largest number of patient-derived European TBEV full genome sequences to date and provide a platform for further studies on evolution of TBEV since the first emergence of human TBE in Europe. Copyright © 2014 Elsevier GmbH. All rights reserved.

  5. The preparation of nucleotides uniformly labelled with carbon-14 by biosinthetic methods. Isolation of adenilic, uridilic, cytidilic and guanlic acids, from the alkaline hydrolisate of escherichia coli RNA

    International Nuclear Information System (INIS)

    Garcia Pineda, D.; Pacheco Lopez, J.

    1978-01-01

    A method is described for the preparation and analysis of adenilic, uridilic, cytidylic and guanilic acids, labelled with carbon 14. Escherichia coli cells have been labelled by growing them in media containing glucose-carbon 14 as their only source of carbon. RNA is isolated from the cells, and after hydrolisis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the isolated nucleotides is determined and also its specific radioactivity. The distribution of radioactivity incorporated in the cell among different groups of molecular species is analyse. (author)

  6. [Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

    2010-01-01

    Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses

  7. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  8. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  9. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  10. Sequence-based comparative study of classical swine fever virus genogroup 2.2 isolate with pestivirus reference strains.

    Science.gov (United States)

    Kumar, Ravi; Rajak, Kaushal Kishor; Chandra, Tribhuwan; Muthuchelvan, Dhanavelu; Saxena, Arpit; Chaudhary, Dheeraj; Kumar, Ajay; Pandey, Awadh Bihari

    2015-09-01

    This study was undertaken with the aim to compare and establish the genetic relatedness between classical swine fever virus (CSFV) genogroup 2.2 isolate and pestivirus reference strains. The available complete genome sequences of CSFV/IND/UK/LAL-290 strain and other pestivirus reference strains were retrieved from GenBank. The complete genome sequence, complete open reading frame, 5' and 3' non-coding region (NCR) sequences were analyzed and compared with reference pestiviruses strains. Clustal W model in MegAlign program of Lasergene 6.0 software was used for analysis of genetic heterogeneity. Phylogenetic analysis was carried out using MEGA 6.06 software package. The complete genome sequence alignment of CSFV/IND/UK/LAL-290 isolate and reference pestivirus strains showed 58.9-72% identities at the nucleotide level and 50.3-76.9% at amino acid level. Sequence homology of 5' and 3' NCRs was found to be 64.1-82.3% and 22.9-71.4%, respectively. In phylogenetic analysis, overall tree topology was found similar irrespective of sequences used in this study; however, whole genome phylogeny of pestivirus formed two main clusters, which further distinguished into the monophyletic clade of each pestivirus species. CSFV/IND/UK/LAL-290 isolate placed with the CSFV Eystrup strain in the same clade with close proximity to border disease virus and Aydin strains. CSFV/IND/UK/LAL-290 exhibited the analogous genomic organization to those of all reference pestivirus strains. Based on sequence identity and phylogenetic analysis, the isolate showed close homology to Aydin/04-TR virus and distantly related to Bungowannah virus.

  11. Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

    Directory of Open Access Journals (Sweden)

    Michal Strouhal

    2017-09-01

    Full Text Available Treponema pallidum subsp. pertenue (TPE is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier and one TPE strain (Fribourg-Blanc isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet.Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively. Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation.The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

  12. Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

    Directory of Open Access Journals (Sweden)

    Sun Yu

    2011-11-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.

  13. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  14. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Directory of Open Access Journals (Sweden)

    Kei-ichi Morita

    Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  15. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Science.gov (United States)

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  16. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  17. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  18. Draft genome sequencing of giardia intestinalis assemblage B isolate GS: is human giardiasis caused by two different species?

    Directory of Open Access Journals (Sweden)

    Oscar Franzén

    2009-08-01

    Full Text Available Giardia intestinalis is a major cause of diarrheal disease worldwide and two major Giardia genotypes, assemblages A and B, infect humans. The genome of assemblage A parasite WB was recently sequenced, and the structurally compact 11.7 Mbp genome contains simplified basic cellular machineries and metabolism. We here performed 454 sequencing to 16x coverage of the assemblage B isolate GS, the only Giardia isolate successfully used to experimentally infect animals and humans. The two genomes show 77% nucleotide and 78% amino-acid identity in protein coding regions. Comparative analysis identified 28 unique GS and 3 unique WB protein coding genes, and the variable surface protein (VSP repertoires of the two isolates are completely different. The promoters of several enzymes involved in the synthesis of the cyst-wall lack binding sites for encystation-specific transcription factors in GS. Several synteny-breaks were detected and verified. The tetraploid GS genome shows higher levels of overall allelic sequence polymorphism (0.5 versus <0.01% in WB. The genomic differences between WB and GS may explain some of the observed biological and clinical differences between the two isolates, and it suggests that assemblage A and B Giardia can be two different species.

  19. PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

    Science.gov (United States)

    Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

    2004-01-01

    A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

  20. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  1. Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

    Science.gov (United States)

    Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

    2016-03-01

    The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

  2. Persistent changes in the initial rate of pyruvate transport by isolated rat liver mitochondria after preincubation with adenine nucleotides and calcium ions

    NARCIS (Netherlands)

    Vaartjes, W.J.; Breejen, J.N. den; Geelen, M.J.H.; Bergh, S.G. van den

    1980-01-01

    1. Preincubation of isolated rat-liver mitochondria in the presence of adenine nucleotides or Ca2+ results in definite and persistent changes in the initial rate of pyruvate transport. 2. These changes in the rate of pyruvate transport are accompanied by equally persistent changes in the opposite

  3. Draft Genome Sequence of a Clostridium botulinum Isolate from Water Used for Cooling at a Plant Producing Low-Acid Canned Foods.

    Science.gov (United States)

    Basavanna, Uma; Gonzalez-Escalona, Narjol; Timme, Ruth; Datta, Shomik; Schoen, Brianna; Brown, Eric W; Zink, Donald; Sharma, Shashi K

    2013-01-01

    Clostridium botulinum is a pathogen of concern for low-acid canned foods. Here we report draft genomes of a neurotoxin-producing C. botulinum strain isolated from water samples used for cooling low-acid canned foods at a canning facility. The genome sequence confirmed that this strain belonged to C. botulinum serotype B1, albeit with major differences, including thousands of unique single nucleotide polymorphisms (SNPs) compared to other genomes of the same serotype.

  4. Draft Genome Sequence of a Clostridium botulinum Isolate from Water Used for Cooling at a Plant Producing Low-Acid Canned Foods

    OpenAIRE

    Basavanna, Uma; Gonzalez-Escalona, Narjol; Timme, Ruth; Datta, Shomik; Schoen, Brianna; Brown, Eric W.; Zink, Donald; Sharma, Shashi K.

    2013-01-01

    Clostridium botulinum is a pathogen of concern for low-acid canned foods. Here we report draft genomes of a neurotoxin-producing C.?botulinum strain isolated from water samples used for cooling low-acid canned foods at a canning facility. The genome sequence confirmed that this strain belonged to C.?botulinum serotype B1, albeit with major differences, including thousands of unique single nucleotide polymorphisms (SNPs) compared to other genomes of the same serotype.

  5. Isolation of the Drosophila melanogaster dunce chromosomal region and recombinational mapping of dunce sequences with restriction site polymorphisms as genetic markers

    OpenAIRE

    Davis, Ronald L.; Davidson, Norman

    1984-01-01

    Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed w...

  6. [Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

    2009-08-01

    Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers

  7. Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

    Science.gov (United States)

    Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

    2017-09-01

    To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

  8. Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients

    Directory of Open Access Journals (Sweden)

    Yunus E. Beyhan

    2017-09-01

    Full Text Available Objectives: To characterize the cutaneous leishmaniasis (CL isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR. Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

  9. Purification, enzymatic characterization, and nucleotide sequence of a high-isoelectric-point alpha-glucosidase from barley malt

    DEFF Research Database (Denmark)

    Frandsen, T P; Lok, F; Mirgorodskaya, E

    2000-01-01

    in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...

  10. Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

    Science.gov (United States)

    Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

    2013-08-01

    Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

  11. Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

    Directory of Open Access Journals (Sweden)

    Qicheng Zhang

    Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

  12. Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

    Science.gov (United States)

    Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

    2013-01-01

    Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

  13. Whole genome sequencing of ESBL-producing Escherichia coli isolated from patients, farm waste and canals in Thailand.

    Science.gov (United States)

    Runcharoen, Chakkaphan; Raven, Kathy E; Reuter, Sandra; Kallonen, Teemu; Paksanont, Suporn; Thammachote, Jeeranan; Anun, Suthatip; Blane, Beth; Parkhill, Julian; Peacock, Sharon J; Chantratita, Narisara

    2017-09-06

    Tackling multidrug-resistant Escherichia coli requires evidence from One Health studies that capture numerous potential reservoirs in circumscribed geographic areas. We conducted a survey of extended β-lactamase (ESBL)-producing E. coli isolated from patients, canals and livestock wastewater in eastern Thailand between 2014 and 2015, and analyzed isolates using whole genome sequencing. The bacterial collection of 149 isolates consisted of 84 isolates from a single hospital and 65 from the hospital sewer, canals and farm wastewater within a 20 km radius. E. coli ST131 predominated the clinical collection (28.6%), but was uncommon in the environment. Genome-based comparison of E. coli from infected patients and their immediate environment indicated low genetic similarity overall between the two, although three clinical-environmental isolate pairs differed by ≤ 5 single nucleotide polymorphisms. Thai E. coli isolates were dispersed throughout a phylogenetic tree containing a global E. coli collection. All Thai ESBL-positive E. coli isolates were multidrug resistant, including high rates of resistance to tobramycin (77.2%), gentamicin (77.2%), ciprofloxacin (67.8%) and trimethoprim (68.5%). ESBL was encoded by six different CTX-M elements and SHV-12. Three isolates from clinical samples (n = 2) or a hospital sewer (n = 1) were resistant to the carbapenem drugs (encoded by NDM-1, NDM-5 or GES-5), and three isolates (clinical (n = 1) and canal water (n = 2)) were resistant to colistin (encoded by mcr-1); no isolates were resistant to both carbapenems and colistin. Tackling ESBL-producing E. coli in this setting will be challenging based on widespread distribution, but the low prevalence of resistance to carbapenems and colistin suggests that efforts are now required to prevent these from becoming ubiquitous.

  14. Draft Whole-Genome Sequences of Three Lactobacillus plantarum Food Isolates

    NARCIS (Netherlands)

    Fernández Ramírez, Mónica D; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Abee, Tjakko; Nierop Groot, Masja N

    2016-01-01

    Lactobacillus plantarum is a widespread member of the Lactobacillus genus and frequently isolated from spoiled acidified food products. Here, we report the draft genome sequences of three L. plantarum food isolates.

  15. Draft whole-genome sequences of three Lactobacillus plantarum food isolates

    NARCIS (Netherlands)

    Fernandez Ramirez, Monica; Boekhorst, Jos; Jong, de Anne; Kuipers, Oscar P.; Abee, Tjakko; Nierop Groot, Masja

    2016-01-01

    Lactobacillus plantarum is a widespread member of the Lactobacillus genus and frequently isolated from spoiled acidified food products. Here, we report the draft genome sequences of three L. plantarum food isolates.

  16. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  17. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  18. Comparison of sequences of hypervariable region (HVR subunit S-1 gene of field isolate I-37 infectious bronchitis virus with Connecticut serotype

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2003-06-01

    Full Text Available Infectious Bronchitis is a contagious and acute respiratory disease in chickens caused by infectious bronchitis virus (IBV.Antigenic differences in IBV are associated with changes in the sequence of the spike glycoprotein (S. The subunit S1 which demonstrates more sequence variability than S-2 have been identified as hypervariable region (HVR-1 and 2. There were several IB virus field isolates included I-37 have been identified in Indonesia by serum neutralization method. However, gene sequence variation in HVR subunit S-1 had not yet been identified. Isolate I-37 was close to the serotype Connecticut 46 (Conn 46. The aim of this study is to identify sequence variation of HVR subunit S-1 gene of isolate I-37 produced by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR and sequencing. Several procedures were carried out in the study including virus titration, propagation and was concentrated from the allantoic fluid infected with IBV. Then, RNA was extracted for RTPCR. urther the product was sequnced and its homology with IBV references from GenBank was compared by GenMac version 8.0. Result showed that isolate I-37 produced 515 bp of amplification product. Isolate I-37 and Conn 46 are same serotype, yet their HVR subunit S-1 nucleotides and amino acids (protein differ by 6.9% and 15.6% respectively. It might be concluded that isolate I-37 was variant of Conn 46.

  19. Isolation and characterization of gene sequences expressed in cotton fiber

    Directory of Open Access Journals (Sweden)

    Taciana de Carvalho Coutinho

    2016-06-01

    Full Text Available ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L. to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for the subsequent generation of a cDNA library. Seventeen sequences were obtained, of which 14 were already described in the NCBI database (National Centre for Biotechnology Information, such as those encoding the lipid transfer proteins (LTPs and arabinogalactans (AGP. However, other cDNAs such as the B05 clone, which displays homology with the glycosyltransferases, have still not been described for this crop. Nevertheless, results showed that several clones obtained in this study are associated with cell wall proteins, wall-modifying enzymes and lipid transfer proteins directly involved in fiber development.

  20. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  1. High quality draft genome sequence of Janthinobacterium psychrotolerans sp. nov., isolated from a frozen freshwater pond.

    Science.gov (United States)

    Gong, Xianzhe; Skrivergaard, Stig; Korsgaard, Benjamin Smed; Schreiber, Lars; Marshall, Ian P G; Finster, Kai; Schramm, Andreas

    2017-01-01

    Strain S3-2 T , isolated from sediment of a frozen freshwater pond, shares 99% 16S rRNA gene sequence identity with strains of the genus Janthinobacterium . Strain S3-2 T is a facultative anaerobe that lacks the ability to produce violacein but shows antibiotic resistance, psychrotolerance, incomplete denitrification, and fermentation. The draft genome of strain S3-2 T has a size of ~5.8 Mbp and contains 5,297 genes, including 115 RNA genes. Based on the phenotypic properties of the strain, the low in silico DNA-DNA hybridization (DDH) values with related genomes (<35%), and the low whole genome-based average nucleotide identity (ANI) (<86%) with other strains within the genus Janthinobacterium, we propose that strain S3-2 T is the type strain (= DSM 102223 = LMG 29653) of a new species within this genus. We propose the name Janthinobacterium psychrotolerans sp. nov. to emphasize the capability of the strain to grow at low temperatures.

  2. Complete Genome Sequences of Isolates of Enterococcus faecium Sequence Type 117, a Globally Disseminated Multidrug-Resistant Clone

    Science.gov (United States)

    Tedim, Ana P.; Lanza, Val F.; Manrique, Marina; Pareja, Eduardo; Ruiz-Garbajosa, Patricia; Cantón, Rafael; Baquero, Fernando; Tobes, Raquel

    2017-01-01

    ABSTRACT The emergence of nosocomial infections by multidrug-resistant sequence type 117 (ST117) Enterococcus faecium has been reported in several European countries. ST117 has been detected in Spanish hospitals as one of the main causes of bloodstream infections. We analyzed genome variations of ST117 strains isolated in Madrid and describe the first ST117 closed genome sequences. PMID:28360174

  3. Whole-genome sequence of the first sequence type 27 Brucella ceti strain isolated from European waters

    DEFF Research Database (Denmark)

    Duvnjak, Sanja; Spicic, Silvio; Kusar, Darja

    2017-01-01

    Brucella spp. that cause marine brucellosis are becoming more important, as the disease appears to be more widespread than originally thought. Here, we report a whole and annotated genome sequence of Brucella ceti CRO350, a sequence type 27 strain isolated from a bottlenose dolphin carcass found...

  4. Species delimitation of common reef corals in the genus Pocillopora using nucleotide sequence phylogenies, population genetics and symbiosis ecology.

    Science.gov (United States)

    Pinzón, Jorge H; LaJeunesse, Todd C

    2011-01-01

    Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.

  5. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  6. Whole Genome Sequencing Based Characterization of Extensively Drug-Resistant Mycobacterium tuberculosis Isolates from Pakistan

    KAUST Repository

    Ali, Asho; Hasan, Zahra; McNerney, Ruth; Mallard, Kim; Hill-Cawthorne, Grant A.; Coll, Francesc; Nair, Mridul; Pain, Arnab; Clark, Taane G.; Hasan, Rumina

    2015-01-01

    Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91-94 codons in 81% of strains; four strains had only gyr B mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded

  7. Whole Genome Sequencing Based Characterization of Extensively Drug-Resistant Mycobacterium tuberculosis Isolates from Pakistan

    KAUST Repository

    Ali, Asho

    2015-02-26

    Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91-94 codons in 81% of strains; four strains had only gyr B mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded

  8. Complete Genome Sequence of a Rhodococcus Species Isolated from the Winter Skate Leucoraja ocellata.

    Science.gov (United States)

    Wiens, Julia; Ho, Ryan; Fernando, Dinesh; Kumar, Ayush; Loewen, Peter C; Brassinga, Ann Karen C; Anderson, W Gary

    2016-09-01

    We report here a genome sequence for Rhodococcus sp. isolate UM008 isolated from the renal/interrenal tissue of the winter skate Leucoraja ocellata Genome sequence analysis suggests that Rhodococcus bacteria may act in a novel mutualistic relationship with their elasmobranch host, serving as biocatalysts in the steroidogenic pathway of 1α-hydroxycorticosterone. Copyright © 2016 Wiens et al.

  9. Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk.

    Science.gov (United States)

    Jiménez, Esther; Villar-Tajadura, M Antonia; Marín, María; Fontecha, Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M

    2012-07-01

    Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties.

  10. Draft genome sequence of the intestinal parasite Blastocystis subtype 4-isolate WR1

    Directory of Open Access Journals (Sweden)

    Ivan Wawrzyniak

    2015-06-01

    Full Text Available The intestinal protistan parasite Blastocystis is characterized by an extensive genetic variability with 17 subtypes (ST1–ST17 described to date. Only the whole genome of a human ST7 isolate was previously sequenced. Here we report the draft genome sequence of Blastocystis ST4-WR1 isolated from a laboratory rodent at Singapore.

  11. Draft genome sequence of the intestinal parasite Blastocystis subtype 4-isolate WR1

    NARCIS (Netherlands)

    Wawrzyniak, Ivan; Courtine, Damien; Osman, Marwan; Hubans-Pierlot, Christine; Cian, Amandine; Nourrisson, Céline; Chabe, Magali; Poirier, Philippe; Bart, Aldert; Polonais, Valérie; Delgado-Viscogliosi, Pilar; El Alaoui, Hicham; Belkorchia, Abdel; van Gool, Tom; Tan, Kevin S. W.; Ferreira, Stéphanie; Viscogliosi, Eric; Delbac, Frédéric

    2015-01-01

    (ST1-ST17) described to date. Only the whole genome of a human ST7 isolate was previously sequenced. Here we report the draft genome sequence of Blastocystis ST4-WR1 isolated from a laboratory rodent at Singapore. (C) 2015 The Authors. Published by Elsevier Inc

  12. Isolation and sequence characterization of DNA-A genome of a new begomovirus strain associated with severe leaf curling symptoms of Jatropha curcas L.

    KAUST Repository

    Chauhan, Sushma

    2018-04-22

    Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp–2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas.

  13. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  14. Isolation, sequence identification and tissue expression profile of a ...

    African Journals Online (AJOL)

    The complete expressed sequence tag (CDS) sequence of Banna mini-pig inbred line (BMI) ribokinase gene (RBKS) was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) based on the conserved sequence information of the cattle or other mammals and known highly homologous swine ESTs.

  15. Dependence of mitochondrial and cytosolic adenine nucleotides on oxygen partial pressure in isolated hepatocytes. Application of a new rapid high pressure filtration technique for fractionation.

    OpenAIRE

    Hummerich, H; de Groot, H; Noll, T; Soboll, S

    1988-01-01

    By using a new rapid high pressure filtration technique, mitochondrial and cytosolic ATP and ADP contents were determined in isolated hepatocytes at different oxygen partial pressures. At 670 mmHg, subcellular adenine nucleotide contents and ATP/ADP ratios were comparable with values obtained with the digitonin fractionation technique. However at lower oxygen partial pressure ADP appears to be rephosphorylated during digitonin fractionation whereas with high pressure filtration fractionation ...

  16. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  17. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  18. Draft genomic sequencing of six potential extraintestinal pathogenic Escherichia coli isolates from retail chicken meat.

    Science.gov (United States)

    Potential Extraintestinal pathogenic Escherichia coli isolates DP254, WH333, WH398, F356, FEX675 and FEX725 were isolated from retail chicken meat products. Here, we report the draft genome sequences for these six E. coli isolates, which are currently being used in food safety research....

  19. Draft genome sequences of seven isolates of Phytophthora ramorum EU2 from Northern Ireland

    Directory of Open Access Journals (Sweden)

    Lourdes de la Mata Saez

    2015-12-01

    Full Text Available Here we present draft-quality genome sequence assemblies for the oomycete Phytophthora ramorum genetic lineage EU2. We sequenced genomes of seven isolates collected in Northern Ireland between 2010 and 2012. Multiple genome sequences from P. ramorum EU2 will be valuable for identifying genetic variation within the clonal lineage that can be useful for tracking its spread.

  20. Draft Genome Sequence of "Terrisporobacter othiniensis" Isolated from a Blood Culture from a Human Patient

    DEFF Research Database (Denmark)

    Lund, Lars Christian; Sydenham, Thomas Vognbjerg; Høgh, Silje Vermedal

    2015-01-01

    "Terrisporobacter othiniensis" (proposed species) was isolated from a blood culture. Genomic DNA was sequenced using a MiSeq benchtop sequencer (Illumina) and assembled using the SPAdes genome assembler. This resulted in a draft genome sequence comprising 3,980,019 bp in 167 contigs containing 3...

  1. High depth, whole-genome sequencing of cholera isolates from Haiti and the Dominican Republic.

    Science.gov (United States)

    Sealfon, Rachel; Gire, Stephen; Ellis, Crystal; Calderwood, Stephen; Qadri, Firdausi; Hensley, Lisa; Kellis, Manolis; Ryan, Edward T; LaRocque, Regina C; Harris, Jason B; Sabeti, Pardis C

    2012-09-11

    Whole-genome sequencing is an important tool for understanding microbial evolution and identifying the emergence of functionally important variants over the course of epidemics. In October 2010, a severe cholera epidemic began in Haiti, with additional cases identified in the neighboring Dominican Republic. We used whole-genome approaches to sequence four Vibrio cholerae isolates from Haiti and the Dominican Republic and three additional V. cholerae isolates to a high depth of coverage (>2000x); four of the seven isolates were previously sequenced. Using these sequence data, we examined the effect of depth of coverage and sequencing platform on genome assembly and identification of sequence variants. We found that 50x coverage is sufficient to construct a whole-genome assembly and to accurately call most variants from 100 base pair paired-end sequencing reads. Phylogenetic analysis between the newly sequenced and thirty-three previously sequenced V. cholerae isolates indicates that the Haitian and Dominican Republic isolates are closest to strains from South Asia. The Haitian and Dominican Republic isolates form a tight cluster, with only four variants unique to individual isolates. These variants are located in the CTX region, the SXT region, and the core genome. Of the 126 mutations identified that separate the Haiti-Dominican Republic cluster from the V. cholerae reference strain (N16961), 73 are non-synonymous changes, and a number of these changes cluster in specific genes and pathways. Sequence variant analyses of V. cholerae isolates, including multiple isolates from the Haitian outbreak, identify coverage-specific and technology-specific effects on variant detection, and provide insight into genomic change and functional evolution during an epidemic.

  2. High depth, whole-genome sequencing of cholera isolates from Haiti and the Dominican Republic

    Directory of Open Access Journals (Sweden)

    Sealfon Rachel

    2012-09-01

    Full Text Available Abstract Background Whole-genome sequencing is an important tool for understanding microbial evolution and identifying the emergence of functionally important variants over the course of epidemics. In October 2010, a severe cholera epidemic began in Haiti, with additional cases identified in the neighboring Dominican Republic. We used whole-genome approaches to sequence four Vibrio cholerae isolates from Haiti and the Dominican Republic and three additional V. cholerae isolates to a high depth of coverage (>2000x; four of the seven isolates were previously sequenced. Results Using these sequence data, we examined the effect of depth of coverage and sequencing platform on genome assembly and identification of sequence variants. We found that 50x coverage is sufficient to construct a whole-genome assembly and to accurately call most variants from 100 base pair paired-end sequencing reads. Phylogenetic analysis between the newly sequenced and thirty-three previously sequenced V. cholerae isolates indicates that the Haitian and Dominican Republic isolates are closest to strains from South Asia. The Haitian and Dominican Republic isolates form a tight cluster, with only four variants unique to individual isolates. These variants are located in the CTX region, the SXT region, and the core genome. Of the 126 mutations identified that separate the Haiti-Dominican Republic cluster from the V. cholerae reference strain (N16961, 73 are non-synonymous changes, and a number of these changes cluster in specific genes and pathways. Conclusions Sequence variant analyses of V. cholerae isolates, including multiple isolates from the Haitian outbreak, identify coverage-specific and technology-specific effects on variant detection, and provide insight into genomic change and functional evolution during an epidemic.

  3. Genomic Sequencing of Ranaviruses Isolated from Edible Frogs (Pelophylax esculentus)

    DEFF Research Database (Denmark)

    Ariel, Ellen; Subramaniam, Kuttichantran; Imnoi, Kamonchai

    2017-01-01

    Ranaviruses were isolated from wild edible frogs (Pelophylax esculentus) during epizootics in Denmark and Italy. Phylogenomic analyses revealed that these isolates are closely related and belong to a clade of ranaviruses that includes the Andrias davidianus ranavirus (ADRV), common midwife toad r...

  4. Human acid β-glucosidase: isolation and amino acid sequence of a peptide containing the catalytic site

    International Nuclear Information System (INIS)

    Dinur, T.; Osiecki, K.M.; Legler, G.; Gatt, S.; Desnick, R.J.; Grabowski, G.A.

    1986-01-01

    Human acid β-glucosidase (D-glucosyl-N-acylsphingosine glucohydrolase, EC 3.2.1.45) cleaves the glucosidic bonds of glucosylceramide and synthetic β-glucosides. The deficient activity of this hydrolase is the enzymatic defect in the subtypes and variants of Gaucher disease, the most prevalent lysosomal storage disease. To isolate and characterize the catalytic site of the normal enzyme, brominated 3 H-labeled conduritol B epoxide ( 3 H-Br-CBE), which inhibits the enzyme by binding covalently to this site, was used as an affinity label. Under optimal conditions 1 mol of 3 H-Br-CBE bound to 1 mol of pure enzyme protein, indicating the presence of a single catalytic site per enzyme subunit. After V 8 protease digestion of the 3 H-Br-CBE-labeled homogeneous enzyme, three radiolabeled peptides, designated peptide A, B, or C, were resolved by reverse-phase HPLC. The partial amino acid sequence (37 residues) of peptide A (M/sub r/, 5000) was determined. The sequence of this peptide, which contained the catalytic site, had exact homology to the sequence near the carboxyl terminus of the protein, as predicted from the nucleotide sequence of the full-length cDNA encoding acid β-glucosidase

  5. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  6. Sequence Analysis of IncA/C and IncI1 Plasmids Isolated from Multidrug-Resistant Salmonella Newport Using Single-Molecule Real-Time Sequencing.

    Science.gov (United States)

    Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong

    2018-04-05

    Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome

  7. Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2

    Energy Technology Data Exchange (ETDEWEB)

    Dash, Paban Kumar, E-mail: pabandash@rediffmail.com; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana

    2013-07-05

    Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a

  8. Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2

    International Nuclear Information System (INIS)

    Dash, Paban Kumar; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana

    2013-01-01

    Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a

  9. [Analysis of COX1 sequences of Taenia isolates from four areas of Guangxi].

    Science.gov (United States)

    Yang, Yi-Chao; Ou-Yang, Yi; Su, Ai-Rong; Wan, Xiao-Ling; Li, Shu-Lin

    2012-06-01

    To analyze the COX1 sequences of Taenia isolates from four areas of Guangxi Zhuang Autonomous Region, and to understand the distribution of Taenia asiatica in Guangxi. Patients with taeniasis in Luzhai, Rongshui, Tiandong and Sanjiang in Guangxi were treated by deworming, and the Taenia isolates were collected. Cyclooxygenase-1 (COX1) sequences of these isolates were amplified by PCR, and the PCR products were sequenced by T-A clone sequencing. The homogeneities and genetic distances were calculated and analyzed, and the phylogenic trees were constructed by some softwares. Meanwhile, the COX1 sequences of the isolates from the 4 areas were compared separately with the sequences of Taenia species in GenBank. The COX1 sequence of the 5 Taenia isolates collected had the same length of 444 bp. There were 5 variable positions between the Luzhai isolate and Taenia asiatica, the homogeneity was 98.87% and their genetic distance was 0.011. The phylogenetic tree analysis revealed that the Luzhai isolate and Taenia asiatica locating at the same node had a close relationship. The homogeneity between Rongshui isolate A and Taenia solium was 100%, while the homogeneity of Rongshui isolate B with Taeniasis saginata and Taenia asiatica were 98.20% and 96.17%, respectively. The homogeneities of the Tiandong and Sanjiang isolates with Taenia solium were 99.55% and 96.40%, respectively, and the genetic distances were 0.005 and 0.037, respectively. The homogeneity between the Luzhai isolate and Taeniasis saginate was 96.40%. Taenia asiatica exists in Luzhai and Taenia solium and Taenia saginata coexist in Rongshui, Guangxi Zhuang Autonomous Region.

  10. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  11. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  12. Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

    OpenAIRE

    Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

    1986-01-01

    Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

  13. Properties of the mitochondrial carrier of adenine-nucleotide after purification. Study of the transport protein under isolated form and reincorporated form in phospho-lipidic vesicles

    International Nuclear Information System (INIS)

    Brandolin, Gerard

    1983-01-01

    The first part of this research thesis addresses the reconstitution of the ADP/ATP transport by incorporation of the specific carrier, isolated in presence of detergent, in phospholipids vesicles. Fundamental properties of the reconstituted transport are identical to that of transport in mitochondria, notably as far as the exchange stoichiometry, the turn over and the transport Km are concerned, as well as the asymmetric orientation of the carrier in the membrane. The second part of this research addresses the study of interactions of specific ligands with the ADP/ATP transport protein in presence of detergent. The study of the variations of the intrinsic fluorescence of the isolated ADP/ATP carrier highlights conformational changes exclusively induced by the presence of transportable nucleotides which are modulated in a different manner by carboxy-atractyloside or bongkrekic acid. Moreover, by using the isolated protein, a detailed analysis of binding parameters of fluorescent analogues of ATP is reported [fr

  14. Closed Genome Sequence of Phytopathogen Biocontrol Agent Bacillus velezensis Strain AGVL-005, Isolated from Soybean.

    Science.gov (United States)

    Pylro, Victor Satler; Dias, Armando Cavalcante Franco; Andreote, Fernando Dini; Morais, Daniel Kumazawa; Varani, Alessandro de Mello; Andreote, Cristiane Cipolla Fasanella; Bernardo, Eduardo Roberto de Almeida; Zucchi, Tiago

    2018-02-15

    We report here the closed and near-complete genome sequence and annotation of Bacillus velezensis strain AGVL-005, a bacterium isolated from soybean seeds in Brazil and used for phytopathogen biocontrol. Copyright © 2018 Pylro et al.

  15. Draft Genome Sequence of Clostridium mangenotii TR, Isolated from the Fecal Material of a Timber Rattlesnake

    Science.gov (United States)

    Cochran, Philip A.; Dowd, Scot E.; Andersen, Kylie; Anderson, Nichole; Brennan, Rachel; Brook, Nicole; Callaway, Tracie; Diamante, Kimberly; Duberstine, Annie; Fitch, Karla; Freiheit, Heidi; Godlewski, Chantel; Gorman, Kelly; Haubrich, Mark; Hernandez, Mercedes; Hirtreiter, Amber; Ivanoski, Beth; Jaminet, Xochitl; Kirkpatrick, Travis; Kratowicz, Jennifer; Latus, Casey; Leable, Tiegen; Lingafelt, Nicole; Lowe, DeAnna; Lowrance, Holly; Malsack, Latiffa; Mazurkiewicz, Julie; Merlos, Persida; Messley, Jamie; Montemurro, Dawn; Nakitare, Samora; Nelson, Christine; Nye, Amber; Pazera, Valerie; Pierangeli, Gina; Rellora, Ashley; Reyes, Angelica; Roberts, Jennifer; Robins, Shadara; Robinson, Jeshannah; Schultz, Alissa; Seifert, Sara; Sigler, Elona; Spangler, Julie; Swift, Ebony; TenCate, Rebecca; Thurber, Jessica; Vallee, Kristin; Wamboldt, Jennifer; Whitten, Shannon; Woods, De’andrea; Wright, Amanda; Yankunas, Darin

    2014-01-01

    Here, we report the draft genome sequence of Clostridium mangenotii strain TR, which was isolated from the fecal material of a timber rattlesnake. This bacterium is nonpathogenic but contains 68 genes involved in virulence, disease, and defense. PMID:24407632

  16. Complete genome sequence of Campylobacter iguaniorum strain 1485ET, isolated from a bearded dragon (Pogona vitticeps)

    Science.gov (United States)

    Campylobacter iguaniorum has been isolated from reptiles. This Campylobacter species is genetically related to C. fetus and C. hyointestinalis. Here we present the first whole genome sequence for this species....

  17. Complete genome sequence of Corynebacterium pseudotuberculosis Cp31, isolated from an Egyptian buffalo

    DEFF Research Database (Denmark)

    Silva, Artur; Ramos, Rommel Thiago Jucá; Ribeiro Carneiro, Adriana

    2012-01-01

    Corynebacterium pseudotuberculosis is of major veterinary importance because it affects many animal species, causing economically significant livestock diseases and losses. Therefore, the genomic sequencing of various lines of this organism, isolated from different hosts, will aid in the developm...

  18. Draft Genome Sequence of Serratia sp. Strain DD3, Isolated from the Guts of Daphnia magna

    OpenAIRE

    Poehlein, Anja; Freese, Heike M.; Daniel, Rolf; Simeonova, Diliana D.

    2014-01-01

    We report the draft genome sequence of Serratia sp. strain DD3, a gammaproteobacterium from the family Enterobacteriaceae. It was isolated from homogenized guts of Daphnia magna. The genome size is 5,274 Mb. peerReviewed

  19. Full genome sequence of a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007

    DEFF Research Database (Denmark)

    Afzal, Mamuna; Abidi, Soad; Mikkelsen, Heidi

    We have sequenced a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007. The strain was isolated from faecal material of a 48 month old second parity Danish Holstein cow, with clinical symptoms of chronic diarrhoea and emaciation. The cultures were grown on Löwen......We have sequenced a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007. The strain was isolated from faecal material of a 48 month old second parity Danish Holstein cow, with clinical symptoms of chronic diarrhoea and emaciation. The cultures were grown......, consisting of 4317 unique gene families. Comparison with M. avium paratuberculosis strain K10 revealed only 3436 genes in common (~70%). We have used GenomeAtlases to show conserved (and unique) regions along the Ejlskov2007 chromosome, compared to 2 other Mycobacterium avium sequenced genomes. Pan......-genome analyses of the sequenced Mycobacterium genomes reveal a surprisingly open and diverse set of genes for this bacterial genera....

  20. First Complete Genome Sequence of a Watermelon Mosaic Virus Isolated from Watermelon in the United States

    OpenAIRE

    Rajbanshi, Naveen; Ali, Akhtar

    2016-01-01

    Watermelon mosaic virus was first reported in 1965 from the Rio Grande Valley, TX. We report here the first complete genome sequence of a watermelon mosaic virus isolate from watermelon collected from the Rio Grande Valley of Texas.

  1. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  2. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Science.gov (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng

    2015-01-01

    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  3. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  4. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  5. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  6. Isolation and amino acid sequence of corticotropin-releasing factor from pig hypothalami.

    OpenAIRE

    Patthy, M; Horvath, J; Mason-Garcia, M; Szoke, B; Schlesinger, D H; Schally, A V

    1985-01-01

    A polypeptide was isolated from acid extracts of porcine hypothalami on the basis of its high ability to stimulate the release of corticotropin from superfused rat pituitary cells. After an initial separation by gel filtration on Sephadex G-25, further purification was carried out by reversed-phase HPLC. The isolated material was homogeneous chromatographically and by N-terminal sequencing. Based on automated gas-phase sequencing of the intact and CNBr-cleaved peptide and on carboxypeptidase ...

  7. Genome Sequences of Two Copper-Resistant Escherichia coli Strains Isolated from Copper-Fed Pigs

    DEFF Research Database (Denmark)

    Lüthje, Freja L.; Hasman, Henrik; Aarestrup, Frank Møller

    2014-01-01

    The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances.......The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances....

  8. Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk

    OpenAIRE

    Jiménez, Esther; Villar-Tajadura, M. Antonia; Marín, María; Fontecha, F. Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M.

    2012-01-01

    Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties. © 2012, American Society for Microbiology.

  9. Persistent changes in the initial rate of pyruvate transport by isolated rat liver mitochondria after preincubation with adenine nucleotides and calcium ions

    OpenAIRE

    Vaartjes, W.J.; Breejen, J.N. den; Geelen, M.J.H.; Bergh, S.G. van den

    1980-01-01

    1. Preincubation of isolated rat-liver mitochondria in the presence of adenine nucleotides or Ca2+ results in definite and persistent changes in the initial rate of pyruvate transport. 2. These changes in the rate of pyruvate transport are accompanied by equally persistent changes in the opposite direction of the activity of pyruvate dehydrogenase (EC. 1.2.4.1). 3. Changes of the transmembrane pH gradient and of the membrane potential, brought about by the pretreatments of the mitochondria, c...

  10. Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

    OpenAIRE

    Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

    1984-01-01

    We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

  11. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  12. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  13. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  14. Draft Genome Sequences of 17 Isolates of the Plant Pathogenic Bacterium Dickeya

    OpenAIRE

    Pritchard, Leighton; Humphris, Sonia; Saddler, Gerry S.; Elphinstone, John G.; Pirhonen, Minna; Toth, Ian K.

    2013-01-01

    Dickeya (formerly Erwinia chrysanthemi) species cause diseases on a wide range of crops and ornamental plants worldwide. Here we present the draft sequences of 17 Dickeya isolates spanning four Dickeya species, including five isolates that are currently unassigned to a species.

  15. Draft genome sequences of 17 isolates of the plant pathogenic bacterium dickeya.

    Science.gov (United States)

    Pritchard, Leighton; Humphris, Sonia; Saddler, Gerry S; Elphinstone, John G; Pirhonen, Minna; Toth, Ian K

    2013-11-21

    Dickeya (formerly Erwinia chrysanthemi) species cause diseases on a wide range of crops and ornamental plants worldwide. Here we present the draft sequences of 17 Dickeya isolates spanning four Dickeya species, including five isolates that are currently unassigned to a species.

  16. Complete Genome Sequence of Genotype VI Newcastle Disease Viruses Isolated from Pigeons in Pakistan

    OpenAIRE

    Wajid, Abdul; Rehmani, Shafqat Fatima; Sharma, Poonam; Goraichuk, Iryna V.; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    Two complete genome sequences of Newcastle disease virus (NDV) are described here. Virulent isolates pigeon/Pakistan/Lahore/21A/2015 and pigeon/Pakistan/Lahore/25A/2015 were obtained from racing pigeons sampled in the Pakistani province of Punjab during 2015. Phylogenetic analysis of the fusion protein genes and complete genomes classified the isolates as members of NDV class II, genotype VI.

  17. Complete Genome Sequence of the Campylobacter ureolyticus Clinical Isolate RIGS 9880

    DEFF Research Database (Denmark)

    Miller, William G; Yee, Emma; On, Stephen L W

    2015-01-01

    The emerging pathogen Campylobacter ureolyticus has been isolated from human and animal genital infections, human periodontal disease, domestic and food animals, and from cases of human gastroenteritis. We report the whole-genome sequence of the human clinical isolate RIGS 9880, which is the first...

  18. Complete Genome Sequences of Getah Virus Strains Isolated from Horses in 2016 in Japan.

    Science.gov (United States)

    Nemoto, Manabu; Bannai, Hiroshi; Ochi, Akihiro; Niwa, Hidekazu; Murakami, Satoshi; Tsujimura, Koji; Yamanaka, Takashi; Kokado, Hiroshi; Kondo, Takashi

    2017-08-03

    Getah virus is mosquito-borne and causes disease in horses and pigs. We sequenced and analyzed the complete genomes of three strains isolated from horses in Ibaraki Prefecture, eastern Japan, in 2016. They were almost identical to the genomes of strains recently isolated from horses, pigs, and mosquitoes in Japan. Copyright © 2017 Nemoto et al.

  19. Complete genome sequences of Escherichia coli strains 1303 and ECC-1470 isolated from bovine mastitis

    NARCIS (Netherlands)

    Leimbach, Andreas; Poehlein, Anja; Witten, Anika; Scheutz, Flemming; Schukken, Ynte|info:eu-repo/dai/nl/075051907; Daniel, Rolf; Dobrindt, Ulrich

    2016-01-01

    Escherichia coli is the leading causative agent of acute bovine mastitis. Here, we report the complete genome sequence of E. coli O70:H32 strain 1303, isolated from an acute case of bovine mastitis, and E. coli Ont:Hnt strain ECC-1470, isolated from a persistent infection.

  20. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  1. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  2. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Draft Genome Sequences of Four Hospital-Associated Pseudomonas putida Isolates.

    Science.gov (United States)

    Mustapha, Mustapha M; Marsh, Jane W; Ezeonwuka, Chinelo D; Pasculle, Anthony W; Pacey, Marissa P; Querry, Ashley M; Muto, Carlene A; Harrison, Lee H

    2016-09-29

    We present here the draft genome sequences of four Pseudomonas putida isolates belonging to a single clone suspected for nosocomial transmission between patients and a bronchoscope in a tertiary hospital. The four genome sequences belong to a single lineage but contain differences in their mobile genetic elements. Copyright © 2016 Mustapha et al.

  4. Complete Genome Sequence of Photobacterium sp. Strain J15, Isolated from Seawater of Southwestern Johor, Malaysia.

    Science.gov (United States)

    Roslan, Noordiyanah Nadhirah; Sabri, Suriana; Oslan, Siti Nurbaya; Baharum, Syarul Nataqain; Leow, Thean Chor

    2016-07-28

    Here, we report the genome sequences of Photobacterium sp. strain J15, isolated from seawater in Johor, Malaysia, with the ability to produce lipase and asparaginase. The PacBio genome sequence analysis of Photobacterium sp. strain J15 generated revealed its potential in producing enzymes with different catalytic functions. Copyright © 2016 Roslan et al.

  5. Draft Genome Sequence of Antimicrobial-Producing Clostridium sp. JC272, Isolated from Marine Sediment

    OpenAIRE

    Tushar, L.; Sasi Jyothsna, T. S.; Sasikala, C.; Ramana, C. V.

    2015-01-01

    We announce the draft genome sequence of Clostridium sp. JC272, isolated from a sediment sample collected from marine habitats of Gujarat, India. Clostridium sp. JC272 is an obligate anaerobe and has the ability to produce antimicrobial compounds. The genome sequence indicates the strain?s capability of producing small peptides (microcins), which are potential novel antibiotics.

  6. Low level of sequence diversity at merozoite surface protein-1 locus of Plasmodium ovale curtisi and P. ovale wallikeri from Thai isolates.

    Science.gov (United States)

    Putaporntip, Chaturong; Hughes, Austin L; Jongwutiwes, Somchai

    2013-01-01

    The merozoite surface protein-1 (MSP-1) is a candidate target for the development of blood stage vaccines against malaria. Polymorphism in MSP-1 can be useful as a genetic marker for strain differentiation in malarial parasites. Although sequence diversity in the MSP-1 locus has been extensively analyzed in field isolates of Plasmodium falciparum and P. vivax, the extent of variation in its homologues in P. ovale curtisi and P. ovale wallikeri, remains unknown. Analysis of the mitochondrial cytochrome b sequences of 10 P. ovale isolates from symptomatic malaria patients from diverse endemic areas of Thailand revealed co-existence of P. ovale curtisi (n = 5) and P. ovale wallikeri (n = 5). Direct sequencing of the PCR-amplified products encompassing the entire coding region of MSP-1 of P. ovale curtisi (PocMSP-1) and P. ovale wallikeri (PowMSP-1) has identified 3 imperfect repeated segments in the former and one in the latter. Most amino acid differences between these proteins were located in the interspecies variable domains of malarial MSP-1. Synonymous nucleotide diversity (πS) exceeded nonsynonymous nucleotide diversity (πN) for both PocMSP-1 and PowMSP-1, albeit at a non-significant level. However, when MSP-1 of both these species was considered together, πS was significantly greater than πN (pdiversity at this locus prior to speciation. Phylogenetic analysis based on conserved domains has placed PocMSP-1 and PowMSP-1 in a distinct bifurcating branch that probably diverged from each other around 4.5 million years ago. The MSP-1 sequences support that P. ovale curtisi and P. ovale wallikeri are distinct species. Both species are sympatric in Thailand. The low level of sequence diversity in PocMSP-1 and PowMSP-1 among Thai isolates could stem from persistent low prevalence of these species, limiting the chance of outcrossing at this locus.

  7. Whole genome sequence of an unusual Borrelia burgdorferi sensu lato isolate

    Energy Technology Data Exchange (ETDEWEB)

    Casjens, S.R.; Dunn, J.; Fraser-Liggett, C. M.; Mongodin, E. F.; Qiu, W. G.; Luft, B. J.; Schutzer, S. E.

    2011-03-01

    Human Lyme disease is caused by a number of related Borrelia burgdorferi sensu lato species. We report here the complete genome sequence of Borrelia sp. isolate SV1 from Finland. This isolate is to date the closest known relative of B. burgdorferi sensu stricto, but it is sufficiently genetically distinct from that species that it and its close relatives warrant its candidacy for new-species status. We suggest that this isolate should be named 'Borrelia finlandensis.'

  8. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Ellis David

    2009-08-01

    Full Text Available Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA-based method to detect a series of mutations in the C. albicans ERG11 gene using "reference" azole-resistant isolates with known mutations. The method was then used to estimate the frequency of ERG11 mutations and their type in 25 Australian clinical C. albicans isolates with reduced susceptibility to fluconazole and in 23 fluconazole-susceptible isolates. RCA results were compared DNA sequencing. Results The RCA assay correctly identified all ERG11 mutations in eight "reference" C. albicans isolates. When applied to 48 test strains, the RCA method showed 100% agreement with DNA sequencing where an ERG11 mutation-specific probe was used. Of 20 different missense mutations detected by sequencing in 24 of 25 (96% isolates with reduced fluconazole susceptibility, 16 were detected by RCA. Five missense mutations were detected by both methods in 18 of 23 (78% fluconazole-susceptible strains. DNA sequencing revealed that mutations in non-susceptible isolates were all due to homozygous nucleotide changes. With the exception of the mutations leading to amino acid substitution E266D, those in fluconazole-susceptible strains were heterozygous. Amino acid substitutions common to both sets of isolates were D116E, E266D, K128T, V437I and V488I. Substitutions unique to isolates with reduced fluconazole susceptibility were G464 S (n = 4 isolates, G448E (n = 3, G307S (n = 3, K143R (n = 3 and Y123H, S405F and R467K (each n = 1. DNA sequencing revealed a novel substitution, G450V, in one isolate. Conclusion The sensitive RCA

  9. Whole-Genome Sequences of Two Borrelia afzelii and Two Borrelia garinii Lyme Disease Agent Isolates

    Energy Technology Data Exchange (ETDEWEB)

    Casjens, S.R.; Dunn, J.; Mongodin, E. F.; Qiu, W.-G.; Luft, B. J.; Fraser-Liggett, C. M.; Schutzer, S. E.

    2011-12-01

    Human Lyme disease is commonly caused by several species of spirochetes in the Borrelia genus. In Eurasia these species are largely Borrelia afzelii, B. garinii, B. burgdorferi, and B. bavariensis sp. nov. Whole-genome sequencing is an excellent tool for investigating and understanding the influence of bacterial diversity on the pathogenesis and etiology of Lyme disease. We report here the whole-genome sequences of four isolates from two of the Borrelia species that cause human Lyme disease, B. afzelii isolates ACA-1 and PKo and B. garinii isolates PBr and Far04.

  10. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  11. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  12. Genetic diversity of clinical isolates of Bacillus cereus using multilocus sequence typing

    Directory of Open Access Journals (Sweden)

    Pruckler James M

    2008-11-01

    Full Text Available Abstract Background Bacillus cereus is most commonly associated with foodborne illness (diarrheal and emetic but is also an opportunistic pathogen that can cause severe and fatal infections. Several multilocus sequence typing (MLST schemes have recently been developed to genotype B. cereus and analysis has suggested a clonal or weakly clonal population structure for B. cereus and its close relatives B. anthracis and B. thuringiensis. In this study we used MLST to determine if B. cereus isolates associated with illnesses of varying severity (e.g., severe, systemic vs. gastrointestinal (GI illness were clonal or formed clonal complexes. Results A retrospective analysis of 55 clinical B. cereus isolates submitted to the Centers for Disease Control and Prevention between 1954 and 2004 was conducted. Clinical isolates from severe infections (n = 27, gastrointestinal (GI illness (n = 18, and associated isolates from food (n = 10 were selected for analysis using MLST. The 55 isolates were diverse and comprised 38 sequence types (ST in two distinct clades. Of the 27 isolates associated with serious illness, 13 clustered in clade 1 while 14 were in clade 2. Isolates associated with GI illness were also found throughout clades 1 and 2, while no isolates in this study belonged to clade 3. All the isolates from this study belonging to the clade 1/cereus III lineage were associated with severe disease while isolates belonging to clade1/cereus II contained isolates primarily associated with severe disease and emetic illness. Only three STs were observed more than once for epidemiologically distinct isolates. Conclusion STs of clinical B. cereus isolates were phylogenetically diverse and distributed among two of three previously described clades. Greater numbers of strains will need to be analyzed to confirm if specific lineages or clonal complexes are more likely to contain clinical isolates or be associated with specific illness, similar to B. anthracis and

  13. Improved diagnostic PCR assay for Actinobacillus pleuropneumoniae based on the nucleotide sequence of an outer membrane lipoprotein

    DEFF Research Database (Denmark)

    Gram, Trine; Ahrens, Peter

    1998-01-01

    species related to A. pleuropneumoniae or isolated from pigs were assayed. They were all found negative in the PCR, as were tonsil cultures from 50 pigs of an A. pleuropneumoniae-negative herd. The sensitivity assessed by agarose gel analysis of the PCR product was 10(2) CFU/PCR test tube. The specificity...

  14. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  15. Whole Genome Sequencing of Enterovirus species C Isolates by High-throughput Sequencing: Development of Generic Primers

    Directory of Open Access Journals (Sweden)

    Maël Bessaud

    2016-08-01

    Full Text Available Enteroviruses are among the most common viruses infecting humans and can cause diverse clinical syndromes ranging from minor febrile illness to severe and potentially fatal diseases. Enterovirus species C (EV-C consists of more than 20 types, among which the 3 serotypes of polioviruses, the etiological agents of poliomyelitis, are included. Biodiversity and evolution of EV-C genomes are shaped by frequent recombination events. Therefore, identification and characterization of circulating EV-C strains require the sequencing of different genomic regions.A simple method was developed to sequence quickly the entire genome of EV-C isolates. Four overlapping fragments were produced separately by RT-PCR performed with generic primers. The four amplicons were then pooled and purified prior to be sequenced by high-throughput technique.The method was assessed on a panel of EV-Cs belonging to a wide-range of types. It can be used to determine full-length genome sequences through de novo assembly of thousands of reads. It was also able to discriminate reads from closely related viruses in mixtures.By decreasing the workload compared to classical Sanger-based techniques, this method will serve as a precious tool for sequencing large panels of EV-Cs isolated in cell cultures during environmental surveillance or from patients, including vaccine-derived polioviruses.

  16. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  17. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Science.gov (United States)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  18. Multilocus Sequence Typing Scheme versus Pulsed-Field Gel Electrophoresis for Typing Mycobacterium abscessus Isolates

    Science.gov (United States)

    Machado, Gabriel Esquitini; Matsumoto, Cristianne Kayoko; Chimara, Erica; Duarte, Rafael da Silva; de Freitas, Denise; Palaci, Moises; Hadad, David Jamil; Lima, Karla Valéria Batista; Lopes, Maria Luiza; Ramos, Jesus Pais; Campos, Carlos Eduardo; Caldas, Paulo César; Heym, Beate

    2014-01-01

    Outbreaks of infections by rapidly growing mycobacteria following invasive procedures, such as ophthalmological, laparoscopic, arthroscopic, plastic, and cardiac surgeries, mesotherapy, and vaccination, have been detected in Brazil since 1998. Members of the Mycobacterium chelonae-Mycobacterium abscessus group have caused most of these outbreaks. As part of an epidemiological investigation, the isolates were typed by pulsed-field gel electrophoresis (PFGE). In this project, we performed a large-scale comparison of PFGE profiles with the results of a recently developed multilocus sequence typing (MLST) scheme for M. abscessus. Ninety-three isolates were analyzed, with 40 M. abscessus subsp. abscessus isolates, 47 M. abscessus subsp. bolletii isolates, and six isolates with no assigned subspecies. Forty-five isolates were obtained during five outbreaks, and 48 were sporadic isolates that were not associated with outbreaks. For MLST, seven housekeeping genes (argH, cya, glpK, gnd, murC, pta, and purH) were sequenced, and each isolate was assigned a sequence type (ST) from the combination of obtained alleles. The PFGE patterns of DraI-digested DNA were compared with the MLST results. All isolates were analyzable by both methods. Isolates from monoclonal outbreaks showed unique STs and indistinguishable or very similar PFGE patterns. Thirty-three STs and 49 unique PFGE patterns were identified among the 93 isolates. The Simpson's index of diversity values for MLST and PFGE were 0.69 and 0.93, respectively, for M. abscessus subsp. abscessus and 0.96 and 0.97, respectively, for M. abscessus subsp. bolletii. In conclusion, the MLST scheme showed 100% typeability and grouped monoclonal outbreak isolates in agreement with PFGE, but it was less discriminative than PFGE for M. abscessus. PMID:24899019

  19. Multilocus sequence typing scheme versus pulsed-field gel electrophoresis for typing Mycobacterium abscessus isolates.

    Science.gov (United States)

    Machado, Gabriel Esquitini; Matsumoto, Cristianne Kayoko; Chimara, Erica; Duarte, Rafael da Silva; de Freitas, Denise; Palaci, Moises; Hadad, David Jamil; Lima, Karla Valéria Batista; Lopes, Maria Luiza; Ramos, Jesus Pais; Campos, Carlos Eduardo; Caldas, Paulo César; Heym, Beate; Leão, Sylvia Cardoso

    2014-08-01

    Outbreaks of infections by rapidly growing mycobacteria following invasive procedures, such as ophthalmological, laparoscopic, arthroscopic, plastic, and cardiac surgeries, mesotherapy, and vaccination, have been detected in Brazil since 1998. Members of the Mycobacterium chelonae-Mycobacterium abscessus group have caused most of these outbreaks. As part of an epidemiological investigation, the isolates were typed by pulsed-field gel electrophoresis (PFGE). In this project, we performed a large-scale comparison of PFGE profiles with the results of a recently developed multilocus sequence typing (MLST) scheme for M. abscessus. Ninety-three isolates were analyzed, with 40 M. abscessus subsp. abscessus isolates, 47 M. abscessus subsp. bolletii isolates, and six isolates with no assigned subspecies. Forty-five isolates were obtained during five outbreaks, and 48 were sporadic isolates that were not associated with outbreaks. For MLST, seven housekeeping genes (argH, cya, glpK, gnd, murC, pta, and purH) were sequenced, and each isolate was assigned a sequence type (ST) from the combination of obtained alleles. The PFGE patterns of DraI-digested DNA were compared with the MLST results. All isolates were analyzable by both methods. Isolates from monoclonal outbreaks showed unique STs and indistinguishable or very similar PFGE patterns. Thirty-three STs and 49 unique PFGE patterns were identified among the 93 isolates. The Simpson's index of diversity values for MLST and PFGE were 0.69 and 0.93, respectively, for M. abscessus subsp. abscessus and 0.96 and 0.97, respectively, for M. abscessus subsp. bolletii. In conclusion, the MLST scheme showed 100% typeability and grouped monoclonal outbreak isolates in agreement with PFGE, but it was less discriminative than PFGE for M. abscessus. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.

    Directory of Open Access Journals (Sweden)

    Heike Hadrys

    Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.

  1. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

    Science.gov (United States)

    Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

    1995-01-01

    Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

  2. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  4. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  5. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  6. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  7. Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

    Science.gov (United States)

    Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

    1993-02-01

    A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

  8. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences.

    Science.gov (United States)

    Otsuka, J; Kawai, Y; Sugaya, N

    2001-11-21

    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  9. Multilocus Sequence Typing of the Clinical Isolates of Salmonella Enterica Serovar Typhimurium in Tehran Hospitals

    Directory of Open Access Journals (Sweden)

    Reza Ranjbar

    2017-09-01

    Full Text Available Background: Salmonella enterica serovar Typhimurium is one of the most important serovars of Salmonella enterica and is associated with human salmonellosis worldwide. Many epidemiological studies have focused on the characteristics of Salmonella Typhimurium in many countries as well as in Asia. This study was conducted to investigate the genetic characteristics of Salmonella Typhimurium using multilocus sequence typing (MLST. Methods: Clinical samples (urine, blood, and stool were collected from patients, who were admitted to 2 hospitals in Tehran between April and September, 2015. Salmonella Typhimurium strains were identified by conventional standard biochemical and serological testing. The antibiotic susceptibility patterns of the Salmonella Typhimurium isolates against 16 antibiotics was determined using the disk diffusion assay. The clonal relationship between the strains of Salmonella Typhimurium was analyzed using MLST. Results: Among the 68 Salmonella isolates, 31% (n=21 were Salmonella Typhimurium. Of the total 21 Salmonella Typhimurium isolates, 76% (n=16 were multidrug-resistant and showed resistance to 3 or more antibiotic families. The Salmonella Typhimurium isolates were assigned to 2 sequence types: ST19 and ST328. ST19 was more common (86%. Both sequence types were further assigned to 1 eBURST group. Conclusion: This is the first study of its kind in Iran to determine the sequence types of the clinical isolates of Salmonella Typhimurium in Tehran hospitals using MLST. ST19 was detected as the major sequence type of Salmonella Typhimurium.

  10. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  11. Purification and amino acid sequence of a bacteriocins produced by Lactobacillus salivarius K7 isolated from chicken intestine

    Directory of Open Access Journals (Sweden)

    Kenji Sonomoto

    2006-03-01

    Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.

  12. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    Science.gov (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  13. Isolation and sequence characterization of DNA-A genome of a new begomovirus strain associated with severe leaf curling symptoms of Jatropha curcas L.

    Science.gov (United States)

    Chauhan, Sushma; Rahman, Hifzur; Mastan, Shaik G; Pamidimarri, D V N Sudheer; Reddy, Muppala P

    2018-07-20

    Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp-2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Strong conservation of rhoptry-associated-protein-1 (RAP-1) locus organization and sequence among Babesia isolates infecting sheep from China (Babesia motasi-like phylogenetic group).

    Science.gov (United States)

    Niu, Qingli; Valentin, Charlotte; Bonsergent, Claire; Malandrin, Laurence

    2014-12-01

    Rhoptry-associated-protein 1 (RAP-1) is considered as a potential vaccine candidate due to its involvement in red blood cell invasion by parasites in the genus Babesia. We examined its value as a vaccine candidate by studying RAP-1 conservation in isolates of Babesia sp. BQ1 Ningxian, Babesia sp. Tianzhu and Babesia sp. Hebei, responsible for ovine babesiosis in different regions of China. The rap-1 locus in these isolates has very similar features to those described for Babesia sp. BQ1 Lintan, another Chinese isolate also in the B. motasi-like phylogenetic group, namely the presence of three types of rap-1 genes (rap-1a, rap-1b and rap-1c), multiple conserved rap-1b copies (5) interspaced with more or less variable rap-1a copies (6), and the 3' localization of one rap-1c. The isolates Babesia sp. Tianzhu, Babesia sp. BQ1 Lintan and Ningxian were almost identical (average nucleotide identity of 99.9%) over a putative locus of about 31 Kb, including the intergenic regions. Babesia sp. Hebei showed a similar locus organization but differed in the rap-1 locus sequence, for each gene and intergenic region, with an average nucleotide identity of 78%. Our results are in agreement with 18S rDNA phylogenetic studies performed on these isolates. However, in extremely closely related isolates the rap-1 locus seems more conserved (99.9%) than the 18S rDNA (98.7%), whereas in still closely related isolates the identities are much lower (78%) compared with the 18S rDNA (97.7%). The particularities of the rap-1 locus in terms of evolution, phylogeny, diagnosis and vaccine development are discussed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Meta-analysis of sequence-based association studies across three cattle breeds reveals 25 QTL for fat and protein percentages in milk at nucleotide resolution.

    Science.gov (United States)

    Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E

    2017-11-09

    Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and

  16. Single-nucleotide variant in multiple copies of a deleted in azoospermia (DAZ) sequence - a human Y chromosome quantitative polymorphism.

    Science.gov (United States)

    Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J

    2002-01-01

    The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel

  17. Characterisation of purified parvalbumin from five fish species and nucleotide sequencing of this major allergen from Pacific pilchard, Sardinops sagax.

    Science.gov (United States)

    Beale, Janine E; Jeebhay, Mohamed F; Lopata, Andreas L

    2009-09-01

    IgE-mediated allergic reaction to seafood is a common cause of food allergy including anaphylactic reactions. Parvalbumin, the major fish allergen, has been shown to display IgE cross-reactivity among fish species consumed predominantly in Europe and the Far East. However, cross-reactivity studies of parvalbumin from fish species widely consumed in the Southern hemisphere are limited as is data relating to immunological and molecular characterisation. In this study, antigenic cross-reactivity and the presence of oligomers and isomers of parvalbumin from five highly consumed fish species in Southern Africa were assessed by immunoblotting using purified parvalbumin and crude fish extracts. Pilchard (Sardinops sagax) parvalbumin was found to display the strongest IgE reactivity among 10 fish-allergic consumers. The cDNA sequence of the beta-form of pilchard parvalbumin was determined and designated Sar sa 1.0101 (accession number FM177701 EMBL/GenBank/DDBJ databases). Oligomeric forms of parvalbumin were observed in all fish species using a monoclonal anti-parvalbumin antibody and subject's sera. Isoforms varied between approximately 10-13 kDa. A highly cross-reactive allergenic isoform of parvalbumin was identified and sequenced, providing a successful primary step towards the generation of a recombinant form that could be used for diagnostic and potential therapeutic use in allergic individuals.

  18. Sequence analysis of the Czech potato mop-top virus (PMTV) isolate Korneta-Nemilkov

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Pečenková, Tamara; Filigarová, Marie; Dědič, P.

    2007-01-01

    Roč. 52, č. 1 (2007), s. 61-64 ISSN 0015-5632 R&D Projects: GA ČR GA522/04/1329; GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje Keywords : SPONGOSPORA-SUBTERRANEA * NUCLEOTIDE-SEQUENCE * GENOME ORGANIZATION Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.989, year: 2007 http://www.cssm.info/priloha/fm2007_061.pdf

  19. Isolation and complete genome sequencing of Mimivirus bombay, a Giant Virus in sewage of Mumbai, India

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    2016-09-01

    Full Text Available We report the isolation and complete genome sequencing of a new Mimiviridae family member, infecting Acanthamoeba castellanii, from sewage in Mumbai, India. The isolated virus has a particle size of about 435 nm and a 1,182,200-bp genome. A phylogeny based on the DNA polymerase sequence placed the isolate as a new member of the Mimiviridae family lineage A and was named as Mimivirus bombay. Extensive presence of Mimiviridae family members in different environmental niches, with remarkably similar genome size and genetic makeup, point towards an evolutionary advantage that needs to be further investigated. The complete genome sequence of Mimivirus bombay was deposited at GenBank/EMBL/DDBJ under the accession number KU761889.

  20. Complete Genome Sequence of an Avian Metapneumovirus Subtype A Strain Isolated from Chicken (Gallus gallus) in Brazil

    OpenAIRE

    Rizotto, La?s S.; Scagion, Guilherme P.; Cardoso, Tereza C.; Sim?o, Raphael M.; Caserta, Leonardo C.; Benassi, Julia C.; Keid, Lara B.; Oliveira, Tr?cia M. F. de S.; Soares, Rodrigo M.; Arns, Clarice W.; Van Borm, Steven; Ferreira, Helena L.

    2017-01-01

    ABSTRACT We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A.

  1. Draft genome sequences of two opportunistic pathogenic strains of Staphylococcus cohnii isolated from human patients.

    Science.gov (United States)

    Mendoza-Olazarán, Soraya; Garcia-Mazcorro, José F; Morfín-Otero, Rayo; Villarreal-Treviño, Licet; Camacho-Ortiz, Adrián; Rodríguez-Noriega, Eduardo; Bocanegra-Ibarias, Paola; Maldonado-Garza, Héctor J; Dowd, Scot E; Garza-González, Elvira

    2017-01-01

    Herein, we report the draft-genome sequences and annotation of two opportunistic pathogenic strains of Staphylococcus cohnii isolated from humans. One strain (SC-57) was isolated from blood from a male patient in May 2006 and the other (SC-532) from a catheter from a male patient in June 2006. Similar to other genomes of Staphylococcus species, most genes (42%) of both strains are involved in metabolism of amino acids and derivatives, carbohydrates and proteins. Eighty (4%) genes are involved in virulence, disease, and defense and both species show phenotypic low biofilm production and evidence of increased antibiotic resistance associated to biofilm production. From both isolates, a new Staphylococcal Cassette Chromosome mec was detected: mec class A, ccr type 1. This is the first report of whole genome sequences of opportunistic S. cohnii isolated from human patients.

  2. Whole-genome sequencing of bloodstream Staphylococcus aureus isolates does not distinguish bacteraemia from endocarditis

    DEFF Research Database (Denmark)

    Lilje, Berit; Rasmussen, Rasmus Vedby; Dahl, Anders

    2017-01-01

    Most Staphylococcus aureus isolates can cause invasive disease given the right circumstances, but it is unknown if some isolates are more likely to cause severe infections than others. S. aureus bloodstream isolates from 120 patients with definite infective endocarditis and 121 with S. aureus...... bacteraemia without infective endocarditis underwent whole-genome sequencing. Genome-wide association analysis was performed using a variety of bioinformatics approaches including SNP analysis, accessory genome analysis and k-mer based analysis. Core and accessory genome analyses found no association...... with either of the two clinical groups. In this study, the genome sequences of S. aureus bloodstream isolates did not discriminate between bacteraemia and infective endocarditis. Based on our study and the current literature, it is not convincing that a specific S. aureus genotype is clearly associated...

  3. Draft genome sequence of Phomopsis longicolla isolate MSPL 10-6

    Directory of Open Access Journals (Sweden)

    Shuxian Li

    2015-03-01

    Full Text Available Phomopsis longicolla is the primary cause of Phomopsis seed decay in soybean. This disease severely affects soybean seed quality by reducing seed viability and oil content, altering seed composition, and increasing frequencies of moldy and/or split beans. It is one of the most economically important soybean diseases. Here, we report the de novo assembled draft genome sequence of the P. longicolla isolate MSPL10-6, which was isolated from field-grown soybean seed in Mississippi, USA. This study represents the first reported genome sequence of a seedborne fungal pathogen in the Diaporthe–Phomopsis complex. The P. longicolla genome sequence will enable research into the genetic basis of fungal infection of soybean seed and provide information for the study of soybean–fungal interactions. The genome sequence will also be valuable for molecular genetic marker development, manipulation of pathogenicity-related genes and development of new control strategies for this pathogen.

  4. Genomic 3' terminal sequence comparison of three isolates of rabbit haemorrhagic disease virus.

    Science.gov (United States)

    Milton, I D; Vlasak, R; Nowotny, N; Rodak, L; Carter, M J

    1992-05-15

    Comparison of sequence data is necessary in older to investigate virus origins, identify features common to virulent strains, and characterize genomic organization within virus families. A virulent caliciviral disease of rabbits recently emerged in China. We have sequenced 1100 bases from the 3' ends of two independent European isolates of this virus, and compared these with previously determined calicivirus sequences. Rabbit caliciviruses were closely related, despite the different countries in which isolation was made. This supports the rapid spread of a new virus across Europe. The capsid protein sequences of these rabbit viruses differ markedly from those determined for feline calicivirus, but a hypothetical 3' open reading frame is relatively well conserved between the caliciviruses of these two different hosts and argues for a functional role.

  5. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  6. Aquimarina agarivorans sp. nov., a genome-sequenced member of the class Flavobacteriia isolated from Gelidium amansii.

    Science.gov (United States)

    Zhou, Yan-Xia; Wang, Chao; Du, Zong-Jun; Chen, Guan-Jun

    2015-08-01

    A novel Gram-stain-negative, facultatively anaerobic, rod-shaped, agar-digesting bacterial strain, designated HQM9T, was isolated from the surface of the marine red alga Gelidium amansii collected from the intertidal zone of Weihai, China. Cells of HQM9T were 3.0-4.0 μm long and 0.2-0.3 μm wide and lacked flagella. The new isolate grew optimally at 28-30 °C, at pH 7.0-7.5, and in the presence of 2.5-3.0% NaCl. The predominant cellular fatty acids were iso-C15 : 0 and iso-C17 : 0 3-OH. The sole menaquinone was MK-6. The DNA G+C content was 33 mol%. The major polar lipids were comprised of phosphatidylethanolamine and four unknown polar lipids. Based on the 16S rRNA gene sequence, the closest relative was Aquimarina agarilytica ZC1T with 97.16% sequence similarity, with which strain HQM9T formed a distinct cluster belonging to the genus Aquimarina in a phylogenetic tree. Moreover, average nucleotide identity and estimated DNA-DNA hybridization values between strains HQM9T and ZC1T were 78.7% and 12.50 ± 2.95%, respectively. On the basis of phenotypic, chemotaxonomic and phylogenetic analysis, strain HQM9T represents the type strain of a novel species within the genus Aquimarina in the family Flavobacteriaceae, phylum Bacteroidetes, for which the name Aquimarina agarivorans sp. nov. is proposed. The type strain is HQM9T ( = ATCC BAA-2612T = CICC 10835T).

  7. Twenty-one genome sequences from Pseudomonas species and 19 genome sequences from diverse bacteria isolated from the rhizosphere and endosphere of Populus deltoides.

    Science.gov (United States)

    Brown, Steven D; Utturkar, Sagar M; Klingeman, Dawn M; Johnson, Courtney M; Martin, Stanton L; Land, Miriam L; Lu, Tse-Yuan S; Schadt, Christopher W; Doktycz, Mitchel J; Pelletier, Dale A

    2012-11-01

    To aid in the investigation of the Populus deltoides microbiome, we generated draft genome sequences for 21 Pseudomonas strains and 19 other diverse bacteria isolated from Populus deltoides roots. Genome sequences for isolates similar to Acidovorax, Bradyrhizobium, Brevibacillus, Caulobacter, Chryseobacterium, Flavobacterium, Herbaspirillum, Novosphingobium, Pantoea, Phyllobacterium, Polaromonas, Rhizobium, Sphingobium, and Variovorax were generated.

  8. Twenty-One Genome Sequences from Pseudomonas Species and 19 Genome Sequences from Diverse Bacteria Isolated from the Rhizosphere and Endosphere of Populus deltoides

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Steven D [ORNL; Utturkar, Sagar M [ORNL; Klingeman, Dawn Marie [ORNL; Johnson, Courtney M [ORNL; Martin, Stanton [ORNL; Land, Miriam L [ORNL; Lu, Tse-Yuan [ORNL; Schadt, Christopher Warren [ORNL; Doktycz, Mitchel John [ORNL; Pelletier, Dale A [ORNL

    2012-01-01

    To aid in the investigation of the Populus deltoides microbiome we generated draft genome sequences for twenty one Pseudomonas and twenty one other diverse bacteria isolated from Populus deltoides roots. Genome sequences for isolates similar to Acidovorax, Bradyrhizobium, Brevibacillus, Burkholderia, Caulobacter, Chryseobacterium, Flavobacterium, Herbaspirillum, Novosphingobium, Pantoea, Phyllobacterium, Polaromonas, Rhizobium, Sphingobium and Variovorax were generated.

  9. COMPLETE NUCLEOTIDE SEQUENCE OF SPHEROIDIN GENES OF CALLIPTAMUS ITALICUS ENTOMOPOXVIRUS(CIEPV) AND GOMPHOCERUS SIBIRICUS ENTOMOPOXVIRUS(GSEPV)

    Institute of Scientific and Technical Information of China (English)

    Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian

    2004-01-01

    The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.

  10. Draft Genome Sequences of Six Ruminant Coxiella burnetii Isolates of European Origin

    DEFF Research Database (Denmark)

    Sidi-Boumedine, Karim; Ellis, Richard J.; Adam, Gilbert

    2014-01-01

    Coxiella burnetii is responsible for Q fever, a worldwide zoonosis attributed to the inhalation of aerosols contaminated by livestock birth products. Six draft genome sequences of European C. burnetii isolates from ruminants are presented here. The availability of these genomes will help in under......Coxiella burnetii is responsible for Q fever, a worldwide zoonosis attributed to the inhalation of aerosols contaminated by livestock birth products. Six draft genome sequences of European C. burnetii isolates from ruminants are presented here. The availability of these genomes will help...

  11. Sequence analysis and typing of Saprolegnia strains isolated from freshwater fish from Southern Chinese regions

    Directory of Open Access Journals (Sweden)

    Siya Liu

    2017-09-01

    Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.

  12. Draft Genome Sequence of Staphylococcus cohnii subsp. urealyticus Isolated from a Healthy Dog.

    Science.gov (United States)

    Bean, David C; Wigmore, Sarah M; Wareham, David W

    2017-02-16

    Staphylococcus cohnii subsp. urealyticus strain SW120 was isolated from the ear swab of a healthy dog. The isolate is resistant to methicillin and fusidic acid. The SW120 draft genome is 2,805,064 bp and contains 2,667 coding sequences, including 58 tRNAs and nine complete rRNA coding regions. Copyright © 2017 Bean et al.

  13. Complete Genome Sequence of Genotype VI Newcastle Disease Viruses Isolated from Pigeons in Pakistan

    Science.gov (United States)

    Wajid, Abdul; Rehmani, Shafqat Fatima; Sharma, Poonam; Goraichuk, Iryna V.; Dimitrov, Kiril M.

    2016-01-01

    Two complete genome sequences of Newcastle disease virus (NDV) are described here. Virulent isolates pigeon/Pakistan/Lahore/21A/2015 and pigeon/Pakistan/Lahore/25A/2015 were obtained from racing pigeons sampled in the Pakistani province of Punjab during 2015. Phylogenetic analysis of the fusion protein genes and complete genomes classified the isolates as members of NDV class II, genotype VI. PMID:27540069

  14. Draft genome sequences of two opportunistic pathogenic strains of Staphylococcus cohnii isolated from human patients

    OpenAIRE

    Mendoza-Olazar?n, Soraya; Garcia-Mazcorro, Jos? F.; Morf?n-Otero, Rayo; Villarreal-Trevi?o, Licet; Camacho-Ortiz, Adri?n; Rodr?guez-Noriega, Eduardo; Bocanegra-Ibarias, Paola; Maldonado-Garza, H?ctor J.; Dowd, Scot E.; Garza-Gonz?lez, Elvira

    2017-01-01

    Herein, we report the draft-genome sequences and annotation of two opportunistic pathogenic strains of Staphylococcus cohnii isolated from humans. One strain (SC-57) was isolated from blood from a male patient in May 2006 and the other (SC-532) from a catheter from a male patient in June 2006. Similar to other genomes of Staphylococcus species, most genes (42%) of both strains are involved in metabolism of amino acids and derivatives, carbohydrates and proteins. Eighty (4%) genes are involved...

  15. Draft Genome Sequence of Lactobacillus sp. Strain TCF032-E4, Isolated from Fermented Radish.

    Science.gov (United States)

    Mao, Yuejian; Chen, Meng; Horvath, Philippe

    2015-07-30

    Here, we report the draft genome sequence of Lactobacillus sp. strain TCF032-E4 (= CCTCC AB2015090 = DSM 100358), isolated from a Chinese fermented radish. The total length of the 57 contigs is about 2.9 Mb, with a G+C content of 43.5 mol% and 2,797 predicted coding sequences (CDSs). Copyright © 2015 Mao et al.

  16. Genetic diversity among Puccinia melanocephala isolates from Brazil assessed using simple sequence repeat markers.

    Science.gov (United States)

    Peixoto-Junior, R F; Creste, S; Landell, M G A; Nunes, D S; Sanguino, A; Campos, M F; Vencovsky, R; Tambarussi, E V; Figueira, A

    2014-09-26

    Brown rust (causal agent Puccinia melanocephala) is an important sugarcane disease that is responsible for large losses in yield worldwide. Despite its importance, little is known regarding the genetic diversity of this pathogen in the main Brazilian sugarcane cultivation areas. In this study, we characterized the genetic diversity of 34 P. melanocephala isolates from 4 Brazilian states using loci identified from an enriched simple sequence repeat (SSR) library. The aggressiveness of 3 isolates from major sugarcane cultivation areas was evaluated by inoculating an intermediately resistant and a susceptible cultivar. From the enriched library, 16 SSR-specific primers were developed, which produced scorable alleles. Of these, 4 loci were polymorphic and 12 were monomorphic for all isolates evaluated. The molecular characterization of the 34 isolates of P. melanocephala conducted using 16 SSR loci revealed the existence of low genetic variability among the isolates. The average estimated genetic distance was 0.12. Phenetic analysis based on Nei's genetic distance clustered the isolates into 2 major groups. Groups I and II included 18 and 14 isolates, respectively, and both groups contained isolates from all 4 geographic regions studied. Two isolates did not cluster with these groups. It was not possible to obtain clusters according to location or state of origin. Analysis of disease severity data revealed that the isolates did not show significant differences in aggressiveness between regions.

  17. Molecular characterization of two isolates of sweet potato leaf curl ...

    African Journals Online (AJOL)

    Comparison analysis showed that DNA-A sequence of JS1 isolate was closely related to that of sweet potato leaf curl virus (SPLCV) from United States with nucleotide sequence identity of 97.0% and DNA-A of Y338 showed highest sequence identity at 97.8% with an isolate of SPLCV from China. Phylogenetic analysis ...

  18. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  19. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  20. Involvement of cyclic nucleotide-gated channels in spontaneous activity generated in isolated interstitial cells of Cajal from the rabbit urethra.

    Science.gov (United States)

    Sancho, Maria; Bradley, Eamonn; Garcia-Pascual, Angeles; Triguero, Domingo; Thornbury, Keith D; Hollywood, Mark A; Sergeant, Gerard P

    2017-11-05

    Cyclic nucleotide-gated (CNG) channels are non-selective cation channels that mediate influx of extracellular Na + and Ca 2+ in various cell types. L-cis-Diltiazem, a CNG channel blocker, inhibits contraction of urethral smooth muscle (USM), however the mechanisms underlying this effect are still unclear. We investigated the possibility that CNG channels contribute to spontaneous pacemaker activity in freshly isolated interstitial cells of Cajal (ICC) isolated from the rabbit urethra (RUICC). Using immunocytochemistry, we found intense CNG1-immunoreactivity in vimentin-immunoreactive RUICC, mainly within patches of the cellular body and processes. In contrast, α-actin immunoreactive smooth muscle cells (SMC) did not show significant reactivity to a specific CNGA1 antibody. Freshly isolated RUICC, voltage clamped at -60mV, developed spontaneous transient inward currents (STICs) that were inhibited by L-cis-Diltiazem (50µM). Similarly, L-cis-Diltiazem (50µM) also inhibited Ca 2+ waves in isolated RUICC, recorded using a Nipkow spinning disk confocal microscope. L-cis-Diltiazem (50µM) did not affect caffeine (10mM)-induced Ca 2+ transients, but significantly reduced phenylephrine-evoked Ca 2+ oscillations and inward currents in in RUICC. L-type Ca 2+ current amplitude in isolated SMC was reduced by ~18% in the presence of L-cis-Diltiazem (50µM), however D-cis-Diltiazem, a recognised L-type Ca 2+ channel blocker, abolished L-type Ca 2+ current but did not affect Ca 2+ waves or STICs in RUICC. These results indicate that the effects of L-cis-diltiazem on rabbit USM could be mediated by inhibition of CNG1 channels that are present in urethral ICC and therefore CNG channels contribute to spontaneous activity in these cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

    Science.gov (United States)

    Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

    1998-01-01

    The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

  2. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  3. Characterization of the transcriptome, nucleotide sequence polymorphism, and natural selection in the desert adapted mouse Peromyscus eremicus

    Directory of Open Access Journals (Sweden)

    Matthew D. MacManes

    2014-10-01

    Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.

  4. Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.

    Science.gov (United States)

    Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

    2013-04-01

    A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

  5. First isolate of KPC-2-producing Klebsiella pneumonaie sequence type 23 from the Americas.

    Science.gov (United States)

    Cejas, Daniela; Fernández Canigia, Liliana; Rincón Cruz, Giovanna; Elena, Alan X; Maldonado, Ivana; Gutkind, Gabriel O; Radice, Marcela A

    2014-09-01

    KPC-2-producing Klebsiella pneumoniae isolates mainly correspond to clonal complex 258 (CC258); however, we describe KPC-2-producing K. pneumoniae isolates belonging to invasive sequence type 23 (ST23). KPC-2 has scarcely been reported to occur in ST23, and this report describes the first isolation of this pathogen in the Americas. Acquisition of resistant markers in virulent clones could mark an evolutionary step toward the establishment of these clones as major nosocomial pathogens. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. Sequence typing of human adenoviruses isolated from Polish patients subjected to allogeneic hematopoietic stem cell transplantation - a single center experience.

    Science.gov (United States)

    Przybylski, Maciej; Rynans, Sylwia; Waszczuk-Gajda, Anna; Bilinski, Jarosław; Basak, Grzegorz W; Jędrzejczak, Wiesław W; Wróblewska, Marta; Młynarczyk, Grażyna; Dzieciątkowski, Tomasz

    2018-03-28

    Human adenoviruses (HAdV) from species A, B and C are commonly recognized as pathogens causing severe morbidity and mortality in hematopoietic stem cell transplant (HSCT) recipients. The purpose of the present study was to determine HAdV types responsible for viremia in HSCT recipients at a large tertiary hospital in Poland. Analysis of partial nucleotide sequences of HAdV hexon gene was used to type 40 clinical isolates of HAdV obtained from 40 HSCT recipients. We identified six different HAdV serotypes belonging to species B, C and E. We demonstrated high variability in sequences of detected HAdV types, and patients infected with the same HAdV types were not hospitalized at the same time, which suggests the low possibility of cross-infection. In almost all patients, anti-HAdV antibodies in IgG class were detected, which indicates a history of HAdV infection in the past. Clinical symptoms accompanying HAdV viremia were in 89%, and in 61.5% of individuals, HAdV was a sole pathogen detected. There were no cases with high-level HAdV viremia and severe systemic or organ infections. Graft-versus-host disease (GvHD) was present in patients infected with species B and C, but grade II of GvHD was observed only in patients infected with HAdV-B. The predominance of HAdV-C and common presence of anti-HAdV antibodies in IgG class may strongly suggest that most infections in the present study were reactivations of HAdV persisting into the patient's mucosa-associated lymphoid tissues. Variability of HAdV sequences suggests that cross-infections between patients were very rare. GvHD: graft-versus-host disease; HAdV: human adenoviruses; HSCT: hematopoietic stem cell transplantation.

  7. Detection and copy number estimation of the transgenic nucleotide sequences in an unknown GM event of Oryza sativa

    Directory of Open Access Journals (Sweden)

    Ali M. Sajjad

    2016-12-01

    Full Text Available The present study was designed to establish a qualitative detection method based on conventional and real time PCR assay to screen the commonly grown rice varieties for the presence of the cry1Ac gene. The detection of genetically modified rice in the screening process would necessitate accurate assay development and precise qualitative PCR tests complying with established procedures for the detection and characterization of transgenes in food grains. Such assay would not only enable the monitoring of transgene flow in local agricultural environment but also the characterization of different plant species produced with this transgene and its regulatory components. Thus, a reliable and quick screening assay was established for the qualitative detection of the transgene along with the promoter and selectable marker gene in genetically modified rice. By conventional PCR, a fragment of 215 bp was amplified with gene specific primers of cry1Ac. Primers for other transgenes such as gna and bar were also employed; however, no amplification was detected. The presence of the p35s, sps, and nptII genes was confirmed by qualitative real-time PCR. The specificity of the respective PCR products was checked through melt peak curve analysis. Sharp and precise melting temperatures indicated the presence of a single kind of PCR product in correspondence to each of the primers used. Moreover, the copy number of cry1Ac was estimated by ∆∆CT method. It is proposed that the primer sets and experimental conditions used in this study will be sufficient to meet the requirements for molecular detection and characterization of the cry1Ac transgene and affiliated sequences in sorting out conventional rice varieties from the ones which are genetically modified. It will also help to monitor the ecological flow of these transgenes and other biosafety factors.

  8. Genetic Characterization of Fasciola Isolates from West Azerbaijan Province Iran Based on ITS1 and ITS2 Sequence of Ribosomal DNA

    Science.gov (United States)

    GALAVANI, Hossein; GHOLIZADEH, Saber; HAZRATI TAPPEH, Khosrow

    2016-01-01

    Background: Fascioliasis, caused by Fasciola hepatica and F. gigantica, has medical and economic importance in the world. Molecular approaches comparing traditional methods using for identification and characterization of Fasciola spp. are precise and reliable. The aims of current study were molecular characterization of Fasciola spp. in West Azerbaijan Province, Iran and then comparative analysis of them using GenBank sequences. Methods: A total number of 580 isolates were collected from different hosts in five cities of West Azerbaijan Province, in 2014 from 90 slaughtered cattle (n=50) and sheep (n=40). After morphological identification and DNA extraction, designing specific primer were used to amplification of ITS1, 5.8s and ITS2 regions, 50 samples were conducted to sequence, randomly. Result: Using morphometric characters 99.14% and 0.86% of isolates identified as F. hepatica and F. gigantica, respectively. PCR amplification of 1081 bp fragment and sequencing result showed 100% similarity with F. hepatica in ITS1 (428 bp), 5.8s (158 bp), and ITS2 (366 bp) regions. Sequence comparison among current study sequences and GenBank data showed 98% identity with 11 nucleotide mismatches. However, in phylogenetic tree F. hepatica sequences of West Azerbaijan Province, Iran, were in a close relationship with Iranian, Asian, and African isolates. Conclusions: Only F. hepatica species is distributed among sheep and cattle in West Azerbaijan Province Iran. However, 5 and 6 bp variation in ITS1 and ITS2 regions, respectively, is not enough to separate of Fasciola spp. Therefore, more studies are essential for designing new molecular markers to correct species identification. PMID:27095969

  9. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  10. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    Science.gov (United States)

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. The preparation of nucleotides uniformly labelled with carbon-14 by biosynthetic methods. Isolation of adenylic, uridylic, cytidylic,and guanylic acids, from the alkaline hydrolysate of escherichia coli RNA

    International Nuclear Information System (INIS)

    Garcia Pineda, M. D.; Pacheco Lopez, J.

    1978-01-01

    A method is described for the preparation and analysis of adenylic, uri dilic, cytidi- 11c and guanylic acids, labelled with 14 C . Escherichia coli cells have been labelled by growing them in a medi dia containing glucose-14 C as their only source of carbon. RNA is isolated from the cells, and after hydrolysis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the Isolated nucleotides is determined, and also its specific radioactivity. (Author) 30 refs

  12. Complete Genome Sequence of Biocontroller Bacillus velezensis Strain JTYP2, Isolated from Leaves of Echeveria laui.

    Science.gov (United States)

    Wang, Beibei; Liu, Hu; Ma, Hailin; Wang, Chengqiang; Liu, Kai; Li, Yuhuan; Hou, Qihui; Ge, Ruofei; Zhang, Tongrui; Liu, Fangchun; Ma, Jinjin; Wang, Yun; Wang, Haide; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

    2017-06-15

    Bacillus velezensis JTYP2 was isolated from the leaves of Echeveria laui in Qingzhou, China, and may control some of the fungal pathogens of the plant. Here, we present the complete genome sequence of B. velezensis JTYP2. Several gene clusters related to its biosynthesis of antimicrobial compounds were predicted. Copyright © 2017 Wang et al.

  13. Genome Sequence of Gluconacetobacter sp. Strain SXCC-1, Isolated from Chinese Vinegar Fermentation Starter▿

    OpenAIRE

    Du, Xin-jun; Jia, Shi-ru; Yang, Yue; Wang, Shuo

    2011-01-01

    Gluconacetobacter strains are prominent bacteria during traditional vinegar fermentation. Here, we report a draft genome sequence of Gluconacetobacter sp. strain SXCC-1. This strain was isolated from a fermentation starter (Daqu) used for commercial production of Shanxi vinegar, the best-known vinegar of China.

  14. Draft Genome Sequence of Lactobacillus plantarum XJ25 Isolated from Chinese Red Wine.

    Science.gov (United States)

    Zhao, Meijing; Liu, Shuwen; He, Ling; Tian, Yu

    2016-11-17

    Here, we present the draft genome sequence of Lactobacillus plantarum XJ25, isolated from Chinese red wine that had undergone spontaneous malolactic fermentation, which consists of 25 contigs and is 3,218,018 bp long. Copyright © 2016 Zhao et al.

  15. Draft Genome Sequence of Methylocella silvestris TVC, a Facultative Methanotroph Isolated from Permafrost

    OpenAIRE

    Wang, Jing; Geng, Kan; Farhan Ul Haque, Muhammad; Crombie, Andrew; Street, Lorna E.; Wookey, Philip A.; Ma, Ke; Murrell, J. Colin; Pratscher, Jennifer

    2018-01-01

    Permafrost environments play a crucial role in global carbon and methane cycling. We report here the draft genome sequence of Methylocella silvestris TVC, a new facultative methanotroph strain, isolated from the Siksik Creek catchment in the continuous permafrost zone of Inuvik (Northwest Territories, Canada).

  16. Draft Genome Sequence of Methylocella silvestris TVC, a Facultative Methanotroph Isolated from Permafrost.

    Science.gov (United States)

    Wang, Jing; Geng, Kan; Farhan Ul Haque, Muhammad; Crombie, Andrew; Street, Lorna E; Wookey, Philip A; Ma, Ke; Murrell, J Colin; Pratscher, Jennifer

    2018-02-22

    Permafrost environments play a crucial role in global carbon and methane cycling. We report here the draft genome sequence of Methylocella silvestris TVC, a new facultative methanotroph strain, isolated from the Siksik Creek catchment in the continuous permafrost zone of Inuvik (Northwest Territories, Canada). Copyright © 2018 Wang et al.

  17. Full-Genome Sequence of a Novel Varicella-Zoster Virus Clade Isolated in Mexico.

    Science.gov (United States)

    Garcés-Ayala, Fabiola; Rodríguez-Castillo, Araceli; Ortiz-Alcántara, Joanna María; Gonzalez-Durán, Elizabeth; Segura-Candelas, José Miguel; Pérez-Agüeros, Sandra Ivette; Escobar-Escamilla, Noé; Méndez-Tenorio, Alfonso; Diaz-Quiñonez, José Alberto; Ramirez-González, José Ernesto

    2015-07-09

    Varicella-zoster virus (VZV) is a member of the Herpesviridae family, which causes varicella (chicken pox) and herpes zoster (shingles) in humans. Here, we report the complete genome sequence of varicella-zoster virus, isolated from a vesicular fluid sample, revealing the circulation of VZV clade VIII in Mexico. Copyright © 2015 Garcés-Ayala et al.

  18. Full-Genome Sequence of a Novel Varicella-Zoster Virus Clade Isolated in Mexico

    OpenAIRE

    Garc?s-Ayala, Fabiola; Rodr?guez-Castillo, Araceli; Ortiz-Alc?ntara, Joanna Mar?a; Gonzalez-Dur?n, Elizabeth; Segura-Candelas, Jos? Miguel; P?rez-Ag?eros, Sandra Ivette; Escobar-Escamilla, No?; M?ndez-Tenorio, Alfonso; Diaz-Qui?onez, Jos? Alberto; Ramirez-Gonz?lez, Jos? Ernesto

    2015-01-01

    Varicella-zoster virus (VZV) is a member of the Herpesviridae family, which causes varicella (chicken pox) and herpes zoster (shingles) in humans. Here, we report the complete genome sequence of varicella-zoster virus, isolated from a vesicular fluid sample, revealing the circulation of VZV clade VIII in Mexico.

  19. Full-Genome Sequence of a Novel Varicella-Zoster Virus Clade Isolated in Mexico

    Science.gov (United States)

    Rodríguez-Castillo, Araceli; Ortiz-Alcántara, Joanna María; Gonzalez-Durán, Elizabeth; Segura-Candelas, José Miguel; Pérez-Agüeros, Sandra Ivette; Escobar-Escamilla, Noé; Méndez-Tenorio, Alfonso; Diaz-Quiñonez, José Alberto

    2015-01-01

    Varicella-zoster virus (VZV) is a member of the Herpesviridae family, which causes varicella (chicken pox) and herpes zoster (shingles) in humans. Here, we report the complete genome sequence of varicella-zoster virus, isolated from a vesicular fluid sample, revealing the circulation of VZV clade VIII in Mexico. PMID:26159533

  20. Characterization of sequence diversity in Plasmodium falciparum SERA5 from Indian isolates

    Directory of Open Access Journals (Sweden)

    Rahul C.N

    2015-06-01

    Full Text Available Objective: To characterize the sequence diversity of blood-stage Plasmodium falciparum serine repeat antigen-5 (PfSERA5 which is lacking in a malaria-endemic country like India. Methods: In this study, parasitic DNA was obtained from field isolates collected from various geographic regions. Subsequently, PfSERA5 gene sequence was PCR amplified and DNA sequenced. Results: We reported the existence of unique repeat polymorphisms and novel haplotypes for both the octamer repeat (OR and serine repeat (SR regions of the N-terminal fragment of PfSERA5 from Indian isolates. Several isolates from India were identical to low-frequency African haplotypes. Unique finding of our study was an Indian isolate showing deletion in a perfectly conserved 14 mer sequence within octamer repeat. Indian haplotypes reported in this study were found to be distributed into the three earlier classified allelic clusters of FCR3, K1 and Honduras showcasing broad diversity as compared to worldwide haplotypes. Conclusions: This study is the first report on genetic diversity of PfSERA5 antigen from India. Further evaluation of these haplotypes by serotyping would provide useful information for investigating variant-specific immunity and aid in malaria vaccine research.

  1. Draft Genome Sequence of Lactobacillus paracasei DmW181, a Bacterium Isolated from Wild Drosophila

    OpenAIRE

    Hammer, Austin J.; Walters, Amber; Carroll, Courtney; Newell, Peter D.; Chaston, John M.

    2017-01-01

    ABSTRACT The draft genome sequence of Lactobacillus paracasei DmW181, an anaerobic bacterium isolate from wild Drosophila flies, is reported here. Strain DmW181 possesses genes for sialic acid and mannose metabolism. The assembled genome is 3,201,429?bp, with 3,454 predicted genes.

  2. Draft Genome Sequence of Lactobacillus paracasei DmW181, a Bacterium Isolated from Wild Drosophila.

    Science.gov (United States)

    Hammer, Austin J; Walters, Amber; Carroll, Courtney; Newell, Peter D; Chaston, John M

    2017-07-06

    The draft genome sequence of Lactobacillus paracasei DmW181, an anaerobic bacterium isolate from wild Drosophila flies, is reported here. Strain DmW181 possesses genes for sialic acid and mannose metabolism. The assembled genome is 3,201,429 bp, with 3,454 predicted genes. Copyright © 2017 Hammer et al.

  3. Draft Genome Sequence of an Isolate of Colletotrichum fructicola, a Causal Agent of Mango Anthracnose.

    Science.gov (United States)

    Li, Qili; Bu, Junyan; Yu, Zhihe; Tang, Lihua; Huang, Suiping; Guo, Tangxun; Mo, Jianyou; Hsiang, Tom

    2018-02-22

    Here, we present a draft genome sequence of isolate 15060 of Colletotrichum fructicola , a causal agent of mango anthracnose. The final assembly consists of 1,048 scaffolds totaling 56,493,063 bp (G+C content, 53.38%) and 15,180 predicted genes. Copyright © 2018 Li et al.

  4. Complete Genome Sequence of an Atypical Dengue Virus Serotype 2 Lineage Isolated in Brazil

    Science.gov (United States)

    Salvador, Felipe Scassi; Amorim, Jaime Henrique; Alves, Rubens Prince Santos; Pereira, Sara A.; Ferreira, Luis Carlos Souza

    2015-01-01

    Here, we report the complete polyprotein sequence of a dengue virus 2 strain isolated in Brazil. This virus belongs to the American genotype and has the ability to cause neurovirulence in immunocompetent adult mice. The data presented here may help understand the genetic determinants responsible for neurovirulence. PMID:26184939

  5. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm

    OpenAIRE

    Morohoshi, Tomohiro; Ikeda, Tsukasa

    2016-01-01

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640?bp and five plasmids of 64,864?bp, 59,879?bp, 42,569?bp, 41,417?bp, and 29,506?bp.

  6. Genome sequence of the pathogenic Herbaspirillum seropedicae strain Os34, isolated from rice roots.

    Science.gov (United States)

    Ye, Weijun; Ye, Shuting; Liu, Jian; Chang, Siping; Chen, Mingyue; Zhu, Bo; Guo, Longbiao; An, Qianli

    2012-12-01

    Most Herbaspirillum seropedicae strains are beneficial endophytes to plants. In contrast, H. seropedicae strain Os34, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os34 presented here allows in-depth comparative genome analyses to understand the specific mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions.

  7. Genome sequence of the pathogenic Herbaspirillum seropedicae strain Os45, isolated from rice roots.

    Science.gov (United States)

    Zhu, Bo; Ye, Shuting; Chang, Siping; Chen, Mingyue; Sun, Li; An, Qianli

    2012-12-01

    Most Herbaspirillum seropedicae strains are beneficial to plants. In contrast, H. seropedicae strain Os45, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os45 presented here allows an in-depth comparative genome analysis to understand the subtle mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions.

  8. Complete Genome Sequence of the Facultative Methylotroph Methylobacterium extorquens TK 0001 Isolated from Soil in Poland.

    Science.gov (United States)

    Belkhelfa, Sophia; Labadie, Karine; Cruaud, Corinne; Aury, Jean-Marc; Roche, David; Bouzon, Madeleine; Salanoubat, Marcel; Döring, Volker

    2018-02-22

    Methylobacterium extorquens TK 0001 (DSM 1337, ATCC 43645) is an aerobic pink-pigmented facultative methylotrophic alphaproteobacterium isolated from soil in Poland. Here, we report the whole-genome sequence and annotation of this organism, which consists of a single 5.71-Mb chromosome. Copyright © 2018 Belkhelfa et al.

  9. Draft Genome Sequence of Staphylococcus carnosus subsp. utilis LTH 7013, Isolated from South Tyrolean Ham.

    Science.gov (United States)

    Müller, Anne; Huptas, Christopher; Wenning, Mareike; Schmidt, Herbert; Weiss, Agnes

    2015-05-14

    Staphylococcus carnosus is used as a starter culture in meat fermentation, where it contributes to color formation and produces aromatic compounds. Here, we report the first draft genome sequence of an S. carnosus subsp. utilis strain, LTH 7013, isolated from South Tyrolean ham, with potential application as a starter culture. Copyright © 2015 Müller et al.

  10. Draft Genome Sequence of Staphylococcus carnosus subsp. utilis LTH 7013, Isolated from South Tyrolean Ham

    OpenAIRE

    M?ller, Anne; Huptas, Christopher; Wenning, Mareike; Schmidt, Herbert; Weiss, Agnes

    2015-01-01

    Staphylococcus carnosus is used as a starter culture in meat fermentation, where it contributes to color formation and produces aromatic compounds. Here, we report the first draft genome sequence of an S.?carnosus subsp. utilis strain, LTH 7013, isolated from South Tyrolean ham, with potential application as a starter culture.

  11. Complete Genome Sequence of the Yogurt Isolate Lactobacillus delbrueckii subsp. bulgaricus ACA-DC 87.

    Science.gov (United States)

    Alexandraki, Voula; Kazou, Maria; Pot, Bruno; Tsakalidou, Effie; Papadimitriou, Konstantinos

    2017-08-24

    Lactobacillus delbrueckii subsp. bulgaricus is widely used in the production of yogurt and cheese. In this study, we present the complete genome sequence of L. delbrueckii subsp. bulgaricus ACA-DC 87 isolated from traditional Greek yogurt. Whole-genome analysis may reveal desirable technological traits of the strain for dairy fermentations. Copyright © 2017 Alexandraki et al.

  12. Complete Genome Sequence of Porcine Parvovirus N Strain Isolated from Guangxi, China

    OpenAIRE

    Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

    2015-01-01

    We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety.

  13. Draft Genome Sequences of 64 Salmonella enterica subsp. enterica Enteritidis Isolates from Mice in US

    Science.gov (United States)

    A ciprofloxacin resistant (CipR) Salmonella enterica subsp. enterica serovar Kentucky ST198 has rapidly and extensively disseminated globally to become a major food-safety and public health concern. Here, we report a complete genome sequence of a CipR S. Kentucky ST198 strain PU131 isolated from a ...

  14. Genome sequences of two Leuconostoc pseudomesenteroides strains isolated from Danish dairy starter cultures

    DEFF Research Database (Denmark)

    Pedersen, Thomas Bæk; Kot, Witold Piotr; Hansen, L.H.

    2014-01-01

    The lactic acid bacterium Leuconostoc pseudomesenteroides can be found in mesophilic cheese starters, where it produces aromatic compounds from, e.g., citrate. Here, we present the draft genome sequences of two L. pseudomesenteroides strains isolated from traditional Danish cheese starters....

  15. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  16. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  17. The Comparison of Streptococcus agalactiae Isolated from Fish and Bovine using Multilocus Sequence Typing

    Directory of Open Access Journals (Sweden)

    ANGELA MARIANA LUSIASTUTI

    2013-12-01

    Full Text Available Multilocus sequence typing (MLST has greater utility for determining the recent ancestral lineage and the relatedness of individual strains. Group B streptococci (GBS is one of the major causes of subclinical mastitis of dairy cattle in several countries. GBS also sporadically causes epizootic infections in fish. The aim of this study was to compare the evolutionary lineage of fish and bovine isolates in relation to the S. agalactiae global population as a whole by comparing the MLST profiles. Twenty S. agalactiae isolates were obtained from dairy cattle and fish. PCR products were amplified with seven different oligonucleotide primer pairs designed from the NEM316 GBS genome sequence. Clone complexes demonstrated that bovine and fish isolates were separate populations. These findings lead us to conclude that fish S. agalactiae is not a zoonotic agent for bovine. MLST could help clarify the emergence of pathogenic clones and to decide whether the host acts as a reservoir for another pathogenic lineage.

  18. Population structure of Lactobacillus helveticus isolates from naturally fermented dairy products based on multilocus sequence typing.

    Science.gov (United States)

    Sun, Zhihong; Liu, Wenjun; Song, Yuqin; Xu, Haiyan; Yu, Jie; Bilige, Menghe; Zhang, Heping; Chen, Yongfu

    2015-05-01

    Lactobacillus helveticus is an economically important lactic acid bacterium used in industrial dairy fermentation. In the present study, the population structure of 245 isolates of L. helveticus from different naturally fermented dairy products in China and Mongolia were investigated using an multilocus sequence typing scheme with 11 housekeeping genes. A total of 108 sequence types were detected, which formed 8 clonal complexes and 27 singletons. Results from Structure, SplitsTree, and ClonalFrame software analyses demonstrated the presence of 3 subpopulations in the L. helveticus isolates used in our study, namely koumiss, kurut-tarag, and panmictic lineages. Most L. helveticus isolates from particular ecological origins had specific population structures. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Complete genome sequencing and phylogenetic analysis of dengue type 1 virus isolated from Jeddah, Saudi Arabia.

    Science.gov (United States)

    Azhar, Esam I; Hashem, Anwar M; El-Kafrawy, Sherif A; Abol-Ela, Said; Abd-Alla, Adly M M; Sohrab, Sayed Sartaj; Farraj, Suha A; Othman, Norah A; Ben-Helaby, Huda G; Ashshi, Ahmed; Madani, Tariq A; Jamjoom, Ghazi

    2015-01-16

    Dengue viruses (DENVs) are mosquito-borne viruses which can cause disease ranging from mild fever to severe dengue infection. These viruses are endemic in several tropical and subtropical regions. Multiple outbreaks of DENV serotypes 1, 2 and 3 (DENV-1, DENV-2 and DENV-3) have been reported from the western region in Saudi Arabia since 1994. Strains from at least two genotypes of DENV-1 (Asia and America/Africa genotypes) have been circulating in western Saudi Arabia until 2006. However, all previous studies reported from Saudi Arabia were based on partial sequencing data of the envelope (E) gene without any reports of full genome sequences for any DENV serotypes circulating in Saudi Arabia. Here, we report the isolation and the first complete genome sequence of a DENV-1 strain (DENV-1-Jeddah-1-2011) isolated from a patient from Jeddah, Saudi Arabia in 2011. Whole genome sequence alignment and phylogenetic analysis showed high similarity between DENV-1-Jeddah-1-2011 strain and D1/H/IMTSSA/98/606 isolate (Asian genotype) reported from Djibouti in 1998. Further analysis of the full envelope gene revealed a close relationship between DENV-1-Jeddah-1-2011 strain and isolates reported between 2004-2006 from Jeddah as well as recent isolates from Somalia, suggesting the widespread of the Asian genotype in this region. These data suggest that strains belonging to the Asian genotype might have been introduced into Saudi Arabia long before 2004 most probably by African pilgrims and continued to circulate in western Saudi Arabia at least until 2011. Most importantly, these results indicate that pilgrims from dengue endemic regions can play an important role in the spread of new DENVs in Saudi Arabia and the rest of the world. Therefore, availability of complete genome sequences would serve as a reference for future epidemiological studies of DENV-1 viruses.

  20. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii) from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing.

    Science.gov (United States)

    Jaradat, Ziad W; Ababneh, Qotaiba O; Saadoun, Ismail M; Samara, Nawal A; Rashdan, Abrar M

    2009-10-27

    Cronobacter spp. (formerly Enterobacter sakazakii), are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%). The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (alpha-MUG, DFI and EsPM) and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences), 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable method for confirmation of the identity of the isolates

  1. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing

    Directory of Open Access Journals (Sweden)

    Samara Nawal A

    2009-10-01

    Full Text Available Abstract Background Cronobacter spp. (formerly Enterobacter sakazakii, are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%. The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (α-MUG, DFI and EsPM and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences, 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Conclusion Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable

  2. The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

    Science.gov (United States)

    Nallaseth, Ferez Soli

    The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

  3. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  4. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  5. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  6. Isolation and Whole-genome Sequence Analysis of the Imipenem Heteroresistant Acinetobacter baumannii Clinical Isolate HRAB-85.

    Science.gov (United States)

    Li, Puyuan; Huang, Yong; Yu, Lan; Liu, Yannan; Niu, Wenkai; Zou, Dayang; Liu, Huiying; Zheng, Jing; Yin, Xiuyun; Yuan, Jing; Yuan, Xin; Bai, Changqing

    2017-09-01

    Heteroresistance is a phenomenon in which there are various responses to antibiotics from bacterial cells within the same population. Here, we isolated and characterised an imipenem heteroresistant Acinetobacter baumannii strain (HRAB-85). The genome of strain HRAB-85 was completely sequenced and analysed to understand its antibiotic resistance mechanisms. Population analysis and multilocus sequence typing were performed. Subpopulations grew in the presence of imipenem at concentrations of up to 64μg/mL, and the strain was found to belong to ST208. The total length of strain HRAB-85 was 4,098,585bp with a GC content of 39.98%. The genome harboured at least four insertion sequences: the common ISAba1, ISAba22, ISAba24, and newly reported ISAba26. Additionally, 19 antibiotic-resistance genes against eight classes of antimicrobial agents were found, and 11 genomic islands (GIs) were identified. Among them, GI3, GI10, and GI11 contained many ISs and antibiotic-resistance determinants. The existence of imipenem heteroresistant phenotypes in A. baumannii was substantiated in this hospital, and imipenem pressure, which could induce imipenem-heteroresistant subpopulations, may select for highly resistant strains. The complete genome sequencing and bioinformatics analysis of HRAB-85 could improve our understanding of the epidemiology and resistance mechanisms of carbapenem-heteroresistant A. baumannii. Copyright © 2017. Published by Elsevier Ltd.

  7. Genomic sequence, organization and characteristics of a new nucleopolyhedrovirus isolated from Clanis bilineata larva

    Directory of Open Access Journals (Sweden)

    Wang Yong

    2009-02-01

    Full Text Available Abstract Background Baculoviruses are well known for their potential as biological agents for controlling agricultural and forest pests. They are also widely used as expression vectors in molecular cloning studies. The genome sequences of 48 baculoviruses are currently available in NCBI databases. As the number of sequenced viral genomes increases, it is important for the authors to present sufficiently detailed analyses and annotations to advance understanding of them. In this study, the complete genome of Clanis bilineata nucleopolyhedrovirus (ClbiNPV has been sequenced and analyzed in order to understand this virus better. Results The genome of ClbiNPV contains 135,454 base pairs (bp with a G+C content of 37%, and 139 putative open reading frames (ORFs of at least 150 nucleotides. One hundred and twenty-six of these ORFs have homologues with other baculovirus genes while the other 13 are unique to ClbiNPV. The 30 baculovirus core genes are all present in ClbiNPV. Phylogenetic analysis based on the combined pif-2 and lef-8 sequences places ClbiNPV in the Group II Alphabaculoviruses. This result is consistent with the absence of gp64 from the ClbiNPV genome and the presence instead of a fusion protein gene, characteristic of Group II. Blast searches revealed that ClbiNPV encodes a photolyase-like gene sequence, which has a 1-bp deletion when compared with photolyases of other baculoviruses. This deletion disrupts the sequence into two small photolyase ORFs, designated Clbiphr-1 and Clbiphr-2, which correspond to the CPD-DNA photolyase and FAD-binding domains of photolyases, respectively. Conclusion ClbiNPV belongs to the Group II Alphabaculoviruses and is most closely related to OrleNPV, LdMNPV, TnSNPV, EcobNPV and ChchNPV. It contains a variant DNA photolyase gene, which only exists in ChchNPV, TnSNPV and SpltGV among the baculoviruses.

  8. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  9. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  10. Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA

    2015-10-24

    Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic diversity

  11. Supplementary Material for: Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA

    2015-01-01

    Abstract Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic

  12. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  13. The soybean-Phytophthora resistance locus Rps1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Madan K

    2008-03-01

    Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a

  14. Sequence Analysis and Phylogenetic Profiling of the Nonstructural (NS Genes of H9N2 Influenza A Viruses Isolated in Iran during 1998-2007

    Directory of Open Access Journals (Sweden)

    Ebrahimi, M.

    2014-11-01

    Full Text Available The earliest evidences on circulation of Avian Influenza (AI virus on the Iranian poultry farms date back to 1998. Great economic losses through dramatic drop in egg production and high mortality rates are characteristically attributed to H9N2 AI virus. In the present work non-structural (NS genes of 10 Iranian H9N2 chicken AI viruses collected during 1998-2007 were fully sequenced and subjected to a phylogenetic analysis. The observations proved allele A was the single-detectable type of the NS gene within the studied isolates. All the examined Iranian isolates fell into the Korean sublineage with a relatively broad sequence homology (91.6-98% in nucleotide construction of the NS genes. The motif for PDZ ligand recognition of the group one isolates was either EDEV (N=6 or ESEV (N=1 While all viruses as group two contained a PL motif “KSEV” (N=3. The present work provides useful epidemiological data at molecular level on source and contemporary evolution of H9N2 virus population in Iran.

  15. Isolation and whole-genome sequencing of a Crimean-Congo hemorrhagic fever virus strain, Greece.

    Science.gov (United States)

    Papa, Anna; Papadopoulou, Elpida; Tsioka, Katerina; Kontana, Anastasia; Pappa, Styliani; Melidou, Ageliki; Giadinis, Nektarios D

    2018-03-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) was isolated from a pool of two adult Rhipicephalus bursa ticks removed from a goat in 2015 in Greece. The strain clusters into lineage Europe 2 representing the second available whole-genome sequenced isolate of this lineage. CCHFV IgG antibodies were detected in 8 of 19 goats of the farm. Currently CCHFV is not associated with disease in mammals other than humans. Studies in animal models are needed to investigate the pathogenicity level of lineage Europe 2 and compare it with that of other lineages. Copyright © 2018 Elsevier GmbH. All rights reserved.

  16. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    OpenAIRE

    W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

    2017-01-01

    The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

  17. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    Directory of Open Access Journals (Sweden)

    Corti Stefania

    2011-03-01

    Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

  18. Expression of Sme efflux pumps and multilocus sequence typing in clinical isolates of Stenotrophomonas maltophilia.

    Science.gov (United States)

    Cho, Hye Hyun; Sung, Ji Youn; Kwon, Kye Chul; Koo, Sun Hoe

    2012-01-01

    Stenotrophomonas maltophilia has emerged as an important opportunistic pathogen, which causes infections that are often difficult to manage because of the inherent resistance of the pathogen to a variety of antimicrobial agents. In this study, we analyzed the expressions of smeABC and smeDEF and their correlation with antimicrobial susceptibility. We also evaluated the genetic relatedness and epidemiological links among 33 isolates of S. maltophilia. In total, 33 S. maltophilia strains were isolated from patients in a tertiary hospital in Daejeon. Minimum inhibitory concentrations (MICs) of 11 antimicrobial agents were determined by using agar dilution method and E-test (BioMérieux, France). Real-time PCR analysis was performed to evaluate the expression of the Sme efflux systems in the S. maltophilia isolates. Additionally, an epidemiological investigation was performed using multilocus sequence typing (MLST) assays. The findings of susceptibility testing showed that the majority of the S. maltophilia isolates were resistant to β-lactams and aminoglycosides. Twenty-one clinical isolates overexpressed smeABC and showed high resistance to ciprofloxacin. Moreover, a high degree of genetic diversity was observed among the S. maltophilia isolates; 3 sequence types (STs) and 23 allelic profiles were observed. The smeABC efflux pump was associated with multidrug resistance in clinical isolates of S. maltophilia. In particular, smeABC efflux pumps appear to perform an important role in ciprofloxacin resistance of S. maltophilia. The MLST scheme for S. maltophilia represents a discriminatory typing method with stable markers and is appropriate for studying population structures.

  19. Whole genome sequencing of Mycobacterium tuberculosis SB24 isolated from Sabah, Malaysia

    Directory of Open Access Journals (Sweden)

    Noraini Philip

    2016-09-01

    Full Text Available Mycobacterium tuberculosis (M. tuberculosis is the causative agent of tuberculosis (TB that causes millions of death every year. We have sequenced the genome of M. tuberculosis isolated from cerebrospinal fluid (CSF of a patient diagnosed with tuberculous meningitis (TBM. The isolated strain was referred as M. tuberculosis SB24. Genomic DNA of the M. tuberculosis SB24 was extracted and subjected to whole genome sequencing using PacBio platform. The draft genome size of M. tuberculosis SB24 was determined to be 4,452,489 bp with a G + C content of 65.6%. The whole genome shotgun project has been deposited in NCBI SRA under the accession number SRP076503.

  20. Complete Genome Sequence of an Avian Metapneumovirus Subtype A Strain Isolated from Chicken (Gallus gallus) in Brazil.

    Science.gov (United States)

    Rizotto, Laís S; Scagion, Guilherme P; Cardoso, Tereza C; Simão, Raphael M; Caserta, Leonardo C; Benassi, Julia C; Keid, Lara B; Oliveira, Trícia M F de S; Soares, Rodrigo M; Arns, Clarice W; Van Borm, Steven; Ferreira, Helena L

    2017-07-20

    We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A. Copyright © 2017 Rizotto et al.

  1. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  2. Genome Sequence of Lactobacillus salivarius NIAS840, Isolated from Chicken Intestine

    Science.gov (United States)

    Ham, Jun-Sang; Kim, Hyoun-Wook; Seol, Kuk-Hwan; Jang, Aera; Jeong, Seok-Geun; Oh, Mi-Hwa; Kim, Dong-Hun; Kang, Dae-Kyung; Kim, Geun-Bae; Cha, Chang-Jun

    2011-01-01

    Lactobacillus salivarius is a well-known lactic acid bacterium to which increasing attention has been paid recently for use as probiotics for humans and animals. L. salivarius NIAS840 was first isolated from broiler chicken feces, displaying antimicrobial activities against multidrug-resistant Staphylococcus aureus and Salmonella enterica serovar Typhimurium. Here, we report the genome sequence of L. salivarius NIAS840 (2,046,557 bp) including a small plasmid and two megaplasmids. PMID:21914873

  3. Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton.

    Science.gov (United States)

    Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping

    2016-07-20

    Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Whole-Genome Sequences of 94 Environmental Isolates of Bacillus cereus Sensu Lato

    Science.gov (United States)

    Feldgarden, Michael; Kolter, Roberto; Mahillon, Jacques

    2013-01-01

    Bacillus cereus sensu lato is a species complex that includes the anthrax pathogen Bacillus anthracis and other bacterial species of medical, industrial, and ecological importance. Their phenotypes of interest are typically linked to large plasmids that are closely related to the anthrax plasmids pXO1 and pXO2. Here, we present the draft genome sequences of 94 isolates of B. cereus sensu lato, which were chosen for their plasmid content and environmental origins. PMID:24092776

  5. Draft genome sequence of Bizionia argentinensis, isolated from antarctic surface water

    OpenAIRE

    Lanzarotti, E.; Pellizza, L.; Bercovich, A.; Foti, M.; Coria, S.H.; Vazquez, S.C.; Ruberto, L.; Hernández, E.A.; Dias, R.L.; Mac Cormack, W.P.; Cicero, D.O.; Smal, C.; Nicolas, M.F.; Vasconcelos, A.T.R.; Marti, M.A.

    2011-01-01

    A psychrotolerant marine bacterial strain, designated JUB59 T, was isolated from Antarctic surface seawater and classified as a new species of the genus Bizionia. Here, we present the first draft genome sequence for this genus, which suggests interesting features such as UV resistance, hydrolytic exoenzymes, and nitrogen metabolism. © 2011, American Society for Microbiology. Fil:Pellizza, L. Universidad de Buenos Aires. Facultad de Ciencias Exactas y Naturales; Argentina. Fil:Mac Cormac...

  6. Complete Genome Sequence of a Newcastle Disease Virus Isolated from Wild Peacock (Pavo cristatus) in India.

    Science.gov (United States)

    Khulape, Sagar A; Gaikwad, Satish S; Chellappa, Madhan Mohan; Mishra, Bishnu Prasad; Dey, Sohini

    2014-06-05

    We report here the complete genome sequence of a Newcastle disease virus (NDV) isolated from a wild peacock. Phylogenetic analysis showed that it belongs to genotype II, class II of NDV strains. This study helps to understand the ecology of NDV strains circulating in a wild avian host of this geographical region during the outbreak of 2012 in northwest India. Copyright © 2014 Khulape et al.

  7. Draft genome sequence of a GES-5-producing Serratia marcescens isolated in southern Brazil

    Directory of Open Access Journals (Sweden)

    Carolina Silva Nodari

    Full Text Available Abstract Serratia marcescens is a Gram-negative rod intrinsically resistant to polymyxins and usually associated with wound, respiratory and urinary tract infections. The whole genome of the first GES-5-producing S. marcescens isolated from a Brazilian patient was sequenced using Ion Torrent PGM System. Besides blaGES-5, we were able to identify genes encoding for other β-lactamases, for aminoglycoside modifying enzymes and for an efflux pump to tetracyclines.

  8. Whole-Genome Sequence of Chlamydia abortus Strain GN6 Isolated from Aborted Yak Fetus

    OpenAIRE

    Li, Zhaocai; Cai, Jinshan; Cao, Xiaoan; Lou, Zhongzi; Chao, Yilin; Kan, Wei; Zhou, Jizhang

    2017-01-01

    ABSTRACT The obligate intracellular Gram-negative bacterium Chlamydia abortus is one of the causative agents of abortion and fetal loss in sheep, goats, and cattle in many countries. It also affects the reproductivity of yaks (Bos grunniens). This study reports the whole-genome sequence of Chlamydia abortus strain GN6, which was isolated from aborted yak fetus in Qinghai-Tibetan Plateau, China.

  9. Whole-Genome Sequence of Chlamydia abortus Strain GN6 Isolated from Aborted Yak Fetus.

    Science.gov (United States)

    Li, Zhaocai; Cai, Jinshan; Cao, Xiaoan; Lou, Zhongzi; Chao, Yilin; Kan, Wei; Zhou, Jizhang

    2017-08-31

    The obligate intracellular Gram-negative bacterium Chlamydia abortus is one of the causative agents of abortion and fetal loss in sheep, goats, and cattle in many countries. It also affects the reproductivity of yaks ( Bos grunniens ). This study reports the whole-genome sequence of Chlamydia abortus strain GN6, which was isolated from aborted yak fetus in Qinghai-Tibetan Plateau, China. Copyright © 2017 Li et al.

  10. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm.

    Science.gov (United States)

    Morohoshi, Tomohiro; Ikeda, Tsukasa

    2016-06-16

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640 bp and five plasmids of 64,864 bp, 59,879 bp, 42,569 bp, 41,417 bp, and 29,506 bp. Copyright © 2016 Morohoshi and Ikeda.

  11. Complete genome sequence of porcine parvovirus N strain isolated from guangxi, china.

    Science.gov (United States)

    Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

    2015-01-08

    We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety. Copyright © 2015 Su et al.

  12. DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

    Directory of Open Access Journals (Sweden)

    Jing Han

    Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

  13. Sequence variation of the glycoprotein gene identifies three distinct lineages within field isolates of viral hemorrhagic septicemia virus, a fish rhabdovirus

    Science.gov (United States)

    Benmansour, A.; Bascuro, B.; Monnier, A.F.; Vende, P.; Winton, J.R.; de Kinkelin, P.

    1997-01-01

    To evaluate the genetic diversity of viral haemorrhagic septicaemia virus (VHSV), the sequence of the glycoprotein genes (G) of 11 North American and European isolates were determined. Comparison with the G protein of representative members of the family Rhabdoviridae suggested that VHSV was a different virus species from infectious haemorrhagic necrosis virus (IHNV) and Hirame rhabdovirus (HIRRV). At a higher taxonomic level, VHSV, IHNV and HIRRV formed a group which was genetically closest to the genus Lyssavirus. Compared with each other, the G genes of VHSV displayed a dissimilar overall genetic diversity which correlated with differences in geographical origin. The multiple sequence alignment of the complete G protein, showed that the divergent positions were not uniformly distributed along the sequence. A central region (amino acid position 245-300) accumulated substitutions and appeared to be highly variable. The genetic heterogeneity within a single isolate was high, with an apparent internal mutation frequency of 1.2 x 10(-3) per nucleotide site, attesting the quasispecies nature of the viral population. The phylogeny separated VHSV strains according to the major geographical area of isolation: genotype I for continental Europe, genotype II for the British Isles, and genotype III for North America. Isolates from continental Europe exhibited the highest genetic variability, with sub-groups correlated partially with the serological classification. Neither neutralizing polyclonal sera, nor monoclonal antibodies, were able to discriminate between the genotypes. The overall structure of the phylogenetic tree suggests that VHSV genetic diversity and evolution fit within the model of random change and positive selection operating on quasispecies.

  14. Draft Genome Sequence of Bacillus mycoides M2E15, a Strain Isolated from the Endosphere of Potato

    NARCIS (Netherlands)

    Yi, Yanglei; de Jong, Anne; Spoelder, Jan; Elzenga, J Theo M; van Elsas, Jan Dirk; Kuipers, Oscar P

    2016-01-01

    We present the draft genome sequence of Bacillus mycoides M2E15, a bacterium isolated from potato endosphere. Analysis of the 6.08-Mbp draft genome sequence identified 6,386 protein-encoding sequences, including potential plant growth promoting genes. Specifically, genes for proteins involved in

  15. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    Directory of Open Access Journals (Sweden)

    W.S.I. de Silva

    2017-07-01

    Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

  16. Pyridine nucleotide cycle of Salmonella typhimurium: isolation and characterization of pncA, pncB, and pncC mutants and utilization of exogenous nicotinamide adenine dinucleotide.

    Science.gov (United States)

    Foster, J W; Kinney, D M; Moat, A G

    1979-03-01

    Mutants of Salmonella typhimurium LT-2 deficient in nicotinamidase activity (pncA) or nicotinic acid phosphoribosyltransferase activity (pncB) were isolated as resistant to analogs of nicotinic acid and nicotinamide. Information obtained from interrupted mating experiments placed the pncA gene at 27 units and the pncB gene at 25 units on the S. typhimurium LT-2 linkage map. A major difference in the location of the pncA gene was found between the S. typhimurium and Escherichia coli linkage maps. The pncA gene is located in a region in which there is a major inversion of the gene order in S. typhimurium as compared to that in E. coli. Growth experiments using double mutants blocked in the de novo pathway to nicotinamide adenine dinucleotide (NAD) (nad) and in the pyridine nucleotide cycle (pnc) at either the pncA or pncB locus, or both, have provided evidence for the existence of an alternate recycling pathway in this organism. Mutants lacking this alternate cycle, pncC, have been isolated and mapped via cotransduction at 0 units. Utilization of exogenous NAD was examined through the use of [14C]carbonyl-labeled NAD and [14C]adenine-labeled NAD. The results of these experiments suggest that NAD is degraded to nicotinamide mononucleotide at the cell surface. A portion of this extracellular nicotinamide mononucleotide is then transported across the cell membrane by nicotinamide mononucleotide glycohydrolase and degraded to nicotinamide in the process. The remaining nicotinamide mononucleotide accumulates extracellularly and will support the growth of nadA pncB mutants which cannot utilize the nicotinamide resulting from the major pathway of NAD degradation. A model is presented for the utilization of exogenous NAD by S. typhimurium LT-2.

  17. Using Next Generation RAD Sequencing to Isolate Multispecies Microsatellites for Pilosocereus (Cactaceae.

    Directory of Open Access Journals (Sweden)

    Isabel A S Bonatelli

    Full Text Available Microsatellite markers (also known as SSRs, Simple Sequence Repeats are widely used in plant science and are among the most informative molecular markers for population genetic investigations, but the development of such markers presents substantial challenges. In this report, we discuss how next generation sequencing can replace the cloning, Sanger sequencing, identification of polymorphic loci, and testing cross-amplification that were previously required to develop microsatellites. We report the development of a large set of microsatellite markers for five species of the Neotropical cactus genus Pilosocereus using a restriction-site-associated DNA sequencing (RAD-seq on a Roche 454 platform. We identified an average of 165 microsatellites per individual, with the absolute numbers across individuals proportional to the sequence reads obtained per individual. Frequency distribution of the repeat units was similar in the five species, with shorter motifs such as di- and trinucleotide being the most abundant repeats. In addition, we provide 72 microsatellites that could be potentially amplified in the sampled species and 22 polymorphic microsatellites validated in two populations of the species Pilosocereus machrisii. Although low coverage sequencing among individuals was observed for most of the loci, which we suggest to be more related to the nature of the microsatellite markers and the possible bias inserted by the restriction enzymes than to the genome size, our work demonstrates that an NGS approach is an efficient method to isolate multispecies microsatellites even in non-model organisms.

  18. Using Next Generation RAD Sequencing to Isolate Multispecies Microsatellites for Pilosocereus (Cactaceae).

    Science.gov (United States)

    Bonatelli, Isabel A S; Carstens, Bryan C; Moraes, Evandro M

    2015-01-01

    Microsatellite markers (also known as SSRs, Simple Sequence Repeats) are widely used in plant science and are among the most informative molecular markers for population genetic investigations, but the development of such markers presents substantial challenges. In this report, we discuss how next generation sequencing can replace the cloning, Sanger sequencing, identification of polymorphic loci, and testing cross-amplification that were previously required to develop microsatellites. We report the development of a large set of microsatellite markers for five species of the Neotropical cactus genus Pilosocereus using a restriction-site-associated DNA sequencing (RAD-seq) on a Roche 454 platform. We identified an average of 165 microsatellites per individual, with the absolute numbers across individuals proportional to the sequence reads obtained per individual. Frequency distribution of the repeat units was similar in the five species, with shorter motifs such as di- and trinucleotide being the most abundant repeats. In addition, we provide 72 microsatellites that could be potentially amplified in the sampled species and 22 polymorphic microsatellites validated in two populations of the species Pilosocereus machrisii. Although low coverage sequencing among individuals was observed for most of the loci, which we suggest to be more related to the nature of the microsatellite markers and the possible bias inserted by the restriction enzymes than to the genome size, our work demonstrates that an NGS approach is an efficient method to isolate multispecies microsatellites even in non-model organisms.

  19. Catalytic center of lecithin:cholesterol acyltransferase: isolation and sequence of diisopropyl fluorophosphate-labeled peptides

    Energy Technology Data Exchange (ETDEWEB)

    Park, Y.B.; Yueksel, U.G.; Gracy, R.W.; Lacko, A.G.

    1987-02-27

    Lecithin:cholesterol acyltransferase (LCAT) was purified from hog plasma and subsequently reacted with (/sup 3/H)-Diisopropyl fluorophosphate (DFP). The labeled enzyme was digested with pepsin and the peptides separated by high performance liquid chromatography (HPLC). Two radioactive peptides were isolated, subjected to automated amino acid sequencing and yielded the following data: A) Ile-Ser-Leu-Gly-Ala-Pro-Trp-Gly-Gly-Ser, and B) Tyr-Ile-Phe-Asp-x-Gly-Phe-Pro-Tyr-x-Asp-Pro-Val. Both of these sequences represent very highly conserved regions of the enzyme when compared to the sequence of human LCAT. Peptide (A) is considered to represent the catalytic center of LCAT based on comparisons with data reported in the literature.

  20. Isolation and genome sequencing of four Arctic marine Psychrobacter strains exhibiting multicopper oxidase activity.

    Science.gov (United States)

    Moghadam, Morteza Shojaei; Albersmeier, Andreas; Winkler, Anika; Cimmino, Lorenzo; Rise, Kjersti; Hohmann-Marriott, Martin Frank; Kalinowski, Jörn; Rückert, Christian; Wentzel, Alexander; Lale, Rahmi

    2016-02-16

    Marine cold-temperature environments are an invaluable source of psychrophilic microbial life for new biodiscoveries. An Arctic marine bacterial strain collection was established consisting of 1448 individual isolates originating from biota, water and sediment samples taken at a various depth in the Barents Sea, North of mainland Norway, with an all year round seawater temperature of 4 °C. The entire collection was subjected to high-throughput screening for detection of extracellular laccase activity with guaiacol as a substrate. In total, 13 laccase-positive isolates were identified, all belonging to the Psychrobacter genus. From the most diverse four strains, based on 16S rRNA gene sequence analysis, all originating from the same Botryllus sp. colonial ascidian tunicate sample, genomic DNA was isolated and genome sequenced using a combined approach of whole genome shotgun and 8 kb mate-pair library sequencing on an Illumina MiSeq platform. The genomes were assembled and revealed genome sizes between 3.29 and 3.52 Mbp with an average G + C content of around 42%, with one to seven plasmids present in the four strains. Bioinformatics based genome mining was performed to describe the metabolic potential of these four strains and to identify gene candidates potentially responsible for the observed laccase-positive phenotype. Up to two different laccase-like multicopper oxidase (LMCO) encoding gene candidates were identified in each of the four strains. Heterologous expression of P11F6-LMCO and P11G5-LMCO2 in Escherichia coli BL21 (DE3) resulted in recombinant proteins exhibiting 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid (ABTS) and guaiacol oxidizing activity. Thirteen Psychrobacter species with laccase-positive phenotype were isolated from a collection of Arctic marine bacteria. Four of the isolates were genome sequenced. The overall genome features were similar to other publicly available Psychrobacter genome sequences except for P11G5 harboring seven